CGT Panels

CGT: Tests list

Select your test and find the gene, mutations and diseases related to them.

CGT Exome
CGT Plus
CGT Bank
Other CGT

CGT 600
CGT 250
CGT Basic
CGT Essential

CGT Exome V5.4.5
Historic Versions

Chromosome	Gene symbol	OMIM (gene)	Disease name (phenotype)	Inheritance
12	AAAS	605378	Triple-A syndrome (achalasia-addisonianism-alacrimia)	Autosomal recessive
16	AARS1	601065	Epileptic encephalopathy, early infantile, type 29	Autosomal recessive
6	AARS2	612035	Combined oxidative phosphorylation deficiency 8; Leukoencephalopathy, progressive, with ovarian failure	Autosomal recessive
7	AASS	605113	Hyperlysinemia, type 1 and type 2	Autosomal recessive
16	ABAT	137150	GABA-transaminase deficiency	Autosomal recessive
9	ABCA1	600046	Tangier disease	Autosomal recessive
2	ABCA12	607800	Ichthyosis, congenital, autosomal recessive, type 4A; ICAR, type 4B (harlequin)	Autosomal recessive
16	ABCA3	601615	Surfactant metabolism dysfunction, pulmonary, type 3	Autosomal recessive
1	ABCA4	601691	Stargardt disease 1; Retinitis pigmentosa 19; Cone-rod dystrophy 3	Autosomal recessive
2	ABCB11	603201	Cholestasis, benign recurrent intrahepatic, type 2; Cholestasis, progressive familial intrahepatic, type 2	Autosomal recessive
7	ABCB4	171060	Cholestasis, progressive familial intrahepatic, type 3	Autosomal recessive
10	ABCC2	601107	Dubin-Johnson syndrome	Autosomal recessive
16	ABCC6	603234	Pseudoxanthoma elasticum; Generalized arterial calcification of infancy, type 2	Autosomal recessive
11	ABCC8	600509	Hyperinsulinemic hypoglycemia, type 1 (congenital hyperinsulinism); Permanent neonatal diabetes mellitus (PNDM)	Autosomal recessive*
X	ABCD1	300371	Adrenoleukodystrophy	X-linked
14	ABCD4	603214	Methylmalonic aciduria and homocystinuria, cblJ type	Autosomal recessive
2	ABCG5	605459	Sitosterolemia 2	Autosomal recessive
2	ABCG8	605460	Sitosterolemia 1	Autosomal recessive
20	ABHD12	613599	PHARC syndrome (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa and cataract)	Autosomal recessive
3	ABHD5	604780	Chanarin-Dorfman syndrome	Autosomal recessive
11	ACAD8	604773	Isobutyryl-CoA dehydrogenase deficiency	Autosomal recessive
3	ACAD9	611103	Acyl-CoA dehydrogenase 9 deficiency (mitochondrial complex I deficiency, nuclear, type 20)	Autosomal recessive
1	ACADM	607008	Medium-chain acyl-CoA dehydrogenase deficiency	Autosomal recessive
12	ACADS	606885	Short-chain acyl-CoA dehydrogenase deficiency	Autosomal recessive
10	ACADSB	600301	Short/branched-chain acyl-CoA dehydrogenase deficiency	Autosomal recessive
17	ACADVL	609575	Very long-chain acyl-CoA dehydrogenase (VLCAD) deficiency	Autosomal recessive
11	ACAT1	607809	Alpha-methylacetoacetic aciduria (3-ketothiolase deficiency)	Autosomal recessive
17	ACE	106180	Renal tubular dysgenesis	Autosomal recessive
22	ACO2	100850	Infantile cerebellar-retinal degeneration	Autosomal recessive
17	ACOX1	609751	Peroxisomal acyl-CoA oxidase deficiency	Autosomal recessive
3	ACOX2	601641	Bile acid synthesis defect, congenital, type 6	Autosomal recessive
19	ACP5	171640	Spondyloenchondrodysplasia with immune dysregulation	Autosomal recessive
16	ACSF3	614245	Combined malonic and methylmalonic aciduria	Autosomal recessive
1	ACTA1	102610	Nemaline myopathy 3; Congenital fiber-type disproportion myopathy 1	Autosomal recessive*
3	ACY1	104620	Aminoacylase 1 deficiency	Autosomal recessive
20	ADA	608958	Severe combined immunodeficiency due to adenosine deaminase deficiency (ADA)	Autosomal recessive
22	ADA2	607575	Vasculitis, autoinflammation, immunodeficiency, and hematologic defects syndrome; Sneddon syndrome	Autosomal recessive
8	ADAM9	602713	Cone-rod dystrophy 9	Autosomal recessive
19	ADAMTS10	608990	Weill-Marchesani syndrome, type 1, recessive	Autosomal recessive
9	ADAMTS13	604134	Thrombotic thrombocytopenic purpura, familial (Schulman-Upshaw syndrome)	Autosomal recessive
15	ADAMTS17	607511	Weill-Marchesani syndrome, type 4, recessive	Autosomal recessive
16	ADAMTS18	607512	Microcornea, myopic chorioretinal atrophy, and telecanthus	Autosomal recessive
5	ADAMTS2	604539	Ehlers-Danlos syndrome, dermatosparaxis type	Autosomal recessive
9	ADAMTSL2	612277	Geleophysic dysplasia type 1	Autosomal recessive
1	ADAMTSL4	610113	Ectopia lentis et pupillae; Ectopia lentis, isolated, type 2	Autosomal recessive
1	ADAR	146920	Aicardi-Goutieres syndrome, type 6	Autosomal recessive
19	ADAT3	615302	Mental retardation, autosomal recessive 36	Autosomal recessive
16	ADGRG1	604110	Polymicrogyria, bilateral frontoparietal	Autosomal recessive
6	ADGRG6	612243	Lethal congenital contracture syndrome 9	Autosomal recessive
5	ADGRV1	602851	Usher syndrome, type 2C	Autosomal recessive; Digenic inheritance (PDZD7 gene)
10	ADK	102750	Hypermethioninemia due to adenosine kinase deficiency	Autosomal recessive
22	ADSL	608222	Adenylosuccinase deficiency	Autosomal recessive
14	ADSS1	612498	Myopathy, distal, 5	Autosomal recessive
18	AFG3L2	604581	Spastic ataxia, type 5, autosomal recessive	Autosomal recessive
4	AFP	104150	Alpha-fetoprotein deficiency	Autosomal recessive
4	AGA	613228	Aspartylglucosaminuria (glycosylasparaginase deficiency)	Autosomal recessive
2	AGBL5	615900	Retinitis pigmentosa 75	Autosomal recessive
7	AGK	610345	Cataract 38; Sengers syndrome	Autosomal recessive
1	AGL	610860	Glycogen storage disease, type 3	Autosomal recessive
9	AGPAT2	603100	Congenital generalized lipodystrophy (Berardinelli-Seip syndrome)	Autosomal recessive
2	AGPS	603051	Rhizomelic chondrodysplasia punctata, type 3	Autosomal recessive
1	AGRN	103320	Myasthenic syndrome, congenital, type 8	Autosomal recessive
1	AGT	106150	Renal tubular dysgenesis	Autosomal recessive
3	AGTR1	106165	Renal tubular dysgenesis	Autosomal recessive
2	AGXT	604285	Hyperoxaluria, primary, type 1	Autosomal recessive
20	AHCY	180960	Hypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase	Autosomal recessive
6	AHI1	608894	Joubert syndrome, type 3	Autosomal recessive
12	AICDA	605257	Immunodeficiency with hyper-IgM, type 2	Autosomal recessive
4	AIMP1	603605	Leukodystrophy, hypomyelinating, type 3	Autosomal recessive
7	AIMP2	600859	Leukodystrophy, hypomyelinating, type 17	Autosomal recessive
17	AIPL1	604392	Leber congenital amaurosis, type 4	Autosomal recessive
21	AIRE	607358	Autoimmune polyendocrinopathy syndrome, type 1	Autosomal recessive*
9	AK1	103000	Hemolytic anemia due to adenylate kinase deficiency	Autosomal recessive
1	AK2	103020	Reticular dysgenesis	Autosomal recessive
10	AKR1C2	600450	46,XY disorder of sex development due to testicular 17,20-desmolase deficiency	Autosomal recessive
7	AKR1D1	604741	Bile acid synthesis defect, congenital, type 2	Autosomal recessive
9	ALAD	125270	Porphyria, acute hepatic	Autosomal recessive
4	ALB	103600	Analbuminemia	Autosomal recessive
10	ALDH18A1	138250	Spastic paraplegia, type 9B, autosomal recessive; Cutis laxa, type 3A (De Barsy syndrome)	Autosomal recessive
15	ALDH1A3	600463	Microphthalmia, isolated 8	Autosomal recessive
17	ALDH3A2	609523	Sjogren-Larsson syndrome	Autosomal recessive
1	ALDH4A1	606811	Hyperprolinemia, type 2	Autosomal recessive
6	ALDH5A1	610045	Succinic semialdehyde dehydrogenase deficiency	Autosomal recessive
14	ALDH6A1	603178	Methylmalonate semialdehyde dehydrogenase deficiency	Autosomal recessive
5	ALDH7A1	107323	Epilepsy, pyridoxine-dependent	Autosomal recessive
16	ALDOA	103850	Glycogen storage disease type 12	Autosomal recessive
9	ALDOB	612724	Fructose intolerance, hereditary	Autosomal recessive
16	ALG1	605907	Congenital disorder of glycosylation, type 1K	Autosomal recessive
13	ALG11	613666	Congenital disorder of glycosylation, type 1P	Autosomal recessive
22	ALG12	607144	Congenital disorder of glycosylation, type 1G	Autosomal recessive
9	ALG2	607905	Myasthenic syndrome, congenital, type 14, with tubular aggregates	Autosomal recessive
3	ALG3	608750	Congenital disorder of glycosylation, type 1D	Autosomal recessive
1	ALG6	604566	Congenital disorder of glycosylation, type 1C	Autosomal recessive
11	ALG8	608103	Congenital disorder of glycosylation, type 1H	Autosomal recessive
11	ALG9	606941	Congenital disorder of glycosylation, type 1L; Gillessen-Kaesbach-Nishimura syndrome	Autosomal recessive
2	ALMS1	606844	Alström syndrome	Autosomal recessive
17	ALOX12B	603741	Ichthyosis, congenital, autosomal recessive, type 2	Autosomal recessive
17	ALOXE3	607206	Ichthyosis, congenital, autosomal recessive, type 3	Autosomal recessive
15	ALPK3	617608	Cardiomyopathy, familial hypertrophic, type 27	Autosomal recessive
1	ALPL	171760	ALPL-related conditions	Autosomal recessive
2	ALS2	606352	Amyotrophic lateral sclerosis, type 2, juvenile; Primary lateral sclerosis, juvenile; Spastic paralysis, infantile onset ascending	Autosomal recessive
12	ALX1	601527	Frontonasal dysplasia, type 3	Autosomal recessive
1	ALX3	606014	Frontonasal dysplasia, type 1	Autosomal recessive
11	ALX4	605420	Frontonasal dysplasia, type 2	Autosomal recessive
5	AMACR	604489	Bile acid synthesis defect, congenital, type 4; Alpha-methylacyl-CoA racemase deficiency	Autosomal recessive
4	AMBN	601259	Amelogenesis imperfecta, type IF	Autosomal recessive
19	AMH	600957	Persistent Mullerian duct syndrome, type 1	Autosomal recessive
12	AMHR2	600956	Persistent Mullerian duct syndrome, type II	Autosomal recessive
14	AMN	605799	Megaloblastic anemia 1 (Imerslund-Grasbeck syndrome)	Autosomal recessive
1	AMPD1	102770	Myopathy due to myoadenylate deaminase deficiency	Autosomal recessive
1	AMPD2	102771	Pontocerebellar hypoplasia, type 9	Autosomal recessive
3	AMT	238310	Glycine encephalopathy	Autosomal recessive
1	ANGPTL3	604774	Hypobetalipoproteinemia, familial, type 2	Autosomal recessive
9	ANKS6	615370	Nephronophthisis 16	Autosomal recessive
3	ANO10	613726	Spinocerebellar ataxia, autosomal recessive, type 10	Autosomal recessive
11	ANO5	608662	Limb-girdle muscular dystrophy, type 12 (LGMD R12)	Autosomal recessive
2	ANTXR1	606410	GAPO syndrome	Autosomal recessive
4	ANTXR2	608041	Hyaline fibromatosis syndrome	Autosomal recessive
7	AP1S1	603531	MEDNIK syndrome	Autosomal recessive
X	AP1S2	300629	Mental retardation, X-linked, syndromic, type 5 (Pettigrew syndrome)	X-linked
5	AP3B1	603401	Hermansky-Pudlak syndrome, type 2	Autosomal recessive
15	AP3B2	602166	Epileptic encephalopathy, early infantile, type 48	Autosomal recessive
19	AP3D1	607246	Hermansky-Pudlak syndrome, type 10	Autosomal recessive
1	AP4B1	607245	Spastic paraplegia, type 47, autosomal recessive	Autosomal recessive
15	AP4E1	607244	Spastic paraplegia, type 51, autosomal recessive	Autosomal recessive
7	AP4M1	602296	Spastic paraplegia, type 50, autosomal recessive	Autosomal recessive
14	AP4S1	607243	Spastic paraplegia, type 52, autosomal recessive	Autosomal recessive
7	AP5Z1	613653	Spastic paraplegia, type 48, autosomal recessive	Autosomal recessive
19	APOC2	608083	Hyperlipoproteinemia, type 1B	Autosomal recessive
19	APOE	107741	Sea-blue histiocyte disease	Autosomal recessive
16	APRT	102600	Adenine phosphoribosyltransferase deficiency	Autosomal recessive
9	APTX	606350	Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia	Autosomal recessive
12	AQP2	107777	Diabetes insipidus, nephrogenic, type 2	Autosomal recessive*
X	AR	313700	Androgen insensitivity syndrome	X-linked
20	ARFGEF2	605371	Periventricular heterotopia with microcephaly	Autosomal recessive
6	ARG1	608313	Argininemia (arginase deficiency)	Autosomal recessive
17	ARHGDIA	601925	Nephrotic syndrome, type 8	Autosomal recessive
19	ARHGEF18	616432	Retinitis pigmentosa 78	Autosomal recessive
3	ARL13B	608922	Joubert syndrome type 8	Autosomal recessive
16	ARL2BP	615407	Retinitis pigmentosa with or without situs inversus	Autosomal recessive
3	ARL6	608845	Bardet-Biedl syndrome, type 3	Autosomal recessive
2	ARMC9	617612	Joubert syndrome 30	Autosomal recessive
7	ARPC1B	604223	Immunodeficiency, type 71, with inflammatory disease and congenital thrombocytopenia	Autosomal recessive
22	ARSA	607574	Metachromatic leukodystrophy	Autosomal recessive
5	ARSB	611542	Mucopolysaccharidosis, type 6 (Maroteaux-Lamy syndrome)	Autosomal recessive
X	ARSL	300180	Chondrodysplasia punctata, brachytelephalangic	X-linked
1	ARV1	611647	Epileptic encephalopathy, early infantile, 38	Autosomal recessive
X	ARX	300382	Epileptic encephalopathy, early infantile, type 1; ARX-related developmental disorders	X-linked
8	ASAH1	613468	Farber lipogranulomatosis; Spinal muscular atrophy with progressive myoclonic epilepsy	Autosomal recessive
7	ASL	608310	Argininosuccinic aciduria	Autosomal recessive
7	ASNS	108370	Asparagine synthetase deficiency	Autosomal recessive
17	ASPA	608034	Canavan disease	Autosomal recessive
8	ASPH	600582	Traboulsi syndrome	Autosomal recessive
1	ASPM	605481	Primary microcephaly type 5, autosomal recessive	Autosomal recessive
9	ASS1	603470	Citrullinemia, type 1	Autosomal recessive
10	ATAD1	614452	Hyperekplexia 4	Autosomal recessive
1	ATF6	605537	Achromatopsia, type 7	Autosomal recessive
2	ATIC	601731	AICA-ribosiduria due to ATIC deficiency	Autosomal recessive
11	ATM	607585	ATM-related conditions	Autosomal recessive
10	ATOH7	609875	Persistent hyperplastic primary vitreous, autosomal recessive	Autosomal recessive
1	ATP13A2	610513	Kufor-Rakeb syndrome; Spastic paraplegia, type 78, autosomal recessive	Autosomal recessive
16	ATP2A1	108730	Brody myopathy	Autosomal recessive
12	ATP6V0A2	611716	Cutis laxa, autosomal recessive, type 2A; Wrinkly skin syndrome	Autosomal recessive
7	ATP6V0A4	605239	Renal tubular acidosis, distal, autosomal recessive	Autosomal recessive
3	ATP6V1A	607027	Cutis laxa, autosomal recessive, type 2D	Autosomal recessive
2	ATP6V1B1	192132	Renal tubular acidosis with deafness	Autosomal recessive
22	ATP6V1E1	108746	Cutis laxa, autosomal recessive, type 2C	Autosomal recessive
X	ATP7A	300011	Menkes disease; Occipital horn syndrome	X-linked
13	ATP7B	606882	Wilson disease	Autosomal recessive
18	ATP8B1	602397	Cholestasis, progressive familial intrahepatic, type 1; Cholestasis, benign recurrent intrahepatic, type 1	Autosomal recessive
3	ATR	601215	Seckel syndrome, type 1	Autosomal recessive
X	ATRX	300032	Mental retardation-hypotonic facies syndrome, X-linked; Alpha-thalassemia/mental retardation syndrome	X-linked
9	AUH	600529	3-methylglutaconic aciduria, type 1	Autosomal recessive
19	AURKC	603495	Spermatogenic failure, type 5	Autosomal recessive
12	AVIL	613397	Nephrotic syndrome, type 21	Autosomal recessive
15	B2M	109700	Immunodeficiency, type 43	Autosomal recessive
1	B3GALNT2	610194	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11	Autosomal recessive
1	B3GALT6	615291	Ehlers-Danlos syndrome, spondylodysplastic type, 2	Autosomal recessive
11	B3GAT3	606374	Multiple joint dislocations, short stature, craniofacial dysmorphism, with or without congenital heart defects	Autosomal recessive
13	B3GLCT	610308	Peters-plus syndrome	Autosomal recessive
12	B4GALNT1	601873	Spastic paraplegia, type 26, autosomal recessive	Autosomal recessive
9	B4GALT1	137060	Congenital disorder of glycosylation, type 2D	Autosomal recessive
5	B4GALT7	604327	Ehlers-Danlos syndrome, spondylodysplastic, type 1	Autosomal recessive
11	B4GAT1	605517	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 13	Autosomal recessive
17	B9D1	614144	Joubert syndrome, type 27; ?Meckel syndrome 9	Autosomal recessive
19	B9D2	611951	Joubert syndrome, type 34; ?Meckel syndrome, type 10	Autosomal recessive
11	BBS1	209901	Bardet-Biedl syndrome, type 1	Autosomal recessive
12	BBS10	610148	Bardet-Biedl syndrome, type 10	Autosomal recessive
4	BBS12	610683	Bardet-Biedl syndrome, type 12	Autosomal recessive
16	BBS2	606151	Bardet-Biedl syndrome, type 2	Autosomal recessive
15	BBS4	600374	Bardet-Biedl syndrome, type 4	Autosomal recessive
2	BBS5	603650	Bardet-Biedl syndrome, type 5	Autosomal recessive
4	BBS7	607590	Bardet-Biedl syndrome, type 7	Autosomal recessive
7	BBS9	607968	Bardet-Biedl syndrome, type 9	Autosomal recessive
19	BCAT2	113530	?Hypervalinemia or hyperleucine-isoleucinemia	Autosomal recessive
3	BCHE	177400	Butyrylcholinesterase deficiency	Autosomal recessive
19	BCKDHA	608348	Maple syrup urine disease, type 1A	Autosomal recessive
6	BCKDHB	248611	Maple syrup urine disease, type 1B	Autosomal recessive
16	BCKDK	614901	Branched-chain ketoacid dehydrogenase kinase deficiency	Autosomal recessive
1	BCL10	603517	?Immunodeficiency, type 37	Autosomal recessive
2	BCS1L	603647	Mitochondrial complex III deficiency nuclear type 1; GRACILE syndrome; Bjornstad syndrome	Autosomal recessive
11	BEST1	607854	Bestrophinopathy, AR	Autosomal recessive
20	BFSP1	603307	Cataract 33, multiple types	Autosomal recessive*
17	BHLHA9	615416	Syndactyly, mesoaxial synostotic, with phalangeal reduction	Autosomal recessive
2	BIN1	601248	Centronuclear myopathy, type 2	Autosomal recessive
15	BLM	604610	Bloom syndrome	Autosomal recessive
10	BLNK	604515	?Agammaglobulinemia 4	Autosomal recessive
19	BLOC1S3	609762	Hermansky-Pudlak syndrome, type 8	Autosomal recessive
15	BLOC1S6	604310	?Hermansky-Pudlak syndrome, type 9	Autosomal recessive
4	BLTP1	611565	Alkuraya-Kucinskas syndrome	Autosomal recessive
7	BLVRA	109750	Hyperbiliverdinemia	Autosomal recessive*
8	BMP1	112264	Osteogenesis imperfecta, type 13	Autosomal recessive
7	BMPER	608699	Diaphanospondylodysostosis	Autosomal recessive
4	BMPR1B	603248	Acromesomelic dysplasia, Demirhan type	Autosomal recessive
2	BOLA3	613183	Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia	Autosomal recessive
7	BPGM	613896	Erythrocytosis due to bisphosphoglycerate mutase deficiency	Autosomal recessive
8	BPNT2	614010	Chondrodysplasia with joint dislocations, GPAPP type	Autosomal recessive
7	BRAT1	614506	Rigidity and multifocal seizure syndrome, lethal neonatal; Neurodevelopmental disorder with cerebellar atrophy and with or without seizures	Autosomal recessive
14	BRF1	604902	Cerebellofaciodental syndrome	Autosomal recessive
17	BRIP1	605882	Fanconi anemia, complementation group J	Autosomal recessive
X	BRWD3	300553	Mental retardation, X-linked, type 93	X-linked
11	BSCL2	606158	Congenital generalized lipodystrophy, type 2; Encephalopathy, progressive, with or without lipodystrophy	Autosomal recessive
1	BSND	606412	Bartter syndrome, type 4A	Autosomal recessive
3	BTD	609019	Biotinidase deficiency	Autosomal recessive
X	BTK	300300	Agammaglobulinemia X-linked, type 1	X-linked
15	BUB1B	602860	Mosaic variegated aneuploidy syndrome 1	Autosomal recessive
12	C12orf57	615140	Temtamy syndrome	Autosomal recessive
19	C19orf12	614297	Neurodegeneration with brain iron accumulation, type 4	Autosomal recessive*
1	C1QA	120550	C1q deficiency	Autosomal recessive
1	C1QB	120570	C1q deficiency	Autosomal recessive
17	C1QBP	601269	Combined oxidative phosphorylation deficiency 33	Autosomal recessive
1	C1QC	120575	C1q deficiency	Autosomal recessive
12	C1S	120580	C1s deficiency	Autosomal recessive
6	C2	613927	C2 deficiency	Autosomal recessive
11	C2CD3	615944	Orofaciodigital syndrome, type 14	Autosomal recessive
19	C3	120700	Complement component 3 deficiency	Autosomal recessive
9	C5	120900	Complement component 5 deficiency	Autosomal recessive
5	C6	217050	Complement component 6 deficiency	Autosomal recessive
5	C7	217070	Complement component 7 deficiency	Autosomal recessive
1	C8B	120960	Complement component 8 deficiency, type 2	Autosomal recessive
15	CA12	603263	Hyperchlorhidrosis, isolated	Autosomal recessive
8	CA2	611492	Osteopetrosis with renal tubular acidosis (osteopetrosis, autosomal recessive, type 3)	Autosomal recessive
16	CA5A	114761	Hyperammonemia due to carbonic anhydrase VA deficiency	Autosomal recessive
8	CA8	114815	Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3	Autosomal recessive
11	CABP2	607314	Deafness, autosomal recessive, type 93	Autosomal recessive
11	CABP4	608965	Congenital stationary night blindness, type 2B	Autosomal recessive
3	CACNA1D	114206	Sinoatrial node dysfunction and deafness	Autosomal recessive
12	CACNA2D4	608171	Retinal cone dystrophy 4	Autosomal recessive
2	CAD	114010	Epileptic encephalopathy, early infantile, 50	Autosomal recessive
2	CALCRL	114190	?Lymphatic malformation 8	Autosomal recessive
17	CANT1	613165	Desbuquois dysplasia, type 1; Epiphyseal dysplasia, multiple, type 7	Autosomal recessive
11	CAPN1	114220	Spastic paraplegia, type 76, autosomal recessive	Autosomal recessive
15	CAPN3	114240	Limb-girdle muscular dystrophy, type 1 (LGMD R1)	Autosomal recessive
7	CARD11	607210	Immunodeficiency, type 11A	Autosomal recessive
9	CARD9	607212	Candidiasis, familial, type 2, autosomal recessive	Autosomal recessive
13	CARS2	612800	Combined oxidative phosphorylation deficiency 27	Autosomal recessive
1	CASQ2	114251	Ventricular tachycardia, catecholaminergic polymorphic, type 2	Autosomal recessive
3	CASR	601199	Hyperparathyroidism, neonatal	Autosomal recessive*
5	CAST	114090	Peeling skin with leukonychia, acral punctate keratoses, cheilitis, and knuckle pads	Autosomal recessive
11	CAT	115500	Acatalasemia	Autosomal recessive
11	CATSPER1	606389	Spermatogenic failure, type 7	Autosomal recessive
17	CAVIN1	603198	Lipodystrophy, congenital generalized, type 4	Autosomal recessive
11	CBLIF	609342	Intrinsic factor deficiency	Autosomal recessive
21	CBS	613381	Homocystinuria due to cystathionine beta-synthase	Autosomal recessive
19	CC2D1A	610055	Mental retardation, autosomal recessive, type 3	Autosomal recessive
4	CC2D2A	612013	Joubert syndrome, type 9; Meckel syndrome, type 6; COACH syndrome, 2	Autosomal recessive
18	CCBE1	612753	Hennekam lymphangiectasia-lymphedema syndrome, type 1	Autosomal recessive
17	CCDC103	614677	Ciliary dyskinesia, primary, type 17	Autosomal recessive
2	CCDC115	613734	Congenital disorder of glycosylation, type IIo	Autosomal recessive
3	CCDC174	616735	Hypotonia, infantile, with psychomotor retardation	Autosomal recessive
3	CCDC39	613798	Ciliary dyskinesia, primary, type 14	Autosomal recessive
17	CCDC40	613799	Ciliary dyskinesia, primary, type 15	Autosomal recessive
12	CCDC65	611088	Ciliary dyskinesia, primary, type 27	Autosomal recessive
19	CCDC8	614145	3M syndrome 3	Autosomal recessive
14	CCDC88C	611204	Hydrocephalus, congenital, type 1	Autosomal recessive
6	CCN6	603400	Progressive pseudorheumatoid dysplasia	Autosomal recessive
5	CCNO	607752	Ciliary dyskinesia, primary, type 29	Autosomal recessive
16	CD19	107265	Immunodeficiency, common variable, type 3	Autosomal recessive
1	CD247	186780	?Immunodeficiency, type 25	Autosomal recessive
12	CD27	186711	Lymphoproliferative syndrome 2	Autosomal recessive
6	CD2AP	604241	Glomerulosclerosis, focal segmental, type 3, susceptibility to	Autosomal recessive*
19	CD320	606475	Methylmalonic aciduria, transient, due to transcobalamin receptor defect	Autosomal recessive
7	CD36	173510	Platelet glycoprotein 4 deficiency	Autosomal recessive
11	CD3D	186790	Immunodeficiency, type 19	Autosomal recessive
11	CD3E	186830	Immunodeficiency, type 18	Autosomal recessive
11	CD3G	186740	Immunodeficiency, type 17, CD3 gamma deficient	Autosomal recessive
20	CD40	109535	Immunodeficiency with hyper-IgM, type 3	Autosomal recessive
X	CD40LG	300386	Hyper-IgM syndrome, type 1 (immunodeficiency, X-linked, with hyper-IgM, type 1)	X-linked
1	CD55	125240	Complement hyperactivation, angiopathic thrombosis, and protein-losing enteropathy (CHAPLE)	Autosomal recessive
11	CD59	107271	CD59 deficiency	Autosomal recessive
19	CD79A	112205	Agammaglobulinemia 3	Autosomal recessive
17	CD79B	147245	Agammaglobulinemia 6	Autosomal recessive
11	CD81	186845	Immunodeficiency, common variable, type 6	Autosomal recessive
2	CD8A	186910	CD8 deficiency, familial	Autosomal recessive
15	CDAN1	607465	Dyserythropoietic anemia, congenital, type 1A	Autosomal recessive
1	CDC14A	603504	Deafness, autosomal recessive, type 105	Autosomal recessive
22	CDC45	603465	Meier-Gorlin syndrome 7	Autosomal recessive
2	CDCA7	609937	Immunodeficiency-centromeric instability-facial anomalies syndrome 3	Autosomal recessive
16	CDH11	600023	Elsahy-Waters syndrome	Autosomal recessive
10	CDH23	605516	Deafness, autosomal recessive, type 12; Usher syndrome, type 1D	Autosomal recessive
16	CDH3	114021	Ectodermal dysplasia, ectrodactyly, and macular dystrophy; Hypotrichosis, congenital, with juvenile macular dystrophy	Autosomal recessive
10	CDHR1	609502	Cone-rod dystrophy, type 15	Autosomal recessive
15	CDIN1	615626	Dyserythropoietic anemia, congenital, type Ib	Autosomal recessive
16	CDK10	603464	Al Kaissi syndrome	Autosomal recessive
9	CDK5RAP2	608201	Primary microcephaly type 3, autosomal recessive	Autosomal recessive
6	CDSN	602593	Peeling skin syndrome 1	Autosomal recessive
16	CDT1	605525	Meier-Gorlin syndrome, type 4	Autosomal recessive
14	CEBPE	600749	Specific granule deficiency	Autosomal recessive
1	CENPF	600236	Stromme syndrome	Autosomal recessive
13	CENPJ	609279	Primary microcephaly type 6, autosomal recessive	Autosomal recessive
1	CEP104	616690	Joubert syndrome 25	Autosomal recessive
5	CEP120	613446	Short-rib thoracic dysplasia 13 with or without polydactyly	Autosomal recessive
4	CEP135	611423	Microcephaly 8, primary, autosomal recessive	Autosomal recessive
15	CEP152	613529	Primary microcephaly type 9, autosomal recessive	Autosomal recessive
11	CEP164	614848	Nephronophthisis 15	Autosomal recessive
3	CEP19	615586	Morbid obesity and spermatogenic failure	Autosomal recessive
12	CEP290	610142	Meckel syndrome, type 4; Joubert syndrome, type 5; Leber congenital amaurosis, type 10	Autosomal recessive
7	CEP41	610523	Joubert syndrome, type 15	Autosomal recessive
10	CEP55	610000	Multinucleated neurons, anhydramnios, renal dysplasia, cerebellar hypoplasia, and hydranencephaly	Autosomal recessive
11	CEP57	607951	Mosaic variegated aneuploidy syndrome 2	Autosomal recessive
9	CEP78	617110	Cone-rod dystrophy and hearing loss	Autosomal recessive
12	CEP83	615847	Nephronophthisis 18	Autosomal recessive
2	CERKL	608381	Retinitis pigmentosa, type 26	Autosomal recessive
15	CERS3	615276	Ichthyosis, congenital, autosomal recessive 9	Autosomal recessive
8	CFAP418	614477	Bardet-Biedl syndrome, type 21; Cone-rod dystrophy 16 and Retintis pigmentosa 64; Ciliary dyskinesia, primary, 26	Autosomal recessive
10	CFAP43	617558	Spermatogenic failure, type 19	Autosomal recessive
18	CFAP53	614759	Heterotaxy, visceral, 6, autosomal recessive	Autosomal recessive
19	CFD	134350	Complement factor D deficiency	Autosomal recessive
1	CFH	134370	Complement factor H deficiency	Autosomal recessive
4	CFI	217030	Complement factor I deficiency	Autosomal recessive
14	CFL2	601443	Nemaline myopathy, type 7, autosomal recessive	Autosomal recessive
7	CFTR	602421	Cystic fibrosis	Autosomal recessive
10	CHAT	118490	Myasthenic syndrome, congenital, type 6, presynaptic	Autosomal recessive
22	CHKB	612395	Muscular dystrophy, congenital, megaconial type	Autosomal recessive
X	CHM	300390	Choroideremia	X-linked
16	CHMP1A	164010	Pontocerebellar hypoplasia, type 8	Autosomal recessive
2	CHRNA1	100690	Multiple pterygium syndrome, lethal type	Autosomal recessive
17	CHRNB1	100710	?Myasthenic syndrome, congenital, 2C, associated with acetylcholine receptor deficiency	Autosomal recessive
2	CHRND	100720	Myasthenic syndrome, congenital, type 3B, fast-channel; Multiple pterygium syndrome, lethal type	Autosomal recessive
17	CHRNE	100725	Myasthenic syndrome, congenital, type 4B, fast-channel; Myasthenic syndrome, congenital, type 4C, associated with acetylcholine receptor deficiency	Autosomal recessive
2	CHRNG	100730	Multiple pterygium syndrome (MPS), Escobar type; MPS, lethal type	Autosomal recessive
15	CHST14	608429	Ehlers-Danlos syndrome, musculocontractural, type 1	Autosomal recessive
10	CHST3	603799	Spondyloepiphyseal dysplasia with congenital joint dislocations	Autosomal recessive
16	CHST6	605294	Macular corneal dystrophy	Autosomal recessive
15	CHSY1	608183	Temtamy preaxial brachydactyly syndrome	Autosomal recessive
10	CHUK	600664	Cocoon syndrome	Autosomal recessive
15	CIB2	605564	Deafness, autosomal recessive, type 48; Usher syndrome, type 1J	Autosomal recessive
16	CIITA	600005	Bare lymphocyte syndrome, type 2, complementation group A	Autosomal recessive
6	CILK1	612325	Endocrine-cerebroosteodysplasia	Autosomal recessive
4	CISD2	611507	Wolfram syndrome 2	Autosomal recessive
12	CIT	605629	Microcephaly 17, primary, autosomal recessive	Autosomal recessive
2	CKAP2L	616174	Filippi syndrome	Autosomal recessive
11	CLCF1	607672	Cold-induced sweating syndrome 2	Autosomal recessive
7	CLCN1	118425	Myotonia congenita, recessive	Autosomal recessive
3	CLCN2	600570	Leukoencephalopathy with ataxia	Autosomal recessive
16	CLCN7	602727	Osteopetrosis, autosomal recessive type 4	Autosomal recessive
1	CLCNKA	602024	Bartter syndrome, type 4B, digenic	Digenic inheritance (CLCNKB gene)
1	CLCNKB	602023	Bartter syndrome, type 3; Bartter syndrome, type 4B, digenic	Autosomal recessive; Digenic inheritance (CLCNKA gene)
3	CLDN1	603718	Ichthyosis, leukocyte vacuoles, alopecia, and sclerosing cholangitis	Autosomal recessive
13	CLDN10	617579	HELIX syndrome	Autosomal recessive
21	CLDN14	605608	Deafness type 29, autosomal recessive	Autosomal recessive
3	CLDN16	603959	Hypomagnesemia, type 3, renal	Autosomal recessive
1	CLDN19	610036	Rena hypomagnesemia type 5, with ocular involvement	Autosomal recessive
11	CLMP	611693	Congenital short bowel syndrome	Autosomal recessive
16	CLN3	607042	Ceroid lipofuscinosis, neuronal, type 3	Autosomal recessive
13	CLN5	608102	Ceroid lipofuscinosis, neuronal, type 5	Autosomal recessive
15	CLN6	606725	Ceroid lipofuscinosis, neuronal, type 6	Autosomal recessive
8	CLN8	607837	Ceroid lipofuscinosis, neuronal, type 8	Autosomal recessive
11	CLP1	608757	Pontocerebellar hypoplasia, type 10	Autosomal recessive
11	CLPB	616254	3-methylglutaconic aciduria, type 7, with cataracts, neurologic involvement and neutropenia	Autosomal recessive
19	CLPP	601119	Perrault syndrome 3	Autosomal recessive
3	CLRN1	606397	Usher syndrome, type 3A	Autosomal recessive
4	CNGA1	123825	Retinitis pigmentosa type 49	Autosomal recessive
2	CNGA3	600053	Achromatopsia, type 2	Autosomal recessive
16	CNGB1	600724	Retinitis pigmentosa type 45	Autosomal recessive
8	CNGB3	605080	Achromatopsia, type 3	Autosomal recessive
10	CNNM2	607803	Hypomagnesemia, seizures, and mental retardation	Autosomal recessive*
2	CNNM4	607805	Jalili syndrome	Autosomal recessive
6	CNPY3	610774	Epileptic encephalopathy, early infantile, type 60	Autosomal recessive
17	CNTNAP1	602346	Lethal congenital contracture syndrome 7	Autosomal recessive
7	CNTNAP2	604569	Pitt-Hopkins like syndrome 1	Autosomal recessive
1	COA6	614772	Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 4	Autosomal recessive
14	COA8	616003	Mitochondrial complex IV deficiency, nuclear type 17	Autosomal recessive
17	COASY	609855	Neurodegeneration with brain iron accumulation 6	Autosomal recessive
17	COG1	606973	Congenital disorder of glycosylation, type IIg	Autosomal recessive
16	COG4	606976	Congenital disorder of glycosylation, type 2J	Autosomal recessive
7	COG5	606821	Congenital disorder of glycosylation, type 2I	Autosomal recessive
13	COG6	606977	Congenital disorder of glycosylation, type 2L; Shaheen syndrome	Autosomal recessive
16	COG7	606978	Congenital disorder of glycosylation, type 2E	Autosomal recessive
16	COG8	606979	Congenital disorder of glycosylation, type 2H	Autosomal recessive
1	COL11A1	120280	Fibrochondrogenesis type 1	Autosomal recessive
6	COL11A2	120290	Otospondylomegaepiphyseal dysplasia, autosomal recessive	Autosomal recessive
10	COL13A1	120350	Myasthenic syndrome, congenital, 19	Autosomal recessive
10	COL17A1	113811	Epidermolysis bullosa, junctional, non-Herlitz type	Autosomal recessive
21	COL18A1	120328	Knobloch syndrome, type 1	Autosomal recessive
7	COL1A2	120160	Ehlers-Danlos syndrome, cardiac valvular type	Autosomal recessive
4	COL25A1	610004	Fibrosis of extraocular muscles, congenital, type 5	Autosomal recessive
9	COL27A1	608461	Steel syndrome	Autosomal recessive
2	COL4A3	120070	Alport syndrome, autosomal recessive, type 2	Autosomal recessive; Autosomal dominant
2	COL4A4	120131	Alport syndrome, autosomal recessive, type 2	Autosomal recessive; Autosomal dominant
X	COL4A5	303630	Alport syndrome, X-linked	X-linked
21	COL6A1	120220	Ullrich congenital muscular dystrophy, type 1 (Limb-girdle muscular dystrophy, type 22 [LGMD R22])	Autosomal recessive*
21	COL6A2	120240	Ullrich congenital muscular dystrophy 1; Bethlem myopathy-1; Myosclerosis	Autosomal recessive
2	COL6A3	120250	Bethlem myopathy 1; Ullrich congenital muscular dystrophy 1; Dystonia 27	Autosomal recessive;Autosomal recessive;Autosomal recessive
3	COL7A1	120120	Dystrophic epidermolysis bullosa (DEB), Hallopeau-Siemens (HS) type and non-HS type; DEB pruriginosa; DEB pretibial	Autosomal recessive; Autosomal recessive; Autosomal recessive
6	COL9A1	120210	Stickler syndrome, type 4	Autosomal recessive
1	COL9A2	120260	?Stickler syndrome, type V	Autosomal recessive
8	COLEC10	607620	3MC syndrome 3	Autosomal recessive
2	COLEC11	612502	3MC syndrome 2	Autosomal recessive
3	COLQ	603033	Myasthenic syndrome, congenital, type 5	Autosomal recessive
4	COQ2	609825	Primary coenzyme Q10 deficiency, type 1	Autosomal recessive
9	COQ4	612898	Coenzyme Q10 deficiency, primary, type 7	Autosomal recessive
14	COQ6	614647	Coenzyme Q10 deficiency, primary, type 6	Autosomal recessive
1	COQ8A	606980	Primary coenzyme Q10 deficiency, type 4	Autosomal recessive
19	COQ8B	615567	Nephrotic syndrome, type 9	Autosomal recessive
16	COQ9	612837	Coenzyme Q10 deficiency, primary, type 5	Autosomal recessive
16	CORO1A	605000	Immunodeficiency, type 8	Autosomal recessive
17	COX10	602125	Mitochondrial complex IV deficiency, nuclear type 3	Autosomal recessive
10	COX15	603646	Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, type 2; Leigh syndrome due to cytochrome c oxidase deficiency	Autosomal recessive
1	COX20	614698	Mitochondrial complex IV deficiency, nuclear type 11	Autosomal recessive
19	COX6B1	124089	Mitochondrial complex IV deficiency, nuclear type 7	Autosomal recessive
3	CP	117700	Aceruloplasminemia	Autosomal recessive
8	CPA6	609562	Febrile seizures, familial, type 11	Autosomal recessive
19	CPAMD8	608841	Anterior segment dysgenesis, type 8	Autosomal recessive
5	CPLANE1	614571	Joubert syndrome 17	Autosomal recessive
4	CPLX1	605032	Epileptic encephalopathy, early infantile, 63	Autosomal recessive
2	CPS1	608307	Carbamoylphosphate synthetase 1 deficiency	Autosomal recessive
11	CPT1A	600528	Carnitine palmitoyltransferase type 1A deficiency, hepatic	Autosomal recessive
1	CPT2	600650	Carnitine palmitoyltransferase type 2 deficiency, lethal neonatal; Carnitine palmitoyltransferase type 2 deficiency, infantile	Autosomal recessive
1	CR2	120650	Immunodeficiency, common variable, type 7	Autosomal recessive
12	CRADD	603454	Mental retardation, autosomal recessive, type 34, with variant lissencephaly	Autosomal recessive
1	CRB1	604210	Retinitis pigmentosa, type 12; Leber congenital amaurosis, type 8	Autosomal recessive
9	CRB2	609720	Ventriculomegaly with cystic kidney disease	Autosomal recessive
3	CRBN	609262	Mental retardation, autosomal recessive, type 2	Autosomal recessive
2	CRIPT	604594	Short stature with microcephaly and distinctive facies	Autosomal recessive
19	CRLF1	604237	Cold-induced sweating syndrome type 1	Autosomal recessive
7	CRPPA	614631	Muscular dystrophy-dystroglycanopathy, type A7; Muscular dystrophy-dystroglycanopathy, type C7	Autosomal recessive
3	CRTAP	605497	Osteogenesis imperfecta, type 7	Autosomal recessive
21	CRYAA	123580	Cataract 9, multiple types	Autosomal recessive*
11	CRYAB	123590	Myopathy, myofibrillar, fatal infantile hypertonic, alpha-B crystallin-related; Cataract 16, multiple types	Autosomal recessive; Autosomal recessive*
22	CRYBB1	600929	Cataract 17	Autosomal recessive*
22	CRYBB3	123630	Cataract 22	Autosomal recessive
22	CSF2RB	138981	Surfactant metabolism dysfunction, pulmonary, type 5	Autosomal recessive
1	CSF3R	138971	Neutropenia, severe congenital, type 7, autosomal recessive	Autosomal recessive
8	CSPP1	611654	Joubert syndrome 21	Autosomal recessive
3	CSTA	184600	Peeling skin syndrome, type 4	Autosomal recessive
21	CSTB	601145	Epilepsy, progressive myoclonic type 1A (Unverricht and Lundborg)	Autosomal recessive
17	CTC1	613129	Cerebroretinal microangiopathy with calcifications and cysts	Autosomal recessive
1	CTH	607657	Cystathioninuria	Autosomal recessive
17	CTNS	606272	Nephropathic cystinosis	Autosomal recessive
1	CTPS1	123860	Immunodeficiency, type 24	Autosomal recessive
20	CTSA	613111	Galactosialidosis	Autosomal recessive
11	CTSC	602365	Haim-Munk syndrome; Papillon-Lefevre syndrome	Autosomal recessive
11	CTSD	116840	Ceroid lipofuscinosis, neuronal, type 10	Autosomal recessive
11	CTSF	603539	Ceroid lipofuscinosis, neuronal, type 13 (Kufs type)	Autosomal recessive
1	CTSK	601105	Pycnodysostosis	Autosomal recessive
10	CUBN	602997	Megaloblastic anemia 1 (Imerslund-Grasbeck syndrome)	Autosomal recessive
X	CUL4B	300304	Mental retardation, X-linked, syndromic, type 15 (Cabezas type)	X-linked
6	CUL7	609577	3M syndrome 1	Autosomal recessive
5	CWC27	617170	Retinitis pigmentosa with or without skeletal anomalies	Autosomal recessive
10	CWF19L1	616120	Spinocerebellar ataxia, autosomal recessive, type 17	Autosomal recessive
18	CYB5A	613218	46,XY disorder of sex development due to isolated 17,20-lyase deficiency	Autosomal recessive
22	CYB5R3	613213	Methemoglobinemia, type 1; Methemoglobinemia, type 2	Autosomal recessive
16	CYBA	608508	Chronic granulomatous disease, type 4	Autosomal recessive
X	CYBB	300481	Chronic granulomatous disease, X-linked	X-linked
8	CYC1	123980	Mitochondrial complex III deficiency, nuclear type 6	Autosomal recessive
15	CYP11A1	118485	46,XY disorder of sex development-adrenal insufficiency due to CYP11A1 deficiency	Autosomal recessive
8	CYP11B1	610613	Adrenal hyperplasia, congenital, due to 11-beta-hydroxylase deficiency	Autosomal recessive
8	CYP11B2	124080	Hypoaldosteronism, congenital, due to CMO I deficiency	Autosomal recessive
10	CYP17A1	609300	17 alpha(?)-hydroxylase/17,20-lyase deficiency	Autosomal recessive
15	CYP19A1	107910	Aromatase deficiency	Autosomal recessive
2	CYP1B1	601771	Glaucoma, primary congenital, type 3A	Autosomal recessive
6	CYP21A2	613815	Congenital adrenal hyperplasia due to 21-hydroxylase deficiency	Autosomal recessive
20	CYP24A1	126065	Hypercalcemia, infantile, type 1	Autosomal recessive
2	CYP26B1	605207	Craniosynostosis with radiohumeral fusions and other skeletal and craniofacial anomalies	Autosomal recessive
10	CYP26C1	608428	Focal facial dermal dysplasia 4	digenic inheritance (CLCNKB gene)
2	CYP27A1	606530	Cerebrotendinous xanthomatosis	Autosomal recessive
12	CYP27B1	609506	Vitamin D-dependent rickets, type 1	Autosomal recessive
11	CYP2R1	608713	Rickets due to defect in vitamin D 25-hydroxylation	Autosomal recessive
4	CYP2U1	610670	Spastic paraplegia, type 56, autosomal recessive	Autosomal recessive
19	CYP4F22	611495	Ichthyosis, congenital, autosomal recessive, type 5	Autosomal recessive
4	CYP4V2	608614	Bietti crystalline corneoretinal dystrophy	Autosomal recessive
8	CYP7B1	603711	Spastic paraplegia, type 5A, autosomal recessive	Autosomal recessive
2	D2HGDH	609186	D-2-hydroxyglutaric aciduria	Autosomal recessive
3	DAG1	128239	Muscular dystrophy-dystroglycanopathy type A9; Muscular dystrophy-dystroglycanopathy type C9	Autosomal recessive
2	DARS1	603084	Hypomyelination with brainstem and spinal cord involvement and leg spasticity	Autosomal recessive
1	DARS2	610956	Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation	Autosomal recessive
9	DBH	609312	Dopamine beta-hydroxylase deficiency	Autosomal recessive
1	DBT	248610	Maple syrup urine disease, type 2	Autosomal recessive
2	DCAF17	612515	Woodhouse-Sakati syndrome	Autosomal recessive
18	DCC	120470	Gaze palsy, familial horizontal, with progressive scoliosis, type 2	Autosomal recessive
6	DCDC2	605755	Sclerosing cholangitis, neonatal; Nephronophthisis 19	Autosomal recessive
11	DCHS1	603057	Van Maldergem syndrome 1	Autosomal recessive
10	DCLRE1C	605988	Omenn syndrome; Severe combined immunodeficiency, Athabascan type	Autosomal recessive
11	DCPS	610534	Al-Raqad syndrome	Autosomal recessive
X	DCX	300121	Lissencephaly, X-linked, type 1	X-linked
11	DDB2	600811	Xeroderma pigmentosum, complementation group E	Autosomal recessive
7	DDC	107930	Aromatic L-amino acid decarboxylase deficiency	Autosomal recessive
14	DDHD1	614603	Spastic paraplegia, type 28, autosomal recessive	Autosomal recessive
8	DDHD2	615003	Spastic paraplegia, type 54, autosomal recessive	Autosomal recessive
1	DDR2	191311	Spondylometaepiphyseal dysplasia, short limb-hand type	Autosomal recessive
20	DDRGK1	616177	Spondyloepimetaphyseal dysplasia, Shohat type	Autosomal recessive
12	DDX11	601150	Warsaw breakage syndrome	Autosomal recessive
1	DDX59	615464	Orofaciodigital syndrome V	Autosomal recessive
11	DENND5A	617278	Epileptic encephalopathy, early infantile, 49	Autosomal recessive
2	DES	125660	Myopathy, myofibrillar, type 1	Autosomal recessive*; Autosomal dominant
8	DGAT1	604900	?Diarrhea 7, protein-losing enteropathy type	Autosomal recessive
17	DGKE	601440	Nephrotic syndrome, type 7	Autosomal recessive
2	DGUOK	601465	DGUOK-related mitochondrial DNA depletion syndrome	Autosomal recessive
1	DHCR24	606418	Desmosterolosis	Autosomal recessive
11	DHCR7	602858	Smith-Lemli-Opitz syndrome	Autosomal recessive
1	DHDDS	608172	Retinitis pigmentosa, type 59	Autosomal recessive
5	DHFR	126060	Megaloblastic anemia due to dihydrofolate reductase deficiency	Autosomal recessive
12	DHH	605423	46,XY complete gonadal dysgenesis	Autosomal recessive
16	DHODH	126064	Miller syndrome	Autosomal recessive
19	DHPS	600944	Neurodevelopmental disorder with seizures and speech and walking impairment	Autosomal recessive
10	DHTKD1	614984	2-aminoadipic 2-oxoadipic aciduria	Autosomal recessive
5	DIAPH1	602121	Seizures, cortical blindness, microcephaly syndrome	Autosomal recessive
2	DIS3L2	614184	Perlman syndrome	Autosomal recessive
X	DKC1	300126	Dyskeratosis congenita, X-linked	X-linked
11	DLAT	608770	Pyruvate dehydrogenase E2 deficiency	Autosomal recessive
7	DLD	238331	Dihydrolipoamide dehydrogenase deficiency	Autosomal recessive
X	DLG3	300189	Mental retardation, X-linked, type 90	X-linked
19	DLL3	602768	Spondylocostal dysostosis type 1	Autosomal recessive
X	DMD	300377	DMD-related conditions	X-linked
5	DMGDH	605849	Dimethylglycine dehydrogenase deficiency	Autosomal recessive
4	DMP1	600980	Hypophosphatemic rickets, autosomal recessive	Autosomal recessive
15	DMXL2	612186	Developmental and epileptic encephalopathy, type 81	Autosomal recessive
16	DNAAF1	613190	Ciliary dyskinesia, primary, type 13	Autosomal recessive
8	DNAAF11	614930	Ciliary dyskinesia, primary, type 19	Autosomal recessive
14	DNAAF2	612517	Ciliary dyskinesia, primary, type 10	Autosomal recessive
19	DNAAF3	614566	Ciliary dyskinesia, primary, type 2	Autosomal recessive
15	DNAAF4	608706	Ciliary dyskinesia, primary, type 25	Autosomal recessive
7	DNAAF5	614864	Ciliary dyskinesia, primary, type 18	Autosomal recessive
3	DNAH1	603332	Spermatogenic failure, type 18	Autosomal recessive
7	DNAH11	603339	Ciliary dyskinesia, primary, type 7, with or without situs inversus	Autosomal recessive
5	DNAH5	603335	Ciliary dyskinesia, primary, type 3, with or without situs inversus	Autosomal recessive
17	DNAH9	603330	Ciliary dyskinesia, primary, type 40	Autosomal recessive
9	DNAI1	604366	Ciliary dyskinesia, primary, type 1, with or without situs inversus	Autosomal recessive
17	DNAI2	605483	Ciliary dyskinesia, primary, type 9, with or without situs inversus	Autosomal recessive
11	DNAJB13	610263	Ciliary dyskinesia, primary, type 34	Autosomal recessive
2	DNAJB2	604139	Spinal muscular atrophy, distal, autosomal recessive, type 5	Autosomal recessive
10	DNAJC12	606060	Hyperphenylalaninemia, mild, non-BH4-deficient	Autosomal recessive
3	DNAJC19	608977	3-methylglutaconic aciduria, type 5	Autosomal recessive
5	DNAJC21	617048	Bone marrow failure syndrome, type 3	Autosomal recessive
1	DNAJC6	608375	Parkinson disease, type 19A, juvenile-onset; Parkinson disease, type 19B, early-onset	Autosomal recessive
14	DNAL1	610062	Ciliary dyskinesia, primary, type 16	Autosomal recessive
3	DNASE1L3	602244	Systemic lupus erythematosus 16	Autosomal recessive
12	DNM1L	603850	Encephalopathy due to defective mitochondrial and peroxisomal fission, type 1	Autosomal recessive*
19	DNM2	602378	Lethal congenital contracture syndrome, type 5	Autosomal recessive
20	DNMT3B	602900	Immunodeficiency-centromeric instability-facial anomalies syndrome, type 1	Autosomal recessive
5	DOCK2	603122	Immunodeficiency, type 40	Autosomal recessive
19	DOCK6	614194	Adams-Oliver syndrome 2	Autosomal recessive
1	DOCK7	615730	Epileptic encephalopathy, early infantile, 23	Autosomal recessive
9	DOCK8	611432	Hyper-IgE recurrent infection syndrome, autosomal recessive	Autosomal recessive
4	DOK7	610285	Fetal akinesia deformation sequence, type 3; Myasthenic syndrome, congenital, type 10	Autosomal recessive
9	DOLK	610746	Congenital disorder of glycosylation, type 1M	Autosomal recessive
21	DONSON	611428	Microcephaly, short stature, and limb abnormalities	Autosomal recessive
11	DPAGT1	191350	Congenital disorder of glycosylation, type 1J; Myasthenic syndrome, congenital, type 13	Autosomal recessive
17	DPH1	603527	Developmental delay with short stature, dysmorphic features, and sparse hair	Autosomal recessive
20	DPM1	603503	Congenital disorder of glycosylation, type 1E	Autosomal recessive
9	DPM2	603564	Congenital disorder of glycosylation, type Iu	Autosomal recessive
1	DPM3	605951	Congenital disorder of glycosylation, type Io	Autosomal recessive
12	DPY19L2	613893	Spermatogenic failure, type 9	Autosomal recessive
1	DPYD	612779	Dihydropyrimidine dehydrogenase deficiency	Autosomal recessive
8	DPYS	613326	Dihydropyrimidinuria	Autosomal recessive
1	DRAM2	613360	Cone-rod dystrophy 21	Autosomal recessive
2	DRC1	615288	Ciliary dyskinesia, primary, type 21	Autosomal recessive
18	DSG1	125670	Erythroderma, congenital, with palmoplantar keratoderma, hypotrichosis, and hyper IgE	Autosomal recessive
18	DSG4	607892	Hypotrichosis, type 6	Autosomal recessive
6	DSP	125647	Cardiomyopathy, dilated, with woolly hair and keratoderma; Epidermolysis bullosa, lethal acantholytic	Autosomal recessive
6	DST	113810	Neuropathy, hereditary sensory and autonomic, type VI;Epidermolysis bullosa simplex 3, localized or generalized intermediate, with bp230 deficiency	Autosomal recessive
1	DSTYK	612666	Spastic paraplegia, type 23, autosomal recessive	Autosomal recessive
6	DTNBP1	607145	Hermansky-Pudlak syndrome, type 7	Autosomal recessive
15	DUOX2	606759	Thyroid dyshormonogenesis, type 6	Autosomal recessive
15	DUOXA2	612772	Thyroid dyshormonogenesis, type 5	Autosomal recessive
18	DYM	607461	Smith-McCort dysplasia; Dyggve-Melchior-Clausen disease	Autosomal recessive
11	DYNC2H1	603297	Short-rib thoracic dysplasia, type 3, with or without polydactyly	Autosomal recessive
7	DYNC2I1	615462	Short-rib thoracic dysplasia 8 with or without polydactyly	Autosomal recessive
9	DYNC2I2	613363	Short-rib thoracic dysplasia 11 with or without polydactyly	Autosomal recessive
2	DYNC2LI1	617083	Short-rib thoracic dysplasia 15 with polydactyly	Autosomal recessive
3	DYNLT2B	617353	Short-rib thoracic dysplasia 17 with or without polydactyly	Autosomal recessive
2	DYSF	603009	Miyoshi muscular dystrophy, type 1; Limb-girdle muscular dystrophy, type 2 (LGMD R2)	Autosomal recessive
3	DZIP1L	617570	Polycystic kidney disease 5	Autosomal recessive
16	EARS2	612799	Combined oxidative phosphorylation deficiency 12	Autosomal recessive
2	ECEL1	605896	Arthrogryposis, distal, type 5D	Autosomal recessive
10	ECHS1	602292	Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency	Autosomal recessive
1	ECM1	602201	Urbach-Wiethe disease	Autosomal recessive
X	EDA	300451	Ectodermal dysplasia, type 1, hypohidrotic, X-linked	X-linked
2	EDAR	604095	Ectodermal dysplasia 10B, hypohidrotic/hair/tooth type	Autosomal recessive
1	EDARADD	606603	Ectodermal dysplasia 11B, hypohidrotic/hair/tooth type	Autosomal recessive
6	EDN1	131240	Auriculocondylar syndrome, type 3	Autosomal recessive
20	EDN3	131242	Waardenburg syndrome, type 4B	Autosomal recessive
13	EDNRB	131244	ABCD syndrome	Autosomal recessive
11	EFEMP2	604633	Cutis laxa, autosomal recessive, type 1B	Autosomal recessive
15	EFL1	617538	Shwachman-Diamond syndrome 2	Autosomal recessive
7	EGFR	131550	?Inflammatory skin and bowel disease, neonatal, 2	Autosomal recessive
10	EGR2	129010	Dejerine-Sottas disease	Autosomal recessive*
2	EIF2AK3	604032	Wolcott-Rallison syndrome	Autosomal recessive
15	EIF2AK4	609280	Pulmonary venoocclusive disease 2	Autosomal recessive
12	EIF2B1	606686	Leukoencephalopathy with vanishing white matter (VWM)	Autosomal recessive
14	EIF2B2	606454	Leukoencephalopathy with vanishing white matter (VWM)	Autosomal recessive
1	EIF2B3	606273	Leukoencephalopathy with vanishing white matter (VWM)	Autosomal recessive
2	EIF2B4	606687	Leukoencephalopathy with vanishing white matter (VWM)	Autosomal recessive
3	EIF2B5	603945	Leukoencephalopathy with vanishing white matter (VWM)	Autosomal recessive
17	EIF4A3	608546	Robin sequence with cleft mandible and limb anomalies	Autosomal recessive
17	ELAC2	605367	Combined oxidative phosphorylation deficiency 17	Autosomal recessive
20	ELMO2	606421	Vascular malformation, primary intraosseous	Autosomal recessive
6	ELOVL4	605512	Ichthyosis, spastic quadriplegia, and mental retardation	Autosomal recessive
9	ELP1	603722	Familial dysautonomia	Autosomal recessive
18	ELP2	616054	Mental retardation, autosomal recessive, type 58	Autosomal recessive
1	EMC1	616846	Cerebellar atrophy, visual impairment, and psychomotor retardation	Autosomal recessive
X	EMD	300384	Emery-Dreifuss muscular dystrophy, type 1, X-linked	X-linked
14	EML1	602033	Band heterotopia	Autosomal recessive
16	EMP2	602334	Nephrotic syndrome, type 10	Autosomal recessive
4	ENAM	606585	Amelogenesis imperfecta, type 1C	Autosomal recessive
17	ENO3	131370	?Glycogen storage disease XIII	Autosomal recessive
6	ENPP1	173335	Arterial calcification, generalized, of infancy, type 1	Autosomal recessive
10	ENTPD1	601752	Spastic paraplegia, type 64, autosomal recessive	Autosomal recessive
3	EOGT	614789	Adams-Oliver syndrome 4	Autosomal recessive
1	EPB41	130500	Elliptocytosis, type 1	Autosomal recessive*
15	EPB42	177070	Spherocytosis, type 5	Autosomal recessive
2	EPCAM	185535	EPCAM-related conditions	Autosomal recessive
18	EPG5	615068	Vici syndrome	Autosomal recessive
6	EPM2A	607566	Epilepsy, progressive myoclonic, type 2A (Lafora)	Autosomal recessive
1	EPRS1	138295	Leukodystrophy, hypomyelinating, type 15	Autosomal recessive
11	EPS8L2	614988	Deafness autosomal recessive, type 106	Autosomal recessive
17	ERAL1	607435	Perrault syndrome 6	Autosomal recessive
12	ERBB3	190151	Lethal congenital contractural syndrome, type 2	Autosomal recessive
19	ERCC1	126380	Cerebrooculofacioskeletal syndrome, type 4	Autosomal recessive
19	ERCC2	126340	Trichothiodystrophy, type 1; Xeroderma pigmentosum, group D	Autosomal recessive
2	ERCC3	133510	Trichothiodystrophy, type 2	Autosomal recessive
16	ERCC4	133520	Fanconi anemia, complementation group Q	Autosomal recessive
13	ERCC5	133530	Cerebrooculofacioskeletal syndrome 3; Xeroderma pigmentosum, group G;Xeroderma pigmentosum, group G/Cockayne syndrome	Autosomal recessive
10	ERCC6	609413	Cockayne syndrome, type B; Cerebrooculofacioskeletal syndrome, type 1	Autosomal recessive
9	ERCC6L2	615667	Bone marrow failure syndrome, type 2	Autosomal recessive
5	ERCC8	609412	Cockayne syndrome, type A	Autosomal recessive
10	ERLIN1	611604	Spastic paraplegia, type 62, autosomal recessive	Autosomal recessive
8	ERLIN2	611605	Spastic paraplegia, type 18, autosomal recessive	Autosomal recessive
8	ESCO2	609353	Roberts syndrome	Autosomal recessive
1	ESPN	606351	Deafness, autosomal recessive, type 36	Autosomal recessive
6	ESR1	133430	Estrogen resistance	Autosomal recessive
14	ESRRB	602167	Deafness, autosomal recessive, type 35	Autosomal recessive
15	ETFA	608053	Glutaric acidemia, type 2A	Autosomal recessive
19	ETFB	130410	Glutaric acidemia, type 2B	Autosomal recessive
4	ETFDH	231675	Glutaric acidemia, type 2C	Autosomal recessive
19	ETHE1	608451	Ethylmalonic encephalopathy	Autosomal recessive
4	EVC	604831	Ellis-van Creveld syndrome	Autosomal recessive
4	EVC2	607261	Ellis-van Creveld syndrome	Autosomal recessive
9	EXOSC3	606489	Pontocerebellar hypoplasia, type 1B	Autosomal recessive
11	EXPH5	612878	Epidermolysis bullosa, nonspecific, autosomal recessive	Autosomal recessive
8	EXTL3	605744	Immunoskeletal dysplasia with neurodevelopmental abnormalities	Autosomal recessive
6	EYS	612424	Retinitis pigmentosa, type 25	Autosomal recessive
13	F10	613872	Factor X deficiency	Autosomal recessive
4	F11	264900	Factor XI deficiency	Autosomal recessive*
6	F13A1	134570	Factor XIIIA deficiency	Autosomal recessive
1	F13B	134580	Factor XIIIB deficiency	Autosomal recessive
11	F2	176930	Prothrombin deficiency	Autosomal recessive
1	F5	612309	Factor V deficiency	Autosomal recessive
13	F7	613878	Factor VII deficiency	Autosomal recessive
X	F8	300841	Hemophilia A	X-linked
X	F9	300746	Hemophilia B	X-linked
16	FA2H	611026	Spastic paraplegia, type 35, autosomal recessive	Autosomal recessive
11	FADD	602457	Infections, recurrent, with encephalopathy, hepatic dysfunction, and cardiovascular malformations	Autosomal recessive
15	FAH	613871	Tyrosinemia, type 1	Autosomal recessive
2	FAM161A	613596	Retinitis pigmentosa, type 28	Autosomal recessive
17	FAM20A	611062	Amelogenesis imperfecta, type 1G (Enamel-renal syndrome)	Autosomal recessive
7	FAM20C	611061	Raine syndrome	Autosomal recessive
15	FAN1	613534	Interstitial nephritis, karyomegalic	Autosomal recessive
16	FANCA	607139	Fanconi anemia, complementation group A	Autosomal recessive
9	FANCC	613899	Fanconi anemia, complementation group C	Autosomal recessive
3	FANCD2	613984	Fanconi anemia, complementation group D2	Autosomal recessive
6	FANCE	613976	Fanconi anemia, complementation group E	Autosomal recessive
11	FANCF	613897	Fanconi anemia, complementation group F	Autosomal recessive
9	FANCG	602956	Fanconi anemia, complementation group G	Autosomal recessive
15	FANCI	611360	Fanconi anemia, complementation group I	Autosomal recessive
2	FANCL	608111	Fanconi anemia, complementation group L	Autosomal recessive
14	FANCM	609644	Spermatogenic failure, type 28; ?Premature ovarian failure 15	Autosomal recessive
11	FAR1	616107	Peroxisomal fatty acyl-CoA reductase 1 disorder	Autosomal recessive
6	FARS2	611592	Combined oxidative phosphorylation deficiency 14; Spastic paraplegia, type 77, autosomal recessive	Autosomal recessive
2	FASTKD2	612322	Combined oxidative phosphorylation deficiency 44	Autosomal recessive
4	FAT4	612411	Hennekam lymphangiectasia-lymphedema syndrome 2	Autosomal recessive
14	FBLN5	604580	Cutis laxa, autosomal recessive, type 1A	Autosomal recessive
9	FBP1	611570	Fructose-1,6-bisphosphatase deficiency	Autosomal recessive
6	FBXL4	605654	Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type)	Autosomal recessive
22	FBXO7	605648	Parkinson disease, type 15, autosomal recessive	Autosomal recessive
17	FDXR	103270	Auditory neuropathy and optic atrophy	Autosomal recessive
18	FECH	612386	Protoporphyria, erythropoietic, autosomal recessive	Autosomal recessive
20	FERMT1	607900	Kindler syndrome	Autosomal recessive
11	FERMT3	607901	Leukocyte adhesion deficiency, type 3	Autosomal recessive
7	FEZF1	613301	Hypogonadotropic hypogonadism type 22, with or without anosmia	Autosomal recessive
4	FGA	134820	Afibrinogenemia, congenital	Autosomal recessive
4	FGB	134830	Congenital afibrinogenemia	Autosomal recessive
X	FGD1	300546	Aarskog-Scott syndrome; Mental retardation, X-linked syndromic, type 16	X-linked
12	FGD4	611104	Charcot-Marie-Tooth disease, type 4H	Autosomal recessive
12	FGF23	605380	Tumoral calcinosis, hyperphosphatemic, familial, type 2	Autosomal recessive
11	FGF3	164950	Deafness, congenital with inner ear agenesis, microtia, and microdontia	Autosomal recessive
4	FGG	134850	Afibrinogenemia, congenital; Hypofibrinogenemia, congenital	Autosomal recessive
1	FH	136850	Fumarase deficiency	Autosomal recessive
11	FIBP	608296	Thauvin-Robinet-Faivre syndrome	Autosomal recessive
6	FIG4	609390	Charcot-Marie-Tooth disease, type 4J; Yunis-Varon syndrome	Autosomal recessive
17	FKBP10	607063	Bruck syndrome 1	Autosomal recessive
7	FKBP14	614505	Ehlers-Danlos syndrome, kyphoscoliotic type, 2	Autosomal recessive
19	FKRP	606596	Muscular dystrophy-dystroglycanopathy, type 5A (Walker-Warburg syndrome); Type 5B; Type 5C (limb-girdle muscular dystrophy, type 9 [LGMDR9])	Autosomal recessive
9	FKTN	607440	Muscular dystrophy-dystroglycanopathy, type 4A (Walker-Warburg syndrome); Type 4B; Type 4C (limb-girdle muscular dystrophy, type 13 [LGMD R13])	Autosomal recessive
1	FLAD1	610595	Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency	Autosomal recessive
1	FLG	135940	Ichthyosis vulgaris	Autosomal recessive*
11	FLI1	193067	Bleeding disorder, platelet-type, type 21	Autosomal recessive*
3	FLNB	603381	Spondylocarpotarsal synostosis syndrome	Autosomal recessive
1	FLVCR1	609144	Posterior column ataxia-retinitis pigmentosa syndrome	Autosomal recessive
14	FLVCR2	610865	Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome	Autosomal recessive
1	FMN2	606373	Mental retardation, autosomal recessive, type 47	Autosomal recessive
1	FMO3	136132	Trimethylaminuria	Autosomal recessive
X	FMR1	309550	FMR1-related conditions	X-linked
11	FOLR1	136430	Neurodegeneration due to cerebral folate transport deficiency	Autosomal recessive
9	FOXE1	602617	Bamforth-Lazarus syndrome	Autosomal recessive
1	FOXE3	601094	Anterior segment dysgenesis, type 2, multiple subtypes	Autosomal recessive
17	FOXN1	600838	T-cell immunodeficiency, congenital alopecia and nail dystrophy	Autosomal recessive
11	FOXRED1	613622	Mitochondrial complex I deficiency, nuclear type 19	Autosomal recessive
4	FRAS1	607830	Fraser syndrome, type 1	Autosomal recessive
9	FREM1	608944	Manitoba oculotrichoanal syndrome	Autosomal recessive
13	FREM2	608945	Fraser syndrome, type 2	Autosomal recessive
9	FRRS1L	604574	Epileptic encephalopathy, early infantile, 37	Autosomal recessive
11	FSHB	136530	Hypogonadotropic hypogonadism, type 24, without anosmia	Autosomal recessive
2	FSHR	136435	Ovarian dysgenesis 1;Ovarian hyperstimulation syndrome;Ovarian response to FSH stimulation	Autosomal recessive; Autosomal dominant; Autosomal recessive
21	FTCD	606806	Glutamate formiminotransferase deficiency	Autosomal recessive
19	FTL	134790	L-ferritin deficiency	Autosomal recessive*
16	FTO	610966	Growth retardation, developmental delay, facial dysmorphism	Autosomal recessive
X	FTSJ1	300499	Mental retardation, X-linked 44	X-linked
1	FUCA1	612280	Fucosidosis	Autosomal recessive
14	FUT8	602589	Congenital disorder of glycosylation with defective fucosylation, type 1	Autosomal recessive
9	FXN	606829	Friedreich ataxia	Autosomal recessive
3	FYCO1	607182	Cataract 18	Autosomal recessive
8	FZD6	603409	Nail disorder, nonsyndromic congenital, type 10 (claw-shaped nails)	Autosomal recessive
17	G6PC1	613742	Glycogen storage disease, type 1A	Autosomal recessive
17	G6PC3	611045	Dursun syndrome	Autosomal recessive
X	G6PD	305900	G6PD deficiency	X-linked
17	GAA	606800	Glycogen storage disease, type 2	Autosomal recessive
14	GALC	606890	Krabbe disease	Autosomal recessive
1	GALE	606953	Galactose epimerase deficiency	Autosomal recessive
17	GALK1	604313	Galactokinase deficiency with cataracts	Autosomal recessive
16	GALNS	612222	Mucopolysaccharidosis, type 4A	Autosomal recessive
2	GALNT3	601756	Tumoral calcinosis, hyperphosphatemic, familial, type 1	Autosomal recessive
9	GALT	606999	Galactosemia	Autosomal recessive
19	GAMT	601240	Cerebral creatine deficiency syndrome, type 2	Autosomal recessive
16	GAN	605379	Giant axonal neuropathy, type 1	Autosomal recessive
16	GAS8	605178	Ciliary dyskinesia, primary, type 33	Autosomal recessive
15	GATM	602360	Cerebral creatine deficiency syndrome, type 3	Autosomal recessive
1	GBA1	606463	Gaucher disease	Autosomal recessive
9	GBA2	609471	Spastic paraplegia, type 46, autosomal recessive	Autosomal recessive
3	GBE1	607839	Glycogen storage disease, type 4	Autosomal recessive
19	GCDH	608801	Glutaricaciduria, type 1	Autosomal recessive
14	GCH1	600225	Hyperphenylalaninemia, BH4-deficient, type B	Autosomal recessive
7	GCK	138079	Permanent neonatal diabetes mellitus (PNDM)	Autosomal recessive*
6	GCM2	603716	Hypoparathyroidism, familial isolated (FIH) 2	Autosomal recessive
6	GCNT2	600429	Cataract 13, with adult i phenotype	Autosomal recessive
16	GCSH	238330	Multiple mitochondrial dysfunctions syndrome 7	Autosomal recessive
8	GDAP1	606598	Charcot-Marie-Tooth disease, recessive intermediate, type A	Autosomal recessive
19	GDF1	602880	Right atrial isomerism (Ivemark syndrome)	Autosomal recessive
20	GDF5	601146	Chondrodysplasia, Grebe type	Autosomal recessive
8	GDF6	601147	Leber congenital amaurosis, type 17	Autosomal recessive
16	GFER	600924	Myopathy, mitochondrial progressive, with congenital cataract, hearing loss, and developmental delay	Autosomal recessive
3	GFM1	606639	Combined oxidative phosphorylation deficiency, type 1	Autosomal recessive
2	GFPT1	138292	Myasthenia, congenital, type 12, with tubular aggregates	Autosomal recessive
2	GGCX	137167	Vitamin K-dependent clotting factors, combined deficiency of, type 1	Autosomal recessive
17	GH1	139250	Growth hormone deficiency, isolated, type 1A; Kowarski syndrome	Autosomal recessive
5	GHR	600946	Laron dwarfism	Autosomal recessive
7	GHRHR	139191	Growth hormone deficiency, isolated, type 1B	Autosomal recessive
3	GHSR	601898	Growth hormone deficiency, isolated partial	Autosomal recessive
20	GINS1	610608	Immunodeficiency, type 55	Autosomal recessive
19	GIPC3	608792	Deafness, autosomal recessive, type 15	Autosomal recessive
6	GJA1	121014	Craniometaphyseal dysplasia, autosomal recessive	Autosomal recessive
X	GJB1	304040	Charcot-Marie-Tooth neuropathy, X-linked dominant, type 1	X-linked
13	GJB2	121011	Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6	Autosomal recessive; Digenic inheritance (GJB6 gene)
13	GJB6	604418	Deafness, autosomal recessive, type 1B; Deafness, digenic GJB2/GJB6	Autosomal recessive; Digenic inheritance (GJB2 gene)
1	GJC2	608803	Spastic paraplegia, type 44, autosomal recessive	Autosomal recessive
X	GLA	300644	Fabry disease	X-linked
3	GLB1	611458	GM1-gangliosidosis, types 1-3; Mucopolysaccharidosis, type 4B (Morquio)	Autosomal recessive
9	GLDC	238300	Glycine encephalopathy	Autosomal recessive
15	GLDN	608603	Lethal congenital contracture syndrome 11	Autosomal recessive
9	GLE1	603371	Lethal congenital contracture syndrome, type 1; Congenital arthrogryposis with anterior horn cell disease	Autosomal recessive
16	GLIS2	608539	Nephronophthisis, type 7	Autosomal recessive
9	GLIS3	610192	Diabetes mellitus, neonatal, with congenital hypothyroidism	Autosomal recessive
5	GLRA1	138491	Hyperekplexia, type 1	Autosomal recessive*
4	GLRB	138492	Hyperekplexia, type 2	Autosomal recessive
14	GLRX5	609588	Anemia, sideroblastic, type 3, pyridoxine-refractory; Spasticity, childhood-onset, with hyperglycinemia	Autosomal recessive
1	GLUL	138290	Glutamine deficiency, congenital	Autosomal recessive
3	GLYCTK	610516	D-glyceric aciduria	Autosomal recessive
5	GM2A	613109	GM2-gangliosidosis, AB variant	Autosomal recessive
2	GMPPA	615495	Alacrima, achalasia, and mental retardation syndrome	Autosomal recessive
3	GMPPB	615320	Muscular dystrophy-dystroglycanopathy 14	Autosomal recessive
3	GNAT1	139330	Night blindness, congenital stationary, type 1G	Autosomal recessive
1	GNAT2	139340	Achromatopsia, type 4	Autosomal recessive
15	GNB5	604447	Intellectual developmental disorder with cardiac arrhythmia; Language delay and ADHD/cognitive impairment with or without cardiac arrhythmia	Autosomal recessive
9	GNE	603824	Inclusion body myopathy, type 2 (Nonaka myopathy)	Autosomal recessive
6	GNMT	606628	Glycine N-methyltransferase deficiency	Autosomal recessive
1	GNPAT	602744	Rhizomelic chondrodysplasia punctata, type 2	Autosomal recessive
12	GNPTAB	607840	Mucolipidosis 2 alpha/beta; Mucolipidosis 3 alpha/beta	Autosomal recessive
16	GNPTG	607838	Mucolipidosis III gamma	Autosomal recessive
4	GNRHR	138850	Hypogonadotropic hypogonadism, type 7, without anosmia	Autosomal recessive
12	GNS	607664	Mucopolysaccharidosis, type 3D (Sanfilippo syndrome D)	Autosomal recessive
1	GORAB	607983	Geroderma osteodysplasticum	Autosomal recessive
17	GOSR2	604027	Epilepsy, progressive myoclonic, type 6	Autosomal recessive
16	GOT2	138150	Epileptic encephalopathy, early infantile, 82	Autosomal recessive
17	GP1BA	606672	Bernard-Soulier syndrome, type A1	Autosomal recessive
22	GP1BB	138720	Bernard-Soulier syndrome, type B	Autosomal recessive
19	GP6	605546	Bleeding disorder, platelet-type, type 11	Autosomal recessive
3	GP9	173515	Bernard-Soulier syndrome, type C	Autosomal recessive
8	GPAA1	603048	Glycosylphosphatidylinositol biosynthesis defect 15	Autosomal recessive
13	GPC6	604404	Omodysplasia, type 1	Autosomal recessive
12	GPD1	138420	Hypertriglyceridemia, transient infantile	Autosomal recessive
14	GPHN	603930	Molybdenum cofactor deficiency C	Autosomal recessive
19	GPI	172400	Hemolytic anemia, nonspherocytic, due to glucose phosphate isomerase deficiency	Autosomal recessive
8	GPIHBP1	612757	Hyperlipoproteinemia, type 1D	Autosomal recessive
X	GPR143	300808	Ocular albinism, type 1 (Nettleship-Falls type)	X-linked
17	GPR179	614515	Night blindness, congenital stationary (complete), type 1E, autosomal recessive	Autosomal recessive
14	GPR68	601404	Amelogenesis imperfecta, type 2A6 (hypomaturation type)	Autosomal recessive
1	GPSM2	609245	Chudley-McCullough syndrome	Autosomal recessive
16	GPT2	138210	Mental retardation, autosomal recessive 49	Autosomal recessive
19	GPX4	138322	Spondylometaphyseal dysplasia, Sedaghatian type	Autosomal recessive
8	GRHL2	608576	Ectodermal dysplasia/short stature syndrome	Autosomal recessive
9	GRHPR	604296	Hyperoxaluria, primary, type 2	Autosomal recessive
4	GRID2	602368	Spinocerebellar ataxia, autosomal recessive, type 18	Autosomal recessive
6	GRIK2	138244	Mental retardation, autosomal recessive, type, 6	Autosomal recessive
9	GRIN1	138249	Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive	Autosomal recessive
12	GRIP1	604597	Fraser syndrome 3	Autosomal recessive
13	GRK1	180381	Oguchi disease-2	Autosomal recessive
6	GRM1	604473	Spinocerebellar ataxia, autosomal recessive, type 13	Autosomal recessive
5	GRM6	604096	Night blindness, congenital stationary (complete), type 1B, autosomal recessive	Autosomal recessive
17	GRN	138945	Ceroid lipofuscinosis, neuronal, type 11	Autosomal recessive
4	GRXCR1	613283	Deafness, autosomal recessive, type 25	Autosomal recessive
14	GSC	138890	Short stature, auditory canal atresia, mandibular hypoplasia, skeletal abnormalities	Autosomal recessive
20	GSS	601002	Glutathione synthetase deficiency	Autosomal recessive
6	GTF2H5	608780	Trichothiodystrophy, type 3, photosensitive	Autosomal recessive
6	GTPBP2	607434	Jaberi-Elahi syndrome	Autosomal recessive
19	GTPBP3	608536	Combined oxidative phosphorylation deficiency 23	Autosomal recessive
12	GUCY2C	601330	Meconium ileus	Autosomal recessive
17	GUCY2D	600179	Leber congenital amaurosis, type 1	Autosomal recessive
4	GUF1	617064	?Epileptic encephalopathy, early infantile, 40	Autosomal recessive
7	GUSB	611499	Mucopolysaccharidosis, type 7	Autosomal recessive
3	GYG1	603942	Polyglucosan body myopathy, type 2	Autosomal recessive
19	GYS1	138570	Glycogen storage disease, type 0, muscle	Autosomal recessive
12	GYS2	138571	Glycogen storage disease, type 0, liver	Autosomal recessive
20	GZF1	613842	Joint laxity, short stature, and myopia	Autosomal recessive
1	H6PD	138090	Cortisone reductase deficiency 1	Autosomal recessive
2	HAAO	604521	Vertebral, cardiac, renal, and limb defects syndrome 1	Autosomal recessive
6	HACE1	610876	Spastic paraplegia and psychomotor retardation with or without seizures	Autosomal recessive
4	HADH	601609	3-hydroxyacyl-CoA dehydrogenase deficiency	Autosomal recessive
2	HADHA	600890	Long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD) deficiency; Mitochondrial trifunctional protein deficiency	Autosomal recessive
2	HADHB	143450	Mitochondrial trifunctional protein deficiency	Autosomal recessive
19	HAMP	606464	Hemochromatosis, type 2B	Autosomal recessive
5	HARS1	142810	Usher syndrome, type 3B	Autosomal recessive
1	HAX1	605998	Neutropenia, severe congenital, type 3, autosomal recessive	Autosomal recessive
16	HBA1	141800	Alpha thalassemia	Autosomal recessive
16	HBA2	141850	Alpha thalassemia	Autosomal recessive
11	HBB	141900	HBB-related hemoglobinopathies	Autosomal recessive
X	HCFC1	300019	Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type )	X-linked
10	HELLS	603946	Immunodeficiency-centromeric instability-facial anomalies syndrome 4	Autosomal recessive
11	HEPACAM	611642	Megalencephalic leukoencephalopathy with subcortical cysts 2A	Autosomal recessive
15	HERC1	605109	Macrocephaly, dysmorphic facies, and psychomotor retardation	Autosomal recessive
15	HERC2	605837	Mental retardation, autosomal recessive, type 38	Autosomal recessive
17	HES7	608059	Spondylocostal dysostosis, type 4, autosomal recessive	Autosomal recessive
3	HESX1	601802	Growth hormone deficiency with pituitary anomalies	Autosomal recessive
15	HEXA	606869	Tay-Sachs disease	Autosomal recessive
5	HEXB	606873	Sandhoff disease, infantile, juvenile, and adult forms	Autosomal recessive
6	HFE	613609	Hemochromatosis, type 1	Autosomal recessive
1	HFM1	615684	Premature ovarian failure 9	Autosomal recessive
3	HGD	607474	Alkaptonuria	Autosomal recessive
7	HGF	142409	Deafness, autosomal recessive, type 39	Autosomal recessive
8	HGSNAT	610453	Mucopolysaccharidosis type 3C (Sanfilippo syndrome C)	Autosomal recessive
2	HIBCH	610690	3-hydroxyisobutryl-CoA hydrolase deficiency	Autosomal recessive
11	HIKESHI	614908	Leukodystrophy, hypomyelinating, type 13	Autosomal recessive
5	HINT1	601314	Neuromyotonia and axonal neuropathy, autosomal recessive	Autosomal recessive
1	HJV	608374	Hemochromatosis, type 2A	Autosomal recessive
10	HK1	142600	Charcot-Marie-Tooth disease, type 4G	Autosomal recessive
21	HLCS	609018	Holocarboxylase synthetase deficiency	Autosomal recessive
1	HMGCL	613898	HMG-CoA lyase deficiency	Autosomal recessive
1	HMGCS2	600234	HMG-CoA synthase-2 deficiency	Autosomal recessive
22	HMOX1	141250	Heme oxygenase-1 deficiency	Autosomal recessive
4	HMX1	142992	Oculoauricular syndrome	Autosomal recessive
2	HNMT	605238	Mental retardation, autosomal recessive, type 51	Autosomal recessive
10	HOGA1	613597	Hyperoxaluria, primary, type 3	Autosomal recessive
7	HOXA1	142955	Athabaskan brainstem dysgenesis syndrome	Autosomal recessive
17	HOXB1	142968	Facial paresis, hereditary congenital, 3	Autosomal recessive
12	HOXC13	142976	Ectodermal dysplasia 9, hair/nail type	Autosomal recessive
1	HPCA	142622	Dystonia 2, torsion, autosomal recessive	Autosomal recessive
12	HPD	609695	Tyrosinemia, type 3	Autosomal recessive
4	HPGD	601688	Hypertrophic osteoarthropathy, primary, type 1 (pachydermoperiostosis)	Autosomal recessive
X	HPRT1	308000	Lesch-Nyhan syndrome	X-linked
10	HPS1	604982	Hermansky-Pudlak syndrome, type 1	Autosomal recessive
3	HPS3	606118	Hermansky-Pudlak syndrome, type 3	Autosomal recessive
22	HPS4	606682	Hermansky-Pudlak syndrome, type 4	Autosomal recessive
11	HPS5	607521	Hermansky-Pudlak syndrome, type 5	Autosomal recessive
10	HPS6	607522	Hermansky-Pudlak syndrome, type 6	Autosomal recessive
10	HPSE2	613469	Urofacial syndrome, type 1	Autosomal recessive
8	HR	602302	Alopecia universalis; Atrichia with papular lesions	Autosomal recessive
16	HSD11B2	614232	Apparent mineralocorticoid excess	Autosomal recessive
X	HSD17B10	300256	HSD10 mitochondrial disease	X-linked
9	HSD17B3	605573	46,XY disorder of sex development due to 17-beta-hydroxysteroid dehydrogenase 3 deficiency	Autosomal recessive
5	HSD17B4	601860	D-bifunctional protein deficiency	Autosomal recessive
1	HSD3B2	613890	Adrenal hyperplasia, congenital, due to 3-beta-hydroxysteroid dehydrogenase 2 deficiency	Autosomal recessive
16	HSD3B7	607764	Bile acid synthesis defect, congenital, type 1	Autosomal recessive
5	HSPA9	600548	Even-plus syndrome	Autosomal recessive
2	HSPD1	118190	Leukodystrophy, hypomyelinating, type 4	Autosomal recessive
1	HSPG2	142461	Schwartz-Jampel syndrome, type 1; Dyssegmental dysplasia, Silverman-Handmaker type	Autosomal recessive
10	HTRA1	602194	CARASIL syndrome	Autosomal recessive
2	HTRA2	606441	3-methylglutaconic aciduria, type 8	Autosomal recessive
3	HYAL1	607071	?Mucopolysaccharidosis, type 9	Autosomal recessive
7	HYC11	610531	Leukodystrophy, hypomyelinating, type 5	Autosomal recessive
16	HYDIN	610812	Ciliary dyskinesia, primary, type 5	Autosomal recessive
11	HYLS1	610693	Hydrolethalus syndrome	Autosomal recessive
9	IARS1	600709	Growth retardation, intellectual developmental disorder, hypotonia, and hepatopathy	Autosomal recessive
1	IBA57	615316	Multiple mitochondrial dysfunctions syndrome 3	Autosomal recessive
2	ICOS	604558	Immunodeficiency, common variable, 1	Autosomal recessive
20	IDH3B	604526	Retinitis pigmentosa, type 46	Autosomal recessive
X	IDS	300823	Mucopolysaccharidosis, type 2	X-linked
4	IDUA	252800	Mucopolysaccharidosis type 1	Autosomal recessive
18	IER3IP1	609382	Microcephaly, epilepsy, and diabetes syndrome	Autosomal recessive
6	IFNGR1	107470	Immunodeficiency, type 27A, mycobacteriosis	Autosomal recessive
21	IFNGR2	147569	Immunodeficiency, type 28, mycobacteriosis	Autosomal recessive
3	IFT122	606045	Cranioectodermal dysplasia 1	Autosomal recessive
16	IFT140	614620	Retinitis pigmentosa, type 80; Short-rib thoracic dysplasia 9 with or without polydactyly	Autosomal recessive
2	IFT172	607386	Short-rib thoracic dysplasia 10 with or without polydactyly	Autosomal recessive
14	IFT43	614068	Short-rib thoracic dysplasia 18 with polydactyly	Autosomal recessive
20	IFT52	617094	Short-rib thoracic dysplasia 16 with or without polydactyly	Autosomal recessive
3	IFT80	611177	Short-rib thoracic dysplasia, type 2, with or without polydactyly	Autosomal recessive
12	IFT81	605489	Short-rib thoracic dysplasia 19 with or without polydactyly	Autosomal recessive
12	IGF1	147440	Growth retardation with deafness and mental retardation due to IGF1 deficiency	Autosomal recessive
15	IGF1R	147370	Insulin-like growth factor I, resistance to	Autosomal recessive*
16	IGFALS	601489	Acid-labile subunit deficiency	Autosomal recessive
4	IGFBP7	602867	Retinal arterial macroaneurysm with supravalvular pulmonic stenosis	Autosomal recessive
11	IGHMBP2	600502	Charcot-Marie-Tooth disease, axonal, type 2S	Autosomal recessive
22	IGLL1	146770	Agammaglobulinemia 2	Autosomal recessive
2	IHH	600726	Acrocapitofemoral dysplasia	Autosomal recessive
8	IKBKB	603258	Immunodeficiency, type 15	Autosomal recessive
11	IL10RA	146933	Inflammatory bowel disease, type 28, early onset, autosomal recessive	Autosomal recessive
21	IL10RB	123889	Inflammatory bowel disease, type 25, early onset, autosomal recessive	Autosomal recessive
9	IL11RA	600939	Craniosynostosis and dental anomalies	Autosomal recessive
5	IL12B	161561	Immunodeficiency, type 29, mycobacteriosis	Autosomal recessive
19	IL12RB1	601604	Immunodeficiency, type 30	Autosomal recessive
22	IL17RA	605461	Immunodeficiency, type 51	Autosomal recessive
3	IL17RC	610925	Candidiasis, familial, 9	Autosomal recessive
X	IL1RAPL1	300206	Mental retardation, X-linked, type 21/34	X-linked
2	IL1RN	147679	Sterile multifocal osteomyelitis with periostitis and pustulosis	Autosomal recessive
16	IL21R	605383	Immunodeficiency, type 56	Autosomal recessive
10	IL2RA	147730	Immunodeficiency, type 41, with lymphoproliferation and autoimmunity	Autosomal recessive
X	IL2RG	308380	Severe combined immunodeficiency, X-linked	X-linked
2	IL36RN	605507	Psoriasis, type 14, pustular	Autosomal recessive
5	IL7R	146661	Severe combined immunodeficiency, T-cell negative, B-cell/natural killer cell-positive type	Autosomal recessive
3	ILDR1	609739	Deafness, autosomal recessive, type 42	Autosomal recessive
8	IMPA1	602064	Mental retardation, autosomal recessive 59	Autosomal recessive
3	IMPG2	607056	Retinitis pigmentosa, type 56	Autosomal recessive
9	INPP5E	613037	Joubert syndrome, type 1	Autosomal recessive
17	INPP5K	607875	Muscular dystrophy, congenital, with cataracts and intellectual disability	Autosomal recessive
11	INPPL1	600829	Opsismodysplasia	Autosomal recessive
11	INS	176730	Permanent neonatal diabetes mellitus (PNDM)	Autosomal recessive*
19	INSR	147670	Diabetes mellitus, insulin-resistant, with acanthosis nigricans, type A	Autosomal recessive
7	INTS1	611345	Neurodevelopmental disorder with cataracts, poor growth, and dysmorphic facies	Autosomal recessive
9	INVS	243305	Nephronophthisis, type 2, infantile	Autosomal recessive
3	IQCB1	609237	Senior-Loken syndrome, type 5	Autosomal recessive
7	IQCE	617631	Polydactyly, postaxial, type A7	Autosomal recessive
12	IRAK4	606883	Immunodeficiency, type 67 (IRAK4 deficiency)	Autosomal recessive
16	IRF8	601565	Immunodeficiency, type 32B, monocyte and dendritic cell deficiency	Autosomal recessive
16	IRX5	606195	Hamamy syndrome	Autosomal recessive
9	ISCA1	611006	Multiple mitochondrial dysfunctions syndrome 5	Autosomal recessive
14	ISCA2	615317	Multiple mitochondrial dysfunctions syndrome 4	Autosomal recessive
12	ISCU	611911	Myopathy with lactic acidosis, hereditary	Autosomal recessive
1	ISG15	147571	Immunodeficiency, type 38	Autosomal recessive
20	ITCH	606409	Autoimmune disease, multisystem, with facial dysmorphism	Autosomal recessive
17	ITGA2B	607759	Glanzmann thrombasthenia	Autosomal recessive
17	ITGA3	605025	Interstitial lung disease, nephrotic syndrome, and epidermolysis bullosa, congenital	Autosomal recessive
2	ITGA6	147556	Epidermolysis bullosa, junctional, with pyloric stenosis	Autosomal recessive
12	ITGA7	600536	Muscular dystrophy, congenital, due to ITGA7 deficiency	Autosomal recessive
10	ITGA8	604063	Renal hypodysplasia/aplasia 1	Autosomal recessive
21	ITGB2	600065	Leukocyte adhesion deficiency	Autosomal recessive
17	ITGB3	173470	Glanzmann thrombasthenia	Autosomal recessive
17	ITGB4	147557	Epidermolysis bullosa, junctional, with pyloric atresia	Autosomal recessive
2	ITGB6	147558	Amelogenesis imperfecta, type 1H	Autosomal recessive
5	ITK	186973	Lymphoproliferative syndrome 1	Autosomal recessive
20	ITPA	147520	Epileptic encephalopathy, early infantile, type 35	Autosomal recessive
3	ITPR1	147265	Gillespie syndrome	Autosomal recessive*
15	IVD	607036	Isovaleric acidemia	Autosomal recessive
6	IYD	612025	Thyroid dyshormonogenesis, type 4	Autosomal recessive
3	JAGN1	616012	Neutropenia, severe congenital, 6, autosomal recessive	Autosomal recessive
19	JAK3	600173	Severe Combined Immunodeficiency, autosomal recessive, T-negative/B-positive type	Autosomal recessive
11	JAM3	606871	Hemorrhagic destruction of the brain, subependymal calcification, and cataracts	Autosomal recessive
17	JUP	173325	Naxos disease	Autosomal recessive
19	KANK2	614610	Nephrotic syndrome, type 16	Autosomal recessive
16	KARS1	601421	Deafness, autosomal recessive, type 89	Autosomal recessive
16	KATNB1	602703	Lissencephaly 6, with microcephaly	Autosomal recessive
16	KATNIP	616650	Joubert syndrome 26	Autosomal recessive
21	KCNE1	176261	Jervell and Lange-Nielsen syndrome 2	Autosomal recessive
11	KCNJ1	600359	Bartter syndrome, type 2	Autosomal recessive
1	KCNJ10	602208	SESAME syndrome	Autosomal recessive
11	KCNJ11	600937	Hyperinsulinemic hypoglycemia, type 2 (congenital hyperinsulinism); Permanent neonatal diabetes mellitus (PNDM)	Autosomal recessive; Autosomal recessive*
2	KCNJ13	603208	Leber congenital amaurosis, type 16	Autosomal recessive
9	KCNV2	607604	Retinal cone dystrophy, type 3B	Autosomal recessive
7	KCTD7	611725	Epilepsy, progressive myoclonic, type 3, with or without intracellular inclusions	Autosomal recessive
X	KDM5C	314690	Mental retardation, X-linked, syndromic, Claes-Jensen type	X-linked
18	KDSR	136440	Erythrokeratodermia variabilis et progressiva 4	Autosomal recessive
12	KERA	603288	Cornea plana 2, autosomal recessive	Autosomal recessive
6	KHDC3L	611687	Hydatidiform mole, recurrent, type 2	Autosomal recessive
14	KIAA0586	610178	Short-rib thoracic dysplasia 14 with polydactyly	Autosomal recessive
17	KIAA0753	617112	?Orofaciodigital syndrome, type 15	Autosomal recessive
7	KIAA1549	613344	Retinitis pigmentosa, type 86	Autosomal recessive
1	KIF14	611279	Microcephaly 20, primary, autosomal recessive; ?Meckel syndrome 12	Autosomal recessive
2	KIF1A	601255	Neuropathy, hereditary sensory, type 2C; Spastic paraplegia, type 30, autosomal recessive	Autosomal recessive
17	KIF1C	603060	Spastic ataxia 2, autosomal recessive	Autosomal recessive
15	KIF7	611254	Acrocallosal syndrome; Joubert syndrome, type 12	Autosomal recessive
10	KIFBP	609367	Goldberg-Shprintzen megacolon syndrome	Autosomal recessive
19	KISS1R	604161	Hypogonadotropic hypogonadism, type 8, with or without anosmia	Autosomal recessive
20	KIZ	615757	Retinitis pigmentosa 69	Autosomal recessive
5	KLHL3	605775	Pseudohypoaldosteronism, type 2D	Autosomal recessive
3	KLHL40	615340	Nemaline myopathy 8, autosomal recessive	Autosomal recessive
2	KLHL41	607701	Nemaline myopathy 9	Autosomal recessive
7	KLHL7	611119	Cold-induced sweating syndrome 3	Autosomal recessive
19	KLK4	603767	Amelogenesis imperfecta, type 2A1 (hypomaturation type)	Autosomal recessive
4	KLKB1	229000	Fletcher factor (prekallikrein) deficiency	Autosomal recessive
15	KNL1	609173	Microcephaly 4, primary, autosomal recessive	Autosomal recessive
19	KPTN	615620	Mental retardation, autosomal recessive 41	Autosomal recessive
22	KREMEN1	609898	Ectodermal dysplasia 13, hair/tooth type	Autosomal recessive
17	KRT10	148080	Epidermolytic hyperkeratosis	Autosomal recessive*
17	KRT14	148066	Epidermolysis bullosa simplex, autosomal recessive, type 1	Autosomal recessive
17	KRT25	616646	Woolly hair, autosomal recessive 3	Autosomal recessive
12	KRT5	148040	Epidermolysis bullosa simplex, autosomal recessive, type 1	Autosomal recessive
12	KRT85	602767	Ectodermal dysplasia 4, hair/nail type	Autosomal recessive
3	KY	605739	Myopathy, myofibrillar, type 7	Autosomal recessive
2	KYNU	605197	Vertebral, cardiac, renal, and limb defects syndrome, type 2	Autosomal recessive
X	L1CAM	308840	L1 Syndrome	X-linked
14	L2HGDH	609584	L-2-hydroxyglutaric aciduria	Autosomal recessive
18	LAMA1	150320	Poretti-Boltshauser syndrome	Autosomal recessive
6	LAMA2	156225	LAMA2-related muscular dystrophy	Autosomal recessive
18	LAMA3	600805	Junctional epidermolysis bullosa (JEB) Herlitz type; JEB non-Herlitz type	Autosomal recessive
7	LAMB1	150240	Lissencephaly, type 5	Autosomal recessive
3	LAMB2	150325	Pierson syndrome; Nephrotic syndrome, type 5, with or without ocular abnormalities	Autosomal recessive; Autosomal recessive
1	LAMB3	150310	Junctional epidermolysis bullosa (JEB) Herlitz type; JEB non-Herlitz type	Autosomal recessive
1	LAMC2	150292	Junctional epidermolysis bullosa (JEB) Herlitz type; JEB non-Herlitz type	Autosomal recessive
9	LAMC3	604349	Cortical malformations, occipital	Autosomal recessive
22	LARGE1	603590	Muscular dystrophy-dystroglycanopathy, type 6A and 6B	Autosomal recessive
4	LARP7	612026	Alazami syndrome	Autosomal recessive
5	LARS1	151350	?Infantile liver failure syndrome 1 (ILFS1)	Autosomal recessive
3	LARS2	604544	Perrault syndrome, type 4	Autosomal recessive
16	LAT	602354	Immunodeficiency, type 52	Autosomal recessive
1	LBR	600024	Greenberg skeletal dysplasia	Autosomal recessive
6	LCA5	611408	Leber congenital amaurosis, type 5	Autosomal recessive
16	LCAT	606967	Familial LCAT deficiency; Fish-eye disease	Autosomal recessive
1	LCK	153390	?Immunodeficiency, type 22	Autosomal recessive
2	LCT	603202	Lactase deficiency, congenital	Autosomal recessive
11	LDHA	150000	Glycogen storage disease type 11	Autosomal recessive
19	LDLR	606945	Hypercholesterolemia, familial, type 1	Autosomal recessive; Autosomal dominant
1	LDLRAP1	605747	Hypercholesterolemia, familial, autosomal recessive	Autosomal recessive
6	LEMD2	616312	Cataract 46, juvenile-onset	Autosomal recessive
7	LEP	164160	Obesity, morbid, due to leptin deficiency	Autosomal recessive
1	LEPR	601007	Obesity, morbid, due to leptin receptor deficiency	Autosomal recessive
19	LGI4	608303	Arthrogryposis multiplex congenita, neurogenic, with myelin defect	Autosomal recessive
19	LHB	152780	Hypogonadotropic hypogonadism, type 23, with or without anosmia	Autosomal recessive
2	LHCGR	152790	Leydig cell hypoplasia	Autosomal recessive
6	LHFPL5	609427	Deafness, autosomal recessive, type 67	Autosomal recessive
9	LHX3	600577	Pituitary hormone deficiency, combined, type 3	Autosomal recessive
4	LIAS	607031	Hyperglycinemia, lactic acidosis, and seizures	Autosomal recessive
5	LIFR	151443	Stuve-Wiedemann syndrome / Schwartz-Jampel type 2 syndrome	Autosomal recessive
13	LIG4	601837	LIG4 syndrome	Autosomal recessive
19	LIM2	154045	Cataract 19, multiple types	Autosomal recessive
15	LINS1	610350	Mental retardation, autosomal recessive, type 27	Autosomal recessive
10	LIPA	613497	Lysosomal acid lipase deficiency	Autosomal recessive
19	LIPE	151750	Lipodystrophy, familial partial, type 6	Autosomal recessive
3	LIPH	607365	Hypotrichosis, type 7 or woolly hair, autosomal recessive, type 2, with or without hypotrichosis	Autosomal recessive
10	LIPN	613924	Ichthyosis, congenital, autosomal recessive 8	Autosomal recessive
2	LIPT1	610284	Lipoyltransferase 1 deficiency	Autosomal recessive
11	LIPT2	617659	Encephalopathy, neonatal severe, with lactic acidosis and brain abnormalities	Autosomal recessive
18	LMAN1	601567	Combined deficiency of factor V and factor VIII, type 1	Autosomal recessive
6	LMBRD1	612625	Methylmalonic aciduria and homocystinuria, cblF type	Autosomal recessive
16	LMF1	611761	Lipase deficiency, combined	Autosomal recessive
3	LMOD3	616112	Nemaline myopathy 10	Autosomal recessive
19	LONP1	605490	CODAS syndrome	Autosomal recessive
18	LOXHD1	613072	Deafness, autosomal recessive, type 77	Autosomal recessive
13	LPAR6	609239	Hypotrichosis, type 8 or woolly hair, autosomal recessive, type 1, with or without hypotrichosis	Autosomal recessive
2	LPIN1	605518	Myoglobinuria, acute recurrent, autosomal recessive	Autosomal recessive
18	LPIN2	605519	Majeed syndrome	Autosomal recessive
8	LPL	609708	Lipoprotein lipase deficiency	Autosomal recessive
4	LRAT	604863	Leber congenital amaurosis type 14	Autosomal recessive
4	LRBA	606453	Immunodeficiency, common variable, 8, with autoimmunity	Autosomal recessive
1	LRIG2	608869	Urofacial syndrome 2	Autosomal recessive
4	LRIT3	615004	Night blindness, congenital stationary (complete), 1F, autosomal recessive	Autosomal recessive
10	LRMDA	614537	Albinism, oculocutaneous, type 7	Autosomal recessive
2	LRP2	600073	Donnai-Barrow syndrome	Autosomal recessive
11	LRP4	604270	Cenani-Lenz syndactyly syndrome	Autosomal recessive
11	LRP5	603506	Osteoporosis-pseudoglioma syndrome	Autosomal recessive
4	LRPAP1	104225	Myopia, type 23, autosomal recessive	Autosomal recessive
2	LRPPRC	607544	Leigh syndrome, French-Canadian type	Autosomal recessive
9	LRSAM1	610933	Charcot-Marie-Tooth disease, axonal, type 2P	Autosomal recessive
11	LRTOMT	612414	Deafness, autosomal recessive, type 63	Autosomal recessive
21	LSS	600909	Alopecia-intellectual disability syndrome 4; Cataract 44; Hypotrichosis 14	Autosomal recessive
14	LTBP2	602091	Microspherophakia and/or megalocornea, with ectopia lentis and with or without secondary glaucoma	Autosomal recessive
11	LTBP3	602090	Dental anomalies and short stature	Autosomal recessive
19	LTBP4	604710	Cutis laxa, autosomal recessive, type 1C	Autosomal recessive
5	LYRM7	615831	Mitochondrial complex III deficiency, nuclear type 8	Autosomal recessive
1	LYST	606897	Chediak-Higashi syndrome	Autosomal recessive
3	LZTFL1	606568	Bardet-Biedl syndrome, type 17	Autosomal recessive
22	LZTR1	600574	Noonan syndrome, type 2	Autosomal recessive
19	MAG	159460	Spastic paraplegia, type 75, autosomal recessive	Autosomal recessive
7	MAGI2	606382	Nephrotic syndrome, type 15	Autosomal recessive
6	MAK	154235	Retinitis pigmentosa type 62	Autosomal recessive
18	MALT1	604860	Immunodeficiency, type 12	Autosomal recessive
9	MAN1B1	604346	Mental retardation, autosomal recessive, type 15	Autosomal recessive
19	MAN2B1	609458	Alpha-mannosidosis	Autosomal recessive
4	MANBA	609489	Mannosidosis, beta	Autosomal recessive
2	MAP3K20	609479	Centronuclear myopathy, type 6, with fiber-type disproportion	Autosomal recessive
15	MAPKBP1	616786	Nephronophthisis 20	Autosomal recessive
17	MAPT	157140	Supranuclear palsy, progressive atypical (parkinsonism syndrome)	Autosomal recessive
12	MARS1	156560	Interstitial lung and liver disease	Autosomal recessive
2	MARS2	609728	Spastic ataxia, type 3, autosomal recessive	Autosomal recessive
5	MARVELD2	610572	Deafness, autosomal recessive, type 49	Autosomal recessive
3	MASP1	600521	3MC syndrome 1	Autosomal recessive
10	MAT1A	610550	Methionine adenosyltransferase deficiency, autosomal recessive	Autosomal recessive
2	MATN3	602109	?Spondyloepimetaphyseal dysplasia	Autosomal recessive
19	MBOAT7	606048	Mental retardation, autosomal recessive 57	Autosomal recessive
18	MC2R	607397	Glucocorticoid deficiency, due to ACTH unresponsiveness	Autosomal recessive
3	MCCC1	609010	3-Methylcrotonyl-CoA carboxylase deficiency, type 1	Autosomal recessive
5	MCCC2	609014	3-Methylcrotonyl-CoA carboxylase deficiency, type 2	Autosomal recessive
2	MCEE	608419	Methylmalonyl-CoA epimerase deficiency	Autosomal recessive
2	MCFD2	607788	Combined deficiency of factor V and factor VIII, type 2	Autosomal recessive
5	MCIDAS	614086	Ciliary dyskinesia, primary, type 42	Autosomal recessive
21	MCM3AP	603294	Peripheral neuropathy, autosomal recessive, with or without impaired intellectual development	Autosomal recessive
8	MCM4	602638	Immunodeficiency, type 54	Autosomal recessive
6	MCM9	610098	Ovarian dysgenesis 4	Autosomal recessive
19	MCOLN1	605248	Mucolipidosis type 4	Autosomal recessive
8	MCPH1	607117	Microcephaly type 1, primary, autosomal recessive	Autosomal recessive
7	MDH2	154100	Epileptic encephalopathy, early infantile, 51	Autosomal recessive
X	MECP2	300005	Encephalopathy, neonatal severe; Rett syndrome	X-linked
1	MECR	608205	Dystonia, childhood-onset, with optic atrophy and basal ganglia abnormalities	Autosomal recessive
11	MED17	603810	Microcephaly, postnatal progressive, with seizures and brain atrophy	Autosomal recessive
6	MED23	605042	Mental retardation, autosomal recessive, type 18	Autosomal recessive
19	MED25	610197	Basel-Vanagait-Smirin-Yosef syndrome	Autosomal recessive
16	MEFV	608107	Familial Mediterranean fever	Autosomal recessive
5	MEGF10	612453	Myopathy, areflexia, respiratory distress, and dysphagia, early-onset	Autosomal recessive
19	MEGF8	604267	Carpenter syndrome, type 2	Autosomal recessive
17	MEOX1	600147	Klippel-Feil syndrome 2	Autosomal recessive
2	MERTK	604705	Retinitis pigmentosa type 38	Autosomal recessive
15	MESP2	605195	Spondylocostal dysostosis, type 2, autosomal recessive	Autosomal recessive
17	METTL23	615262	Mental retardation, autosomal recessive 44	Autosomal recessive
2	MFF	614785	Encephalopathy due to defective mitochondrial and peroxisomal fission, type 2	Autosomal recessive
1	MFN2	608507	Charcot-Marie-Tooth disease, axonal, type 2A2B	Autosomal recessive
11	MFRP	606227	Microphthalmia, isolated type 5	Autosomal recessive
1	MFSD2A	614397	Microcephaly 15, primary, autosomal recessive	Autosomal recessive
4	MFSD8	611124	Ceroid lipofuscinosis, neuronal, type 7	Autosomal recessive
14	MGAT2	602616	Congenital disorder of glycosylation, type 2a	Autosomal recessive
20	MGME1	615076	Mitochondrial DNA depletion syndrome 11	Autosomal recessive
12	MGP	154870	Keutel syndrome	Autosomal recessive
10	MICU1	605084	Myopathy with extrapyramidal signs	Autosomal recessive
X	MID1	300552	Opitz GBBB syndrome, type 1	X-linked
13	MIPEP	602241	Combined oxidative phosphorylation deficiency 31	Autosomal recessive
3	MITF	156845	COMMAD syndrome	Autosomal recessive
20	MKKS	604896	Bardet-Biedl syndrome type 6	Autosomal recessive
17	MKS1	609883	Bardet-Biedl syndrome type 13; Meckel syndrome, type 1; Joubert syndrome, type 28	Autosomal recessive
22	MLC1	605908	Megalencephalic leukoencephalopathy with subcortical cysts	Autosomal recessive
2	MLPH	606526	Griscelli syndrome, type 3	Autosomal recessive
16	MLYCD	606761	Malonyl-CoA decarboxylase deficiency	Autosomal recessive
4	MMAA	607481	Methylmalonic aciduria, vitamin B12-responsive	Autosomal recessive
12	MMAB	607568	Methylmalonic aciduria, vitamin B12-responsive, type cblB	Autosomal recessive
1	MMACHC	609831	Methylmalonic aciduria and homocystinuria, cblC type	Autosomal recessive; digenic inheritance (PRDX1 gene)
2	MMADHC	611935	Homocystinuria, cblD type, variant 1	Autosomal recessive
3	MME	120520	Charcot-Marie-Tooth disease, axonal, type 2T	Autosomal recessive*
11	MMP13	600108	Metaphyseal dysplasia, Spahr type	Autosomal recessive
16	MMP2	120360	Multicentric osteolysis, nodulosis, and arthropathy (MONA)	Autosomal recessive
11	MMP20	604629	Amelogenesis imperfecta, type 2A2 (hypomaturation type)	Autosomal recessive
10	MMP21	608416	Heterotaxy, visceral, 7, autosomal	Autosomal recessive
6	MMUT	609058	Methylmalonic aciduria, mut(0) type	Autosomal recessive
18	MOCOS	613274	Xanthinuria, type 2	Autosomal recessive
6	MOCS1	603707	Molybdenum cofactor deficiency A	Autosomal recessive
5	MOCS2	603708	Molybdenum cofactor deficiency B	Autosomal recessive
2	MOGS	601336	Congenital disorder of glycosylation, type 2B	Autosomal recessive
6	MPC1	614738	Mitochondrial pyruvate carrier deficiency	Autosomal recessive
17	MPDU1	604041	Congenital disorder of glycosylation, type 1F	Autosomal recessive
9	MPDZ	603785	Hydrocephalus, congenital, type 2, with or without brain or eye anomalies	Autosomal recessive
15	MPI	154550	Congenital disorder of glycosylation, type 1B	Autosomal recessive
6	MPIG6B	606520	Thrombocytopenia, anemia, and myelofibrosis	Autosomal recessive
1	MPL	159530	Thrombocytopenia, congenital amegakaryocytic	Autosomal recessive
7	MPLKIP	609188	Trichothiodystrophy, type 4, nonphotosensitive	Autosomal recessive
17	MPO	606989	Myeloperoxidase deficiency	Autosomal recessive
2	MPV17	137960	Mitochondrial DNA depletion syndrome type 6 (hepatocerebral); Charcot-Marie-Tooth disease, axonal, type 2EE	Autosomal recessive
1	MPZ	159440	Dejerine-Sottas disease	Autosomal recessive*
21	MRAP	609196	Glucocorticoid deficiency, type 2	Autosomal recessive
11	MRE11	600814	Ataxia-telangiectasia-like disorder 1	Autosomal recessive
10	MRPS16	609204	Combined oxidative phosphorylation deficiency 2	Autosomal recessive
3	MRPS22	605810	Combined oxidative phosphorylation deficiency type 5	Autosomal recessive
16	MRPS34	611994	Combined oxidative phosphorylation deficiency 32	Autosomal recessive
5	MSH3	600887	Familial adenomatous polyposis, type 4	Autosomal recessive
4	MSMO1	607545	Microcephaly, congenital cataract, and psoriasiform dermatitis	Autosomal recessive
12	MSRB3	613719	Deafness, autosomal recessive, type 74	Autosomal recessive
1	MSTO1	617619	Myopathy, mitochondrial, and ataxia	Autosomal recessive*
15	MTFMT	611766	Combined oxidative phosphorylation deficiency 15	Autosomal recessive
14	MTHFD1	172460	Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinemia	Autosomal recessive
1	MTHFR	607093	Homocystinuria due to MTHFR deficiency	Autosomal recessive
X	MTM1	300415	Myotubular myopathy, X-linked	X-linked
11	MTMR2	603557	Charcot-Marie-Tooth disease, type 4B1	Autosomal recessive
6	MTO1	614667	Combined oxidative phosphorylation deficiency 10	Autosomal recessive
1	MTR	156570	Homocystinuria-megaloblastic anemia, cblG complementation type	Autosomal recessive
12	MTRFR	613541	Combined oxidative phosphorylation deficiency 7; Spastic paraplegia, type 55, autosomal recessive	Autosomal recessive
5	MTRR	602568	Homocystinuria-megaloblastic anemia, cbl E type	Autosomal recessive
4	MTTP	157147	Abetalipoproteinemia	Autosomal recessive
9	MUSK	601296	Fetal akinesia deformation sequence, type 1; Myasthenic syndrome, congenital, type 9, associated with acetylcholine receptor deficiency	Autosomal recessive
1	MUTYH	604933	Adenomas, multiple colorectal	Autosomal recessive
12	MVK	251170	Mevalonic aciduria	Autosomal recessive
12	MYBPC1	160794	Lethal congenital contracture syndrome, type 4	Autosomal recessive
3	MYD88	602170	Immunodeficiency, type 68	Autosomal recessive
17	MYH2	160740	Proximal myopathy and ophthalmoplegia	Autosomal recessive
9	MYMK	615345	Carey-Fineman-Ziter syndrome	Autosomal recessive
17	MYO15A	602666	Deafness, autosomal recessive, type 3	Autosomal recessive
22	MYO18B	607295	Klippel-Feil syndrome, type 4, autosomal recessive, with myopathy and facial dysmorphism	Autosomal recessive
15	MYO1E	601479	Glomerulosclerosis, focal segmental, 6	Autosomal recessive
10	MYO3A	606808	Deafness, autosomal recessive, type 30	Autosomal recessive
15	MYO5A	160777	Griscelli syndrome, type 1	Autosomal recessive
18	MYO5B	606540	Microvillus inclusion disease	Autosomal recessive
6	MYO6	600970	Deafness, autosomal recessive, type 37	Autosomal recessive
11	MYO7A	276903	Usher syndrome, type 1B; Deafness, autosomal recessive, type 2	Autosomal recessive
10	MYPN	608517	Nemaline myopathy, type 11, autosomal recessive	Autosomal recessive
2	NADK2	615787	2,4-dienoyl-CoA reductase deficiency	Autosomal recessive
22	NAGA	104170	Schindler disease, type I; Schindler disease, type III; Kanzaki disease	Autosomal recessive
17	NAGLU	609701	Mucopolysaccharidosis, type 3B (Sanfilippo B)	Autosomal recessive
17	NAGS	608300	N-acetylglutamate synthase deficiency	Autosomal recessive
13	NALCN	611549	Hypotonia, infantile, with psychomotor retardation and characteristic facies 1	Autosomal recessive
9	NANS	605202	Spondyloepimetaphyseal dysplasia, Camera-Genevieve type	Autosomal recessive
11	NARS2	612803	Combined oxidative phosphorylation deficiency 24	Autosomal recessive
1	NAXE	608862	Encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy	Autosomal recessive
2	NBAS	608025	Infantile liver failure syndrome, type 2; Short stature, optic nerve atrophy, and Pelger-Huet anomaly	Autosomal recessive
3	NBEAL2	614169	Gray platelet syndrome	Autosomal recessive
8	NBN	602667	Nijmegen breakage syndrome	Autosomal recessive
11	NCAPD3	609276	Microcephaly 22, primary, autosomal recessive	Autosomal recessive
7	NCF1	608512	Chronic granulomatous disease, type 1	Autosomal recessive
1	NCF2	608515	Chronic granulomatous disease, type 2	Autosomal recessive
22	NCF4	601488	Chronic granulomatous disease, type 3	Autosomal recessive
16	NDE1	609449	Lissencephaly, type 4 (with microcephaly)	Autosomal recessive
X	NDP	300658	Norrie disease	X-linked
8	NDRG1	605262	Charcot-Marie-Tooth disease, type 4D	Autosomal recessive
5	NDST1	600853	Mental retardation, autosomal recessive, type 46	Autosomal recessive
2	NDUFA10	603835	Mitochondrial complex I deficiency, nuclear type 22	Autosomal recessive
19	NDUFA11	612638	Mitochondrial complex I deficiency, nuclear type 14	Autosomal recessive
12	NDUFA12	614530	?Mitochondrial complex I deficiency, nuclear type 23	Autosomal recessive
5	NDUFA2	602137	Mitochondrial complex I deficiency, nuclear type 13	Autosomal recessive
12	NDUFA9	603834	Mitochondrial complex I deficiency, nuclear type 26	Autosomal recessive
15	NDUFAF1	606934	Mitochondrial complex I deficiency, nuclear type 11	Autosomal recessive
5	NDUFAF2	609653	Mitochondrial complex I deficiency, nuclear type 10	Autosomal recessive
3	NDUFAF3	612911	Mitochondrial complex I deficiency, nuclear type 18	Autosomal recessive
20	NDUFAF5	612360	Mitochondrial complex I deficiency, nuclear type 16	Autosomal recessive
8	NDUFAF6	612392	Mitochondrial complex I deficiency, nuclear type 17	Autosomal recessive
2	NDUFB3	603839	Mitochondrial complex I deficiency, nuclear type 25	Autosomal recessive
8	NDUFB9	601445	Mitochondrial complex I deficiency, nuclear type 24	Autosomal recessive
2	NDUFS1	157655	Mitochondrial complex I deficiency, nuclear type 5	Autosomal recessive
1	NDUFS2	602985	Mitochondrial complex I deficiency, nuclear type 6	Autosomal recessive
11	NDUFS3	603846	Mitochondrial complex I deficiency, nuclear type 8	Autosomal recessive
5	NDUFS4	602694	Mitochondrial complex I deficiency, nuclear type 1	Autosomal recessive
5	NDUFS6	603848	Mitochondrial complex I deficiency, nuclear type 9	Autosomal recessive
19	NDUFS7	601825	Mitochondrial complex I deficiency, nuclear type 3	Autosomal recessive
11	NDUFS8	602141	Mitochondrial complex I deficiency, nuclear type 2	Autosomal recessive
11	NDUFV1	161015	Mitochondrial complex I deficiency, nuclear type 4	Autosomal recessive
18	NDUFV2	600532	Mitochondrial complex I deficiency, nuclear type 7	Autosomal recessive
2	NEB	161650	Nemaline myopathy type 2	Autosomal recessive
11	NECTIN1	600644	Cleft lip/palate-ectodermal dysplasia syndrome; Orofacial cleft 7	Autosomal recessive
1	NECTIN4	609607	Ectodermal dysplasia-syndactyly syndrome, type 1	Autosomal recessive
8	NEFL	162280	Charcot-Marie-Tooth disease, type 1F	Autosomal recessive
4	NEK1	604588	Short-rib thoracic dysplasia, type 6, with or without polydactyly	Autosomal recessive
17	NEK8	609799	Renal-hepatic-pancreatic dysplasia, type 2	Autosomal recessive
14	NEK9	609798	Lethal congenital contracture syndrome 10	Autosomal recessive
6	NEU1	608272	Sialidosis, type 1 and type 2	Autosomal recessive
10	NEUROG3	604882	Diarrhea 4, malabsorptive, congenital	Autosomal recessive
2	NFU1	608100	Multiple mitochondrial dysfunctions syndrome 1	Autosomal recessive
1	NGF	162030	Neuropathy, hereditary sensory and autonomic, type 5	Autosomal recessive
3	NGLY1	610661	Congenital disorder of deglycosylation	Autosomal recessive
2	NHEJ1	611290	Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation	Autosomal recessive
6	NHLRC1	608072	Epilepsy, progressive myoclonic, type 2B (Lafora)	Autosomal recessive
5	NHP2	606470	Dyskeratosis congenita, autosomal recessive type 2	Autosomal recessive
14	NIN	608684	Seckel syndrome, type 7	Autosomal recessive
5	NIPAL4	609383	Ichthyosis, congenital, autosomal recessive, type 6	Autosomal recessive
8	NKX2-6	611770	Conotruncal heart malformations	Autosomal recessive
4	NKX3-2	602183	Spondylo-megaepiphyseal-metaphyseal dysplasia	Autosomal recessive
10	NKX6-2	605955	Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy	Autosomal recessive
17	NLRP1	606636	Autoinflammation with arthritis and dyskeratosis	Autosomal recessive*
19	NLRP7	609661	Hydatidiform mole, recurrent, type 1	Autosomal recessive
7	NME8	607421	Ciliary dyskinesia, primary, type 6	Autosomal recessive
1	NMNAT1	608700	Leber congenital amaurosis 9; Spondyloepiphyseal dysplasia, sensorineural hearing loss, intellectual developmental disorder, and Leber congenital amaurosis	Autosomal recessive
5	NNT	607878	Glucocorticoid deficiency 4, with or without mineralocorticoid deficiency	Autosomal recessive
15	NOP10	606471	Dyskeratosis congenita, autosomal recessive type 1	Autosomal recessive
18	NPC1	607623	Niemann-Pick disease, type C1	Autosomal recessive
14	NPC2	601015	Niemann-pick disease, type C2	Autosomal recessive
2	NPHP1	607100	Joubert syndrome type 4	Autosomal recessive
3	NPHP3	608002	Meckel syndrome type 7	Autosomal recessive
1	NPHP4	607215	Nephronophthisis type 4	Autosomal recessive
19	NPHS1	602716	Nephrotic syndrome, type 1	Autosomal recessive
1	NPHS2	604766	Nephrotic syndrome, type 2	Autosomal recessive
9	NPR2	108961	Acromesomelic dysplasia, Maroteaux type	Autosomal recessive
X	NR0B1	300473	Adrenal hypoplasia, congenital	X-linked
12	NR1H4	603826	Cholestasis, progressive familial intrahepatic, type 5	Autosomal recessive
15	NR2E3	604485	Enhanced S-cone syndrome (Goldmann-Favre); Retinitis pigmentosa, type 37	Autosomal recessive; Autosomal recessive*
14	NRL	162080	Retinal degeneration, autosomal recessive, clumped pigment type	Autosomal recessive*
2	NRXN1	600565	Pitt-Hopkins-like syndrome, type 2	Autosomal recessive
8	NSMCE2	617246	Seckel syndrome, type 10	Autosomal recessive
5	NSUN2	610916	Mental retardation, autosomal recessive, type 5	Autosomal recessive
10	NT5C2	600417	Spastic paraplegia, type 45, autosomal recessive	Autosomal recessive
7	NT5C3A	606224	Anemia, hemolytic, due to UMPH1 deficiency	Autosomal recessive
6	NT5E	129190	Calcification of joints and arteries	Autosomal recessive
16	NTHL1	602656	Familial adenomatous polyposis, type 3	Autosomal recessive
1	NTRK1	191315	Insensitivity to pain, congenital, with anhidrosis	Autosomal recessive
14	NUBPL	613621	Mitochondrial complex I deficiency, nuclear type 21	Autosomal recessive
12	NUP107	607617	Nephrotic syndrome, type 11	Autosomal recessive
19	NUP62	605815	Striatonigral degeneration, infantile	Autosomal recessive
16	NUP93	614351	Nephrotic syndrome, type 12	Autosomal recessive
10	OAT	613349	Gyrate atrophy of choroid and retina	Autosomal recessive
2	OBSL1	610991	3M syndrome 2	Autosomal recessive
15	OCA2	611409	Oculocutaneous albinism type 2	Autosomal recessive
5	OCLN	602876	Pseudo-TORCH syndrome, type 1	Autosomal recessive
X	OCRL	300535	Lowe Syndrome; Dent disease type 2	X-linked
19	ODAD1	615038	Ciliary dyskinesia, primary, type 20	Autosomal recessive
10	ODAD2	615408	Ciliary dyskinesia, primary, type 23	Autosomal recessive
19	ODAD3	615956	Ciliary dyskinesia, primary, type 30	Autosomal recessive
3	OPA1	605290	Behr syndrome	Autosomal recessive
19	OPA3	606580	3-methylglutaconic aciduria, type 3	Autosomal recessive
X	OPHN1	300127	Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance	X-linked
10	OPTN	602432	Amyotrophic lateral sclerosis, type 12	Autosomal recessive
12	ORAI1	610277	Immunodeficiency, type 9	Autosomal recessive
1	ORC1	601902	Meier-Gorlin syndrome, type 1	Autosomal recessive
2	ORC4	603056	Meier-Gorlin syndrome, type 2	Autosomal recessive
16	ORC6	607213	Meier-Gorlin syndrome, type 3	Autosomal recessive
14	OSGEP	610107	Galloway-Mowat syndrome 3	Autosomal recessive
6	OSTM1	607649	Osteopetrosis, autosomal recessive type 5	Autosomal recessive
X	OTC	300461	Ornithine transcarbamylase deficiency	X-linked
16	OTOA	607038	Deafness, autosomal recessive, type 22	Autosomal recessive
2	OTOF	603681	Deafness, autosomal recessive, type 9	Autosomal recessive
11	OTOG	604487	Deafness, autosomal recessive, type 18B	Autosomal recessive
12	OTOGL	614925	Deafness, autosomal recessive, type 84B	Autosomal recessive
8	OTUD6B	612021	Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies	Autosomal recessive
5	OTULIN	615712	Autoinflammation, panniculitis, and dermatosis syndrome	Autosomal recessive
5	OXCT1	601424	Succinyl CoA:3-oxoacid CoA transferase deficiency	Autosomal recessive
3	P2RY12	600515	Bleeding disorder, platelet-type, type 8	Autosomal recessive
1	P3H1	610339	Osteogenesis imperfecta, type 8	Autosomal recessive
3	P3H2	610341	Myopia, high, with cataract and vitreoretinal degeneration	Autosomal recessive
1	PADI6	610363	Preimplantation embryonic lethality 2	Autosomal recessive
12	PAH	612349	Phenylketonuria	Autosomal recessive
X	PAK3	300142	Mental retardation, X-linked, type 30	X-linked
16	PALB2	610355	PALB2-related conditions	Autosomal recessive
16	PAM16	614336	Spondylometaphyseal dysplasia, Megarbane-Dagher-Melike type	Autosomal recessive
20	PANK2	606157	Neurodegeneration with brain iron accumulation type 1	Autosomal recessive
10	PAPSS2	603005	Brachyolmia, type 4, with mild epiphyseal and metaphyseal changes	Autosomal recessive
1	PARK7	602533	Parkinson disease, type 7, autosomal recessive, early-onset	Autosomal recessive
16	PARN	604212	Dyskeratosis congenita, autosomal recessive 6	Autosomal recessive
15	PATL2	614661	Oocyte maturation defect 4	Autosomal recessive
1	PAX7	167410	Rhabdomyosarcoma 2, alveolar	Autosomal recessive
11	PC	608786	Pyruvate carboxylase deficiency	Autosomal recessive
2	PCARE	613425	Retinitis pigmentosa, type 54	Autosomal recessive
10	PCBD1	126090	Hyperphenylalaninemia, BH4-deficient, type D	Autosomal recessive
13	PCCA	232000	Propionic acidemia	Autosomal recessive
3	PCCB	232050	Propionic acidemia	Autosomal recessive
5	PCDH12	605622	Microcephaly, seizures, spasticity, and brain calcification	Autosomal recessive
10	PCDH15	605514	Deafness, autosomal recessive, type 23; Usher syndrome, type 1D/F digenic	Autosomal recessive
14	PCK2	614095	PEPCK deficiency, mitochondrial	Autosomal recessive
21	PCNT	605925	Microcephalic osteodysplastic primordial dwarfism, type 2	Autosomal recessive
5	PCSK1	162150	Obesity with impaired prohormone processing	Autosomal recessive
3	PCYT1A	123695	Spondylometaphyseal dysplasia with cone-rod dystrophy	Autosomal recessive
6	PDE10A	610652	Dyskinesia, limb and orofacial, infantile-onset	Autosomal recessive
5	PDE6A	180071	Retinitis pigmentosa type 43	Autosomal recessive
4	PDE6B	180072	Retinitis pigmentosa type 40	Autosomal recessive
10	PDE6C	600827	Cone dystrophy type 4	Autosomal recessive
17	PDE6G	180073	Retinitis pigmentosa type 57	Autosomal recessive
12	PDE6H	601190	Retinal cone dystrophy 3 and achromatopsia 6	Autosomal recessive*
X	PDHA1	300502	Pyruvate dehydrogenase E1-alpha deficiency	X-linked
3	PDHB	179060	Pyruvate dehydrogenase E1-beta deficiency	Autosomal recessive
11	PDHX	608769	Lacticacidemia due to PDX1 deficiency	Autosomal recessive
8	PDP1	605993	Pyruvate dehydrogenase phosphatase deficiency	Autosomal recessive
10	PDSS1	607429	Coenzyme Q10 deficiency, primary, type 2	Autosomal recessive
6	PDSS2	610564	Coenzyme Q10 deficiency, primary, type 3	Autosomal recessive
13	PDX1	600733	Pancreatic agenesis type 1	Autosomal recessive
21	PDXK	179020	Neuropathy, hereditary motor and sensory, type VIC, with optic atrophy	Autosomal recessive
10	PDZD7	612971	Deafness, autosomal recessive, type 57; Usher syndrome, type 2C, digenic	Autosomal recessive; Digenic inheritance (ADGRV1 gene)
19	PEPD	613230	Prolidase deficiency	Autosomal recessive
19	PET100	614770	Mitochondrial complex IV deficiency, nuclear type 12	Autosomal recessive
7	PEX1	602136	Heimler syndrome 1; Peroxisome biogenesis disorder 1A (Zellweger); Peroxisome biogenesis disorder 1B (NALD/IRD)	Autosomal recessive
1	PEX10	602859	Peroxisome biogenesis disorder, type 6A (Zellweger syndrome); Peroxisome biogenesis disorder, type 6B	Autosomal recessive
1	PEX11B	603867	?Peroxisome biogenesis disorder 14B	Autosomal recessive
17	PEX12	601758	Peroxisome biogenesis disorder type 3A (Zellweger)	Autosomal recessive
2	PEX13	601789	Peroxisome biogenesis disorder, type 11A (Zellweger syndrome); Peroxisome biogenesis disorder, type 11B	Autosomal recessive
1	PEX14	601791	Peroxisome biogenesis disorder, type 13A (Zellweger syndrome)	Autosomal recessive
11	PEX16	603360	Peroxisome biogenesis disorder, type 8A (Zellweger syndrome); Peroxisome biogenesis disorder, type 8B	Autosomal recessive
1	PEX19	600279	Peroxisome biogenesis disorder, type 12A (Zellweger syndrome)	Autosomal recessive
8	PEX2	170993	Peroxisome biogenesis disorder type 5A (Zellweger)	Autosomal recessive
22	PEX26	608666	Peroxisome biogenesis disorder type 7A (Zellweger)	Autosomal recessive
6	PEX3	603164	Peroxisome biogenesis disorder, type 10A (Zellweger syndrome)	Autosomal recessive
12	PEX5	600414	Peroxisome biogenesis disorder type 2A (Zellweger)	Autosomal recessive
6	PEX6	601498	Peroxisome biogenesis disorder, type 4A (Zellweger syndrome); Peroxisome biogenesis disorder, type 4B; Heimler syndrome 2	Autosomal recessive; Autosomal recessive*; Autosomal recessive
6	PEX7	601757	Rhizomelic chondrodysplasia punctata, type 1	Autosomal recessive
12	PFKM	610681	Glycogen storage disease, type 7	Autosomal recessive
7	PGAM2	612931	Glycogen storage disease X	Autosomal recessive
2	PGAP1	611655	Mental retardation, autosomal recessive 42	Autosomal recessive
11	PGAP2	615187	Hyperphosphatasia with mental retardation syndrome 3	Autosomal recessive
17	PGAP3	611801	Hyperphosphatasia with mental retardation syndrome 4	Autosomal recessive
X	PGK1	311800	Phosphoglycerate kinase 1 deficiency	X-linked
1	PGM1	171900	Congenital disorder of glycosylation, type 1t	Autosomal recessive
6	PGM3	172100	Immunodeficiency, type 23	Autosomal recessive
X	PHF8	300560	Mental retardation syndrome, X-linked, Siderius type	X-linked
1	PHGDH	606879	Neu-Laxova syndrome, type 1; Phosphoglycerate dehydrogenase deficiency	Autosomal recessive
16	PHKB	172490	Glycogen storage disease, type 9B	Autosomal recessive
16	PHKG2	172471	Glycogen storage disease type 9c	Autosomal recessive
11	PHOX2A	602753	Fibrosis of extraocular muscles, congenital, 2	Autosomal recessive
10	PHYH	602026	Refsum disease	Autosomal recessive
22	PI4KA	600286	Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis	Autosomal recessive
13	PIBF1	607532	Joubert syndrome 33	Autosomal recessive
16	PIEZO1	611184	Lymphedema, hereditary, type 3	Autosomal recessive
18	PIEZO2	613629	Arthrogryposis, distal, with impaired proprioception and touch	Autosomal recessive
1	PIGC	601730	Glycosylphosphatidylinositol biosynthesis defect 16	Autosomal recessive
4	PIGG	616918	Mental retardation, autosomal recessive 53	Autosomal recessive
17	PIGL	605947	Zunich neuroectodermal syndrome	Autosomal recessive
1	PIGM	610273	Glycosylphosphatidylinositol deficiency	Autosomal recessive
18	PIGN	606097	Multiple congenital anomalies-hypotonia-seizures syndrome, type 1	Autosomal recessive
9	PIGO	614730	Hyperphosphatasia with mental retardation syndrome 2	Autosomal recessive
20	PIGT	610272	Multiple congenital anomalies-hypotonia-seizures syndrome 3	Autosomal recessive
1	PIGV	610274	Hyperphosphatasia with mental retardation syndrome 1	Autosomal recessive
17	PIGW	610275	Glycosylphosphatidylinositol biosynthesis defect 11	Autosomal recessive
4	PIGY	610662	Hyperphosphatasia with mental retardation syndrome 6	Autosomal recessive
1	PINK1	608309	Parkinson disease, type 6, early onset	Autosomal recessive
19	PIP5K1C	606102	Lethal congenital contractural syndrome, type 3	Autosomal recessive
2	PJVK	610219	Deafness, autosomal recessive, type 59	Autosomal recessive
7	PKD1L1	609721	Heterotaxy, visceral, 8, autosomal	Autosomal recessive
6	PKHD1	606702	Polycystic kidney disease type 4	Autosomal recessive
1	PKLR	609712	Pyruvate kinase deficiency	Autosomal recessive
1	PKP1	601975	Ectodermal dysplasia/skin fragility syndrome	Autosomal recessive
22	PLA2G6	603604	Infantile neuroaxonal dystrophy type 1	Autosomal recessive
9	PLAA	603873	Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies	Autosomal recessive
20	PLCB1	607120	Epileptic encephalopathy, early infantile, type 12	Autosomal recessive
20	PLCB4	600810	Auriculocondylar syndrome, type 2	Autosomal recessive*
3	PLCD1	602142	Nail disorder, nonsyndromic congenital, type 3 (leukonychia)	Autosomal recessive
10	PLCE1	608414	Nephrotic syndrome, type 3	Autosomal recessive
3	PLD1	602382	Cardiac valvular defect, developmental	Autosomal recessive
8	PLEC	601282	Epidermolysis bullosa simplex with muscular dystrophy	Autosomal recessive
1	PLEKHG5	611101	Charcot-Marie-Tooth disease, recessive intermediate, type C	Autosomal recessive
6	PLG	173350	Plasminogen deficiency, type I	Autosomal recessive
4	PLK4	605031	Microcephaly and chorioretinopathy, autosomal recessive, 2	Autosomal recessive
1	PLOD1	153454	Ehlers-Danlos syndrome, kyphoscoliotic type, 1	Autosomal recessive
3	PLOD2	601865	Bruck syndrome 2	Autosomal recessive
7	PLOD3	603066	Lysyl hydroxylase 3 deficiency	Autosomal recessive
X	PLP1	300401	Pelizaeus-Merzbacher disease	X-linked
8	PLPBP	604436	Epilepsy, early-onset, vitamin B6-dependent	Autosomal recessive
16	PMM2	601785	Congenital disorder of glycosylation, type 1A	Autosomal recessive
17	PMP22	601097	Dejerine-Sottas disease	Autosomal recessive*
9	PMPCA	613036	Spinocerebellar ataxia, autosomal recessive, type 2	Autosomal recessive
7	PMPCB	603131	Multiple mitochondrial dysfunctions syndrome 6	Autosomal recessive
19	PNKP	605610	Microcephaly, seizures, and developmental delay; Ataxia-oculomotor apraxia 4; ?Charcot-Marie-Tooth disease, type 2B2	Autosomal recessive
14	PNP	164050	Immunodeficiency due to purine nucleoside phosphorylase deficiency	Autosomal recessive
6	PNPLA1	612121	Ichthyosis, congenital, autosomal recessive, type 10	Autosomal recessive
11	PNPLA2	609059	Neutral lipid storage disease with myopathy	Autosomal recessive
19	PNPLA6	603197	Boucher-Neuhauser syndrome; Oliver-McFarlane syndrome; Spastic paraplegia, type 39, autosomal recessive	Autosomal recessive
17	PNPO	603287	Pyridoxamine 5'-phosphate oxidase deficiency	Autosomal recessive
2	PNPT1	610316	Combined oxidative phosphorylation deficiency 13	Autosomal recessive
3	POC1A	614783	Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis	Autosomal recessive
12	POC1B	614784	Cone-rod dystrophy 20	Autosomal recessive
12	POLE	174762	FILS syndrome	Autosomal recessive
15	POLG	174763	POLG-related disorders	Autosomal recessive
6	POLH	603968	Xeroderma pigmentosum, variant type	Autosomal recessive
6	POLR1C	610060	Leukodystrophy, hypomyelinating, type 11; Treacher Collins syndrome 3	Autosomal recessive
13	POLR1D	613715	Treacher Collins syndrome, type 2	Autosomal recessive*
10	POLR3A	614258	Leukodystrophy, hypomyelinating, type 7	Autosomal recessive
12	POLR3B	614366	Leukodystrophy, hypomyelinating, type 8	Autosomal recessive
2	POMC	176830	Obesity, adrenal insufficiency, and red hair due to POMC deficiency	Autosomal recessive
1	POMGNT1	606822	Muscular dystrophy-dystroglycanopathy, type 3A (Walker-Warburg syndrome); Type 3B; Type 3C (limb-girdle muscular dystrophy, type 15 [LGMDR15])	Autosomal recessive
3	POMGNT2	614828	Muscular dystrophy-dystroglycanopathy, type 8A (Walker-Warburg syndrome); Type 8C (limb-girdle muscular dystrophy, type 24 [LGMD R24])	Autosomal recessive
8	POMK	615247	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 12	Autosomal recessive
13	POMP	613386	Keratosis linearis with ichthyosis congenita and sclerosing keratoderma	Autosomal recessive
9	POMT1	607423	Muscular dystrophy-dystroglycanopathy, type 1A (Walker-Warburg syndrome); Type 1B; Type 1C (limb-girdle muscular dystrophy, type 11 [LGMD R11])	Autosomal recessive
14	POMT2	607439	Muscular dystrophy-dystroglycanopathy, type 2A (Walker-Warburg syndrome); Type 2B; Type 2C (limb-girdle muscular dystrophy, type 14 [LGMD R14])	Autosomal recessive
8	POP1	602486	Anauxetic dysplasia, type 2	Autosomal recessive
7	POR	124015	Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis	Autosomal recessive
3	POU1F1	173110	Pituitary hormone deficiency, combined, type 1	Autosomal recessive*
X	POU3F4	300039	Deafness, X-linked, type 2	X-linked
4	PPA2	609988	Sudden cardiac failure, infantile	Autosomal recessive
15	PPIB	123841	Osteogenesis imperfecta, type 9	Autosomal recessive
4	PPM1K	611065	?Maple syrup urine disease, mild variant	Autosomal recessive
1	PPP1R15B	613257	Microcephaly, short stature, and impaired glucose metabolism 2	Autosomal recessive
1	PPT1	600722	Ceroid lipofuscinosis, neuronal, type 1	Autosomal recessive
X	PQBP1	300463	Renpenning syndrome	X-linked
17	PRCD	610598	Retinitis pigmentosa, type 36	Autosomal recessive
9	PRDM12	616458	Neuropathy, hereditary sensory and autonomic, type VIII	Autosomal recessive
4	PRDM5	614161	Brittle cornea syndrome, type 2	Autosomal recessive
1	PRDX1	176763	Methylmalonic aciduria and homocystinuria, cblC type, digenic	Autosomal recessive; Digenic inheritance (MMACHC gene)
2	PREPL	609557	Myasthenic syndrome, congenital, type 22	Autosomal recessive
10	PRF1	170280	Hemophagocytic lymphohistiocytosis, familial, type 2	Autosomal recessive
1	PRG4	604283	Camptodactyly-arthropathy-coxa vara-pericarditis syndrome	Autosomal recessive
12	PRICKLE1	608500	Epilepsy, progressive myoclonic, type 1B	Autosomal recessive
3	PRKCD	176977	Autoimmune lymphoproliferative syndrome, type 3	Autosomal recessive
6	PRKN	602544	Parkinson disease, type 2, juvenile	Autosomal recessive
2	PRKRA	603424	Dystonia, type 16	Autosomal recessive
16	PRMT7	610087	Short stature, brachydactyly, intellectual developmental disability, and seizures	Autosomal recessive
2	PROC	612283	Thrombophilia due to protein C deficiency, autosomal recessive	Autosomal recessive
22	PRODH	606810	Hyperprolinemia, type 1	Autosomal recessive
4	PROM1	604365	Retinitis pigmentosa, type 41	Autosomal recessive
5	PROP1	601538	Pituitary hormone deficiency, combined, type 2	Autosomal recessive
3	PROS1	176880	Thrombophilia due to protein S deficiency, autosomal recessive	Autosomal recessive
6	PRPH2	179605	Leber congenital amaurosis 18; Retinitis punctata albescens	Autosomal recessive*
X	PRPS1	311850	PRPS1-related disoders	X-linked
1	PRRX1	167420	Agnathia-otocephaly complex	Autosomal recessive*
4	PRSS12	606709	Mental retardation, autosomal recessive, type 1	Autosomal recessive
2	PRSS56	613858	Microphthalmia, isolated, type 6	Autosomal recessive
1	PRUNE1	617413	Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies	Autosomal recessive
19	PRX	605725	Charcot-Marie-Tooth disease, type 4F	Autosomal recessive
10	PSAP	176801	Combined SAP deficiency	Autosomal recessive
9	PSAT1	610936	Neu-Laxova syndrome, type 2	Autosomal recessive
6	PSMB8	177046	Autoinflammation, lipodystrophy, and dermatosis syndrome	Autosomal recessive
17	PSMC3IP	608665	Ovarian dysgenesis 3	Autosomal recessive
7	PSPH	172480	Phosphoserine phosphatase deficiency	Autosomal recessive
10	PTF1A	607194	Pancreatic agenesis 2	Autosomal recessive
11	PTH	168450	Hypoparathyroidism, familial isolated, type 1	Autosomal recessive*
3	PTH1R	168468	Chondrodysplasia, Blomstrand type; Eiken syndrome	Autosomal recessive
3	PTPN23	606584	Neurodevelopmental disorder and structural brain anomalies with or without seizures and spasticity	Autosomal recessive
1	PTPRC	151460	Severe combined immunodeficiency, T cell-negative, B-cell/natural killer-cell positive	Autosomal recessive
12	PTPRO	600579	Nephrotic syndrome, type 6	Autosomal recessive
12	PTPRQ	603317	Deafness, autosomal recessive, type 84A	Autosomal recessive
17	PTRH2	608625	Infantile-onset multisystem neurologic, endocrine, and pancreatic disease	Autosomal recessive
11	PTS	612719	Hyperphenylalaninemia, BH4-deficient, type A	Autosomal recessive
12	PUS1	608109	Myopathy, lactic acidosis, and sideroblastic anemia, type 1	Autosomal recessive
2	PXDN	605158	Anterior segment dysgenesis, type 7, with sclerocornea	Autosomal recessive
17	PYCR1	179035	Cutis laxa, autosomal recessive, type 2B	Autosomal recessive
1	PYCR2	616406	Leukodystrophy, hypomyelinating, type 10	Autosomal recessive
14	PYGL	613741	Glycogen storage disease, type 6	Autosomal recessive
11	PYGM	608455	McArdle disease	Autosomal recessive
12	PYROXD1	617220	Myopathy, myofibrillar, type 8	Autosomal recessive
3	QARS1	603727	Microcephaly, progressive, seizures, and cerebral and cerebellar atrophy	Autosomal recessive
4	QDPR	612676	Hyperphenylalaninemia, BH4-deficient, type C	Autosomal recessive
10	RAB18	602207	Warburg micro syndrome, type 3	Autosomal recessive
6	RAB23	606144	Carpenter syndrome	Autosomal recessive
15	RAB27A	603868	Griscelli syndrome, type 2	Autosomal recessive
4	RAB28	612994	Cone-rod dystrophy 18	Autosomal recessive
4	RAB33B	605950	Smith-McCort dysplasia 2	Autosomal recessive
2	RAB3GAP1	602536	Warburg micro syndrome, type 1	Autosomal recessive
1	RAB3GAP2	609275	Martsolf syndrome 1; Warburg micro syndrome 2	Autosomal recessive
5	RAD50	604040	Nijmegen breakage syndrome-like disorder	Autosomal recessive
17	RAD51C	602774	RAD51C-related conditions	Autosomal recessive
11	RAG1	179615	Omenn syndrome; Severe combined immunodeficiency, B cell-negative	Autosomal recessive
11	RAG2	179616	Omenn syndrome; Severe combined immunodeficiency, B cell-negative	Autosomal recessive
11	RAPSN	601592	Fetal akinesia deformation sequence, type 2; Myasthenic syndrome, congenital, type 11, associated with AChR deficiency	Autosomal recessive
3	RARB	180220	Microphthalmia, syndromic 12	Autosomal recessive
5	RARS1	107820	Leukodystrophy, hypomyelinating, type 9	Autosomal recessive
6	RARS2	611524	Pontocerebellar hypoplasia, type 6	Autosomal recessive
15	RASGRP1	603962	Immunodeficiency, type 64	Autosomal recessive
18	RAX	601881	Isolated microphthalmia, type 3	Autosomal recessive
18	RBBP8	604124	Jawad syndrome; Seckel syndrome, type 2	Autosomal recessive
20	RBCK1	610924	Polyglucosan body myopathy 1 with or without immunodeficiency	Autosomal recessive
1	RBM8A	605313	Thrombocytopenia-absent radius syndrome	Autosomal recessive
10	RBP3	180290	?Retinitis pigmentosa 66	Autosomal recessive
10	RBP4	180250	Retinal dystrophy, iris coloboma, and comedogenic acne syndrome	Autosomal recessive
13	RCBTB1	607867	Retinal dystrophy with or without extraocular anomalies	Autosomal recessive
1	RD3	180040	Leber congenital amaurosis, type 12	Autosomal recessive
14	RDH12	608830	Leber congenital amaurosis, type 13	Autosomal recessive
12	RDH5	601617	Fundus albipunctatus	Autosomal recessive*
11	RDX	179410	Deafness, autosomal recessive, type 24	Autosomal recessive
8	RECQL4	603780	Baller-Gerold syndrome; RAPADILINO syndrome; Rothmund-Thomson syndrome	Autosomal recessive
19	REEP6	609346	Retinitis pigmentosa 77	Autosomal recessive
7	RELN	600514	Lissencephaly 2 (Norman-Roberts type)	Autosomal recessive
1	REN	179820	Renal tubular dysgenesis	Autosomal recessive
5	RETREG1	613114	Neuropathy, hereditary sensory and autonomic, type 2B	Autosomal recessive
3	RFT1	611908	Congenital disorder of glycosylation, type In	Autosomal recessive
1	RFX5	601863	Bare lymphocyte syndrome, type 2	Autosomal recessive
6	RFX6	612659	Mitchell-Riley syndrome	Autosomal recessive
19	RFXANK	603200	Bare lymphocyte syndrome, type 2, complementation group B	Autosomal recessive
13	RFXAP	601861	Bare lymphocyte syndrome, type 2	Autosomal recessive
3	RHO	180380	Retinitis pigmentosa, type 4; Retinitis punctata albescens	Autosomal recessive*
20	RIN2	610222	Macs syndrome	Autosomal recessive
21	RIPK4	605706	Popliteal pterygium syndrome, Bartsocas-Papas type	Autosomal recessive
6	RIPOR2	611410	Deafness, autosomal recessive, type 104	Autosomal recessive
15	RLBP1	180090	Bothnia retinal dystrophy; Fundus albipunctatus	Autosomal recessive; Autosomal recessive*
6	RMND1	614917	Combined oxidative phosphorylation deficiency 11	Autosomal recessive
9	RMRP	157660	Anauxetic dysplasia, type 1	Autosomal recessive
2	RNASEH1	604123	Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 2	Autosomal recessive
19	RNASEH2A	606034	Aicardi-Goutieres syndrome, type 4	Autosomal recessive
13	RNASEH2B	610326	Aicardi-Goutieres syndrome, type 2	Autosomal recessive
11	RNASEH2C	610330	Aicardi-Goutieres syndrome, type 3	Autosomal recessive
6	RNASET2	612944	Leukoencephalopathy, cystic, without megalencephaly	Autosomal recessive
3	RNF168	612688	RIDDLE syndrome	Autosomal recessive
7	RNF216	609948	Gordon Holmes syndrome	Autosomal recessive
11	ROBO3	608630	Gaze palsy, familial horizontal, with progressive scoliosis, type 1	Autosomal recessive
16	ROGDI	614574	Kohlschutter-Tonz syndrome	Autosomal recessive
11	ROM1	180721	Retinitis pigmentosa, type 7, digenic	Autosomal recessive
9	ROR2	602337	Robinow syndrome, autosomal recessive	Autosomal recessive
1	RORC	602943	Immunodeficiency, type 42	Autosomal recessive
8	RP1	603937	Retinitis pigmentosa, type 1	Autosomal recessive
X	RP2	300757	Retinitis pigmentosa, type 2, X-linked	X-linked
1	RPE65	180069	RPE65-related Leber congenital amaurosis/early-onset severe retinal dystrophy	Autosomal recessive
X	RPGR	312610	Retinitis pigmentosa, type 3, X-linked; Cone-rod dystrophy, X-linked, 1	X-linked
14	RPGRIP1	605446	Leber congenital amaurosis, type 6	Autosomal recessive
16	RPGRIP1L	610937	Joubert syndrome, type 7; Meckel syndrome, type 5; COACH syndrome	Autosomal recessive
8	RRM2B	604712	Mitochondrial DNA depletion syndrome, type 8A (encephalomyopathic type with renal tubulopathy) and type 8B (MNGIE type)	Autosomal recessive
X	RS1	300839	Retinoschisis	X-linked
21	RSPH1	609314	Ciliary dyskinesia, primary, type 24	Autosomal recessive
6	RSPH3	615876	Ciliary dyskinesia, primary, type 32	Autosomal recessive
6	RSPH4A	612647	Ciliary dyskinesia, primary, type 11	Autosomal recessive
6	RSPH9	612648	Ciliary dyskinesia, primary, type 12	Autosomal recessive
20	RSPO4	610573	Anonychia congenita	Autosomal recessive
16	RSPRY1	616585	Spondyloepimetaphyseal dysplasia, Faden-Alkuraya type	Autosomal recessive
20	RTEL1	608833	Dyskeratosis congenita, autosomal recessive type 5	Autosomal recessive*
6	RTN4IP1	610502	Optic atrophy 10 with or without ataxia, mental retardation, and seizures	Autosomal recessive
18	RTTN	610436	Microcephaly, short stature, and polymicrogyria with seizures	Autosomal recessive
9	RUSC2	611053	Mental retardation, autosomal recessive 61	Autosomal recessive
12	RXYLT1	605862	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10	Autosomal recessive
19	RYR1	180901	Malignant hyperthermia susceptibility, type 1	Autosomal dominant
19	S1PR2	605111	Deafness, autosomal recessive, type 68	Autosomal recessive
13	SACS	604490	Spastic ataxia, Charlevoix-Saguenay, type	Autosomal recessive
2	SAG	181031	Oguchi disease, type 1	Autosomal recessive
7	SAMD9	610456	Tumoral calcinosis, familial, normophosphatemic	Autosomal recessive
20	SAMHD1	606754	Aicardi-Goutieres syndrome, type 5	Autosomal recessive
5	SAR1B	607690	Chylomicron retention disease	Autosomal recessive
19	SARS2	612804	Hyperuricemia, pulmonary hypertension, renal failure, and alkalosis	Autosomal recessive
7	SBDS	607444	Shwachman-Diamond syndrome	Autosomal recessive
22	SBF1	603560	Charcot-Marie-Tooth disease, type 4B3	Autosomal recessive
11	SBF2	607697	Charcot-Marie-Tooth disease, type 4B2	Autosomal recessive
11	SC5D	602286	Lathosterolosis	Autosomal recessive
4	SCARB2	602257	Epilepsy, progressive myoclonic, type 4, with or without renal failure	Autosomal recessive
22	SCARF2	613619	Van den Ende-Gupta syndrome	Autosomal recessive
19	SCN1B	600235	Epileptic encephalopathy, early infantile, type 52	Autosomal recessive
17	SCN4A	603967	Myasthenic syndrome, congenital, type 16	Autosomal recessive
2	SCN9A	603415	Indifference to pain and autosomal recessive hereditary sensory neuropathy type 2D	Autosomal recessive
12	SCNN1A	600228	Pseudohypoaldosteronism, type 1	Autosomal recessive
16	SCNN1B	600760	Pseudohypoaldosteronism, type 1	Autosomal recessive
16	SCNN1G	600761	Pseudohypoaldosteronism, type 1	Autosomal recessive
17	SCO1	603644	Mitochondrial complex IV deficiency, nuclear type 4	Autosomal recessive
22	SCO2	604272	Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, type 1	Autosomal recessive
11	SCYL1	607982	Spinocerebellar ataxia, autosomal recessive, type 21	Autosomal recessive
1	SDCCAG8	613524	Bardet-Biedl syndrome, type 16	Autosomal recessive
5	SDHA	600857	Mitochondrial respiratory chain complex II deficiency; Leigh syndrome	Autosomal recessive
19	SDHAF1	612848	Mitochondrial complex II deficiency	Autosomal recessive
12	SDR9C7	609769	Ichthyosis, congenital, autosomal recessive 13	Autosomal recessive
14	SEC23A	610511	Craniolenticulosutural dysplasia	Autosomal recessive
20	SEC23B	610512	Dyserythropoietic anemia, congenital, type 2	Autosomal recessive
4	SEC24D	607186	Cole-Carpenter syndrome 2	Autosomal recessive
9	SECISBP2	607693	Thyroid hormone metabolism, abnormal	Autosomal recessive
1	SELENON	606210	Muscular dystrophy, rigid spine, type 1	Autosomal recessive
1	SEMA4A	607292	Cone-rod dystrophy, type 10; Retinitis pigmentosa, type 35	Autosomal recessive
4	SEPSECS	613009	Pontocerebellar hypoplasia, type 2D	Autosomal recessive
6	SERAC1	614725	3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL)	Autosomal recessive
14	SERPINA1	107400	Alpha-1 antitrypsin deficiency	Autosomal recessive
18	SERPINB7	603357	Palmoplantar keratoderma, Nagashima type	Autosomal recessive
18	SERPINB8	601697	Peeling skin syndrome 5	Autosomal recessive
1	SERPINC1	107300	Thrombophilia due to antithrombin III deficiency	Autosomal recessive*
7	SERPINE1	173360	Plasminogen activator inhibitor-1 deficiency	Autosomal recessive*
17	SERPINF1	172860	Osteogenesis imperfecta, type 6	Autosomal recessive
17	SERPINF2	613168	Alpha-2-plasmin inhibitor deficiency	Autosomal recessive
11	SERPING1	606860	Angioedema, hereditary, types 1 and 2	Autosomal recessive*
11	SERPINH1	600943	Osteogenesis imperfecta, type 10	Autosomal recessive
9	SETX	608465	Spinocerebellar ataxia, autosomal recessive, type 1	Autosomal recessive
7	SFRP4	606570	Pyle disease	Autosomal recessive
2	SFTPB	178640	Surfactant metabolism dysfunction, pulmonary, type 1	Autosomal recessive
10	SFXN4	615564	Combined oxidative phosphorylation deficiency 18	Autosomal recessive
17	SGCA	600119	Limb-girdle muscular dystrophy, type 3 (LGMD R3)	Autosomal recessive
4	SGCB	600900	Limb-girdle muscular dystrophy, type 4 (LGMD R4)	Autosomal recessive
5	SGCD	601411	Limb-girdle muscular dystrophy, type 6 (LGMD R6)	Autosomal recessive
13	SGCG	608896	Limb-girdle muscular dystrophy, type 5 (LGMD R5)	Autosomal recessive
10	SGPL1	603729	Nephrotic syndrome, type 14	Autosomal recessive
17	SGSH	605270	Mucopolysaccharidosis, type 3A (Sanfilippo A)	Autosomal recessive
X	SH2D1A	300490	Lymphoproliferative syndrome, X-linked, type 1	X-linked
5	SH3PXD2B	613293	Frank-ter Haar syndrome	Autosomal recessive
5	SH3TC2	608206	Charcot-Marie-Tooth disease, type 4C	Autosomal recessive
3	SI	609845	Sucrase-isomaltase deficiency, congenital	Autosomal recessive
5	SIL1	608005	Marinesco-Sjogren syndrome	Autosomal recessive
14	SIX6	606326	Optic disc anomalies with retinal and/or macular dystrophy	Autosomal recessive
6	SKIC2	600478	Trichohepatoenteric syndrome, type 2 (diarrhea, syndromic)	Autosomal recessive
5	SKIC3	614589	Trichohepatoenteric syndrome, type 1 (diarrhea, syndromic)	Autosomal recessive
13	SLC10A2	601295	Bile acid malabsorption, primary	Autosomal recessive
12	SLC11A2	600523	Anemia, hypochromic microcytic, with iron overload 1	Autosomal recessive
15	SLC12A1	600839	Bartter syndrome, type 1	Autosomal recessive
16	SLC12A3	600968	Gitelman syndrome	Autosomal recessive
20	SLC12A5	606726	Epileptic encephalopathy, early infantile, 34	Autosomal recessive
15	SLC12A6	604878	Agenesis of the corpus callosum with peripheral neuropathy	Autosomal recessive
17	SLC13A5	608305	Epileptic encephalopathy, early infantile, 25	Autosomal recessive
1	SLC16A1	600682	Monocarboxylate transporter 1 deficiency	Autosomal recessive*
X	SLC16A2	300095	Allan-Herndon-Dudley syndrome	X-linked
6	SLC17A5	604322	Salla disease	Autosomal recessive
10	SLC18A3	600336	Myasthenic syndrome, congenital, 21, presynaptic	Autosomal recessive
1	SLC19A2	603941	Thiamine-responsive megaloblastic anemia syndrome	Autosomal recessive
2	SLC19A3	606152	Thiamine metabolism dysfunction syndrome, type 2 (biotin- or thiamine-responsive encephalopathy type)	Autosomal recessive
9	SLC1A1	133550	Dicarboxylic aminoaciduria	Autosomal recessive
2	SLC1A4	600229	Spastic tetraplegia, thin corpus callosum, and progressive microcephaly	Autosomal recessive
11	SLC22A12	607096	Hypouricemia, renal	Autosomal recessive
5	SLC22A5	603377	Carnitine deficiency, systemic primary	Autosomal recessive
15	SLC24A1	603617	Night blindness, congenital stationary (complete), type 1D, autosomal recessive	Autosomal recessive
14	SLC24A4	609840	Amelogenesis imperfecta, type IIA5	Autosomal recessive
15	SLC24A5	609802	Albinism, oculocutaneous, type 6	Autosomal recessive
22	SLC25A1	190315	Combined D-2- and L-2-hydroxyglutaric aciduria	Autosomal recessive
2	SLC25A12	603667	Epileptic encephalopathy, early infantile, type 39	Autosomal recessive
7	SLC25A13	603859	Citrullinemia, type 2, neonatal-onset; Citrullinemia, type 2, adult-onset	Autosomal recessive
13	SLC25A15	603861	Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome	Autosomal recessive
17	SLC25A19	606521	Microcephaly, Amish type; Thiamine metabolism dysfunction syndrome 4 (progressive polyneuropathy type)	Autosomal recessive
3	SLC25A20	613698	Carnitine-acylcarnitine translocase deficiency	Autosomal recessive
11	SLC25A22	609302	Epileptic encephalopathy, early infantile, type 3	Autosomal recessive
3	SLC25A26	611037	Combined oxidative phosphorylation deficiency 28	Autosomal recessive
12	SLC25A3	600370	Mitochondrial phosphate carrier deficiency	Autosomal recessive
3	SLC25A38	610819	Anemia, sideroblastic, type 2, pyridoxine-refractory	Autosomal recessive
4	SLC25A4	103220	Mitochondrial DNA depletion syndrome, type 12B (cardiomyopathic type) AR	Autosomal recessive
5	SLC25A46	610826	Neuropathy, hereditary motor and sensory, type VIB	Autosomal recessive
5	SLC26A2	606718	Achondrogenesis Ib; Atelosteogenesis, type II;De la Chapelle dysplasia; Diastrophic dysplasia;Diastrophic dysplasia, broad bone-platyspondylic variant;Epiphyseal dysplasia, multiple, 4	Autosomal recessive
7	SLC26A3	126650	Diarrhea 1, secretory chloride, congenital	Autosomal recessive
7	SLC26A4	605646	Deafness, autosomal recessive, type 4; Pendred syndrome	Autosomal recessive
7	SLC26A5	604943	?Deafness, autosomal recessive, type 61	Autosomal recessive
9	SLC27A4	604194	Ichthyosis prematurity syndrome	Autosomal recessive
10	SLC29A3	612373	Histiocytosis-lymphadenopathy plus syndrome	Autosomal recessive
1	SLC2A1	138140	GLUT1 deficiency syndrome 1, infantile onset, severe	Autosomal recessive*
20	SLC2A10	606145	Arterial tortuosity syndrome	Autosomal recessive
3	SLC2A2	138160	Fanconi-Bickel syndrome	Autosomal recessive
4	SLC2A9	606142	Hypouricemia, renal, type 2	Autosomal recessive*
1	SLC30A10	611146	Hypermanganesemia with dystonia, type 1	Autosomal recessive
3	SLC33A1	603690	Congenital cataracts, hearing loss, and neurodegeneration	Autosomal recessive
5	SLC34A1	182309	Hypercalcemia, infantile, type 2	Autosomal recessive
4	SLC34A2	604217	Pulmonary alveolar microlithiasis	Autosomal recessive
9	SLC34A3	609826	Hypophosphatemic rickets with hypercalciuria	Autosomal recessive
6	SLC35A1	605634	Congenital disorder of glycosylation, type 2F	Autosomal recessive
1	SLC35A3	605632	Arthrogryposis, impaired intellectual development, and seizures	Autosomal recessive
11	SLC35C1	605881	Congenital disorder of glycosylation, type 2C	Autosomal recessive
1	SLC35D1	610804	Schneckenbecken dysplasia	Autosomal recessive
11	SLC37A4	602671	Glycogen storage disease, type 1B	Autosomal recessive
16	SLC38A8	615585	Foveal hypoplasia 2, with or without optic nerve misrouting and/or anterior segment dysgenesis	Autosomal recessive
11	SLC39A13	608735	Ehlers-Danlos syndrome, spondylodysplastic type, 3	Autosomal recessive
8	SLC39A14	608736	Hypermanganesemia with dystonia 2	Autosomal recessive
8	SLC39A4	607059	Acrodermatitis enteropathica	Autosomal recessive
4	SLC39A8	608732	Congenital disorder of glycosylation, type IIn	Autosomal recessive
2	SLC3A1	104614	Cystinuria	Autosomal recessive*
1	SLC45A1	605763	Intellectual developmental disorder with neuropsychiatric features	Autosomal recessive
5	SLC45A2	606202	Albinism, oculocutaneous, type 4	Autosomal recessive
17	SLC46A1	611672	Folate malabsorption, hereditary	Autosomal recessive
17	SLC4A1	109270	Distal renal tubular acidosis	Autosomal recessive
20	SLC4A11	610206	Corneal endothelial dystrophy, autosomal recessive	Autosomal recessive
4	SLC4A4	603345	Renal tubular acidosis, proximal, with ocular abnormalities	Autosomal recessive
8	SLC52A2	607882	Brown-Vialetto-Van Laere syndrome, type 2	Autosomal recessive
20	SLC52A3	613350	Brown-Vialetto-Van Laere syndrome, type 1	Autosomal recessive
22	SLC5A1	182380	Glucose/galactose malabsorption	Autosomal recessive
16	SLC5A2	182381	Renal glucosuria	Autosomal recessive*
19	SLC5A5	601843	Thyroid dyshormonogenesis, type 1	Autosomal recessive
2	SLC5A7	608761	Myasthenic syndrome, congenital, type 20, presynaptic	Autosomal recessive
1	SLC6A17	610299	Mental retardation, autosomal recessive 48	Autosomal recessive
5	SLC6A19	608893	Hartnup disorder	Autosomal recessive
5	SLC6A3	126455	Parkinsonism-dystonia, infantile	Autosomal recessive
11	SLC6A5	604159	Hyperekplexia, type 3	Autosomal recessive*
X	SLC6A8	300036	Cerebral creatine deficiency syndrome, type 1	X-linked
1	SLC6A9	601019	Glycine encephalopathy with normal serum glycine	Autosomal recessive
3	SLC7A14	615720	Retinitis pigmentosa 68	Autosomal recessive
14	SLC7A7	603593	Lysinuric protein intolerance	Autosomal recessive
19	SLC7A9	604144	Cystinuria	Autosomal recessive*
5	SLC9A3	182307	Diarrhea 8, secretory sodium, congenital	Autosomal recessive
3	SLCO2A1	601460	Hypertrophic osteoarthropathy, primary, autosomal recessive, type 2	Autosomal recessive
13	SLITRK6	609681	Deafness and myopia	Autosomal recessive
8	SLURP1	606119	Meleda disease	Autosomal recessive
16	SLX4	613278	Fanconi anemia, complementation group P	Autosomal recessive
2	SMARCAL1	606622	Schimke immunoosseous dysplasia	Autosomal recessive
17	SMARCD2	601736	Specific granule deficiency 2	Autosomal recessive
19	SMG9	613176	Heart and brain malformation syndrome	Autosomal recessive
5	SMN1	600354	Spinal muscular atrophy	Autosomal recessive
14	SMOC1	608488	Microphthalmia. with limb anomalies	Autosomal recessive
6	SMOC2	607223	Dentin dysplasia, type 1, with microdontia and misshapen teeth	Autosomal recessive
11	SMPD1	607608	Niemann-Pick disease, type A; Niemann-Pick disease, type B	Autosomal recessive
22	SNAP29	604202	Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome	Autosomal recessive
7	SNX10	614780	Osteopetrosis, autosomal recessive, type 8	Autosomal recessive
6	SNX14	616105	Spinocerebellar ataxia, autosomal recessive, type 20	Autosomal recessive
6	SOBP	613667	Mental retardation, anterior maxillary protrusion, and strabismus	Autosomal recessive
21	SOD1	147450	Spastic tetraplegia and axial hypotonia, progressive; Amyotrophic lateral sclerosis, type 1	Autosomal recessive; Autosomal recessive*
9	SOHLH1	610224	Ovarian dysgenesis 5	Autosomal recessive
17	SOST	605740	Sclerosteosis, type 1; Van Buchem disease	Autosomal recessive
20	SOX18	601618	Hypotrichosis-lymphedema-telangiectasia syndrome	Autosomal recessive
2	SP110	604457	Hepatic venoocclusive disease with immunodeficiency	Autosomal recessive
12	SP7	606633	Osteogenesis imperfecta, type XII	Autosomal recessive
8	SPAG1	603395	Ciliary dyskinesia, primary, type 28	Autosomal recessive
5	SPARC	182120	Osteogenesis imperfecta, type XVII	Autosomal recessive
13	SPART	607111	Spactic paraplegia, type 20, autosomal recessive	Autosomal recessive
4	SPATA5	613940	Epilepsy, hearing loss, and mental retardation syndrome	Autosomal recessive
14	SPATA7	609868	Leber congenital amaurosis, type 3	Autosomal recessive
2	SPEG	615950	Centronuclear myopathy, type 5	Autosomal recessive
15	SPG11	610844	Amyotrophic lateral sclerosis 5, juvenile; Charcot-Marie-Tooth disease, axonal, type 2X; Spastic paraplegia 11	Autosomal recessive
15	SPG21	608181	Mast syndrome	Autosomal recessive
16	SPG7	602783	Spastic paraplegia, type 7, autosomal recessive	Autosomal recessive
5	SPINK1	167790	Tropical calcific pancreatitis	Autosomal recessive*
5	SPINK5	605010	Netherton syndrome	Autosomal recessive
19	SPINT2	605124	Diarrhea 3, secretory sodium, congenital, syndromic	Autosomal recessive
2	SPR	182125	Dystonia, dopa-responsive, due to sepiapterin reductase deficiency	Autosomal recessive*
1	SPRTN	616086	Ruijs-Aalfs syndrome	Autosomal recessive
1	SPTA1	182860	Pyropoikilocytosis; Spherocytosis, type 3	Autosomal recessive
11	SPTBN2	604985	Spinocerebellar ataxia, autosomal recessive, type 14	Autosomal recessive
19	SPTBN4	606214	Neurodevelopmental disorder with hypotonia, neuropathy, and deafness	Autosomal recessive
5	SQSTM1	601530	Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset	Autosomal recessive
2	SRD5A2	607306	46,XY disorder of sex development due to 5-alpha-reductase 2 deficiency (pseudovaginal perineoscrotal hypospadias)	Autosomal recessive
4	SRD5A3	611715	Congenital disorder of glycosylation, type 1Q; Kahrizi syndrome	Autosomal recessive
11	ST14	606797	Ichthyosis, congenital, autosomal recessive, type 11	Autosomal recessive
1	ST3GAL3	606494	Mental retardation, autosomal recessive 12	Autosomal recessive
2	ST3GAL5	604402	Salt and pepper developmental regression syndrome	Autosomal recessive
12	STAC3	615521	Native American myopathy	Autosomal recessive
7	STAG3	608489	Premature ovarian failure, type 8; Spermatogenic failure 61	Autosomal recessive
2	STAMBP	606247	Microcephaly-capillary malformation syndrome	Autosomal recessive
8	STAR	600617	Lipoid adrenal hyperplasia	Autosomal recessive
2	STAT1	600555	Immunodeficiency, type 31B, mycobacterial and viral infections	Autosomal recessive
12	STAT2	600556	Immunodeficiency, type 44	Autosomal recessive
17	STAT5B	604260	Laron syndrome with immunodeficiency	Autosomal recessive
1	STIL	181590	Microcephaly, type 7, primary, autosomal recessive	Autosomal recessive
11	STIM1	605921	Immunodeficiency, type 10	Autosomal recessive
20	STK4	604965	T-cell immunodeficiency, recurrent infections, autoimmunity, and cardiac malformations	Autosomal recessive
15	STRA6	610745	Microphthalmia, isolated, with coloboma, type 8	Autosomal recessive
17	STRADA	608626	Polyhydramnios, megalencephaly, and symptomatic epilepsy	Autosomal recessive
15	STRC	606440	Deafness, autosomal recessive, type 16	Autosomal recessive
16	STUB1	607207	Spinocerebellar ataxia, autosomal recessive, type 16	Autosomal recessive
6	STX11	605014	Hemophagocytic lymphohistiocytosis, familial, type 4	Autosomal recessive
19	STXBP2	601717	Hemophagocytic lymphohistiocytosis, familial, type 5	Autosomal recessive
13	SUCLA2	603921	Mitochondrial DNA depletion syndrome, type 5 (encephalomyopathic with or without methylmalonic aciduria)	Autosomal recessive
2	SUCLG1	611224	Mitochondrial DNA depletion syndrome, type 9 (encephalomyopathic, type with methylmalonic aciduria)	Autosomal recessive
10	SUFU	607035	Joubert syndrome, type 32	Autosomal recessive
7	SUGCT	609187	Glutaric aciduria, type 3	Autosomal recessive
19	SULT2B1	604125	Ichthyosis, congenital, autosomal recessive, type 14	Autosomal recessive
3	SUMF1	607939	Multiple sulfatase deficiency	Autosomal recessive
20	SUN5	613942	Spermatogenic failure, type 16	Autosomal recessive
12	SUOX	606887	Sulfite oxidase deficiency	Autosomal recessive
9	SURF1	185620	Mitochondrial complex IV deficiency, nuclear type 1; Charcot-Marie-Tooth disease, type 4K	Autosomal recessive
X	SYN1	313440	Epilepsy, X-linked, with variable learning disabilities and behavior disorders	X-linked
6	SYNE1	608441	Spinocerebellar ataxia, autosomal recessive, type 8	Autosomal recessive
19	SYNE4	615535	Deafness, autosomal recessive, type 76	Autosomal recessive
21	SYNJ1	604297	Epileptic encephalopathy, early infantile, 53	Autosomal recessive
1	SYT14	610949	?Spinocerebellar ataxia, autosomal recessive, type 11	Autosomal recessive
1	SZT2	615463	Epileptic encephalopathy, early infantile, 18	Autosomal recessive
12	TAC3	162330	Hypogonadotropic hypogonadism, type 10, with or without anosmia	Autosomal recessive
17	TACO1	612958	Mitochondrial complex IV deficiency, nuclear type 8	Autosomal recessive
4	TACR3	162332	Hypogonadotropic hypogonadism, type 11, with or without anosmia	Autosomal recessive
1	TACSTD2	137290	Corneal dystrophy, gelatinous drop-like	Autosomal recessive
1	TAF13	600774	Mental retardation, autosomal recessive 60	Autosomal recessive
8	TAF2	604912	Mental retardation, autosomal recessive 40	Autosomal recessive
7	TAF6	602955	Alazami-Yuan syndrome	Autosomal recessive
11	TALDO1	602063	Transaldolase deficiency	Autosomal recessive
22	TANGO2	616830	Metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration	Autosomal recessive
6	TAP1	170260	Bare lymphocyte syndrome, type 1	Autosomal recessive
6	TAP2	170261	Bare lymphocyte syndrome, type 1, due to TAP2 deficiency	Autosomal recessive
6	TAPBP	601962	Bare lymphocyte syndrome, type 1	Autosomal recessive
4	TAPT1	612758	Osteochondrodysplasia, complex lethal, Symoens-Barnes-Gistelinck type	Autosomal recessive
16	TAT	613018	Tyrosinemia, type 2	Autosomal recessive
20	TBC1D20	611663	Warburg micro syndrome 4	Autosomal recessive
3	TBC1D23	617687	Pontocerebellar hypoplasia, type 11	Autosomal recessive
16	TBC1D24	613577	DOORS (deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures) syndrome; Epileptic encephalopathy, early infantile, type 16; Deafness, autosomal recessive, type 86	Autosomal recessive
6	TBC1D7	612655	Macrocephaly/megalencephaly syndrome, autosomal recessive	Autosomal recessive
17	TBCD	604649	Encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum	Autosomal recessive
1	TBCE	604934	Encephalopathy, progressive, with amyotrophy and optic atrophy; Hypoparathyroidism-retardation-dysmorphism syndrome; Kenny-Caffey syndrome, type 1	Autosomal recessive
4	TBCK	616899	Hypotonia, infantile, with psychomotor retardation and characteristic facies 3	Autosomal recessive
1	TBX15	604127	Cousin syndrome	Autosomal recessive
1	TBX19	604614	Congenital isolated adrenocorticotropic hormone deficiency	Autosomal recessive
7	TBXAS1	274180	Ghosal syndrome	Autosomal recessive
17	TCAP	604488	Limb-girdle muscular dystrophy, type 7 (LGMD R7)	Autosomal recessive
11	TCIRG1	604592	Osteopetrosis, autosomal recessive, type 1	Autosomal recessive
22	TCN2	613441	Transcobalamin II deficiency	Autosomal recessive
12	TCTN1	609863	Joubert syndrome, type 13	Autosomal recessive
12	TCTN2	613846	Joubert syndrome, type 24; ?Meckel syndrome, type 8	Autosomal recessive
10	TCTN3	613847	Joubert syndrome 18; Orofaciodigital syndrome IV	Autosomal recessive
14	TDP1	607198	?Spinocerebellar ataxia, autosomal recessive with axonal neuropathy	Autosomal recessive
6	TDP2	605764	Spinocerebellar ataxia, autosomal recessive, type 23	Autosomal recessive
9	TDRD7	611258	Cataract 36	Autosomal recessive
14	TECPR2	615000	Spastic paraplegia, type 49, autosomal recessive	Autosomal recessive
19	TECR	610057	Mental retardation, autosomal recessive, type 14	Autosomal recessive
4	TECRL	617242	Ventricular tachycardia, catecholaminergic polymorphic, 3	Autosomal recessive
11	TECTA	602574	Deafness, autosomal recessive, type 21	Autosomal recessive
16	TELO2	611140	You-Hoover-Fong syndrome	Autosomal recessive
4	TENM3	610083	Microphthalmia, isolated, with coloboma 9	Autosomal recessive
5	TERT	187270	Dyskeratosis congenita, autosomal recessive, type 4	Autosomal recessive
8	TEX15	605795	Spermatogenic failure, type 25	Autosomal recessive
3	TF	190000	Atransferrinemia	Autosomal recessive
7	TFR2	604720	Hemochromatosis, type 3	Autosomal recessive
3	TFRC	190010	Immunodeficiency, type 46	Autosomal recessive
8	TG	188450	Thyroid dyshormonogenesis, type 3	Autosomal recessive
13	TGDS	616146	Catel-Manzke syndrome	Autosomal recessive
14	TGM1	190195	Ichthyosis, congenital, autosomal recessive, type 1	Autosomal recessive
15	TGM5	603805	Peeling skin syndrome, type 2	Autosomal recessive
11	TH	191290	Segawa syndrome, recessive	Autosomal recessive
X	THOC2	300395	Mental retardation, X-linked 12	X-linked
16	THOC6	615403	Beaulieu-Boycott-Innes syndrome	Autosomal recessive
3	THRB	190160	Thyroid hormone resistance, autosomal recessive	Autosomal recessive
19	TIMM50	607381	3-methylglutaconic aciduria, type 9	Autosomal recessive
3	TIMMDC1	615534	Mitochondrial complex I deficiency, nuclear type 31	Autosomal recessive
9	TJP2	607709	Cholestasis, progressive familial intrahepatic 4; Hypercholanemia, familial 1	Autosomal recessive
16	TK2	188250	Mitochondrial DNA depletion syndrome , type 2 (myopathic type)	Autosomal recessive
3	TKT	606781	Short stature, developmental delay, and congenital heart defects	Autosomal recessive
19	TLE6	612399	Preimplantation embryonic lethality	Autosomal recessive
9	TMC1	606706	Deafness, autosomal recessive, type 7	Autosomal recessive
17	TMC6	605828	Epidermodysplasia verruciformis	Autosomal recessive
17	TMC8	605829	Epidermodysplasia verruciformis	Autosomal recessive
1	TMCO1	614123	Craniofacial dysmorphism, skeletal anomalies, and mental retardation syndrome	Autosomal recessive
17	TMEM107	616183	Meckel syndrome, type 13; Orofaciodigital syndrome, type 16	Autosomal recessive
11	TMEM126A	612988	Optic atrophy 7	Autosomal recessive
11	TMEM126B	615533	Mitochondrial complex I deficiency, nuclear type 29	Autosomal recessive
11	TMEM138	614459	Joubert syndrome 16	Autosomal recessive
4	TMEM165	614726	Congenital disorder of glycosylation, type 2K	Autosomal recessive
17	TMEM199	616815	Congenital disorder of glycosylation, type 2P	Autosomal recessive
11	TMEM216	613277	Joubert syndrome, type 2; Meckel syndrome, type 2	Autosomal recessive
16	TMEM231	614949	Joubert syndrome, type 20; Meckel syndrome,type 11	Autosomal recessive
2	TMEM237	614423	Joubert syndrome, type 14	Autosomal recessive
14	TMEM260	617449	Structural heart defects and renal anomalies syndrome	Autosomal recessive
8	TMEM67	609884	Meckel syndrome 3; COACH syndrome 1; Joubert syndrome 6; Nephronophthisis 11	Autosomal recessive
8	TMEM70	612418	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 2	Autosomal recessive
3	TMIE	607237	Deafness, autosomal recessive, type 6	Autosomal recessive
21	TMPRSS15	606635	Enterokinase deficiency	Autosomal recessive
21	TMPRSS3	605511	Deafness, autosomal recessive, type 8/10	Autosomal recessive
22	TMPRSS6	609862	Iron-refractory iron deficiency anemia	Autosomal recessive
12	TMTC3	617218	Lissencephaly 8	Autosomal recessive
18	TNFRSF11A	603499	Osteopetrosis, autosomal recessive, type 7	Autosomal recessive
8	TNFRSF11B	602643	Paget disease of bone, type 5, juvenile-onset	Autosomal recessive
17	TNFRSF13B	604907	Immunodeficiency, common variable, type 2	Autosomal recessive
13	TNFSF11	602642	Osteopetrosis, autosomal recessive, type 2	Autosomal recessive
3	TNIK	610005	Mental retardation, autosomal recessive 54	Autosomal recessive
19	TNNT1	191041	Nemaline myopathy , type 5, Amish type	Autosomal recessive
6	TNXB	600985	Ehlers-Danlos syndrome, classic-like	Autosomal recessive
1	TOE1	613931	Pontocerebellar hypoplasia, type 7	Autosomal recessive
17	TOP3A	601243	Microcephaly, growth restriction, and increased sister chromatid exchange 2	Autosomal recessive
20	TP53RK	608679	Galloway-Mowat syndrome 4	Autosomal recessive
12	TPI1	190450	Hemolytic anemia due to triosephosphate isomerase deficiency	Autosomal recessive
7	TPK1	606370	Episodic encephalopathy due to thiamine pyrophosphokinase deficiency	Autosomal recessive
1	TPM3	191030	Nemaline myopathy, type 1; Congenital fiber-type disproportion myopathy	Autosomal recessive*
2	TPO	606765	Thyroid dyshormonogenesis, type 2A	Autosomal recessive
11	TPP1	607998	Ceroid lipofuscinosis, neuronal, type 2; Spinocerebellar ataxia, autosomal recessive, type 7	Autosomal recessive
9	TPRN	613354	Deafness, autosomal recessive, type 79	Autosomal recessive
2	TRAF3IP1	607380	Senior-Loken syndrome, type 9	Autosomal recessive
3	TRAIP	605958	Seckel syndrome, type 9	Autosomal recessive
4	TRAPPC11	614138	Limb-girdle muscular dystrophy, type 18 (LGMD R18)	Autosomal recessive
2	TRAPPC12	614139	Encephalopathy, progressive, early-onset, with brain atrophy and spasticity	Autosomal recessive
14	TRAPPC6B	610397	Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy	Autosomal recessive
8	TRAPPC9	611966	Mental retardation, autosomal recessive, type 13	Autosomal recessive
6	TRDN	603283	Ventricular tachycardia, catecholaminergic polymorphic, type 5, with or without muscle weakness	Autosomal recessive
6	TREM2	605086	Nasu-Hakola disease	Autosomal recessive
3	TREX1	606609	Aicardi-Goutieres syndrome, type 1	Autosomal recessive
8	TRHR	188545	Hypothyroidism, congenital, nongoitrous, type 7	Autosomal recessive
4	TRIM2	614141	Charcot-Marie-Tooth disease, type 2R	Autosomal recessive
9	TRIM32	602290	Limb-girdle muscular dystrophy, type 8 (LGMD R8)	Autosomal recessive
17	TRIM37	605073	Mulibrey nanism	Autosomal recessive
22	TRIOBP	609761	Deafness, autosomal recessive, type 28	Autosomal recessive
14	TRIP11	604505	Achondrogenesis, type 1A	Autosomal recessive
5	TRIP13	604507	Mosaic variegated aneuploidy syndrome 3	Autosomal recessive
15	TRIP4	604501	Spinal muscular atrophy with congenital bone fractures 1	Autosomal recessive
1	TRIT1	617840	Combined oxidative phosphorylation deficiency 35	Autosomal recessive
4	TRMT10A	616013	Microcephaly, short stature, and impaired glucose metabolism 1	Autosomal recessive
3	TRMT10C	615423	Combined oxidative phosphorylation deficiency 30	Autosomal recessive
14	TRMT5	611023	Combined oxidative phosphorylation deficiency 26	Autosomal recessive
22	TRMU	610230	Liver failure, transient infantile	Autosomal recessive
3	TRNT1	612907	Retinitis pigmentosa and erythrocytic microcytosis	Autosomal recessive
15	TRPM1	603576	Night blindness, congenital stationary (complete), type 1C, autosomal recessive	Autosomal recessive
9	TRPM6	607009	Familial hypomagnesemia with secondary hypocalcemia	Autosomal recessive
7	TRPV6	606680	Hyperparathyroidism, transient neonatal	Autosomal recessive
1	TSEN15	608756	Pontocerebellar hypoplasia, type 2F	Autosomal recessive
3	TSEN2	608753	Pontocerebellar hypoplasia, type 2B	Autosomal recessive
19	TSEN34	608754	Pontocerebellar hypoplasia type 2C	Autosomal recessive
17	TSEN54	608755	Pontocerebellar hypoplasia, type 2A; Pontocerebellar hypoplasia, type 4	Autosomal recessive
12	TSFM	604723	Combined oxidative phosphorylation deficiency, type 3	Autosomal recessive
1	TSHB	188540	Hypothyroidism, congenital, nongoitrous, type 4	Autosomal recessive
14	TSHR	603372	Hypothyroidism, congenital, nongoitrous, type 1	Autosomal recessive
17	TTC19	613814	Mitochondrial complex III deficiency, nuclear type 2	Autosomal recessive
2	TTC21B	612014	Short-rib thoracic dysplasia, type 4, with or without polydactyly	Autosomal recessive
2	TTC7A	609332	Gastrointestinal defects and immunodeficiency syndrome	Autosomal recessive
14	TTC8	608132	Bardet-Biedl syndrome, type 8	Autosomal recessive
8	TTI2	614426	Mental retardation, autosomal recessive, type 39	Autosomal recessive
14	TTLL5	612268	Cone-rod dystrophy 19	Autosomal recessive
2	TTN	188840	Limb-girdle muscular dystrophy type 10 (LGMDR10); Early-onset myopathy with fatal cardiomyopathy (Salih myopathy)	Autosomal recessive
8	TTPA	600415	Ataxia with isolated vitamin E deficiency	Autosomal recessive
22	TUBA8	605742	Cortical dysplasia, complex, with other brain malformations, type 8	Autosomal recessive
15	TUBGCP4	609610	Microcephaly and chorioretinopathy, autosomal recessive, type 3	Autosomal recessive
22	TUBGCP6	610053	Microcephaly and chorioretinopathy, autosomal recessive, type 1	Autosomal recessive
16	TUFM	602389	Combined oxidative phosphorylation deficiency 4	Autosomal recessive
6	TULP1	602280	Retinitis pigmentosa 14; Leber congenital amaurosis 15	Autosomal recessive
8	TUSC3	601385	Mental retardation, autosomal recessive, type 7	Autosomal recessive
2	TWIST2	607556	Focal facial dermal dysplasia, type 3 (Setleis type)	Autosomal recessive
10	TWNK	606075	Mitochondrial DNA depletion syndrome, type 7 (hepatocerebral type); Perrault syndrome type 5	Autosomal recessive
18	TXNL4A	611595	Burn-McKeown syndrome	Autosomal recessive
19	TYK2	176941	Immunodeficiency, type 35	Autosomal recessive
22	TYMP	131222	Mitochondrial DNA depletion syndrome, type 1 (MNGIE type)	Autosomal recessive
11	TYR	606933	Oculocutaneous albinism (OCA) type 1A; OCA type 1B	Autosomal recessive
19	TYROBP	604142	Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy, type 1 (Nasu-Hakola disease)	Autosomal recessive
9	TYRP1	115501	Albinism, oculocutaneous, type 3	Autosomal recessive
3	UBA5	610552	Epileptic encephalopathy, early infantile, 44	Autosomal recessive
1	UBE2T	610538	Fanconi anemia, complementation group T	Autosomal recessive
15	UBE3A	601623	Angelman syndrome	Autosomal dominant*
12	UBE3B	608047	Kaufman oculocerebrofacial syndrome	Autosomal recessive
15	UBR1	605981	Johanson-Blizzard syndrome	Autosomal recessive
4	UCHL1	191342	Spastic paraplegia, type 79, autosomal recessive	Autosomal recessive
13	UFM1	610553	Leukodystrophy, hypomyelinating, type 14	Autosomal recessive
2	UGT1A1	191740	Crigler-Najjar syndrome, type 1; Crigler-Najjar syndrome, type 2	Autosomal recessive
3	UMPS	613891	Orotic aciduria	Autosomal recessive
17	UNC13D	608897	Hemophagocytic lymphohistiocytosis, familial, type 3	Autosomal recessive
2	UNC80	612636	Hypotonia, infantile, with psychomotor retardation and characteristic facies, type 2	Autosomal recessive
12	UNG	191525	Immunodeficiency with hyper IgM, type 5	Autosomal recessive
22	UPB1	606673	Beta-ureidopropionase deficiency	Autosomal recessive
X	UPF3B	300298	Mental retardation, X-linked, syndromic, type 14	X-linked
8	UQCRB	191330	Mitochondrial complex III deficiency, nuclear, type 3	Autosomal recessive
16	UQCRC2	191329	Mitochondrial complex III deficiency, nuclear type 5	Autosomal recessive
5	UQCRQ	612080	Mitochondrial complex III deficiency, nuclear, type 4	Autosomal recessive
1	UROD	613521	Porphyria cutanea tarda	Autosomal recessive
10	UROS	606938	Porphyria, congenital erythropoietic	Autosomal recessive
16	USB1	613276	Poikiloderma with neutropenia	Autosomal recessive
11	USH1C	605242	Usher syndrome, type 1C; Deafness, autosomal recessive, type 18A	Autosomal recessive
17	USH1G	607696	Usher syndrome, type 1G	Autosomal recessive
1	USH2A	608400	Usher syndrome, type 2A; Retinitis pigmentosa 39	Autosomal recessive
22	USP18	607057	Pseudo-TORCH syndrome 2	Autosomal recessive
4	UVSSA	614632	UV-sensitive syndrome, type 3	Autosomal recessive
16	VAC14	604632	Striatonigral degeneration, childhood-onset	Autosomal recessive
6	VARS1	192150	Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy	Autosomal recessive
6	VARS2	612802	Combined oxidative phosphorylation deficiency 20	Autosomal recessive
12	VDR	601769	Rickets, vitamin D-resistant, type 2A	Autosomal recessive
14	VIPAS39	613401	Arthrogryposis, renal dysfunction and cholestasis, type 2	Autosomal recessive
16	VKORC1	608547	Vitamin K-dependent clotting factors, combined deficiency of, type 2	Autosomal recessive
9	VLDLR	192977	Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion, type 1	Autosomal recessive
9	VPS13A	605978	Choreoacanthocytosis	Autosomal recessive
8	VPS13B	607817	Cohen syndrome	Autosomal recessive
15	VPS13C	608879	Parkinson disease 23, autosomal recessive, early onset	Autosomal recessive
15	VPS33B	608552	Arthrogryposis, renal dysfunction and cholestasis, type 1	Autosomal recessive
8	VPS37A	609927	Spastic paraplegia, type 53, autosomal recessive	Autosomal recessive
1	VPS45	610035	Neutropenia, severe congenital, type 5	Autosomal recessive
17	VPS53	615850	Pontocerebellar hypoplasia, type 2E	Autosomal recessive
14	VRK1	602168	Pontocerebellar hypoplasia, type 1A	Autosomal recessive
14	VSX2	142993	Microphthalmia with coloboma 3; Isolated microphthalmia 2	Autosomal recessive
12	VWF	613160	von Willibrand disease, type 3	Autosomal recessive
1	WARS2	604733	Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures	Autosomal recessive
X	WAS	300392	Wiskott-Aldrich syndrome; Thrombocytopenia, X-linked	X-linked
12	WASHC4	615748	?Mental retardation, autosomal recessive, type 43	Autosomal recessive
8	WASHC5	610657	Ritscher-Schinzel syndrome, type 1	Autosomal recessive
4	WDR19	608151	Nephronophthisis, type 13; Senior-Loken syndrome, type 8	Autosomal recessive
2	WDR35	613602	Cranioectodermal dysplasia 2	Autosomal recessive
17	WDR45B	609226	Neurodevelopmental disorder with spastic quadriplegia and brain abnormalities with or without seizures	Autosomal recessive
19	WDR62	613583	Microcephaly, type 2, primary, autosomal recessive, with or without cortical malformations	Autosomal recessive
15	WDR72	613214	Amelogenesis imperfecta, type 2A3 (hypomaturation type)	Autosomal recessive
15	WDR73	616144	Galloway-Mowat syndrome 1	Autosomal recessive
17	WDR81	614218	Cerebellar ataxia, mental retardation, and dysequilibrium syndrome, type 2	Autosomal recessive
7	WEE2	614084	Oocyte maturation defect 5	Autosomal recessive
4	WFS1	606201	Wolfram syndrome, type 1	Autosomal recessive
9	WHRN	607928	Usher syndrome, type 2D; Deafness, autosomal recessive, type 31	Autosomal recessive
2	WIPF1	602357	?Wiskott-Aldrich syndrome 2	Autosomal recessive
12	WNK1	605232	Neuropathy, hereditary sensory and autonomic, type 2	Autosomal recessive
12	WNT1	164820	Osteogenesis imperfecta, type XV	Autosomal recessive
2	WNT10A	606268	WNT10A-related conditions	Autosomal recessive
12	WNT10B	601906	Split-hand/foot malformation, type 6	Autosomal recessive
17	WNT3	165330	?Tetra-amelia syndrome	Autosomal recessive
3	WNT7A	601570	Fuhrmann syndrome	Autosomal recessive
17	WRAP53	612661	Dyskeratosis congenita, autosomal recessive, type 3	Autosomal recessive
8	WRN	604611	Werner syndrome	Autosomal recessive
16	WWOX	605131	Epileptic encephalopathy, early infantile, type 28; Spinocerebellar ataxia, autosomal recessive, type 12	Autosomal recessive
2	XDH	607633	Xanthinuria, type 1	Autosomal recessive
9	XPA	611153	Xeroderma pigmentosum, group A	Autosomal recessive
3	XPC	613208	Xeroderma pigmentosum, group C	Autosomal recessive
22	XPNPEP3	613553	Nephronophthisis-like nephropathy, type 1	Autosomal recessive
5	XRCC4	194363	Short stature, microcephaly, and endocrine dysfunction	Autosomal recessive
16	XYLT1	608124	Desbuquois dysplasia, type 2	Autosomal recessive
17	XYLT2	608125	Spondyloocular syndrome	Autosomal recessive
12	YARS2	610957	Myopathy, lactic acidosis, and sideroblastic anemia, type 2	Autosomal recessive
1	YY1AP1	607860	Grange syndrome	Autosomal recessive
2	ZAP70	176947	Autoimmune disease, multisystem, infantile-onset, type 2; Immunodeficiency, type 48	Autosomal recessive
11	ZBTB16	176797	Skeletal defects, genital hypoplasia, and mental retardation	Autosomal recessive
6	ZBTB24	614064	Immunodeficiency-centromeric instability-facial anomalies syndrome, type 2	Autosomal recessive
14	ZC3H14	613279	Mental retardation, autosomal recessive, type 56	Autosomal recessive
X	ZDHHC9	300646	Mental retardation, X-linked syndromic, Raymond type	X-linked
14	ZFYVE26	612012	Spastic paraplegia, type 15, autosomal recessive	Autosomal recessive
1	ZMPSTE24	606480	Mandibuloacral dysplasia with, type B lipodystrophy	Autosomal recessive
3	ZMYND10	607070	Ciliary dyskinesia, primary, type 22	Autosomal recessive
11	ZNF408	616454	Retinitis pigmentosa, type 72	Autosomal recessive
16	ZNF423	604557	Joubert syndrome, type 19	Autosomal recessive
16	ZNF469	612078	Brittle cornea syndrome, type 1	Autosomal recessive
X	ZNF711	314990	Mental retardation, X-linked, type 97	X-linked
17	ZNHIT3	604500	PEHO syndrome	Autosomal recessive
11	ZP1	195000	Oocyte maturation defect, type 1	Autosomal recessive

Download CGT Exome v1.0

Export Download CGT Exome v1.1

Export Download CGT Exome v1.2

Export Download CGT Exome v2.0

Export Download CGT Exome v3.1.2

Export Download CGT Exome v3.2.3

Export Download CGT EXOME v3.3.4

Export

CGT Plus V5.4.8
Historic Versions

Chromosome	Gene symbol	OMIM (gene)	Disease name (phenotype)	Inheritance
12	AAAS	605378	Triple-A syndrome (achalasia-addisonianism-alacrimia)	Autosomal recessive
2	ABCA12	607800	Ichthyosis, congenital, autosomal recessive, type 4A; ICAR, type 4B (harlequin)	Autosomal recessive
16	ABCA3	601615	Surfactant metabolism dysfunction, pulmonary, type 3	Autosomal recessive
1	ABCA4	601691	Stargardt disease 1; Retinitis pigmentosa 19; Cone-rod dystrophy 3	Autosomal recessive
2	ABCB11	603201	Cholestasis, benign recurrent intrahepatic, type 2; Cholestasis, progressive familial intrahepatic, type 2	Autosomal recessive
11	ABCC8	600509	Hyperinsulinemic hypoglycemia, type 1 (congenital hyperinsulinism); Permanent neonatal diabetes mellitus (PNDM)	Autosomal recessive*
X	ABCD1	300371	Adrenoleukodystrophy	X-linked
14	ABCD4	603214	Methylmalonic aciduria and homocystinuria, cblJ type	Autosomal recessive
11	ACAD8	604773	Isobutyryl-CoA dehydrogenase deficiency	Autosomal recessive
3	ACAD9	611103	Acyl-CoA dehydrogenase 9 deficiency (mitochondrial complex I deficiency, nuclear, type 20)	Autosomal recessive
1	ACADM	607008	Medium-chain acyl-CoA dehydrogenase deficiency	Autosomal recessive
12	ACADS	606885	Short-chain acyl-CoA dehydrogenase deficiency	Autosomal recessive
10	ACADSB	600301	Short/branched-chain acyl-CoA dehydrogenase deficiency	Autosomal recessive
17	ACADVL	609575	Very long-chain acyl-CoA dehydrogenase (VLCAD) deficiency	Autosomal recessive
11	ACAT1	607809	Alpha-methylacetoacetic aciduria (3-ketothiolase deficiency)	Autosomal recessive
17	ACOX1	609751	Peroxisomal acyl-CoA oxidase deficiency	Autosomal recessive
16	ACSF3	614245	Combined malonic and methylmalonic aciduria	Autosomal recessive
20	ADA	608958	Severe combined immunodeficiency due to adenosine deaminase deficiency (ADA)	Autosomal recessive
5	ADAMTS2	604539	Ehlers-Danlos syndrome, dermatosparaxis type	Autosomal recessive
16	ADGRG1	604110	Polymicrogyria, bilateral frontoparietal	Autosomal recessive
5	ADGRV1	602851	Usher syndrome, type 2C	Autosomal recessive; Digenic inheritance (PDZD7 gene)
10	ADK	102750	Hypermethioninemia due to adenosine kinase deficiency	Autosomal recessive
4	AGA	613228	Aspartylglucosaminuria (glycosylasparaginase deficiency)	Autosomal recessive
1	AGL	610860	Glycogen storage disease, type 3	Autosomal recessive
2	AGPS	603051	Rhizomelic chondrodysplasia punctata, type 3	Autosomal recessive
2	AGXT	604285	Hyperoxaluria, primary, type 1	Autosomal recessive
20	AHCY	180960	Hypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase	Autosomal recessive
6	AHI1	608894	Joubert syndrome, type 3	Autosomal recessive
17	AIPL1	604392	Leber congenital amaurosis, type 4	Autosomal recessive
21	AIRE	607358	Autoimmune polyendocrinopathy syndrome, type 1	Autosomal recessive*
17	ALDH3A2	609523	Sjogren-Larsson syndrome	Autosomal recessive
1	ALDH4A1	606811	Hyperprolinemia, type 2	Autosomal recessive
9	ALDOB	612724	Fructose intolerance, hereditary	Autosomal recessive
16	ALG1	605907	Congenital disorder of glycosylation, type 1K	Autosomal recessive
1	ALG6	604566	Congenital disorder of glycosylation, type 1C	Autosomal recessive
2	ALMS1	606844	Alström syndrome	Autosomal recessive
1	ALPL	171760	ALPL-related conditions	Autosomal recessive
3	AMT	238310	Glycine encephalopathy	Autosomal recessive
3	ANO10	613726	Spinocerebellar ataxia, autosomal recessive, type 10	Autosomal recessive
X	AP1S2	300629	Mental retardation, X-linked, syndromic, type 5 (Pettigrew syndrome)	X-linked
12	AQP2	107777	Diabetes insipidus, nephrogenic, type 2	Autosomal recessive*
X	AR	313700	Androgen insensitivity syndrome	X-linked
6	ARG1	608313	Argininemia (arginase deficiency)	Autosomal recessive
3	ARL13B	608922	Joubert syndrome type 8	Autosomal recessive
22	ARSA	607574	Metachromatic leukodystrophy	Autosomal recessive
5	ARSB	611542	Mucopolysaccharidosis, type 6 (Maroteaux-Lamy syndrome)	Autosomal recessive
X	ARSL	300180	Chondrodysplasia punctata, brachytelephalangic	X-linked
X	ARX	300382	Epileptic encephalopathy, early infantile, type 1; ARX-related developmental disorders	X-linked
7	ASL	608310	Argininosuccinic aciduria	Autosomal recessive
7	ASNS	108370	Asparagine synthetase deficiency	Autosomal recessive
17	ASPA	608034	Canavan disease	Autosomal recessive
9	ASS1	603470	Citrullinemia, type 1	Autosomal recessive
11	ATM	607585	ATM-related conditions	Autosomal recessive
2	ATP6V1B1	192132	Renal tubular acidosis with deafness	Autosomal recessive
X	ATP7A	300011	Menkes disease; Occipital horn syndrome	X-linked
13	ATP7B	606882	Wilson disease	Autosomal recessive
18	ATP8B1	602397	Cholestasis, progressive familial intrahepatic, type 1; Cholestasis, benign recurrent intrahepatic, type 1	Autosomal recessive
X	ATRX	300032	Mental retardation-hypotonic facies syndrome, X-linked; Alpha-thalassemia/mental retardation syndrome	X-linked
9	AUH	600529	3-methylglutaconic aciduria, type 1	Autosomal recessive
9	B4GALT1	137060	Congenital disorder of glycosylation, type 2D	Autosomal recessive
11	BBS1	209901	Bardet-Biedl syndrome, type 1	Autosomal recessive
12	BBS10	610148	Bardet-Biedl syndrome, type 10	Autosomal recessive
4	BBS12	610683	Bardet-Biedl syndrome, type 12	Autosomal recessive
16	BBS2	606151	Bardet-Biedl syndrome, type 2	Autosomal recessive
3	BCHE	177400	Butyrylcholinesterase deficiency	Autosomal recessive
19	BCKDHA	608348	Maple syrup urine disease, type 1A	Autosomal recessive
6	BCKDHB	248611	Maple syrup urine disease, type 1B	Autosomal recessive
2	BCS1L	603647	Mitochondrial complex III deficiency nuclear type 1; GRACILE syndrome; Bjornstad syndrome	Autosomal recessive
15	BLM	604610	Bloom syndrome	Autosomal recessive
X	BRWD3	300553	Mental retardation, X-linked, type 93	X-linked
1	BSND	606412	Bartter syndrome, type 4A	Autosomal recessive
3	BTD	609019	Biotinidase deficiency	Autosomal recessive
X	BTK	300300	Agammaglobulinemia X-linked, type 1	X-linked
8	CA2	611492	Osteopetrosis with renal tubular acidosis (osteopetrosis, autosomal recessive, type 3)	Autosomal recessive
15	CAPN3	114240	Limb-girdle muscular dystrophy, type 1 (LGMD R1)	Autosomal recessive
1	CASQ2	114251	Ventricular tachycardia, catecholaminergic polymorphic, type 2	Autosomal recessive
21	CBS	613381	Homocystinuria due to cystathionine beta-synthase	Autosomal recessive
4	CC2D2A	612013	Joubert syndrome, type 9; Meckel syndrome, type 6; COACH syndrome, 2	Autosomal recessive
14	CCDC88C	611204	Hydrocephalus, congenital, type 1	Autosomal recessive
6	CCN6	603400	Progressive pseudorheumatoid dysplasia	Autosomal recessive
X	CD40LG	300386	Hyper-IgM syndrome, type 1 (immunodeficiency, X-linked, with hyper-IgM, type 1)	X-linked
10	CDH23	605516	Deafness, autosomal recessive, type 12; Usher syndrome, type 1D	Autosomal recessive
12	CEP290	610142	Meckel syndrome, type 4; Joubert syndrome, type 5; Leber congenital amaurosis, type 10	Autosomal recessive
2	CERKL	608381	Retinitis pigmentosa, type 26	Autosomal recessive
7	CFTR	602421	Cystic fibrosis	Autosomal recessive
10	CHAT	118490	Myasthenic syndrome, congenital, type 6, presynaptic	Autosomal recessive
X	CHM	300390	Choroideremia	X-linked
17	CHRNE	100725	Myasthenic syndrome, congenital, type 4B, fast-channel; Myasthenic syndrome, congenital, type 4C, associated with acetylcholine receptor deficiency	Autosomal recessive
2	CHRNG	100730	Multiple pterygium syndrome (MPS), Escobar type; MPS, lethal type	Autosomal recessive
16	CHST6	605294	Macular corneal dystrophy	Autosomal recessive
16	CIITA	600005	Bare lymphocyte syndrome, type 2, complementation group A	Autosomal recessive
7	CLCN1	118425	Myotonia congenita, recessive	Autosomal recessive
16	CLN3	607042	Ceroid lipofuscinosis, neuronal, type 3	Autosomal recessive
13	CLN5	608102	Ceroid lipofuscinosis, neuronal, type 5	Autosomal recessive
15	CLN6	606725	Ceroid lipofuscinosis, neuronal, type 6	Autosomal recessive
8	CLN8	607837	Ceroid lipofuscinosis, neuronal, type 8	Autosomal recessive
3	CLRN1	606397	Usher syndrome, type 3A	Autosomal recessive
4	CNGA1	123825	Retinitis pigmentosa type 49	Autosomal recessive
16	CNGB1	600724	Retinitis pigmentosa type 45	Autosomal recessive
8	CNGB3	605080	Achromatopsia, type 3	Autosomal recessive
9	COL27A1	608461	Steel syndrome	Autosomal recessive
2	COL4A3	120070	Alport syndrome, autosomal recessive, type 2	Autosomal recessive; Autosomal dominant
2	COL4A4	120131	Alport syndrome, autosomal recessive, type 2	Autosomal recessive; Autosomal dominant
X	COL4A5	303630	Alport syndrome, X-linked	X-linked
3	COL7A1	120120	Dystrophic epidermolysis bullosa (DEB), Hallopeau-Siemens (HS) type and non-HS type; DEB pruriginosa; DEB pretibial	Autosomal recessive; Autosomal recessive; Autosomal recessive
3	COLQ	603033	Myasthenic syndrome, congenital, type 5	Autosomal recessive
10	COX15	603646	Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, type 2; Leigh syndrome due to cytochrome c oxidase deficiency	Autosomal recessive
2	CPS1	608307	Carbamoylphosphate synthetase 1 deficiency	Autosomal recessive
11	CPT1A	600528	Carnitine palmitoyltransferase type 1A deficiency, hepatic	Autosomal recessive
1	CPT2	600650	Carnitine palmitoyltransferase type 2 deficiency, lethal neonatal; Carnitine palmitoyltransferase type 2 deficiency, infantile	Autosomal recessive
1	CRB1	604210	Retinitis pigmentosa, type 12; Leber congenital amaurosis, type 8	Autosomal recessive
3	CRTAP	605497	Osteogenesis imperfecta, type 7	Autosomal recessive
1	CTH	607657	Cystathioninuria	Autosomal recessive
17	CTNS	606272	Nephropathic cystinosis	Autosomal recessive
20	CTSA	613111	Galactosialidosis	Autosomal recessive
11	CTSC	602365	Haim-Munk syndrome; Papillon-Lefevre syndrome	Autosomal recessive
11	CTSD	116840	Ceroid lipofuscinosis, neuronal, type 10	Autosomal recessive
1	CTSK	601105	Pycnodysostosis	Autosomal recessive
X	CUL4B	300304	Mental retardation, X-linked, syndromic, type 15 (Cabezas type)	X-linked
16	CYBA	608508	Chronic granulomatous disease, type 4	Autosomal recessive
X	CYBB	300481	Chronic granulomatous disease, X-linked	X-linked
15	CYP11A1	118485	46,XY disorder of sex development-adrenal insufficiency due to CYP11A1 deficiency	Autosomal recessive
8	CYP11B1	610613	Adrenal hyperplasia, congenital, due to 11-beta-hydroxylase deficiency	Autosomal recessive
8	CYP11B2	124080	Hypoaldosteronism, congenital, due to CMO I deficiency	Autosomal recessive
10	CYP17A1	609300	17 alpha(?)-hydroxylase/17,20-lyase deficiency	Autosomal recessive
15	CYP19A1	107910	Aromatase deficiency	Autosomal recessive
2	CYP1B1	601771	Glaucoma, primary congenital, type 3A	Autosomal recessive
6	CYP21A2	613815	Congenital adrenal hyperplasia due to 21-hydroxylase deficiency	Autosomal recessive
2	CYP27A1	606530	Cerebrotendinous xanthomatosis	Autosomal recessive
12	CYP27B1	609506	Vitamin D-dependent rickets, type 1	Autosomal recessive
1	DBT	248610	Maple syrup urine disease, type 2	Autosomal recessive
10	DCLRE1C	605988	Omenn syndrome; Severe combined immunodeficiency, Athabascan type	Autosomal recessive
X	DCX	300121	Lissencephaly, X-linked, type 1	X-linked
11	DDB2	600811	Xeroderma pigmentosum, complementation group E	Autosomal recessive
11	DHCR7	602858	Smith-Lemli-Opitz syndrome	Autosomal recessive
1	DHDDS	608172	Retinitis pigmentosa, type 59	Autosomal recessive
X	DKC1	300126	Dyskeratosis congenita, X-linked	X-linked
7	DLD	238331	Dihydrolipoamide dehydrogenase deficiency	Autosomal recessive
X	DLG3	300189	Mental retardation, X-linked, type 90	X-linked
X	DMD	300377	DMD-related conditions	X-linked
5	DNAH5	603335	Ciliary dyskinesia, primary, type 3, with or without situs inversus	Autosomal recessive
9	DNAI1	604366	Ciliary dyskinesia, primary, type 1, with or without situs inversus	Autosomal recessive
17	DNAI2	605483	Ciliary dyskinesia, primary, type 9, with or without situs inversus	Autosomal recessive
10	DNAJC12	606060	Hyperphenylalaninemia, mild, non-BH4-deficient	Autosomal recessive
4	DOK7	610285	Fetal akinesia deformation sequence, type 3; Myasthenic syndrome, congenital, type 10	Autosomal recessive
9	DOLK	610746	Congenital disorder of glycosylation, type 1M	Autosomal recessive
11	DPAGT1	191350	Congenital disorder of glycosylation, type 1J; Myasthenic syndrome, congenital, type 13	Autosomal recessive
20	DPM1	603503	Congenital disorder of glycosylation, type 1E	Autosomal recessive
1	DPYD	612779	Dihydropyrimidine dehydrogenase deficiency	Autosomal recessive
15	DUOX2	606759	Thyroid dyshormonogenesis, type 6	Autosomal recessive
15	DUOXA2	612772	Thyroid dyshormonogenesis, type 5	Autosomal recessive
11	DYNC2H1	603297	Short-rib thoracic dysplasia, type 3, with or without polydactyly	Autosomal recessive
2	DYSF	603009	Miyoshi muscular dystrophy, type 1; Limb-girdle muscular dystrophy, type 2 (LGMD R2)	Autosomal recessive
X	EDA	300451	Ectodermal dysplasia, type 1, hypohidrotic, X-linked	X-linked
2	EDAR	604095	Ectodermal dysplasia 10B, hypohidrotic/hair/tooth type	Autosomal recessive
2	EIF2AK3	604032	Wolcott-Rallison syndrome	Autosomal recessive
3	EIF2B5	603945	Leukoencephalopathy with vanishing white matter (VWM)	Autosomal recessive
9	ELP1	603722	Familial dysautonomia	Autosomal recessive
X	EMD	300384	Emery-Dreifuss muscular dystrophy, type 1, X-linked	X-linked
19	ERCC2	126340	Trichothiodystrophy, type 1; Xeroderma pigmentosum, group D	Autosomal recessive
2	ERCC3	133510	Trichothiodystrophy, type 2	Autosomal recessive
13	ERCC5	133530	Cerebrooculofacioskeletal syndrome 3; Xeroderma pigmentosum, group G;Xeroderma pigmentosum, group G/Cockayne syndrome	Autosomal recessive
10	ERCC6	609413	Cockayne syndrome, type B; Cerebrooculofacioskeletal syndrome, type 1	Autosomal recessive
5	ERCC8	609412	Cockayne syndrome, type A	Autosomal recessive
8	ESCO2	609353	Roberts syndrome	Autosomal recessive
15	ETFA	608053	Glutaric acidemia, type 2A	Autosomal recessive
19	ETFB	130410	Glutaric acidemia, type 2B	Autosomal recessive
4	ETFDH	231675	Glutaric acidemia, type 2C	Autosomal recessive
19	ETHE1	608451	Ethylmalonic encephalopathy	Autosomal recessive
4	EVC	604831	Ellis-van Creveld syndrome	Autosomal recessive
4	EVC2	607261	Ellis-van Creveld syndrome	Autosomal recessive
9	EXOSC3	606489	Pontocerebellar hypoplasia, type 1B	Autosomal recessive
6	EYS	612424	Retinitis pigmentosa, type 25	Autosomal recessive
4	F11	264900	Factor XI deficiency	Autosomal recessive*
11	F2	176930	Prothrombin deficiency	Autosomal recessive
1	F5	612309	Factor V deficiency	Autosomal recessive
X	F8	300841	Hemophilia A	X-linked
X	F9	300746	Hemophilia B	X-linked
15	FAH	613871	Tyrosinemia, type 1	Autosomal recessive
2	FAM161A	613596	Retinitis pigmentosa, type 28	Autosomal recessive
7	FAM20C	611061	Raine syndrome	Autosomal recessive
16	FANCA	607139	Fanconi anemia, complementation group A	Autosomal recessive
9	FANCC	613899	Fanconi anemia, complementation group C	Autosomal recessive
9	FANCG	602956	Fanconi anemia, complementation group G	Autosomal recessive
X	FGD1	300546	Aarskog-Scott syndrome; Mental retardation, X-linked syndromic, type 16	X-linked
1	FH	136850	Fumarase deficiency	Autosomal recessive
19	FKRP	606596	Muscular dystrophy-dystroglycanopathy, type 5A (Walker-Warburg syndrome); Type 5B; Type 5C (limb-girdle muscular dystrophy, type 9 [LGMDR9])	Autosomal recessive
9	FKTN	607440	Muscular dystrophy-dystroglycanopathy, type 4A (Walker-Warburg syndrome); Type 4B; Type 4C (limb-girdle muscular dystrophy, type 13 [LGMD R13])	Autosomal recessive
1	FMO3	136132	Trimethylaminuria	Autosomal recessive
X	FMR1	309550	FMR1-related conditions	X-linked
11	FOXRED1	613622	Mitochondrial complex I deficiency, nuclear type 19	Autosomal recessive
4	FRAS1	607830	Fraser syndrome, type 1	Autosomal recessive
21	FTCD	606806	Glutamate formiminotransferase deficiency	Autosomal recessive
X	FTSJ1	300499	Mental retardation, X-linked 44	X-linked
1	FUCA1	612280	Fucosidosis	Autosomal recessive
9	FXN	606829	Friedreich ataxia	Autosomal recessive
17	G6PC1	613742	Glycogen storage disease, type 1A	Autosomal recessive
17	G6PC3	611045	Dursun syndrome	Autosomal recessive
X	G6PD	305900	G6PD deficiency	X-linked
17	GAA	606800	Glycogen storage disease, type 2	Autosomal recessive
14	GALC	606890	Krabbe disease	Autosomal recessive
1	GALE	606953	Galactose epimerase deficiency	Autosomal recessive
17	GALK1	604313	Galactokinase deficiency with cataracts	Autosomal recessive
16	GALNS	612222	Mucopolysaccharidosis, type 4A	Autosomal recessive
9	GALT	606999	Galactosemia	Autosomal recessive
19	GAMT	601240	Cerebral creatine deficiency syndrome, type 2	Autosomal recessive
1	GBA1	606463	Gaucher disease	Autosomal recessive
3	GBE1	607839	Glycogen storage disease, type 4	Autosomal recessive
19	GCDH	608801	Glutaricaciduria, type 1	Autosomal recessive
14	GCH1	600225	Hyperphenylalaninemia, BH4-deficient, type B	Autosomal recessive
16	GCSH	238330	Multiple mitochondrial dysfunctions syndrome 7	Autosomal recessive
8	GDAP1	606598	Charcot-Marie-Tooth disease, recessive intermediate, type A	Autosomal recessive
20	GDF5	601146	Chondrodysplasia, Grebe type	Autosomal recessive
3	GFM1	606639	Combined oxidative phosphorylation deficiency, type 1	Autosomal recessive
7	GHRHR	139191	Growth hormone deficiency, isolated, type 1B	Autosomal recessive
X	GJB1	304040	Charcot-Marie-Tooth neuropathy, X-linked dominant, type 1	X-linked
13	GJB2	121011	Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6	Autosomal recessive; Digenic inheritance (GJB6 gene)
13	GJB6	604418	Deafness, autosomal recessive, type 1B; Deafness, digenic GJB2/GJB6	Autosomal recessive; Digenic inheritance (GJB2 gene)
X	GLA	300644	Fabry disease	X-linked
3	GLB1	611458	GM1-gangliosidosis, types 1-3; Mucopolysaccharidosis, type 4B (Morquio)	Autosomal recessive
9	GLDC	238300	Glycine encephalopathy	Autosomal recessive
9	GLE1	603371	Lethal congenital contracture syndrome, type 1; Congenital arthrogryposis with anterior horn cell disease	Autosomal recessive
9	GNE	603824	Inclusion body myopathy, type 2 (Nonaka myopathy)	Autosomal recessive
6	GNMT	606628	Glycine N-methyltransferase deficiency	Autosomal recessive
12	GNPTAB	607840	Mucolipidosis 2 alpha/beta; Mucolipidosis 3 alpha/beta	Autosomal recessive
16	GNPTG	607838	Mucolipidosis III gamma	Autosomal recessive
4	GNRHR	138850	Hypogonadotropic hypogonadism, type 7, without anosmia	Autosomal recessive
12	GNS	607664	Mucopolysaccharidosis, type 3D (Sanfilippo syndrome D)	Autosomal recessive
17	GP1BA	606672	Bernard-Soulier syndrome, type A1	Autosomal recessive
22	GP1BB	138720	Bernard-Soulier syndrome, type B	Autosomal recessive
3	GP9	173515	Bernard-Soulier syndrome, type C	Autosomal recessive
X	GPR143	300808	Ocular albinism, type 1 (Nettleship-Falls type)	X-linked
9	GRHPR	604296	Hyperoxaluria, primary, type 2	Autosomal recessive
12	GRIP1	604597	Fraser syndrome 3	Autosomal recessive
20	GSS	601002	Glutathione synthetase deficiency	Autosomal recessive
17	GUCY2D	600179	Leber congenital amaurosis, type 1	Autosomal recessive
7	GUSB	611499	Mucopolysaccharidosis, type 7	Autosomal recessive
4	HADH	601609	3-hydroxyacyl-CoA dehydrogenase deficiency	Autosomal recessive
2	HADHA	600890	Long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD) deficiency; Mitochondrial trifunctional protein deficiency	Autosomal recessive
2	HADHB	143450	Mitochondrial trifunctional protein deficiency	Autosomal recessive
1	HAX1	605998	Neutropenia, severe congenital, type 3, autosomal recessive	Autosomal recessive
16	HBA1	141800	Alpha thalassemia	Autosomal recessive
16	HBA2	141850	Alpha thalassemia	Autosomal recessive
11	HBB	141900	HBB-related hemoglobinopathies	Autosomal recessive
X	HCFC1	300019	Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type )	X-linked
15	HEXA	606869	Tay-Sachs disease	Autosomal recessive
5	HEXB	606873	Sandhoff disease, infantile, juvenile, and adult forms	Autosomal recessive
6	HFE	613609	Hemochromatosis, type 1	Autosomal recessive
3	HGD	607474	Alkaptonuria	Autosomal recessive
8	HGSNAT	610453	Mucopolysaccharidosis type 3C (Sanfilippo syndrome C)	Autosomal recessive
1	HJV	608374	Hemochromatosis, type 2A	Autosomal recessive
21	HLCS	609018	Holocarboxylase synthetase deficiency	Autosomal recessive
1	HMGCL	613898	HMG-CoA lyase deficiency	Autosomal recessive
22	HMOX1	141250	Heme oxygenase-1 deficiency	Autosomal recessive
10	HOGA1	613597	Hyperoxaluria, primary, type 3	Autosomal recessive
12	HPD	609695	Tyrosinemia, type 3	Autosomal recessive
X	HPRT1	308000	Lesch-Nyhan syndrome	X-linked
10	HPS1	604982	Hermansky-Pudlak syndrome, type 1	Autosomal recessive
3	HPS3	606118	Hermansky-Pudlak syndrome, type 3	Autosomal recessive
X	HSD17B10	300256	HSD10 mitochondrial disease	X-linked
9	HSD17B3	605573	46,XY disorder of sex development due to 17-beta-hydroxysteroid dehydrogenase 3 deficiency	Autosomal recessive
5	HSD17B4	601860	D-bifunctional protein deficiency	Autosomal recessive
1	HSD3B2	613890	Adrenal hyperplasia, congenital, due to 3-beta-hydroxysteroid dehydrogenase 2 deficiency	Autosomal recessive
1	HSPG2	142461	Schwartz-Jampel syndrome, type 1; Dyssegmental dysplasia, Silverman-Handmaker type	Autosomal recessive
3	HYAL1	607071	?Mucopolysaccharidosis, type 9	Autosomal recessive
11	HYLS1	610693	Hydrolethalus syndrome	Autosomal recessive
20	IDH3B	604526	Retinitis pigmentosa, type 46	Autosomal recessive
X	IDS	300823	Mucopolysaccharidosis, type 2	X-linked
4	IDUA	252800	Mucopolysaccharidosis type 1	Autosomal recessive
11	IGHMBP2	600502	Charcot-Marie-Tooth disease, axonal, type 2S	Autosomal recessive
X	IL1RAPL1	300206	Mental retardation, X-linked, type 21/34	X-linked
X	IL2RG	308380	Severe combined immunodeficiency, X-linked	X-linked
15	IVD	607036	Isovaleric acidemia	Autosomal recessive
6	IYD	612025	Thyroid dyshormonogenesis, type 4	Autosomal recessive
19	JAK3	600173	Severe Combined Immunodeficiency, autosomal recessive, T-negative/B-positive type	Autosomal recessive
11	KCNJ11	600937	Hyperinsulinemic hypoglycemia, type 2 (congenital hyperinsulinism); Permanent neonatal diabetes mellitus (PNDM)	Autosomal recessive; Autosomal recessive*
X	KDM5C	314690	Mental retardation, X-linked, syndromic, Claes-Jensen type	X-linked
X	L1CAM	308840	L1 Syndrome	X-linked
6	LAMA2	156225	LAMA2-related muscular dystrophy	Autosomal recessive
18	LAMA3	600805	Junctional epidermolysis bullosa (JEB) Herlitz type; JEB non-Herlitz type	Autosomal recessive
1	LAMB3	150310	Junctional epidermolysis bullosa (JEB) Herlitz type; JEB non-Herlitz type	Autosomal recessive
1	LAMC2	150292	Junctional epidermolysis bullosa (JEB) Herlitz type; JEB non-Herlitz type	Autosomal recessive
22	LARGE1	603590	Muscular dystrophy-dystroglycanopathy, type 6A and 6B	Autosomal recessive
6	LCA5	611408	Leber congenital amaurosis, type 5	Autosomal recessive
19	LDLR	606945	Hypercholesterolemia, familial, type 1	Autosomal recessive; Autosomal dominant
1	LDLRAP1	605747	Hypercholesterolemia, familial, autosomal recessive	Autosomal recessive
2	LHCGR	152790	Leydig cell hypoplasia	Autosomal recessive
9	LHX3	600577	Pituitary hormone deficiency, combined, type 3	Autosomal recessive
5	LIFR	151443	Stuve-Wiedemann syndrome / Schwartz-Jampel type 2 syndrome	Autosomal recessive
10	LIPA	613497	Lysosomal acid lipase deficiency	Autosomal recessive
3	LIPH	607365	Hypotrichosis, type 7 or woolly hair, autosomal recessive, type 2, with or without hypotrichosis	Autosomal recessive
6	LMBRD1	612625	Methylmalonic aciduria and homocystinuria, cblF type	Autosomal recessive
18	LOXHD1	613072	Deafness, autosomal recessive, type 77	Autosomal recessive
8	LPL	609708	Lipoprotein lipase deficiency	Autosomal recessive
2	LRP2	600073	Donnai-Barrow syndrome	Autosomal recessive
2	LRPPRC	607544	Leigh syndrome, French-Canadian type	Autosomal recessive
1	LYST	606897	Chediak-Higashi syndrome	Autosomal recessive
19	MAN2B1	609458	Alpha-mannosidosis	Autosomal recessive
4	MANBA	609489	Mannosidosis, beta	Autosomal recessive
10	MAT1A	610550	Methionine adenosyltransferase deficiency, autosomal recessive	Autosomal recessive
3	MCCC1	609010	3-Methylcrotonyl-CoA carboxylase deficiency, type 1	Autosomal recessive
5	MCCC2	609014	3-Methylcrotonyl-CoA carboxylase deficiency, type 2	Autosomal recessive
2	MCEE	608419	Methylmalonyl-CoA epimerase deficiency	Autosomal recessive
19	MCOLN1	605248	Mucolipidosis type 4	Autosomal recessive
8	MCPH1	607117	Microcephaly type 1, primary, autosomal recessive	Autosomal recessive
X	MECP2	300005	Encephalopathy, neonatal severe; Rett syndrome	X-linked
11	MED17	603810	Microcephaly, postnatal progressive, with seizures and brain atrophy	Autosomal recessive
16	MEFV	608107	Familial Mediterranean fever	Autosomal recessive
15	MESP2	605195	Spondylocostal dysostosis, type 2, autosomal recessive	Autosomal recessive
4	MFSD8	611124	Ceroid lipofuscinosis, neuronal, type 7	Autosomal recessive
X	MID1	300552	Opitz GBBB syndrome, type 1	X-linked
17	MKS1	609883	Bardet-Biedl syndrome type 13; Meckel syndrome, type 1; Joubert syndrome, type 28	Autosomal recessive
22	MLC1	605908	Megalencephalic leukoencephalopathy with subcortical cysts	Autosomal recessive
16	MLYCD	606761	Malonyl-CoA decarboxylase deficiency	Autosomal recessive
4	MMAA	607481	Methylmalonic aciduria, vitamin B12-responsive	Autosomal recessive
12	MMAB	607568	Methylmalonic aciduria, vitamin B12-responsive, type cblB	Autosomal recessive
1	MMACHC	609831	Methylmalonic aciduria and homocystinuria, cblC type	Autosomal recessive; digenic inheritance (PRDX1 gene)
2	MMADHC	611935	Homocystinuria, cblD type, variant 1	Autosomal recessive
6	MMUT	609058	Methylmalonic aciduria, mut(0) type	Autosomal recessive
2	MOGS	601336	Congenital disorder of glycosylation, type 2B	Autosomal recessive
15	MPI	154550	Congenital disorder of glycosylation, type 1B	Autosomal recessive
1	MPL	159530	Thrombocytopenia, congenital amegakaryocytic	Autosomal recessive
2	MPV17	137960	Mitochondrial DNA depletion syndrome type 6 (hepatocerebral); Charcot-Marie-Tooth disease, axonal, type 2EE	Autosomal recessive
1	MTHFR	607093	Homocystinuria due to MTHFR deficiency	Autosomal recessive
X	MTM1	300415	Myotubular myopathy, X-linked	X-linked
11	MTMR2	603557	Charcot-Marie-Tooth disease, type 4B1	Autosomal recessive
1	MTR	156570	Homocystinuria-megaloblastic anemia, cblG complementation type	Autosomal recessive
5	MTRR	602568	Homocystinuria-megaloblastic anemia, cbl E type	Autosomal recessive
4	MTTP	157147	Abetalipoproteinemia	Autosomal recessive
12	MVK	251170	Mevalonic aciduria	Autosomal recessive
17	MYO15A	602666	Deafness, autosomal recessive, type 3	Autosomal recessive
11	MYO7A	276903	Usher syndrome, type 1B; Deafness, autosomal recessive, type 2	Autosomal recessive
2	NADK2	615787	2,4-dienoyl-CoA reductase deficiency	Autosomal recessive
22	NAGA	104170	Schindler disease, type I; Schindler disease, type III; Kanzaki disease	Autosomal recessive
17	NAGLU	609701	Mucopolysaccharidosis, type 3B (Sanfilippo B)	Autosomal recessive
17	NAGS	608300	N-acetylglutamate synthase deficiency	Autosomal recessive
8	NBN	602667	Nijmegen breakage syndrome	Autosomal recessive
7	NCF1	608512	Chronic granulomatous disease, type 1	Autosomal recessive
1	NCF2	608515	Chronic granulomatous disease, type 2	Autosomal recessive
X	NDP	300658	Norrie disease	X-linked
8	NDRG1	605262	Charcot-Marie-Tooth disease, type 4D	Autosomal recessive
5	NDUFAF2	609653	Mitochondrial complex I deficiency, nuclear type 10	Autosomal recessive
20	NDUFAF5	612360	Mitochondrial complex I deficiency, nuclear type 16	Autosomal recessive
5	NDUFS4	602694	Mitochondrial complex I deficiency, nuclear type 1	Autosomal recessive
5	NDUFS6	603848	Mitochondrial complex I deficiency, nuclear type 9	Autosomal recessive
19	NDUFS7	601825	Mitochondrial complex I deficiency, nuclear type 3	Autosomal recessive
11	NDUFV1	161015	Mitochondrial complex I deficiency, nuclear type 4	Autosomal recessive
2	NEB	161650	Nemaline myopathy type 2	Autosomal recessive
6	NEU1	608272	Sialidosis, type 1 and type 2	Autosomal recessive
5	NHP2	606470	Dyskeratosis congenita, autosomal recessive type 2	Autosomal recessive
19	NLRP7	609661	Hydatidiform mole, recurrent, type 1	Autosomal recessive
15	NOP10	606471	Dyskeratosis congenita, autosomal recessive type 1	Autosomal recessive
18	NPC1	607623	Niemann-Pick disease, type C1	Autosomal recessive
14	NPC2	601015	Niemann-pick disease, type C2	Autosomal recessive
2	NPHP1	607100	Joubert syndrome type 4	Autosomal recessive
19	NPHS1	602716	Nephrotic syndrome, type 1	Autosomal recessive
1	NPHS2	604766	Nephrotic syndrome, type 2	Autosomal recessive
X	NR0B1	300473	Adrenal hypoplasia, congenital	X-linked
15	NR2E3	604485	Enhanced S-cone syndrome (Goldmann-Favre); Retinitis pigmentosa, type 37	Autosomal recessive; Autosomal recessive*
1	NTRK1	191315	Insensitivity to pain, congenital, with anhidrosis	Autosomal recessive
10	OAT	613349	Gyrate atrophy of choroid and retina	Autosomal recessive
15	OCA2	611409	Oculocutaneous albinism type 2	Autosomal recessive
X	OCRL	300535	Lowe Syndrome; Dent disease type 2	X-linked
19	OPA3	606580	3-methylglutaconic aciduria, type 3	Autosomal recessive
X	OPHN1	300127	Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance	X-linked
6	OSTM1	607649	Osteopetrosis, autosomal recessive type 5	Autosomal recessive
X	OTC	300461	Ornithine transcarbamylase deficiency	X-linked
2	OTOF	603681	Deafness, autosomal recessive, type 9	Autosomal recessive
1	P3H1	610339	Osteogenesis imperfecta, type 8	Autosomal recessive
12	PAH	612349	Phenylketonuria	Autosomal recessive
X	PAK3	300142	Mental retardation, X-linked, type 30	X-linked
20	PANK2	606157	Neurodegeneration with brain iron accumulation type 1	Autosomal recessive
11	PC	608786	Pyruvate carboxylase deficiency	Autosomal recessive
10	PCBD1	126090	Hyperphenylalaninemia, BH4-deficient, type D	Autosomal recessive
13	PCCA	232000	Propionic acidemia	Autosomal recessive
3	PCCB	232050	Propionic acidemia	Autosomal recessive
10	PCDH15	605514	Deafness, autosomal recessive, type 23; Usher syndrome, type 1D/F digenic	Autosomal recessive
5	PDE6A	180071	Retinitis pigmentosa type 43	Autosomal recessive
X	PDHA1	300502	Pyruvate dehydrogenase E1-alpha deficiency	X-linked
3	PDHB	179060	Pyruvate dehydrogenase E1-beta deficiency	Autosomal recessive
7	PEX1	602136	Heimler syndrome 1; Peroxisome biogenesis disorder 1A (Zellweger); Peroxisome biogenesis disorder 1B (NALD/IRD)	Autosomal recessive
1	PEX10	602859	Peroxisome biogenesis disorder, type 6A (Zellweger syndrome); Peroxisome biogenesis disorder, type 6B	Autosomal recessive
17	PEX12	601758	Peroxisome biogenesis disorder type 3A (Zellweger)	Autosomal recessive
8	PEX2	170993	Peroxisome biogenesis disorder type 5A (Zellweger)	Autosomal recessive
22	PEX26	608666	Peroxisome biogenesis disorder type 7A (Zellweger)	Autosomal recessive
12	PEX5	600414	Peroxisome biogenesis disorder type 2A (Zellweger)	Autosomal recessive
6	PEX6	601498	Peroxisome biogenesis disorder, type 4A (Zellweger syndrome); Peroxisome biogenesis disorder, type 4B; Heimler syndrome 2	Autosomal recessive; Autosomal recessive*; Autosomal recessive
6	PEX7	601757	Rhizomelic chondrodysplasia punctata, type 1	Autosomal recessive
12	PFKM	610681	Glycogen storage disease, type 7	Autosomal recessive
X	PGK1	311800	Phosphoglycerate kinase 1 deficiency	X-linked
X	PHF8	300560	Mental retardation syndrome, X-linked, Siderius type	X-linked
1	PHGDH	606879	Neu-Laxova syndrome, type 1; Phosphoglycerate dehydrogenase deficiency	Autosomal recessive
6	PKHD1	606702	Polycystic kidney disease type 4	Autosomal recessive
22	PLA2G6	603604	Infantile neuroaxonal dystrophy type 1	Autosomal recessive
1	PLOD1	153454	Ehlers-Danlos syndrome, kyphoscoliotic type, 1	Autosomal recessive
X	PLP1	300401	Pelizaeus-Merzbacher disease	X-linked
16	PMM2	601785	Congenital disorder of glycosylation, type 1A	Autosomal recessive
17	PNPO	603287	Pyridoxamine 5'-phosphate oxidase deficiency	Autosomal recessive
15	POLG	174763	POLG-related disorders	Autosomal recessive
6	POLR1C	610060	Leukodystrophy, hypomyelinating, type 11; Treacher Collins syndrome 3	Autosomal recessive
1	POMGNT1	606822	Muscular dystrophy-dystroglycanopathy, type 3A (Walker-Warburg syndrome); Type 3B; Type 3C (limb-girdle muscular dystrophy, type 15 [LGMDR15])	Autosomal recessive
9	POMT1	607423	Muscular dystrophy-dystroglycanopathy, type 1A (Walker-Warburg syndrome); Type 1B; Type 1C (limb-girdle muscular dystrophy, type 11 [LGMD R11])	Autosomal recessive
14	POMT2	607439	Muscular dystrophy-dystroglycanopathy, type 2A (Walker-Warburg syndrome); Type 2B; Type 2C (limb-girdle muscular dystrophy, type 14 [LGMD R14])	Autosomal recessive
7	POR	124015	Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis	Autosomal recessive
3	POU1F1	173110	Pituitary hormone deficiency, combined, type 1	Autosomal recessive*
X	POU3F4	300039	Deafness, X-linked, type 2	X-linked
4	PPM1K	611065	?Maple syrup urine disease, mild variant	Autosomal recessive
1	PPT1	600722	Ceroid lipofuscinosis, neuronal, type 1	Autosomal recessive
X	PQBP1	300463	Renpenning syndrome	X-linked
1	PRDX1	176763	Methylmalonic aciduria and homocystinuria, cblC type, digenic	Autosomal recessive; Digenic inheritance (MMACHC gene)
10	PRF1	170280	Hemophagocytic lymphohistiocytosis, familial, type 2	Autosomal recessive
22	PRODH	606810	Hyperprolinemia, type 1	Autosomal recessive
5	PROP1	601538	Pituitary hormone deficiency, combined, type 2	Autosomal recessive
X	PRPS1	311850	PRPS1-related disoders	X-linked
10	PSAP	176801	Combined SAP deficiency	Autosomal recessive
11	PTS	612719	Hyperphenylalaninemia, BH4-deficient, type A	Autosomal recessive
12	PUS1	608109	Myopathy, lactic acidosis, and sideroblastic anemia, type 1	Autosomal recessive
11	PYGM	608455	McArdle disease	Autosomal recessive
4	QDPR	612676	Hyperphenylalaninemia, BH4-deficient, type C	Autosomal recessive
6	RAB23	606144	Carpenter syndrome	Autosomal recessive
11	RAG1	179615	Omenn syndrome; Severe combined immunodeficiency, B cell-negative	Autosomal recessive
11	RAG2	179616	Omenn syndrome; Severe combined immunodeficiency, B cell-negative	Autosomal recessive
11	RAPSN	601592	Fetal akinesia deformation sequence, type 2; Myasthenic syndrome, congenital, type 11, associated with AChR deficiency	Autosomal recessive
6	RARS2	611524	Pontocerebellar hypoplasia, type 6	Autosomal recessive
18	RAX	601881	Isolated microphthalmia, type 3	Autosomal recessive
14	RDH12	608830	Leber congenital amaurosis, type 13	Autosomal recessive
9	RMRP	157660	Anauxetic dysplasia, type 1	Autosomal recessive
13	RNASEH2B	610326	Aicardi-Goutieres syndrome, type 2	Autosomal recessive
11	RNASEH2C	610330	Aicardi-Goutieres syndrome, type 3	Autosomal recessive
X	RP2	300757	Retinitis pigmentosa, type 2, X-linked	X-linked
1	RPE65	180069	RPE65-related Leber congenital amaurosis/early-onset severe retinal dystrophy	Autosomal recessive
X	RPGR	312610	Retinitis pigmentosa, type 3, X-linked; Cone-rod dystrophy, X-linked, 1	X-linked
16	RPGRIP1L	610937	Joubert syndrome, type 7; Meckel syndrome, type 5; COACH syndrome	Autosomal recessive
X	RS1	300839	Retinoschisis	X-linked
20	RTEL1	608833	Dyskeratosis congenita, autosomal recessive type 5	Autosomal recessive*
13	SACS	604490	Spastic ataxia, Charlevoix-Saguenay, type	Autosomal recessive
2	SAG	181031	Oguchi disease, type 1	Autosomal recessive
20	SAMHD1	606754	Aicardi-Goutieres syndrome, type 5	Autosomal recessive
7	SBDS	607444	Shwachman-Diamond syndrome	Autosomal recessive
22	SCO2	604272	Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, type 1	Autosomal recessive
4	SEPSECS	613009	Pontocerebellar hypoplasia, type 2D	Autosomal recessive
14	SERPINA1	107400	Alpha-1 antitrypsin deficiency	Autosomal recessive
17	SGCA	600119	Limb-girdle muscular dystrophy, type 3 (LGMD R3)	Autosomal recessive
4	SGCB	600900	Limb-girdle muscular dystrophy, type 4 (LGMD R4)	Autosomal recessive
5	SGCD	601411	Limb-girdle muscular dystrophy, type 6 (LGMD R6)	Autosomal recessive
13	SGCG	608896	Limb-girdle muscular dystrophy, type 5 (LGMD R5)	Autosomal recessive
17	SGSH	605270	Mucopolysaccharidosis, type 3A (Sanfilippo A)	Autosomal recessive
X	SH2D1A	300490	Lymphoproliferative syndrome, X-linked, type 1	X-linked
5	SH3TC2	608206	Charcot-Marie-Tooth disease, type 4C	Autosomal recessive
5	SKIC3	614589	Trichohepatoenteric syndrome, type 1 (diarrhea, syndromic)	Autosomal recessive
16	SLC12A3	600968	Gitelman syndrome	Autosomal recessive
15	SLC12A6	604878	Agenesis of the corpus callosum with peripheral neuropathy	Autosomal recessive
X	SLC16A2	300095	Allan-Herndon-Dudley syndrome	X-linked
6	SLC17A5	604322	Salla disease	Autosomal recessive
1	SLC19A2	603941	Thiamine-responsive megaloblastic anemia syndrome	Autosomal recessive
2	SLC19A3	606152	Thiamine metabolism dysfunction syndrome, type 2 (biotin- or thiamine-responsive encephalopathy type)	Autosomal recessive
5	SLC22A5	603377	Carnitine deficiency, systemic primary	Autosomal recessive
7	SLC25A13	603859	Citrullinemia, type 2, neonatal-onset; Citrullinemia, type 2, adult-onset	Autosomal recessive
13	SLC25A15	603861	Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome	Autosomal recessive
3	SLC25A20	613698	Carnitine-acylcarnitine translocase deficiency	Autosomal recessive
5	SLC26A2	606718	Achondrogenesis Ib; Atelosteogenesis, type II;De la Chapelle dysplasia; Diastrophic dysplasia;Diastrophic dysplasia, broad bone-platyspondylic variant;Epiphyseal dysplasia, multiple, 4	Autosomal recessive
7	SLC26A3	126650	Diarrhea 1, secretory chloride, congenital	Autosomal recessive
7	SLC26A4	605646	Deafness, autosomal recessive, type 4; Pendred syndrome	Autosomal recessive
6	SLC35A1	605634	Congenital disorder of glycosylation, type 2F	Autosomal recessive
1	SLC35A3	605632	Arthrogryposis, impaired intellectual development, and seizures	Autosomal recessive
11	SLC35C1	605881	Congenital disorder of glycosylation, type 2C	Autosomal recessive
1	SLC35D1	610804	Schneckenbecken dysplasia	Autosomal recessive
11	SLC37A4	602671	Glycogen storage disease, type 1B	Autosomal recessive
8	SLC39A4	607059	Acrodermatitis enteropathica	Autosomal recessive
2	SLC3A1	104614	Cystinuria	Autosomal recessive*
5	SLC45A2	606202	Albinism, oculocutaneous, type 4	Autosomal recessive
17	SLC46A1	611672	Folate malabsorption, hereditary	Autosomal recessive
20	SLC4A11	610206	Corneal endothelial dystrophy, autosomal recessive	Autosomal recessive
19	SLC5A5	601843	Thyroid dyshormonogenesis, type 1	Autosomal recessive
5	SLC6A19	608893	Hartnup disorder	Autosomal recessive
X	SLC6A8	300036	Cerebral creatine deficiency syndrome, type 1	X-linked
14	SLC7A7	603593	Lysinuric protein intolerance	Autosomal recessive
19	SLC7A9	604144	Cystinuria	Autosomal recessive*
2	SMARCAL1	606622	Schimke immunoosseous dysplasia	Autosomal recessive
5	SMN1	600354	Spinal muscular atrophy	Autosomal recessive
11	SMPD1	607608	Niemann-Pick disease, type A; Niemann-Pick disease, type B	Autosomal recessive
15	SPG11	610844	Amyotrophic lateral sclerosis 5, juvenile; Charcot-Marie-Tooth disease, axonal, type 2X; Spastic paraplegia 11	Autosomal recessive
16	SPG7	602783	Spastic paraplegia, type 7, autosomal recessive	Autosomal recessive
2	SRD5A2	607306	46,XY disorder of sex development due to 5-alpha-reductase 2 deficiency (pseudovaginal perineoscrotal hypospadias)	Autosomal recessive
2	ST3GAL5	604402	Salt and pepper developmental regression syndrome	Autosomal recessive
8	STAR	600617	Lipoid adrenal hyperplasia	Autosomal recessive
3	SUMF1	607939	Multiple sulfatase deficiency	Autosomal recessive
9	SURF1	185620	Mitochondrial complex IV deficiency, nuclear type 1; Charcot-Marie-Tooth disease, type 4K	Autosomal recessive
X	SYN1	313440	Epilepsy, X-linked, with variable learning disabilities and behavior disorders	X-linked
16	TAT	613018	Tyrosinemia, type 2	Autosomal recessive
11	TCIRG1	604592	Osteopetrosis, autosomal recessive, type 1	Autosomal recessive
14	TECPR2	615000	Spastic paraplegia, type 49, autosomal recessive	Autosomal recessive
3	TF	190000	Atransferrinemia	Autosomal recessive
7	TFR2	604720	Hemochromatosis, type 3	Autosomal recessive
8	TG	188450	Thyroid dyshormonogenesis, type 3	Autosomal recessive
14	TGM1	190195	Ichthyosis, congenital, autosomal recessive, type 1	Autosomal recessive
11	TH	191290	Segawa syndrome, recessive	Autosomal recessive
X	THOC2	300395	Mental retardation, X-linked 12	X-linked
11	TMEM216	613277	Joubert syndrome, type 2; Meckel syndrome, type 2	Autosomal recessive
8	TMEM67	609884	Meckel syndrome 3; COACH syndrome 1; Joubert syndrome 6; Nephronophthisis 11	Autosomal recessive
21	TMPRSS3	605511	Deafness, autosomal recessive, type 8/10	Autosomal recessive
6	TNXB	600985	Ehlers-Danlos syndrome, classic-like	Autosomal recessive
2	TPO	606765	Thyroid dyshormonogenesis, type 2A	Autosomal recessive
11	TPP1	607998	Ceroid lipofuscinosis, neuronal, type 2; Spinocerebellar ataxia, autosomal recessive, type 7	Autosomal recessive
6	TRDN	603283	Ventricular tachycardia, catecholaminergic polymorphic, type 5, with or without muscle weakness	Autosomal recessive
3	TREX1	606609	Aicardi-Goutieres syndrome, type 1	Autosomal recessive
9	TRIM32	602290	Limb-girdle muscular dystrophy, type 8 (LGMD R8)	Autosomal recessive
17	TRIM37	605073	Mulibrey nanism	Autosomal recessive
22	TRMU	610230	Liver failure, transient infantile	Autosomal recessive
17	TSEN54	608755	Pontocerebellar hypoplasia, type 2A; Pontocerebellar hypoplasia, type 4	Autosomal recessive
12	TSFM	604723	Combined oxidative phosphorylation deficiency, type 3	Autosomal recessive
1	TSHB	188540	Hypothyroidism, congenital, nongoitrous, type 4	Autosomal recessive
14	TSHR	603372	Hypothyroidism, congenital, nongoitrous, type 1	Autosomal recessive
8	TTPA	600415	Ataxia with isolated vitamin E deficiency	Autosomal recessive
22	TYMP	131222	Mitochondrial DNA depletion syndrome, type 1 (MNGIE type)	Autosomal recessive
11	TYR	606933	Oculocutaneous albinism (OCA) type 1A; OCA type 1B	Autosomal recessive
9	TYRP1	115501	Albinism, oculocutaneous, type 3	Autosomal recessive
15	UBE3A	601623	Angelman syndrome	Autosomal dominant*
2	UGT1A1	191740	Crigler-Najjar syndrome, type 1; Crigler-Najjar syndrome, type 2	Autosomal recessive
17	UNC13D	608897	Hemophagocytic lymphohistiocytosis, familial, type 3	Autosomal recessive
X	UPF3B	300298	Mental retardation, X-linked, syndromic, type 14	X-linked
11	USH1C	605242	Usher syndrome, type 1C; Deafness, autosomal recessive, type 18A	Autosomal recessive
17	USH1G	607696	Usher syndrome, type 1G	Autosomal recessive
1	USH2A	608400	Usher syndrome, type 2A; Retinitis pigmentosa 39	Autosomal recessive
9	VPS13A	605978	Choreoacanthocytosis	Autosomal recessive
8	VPS13B	607817	Cohen syndrome	Autosomal recessive
1	VPS45	610035	Neutropenia, severe congenital, type 5	Autosomal recessive
17	VPS53	615850	Pontocerebellar hypoplasia, type 2E	Autosomal recessive
14	VRK1	602168	Pontocerebellar hypoplasia, type 1A	Autosomal recessive
14	VSX2	142993	Microphthalmia with coloboma 3; Isolated microphthalmia 2	Autosomal recessive
X	WAS	300392	Wiskott-Aldrich syndrome; Thrombocytopenia, X-linked	X-linked
9	WHRN	607928	Usher syndrome, type 2D; Deafness, autosomal recessive, type 31	Autosomal recessive
2	WNT10A	606268	WNT10A-related conditions	Autosomal recessive
8	WRN	604611	Werner syndrome	Autosomal recessive
9	XPA	611153	Xeroderma pigmentosum, group A	Autosomal recessive
3	XPC	613208	Xeroderma pigmentosum, group C	Autosomal recessive
X	ZDHHC9	300646	Mental retardation, X-linked syndromic, Raymond type	X-linked
14	ZFYVE26	612012	Spastic paraplegia, type 15, autosomal recessive	Autosomal recessive
X	ZNF711	314990	Mental retardation, X-linked, type 97	X-linked

Download CGT Plus v1.0

Export Download CGT Plus v1.1

Export Download CGT Plus v1.2

Export Download CGT Plus v2.0

Export Download CGT Plus v3.0.1

Export Download CGT Plus v3.1.1

Export Download CGT Plus v3.2.3

Export Download CGT Plus v3.3.5

Export

CGT Bank v3.3.10
CGT Bank v3.3.11
Historic Versions

chrom	OMIM (gene)	gene	previous symbol	OMIM (phen)	disease name (phenotype)	inheritance
X	300371	ABCD1		300100	Adrenoleukodystrophy	X-linked
X	300629	AP1S2		304340	Mental retardation, X-linked, syndromic, type 5 (Pettigrew syndrome)	X-linked
X	313700	AR		300068	Androgen insensitivity syndrome, complete	X-linked
X	300180	ARSL	ARSE	302950	Chondrodysplasia punctata, brachytelephalangic	X-linked
X	300382	ARX		308350; 300215; 309510	Epileptic encephalopathy, early infantile, type 1; ARX-related developmental disorders	X-linked
X	300011	ATP7A		309400; 304150	Menkes disease; Occipital horn syndrome	X-linked
X	300504	ATRX		309580; 301040	Mental retardation-hypotonic facies syndrome, X-linked; Alpha-thalassemia/mental retardation syndrome	X-linked
X	300553	BRWD3		300659	Mental retardation, X-linked, type 93	X-linked
X	300300	BTK		300755	Agammaglobulinemia X-linked, type 1	X-linked
X	300386	CD40LG		308230	Hyper-IgM syndrome, type 1 (immunodeficiency, X-linked, with hyper-IgM, type 1)	X-linked
7	602421	CFTR		219700	Cystic fibrosis	Autosomal recessive
X	300390	CHM		303100	Choroideremia	X-linked
X	303630	COL4A5		301050	Alport syndrome, X-linked	X-linked
X	300304	CUL4B		300354	Mental retardation, X-linked, syndromic, type 15 (Cabezas type)	X-linked
X	300481	CYBB		306400	Chronic granulomatous disease, X-linked	X-linked
6	613815	CYP21A2		201910	Congenital adrenal hyperplasia due to 21-hydroxylase deficiency	Autosomal recessive
X	300121	DCX		300067	Lissencephaly, X-linked, type 1	X-linked
X	300126	DKC1		305000	Dyskeratosis congenita, X-linked	X-linked
X	300189	DLG3		300850	Mental retardation, X-linked, type 90	X-linked
X	300377	DMD		310200; 300376	Duchenne/Becker muscular dystrophy	X-linked
X	300451	EDA		305100	Ectodermal dysplasia, type 1, hypohidrotic, X-linked	X-linked
X	300384	EMD		310300	Emery-Dreifuss muscular dystrophy, type 1, X-linked	X-linked
X	300841	F8		306700	Hemophilia A	X-linked
X	300746	F9		306900	Hemophilia B	X-linked
X	300546	FGD1		305400	Aarskog-Scott syndrome; Mental retardation, X-linked syndromic, type 16	X-linked
X	309550	FMR1		300624	Fragile X syndrome	X-linked
X	300499	FTSJ1		309549	Mental retardation, X-linked 44	X-linked
X	305900	G6PD		300908	Hemolytic anemia, G6PD deficient (favism)	X-linked
X	304040	GJB1		302800	Charcot-Marie-Tooth neuropathy, X-linked dominant, type 1	X-linked
13	121011	GJB2		220290	Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6	Autosomal recessive; Digenic inheritance (GJB6 gene)
X	300644	GLA		301500	Fabry disease	X-linked
X	300808	GPR143		300500	Ocular albinism, type 1 (Nettleship-Falls type)	X-linked
16	141800	HBA1		604131	Thalassemia, alpha-	Autosomal recessive
16	141850	HBA2		604131	Thalassemia, alpha-	Autosomal recessive
11	141900	HBB		603903	HBB-related hemoglobinopathy	Autosomal recessive
X	300019	HCFC1		309541	Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type )	X-linked
X	308000	HPRT1		300322	Lesch-Nyhan syndrome	X-linked
X	300256	HSD17B10		300438	HSD10 mitochondrial disease	X-linked
X	300823	IDS		309900	Mucopolysaccharidosis, type 2	X-linked
X	300206	IL1RAPL1		300143	Mental retardation, X-linked, type 21/34	X-linked
X	308380	IL2RG		300400	Severe combined immunodeficiency, X-linked	X-linked
X	314690	KDM5C		300534	Mental retardation, X-linked, syndromic, Claes-Jensen type	X-linked
X	308840	L1CAM		307000; 303350; 304100	L1 Syndrome	X-linked
X	300005	MECP2		300673; 312750	Encephalopathy, neonatal severe; Rett syndrome	X-linked
X	300415	MTM1		310400	Myotubular myopathy, X-linked	X-linked
X	300658	NDP		310600	Norrie disease	X-linked
X	300473	NR0B1		300200	Adrenal hypoplasia, congenital	X-linked
X	300535	OCRL		309000; 300555	Lowe Syndrome; Dent disease type 2	X-linked
X	300127	OPHN1		300486	Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance	X-linked
X	300461	OTC		311250	Ornithine transcarbamylase deficiency	X-linked
X	300142	PAK3		300558	Mental retardation, X-linked, type 30	X-linked
X	300502	PDHA1		312170	Pyruvate dehydrogenase E1-alpha deficiency	X-linked
X	311800	PGK1		300653	Phosphoglycerate kinase 1 deficiency	X-linked
X	300560	PHF8		300263	Mental retardation syndrome, X-linked, Siderius type	X-linked
X	300401	PLP1		312080	Pelizaeus-Merzbacher disease	X-linked
X	300039	POU3F4		304400	Deafness, X-linked, type 2	X-linked
X	300463	PQBP1		309500	Renpenning syndrome	X-linked
X	311850	PRPS1		300661; 304500; 311070; 301835	PRPS1-related disoders	X-linked
X	300757	RP2		312600	Retinitis pigmentosa, type 2, X-linked	X-linked
X	312610	RPGR		300029; 304020	Retinitis pigmentosa, type 3, X-linked; Cone-rod dystrophy, X-linked, 1	X-linked
X	300839	RS1		312700	Retinoschisis	X-linked
X	300490	SH2D1A		308240	Lymphoproliferative syndrome, X-linked, type 1	X-linked
X	300095	SLC16A2		300523	Allan-Herndon-Dudley syndrome	X-linked
X	300036	SLC6A8		300352	Cerebral creatine deficiency syndrome, type 1	X-linked
5	600354	SMN1		253300	Spinal muscular atrophy	Autosomal recessive
X	313440	SYN1		300491	Epilepsy, X-linked, with variable learning disabilities and behavior disorders	X-linked
X	300395	THOC2		300957	Mental retardation, X-linked 12	X-linked
X	300298	UPF3B		300676	Mental retardation, X-linked, syndromic, type 14	X-linked
X	300392	WAS		301000; 313900	Wiskott-Aldrich syndrome; Thrombocytopenia, X-linked	X-linked
X	300646	ZDHHC9		300799	Mental retardation, X-linked syndromic, Raymond type	X-linked
X	314990	ZNF711		300803	Mental retardation, X-linked, type 97	X-linked

chrom	OMIM (gene)	Gene	Previous Symbol	OMIM (phen)	disease name (phenotype)	inheritance
X	300371	ABCD1		300100	Adrenoleukodystrophy	X-linked
1	607008	ACADM		201450	Medium-chain acyl-CoA dehydrogenase deficiency	Autosomal recessive
2	604285	AGXT		259900	Hyperoxaluria, primary, type 1	Autosomal recessive
X	300629	AP1S2		304340	Mental retardation, X-linked, syndromic, type 5 (Pettigrew syndrome)	X-linked
X	313700	AR		300068	Androgen insensitivity syndrome, complete	X-linked
22	607574	ARSA		250100	Metachromatic leukodystrophy	Autosomal recessive
X	300180	ARSL	ARSE	302950	Chondrodysplasia punctata, brachytelephalangic	X-linked
X	300382	ARX		308350; 300215; 309510	Epileptic encephalopathy, early infantile, type 1; ARX-related developmental disorders	X-linked
X	300011	ATP7A		309400; 304150	Menkes disease; Occipital horn syndrome	X-linked
X	300504	ATRX		309580; 301040	Mental retardation-hypotonic facies syndrome, X-linked; Alpha-thalassemia/mental retardation syndrome	X-linked
X	300553	BRWD3		300659	Mental retardation, X-linked, type 93	X-linked
3	609019	BTD		253260	Biotinidase deficiency	Autosomal recessive
X	300300	BTK		300755	Agammaglobulinemia X-linked, type 1	X-linked
21	613381	CBS		236200	Homocystinuria due to cystathionine beta-synthase	Autosomal recessive
X	300386	CD40LG		308230	Hyper-IgM syndrome, type 1 (immunodeficiency, X-linked, with hyper-IgM, type 1)	X-linked
7	602421	CFTR		219700	Cystic fibrosis	Autosomal recessive
X	300390	CHM		303100	Choroideremia	X-linked
X	303630	COL4A5		301050	Alport syndrome, X-linked	X-linked
X	300304	CUL4B		300354	Mental retardation, X-linked, syndromic, type 15 (Cabezas type)	X-linked
X	300481	CYBB		306400	Chronic granulomatous disease, X-linked	X-linked
X	300121	DCX		300067	Lissencephaly, X-linked, type 1	X-linked
11	602858	DHCR7		270400	Smith-Lemli-Opitz syndrome	Autosomal recessive
X	300126	DKC1		305000	Dyskeratosis congenita, X-linked	X-linked
X	300189	DLG3		300850	Mental retardation, X-linked, type 90	X-linked
X	300377	DMD		310200; 300376	Duchenne/Becker muscular dystrophy	X-linked
X	300451	EDA		305100	Ectodermal dysplasia, type 1, hypohidrotic, X-linked	X-linked
X	300384	EMD		310300	Emery-Dreifuss muscular dystrophy, type 1, X-linked	X-linked
X	300841	F8		306700	Hemophilia A	X-linked
X	300746	F9		306900	Hemophilia B	X-linked
X	300546	FGD1		305400	Aarskog-Scott syndrome; Mental retardation, X-linked syndromic, type 16	X-linked
X	309550	FMR1		300624	Fragile X syndrome	X-linked
X	300499	FTSJ1		309549	Mental retardation, X-linked 44	X-linked
X	305900	G6PD		300908	Hemolytic anemia, G6PD deficient (favism)	X-linked
17	606800	GAA		232300	Glycogen storage disease, type 2	Autosomal recessive
9	606999	GALT		230400	Galactosemia	Autosomal recessive
X	304040	GJB1		302800	Charcot-Marie-Tooth neuropathy, X-linked dominant, type 1	X-linked
13	121011	GJB2		220290	Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6	Autosomal recessive; Digenic inheritance (GJB6 gene)
X	300644	GLA		301500	Fabry disease	X-linked
X	300808	GPR143		300500	Ocular albinism, type 1 (Nettleship-Falls type)	X-linked
2	600890	HADHA		609016; 609015	Long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD) deficiency; Mitochondrial trifunctional protein deficiency	Autosomal recessive
16	141800	HBA1		604131	Thalassemia, alpha-	Autosomal recessive
16	141850	HBA2		604131	Thalassemia, alpha-	Autosomal recessive
11	141900	HBB		603903	HBB-related hemoglobinopathy	Autosomal recessive
X	300019	HCFC1		309541	Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type )	X-linked
X	308000	HPRT1		300322	Lesch-Nyhan syndrome	X-linked
X	300256	HSD17B10		300438	HSD10 mitochondrial disease	X-linked
X	300823	IDS		309900	Mucopolysaccharidosis, type 2	X-linked
X	300206	IL1RAPL1		300143	Mental retardation, X-linked, type 21/34	X-linked
X	308380	IL2RG		300400	Severe combined immunodeficiency, X-linked	X-linked
X	314690	KDM5C		300534	Mental retardation, X-linked, syndromic, Claes-Jensen type	X-linked
X	308840	L1CAM		307000; 303350; 304100	L1 Syndrome	X-linked
X	300005	MECP2		300673; 312750	Encephalopathy, neonatal severe; Rett syndrome	X-linked
1	609831	MMACHC		277400	Methylmalonic aciduria and homocystinuria, cblC type	Autosomal recessive, digenic inheritance (PRDX1 gene)
X	300415	MTM1		310400	Myotubular myopathy, X-linked	X-linked
X	300658	NDP		310600	Norrie disease	X-linked
X	300473	NR0B1		300200	Adrenal hypoplasia, congenital	X-linked
X	300535	OCRL		309000; 300555	Lowe Syndrome; Dent disease type 2	X-linked
X	300127	OPHN1		300486	Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance	X-linked
X	300461	OTC		311250	Ornithine transcarbamylase deficiency	X-linked
12	612349	PAH		261600	Phenylketonuria	Autosomal recessive
X	300142	PAK3		300558	Mental retardation, X-linked, type 30	X-linked
X	300502	PDHA1		312170	Pyruvate dehydrogenase E1-alpha deficiency	X-linked
X	311800	PGK1		300653	Phosphoglycerate kinase 1 deficiency	X-linked
X	300560	PHF8		300263	Mental retardation syndrome, X-linked, Siderius type	X-linked
X	300401	PLP1		312080	Pelizaeus-Merzbacher disease	X-linked
16	601785	PMM2		212065	Congenital disorder of glycosylation, type 1A	Autosomal recessive
X	300039	POU3F4		304400	Deafness, X-linked, type 2	X-linked
X	300463	PQBP1		309500	Renpenning syndrome	X-linked
X	311850	PRPS1		300661; 304500; 311070; 301835	PRPS1-related disoders	X-linked
X	300757	RP2		312600	Retinitis pigmentosa, type 2, X-linked	X-linked
X	312610	RPGR		300029; 304020	Retinitis pigmentosa, type 3, X-linked; Cone-rod dystrophy, X-linked, 1	X-linked
X	300839	RS1		312700	Retinoschisis	X-linked
X	300490	SH2D1A		308240	Lymphoproliferative syndrome, X-linked, type 1	X-linked
X	300095	SLC16A2		300523	Allan-Herndon-Dudley syndrome	X-linked
5	606718	SLC26A2		600972	Achondrogenesis, type 1B (diastrophic dysplasia)	Autosomal recessive
X	300036	SLC6A8		300352	Cerebral creatine deficiency syndrome, type 1	X-linked
5	600354	SMN1		253300	Spinal muscular atrophy	Autosomal recessive
X	313440	SYN1		300491	Epilepsy, X-linked, with variable learning disabilities and behavior disorders	X-linked
X	300395	THOC2		300957	Mental retardation, X-linked 12	X-linked
X	300298	UPF3B		300676	Mental retardation, X-linked, syndromic, type 14	X-linked
X	300392	WAS		301000; 313900	Wiskott-Aldrich syndrome; Thrombocytopenia, X-linked	X-linked
X	300646	ZDHHC9		300799	Mental retardation, X-linked syndromic, Raymond type	X-linked
X	314990	ZNF711		300803	Mental retardation, X-linked, type 97	X-linked

Download CGT Bank v1.1

Export Download CGT Bank v2.0

Export Download CGT Bank v2.1

Export Download CGT Bank v2.2

Export Download CGT Bank v2.3

Export Download CGT Bank v3.0.2

Export Download CGT Bank v3.1.1

Export Download CGT Bank v3.1.2

Export Download CGT Bank v3.1.3

Export Download CGT Bank v3.1.5

Export Download CGT Bank v3.2.3

Export Download CGT Bank v3.2.2

Export Download CGT Bank v3.2.1

Export Download CGT Bankv3.3.1.0

Export Download CGT Bankv3.3.1.1

Export

CGT 600 v1
CGT 600 v2

Gene	Disease	Transcript	Mutations	Disease.description	products
ABCA4	Cone-rod dystrophy type 3	NM_000350.2	NM_000350.2:c.3540_3555delGTCTAAGGGTTTCTCC, NM_000350.2:c.2616_2617delCT, NM_000350.2:c.4793C>A, NM_000350.2:c.6179T>G, NM_000350.2:c.1222C>T, NM_000350.2:c.763C>T	Cone rod dystrophy type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness. The prevalence is 1:100,000-9100,000.	250,600
ABCA4	Retinitis pigmentosa type 19	NM_000350.2	NM_000350.2:c.1848delA	Retinitis pigmentosa type 19 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	250,600
ABCA4	Stargardt disease type 1	NM_000350.2	NM_000350.2:c.1018T>G, NM_000350.2:c.4457C>T, NM_000350.2:c.1225delA, NM_000350.2:c.1622T>C, NM_000350.2:c.1715G>A, NM_000350.2:c.1755delA, NM_000350.2:c.1771delT, NM_000350.2:c.1804C>T, NM_000350.2:c.6449G>A, NM_000350.2:c.1938-1G>A, NM_000350.2:c.1964T>G, NM_000350.2:c.2160+1G>T, NM_000350.2:c.2588G>C, NM_000350.2:c.4469G>A, NM_000350.2:c.2690C>T, NM_000350.2:c.2791G>A, NM_000350.2:c.286A>G, NM_000350.2:c.2971G>C, NM_000350.2:c.3083C>T, NM_000350.2:c.3106G>A, NM_000350.2:c.3210_3211dupGT, NM_000350.2:c.3364G>A, NM_000350.2:c.6320G>A, NM_000350.2:c.3970delG, NM_000350.2:c.4139C>T, NM_000350.2:c.4429C>T, NM_000350.2:c.2300T>A, NM_000350.2:c.3322C>T, NM_000350.2:c.52C>T, NM_000350.2:c.5512delC, NM_000350.2:c.5819T>C, NM_000350.2:c.5881G>A, NM_000350.2:c.5882G>A, NM_000350.2:c.5912T>G, NM_000350.2:c.634C>T, NM_000350.2:c.5714+5G>A, NM_000350.2:c.6394G>T, NM_000350.2:c.67-2A>G, NM_000350.2:c.5461-10T>C, NM_000350.2:c.6089G>A, NM_000350.2:c.6118C>T, NM_000350.2:c.6148G>C, NM_000350.2:c.661G>A, NM_000350.2:c.5338C>G	Stargardt disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by progressive central vision loss, mild loss of color vision, delayed dark adaptation and macular atrophy with or without paramacular flecks and degeneration of the underlying retinal pigment ephitelium. The prevalence is 1:10,000- 5:10,000.	250,600
ABCB7	Sideroblastic anemia and ataxia, X-linked	NM_004299.4	NM_004299.4:c.1203T>G, NM_004299.4:c.1234G>C, NM_004299.4:c.1300G>A	X-linked sideroblastic anemia with ataxia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ABCB7 gene located on chromosomal region Xq13.3. The age of onset is neonatal/infantile. This disease is characterized by core neurological features including motor delay, ataxia evident from early childhood, and dysarthria and patients usually have a mild asymptomatic anaemia or a borderline decreased mean corpuscular volume. The prevalence is <1:1,000,000.	600
ACAD9	Acyl-CoA dehydrogenase type 9 deficiency	NM_014049.4	NM_014049.4:c.1240C>T, NM_014049.4:c.1249C>T, NM_014049.4:c.130T>A, NM_014049.4:c.1594C>T, NM_014049.4:c.23delT, NM_014049.4:c.358delT, NM_014049.4:c.797G>A, NM_014049.4:c.976G>C, NM_014049.4:c.453+1G>A	Acyl-CoA dehydrogenase type 9 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAD9 gene located on chromosomal region 3q21.3. The age of onset is neonatal/infantile. This disease is characterized by failure to thrive, hypertrophic cardiomyopathy, exercise intolerance and mild to severe neurological dysfunction.	250,600
ACADM	Acyl-CoA dehydrogenase deficiency, medium-chain	NM_000016.5	NM_000016.5:c.1102_1105delTTAG, NM_000016.5:c.1232_1233delAA, NM_000016.5:c.287-2A>G, NM_000016.5:c.362C>T, NM_000016.5:c.447G>A, NM_000016.5:c.447G>T, NM_000016.5:c.449_452delCTGA, NM_000016.5:c.616C>T, NM_000016.5:c.617G>A, NM_000016.5:c.683C>A, NM_000016.5:c.797A>G, NM_000016.5:c.799G>A, NM_000016.5:c.815_827delTTGCAATGGGAGC, NM_000016.5:c.890A>G, NM_000016.5:c.984delG, NM_000016.5:c.985A>G, NM_000016.5:c.127G>A, NM_000016.5:c.734C>T, NM_000016.5:c.250C>T	Medium chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADM gene located on chromosomal region 1p31. The age of onset is neonatal/infantile. This disease is characterized by a rapidly progressive metabolic crisis, often presenting as hypoketotic hypoglycemia, lethargy, vomiting, seizures and coma. The prevalence is 1:4,900-1:27,000 in Caucasian populations and 1:14,600 in worldwide populations.	250,600
ACADS	Acyl-CoA dehydrogenase deficiency, short-chain	NM_000017.2	NM_000017.2:c.1095G>T, NM_000017.2:c.1108A>G, NM_000017.2:c.1147C>T, NM_000017.2:c.136C>T, NM_000017.2:c.319C>T, NM_000017.2:c.417G>C, NM_000017.2:c.529T>C, NM_000017.2:c.561_568delCAATGCCT, NM_000017.2:c.826G>A, NM_000017.2:c.314T>A	Short chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADS gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by seizures, developmental delay, failure to grow with poor feeding, and usually muscle weakness and hypotonia. The prevalence is <1:50,000.	250,600
ACADSB	2-Methylbutyryl-CoA dehydrogenase deficiency	NM_001609.3	NM_001609.3:c.1159G>A, NM_001609.3:c.443C>T, NM_001609.3:c.763C>T, NM_001609.3:c.621G>A, NM_001609.3:c.303+1G>A	2-Methylbutyryl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADSB gene located on chromosomal region 10q26.3. The age of onset is neonatal/infantile. This disease is characterized by muscle hypotonia, cerebral palsy, developmental delay, lethargy, hypoglycemia, and metabolic acidosis. The prevalence is <1:1,000,000.	250,600
ACADVL	Very long chain acyl-CoA dehydrogenase deficiency	NM_000018.3	NM_000018.3:c.1096C>T, NM_000018.3:c.1097G>A, NM_000018.3:c.1106T>C, NM_000018.3:c.1141_1143delGAG, NM_000018.3:c.1182+1G>A, NM_000018.3:c.1357C>T, NM_000018.3:c.1360G>A, NM_000018.3:c.1375dupC, NM_000018.3:c.1389dupG, NM_000018.3:c.1406G>A, NM_000018.3:c.1468G>C, NM_000018.3:c.1532+1G>A, NM_000018.3:c.1837C>T, NM_000018.3:c.1843C>T, NM_000018.3:c.1882delC, NM_000018.3:c.278-1G>A, NM_000018.3:c.298_299delCA, NM_000018.3:c.343delG, NM_000018.3:c.400C>T, NM_000018.3:c.477+1G>C, NM_000018.3:c.520G>A, NM_000018.3:c.685C>T, NM_000018.3:c.739A>C, NM_000018.3:c.753-2A>C, NM_000018.3:c.896_898delAGA, NM_000018.3:c.917T>C, NM_000018.3:c.1844G>A, NM_000018.3:c.848T>C	Very long chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADVL gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by cardiomyopathy, hypoketotic hypoglycemia, liver disease, exercise intolerance and rhabdomyolysis. The prevalence is 1:100,000-9:100,000.	250,600
ACAT1	Beta-ketothiolase deficiency	NM_000019.3	NM_000019.3:c.1035_1037delAGA, NM_000019.3:c.1083dupA, NM_000019.3:c.1136G>T, NM_000019.3:c.1138G>A, NM_000019.3:c.2T>A, NM_000019.3:c.410_417delCTCAAAGT, NM_000019.3:c.547G>A, NM_000019.3:c.622C>T, NM_000019.3:c.905delA	Beta-ketothiolase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAT1 gene located on chromosomal region 11q22.3. The age of onset is neonatal/infantile. This disease is characterized by normal early development followed by a progressive loss of mental and motor skills. The prevalence is < 1:1,000,000.	600
ACE	Renal tubular dysgenesis	NM_000789.3	NM_000789.3:c.1319_1322delTGGA, NM_000789.3:c.1510delC, NM_000789.3:c.3381-4C>T, NM_000789.3:c.798C>G, NM_000789.3:c.1486C>T, NM_000789.3:c.2371C>T, NM_000789.3:c.1587-2A>G	Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.	250,600
ACOX1	Peroxisomal acyl-CoA oxidase deficiency	NM_004035.6	NM_004035.6:c.832A>G, NM_004035.6:c.532G>T, NM_004035.6:c.591delG	Peroxisomal acyl-CoA oxidase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACOX1 gene located on chromosomal region 17q25.1. The age of onset is neonatal/infantile. This disease is characterized by hypotonia and seizures in the neonatal period and neurological regression in early infancy. The prevalence is < 1:1,000,000.	600
ACTN4	Glomerulosclerosis, focal segmental, type 1	NM_004924.4	NM_004924.4:c.763A>G, NM_004924.4:c.2619_2620insC, NM_004924.4:c.776C>T, NM_004924.4:c.784T>C	Focal segmental glomerulosclerosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACTN4 gene located on chromosomal region 19q13.2. The age of onset is variable. This disease is characterized by severe proteinuria with low serum albumin and possible edemas.	600
ADA	Adenosine deaminase deficiency	NM_000022.2	NM_000022.2:c.226C>T, NM_000022.2:c.632G>A, NM_000022.2:c.890C>A, NM_000022.2:c.247G>A, NM_000022.2:c.320T>C, NM_000022.2:c.872C>T, NM_000022.2:c.956_960delAAGAG, NM_000022.2:c.986C>T	Adenosine deaminase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADA gene located on chromosomal region 20q13.12. The age of onset is neonatal/infantile. This disease is characterized by profound lymphopenia and very low immunoglobulin levels of all isotypes resulting in severe and recurrent opportunistic infections. The annual incidence is 1:200,000-1:1,000,000. The prevalence is 1:100,000-9:100,000.	250,600
ADAMTS2	Ehlers-Danlos syndrome type 7C	NM_014244.4	NM_014244.4:c.2384G>A	Ehlers-Danlos syndrome type 7C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADAMTS2 gene located on chromosomal region 5q35.3. The age of onset is neonatal/infantile. This disease is characterized by extremely fragile tissues, hyperextensible skin and easy bruising. The prevalence is <1:1,000,000.	600
ADAMTSL2	Geleophysic dysplasia type 1	NM_014694.3	NM_014694.3:c.338G>A, NM_014694.3:c.440C>T, NM_014694.3:c.661C>T, NM_014694.3:c.340G>A	Geleophysic dysplasia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADAMTSL2 gene located on chromosomal region 9q34.2. The age of onset is infantile. This disease is characterized by extremely by short stature, prominent abnormalities in hands and feet, and a characteristic facial appearance. The prevalence is <1:1,000,000.	600
ADCK3	Primary coenzyme Q10 deficiency type 4	NM_020247.4	NM_020247.4:c.911C>T, NM_020247.4:c.815G>T, NM_020247.4:c.993C>T, NM_020247.4:c.1541A>G, NM_020247.4:c.1645G>A, NM_020247.4:c.1651G>A, NM_020247.4:c.1750_1752delACC, NM_020247.4:c.1813_1814insG, NM_020247.4:c.589-3C>G, NM_020247.4:c.637C>T, NM_020247.4:c.815G>A	Primary coenzyme Q10 deficiency type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADCK3 gene located on chromosomal region 1q42.13. The age of onset is infantile. This disease is characterized by progressive ataxia, cerebellar atrophy, and often exercise intolerance with elevated lactate levels and mild intellectual deficit.	250,600
AGA	Aspartylglucosaminuria	NM_000027.3	NM_000027.3:c.488G>C, NM_000027.3:c.755G>A, NM_000027.3:c.214T>C, NM_000027.3:c.302C>T, NM_000027.3:c.800dupT, NM_000027.3:c.904G>A	Aspartylglucosaminuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGA gene located on chromosomal region 4q34.3. The age of onset is infantile. This disease is characterized by slowly developping mental retardation, beginning with clumsiness, late speech, and hyperkinesia, mild facial dysmorphism, and slight kyphoscoliosis.	600
AGL	Glycogen storage disease type 3	NM_000642.2	NM_000642.2:c.1783C>T, NM_000642.2:c.18_19delGA, NM_000642.2:c.112A>G, NM_000642.2:c.1222C>T, NM_000642.2:c.1481G>A, NM_000642.2:c.1485delT, NM_000642.2:c.16C>T, NM_000642.2:c.4260-1G>T, NM_000642.2:c.3214_3215delGA, NM_000642.2:c.1999delC, NM_000642.2:c.2039G>A, NM_000642.2:c.2590C>T, NM_000642.2:c.4456delT, NM_000642.2:c.3216_3217delGA, NM_000642.2:c.3980G>A, NM_000642.2:c.4342G>C, NM_000642.2:c.4529dupA, NM_000642.2:c.294-2A>T, NM_000642.2:c.4260-12A>G	Glycogen storage disease type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGL gene located on chromosomal region 1p21.2. The age of onset is infantile. This disease is characterized by hepatomegaly, growth retardation and occasional seizures related to hypoglycemia and frequently muscular hypotonia and hypertrophic cardiomyopathy.	250,600
AGPS	Rhizomelic chondrodysplasia punctata type 3	NM_003659.3	NM_003659.3:c.1256G>A, NM_003659.3:c.926C>T, NM_003659.3:c.1406T>C, NM_003659.3:c.1703C>T	Rhizomelic chondrodysplasia punctata type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGPS gene located on chromosomal region 2q31.2. The age of onset is neonatal/infantile. This disease is characterized by shortness of the femur and humerus, vertebral disorders, cataract, cutaneous lesions and severe intellectual deficit. The prevalence is 1:100,000-9:100,000.	600
AGT	Renal tubular dysgenesis	NM_000029.3	NM_000029.3:c.1124G>A, NM_000029.3:c.604C>T, NM_000029.3:c.1290_1291insT, NM_000029.3:c.1290delT	Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.	600
AGTR1	Renal tubular dysgenesis	NM_031850.3	NM_031850.3:c.481delC, NM_031850.3:c.259dupG, NM_031850.3:c.215dupT, NM_031850.3:c.481C>T	Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.	600
AGXT	Primary hyperoxaluria type 1	NM_000030.2	NM_000030.2:c.166-2A>G, NM_000030.2:c.121G>A, NM_000030.2:c.32C>A, NM_000030.2:c.245G>A, NM_000030.2:c.25_26insC, NM_000030.2:c.322T>C, NM_000030.2:c.508G>A, NM_000030.2:c.560C>T, NM_000030.2:c.590G>A, NM_000030.2:c.613T>C, NM_000030.2:c.697C>T, NM_000030.2:c.698G>A, NM_000030.2:c.731T>C, NM_000030.2:c.738G>A, NM_000030.2:c.836T>C, NM_000030.2:c.860G>A, NM_000030.2:c.33_34insC, NM_000030.2:c.454T>A, NM_000030.2:c.466G>A, NM_000030.2:c.248A>G	Primary hyperoxaluria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGXT gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by variable clinical presentation, ranging from occasional symptomatic nephrolithiasis to nephrocalcinosis and end-stage renal disease with systemic involvement. The prevalence is 1:1,000,000-9:1,000,000.	250,600
AHI1	Joubert syndrome type 3	NM_017651.4	NM_017651.4:c.1303C>T, NM_017651.4:c.1484G>A, NM_017651.4:c.2295_2296insA, NM_017651.4:c.2295dupA, NM_017651.4:c.3257A>G, NM_017651.4:c.2168G>A, NM_017651.4:c.985C>T, NM_017651.4:c.989A>G, NM_017651.4:c.3263_3264delGG, NM_017651.4:c.1051C>T, NM_017651.4:c.1052G>T	El síndrome de Joubert tipo 3 sigue un patrón de herencia autosómico recesivo y está causado por variantes patogénicas en el gen AHI1 localizado en la región cromosómica 6q23.3. La edad de aparición es neonatal/infantil con síntomas como los rasgos neurológicos del síndrome de Joubert (hipotonía neonatal, retraso del desarrollo, discapacidad intelectural de leve a grave, ataxia, movimiento ocular anormal incluyendo apraxia oculomotora y nistagmo en posición primaria) asociados a una distrofia retiniana.	250,600
AIPL1	Cone-rod dystrophy	NM_014336.4	NM_014336.4:c.1053_1064delTGCAGAGCCACC	La distrofia de conos y bastones causada por variantes patogénicas en el gen AIPL1 localizado en la región cromosómica 17p13.2 sigue un patrón de herencia autosómico recesivo. La edad de aparición es temprana. Se caracteriza por una agudeza visual disminuida, defectos en la visión de los colores, fotoaversión y disminución de la sensibilidad en el centro del campo visual, seguido por una pérdida de la visión periférica y ceguera nocturna.	250,600
AIPL1	Leber congenital amaurosis type 4	NM_014336.4	NM_014336.4:c.905G>T, NM_014336.4:c.834G>A, NM_014336.4:c.589G>C, NM_014336.4:c.715T>C	Leber congenital amaurosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AIPL1gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. The prevalence is 1:100,000-9:100,000.	250,600
ALAS2	Erythropoietic protoporphyria	NM_000032.4	NM_000032.4:c.1699_1700delAT, NM_000032.4:c.1706_1709delAGTG	Erythropoietic protoporphyria caused by pathogenic variants in the ALAS2 gene located on chromosomal region Xp11.21 follows a dominant X-linked pattern of inheritance. The age of onset is neonatal/infancy. This disease is characterized by cutaneous manifestations of acute painful photosensitivity with erythema and edema, sometimes with petechiae, together with stinging and burning sensations without blistering, upon exposure to sunlight or artificial light (400-700 nm). These episodes have a variable severity depending on the exposure duration and may result in chronic permanent lesions on exposed skin. There is a risk of .cholelithiasis with obstructive episodes, and chronic liver disease that might evolve to acute liver failure. The global prevalence is ranging between 1/75,000 and 1/200,000.	600
ALAS2	Sideroblastic anemia, X-linked	NM_000032.4	NM_000032.4:c.1354C>T	X-linked sideroblastic anemia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ALAS2 gene located on chromosomal region Xp11.21. The age of onset is variable. This disease is characterized by clinical features of anemia and/or iron overload such as pallor, fatigue, weakness, and more rarely breathlessness, mild splenomegaly, cardiac problems, abnormal liver function, hyperglycemia, glucose intolerance and skin hyperpigmentation.	600
ALDH4A1	Hyperprolinemia type 2	NM_003748.3	NM_003748.3:c.1055C>T	Hyperprolinemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDH4A1 gene located on chromosomal region 1p36. The age of onset is variable. This disease is characterized by seizures, intellectual deficit and mild developmental delay.	600
ALDH5A1	Succinic semialdehyde dehydrogenase deficiency	NM_001080.3	NM_001080.3:c.1234C>T, NM_001080.3:c.1226G>A, NM_001080.3:c.901A>G, NM_001080.3:c.1540C>T, NM_001080.3:c.1579C>T, NM_001080.3:c.612G>A, NM_001080.3:c.803G>A, NM_001080.3:c.862A>G	Succinic semialdehyde dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDH451 gene located on chromosomal region 6p22. The age of onset is infantile. This disease is characterized by psychomotor retardation, delayed speech development, hypotonia and ataxia. It is a rare disease with around 350 cases reported.	600
ALDOA	Glycogen storage disease type 12	NM_000034.3	NM_000034.3:c.619G>A, NM_000034.3:c.386A>G	Glycogen storage disease type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOA gene located on chromosomal region 16p11.2. The age of onset is neonatal/infantile. This disease is characterized by myopathy with exercise intolerance and rhabdomyolysis associated with hemolytic anaemia.	600
ALDOB	Hereditary fructose intolerance	NM_000035.3	NM_000035.3:c.1005C>G, NM_000035.3:c.178C>T, NM_000035.3:c.1027T>C, NM_000035.3:c.10C>T, NM_000035.3:c.136A>T, NM_000035.3:c.448G>C, NM_000035.3:c.2T>C, NM_000035.3:c.360_363delCAAA, NM_000035.3:c.442T>C, NM_000035.3:c.1013C>T, NM_000035.3:c.113-1_115delGGTA, NM_000035.3:c.1067C>A, NM_000035.3:c.612T>A, NM_000035.3:c.720C>A, NM_000035.3:c.524C>A	Hereditary fructose intolerance follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOB gene located on chromosomal region 9q21.3-q22.2. The age of onset is neonatal/infantile. This disease is characterized by severe abdominal pain, vomiting, and hypoglycemia following ingestion of fructose or other sugars metabolised through fructose-1-phosphate. The prevalence is 1:100,000-9:100,000.	250,600
ALG1	Congenital disorders of glycosylation type 1k	NM_019109.4	NM_019109.4:c.1187+1G>A, NM_019109.4:c.1079C>T, NM_019109.4:c.1129A>G, NM_019109.4:c.901+1G>A, NM_019109.4:c.434G>A, NM_019109.4:c.450C>G, NM_019109.4:c.773C>T	Congenital disorder of glycosylation type 1k follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG1 gene located on chromosomal region 16p13.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay, seizures, microcephaly and coagulation anomalies. The prevalence is <1:1,000,000.	600
ALG6	Congenital disorders of glycosylation type Ic	NM_013339.3	NM_013339.3:c.897_899delAAT, NM_013339.3:c.998C>T, NM_013339.3:c.495-3C>G, NM_013339.3:c.53G>A, NM_013339.3:c.316C>T, NM_013339.3:c.482A>G, NM_013339.3:c.1432T>C	Congenital disorder of glycosylation type 1c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG6 gene located on chromosomal region 1p31.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay and muscular hypotonia, and possible coagulation anomalies, hormonal abnormalities and seizures. The prevalence is <1:1,000,000.	250,600
ALMS1	Alström syndrome	NM_015120.4	NM_015120.4:c.11443C>T, NM_015120.4:c.10775delC, NM_015120.4:c.11316_11319delAGAG, NM_015120.4:c.2323C>T, NM_015120.4:c.11449C>T, NM_015120.4:c.11452_11453insA, NM_015120.4:c.1574_1576delCTCinsT, NM_015120.4:c.8383C>T, NM_015120.4:c.9612_9616delAACAG, NM_015120.4:c.10579_10580delAT, NM_015120.4:c.11610_11611delCT, NM_015120.4:c.12439C>T, NM_015120.4:c.12445C>T, NM_015120.4:c.891_907delTCAGCACCCGCTTATAG, NM_015120.4:c.9911-1G>A, NM_015120.4:c.11618_11619delCT, NM_015120.4:c.4245delC, NM_015120.4:c.5584C>T, NM_015120.4:c.8164C>T	Alström syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALMS1 gene located on chromosomal region 2p13.1. The age of onset is neonatal/infantile. This disease is characterized by cone-rod dystrophy, hearing loss, obesity, insulin resistance and hyperinsulinemia, type 2 diabetes mellitus, dilated cardiomyopathy and progressive hepatic and renal dysfunction. The prevalence is 1:10,000-1:1,000,000.	250,600
ALPL	Hypophosphatasia	NM_000478.4	NM_000478.4:c.1001G>A, NM_000478.4:c.1366G>A, NM_000478.4:c.211C>T, NM_000478.4:c.212G>C, NM_000478.4:c.323C>T, NM_000478.4:c.346G>A, NM_000478.4:c.407G>A, NM_000478.4:c.526G>A, NM_000478.4:c.535G>A, NM_000478.4:c.571G>A, NM_000478.4:c.620A>C, NM_000478.4:c.1133A>T, NM_000478.4:c.1250A>G, NM_000478.4:c.1306T>C, NM_000478.4:c.98C>T, NM_000478.4:c.1574delG, NM_000478.4:c.892G>A, NM_000478.4:c.814C>T, NM_000478.4:c.881A>C	Childhood-onset hypophosphatasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALPL gene located on chromosomal region 1p36.12. The age of onset is infantile. This disease is characterized by clinical features ranging from stillbirth without mineralized bone to pathologic fractures of the lower extremities in later adulthood.	600
AMACR	Alpha-methylacyl-CoA racemase deficiency	NM_014324.5	NM_014324.5:c.857delT, NM_014324.5:c.320T>C, NM_014324.5:c.43delG, NM_014324.5:c.154T>C	Alpha-methylacyl-Coa racemase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMACR gene located on chromosomal region 5p13. The age of onset is variable. This disease is characterized by mild cholestatic liver disease, fat malabsorption and/or neurological disease. The prevalence is <1:1,000,000.	600
AMT	Glycine encephalopathy	NM_000481.3	NM_000481.3:c.139G>A, NM_000481.3:c.125A>G, NM_000481.3:c.959G>A, NM_000481.3:c.574C>T, NM_000481.3:c.806G>A, NM_000481.3:c.826G>C, NM_000481.3:c.259-1G>C	Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMT and GLDC genes located on chromosomal regions 3p21.31 and 9p24.1 respectively. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000.	600
ANO5	Limb-girdle muscular dystrophy type 2L, autosomal recessive	NM_213599.2	NM_213599.2:c.155A>G, NM_213599.2:c.1622_1623insA, NM_213599.2:c.1407+5G>A, NM_213599.2:c.1887delA, NM_213599.2:c.1733T>C, NM_213599.2:c.692G>T, NM_213599.2:c.1627_1628insA, NM_213599.2:c.172C>T, NM_213599.2:c.206_207delAT, NM_213599.2:c.1210C>T, NM_213599.2:c.1295C>G, NM_213599.2:c.1914G>A, NM_213599.2:c.184_185insA, NM_213599.2:c.1898+1G>A, NM_213599.2:c.191_192insA	Autosomal recessive limb-girdle muscular dystrophy type 2L follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ANO5 gene located on chromosomal region 11p14.3. The age of onset is adult. This disease is characterized by weakness and wasting restricted to the limb musculature, proximal greater than distal, and muscle degeneration/regeneration on muscle biopsy. The prevalence is <1:1,000,000.	250,600
APTX	Ataxia with oculomotor apraxia type 1	NM_175073.2	NM_175073.2:c.167delT, NM_175073.2:c.788T>G, NM_175073.2:c.320delC, NM_175073.2:c.617C>T, NM_175073.2:c.659C>T, NM_175073.2:c.134-2A>G, NM_175073.2:c.166C>T, NM_175073.2:c.124C>T, NM_175073.2:c.875-1G>A, NM_175073.2:c.837G>A, NM_175073.2:c.596G>A	Ataxia with oculomotor apraxia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the APTX gene located on chromosomal region 9p13.1. The age of onset is infantile. This disease is characterized by a progressive cerebellar ataxia associated with oculomotor apraxia, choeroathetosis and severe peripheral neuropathy. The prevalence is 0,4:100.000 in Portugal.	250,600
AR	Androgen insensitivity syndrome	NM_000044.3	NM_000044.3:c.2650A>T, NM_000044.3:c.340C>T, NM_000044.3:c.1937C>A, NM_000044.3:c.2323C>T, NM_000044.3:c.2391G>A, NM_000044.3:c.2567G>A, NM_000044.3:c.1769-11T>A, NM_000044.3:c.1771A>T, NM_000044.3:c.2395C>G	Androgen insensitivity syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the AR gene located on chromosomal region Xq12. The age of onset is variable. This disease is characterized by the presence of female external genitalia in a 46,XY individual with normal testis development but undescended testes and unresponsiveness to age-appropriate levels of androgens. The prevalence is 2:100,000-5:100,000.	250,600
ARG1	Argininemia	NM_000045.3	NM_000045.3:c.61C>T, NM_000045.3:c.365G>A, NM_000045.3:c.413G>T, NM_000045.3:c.871C>T, NM_000045.3:c.32T>C, NM_000045.3:c.703G>C, NM_000045.3:c.869C>G	Argininemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARG1gene located on chromosomal region 6q23. The age of onset is neonatal/infantile. This disease is characterized by variable degrees of hyperammonemia, developing from about 3 years of age, and leading to progressive loss of developmental milestones and spasticity in the absence of treatment. The prevalence is 1:350,000-1:1,000,000.	600
ARL13B	Joubert syndrome type 8	NM_182896.2	NM_182896.2:c.1186C>G, NM_182896.2:c.246G>A, NM_182896.2:c.1252C>T, NM_182896.2:c.598C>T	Joubert syndrome type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL13B gene located on chromosomal region 3q11.1. The age of onset is neonatal/infantile. This disease is characterized by congenital malformation of the brainstem and agenesis or hypoplasia of the cerebellar vermis leading to an abnormal respiratory pattern, nystagmus, hypotonia, ataxia and delay in achieving motor milestones. The prevalence is 1/80,000 to 1/100,000.	600
ARL6	Bardet-Biedl syndrome type 3	NM_177976.2	NM_177976.2:c.4G>T, NM_177976.2:c.92C>G, NM_177976.2:c.281T>C, NM_177976.2:c.92C>T, NM_177976.2:c.431C>T, NM_177976.2:c.364C>T	Bardet-Biedl syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL6 gene located on chromosomal region 3q11.2. The age of onset is early. A syndrome characterized by usually severe pigmentary retinopathy, early-onset obesity, polydactyly, hypogenitalism, renal malformation and mental retardation. Secondary features include diabetes mellitus, hypertension and congenital heart disease.	600
ARL6	Retinitis pigmentosa type 55	NM_177976.2	NM_177976.2:c.266C>T	Retinitis pigmentosa type 55 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL6 gene located on chromosomal region 3q11.2. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	600
ARSA	Metachromatic leukodystrophy	NM_000487.5	NM_000487.5:c.1241delC, NM_000487.5:c.1283C>T, NM_000487.5:c.346C>T, NM_000487.5:c.34delG, NM_000487.5:c.1210+1G>A, NM_000487.5:c.1232C>T, NM_000487.5:c.582delC, NM_000487.5:c.583delT, NM_000487.5:c.542dupT, NM_000487.5:c.542T>G, NM_000487.5:c.1408_1418delGCAGCTGTGAC, NM_000487.5:c.195delC, NM_000487.5:c.641C>T, NM_000487.5:c.1401_1411delGTTAGACGCAG, NM_000487.5:c.869G>A, NM_000487.5:c.869G>T, NM_000487.5:c.883G>A, NM_000487.5:c.899T>C, NM_000487.5:c.931G>A, NM_000487.5:c.937C>T, NM_000487.5:c.938G>A, NM_000487.5:c.979G>A, NM_000487.5:c.737G>A, NM_000487.5:c.739G>A, NM_000487.5:c.763G>A, NM_000487.5:c.827C>T, NM_000487.5:c.854+1G>A, NM_000487.5:c.1108-2A>G, NM_000487.5:c.1125_1126delCT, NM_000487.5:c.1150G>A, NM_000487.5:c.1174C>T, NM_000487.5:c.1175G>A, NM_000487.5:c.986C>T, NM_000487.5:c.991G>T, NM_000487.5:c.465+1G>A, NM_000487.5:c.257G>A, NM_000487.5:c.293C>T, NM_000487.5:c.302G>A	Metachromatic leukodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSA gene located on chromosomal region 22q13.33. The age of onset is variable. This disease is characterized by hypotonia, walking difficulties, optic atrophy and motor regression preceding mental impairment in the late infantile form, arrested intellectual development, followed by motor regression, epileptic seizures and ataxia in the juvenile form, and motor or psychiatric disorders, but with slow progression in the adult form. The incidence is 0.5:5,000-1:50,000 and the prevalence is 1:10,000 -5/10,000.	250,600
ARSB	Mucopolysaccharidosis type 6	NM_000046.3	NM_000046.3:c.410G>T, NM_000046.3:c.427delG, NM_000046.3:c.349T>C, NM_000046.3:c.389C>T, NM_000046.3:c.937C>G, NM_000046.3:c.944G>A, NM_000046.3:c.971G>T, NM_000046.3:c.979C>T, NM_000046.3:c.1562G>A, NM_000046.3:c.629A>G, NM_000046.3:c.1143-1G>C, NM_000046.3:c.571C>T, NM_000046.3:c.589C>T, NM_000046.3:c.1178A>C, NM_000046.3:c.1214G>A, NM_000046.3:c.1143-8T>G, NM_000046.3:c.1161dupC, NM_000046.3:c.707T>C, NM_000046.3:c.753C>G, NM_000046.3:c.1366C>T, NM_000046.3:c.1438_1439insG, NM_000046.3:c.921delA	Mucopolysaccharidosis type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSB gene located on chromosomal region 5q14.1. The age of onset is infantile. This disease is characterized by educed pulmonary function, hepatosplenomegaly, hearing loss, sleep apnea, corneal clouding, carpal tunnel disease and occasionally central nervous system findings may include cervical cord compression caused by cervical spinal instability, meningeal thickening and/or bony stenosis, communicating hydrocephalus, optic nerve atrophy and blindness. The prevalence is 1:250,000-1:600,000 newborns.	250,600
ARSE	Chondrodysplasia punctata type 1, X-linked	NM_000047.2	NM_000047.2:c.119T>G, NM_000047.2:c.1429delG, NM_000047.2:c.1442C>T, NM_000047.2:c.1732C>T, NM_000047.2:c.1743G>A, NM_000047.2:c.24-1G>A, NM_000047.2:c.410G>C, NM_000047.2:c.410G>T	X-linked chondrodysplasia punctata type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARSE gene located on chromosomal region Xp22.33. The age of onset is neonatal. This disease is characterized by chondrodysplasia punctata (stippled epiphyses), brachytelephalangy (shortening of the distal phalanges), and nasomaxillary hypoplasia. The prevalence is 1:500,000.	250,600
ARX	Epileptic encephalopathy, early infantile, type 1	NM_139058.2	NM_139058.2:c.1058C>T	Early infantile epileptic encephalopathy type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARX gene located on chromosomal region Xp21.3. The age of onset is neonatal/infantile. This disease is characterized by poor suckling reflexes, hypotonia and generalized and symmetrical tonic spasms. The prevalence is 1:500,000.	600
ARX	Lissencephaly with abnormal genitalia, X-linked	NM_139058.2	NM_139058.2:c.980_983delAACA	X-linked lissencephaly with abnormal genitalia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARX gene located on chromosomal region Xp21.3. The age of onset is neonatal/infantile. It is a severe neurological disorder that only manifests in genotypic males and includes lissencephaly with posterior-to-anterior gradient and only moderate increase in thickness of the cortex, absent corpus callosum, neonatal-onset severe epilepsy, hypothalamic dysfunction including defective temperature regulation, and ambiguous genitalia with micropenis and cryptorchidism.	600
ASL	Argininosuccinic aciduria	NM_000048.3	NM_000048.3:c.1135C>T, NM_000048.3:c.1060C>T, NM_000048.3:c.1255_1256delCT, NM_000048.3:c.1366C>T, NM_000048.3:c.1045_1057delGTCATCTCTACGC, NM_000048.3:c.578G>A, NM_000048.3:c.539T>G, NM_000048.3:c.544C>T, NM_000048.3:c.557G>A, NM_000048.3:c.1144-2A>G, NM_000048.3:c.602+1G>A, NM_000048.3:c.857A>G, NM_000048.3:c.925G>A, NM_000048.3:c.446+1G>A, NM_000048.3:c.505T>C, NM_000048.3:c.525-2A>T, NM_000048.3:c.532G>A, NM_000048.3:c.337C>T, NM_000048.3:c.346C>T, NM_000048.3:c.35G>A, NM_000048.3:c.1369dupG, NM_000048.3:c.437G>A, NM_000048.3:c.392C>T, NM_000048.3:c.1153C>T	Argininosuccinic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASL gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by severe hyperammonemic coma, hypotonia, growth failure, anorexia and chronic vomiting or behavioral disorders during childhood, and hyperammonemic coma or behavioral disorders that simulate psychiatric disorders later in life. The prevalence is 1:70,000 newborns.	250,600
ASPA	Canavan disease	NM_000049.2	NM_000049.2:c.838C>T, NM_000049.2:c.693C>A, NM_000049.2:c.654C>A, NM_000049.2:c.433-2A>G, NM_000049.2:c.854A>C, NM_000049.2:c.914C>A, NM_000049.2:c.212G>A, NM_000049.2:c.863A>G	Canavan disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPA gene located on chromosomal region 17p13.3. The age of onset is neonatal/infantile. This disease is characterized by a variable spectrum between severe forms with leukodystrophy, macrocephaly and severe developmental delay, and a very rare mild/juvenile form characterized by mild developmental delay. The prevalence is 1:6,400- 1:13,500 in Askenazis Jewis.	250,600
ASPM	Microcephaly primary, type 5, autosomal recessive	NM_018136.4	NM_018136.4:c.1002delA, NM_018136.4:c.3055C>T, NM_018136.4:c.2389C>T, NM_018136.4:c.2967G>A, NM_018136.4:c.1260_1266delTCAAGTC, NM_018136.4:c.10059C>A, NM_018136.4:c.1154_1155delAG, NM_018136.4:c.1179delT, NM_018136.4:c.1729_1730delAG, NM_018136.4:c.1959_1962delCAAA, NM_018136.4:c.1990C>T, NM_018136.4:c.3979C>T, NM_018136.4:c.4195dupA, NM_018136.4:c.4583delA, NM_018136.4:c.4795C>T, NM_018136.4:c.4858_4859delAT, NM_018136.4:c.5136C>A, NM_018136.4:c.5149delA, NM_018136.4:c.1366G>T, NM_018136.4:c.1406_1413delATCCTAAA, NM_018136.4:c.1590delA, NM_018136.4:c.6189T>G, NM_018136.4:c.6232C>T, NM_018136.4:c.6337_6338delAT, NM_018136.4:c.6732delA, NM_018136.4:c.719_720delCT, NM_018136.4:c.7491_7495delTATTA, NM_018136.4:c.7565T>G, NM_018136.4:c.7761T>G, NM_018136.4:c.7782_7783delGA, NM_018136.4:c.7860_7861delGA, NM_018136.4:c.7894C>T, NM_018136.4:c.8131_8132delAA, NM_018136.4:c.8230_8231insA, NM_018136.4:c.8378delT, NM_018136.4:c.8508_8509delGA, NM_018136.4:c.8668C>T, NM_018136.4:c.8844delC, NM_018136.4:c.9115_9118dupCATT, NM_018136.4:c.9159delA, NM_018136.4:c.9178C>T, NM_018136.4:c.3082G>A, NM_018136.4:c.3188T>G, NM_018136.4:c.3477_3481delCGCTA, NM_018136.4:c.349C>T, NM_018136.4:c.3527C>G, NM_018136.4:c.3663delG, NM_018136.4:c.3710C>G, NM_018136.4:c.3796G>T, NM_018136.4:c.3811C>T, NM_018136.4:c.3978G>A, NM_018136.4:c.9747_9748delCT, NM_018136.4:c.9754delA, NM_018136.4:c.9789T>A, NM_018136.4:c.8711_8712delAA, NM_018136.4:c.9190C>T, NM_018136.4:c.9238A>T, NM_018136.4:c.9319C>T, NM_018136.4:c.5439_5440delAG, NM_018136.4:c.577C>T, NM_018136.4:c.6073delG, NM_018136.4:c.9677dupG, NM_018136.4:c.9685delA, NM_018136.4:c.9697C>T, NM_018136.4:c.9730C>T, NM_018136.4:c.9557C>G, NM_018136.4:c.9492T>G, NM_018136.4:c.9539A>C	Primary autosomal recessive microcephaly type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPM gene located on chromosomal region 1q31. The age of onset is neonatal/infantile. This disease is characterized by a reduction in head circumference at birth, mild to moderate non-progressive intellectual impairment and delay in early motor milestones, speech delay and hyperactive behavior are common. The annual incidence is 1:1,000,000.	250,600
ASS1	Citrullinemia type 1	NM_000050.4	NM_000050.4:c.421-2A>G, NM_000050.4:c.40G>A, NM_000050.4:c.1088G>A, NM_000050.4:c.470G>A, NM_000050.4:c.1085G>T, NM_000050.4:c.1087C>T, NM_000050.4:c.257G>A, NM_000050.4:c.323G>T, NM_000050.4:c.349G>A, NM_000050.4:c.380G>A, NM_000050.4:c.836G>A, NM_000050.4:c.910C>T, NM_000050.4:c.928A>C, NM_000050.4:c.496-2A>G, NM_000050.4:c.535T>C, NM_000050.4:c.539G>A, NM_000050.4:c.53C>T, NM_000050.4:c.571G>A, NM_000050.4:c.787G>A, NM_000050.4:c.793C>T, NM_000050.4:c.794G>A, NM_000050.4:c.805G>A, NM_000050.4:c.835C>T, NM_000050.4:c.919C>T, NM_000050.4:c.970G>A, NM_000050.4:c.814C>T, NM_000050.4:c.970+5G>A, NM_000050.4:c.1168G>A, NM_000050.4:c.1194-1G>C, NM_000050.4:c.256C>T	Citrullinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASS1 gene located on chromosomal region 9q34.1. The age of onset is variable. This disease is characterized by hyperammonemia, progressive lethargy, poor feeding and vomiting in the neonatal form and by variable hyperammonemia in the later-onset form. The prevalence is 1:100,000-9:100,000.	250,600
ATIC	AICA-ribosiduria	NM_004044.6	NM_004044.6:c.223+1G>A, NM_004044.6:c.1277A>G, NM_004044.6:c.625delG	AICA-ribosiduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATIC gene located on chromosomal region 2q35. The age of onset is neonatal/infantile. This disease is characterized by profound intellectual deficit, epilepsy, dysmorphic features of the knees, elbows, and shoulders and congenital blindness. The prevalence is <1:1,000,000.	250,600
ATP7A	Menkes disease	NM_000052.6	NM_000052.6:c.2938C>T, NM_000052.6:c.2531G>A, NM_000052.6:c.1639C>T, NM_000052.6:c.1974_1977dupGTTT, NM_000052.6:c.3257_3258delAC, NM_000052.6:c.3294+2T>G, NM_000052.6:c.3915_3921delCTCCCCA, NM_000052.6:c.3931A>G	Menkes disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ATP7A gene located on chromosomal region Xq21.1. The age of onset is neonatal/infantile. This disease is characterized by progressive neurodegeneration and marked connective tissue anomalies as well as typical sparse abnormal steely hair. The birth incidence is 1:300,000 in Europe, 1:360,000 in Japan and 1:50,000-1:100,000 in Australia, and The prevalence is 1:100,000 newborns.	600
ATP7A	Occipital horn syndrome	NM_000052.6	NM_000052.6:c.3911A>G	Occipital horn syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ATP7A gene located on chromosomal region Xq21.1. The age of onset is variable. This disease is characterized by progressive neurodegeneration and connective tissue disorders due to a copper transport defect. The prevalence is 1:100,000 newborns.	600
ATP7A	Spinal muscular atrophy, distal, X-linked	NM_000052.6	NM_000052.6:c.2981C>T	Spinal muscular atrophy, distal follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ATP7A gene located on chromosomal region Xq21.1. The age of onset is infantile. This disease is characterized by distal weakness, atrophy of the muscles of the lower limbs, particularly in the tibioperoneal compartment and pes cavus.	600
ATP7B	Wilson disease	NM_000053.3	NM_000053.3:c.2532delA, NM_000053.3:c.2356-2A>G, NM_000053.3:c.1285+5G>T, NM_000053.3:c.2305A>G, NM_000053.3:c.1145_1151delCCCAACT, NM_000053.3:c.1934T>G, NM_000053.3:c.2071G>A, NM_000053.3:c.2297C>G, NM_000053.3:c.2972C>T, NM_000053.3:c.2975C>T, NM_000053.3:c.3083delA, NM_000053.3:c.2605G>A, NM_000053.3:c.2621C>T, NM_000053.3:c.2755C>G, NM_000053.3:c.2755C>T, NM_000053.3:c.2762G>A, NM_000053.3:c.2795C>A, NM_000053.3:c.2804C>T, NM_000053.3:c.2807T>A, NM_000053.3:c.2906G>A, NM_000053.3:c.2930C>T, NM_000053.3:c.4301C>T, NM_000053.3:c.915T>A, NM_000053.3:c.98T>C, NM_000053.3:c.1745_1746delTA, NM_000053.3:c.2123T>C, NM_000053.3:c.2267C>T, NM_000053.3:c.4088C>T, NM_000053.3:c.4135C>T, NM_000053.3:c.1512_1513insT, NM_000053.3:c.19_20delCA, NM_000053.3:c.1922T>C, NM_000053.3:c.3955C>T, NM_000053.3:c.3990_3993delTTAT, NM_000053.3:c.4058G>A, NM_000053.3:c.3207C>A, NM_000053.3:c.3359T>A, NM_000053.3:c.3688A>G, NM_000053.3:c.3101A>G, NM_000053.3:c.3796G>A, NM_000053.3:c.3809A>G, NM_000053.3:c.562C>T, NM_000053.3:c.3694A>C, NM_000053.3:c.1846C>T	Wilson disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATP7B gene located on chromosomal region 13q14.3. The age of onset is infantile. This disease is characterized by the toxic accumulation of copper, mainly in the liver and central nervous system, and symptomatic patients may present with hepatic, neurologic or psychiatric forms. The birth incidence is 1:30,000-1:100,000 in France and The prevalence is 1:10,000-1:30,000.	250,600
ATR	Seckel syndrome type 1	NM_001184.3	NM_001184.3:c.2341+1G>A, NM_001184.3:c.5645delA, NM_001184.3:c.6037_6038insA, NM_001184.3:c.6488delT, NM_001184.3:c.975_976delCT, NM_001184.3:c.5635G>T	Seckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATR gene located on chromosomal region 3q23. The age of onset is neonatal/infantile. This disease is characterized by a proportionate dwarfism of prenatal onset, a severe microcephaly with a bird-headed like appearance and mental retardation. The prevalence is <1:1,000,000.	250,600
AUH	3-Methylglutaconic aciduria type 1	NM_001698.2	NM_001698.2:c.471delT, NM_001698.2:c.559G>A, NM_001698.2:c.589C>T, NM_001698.2:c.650G>A, NM_001698.2:c.895-1G>A, NM_001698.2:c.991A>T, NM_001698.2:c.656-2A>G, NM_001698.2:c.943-2A>G	3-Methylglutaconic aciduria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AUH gene located on chromosomal region 9q22.31. The age of onset is neonatal/infantile. This disease is characterized by a variable clinical phenotype ranging from mildly delayed speech to psychomotor retardation, coma, failure to thrive, metabolic acidosis and dystonia. The prevalence is <1:1,000,000.	600
B4GALT1	Congenital disorders of glycosylation type 2d	NM_001497.3	NM_001497.3:c.1031dupC	Congenital disorder of glycosylation type 2d follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the B4GALT1 gene located on chromosomal region 9p13. The age of onset is neonatal/infantile. This disease is characterized by macrocephaly, hydrocephaly, hypotonia, myopathy and coagulation anomalies. The prevalence is <1:1,000,000.	600
B9D2	Meckel syndrome type 10	NM_030578.3	NM_030578.3:c.301A>C	Meckel syndrome type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the B9D2 gene located on chromosomal region 19q13.2. The age of onset is neonatal/infantile. This disease is characterized by a combination of renal cysts developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and polydactyly. The prevalence is <1:1,000,000.	600
BCKDHA	Maple syrup urine disease type 1A	NM_000709.3	NM_000709.3:c.1037G>A, NM_000709.3:c.1036C>T, NM_000709.3:c.1234G>A, NM_000709.3:c.14delT, NM_000709.3:c.761C>A, NM_000709.3:c.929C>G, NM_000709.3:c.964C>T, NM_000709.3:c.979G>A, NM_000709.3:c.905A>C, NM_000709.3:c.632C>T, NM_000709.3:c.659C>T, NM_000709.3:c.740_741insT, NM_000709.3:c.868G>A, NM_000709.3:c.909_910delGT, NM_000709.3:c.917delT, NM_000709.3:c.853G>C, NM_000709.3:c.796delA	Maple syrup urine disease type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHA gene located on chromosomal region 19q13.1-13.2. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:1,000,000-9:1,000,000.	250,600
BCKDHB	Maple syrup urine disease type 1B	NM_183050.2	NM_183050.2:c.1046G>A, NM_183050.2:c.547C>T, NM_183050.2:c.509G>A, NM_183050.2:c.526A>T, NM_183050.2:c.344-1G>A, NM_183050.2:c.1114G>T, NM_183050.2:c.302G>A, NM_183050.2:c.342T>G, NM_183050.2:c.508C>A, NM_183050.2:c.508C>G, NM_183050.2:c.508C>T, NM_183050.2:c.748G>T, NM_183050.2:c.752T>C, NM_183050.2:c.799C>T, NM_183050.2:c.548G>C, NM_183050.2:c.884delT, NM_183050.2:c.902T>G, NM_183050.2:c.952-1G>A, NM_183050.2:c.853C>T, NM_183050.2:c.832G>A, NM_183050.2:c.356T>G, NM_183050.2:c.970C>T, NM_183050.2:c.488A>T, NM_183050.2:c.479T>G	Maple syrup urine disease type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHB gene located on chromosomal region 6q14.1. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:10,000-5:10,000.	600
BCS1L	Björnstad syndrome	NM_004328.4	NM_004328.4:c.548G>A	Björnstadt syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal/infantile. This disease is characterized by congenital sensorineural hearing loss and pili torti. The prevalence is <1:1,000,000.	250,600
BCS1L	GRACILE syndrome	NM_004328.4	NM_004328.4:c.232A>G	GRACILE syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal/infantile. This disease is characterized by fetal growth restriction (GR), aminoaciduria (A), cholestasis (C), iron overload (I), lactacidosis (L) and early death (E). The birth incidence is 1:50,000 in Finland and the prevalence is <1:1,000,000.	250,600
BCS1L	Mitochondrial comlpex III deficiency, nuclear type 1	NM_004328.4	NM_004328.4:c.1057G>A, NM_004328.4:c.830G>A, NM_004328.4:c.133C>T, NM_004328.4:c.103G>C, NM_004328.4:c.696delT, NM_004328.4:c.148A>G, NM_004328.4:c.166C>T, NM_004328.4:c.550C>T, NM_004328.4:c.547C>T	Mitochondrial comlpex III deficiency, nuclear type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal and it is characterized by lactic acidosis, hypotonia, hypoglycemia, failure to thrive, encephalopathy, and delayed psychomotor development.	250,600
BEST1	Bestrophinopathy	NM_004183.3	NM_004183.3:c.934G>A, NM_004183.3:c.598C>T, NM_004183.3:c.752G>A, NM_004183.3:c.949G>A, NM_004183.3:c.521_522delTG	Bestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram.	250,600
BEST1	Retinitis pigmentosa type 50	NM_004183.3	NM_004183.3:c.1383_1384insGCCTTGATGGA, NM_004183.3:c.1444delG, NM_004183.3:c.1491_1497dupCAAAGAC, NM_004183.3:c.1566_1576dupCTTGATGGAGC, NM_004183.3:c.341_342delTG, NM_004183.3:c.1308_1309insACCAAAG, NM_004183.3:c.1264delG, NM_004183.3:c.418C>G, NM_004183.3:c.614T>C, NM_004183.3:c.682G>A, NM_004183.3:c.344delG, NM_004183.3:c.524delG	Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 50 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q12.3. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.	250,600
BEST1	Vitelliform macular dystrophy type 2	NM_004183.3	NM_004183.3:c.122T>C, NM_004183.3:c.422G>A	Vitelliform macular dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q12.3. The age of onset is infancy or adolescence. This disease is characterized by normal vision at birth, then progresses through distinct stages that include an asymptomatic previtelliform phase (stage 1) followed by the formation of a yellow, egg yolk-like (vitelliform) lesion in the macula (stage 2). The contents become less homogenous and develop a "scrambled-egg" appearance (stage 2a). The lesion eventually develops a fluid, yellow-colored vitelline substance (pseudohypopyon or stage 3) and finally breaks down, leaving a scar that causes central visual acuity deterioration (20/200). This may be complicated by a subfoveal choroidal neovascular (CNV) membrane (rare in children). Anomalous color discrimination (mainly the protan axis) and metamorphopsia may be observed but patients retain normal peripheral vision and dark adaptation. Some affected individuals remain asymptomatic. The prevalence is 1/5,000 to 1/67,000.	250,600
BRCA2	Fanconi anemia, complementation group D1	NM_000059.3	NM_000059.3:c.1514T>C, NM_000059.3:c.4648G>T, NM_000059.3:c.8415A>T, NM_000059.3:c.7544C>T, NM_000059.3:c.7994A>G, NM_000059.3:c.5574_5577delAATT, NM_000059.3:c.4889C>G, NM_000059.3:c.4936_4939delGAAA, NM_000059.3:c.5066_5067insA, NM_000059.3:c.6024dupG, NM_000059.3:c.6860delG, NM_000059.3:c.7235C>A, NM_000059.3:c.9382C>T, NM_000059.3:c.9900dupA, NM_000059.3:c.3847_3848delGT, NM_000059.3:c.5718_5719delCT, NM_000059.3:c.5837_5838delCAinsAG, NM_000059.3:c.6023_6024insG, NM_000059.3:c.8503T>C, NM_000059.3:c.6486_6489delACAA, NM_000059.3:c.657_658delTG, NM_000059.3:c.6997_6998insT	Fanconi anemia, complementation group D1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BRCA2 gene located on chromosomal region 13q12.3. The age of onset is infantile. This disease is characterized by physical abnormalities, bone marrow failure, and increased risk of malignancy. The prevalence is 1:1,000,000-9:1,000,000.	250,600
BRIP1	Fanconi anemia, complementation group J	NM_032043.2	NM_032043.2:c.2990_2993delCAAA, NM_032043.2:c.1045G>C, NM_032043.2:c.2237_2240delTCAA, NM_032043.2:c.3209C>A, NM_032043.2:c.502C>T, NM_032043.2:c.139C>G, NM_032043.2:c.1702_1703delAA, NM_032043.2:c.2392C>T	Fanconi anemia, complementation group J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BRIP1 gene located on chromosomal region 17q22.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:1,000,000- 9:1,000,000.	250,600
BSCL2	Berardinelli-Seip congenital lipodystrophy	NM_032667.6	NM_032667.6:c.634G>C, NM_032667.6:c.412C>T, NM_032667.6:c.782_783insG, NM_032667.6:c.823C>T, NM_032667.6:c.985C>T, NM_032667.6:c.672-3C>G, NM_032667.6:c.974_975insG, NM_032667.6:c.671+5G>A	Berardinelli-Seip congenital lipodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSCL2 gene located on chromosomal region 11q13. The age of onset is neonatal/infantile. This disease is characterized the association of lipoatrophy, hypertriglyceridemia, hepatomegaly and acromegaloid features. The prevalence is 1.27:100,000.	600
BSCL2	Severe neurodegenerative syndrome with lipodystrophy	NM_032667.6	NM_032667.6:c.793C>T	Severe neurodegenerative syndrome with lipodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSCL2 gene located on chromosomal region 11q13. The age of onset is neonatal/infantile. This disease is characterized by developmental regression of motor and cognitive skills in the first years of life, often leading to death in the first decade, hyperactive behavior, seizures, tremor and ataxic gait. Patients may show a mild or typical lipodystrophic appearance. The prevalence is 1.27:100,000.	600
BSND	Bartter syndrome type 4A	NM_057176.2	NM_057176.2:c.1A>T, NM_057176.2:c.22C>T, NM_057176.2:c.3G>A, NM_057176.2:c.10G>T, NM_057176.2:c.23G>T, NM_057176.2:c.35T>C, NM_057176.2:c.23G>A, NM_057176.2:c.139G>A	Bartter syndrome type 4A with deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSND gene located on chromosomal region 1p32.3. The age of onset is neonatal/infantile. This disease is characterized by maternal polyhydramnios, premature delivery, polyuria, sensorineural deafness and is associated with hypokalemic alkalosis, increased levels of plasma renin and aldosterone, low blood pressure, and vascular resistance to angiotensin II.	250,600
BTD	Biotinidase deficiency	NM_000060.3	NM_000060.3:c.1531C>G, NM_000060.3:c.1508_1512delGGATG, NM_000060.3:c.1339C>T, NM_000060.3:c.1352G>A, NM_000060.3:c.1489C>T, NM_000060.3:c.643C>T, NM_000060.3:c.664G>A, NM_000060.3:c.755A>G, NM_000060.3:c.1368A>C, NM_000060.3:c.933delT, NM_000060.3:c.1595C>T, NM_000060.3:c.1612C>T, NM_000060.3:c.757C>T, NM_000060.3:c.1106C>T, NM_000060.3:c.1321delG, NM_000060.3:c.794A>T, NM_000060.3:c.595G>A, NM_000060.3:c.629A>G, NM_000060.3:c.631C>T, NM_000060.3:c.235C>T, NM_000060.3:c.334G>C, NM_000060.3:c.511G>A, NM_000060.3:c.184G>A, NM_000060.3:c.557G>A, NM_000060.3:c.583A>G, NM_000060.3:c.968A>G, NM_000060.3:c.528G>T, NM_000060.3:c.443G>A	Biotinidase deficiency an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BTD gene located on chromosomal region 3p25. The age of onset is neonatal/infantile. This disease is characterized by seizures, breathing difficulties, hypotonia, skin rash, alopecia, hearing loss and delayed development.	250,600
BTK	Agammaglobulinemia, X-linked	NM_000061.2	NM_000061.2:c.1275C>A, NM_000061.2:c.1506C>A, NM_000061.2:c.1125T>G, NM_000061.2:c.1223T>C, NM_000061.2:c.1288A>G, NM_000061.2:c.1082A>G, NM_000061.2:c.763C>T, NM_000061.2:c.1516T>C, NM_000061.2:c.718G>T, NM_000061.2:c.755G>A, NM_000061.2:c.1766A>G, NM_000061.2:c.1773C>A, NM_000061.2:c.1558C>T, NM_000061.2:c.1559G>A, NM_000061.2:c.1889T>A, NM_000061.2:c.1906G>T, NM_000061.2:c.338T>A, NM_000061.2:c.1820C>A, NM_000061.2:c.862C>T, NM_000061.2:c.919A>G, NM_000061.2:c.1838G>A, NM_000061.2:c.1001A>C	X-linked agammaglobulinemia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the BTK gene located on chromosomal region Xq21.33-q22. The age of onset is infantile. This disease is characterized by recurrent bacterial infections during infancy. The prevalence is 3:1,000,000-6:1,000,000 men.	600
C10orf2	Infantile onset spinocerebellar ataxia	NM_021830.4	NM_021830.4:c.1523A>G	La ataxia espinocerebelosa infantil sigue un patrón de herencia autosómico recesivo y está causada por variantes patogénicas en el gen C10orf2 localizado en la región cromosómica 10q24. La edad de aparición es neonatal/infantil con síntomas como inicio temprano ataxia, atetosis y reducción de los reflejos tendinosos.	600
C10orf2	Mitochondrial DNA depletion syndrome, hepatocerebrorenal form	NM_021830.4	NM_021830.4:c.1287C>T, NM_021830.4:c.952G>A, NM_021830.4:c.1370C>T, NM_021830.4:c.524_525insG	Mitochondrial DNA depletion syndrome, hepatocerebrorenal form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C10orf2 gene located on chromosomal region 10q24. The age of onset is neonatal/infantile. It is a severe disease associated with mitochondrial dysfunction. Some patients are affected by progressive atrophy of the cerebellum, brain stem, the spinal cord, and sensory axonal neuropathy. Clinical features include hypotonia, athetosis, ataxia, ophthalmoplegia, sensorineural hearing deficit, sensory axonal neuropathy, epileptic encephalopathy and female hypogonadism. In some individuals liver dysfunction and multi-organ failure is present.	600
C10orf2	Sensory ataxic neuropathy - dysarthria - ophthalmoparesis	NM_021830.4	NM_021830.4:c.955A>G	Sensory ataxic neuropathy - dysarthria - ophthalmoparesis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C10orf2 gene located on chromosomal region 10q24. This syndrome is characterised by adult-onset severe sensory ataxic neuropathy, dysarthria and chronic progressive external ophthalmoplegia. The prevalence is unknown. Other common features include progressive gait unsteadiness, absent deep tendon reflexes, the presence of Romberg's sign, a decreased sense of vibration and proprioception and detection of red ragged fibres on muscle biopsy.	600
C3	Atypical hemolytic-uremic syndrome with C3 anomaly	NM_000064.2	NM_000064.2:c.2562C>G	Atypical hemolytic-uremic syndrome with C3 anomaly follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C3 gene located on chromosomal region 19p13.3-p13.2. An atypical form of hemolytic uremic syndrome. It is a complex genetic disease characterized by microangiopathic hemolytic anemia, thrombocytopenia, renal failure and absence of episodes of enterocolitis and diarrhea. In contrast to typical hemolytic uremic syndrome, atypical forms have a poorer prognosis, with higher death rates and frequent progression to end-stage renal disease. The prevalence is <1:1.000.000.	600
C3	C3 deficiency	NM_000064.2	NM_000064.2:c.2354+1G>A, NM_000064.2:c.4851-1G>A, NM_000064.2:c.1119+1G>T, NM_000064.2:c.3116dupT, NM_000064.2:c.3627_3628insGGGGCCC, NM_000064.2:c.1004-2A>T	C3 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C3 gene located on chromosomal region 19p13.3-p13.2. The age of onset is infantile. It is a rare defect of the complement classical pathway. Patients develop recurrent, severe, pyogenic infections because of ineffective opsonization of pathogens. Some patients may also develop autoimmune disorders, such as arthralgia and vasculitic rashes, lupus-like syndrome and membranoproliferative glomerulonephritis. The prevalence is <1:1.000.000.	600
CA2	Osteopetrosis, autosomal recessive, type 3	NM_000067.2	NM_000067.2:c.663+2T>C, NM_000067.2:c.319C>T, NM_000067.2:c.120T>G	Osteopetrosis, autosomal recessive, type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CA2 gene located on chromosomal region 8q22. The age of onset is neonatal/infantile. This disease is characterized by osteopetrosis, renal tubular acidosis, and neurological disorders related to cerebral calcifications. The prevalence is <1:1.000.000.	600
CAPN3	Limb-girdle muscular dystrophy type 2A	NM_000070.2	NM_000070.2:c.1838delA, NM_000070.2:c.2120A>G, NM_000070.2:c.1795_1796insA, NM_000070.2:c.1469G>A, NM_000070.2:c.1599_1602delGAGC, NM_000070.2:c.1715G>A, NM_000070.2:c.1743_1745+1delTGAG, NM_000070.2:c.257C>T, NM_000070.2:c.328C>T, NM_000070.2:c.549delA, NM_000070.2:c.2212C>T, NM_000070.2:c.223dupT, NM_000070.2:c.2243G>A, NM_000070.2:c.2251_2254dupGTCA, NM_000070.2:c.2257G>A, NM_000070.2:c.2306G>A, NM_000070.2:c.2361_2363delAGinsTCATCT, NM_000070.2:c.2361_2364delAGinsTCATCT, NM_000070.2:c.2362_2363delAGinsTCATCT, NM_000070.2:c.246G>A, NM_000070.2:c.676G>A, NM_000070.2:c.551C>T, NM_000070.2:c.580delT, NM_000070.2:c.133G>A, NM_000070.2:c.550delA, NM_000070.2:c.1468C>T, NM_000070.2:c.956C>T, NM_000070.2:c.1322delG, NM_000070.2:c.1466G>A, NM_000070.2:c.662G>T, NM_000070.2:c.855_864dupGTTGATTGCA, NM_000070.2:c.1610A>G, NM_000070.2:c.598_612delTTCTGGAGTGCTCTG	Limb-girdle muscular dystrophy type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CAPN3 gene located on chromosomal region 15q15.1. The age of onset is variable. This disease is characterized by symmetrical and selective atrophy and weakness of proximal limb and girdle muscles. The prevalence is 1:100,000- 9:100,000.	250,600
CBS	Homocystinuria	NM_000071.2	NM_000071.2:c.1150A>G, NM_000071.2:c.1058C>T, NM_000071.2:c.1136G>A, NM_000071.2:c.341C>T, NM_000071.2:c.1006C>T, NM_000071.2:c.325T>C, NM_000071.2:c.1316G>A, NM_000071.2:c.374G>A, NM_000071.2:c.1265C>T, NM_000071.2:c.1280C>T, NM_000071.2:c.146C>T, NM_000071.2:c.1471C>T, NM_000071.2:c.1616T>C, NM_000071.2:c.162G>A, NM_000071.2:c.833T>C, NM_000071.2:c.904G>A, NM_000071.2:c.919G>A, NM_000071.2:c.393G>C, NM_000071.2:c.415G>A, NM_000071.2:c.430G>A, NM_000071.2:c.434C>T, NM_000071.2:c.502G>A, NM_000071.2:c.526G>T, NM_000071.2:c.572C>T, NM_000071.2:c.676G>A, NM_000071.2:c.689delT, NM_000071.2:c.797G>A, NM_000071.2:c.959T>C, NM_000071.2:c.969G>A, NM_000071.2:c.992C>A, NM_000071.2:c.1330G>A, NM_000071.2:c.1379C>T, NM_000071.2:c.1397C>T, NM_000071.2:c.304A>C	Homocystinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CBS gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by the multiple involvement of the eye, skeleton, central nervous system and vascular system. The prevalence is 1:200,000-1:335,000.	250,600
CC2D2A	Joubert syndrome type 9	NM_001080522.2	NM_001080522.2:c.4179delG, NM_001080522.2:c.3594+1G>A, NM_001080522.2:c.3289delG, NM_001080522.2:c.4582C>T, NM_001080522.2:c.4667A>T, NM_001080522.2:c.2848C>T, NM_001080522.2:c.3364C>T, NM_001080522.2:c.4333C>T, NM_001080522.2:c.4181delG	Joubert syndrome type 9 defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized neonatal hypotonia, developmental delay, intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia, primary position nystagmus and congenital hepatic fibrosis.	250,600
CC2D2A	Meckel syndrome type 6	NM_001080522.2	NM_001080522.2:c.3145C>T, NM_001080522.2:c.2486+1G>C	Meckel syndrome type 6 with hepatic defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized by a combination of renal cysts, developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and polydactyly.	250,600
CD2AP	Focal segmental glomerulosclerosis type 3	NM_012120.2	NM_012120.2:c.730-1delGinsCT, NM_012120.2:c.1575_1577delAGA, NM_012120.2:c.1488G>A	Focal segmental glomerulosclerosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CD2AP gene located on chromosomal region 6p12. The age of onset is variable. A renal pathology defined by the presence of segmental sclerosis in glomeruli and resulting in proteinuria, reduced glomerular filtration rate and progressive decline in renal function. Renal insufficiency often progresses to end-stage renal disease, a highly morbid state requiring either dialysis therapy or kidney transplantation.	600
CD40LG	Hyper IgM syndrome, X-linked	NM_000074.2	NM_000074.2:c.386A>G, NM_000074.2:c.368C>A, NM_000074.2:c.384T>A, NM_000074.2:c.632C>A, NM_000074.2:c.107T>G	X-linked hyper-IgM syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the CD40LG gene located on chromosomal region Xq26. The age of onset is neonatal/infantile. This disease is characterized by lower-respiratory tract bacterial infections, opportunistic infections, recurrent or protracted diarrhea associated with failure to thrive, neutropenia, thrombocytopenia and anemia. The prevalence is 2:1,000,000 male newborns.	600
CDH23	Deafness type 12, autosomal recessive	NM_022124.5	NM_022124.5:c.6442G>A, NM_022124.5:c.5663T>C, NM_022124.5:c.9565C>T, NM_022124.5:c.7823G>A, NM_022124.5:c.902G>A	Non-syndromic autosomal recessive deafness type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	250,600
CDH23	Usher syndrome type 1D	NM_022124.5	NM_022124.5:c.288+1G>A, NM_022124.5:c.193delC, NM_022124.5:c.6050-9G>A, NM_022124.5:c.3141C>A, NM_022124.5:c.146-2A>G, NM_022124.5:c.4504C>T, NM_022124.5:c.3516_3519delATCC, NM_022124.5:c.3579+2T>C, NM_022124.5:c.3293A>G, NM_022124.5:c.9319+1_9319+4delGTAA, NM_022124.5:c.5237G>A, NM_022124.5:c.1858+2T>G, NM_022124.5:c.6392delC, NM_022124.5:c.7660G>A	Usher syndrome type 1D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by sensorineural deafness, retinitis pigmentosa and progressive vision loss.	250,600
CDH3	Ectodermal dysplasia - ectrodactyly - macular dystrophy	NM_001793.4	NM_001793.4:c.455_456insC, NM_001793.4:c.981delG, NM_001793.4:c.1508G>A, NM_001793.4:c.965A>T, NM_001793.4:c.830delG, NM_001793.4:c.965A>G	Ectodermal dysplasia - ectrodactyly - macular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH3 gene located on chromosomal region 16q22.1. The age of onset is neonatal/infantile. This disease is characterized by the association of ectodermal dysplasia, ectrodactyly, and macular dystrophy. The prevalence is <1:1,000,000.	600
CDHR1	Retinitis pigmentosa type 65	NM_033100.3	NM_033100.3:c.1485+2T>C, NM_033100.3:c.1463delG, NM_033100.3:c.1110delC, NM_033100.3:c.338delG, NM_033100.3:c.524dupA, NM_033100.3:c.1485+2T>G, NM_033100.3:c.1112delC, NM_033100.3:c.640delG	Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 65 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDHR1 gene located on chromosomal region 10q23.1. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.	250,600
CDK5RAP2	Microcephaly, primary, type 3, autosomal recessive	NM_018249.5	NM_018249.5:c.4661_4662insTATT, NM_018249.5:c.246T>A, NM_018249.5:c.4546G>T, NM_018249.5:c.127+1G>C, NM_018249.5:c.4672C>T, NM_018249.5:c.524_528delAGGCA, NM_018249.5:c.700G>T	Primary autosomal recessive microcephaly type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDK5RAP2 gene located on chromosomal region 9q33.2. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.	600
CENPJ	Microcephaly primary, type 6, autosomal recessive	NM_018451.4	NM_018451.4:c.3243_3246delTCAG, NM_018451.4:c.2614delT, NM_018451.4:c.3415G>T, NM_018451.4:c.3653C>T, NM_018451.4:c.2462C>T, NM_018451.4:c.3699_3702dupAATA, NM_018451.4:c.3568_3571dupGTCA, NM_018451.4:c.3843_3844insTA, NM_018451.4:c.757_760delGTCT, NM_018451.4:c.1952_1953insAGTG, NM_018451.4:c.3704A>T, NM_018451.4:c.232_236delCAGAA, NM_018451.4:c.2460_2463delGACG, NM_018451.4:c.2968_2972delAAAAA, NM_018451.4:c.40C>T, NM_018451.4:c.289dupA	Primary autosomal recessive microcephaly type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CENPJ gene located on chromosomal region 13q12.12. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.	250,600
CEP152	Microcephaly, primary, type 9, autosomal recessive	NM_014985.3	NM_014985.3:c.794A>C, NM_014985.3:c.749_750delGA	Primary autosomal recessive microcephaly type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP152 gene located on chromosomal region 15q21.1. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.	600
CEP152	Seckel syndrome type 5	NM_014985.3	NM_014985.3:c.2034T>G, NM_014985.3:c.1578-1G>A	Seckel syndrome type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP152 gene located on chromosomal region 15q21.1. The age of onset is neonatal/infantile. This disease is characterized by proportionate dwarfism of prenatal onset associated with low birth weight, growth retardation, severe microcephaly with a bird-headed like appearance, and mental retardation.	600
CEP290	Joubert syndrome, Senior-Loken type	NM_025114.3	NM_025114.3:c.5611_5614delCAAA, NM_025114.3:c.164_167delCTCA	Joubert syndrome, Senior-Loken type syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infantile. This disease is characterized by symptoms of nephronophthisis such as polyuria, polydipsia, secondary eneuresis and anemia. The progression of the disease can lead to acute or chronic renal insufficiency and finally to end-stage kidney disease. Ocular features include congenital or early-onset severe visual loss, due to retinal dystrophy. In rare occasions, other additional clinical signs may be observed like liver fibrosis, obesity and neurologic disorders.. The prevalence is <1:1,000,000.	250,600
CEP290	Joubert syndrome type 5	NM_025114.3	NM_025114.3:c.4656delA, NM_025114.3:c.21G>T, NM_025114.3:c.5668G>T	Joubert syndrome with oculorenal defect 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infantile. This disease is characterized by neonatal hypotonia, developmental delay, intellectrual disability, ataxia, abnormal eye movements including oculomotor apraxia, primary position nystagmus and renal and ocular disease.	250,600
CEP290	Leber congenital amaurosis type 10	NM_025114.3	NM_025114.3:c.7341_7342insA, NM_025114.3:c.4705-1G>T, NM_025114.3:c.4723A>T, NM_025114.3:c.4962_4963delAA, NM_025114.3:c.4916C>A, NM_025114.3:c.6624delG, NM_025114.3:c.6645+1G>A, NM_025114.3:c.7324G>T, NM_025114.3:c.6798G>A, NM_025114.3:c.7394_7395delAG, NM_025114.3:c.1681C>T, NM_025114.3:c.7341delA, NM_025114.3:c.6448_6455delCAGTTGAA, NM_025114.3:c.1665_1666delAA, NM_025114.3:c.384_387delTAGA, NM_025114.3:c.2249T>G, NM_025114.3:c.3185delT, NM_025114.3:c.4393C>T, NM_025114.3:c.1501G>T	Leber congenital amaurosis type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infancy/neonatal. This disease is characterized by retinal dystrophy defined by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.	250,600
CEP290	Meckel syndrome type 4	NM_025114.3	NM_025114.3:c.613C>T	Meckel syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is neonatal. This disease is characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically occipital encephalocele), hepatic ductal dysplasia and cysts, and postaxial polydactyly. The prevalence is <1 / 1,000,000.	250,600
CERKL	Retinitis pigmentosa tipo 26	NM_201548.4	NM_201548.4:c.1012C>T, NM_201548.4:c.1090C>T, NM_201548.4:c.312delA, NM_201548.4:c.715C>T, NM_201548.4:c.769C>T, NM_201548.4:c.780delT, NM_201548.4:c.847C>T, NM_201548.4:c.1553_1569dupTTATCAGTCTTTATGGA	Retinitis pigmentosa 26 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CERKL gene located on chromosomal region 2q31.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	250,600
CFH	Complement factor H deficiency	NM_000186.3	NM_000186.3:c.3628C>T, NM_000186.3:c.2876G>A, NM_000186.3:c.380G>T, NM_000186.3:c.481G>T, NM_000186.3:c.1606T>C	Immunodeficiency with factor H anomaly follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFH gene located on chromosomal region 1q32. This disease is characterized by recurrent bacterial infections and renal failure.	250,600
CFTR	Cystic fibrosis	NM_000492.3	NM_000492.3:c.1327_1330dupGATA, NM_000492.3:c.1210-7_1210-6delTT, NM_000492.3:c.125C>T, NM_000492.3:c.1301_1307delCACTTCT, NM_000492.3:c.1397C>A, NM_000492.3:c.1340delA, NM_000492.3:c.1364C>A, NM_000492.3:c.1393-1G>A, NM_000492.3:c.1438G>T, NM_000492.3:c.1466C>A, NM_000492.3:c.1475C>T, NM_000492.3:c.1477C>T, NM_000492.3:c.1516A>G, NM_000492.3:c.1519_1521delATC, NM_000492.3:c.1521_1523delCTT, NM_000492.3:c.1545_1546delTA, NM_000492.3:c.1624G>T, NM_000492.3:c.1692delA, NM_000492.3:c.1706A>G, NM_000492.3:c.1721C>A, NM_000492.3:c.178G>T, NM_000492.3:c.1970delG, NM_000492.3:c.200C>T, NM_000492.3:c.2012delT, NM_000492.3:c.2051_2052delAAinsG, NM_000492.3:c.2052_2053insA, NM_000492.3:c.2052delA, NM_000492.3:c.1000C>T, NM_000492.3:c.1007T>A, NM_000492.3:c.1013C>T, NM_000492.3:c.1021T>C, NM_000492.3:c.1022_1023insTC, NM_000492.3:c.1040G>A, NM_000492.3:c.1040G>C, NM_000492.3:c.1055G>A, NM_000492.3:c.1081delT, NM_000492.3:c.115C>T, NM_000492.3:c.2538G>A, NM_000492.3:c.254G>A, NM_000492.3:c.2551C>T, NM_000492.3:c.2583delT, NM_000492.3:c.262_263delTT, NM_000492.3:c.2657+5G>A, NM_000492.3:c.2668C>T, NM_000492.3:c.273+1G>A, NM_000492.3:c.2737_2738insG, NM_000492.3:c.2739T>A, NM_000492.3:c.274-1G>A, NM_000492.3:c.274G>A, NM_000492.3:c.274G>T, NM_000492.3:c.2780T>C, NM_000492.3:c.2834C>T, NM_000492.3:c.2855T>C, NM_000492.3:c.2869_2870insG, NM_000492.3:c.2875delG, NM_000492.3:c.2908G>C, NM_000492.3:c.292C>T, NM_000492.3:c.2939T>A, NM_000492.3:c.2989-1G>A, NM_000492.3:c.3067_3072delATAGTG, NM_000492.3:c.3140-26A>G, NM_000492.3:c.3194T>C, NM_000492.3:c.3196C>T, NM_000492.3:c.3197G>A, NM_000492.3:c.3230T>C, NM_000492.3:c.325_327delTATinsG, NM_000492.3:c.3266G>A, NM_000492.3:c.3276C>A, NM_000492.3:c.3276C>G, NM_000492.3:c.328G>C, NM_000492.3:c.328G>T, NM_000492.3:c.3302T>A, NM_000492.3:c.3310G>T, NM_000492.3:c.349C>T, NM_000492.3:c.350G>T, NM_000492.3:c.3528delC, NM_000492.3:c.3533_3536delCAAC, NM_000492.3:c.3587C>G, NM_000492.3:c.358G>A, NM_000492.3:c.3611G>A, NM_000492.3:c.3612G>A, NM_000492.3:c.3659delC, NM_000492.3:c.366T>A, NM_000492.3:c.3731G>A, NM_000492.3:c.3744delA, NM_000492.3:c.3752G>A, NM_000492.3:c.3761T>G, NM_000492.3:c.3764C>A, NM_000492.3:c.3773_3774insT, NM_000492.3:c.3846G>A, NM_000492.3:c.3909C>G, NM_000492.3:c.3937C>T, NM_000492.3:c.4056G>T, NM_000492.3:c.4077_4080delinsAA, NM_000492.3:c.4077_4080delTGTTinsAA, NM_000492.3:c.4251delA, NM_000492.3:c.4333G>A, NM_000492.3:c.4426C>T, NM_000492.3:c.442delA, NM_000492.3:c.445G>A, NM_000492.3:c.445G>T, NM_000492.3:c.446G>T, NM_000492.3:c.531delT, NM_000492.3:c.532G>A, NM_000492.3:c.571T>G, NM_000492.3:c.577G>T, NM_000492.3:c.579+1G>T, NM_000492.3:c.579+3A>G, NM_000492.3:c.579+5G>A, NM_000492.3:c.592G>A, NM_000492.3:c.595C>T, NM_000492.3:c.613C>T, NM_000492.3:c.617T>G, NM_000492.3:c.650A>G, NM_000492.3:c.658C>T, NM_000492.3:c.708delT, NM_000492.3:c.722_743delGGAGAATGATGATGAAGTACAG, NM_000492.3:c.803delA, NM_000492.3:c.935_937delTCT, NM_000492.3:c.988G>T, NM_000492.3:c.1046C>T, NM_000492.3:c.14C>T, NM_000492.3:c.1558G>A, NM_000492.3:c.1585-1G>A, NM_000492.3:c.1684G>C, NM_000492.3:c.1766+1G>A, NM_000492.3:c.1397C>G, NM_000492.3:c.1399C>T, NM_000492.3:c.1400T>C, NM_000492.3:c.3380G>A, NM_000492.3:c.3409A>G, NM_000492.3:c.3868C>A, NM_000492.3:c.489+1G>T, NM_000492.3:c.2537G>A, NM_000492.3:c.2125C>T, NM_000492.3:c.2128A>T, NM_000492.3:c.2175_2176insA, NM_000492.3:c.2052dupA, NM_000492.3:c.2195T>G, NM_000492.3:c.2215delG, NM_000492.3:c.223C>T, NM_000492.3:c.2175dupA, NM_000492.3:c.221G>A, NM_000492.3:c.2930C>T, NM_000492.3:c.3205G>A, NM_000492.3:c.2249C>T	Cystic fibrosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFTR gene located on chromosomal region 7q31.2. The age of onset of severe form is neonatal or infantile but there are also variants associated with moderate clinical or late onset. This disease is characterized by the production of sweat with a high salt content, mucus secretions with an abnormal viscosity, chronic bronchitis, pancreatic insufficiency, adolescent diabetes and, more rarely, stercoral obstruction and cirrhosis. Male sterility is a constant feature. Late-onset forms, which are usually only mild or monosymptomatic. The prevalence is 1:10,000-9:10,000.	250,600
CHST6	Macular corneal dystrophy	NM_021615.4	NM_021615.4:c.820G>T, NM_021615.4:c.853delC, NM_021615.4:c.993G>T, NM_021615.4:c.327_328delCT, NM_021615.4:c.392C>A	Macular corneal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CHST6 gene located on chromosomal region 16q22. The age of onset is variable. This disease is characterized by bilateral ill-defined cloudy regions within a hazy stroma, and eventually severe visual impairment. The prevalence is 1:100,000-9:100,000.	250,600
CLCN1	Myotonia congenita, autosomal recessive	NM_000083.2	NM_000083.2:c.1453A>G, NM_000083.2:c.409T>G, NM_000083.2:c.568G>A, NM_000083.2:c.899G>A, NM_000083.2:c.1169G>A, NM_000083.2:c.1238T>G, NM_000083.2:c.871G>A, NM_000083.2:c.180+3A>T, NM_000083.2:c.225dupC, NM_000083.2:c.501C>G, NM_000083.2:c.2680C>T	Myotonia congenita (Becker disease) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN1 gene located on chromosomal region 7q35. The age of onset is neonatal/infantile. This disease is characterized by slow muscle relaxation, that it is relieved with exercise, associated with hyperexcitation of the muscle fibres. The prevalence is 1:100,000.	250,600
CLCN7	Osteopetrosis type 4, autosomal recessive	NM_001287.5	NM_001287.5:c.622C>T, NM_001287.5:c.781A>T	Osteopetrosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN7 gene located on chromosomal region 16p13. The age of onset is neonatal/infantile. This disease is characterized bone marrow failure, fractures and visual impairment. The incidence is 1:200,000 live births and the prevalence is 1:100,000.	600
CLDN14	Deafness type 29, autosomal recessive	NM_144492.2	NM_144492.2:c.254T>A, NM_144492.2:c.301G>A, NM_144492.2:c.398delT	Deafness type 29, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN14 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	600
CLDN19	Hypomagnesemia type 5, renal failure with severe ocular abnormalities	NM_148960.2	NM_148960.2:c.269T>C, NM_148960.2:c.425_437delCCCTGGTGACCCA, NM_148960.2:c.59G>A, NM_148960.2:c.169C>G, NM_148960.2:c.599G>A	Hypomagnesemia type 5, renal failure with severe ocular abnormalities follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN19 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by excessive magnesium and calcium renal wasting, bilateral nephrocalcinosis, progressive renal failure and severe ocular abnormalities. The prevalence is <1:1,000,000.	250,600
CLN3	Ceroid-lipofuscinoses neuronal type 3	NM_001042432.1	NM_001042432.1:c.883G>A, NM_001042432.1:c.597C>A, NM_001042432.1:c.622_623insT, NM_001042432.1:c.1272delG, NM_001042432.1:c.1210C>A	Juvenile neuronal ceroid lipofuscinosis 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN3 gene located on chromosomal region 16p12.1. The age of onset is infantile. This disease is characterized by onset at early school age with vision loss due to retinopathy, seizures and the decline of mental and motor capacities. The annual birth incidence is 1:217,000-1:450,000 in Sweden and 1:143,000 in Germany, and the prevalence is 1.5:1,000,000-9:1,000,000.	600
CLN5	Neuronal ceroid lipofuscinosis type 5	NM_006493.2	NM_006493.2:c.619T>C, NM_006493.2:c.335G>A, NM_006493.2:c.377G>A, NM_006493.2:c.620G>C, NM_006493.2:c.669dupC, NM_006493.2:c.335G>C, NM_006493.2:c.565C>T, NM_006493.2:c.575A>G, NM_006493.2:c.593T>C, NM_006493.2:c.595C>T, NM_006493.2:c.613C>T, NM_006493.2:c.919delA, NM_006493.2:c.924_925delAT, NM_006493.2:c.955_970delGGAAATGAAACATCTG, NM_006493.2:c.835G>A, NM_006493.2:c.526dupA, NM_006493.2:c.1026C>A, NM_006493.2:c.524T>G, NM_006493.2:c.433C>T	Neuronal ceroid lipofuscinosis type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN5 gene located on chromosomal region 3q21.1-q32. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy and vision loss through retinal degeneration. The prevalence is <1:1,000,000.	600
CLN6	Ceroid lipofuscinosis, neuronal, type 6	NM_017882.2	NM_017882.2:c.200T>C, NM_017882.2:c.214G>C, NM_017882.2:c.139C>T, NM_017882.2:c.307C>T, NM_017882.2:c.214G>T, NM_017882.2:c.663C>G	Late infantile neuronal ceroid lipofuscinosis 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN6 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy and vision loss through retinal degeneration. The prevalence is <1:1,000,000.	600
CLN8	Ceroid lipofuscinosis, neuronal, type 8	NM_018941.3	NM_018941.3:c.88delG, NM_018941.3:c.789G>C, NM_018941.3:c.610C>T, NM_018941.3:c.88G>C	Late infantile neuronal ceroid lipofuscinosis 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN8 gene located on chromosomal region 8p23.3. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy, and vision loss through retinal degeneration. The prevalence is <1:1,000,000.	600
CLRN1	Retinitis pigmentosa type 61	NM_174878.2	NM_174878.2:c.92C>T	Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 61 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1gene located on chromosomal region 3q25.1. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.	250,600
CLRN1	Usher syndrome type 3A	NM_174878.2	NM_174878.2:c.591_592insT, NM_174878.2:c.630_631insT, NM_174878.2:c.118T>G, NM_174878.2:c.433+1061A>T, NM_174878.2:c.189C>A, NM_174878.2:c.144T>G	Usher syndrome type 3A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1 gene located on chromosomal region 3q25.1. The age of onset is neonatal/infantile. This disease is characterized by the association of sensorineural deafness with retinitis pigmentosa and progressive vision loss. The prevalence is 1:1.000.000- 9/1.000.000.	250,600
CNGA1	Retinitis pigmentosa type 49	NM_000087.3	NM_000087.3:c.1747C>T, NM_000087.3:c.1540C>T, NM_000087.3:c.2071T>C, NM_000087.3:c.1927C>T, NM_000087.3:c.1271G>A, NM_000087.3:c.1001G>A, NM_000087.3:c.959C>T, NM_000087.3:c.97_98insA, NM_000087.3:c.449+2T>C, NM_000087.3:c.1972delA, NM_000087.3:c.238G>T, NM_000087.3:c.794G>A, NM_000087.3:c.238G>A	Retinitis pigmentosa 49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGA1 gene located on chromosomal region 4p12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	250,600
CNGB1	Retinitis pigmentosa tipo 45	NM_001297.4	NM_001297.4:c.3150delG, NM_001297.4:c.2762_2765delACGA, NM_001297.4:c.2957A>T, NM_001297.4:c.413-1G>A, NM_001297.4:c.218-2A>G, NM_001297.4:c.2492+2T>G, NM_001297.4:c.3462+1G>A, NM_001297.4:c.2653delG, NM_001297.4:c.3425delT, NM_001297.4:c.1122-2A>T, NM_001297.4:c.1958-1G>A, NM_001297.4:c.952C>T	Retinitis pigmentosa 45 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB1 gene located on chromosomal region 16q13. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000 to 5:10,000.	250,600
CNGB3	Achromatopsia type 3	NM_019098.4	NM_019098.4:c.2011G>T, NM_019098.4:c.1063C>T, NM_019098.4:c.1208G>A, NM_019098.4:c.1672G>T, NM_019098.4:c.819_826delCAGACTCC, NM_019098.4:c.1148delC, NM_019098.4:c.886_890delACTTC, NM_019098.4:c.2048_2049delCA, NM_019098.4:c.446_447insT, NM_019098.4:c.893_897delCAAAA, NM_019098.4:c.887_896delCTTCTACAAA	Achromatopsia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is neonatal/Infantile. This disease is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, and reduced or complete loss of color discrimination. Most individuals have complete form, with total lack of function in all three types of cones. Rarely, individuals have incomplete form, with similar, but generally less severe symptoms. The prevalence is 1/30,000-1/50,000.	250,600
CNGB3	Macular degeneration, juvenile	NM_019098.4	NM_019098.4:c.1405T>G	Juvenile macular degeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is infancy or adolescence. This disease is characterized by blurred or distorted central vision with dark areas. Normally, side vision is not affected, but the perception of color can vary during the later stages of the disease.	250,600
COL11A1	Stickler syndrome type 2	NM_001854.3	NM_001854.3:c.1750dupG, NM_001854.3:c.2350G>C, NM_001854.3:c.4606C>G, NM_001854.3:c.4642C>G, NM_001854.3:c.3709-1G>A	Stickler syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL11A1 gene located on chromosomal region 1p21. The age of onset is neonatal/infantile. Autosomal recessive Stickler syndrome is a rare type of Stickler syndrome manifesting with opthalmological (myopia, retinal detachment and cataracts), orofacial (micrognathia, midface hypoplasia and cleft palate) auditory (sensorineural hearing loss) and articular (epiphyseal dysplasia) symptoms.	600
COL17A1	Epidermolysis bullosa, junctional, non-Herlitz type	NM_000494.3	NM_000494.3:c.1898G>A, NM_000494.3:c.3827_3828insC, NM_000494.3:c.2228-3_2235delCAGGTCCTGCTinsTTG, NM_000494.3:c.1706delC, NM_000494.3:c.2336-2A>G, NM_000494.3:c.3897_3900delATCT, NM_000494.3:c.3908G>A, NM_000494.3:c.2336-1G>T, NM_000494.3:c.2965delA, NM_000494.3:c.3043C>T, NM_000494.3:c.3067C>T, NM_000494.3:c.3277+1G>A, NM_000494.3:c.3676C>T, NM_000494.3:c.4319_4320insC, NM_000494.3:c.433C>T, NM_000494.3:c.520_521delAG, NM_000494.3:c.4003_4004delGG, NM_000494.3:c.2551+1G>T, NM_000494.3:c.3800delC, NM_000494.3:c.2564T>G, NM_000494.3:c.2430_2431insCCGA, NM_000494.3:c.2383C>T, NM_000494.3:c.2944_2947+1delGAAGG	Epidermolysis bullosa, junctional, non-Herlitz type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL17A1 gene located on chromosomal region 10q24.3. The age of onset is neonatal/infantile. This disease is characterized by a generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.	250,600
COL18A1	Knobloch syndrome type 1	NM_030582.3	NM_030582.3:c.3367_3379delCCCCCAGGCCCAC, NM_030582.3:c.3493_3501delGGCCCCCCA, NM_030582.3:c.2797C>T, NM_030582.3:c.995_996insGACGTGAAAGAGGGG, NM_030582.3:c.3502_3511delGGCCCCCCAG, NM_030582.3:c.3618_3618+1delGG, NM_030582.3:c.994_995insGGACGTGAAAGAGGG, NM_030582.3:c.3517_3518delCC, NM_030582.3:c.1535_1536insGACGTGAAAGAGGGG, NM_030582.3:c.2589_2590delAG, NM_030582.3:c.4054_4055delCT, NM_030582.3:c.4463_4464insG	Knobloch syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL18A1 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by vitreoretinal and macular degeneration, and occipital encephalocele. The prevalence is <1:1,000,000.	250,600
COL1A2	Ehlers-Danlos syndrome, cardiac valvular type	NM_000089.3	NM_000089.3:c.3601G>T, NM_000089.3:c.1404+1G>A, NM_000089.3:c.559G>C, NM_000089.3:c.133-1G>A, NM_000089.3:c.1404+1G>C, NM_000089.3:c.240_247delGTATGATG, NM_000089.3:c.293_294insC	Ehlers-Danlos syndrome, cardiac valvular type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL1A2 gene located on chromosomal region 7q22.1. The age of onset is neonatal/infantile. This disease is characterized by joint hypermobility, skin hyperextensibility and cardiac valvular defects. The prevalence is 6/100,000 to 7/100,000.	600
COL2A1	Otospondylomegaepiphyseal dysplasia	NM_001844.4	NM_001844.4:c.1052delG, NM_001844.4:c.3106C>T	Otospondylomegaepiphyseal dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL2A1 gene located on chromosomal region 12q13.11. The age of onset is neonatal/infantile. This disease is characterized by sensorineural hearing loss, enlarged epiphyses, skeletal dysplasia with disproportionately short limbs, vertebral body anomalies and a characteristic facies. The prevalence is 1:7,500-1:9,000.	600
COL4A3	Alport syndrome, autosomal recessive	NM_000091.4	NM_000091.4:c.345delG, NM_000091.4:c.346C>A, NM_000091.4:c.898G>A, NM_000091.4:c.4421T>C, NM_000091.4:c.2110delC, NM_000091.4:c.343delG, NM_000091.4:c.4420_4424delCTTTT, NM_000091.4:c.5002_*6delAAAAGACACTGAAGCTAA, NM_000091.4:c.2083G>A, NM_000091.4:c.2954G>T, NM_000091.4:c.4484A>G, NM_000091.4:c.4571C>G, NM_000091.4:c.4441C>T	Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.	250,600
COL4A4	Alport syndrome, autosomal recessive	NM_000092.4	NM_000092.4:c.3713C>A, NM_000092.4:c.4129C>T, NM_000092.4:c.4923C>A, NM_000092.4:c.3601G>A, NM_000092.4:c.2312delG, NM_000092.4:c.71+1G>A	Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.	250,600
COL7A1	Epidermolysis bullosa dystrophica, Hallopeau-Siemens type	NM_000094.3	NM_000094.3:c.4039G>C, NM_000094.3:c.425A>G, NM_000094.3:c.336C>G, NM_000094.3:c.3809C>T, NM_000094.3:c.4119+1G>T, NM_000094.3:c.6205C>T, NM_000094.3:c.6527_6528insC, NM_000094.3:c.6573+1G>T, NM_000094.3:c.6187C>T, NM_000094.3:c.6752G>A, NM_000094.3:c.6859G>A, NM_000094.3:c.6946G>A, NM_000094.3:c.6670G>T, NM_000094.3:c.1907G>T, NM_000094.3:c.2471_2472insG, NM_000094.3:c.7440+4delC, NM_000094.3:c.7912G>T, NM_000094.3:c.7930-1G>C, NM_000094.3:c.7957G>A, NM_000094.3:c.8245G>A, NM_000094.3:c.8371C>T, NM_000094.3:c.8393T>A, NM_000094.3:c.8440C>T, NM_000094.3:c.8479C>T, NM_000094.3:c.8524_8527+10delGAAGGTGAGGACAG, NM_000094.3:c.887delG, NM_000094.3:c.933C>A, NM_000094.3:c.238G>T, NM_000094.3:c.3831+1G>T, NM_000094.3:c.4373C>T, NM_000094.3:c.6091G>A, NM_000094.3:c.4888C>T, NM_000094.3:c.5052+1G>A, NM_000094.3:c.5096C>T, NM_000094.3:c.4783G>C, NM_000094.3:c.5443G>C, NM_000094.3:c.5532+1G>A, NM_000094.3:c.5821-1G>A, NM_000094.3:c.5287C>T, NM_000094.3:c.706C>T, NM_000094.3:c.7345-1G>A, NM_000094.3:c.592G>A, NM_000094.3:c.7411C>T	Epidermolysis bullosa dystrophica, Hallopeau-Siemens type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL7A1 gene located on chromosomal region 3p21.1. The age of onset is neonatal/infantile. This disease is characterized by generalized cutaneous and mucosal blistering and scarring associated with severe deformities and major extracutaneous involvement. The prevalence is <1:1,000,000.	250,600
COL9A1	Stickler syndrome type 4	NM_001851.4	NM_001851.4:c.883C>T, NM_001851.4:c.706C>T	Stickler syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL9A1 gene located on chromosomal region 6q13. The age of onset is infantile. This disease is characterized by opthalmological (myopia, retinal detachment and cataracts), orofacial (micrognathia, midface hypoplasia and cleft palate) auditory (sensorineural hearing loss) and articular (epiphyseal dysplasia) symptoms. The prevalence is <1:1,000,000.	600
COL9A2	Stickler syndrome type 5	NM_001852.3	NM_001852.3:c.1918C>T, NM_001852.3:c.1097_1098insC, NM_001852.3:c.793-1G>C	Stickler syndrome type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL9A2 gene located on chromosomal region 1p33-p32. The age of onset is infantile. This disease is characterized by opthalmological (myopia, retinal detachment and cataracts), orofacial (micrognathia, midface hypoplasia and cleft palate) auditory (sensorineural hearing loss) and articular (epiphyseal dysplasia) symptoms. The prevalence is <1:1,000,000.	600
COQ2	Primary coenzyme Q10 deficiency type 1	NM_015697.7	NM_015697.7:c.683A>G, NM_015697.7:c.1197delT, NM_015697.7:c.590G>A, NM_015697.7:c.723delT, NM_015697.7:c.890A>G	Coenzyme Q10 deficiency, primary follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ2 gene located on chromosomal region 4q21.23. The age of onset is neonatal/infantile. The phenotypes include an encephalomyopathic form with seizures and ataxia; a multisystem infantile form with encephalopathy, cardiomyopathy and renal failure; a predominantly cerebellar form with ataxia and cerebellar atrophy; Leigh syndrome with growth retardation; and an isolated myopathic form.	250,600
CPS1	Carbamoylphosphate synthetase type 1 deficiency	NM_001875.4	NM_001875.4:c.1912C>T, NM_001875.4:c.697C>T, NM_001875.4:c.1631C>T, NM_001875.4:c.3556delA	Carbamoylphosphate synthetase deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPS1 gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by congenital hyperammonemia and defective citrulline synthesis. The prevalence is 1:800,000 newborn in Japan.	600
CPT1A	Carnitine palmitoyltransferase type 1A deficiency	NM_001876.3	NM_001876.3:c.1216C>T, NM_001876.3:c.1241C>T, NM_001876.3:c.1361A>G, NM_001876.3:c.222C>A, NM_001876.3:c.1079A>G, NM_001876.3:c.1436C>T, NM_001876.3:c.1493A>G, NM_001876.3:c.335_336delCC, NM_001876.3:c.1393G>T, NM_001876.3:c.281+1G>A, NM_001876.3:c.1538C>T, NM_001876.3:c.298C>T	Carnitine palmitoyl transferase 1A deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT1A gene located on chromosomal region 11q13.2. The age of onset is neonatal/infantile. This disease is characterized by recurrent attacks of fasting-induced hypoketotic hypoglycemia and risk of liver failure. The prevalence is 1.3:1,000 newborn.	600
CPT2	Carnitine palmitoyltransferase deficiency, type 2	NM_000098.2	NM_000098.2:c.1239_1240delGA, NM_000098.2:c.1369A>T, NM_000098.2:c.1237C>T, NM_000098.2:c.680C>T, NM_000098.2:c.1437C>G, NM_000098.2:c.149C>A, NM_000098.2:c.1784delC, NM_000098.2:c.886C>T, NM_000098.2:c.1763C>G, NM_000098.2:c.359A>G, NM_000098.2:c.370C>T, NM_000098.2:c.1883A>C, NM_000098.2:c.1891C>T, NM_000098.2:c.1148T>A, NM_000098.2:c.638A>G, NM_000098.2:c.725_726delAC, NM_000098.2:c.452G>A, NM_000098.2:c.338C>T, NM_000098.2:c.481C>T, NM_000098.2:c.464dupT, NM_000098.2:c.520G>A	Carnitine palmitoyl transferase type 2 deficiency, infantile form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT2 gene located on chromosomal region 1p32. The age of onset is neonatal/infantile. This disease is characterized by a severe fasting intolerance leading to metabolic derangements of hypoketotic hypoglycemia, resulting in coma and seizures, and hepatic encephalopathy leading to liver failure. The prevalence is <1:1,000,000.	250,600
CRB1	Leber congenital amaurosis type 8	NM_201253.2	NM_201253.2:c.3299T>G, NM_201253.2:c.3383delT, NM_201253.2:c.3419T>A, NM_201253.2:c.3094G>A, NM_201253.2:c.936T>G, NM_201253.2:c.493_501delGATGGAATT, NM_201253.2:c.3997G>T, NM_201253.2:c.498_506delAATTGATGG, NM_201253.2:c.2688T>A, NM_201253.2:c.613_619delATAGGAA, NM_201253.2:c.2401A>T, NM_201253.2:c.610_616delGAAATAG	Leber congenital amaurosis follows an autosomal recessive pattern of inheritance. Type 8 is caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. The age of onset is neonatal/infancy. This disease comprises a group of early-onset childhood retinal dystrophies characterized by vision loss, nystagmus, and severe retinal dysfunction. Patients usually present at birth with profound vision loss and pendular nystagmus. Electroretinogram responses are usually nonrecordable. Other clinical findings may include high hypermetropia, photodysphoria, oculodigital sign, keratoconus, cataracts, and a variable appearance to the fundus.	250,600
CRB1	Pigmented paravenous chorioretinal atrophy	NM_201253.2	NM_201253.2:c.484G>A	Pigmented paravenous chorioretinal atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRB1 gene located on chromosomal region 19p12. The age of onset is variable. This disease is characterized by an unusual retinal degeneration characterized by accumulation of pigmentation along retinal veins.	250,600
CRB1	Retinitis pigmentosa type 12	NM_201253.2	NM_201253.2:c.3053_3054insTTATA, NM_201253.2:c.3122T>C, NM_201253.2:c.2416G>T, NM_201253.2:c.2843G>A, NM_201253.2:c.3299T>C, NM_201253.2:c.2983G>T, NM_201253.2:c.2290C>T	Retinitis pigmentosa 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	250,600
CRLF1	Cold-induced sweating syndrome	NM_004750.4	NM_004750.4:c.538C>T, NM_004750.4:c.303delC, NM_004750.4:c.413C>T, NM_004750.4:c.527+5G>A, NM_004750.4:c.226T>G, NM_004750.4:c.829C>T, NM_004750.4:c.397+1G>A, NM_004750.4:c.708_709delCCinsT, NM_004750.4:c.713_714insC, NM_004750.4:c.1125delG, NM_004750.4:c.676dupA, NM_004750.4:c.856-1G>A, NM_004750.4:c.852G>T, NM_004750.4:c.935G>A, NM_004750.4:c.1137C>G, NM_004750.4:c.845_846delTG	Cold-induced sweating syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRLF1 gene located on chromosomal region 19p12. The age of onset is infantile. This disease is characterized by profuse sweating (involving the chest, face, arms and trunk) induced by cold ambient temperature kyphoscoliosis, a high-arched palate, depressed nasal bridge and impaired peripheral sensitivity to pain and temperature. The prevalence is <1:1,000,000.	600
CRTAP	Osteogenesis imperfecta type 7	NM_006371.4	NM_006371.4:c.826C>T, NM_006371.4:c.180G>A, NM_006371.4:c.561T>G, NM_006371.4:c.634C>T	Osteogenesis imperfecta type VII follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRTAP gene located on chromosomal region 3p22.3. The age of onset is variable. This disease is characterized by increased bone fragility, low bone mass, and susceptibility to bone fractures with variable severity. The prevalence is 6:100,000-7:100,000.	600
CRX	Leber congenital amaurosis type 7	NM_000554.4	NM_000554.4:c.425A>G, NM_000554.4:c.196G>A, NM_000554.4:c.898T>C	Leber congenital amaurosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRX gene located on chromosomal region 19q13.3. The age of onset is neonatal/infantile. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. The prevalence is 2:100,000-3:100,000 newborn.	250,600
CSTB	Progressive myoclonic epilepsy type 1A	NM_000100.3	NM_000100.3:c.212A>C, NM_000100.3:c.202C>T	Progressive myoclonic epilepsy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CSTB gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by severe, stimulus-sensitive myoclonus and tonic-clonic seizures. The onset, occurring between 6 and 13 years of age, is characterized by convulsions. Myoclonus begins 1 to 5 years later. The twitchings occur predominantly in the proximal muscles of the extremities and are bilaterally symmetrical, although asynchronous. At first small, they become late in the clinical course so violent that the victim is thrown to the floor. Mental deterioration and eventually dementia develop. The prevalence is 1:20,000 newborn.	600
CTNS	Cystinosis, ocular nonnephropathic	NM_004937.2	NM_004937.2:c.589G>A, NM_004937.2:c.853-3C>G	Ocular non nephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. It presents typical ocular findings of nephropathic cystinosis. However, systemic manifestations are absent and kidney disease does not occur. The prevalence is 1:100,000-1:200,000.	250,600
CTNS	Nephropathic cystinosis	NM_004937.2	NM_004937.2:c.416C>T, NM_004937.2:c.414G>A, NM_004937.2:c.124G>A, NM_004937.2:c.357_360delCAGC, NM_004937.2:c.397_398delAT, NM_004937.2:c.1015G>A, NM_004937.2:c.646dupA, NM_004937.2:c.283G>T, NM_004937.2:c.329G>T, NM_004937.2:c.506G>A	Nephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. This disease is characterized by hypothyroidism, insulin-dependent diabetes, hepatosplenomegaly with portal hypertension, and muscle, cerebral and ocular involvement, caused by cystine deposits in various organs. The prevalence is 1:100,000-1:200,000.	250,600
CTSD	Ceroid lipofuscinosis, neuronal, type 10	NM_001909.4	NM_001909.4:c.685T>A, NM_001909.4:c.1149G>C	Neuronal ceroid lipofuscinosis type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSD gene located on chromosomal region 11p15.5. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 2:100,000-4:100,000 newborn.	600
CTSK	Pycnodysostosis	NM_000396.3	NM_000396.3:c.236G>A, NM_000396.3:c.154A>T, NM_000396.3:c.436G>C, NM_000396.3:c.926T>C, NM_000396.3:c.721C>T	Pycnodysostosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSK gene located on chromosomal region 1q21. The age of onset is variable. This disease is characterized by osteosclerosis, short stature or dwarfism, acroosteolysis of the distal phalanges, fragile bones associated with spontaneous fractures and dysplasia of the clavicles. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
CYP21A2	Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency	-	hybrid 5'CYP21A1P/3'CYP21A2, hybrid 5'CYP21A2/3'CYP21A1P (Detection by MLPA)	Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP21A2 gene located on chromosomal region 6p21.3. The age of onset is neonatal/infantile. This disease is characterized by simple virilizing or salt wasting forms that can manifest with genital ambiguity in females, and in both sexes with adrenal insufficiency with dehydration during the neonatal period, life threatening hypoglycemia and hyperandrogenia. The prevalence is 1/100,000 to 9/100,000.	600
CYP21A2	Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency	NM_000500.7	NM_000500.7:c.518T>A, NM_000500.7:c.955C>T, NM_000500.7:c.1069C>T, NM_000500.7:c.719T>A, NM_000500.7:c.[713T>A;719T>A], NM_000500.7:c.293-13A/C>G, NM_000500.7:c.332_339del, NM_000500.7:c.[710T>A;719T>A], NM_000500.7:c.923_924insT, NM_000500.7:c.[710T>A;713T>A], NM_000500.7:c.713T>A, NM_000500.7:c.[710T>A;713T>A;719T>A], NM_000500.7:c.710T>A (Detection by minisequencing)	Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP21A2 gene located on chromosomal region 6p21.3. The age of onset is neonatal/infantile. This disease is characterized by simple virilizing or salt wasting forms that can manifest with genital ambiguity in females, and in both sexes with adrenal insufficiency with dehydration during the neonatal period, life threatening hypoglycemia and hyperandrogenia. The prevalence is 1/100,000 to 9/100,000.	600
CYP21A2	Non-classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency	NM_000500.7	NM_000500.7:c.92C>T, NM_000500.7:c.844G>T, NM_000500.7:c.1360C>T (Detection by minisequencing)	Nonclassic congenital adrenal hyperplasia due to 21-hydroxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP21A2 gene located on chromosomal region 6p21.3. This is a common milder form of congenital adrenal hyperplasia characterized by a later onset of androgen excess symptoms seen in females and precocious pseudopuberty in both sexes. Cortisol and aldosterone levels are normal but there is an increased amount of androgens. Disease onset occurs in adolescence with variable degrees of postnatal androgen excess (precocious pubarche, hirsutism, acne, alopecia, anovulation and menstrual irregularies and in the post-pubertal period it can mimic polycystic ovary syndrome. It is also sometimes asymptomatic. The prevalence ranges from 1/1,000-1/500 in the general Caucasian population, but up to 1-2% among inbred populations, such as Eastern European (Ashkenazi) Jews.	600
CYP4V2	Bietti crystalline corneoretinal dystrophy	NM_207352.3	NM_207352.3:c.1523G>A, NM_207352.3:c.130T>A, NM_207352.3:c.327+1G>A, NM_207352.3:c.332T>C	Bietti crystalline corneoretinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP4V2 gene located on chromosomal region 4q35.2. The age of onset is adult. This disease is characterized by nightblindness, decreased vision, paracentral scotoma, and, in the end stages of the disease, legal blindness.	250,600
CYP7B1	Congenital bile acid synthesis defect type 3	NM_004820.3	NM_004820.3:c.1162C>T	Congenital bile acid synthesis defect type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by severe neonatal cholestatic liver disease. The prevalence is below 1,000,000.	250,600
CYP7B1	Spastic paraplegia type 5A, autosomal recessive	NM_004820.3	NM_004820.3:c.1460_1461insT, NM_004820.3:c.321_324delACAA, NM_004820.3:c.825T>A, NM_004820.3:c.889A>G, NM_004820.3:c.1456C>T, NM_004820.3:c.187C>T	Autosomal recessive spastic paraplegia type 5A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. The prevalence is below 1,000,000.	250,600
D2HGDH	D-2-Hydroxyglutaric aciduria	NM_152783.4	NM_152783.4:c.1315A>G, NM_152783.4:c.1276G>A, NM_152783.4:c.440T>G, NM_152783.4:c.1333_1334delAC, NM_152783.4:c.1123G>T, NM_152783.4:c.1331T>C	D-2-Hydroxyglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the D2HGDH gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by extremely variable clinical manifestations, with severe cases characterized by neonatal or early infantile-onset epileptic encephalopathy, and marked hypotonia, and cerebral visual failure, developmental delay, seizures, involuntary movements, and cardiomyopathy are also common in these cases. The prevalence is below 1,000,000.	250,600
DBT	Maple syrup urine disease type 2	NM_001918.3	NM_001918.3:c.670G>T, NM_001918.3:c.827T>G, NM_001918.3:c.294C>G, NM_001918.3:c.581C>G, NM_001918.3:c.772+1G>A, NM_001918.3:c.272_275delCAGT, NM_001918.3:c.1281+1G>A, NM_001918.3:c.871C>T, NM_001918.3:c.901C>T, NM_001918.3:c.939G>C, NM_001918.3:c.126T>G	Maple syrup urine disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DBT gene located on chromosomal region 1p31. The age of onset is neonatal/infantile. This disease is characterized by a maple syrup odor in the cerumen at birth, poor feeding, lethargy and focal dystonia, followed by progressive encephalopathy and central respiratory failure if untreated. The prevalence is 1/10,000 to 5/10,000.	250,600
DCLRE1C	Omenn syndrome	NM_001033855.2	NM_001033855.2:c.2T>C	Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency.	250,600
DCLRE1C	Severe combined immunodeficiency due to DCLRE1C deficiency	NM_001033855.2	NM_001033855.2:c.1558_1559insA, NM_001033855.2:c.597C>A, NM_001033855.2:c.780+1delG, NM_001033855.2:c.1639G>T, NM_001033855.2:c.1903_1904insA, NM_001033855.2:c.457G>A, NM_001033855.2:c.1559_1560insA	Severe combined immunodeficiency due to DCLRE1C deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DCLRE1C gene located on chromosomal region 10p13. The age of onset is neonatal/infantile. This disease is characterized by severe and recurrent infections, diarrhea, failure to thrive, and cell sensitivity to ionizing radiation. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
DDB2	Xeroderma pigmentosum complementation group E	NM_000107.2	NM_000107.2:c.730A>G, NM_000107.2:c.937C>T, NM_000107.2:c.818G>A, NM_000107.2:c.919G>T	Xeroderma pigmentosum complementation group E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DDB2 gene located on chromosomal region 11p12-p11. The age of onset is variable. This disease is characterized by mild xeroderma pigmentosum symptoms and no neurological abnormalities. The prevalence is 1/1,000,000.	600
DDC	Aromatic L-amino acid decarboxylase deficiency	NM_000790.3	NM_000790.3:c.100delG, NM_000790.3:c.1040G>A, NM_000790.3:c.823G>A, NM_000790.3:c.304G>A, NM_000790.3:c.272C>T, NM_000790.3:c.749C>T	Aromatic L-amino acid decarboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DDC gene located on chromosomal region 7p12.2. The age of onset is neonatal/infantile. This disease is characterized by severe developmental delay, weak muscle tone (hypotonia), muscle stiffness, difficulty moving, and involuntary writhing movements of the limbs (athetosis). The prevalence is below 1,000,000.	600
DFNB31	Deafness type 31, autosomal recessive	NM_015404.3	NM_015404.3:c.1135C>T, NM_015404.3:c.817C>T	Deafness, autosomal recessive type 31 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DFNB31 gene located on chromosomal region 9q32. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	250,600
DFNB59	Deafness type 59, autosomal recessive	NM_001042702.3	NM_001042702.3:c.122delA, NM_001042702.3:c.420delT, NM_001042702.3:c.113dupT, NM_001042702.3:c.988delG, NM_001042702.3:c.726delT, NM_001042702.3:c.161C>T, NM_001042702.3:c.817_818insT	Autosomal recessive nonsyndromic sensorineural deafness type DFNB59 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DFNB59 gene located on chromosomal region 2q31.2. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	600
DGUOK	Mitochondrial DNA depletion syndrome type 3	NM_080916.2	NM_080916.2:c.137A>G, NM_080916.2:c.707+2T>G, NM_080916.2:c.763G>T, NM_080916.2:c.425G>A, NM_080916.2:c.313C>T, NM_080916.2:c.494A>T	Mitochondrial DNA depletion syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DGUOK gene located on chromosomal region 2p13. The age of onset is neonatal/infantile. This disease is characterized by progressive liver failure, hypoglycemia and neurologic abnormalities including hypotonia, encephalopathy and peripheral neuropathy	250,600
DHCR7	Smith-Lemli-Opitz syndrome	NM_001360.2	NM_001360.2:c.1055G>A, NM_001360.2:c.1210C>T, NM_001360.2:c.1054C>T, NM_001360.2:c.461C>G, NM_001360.2:c.151C>T, NM_001360.2:c.1031G>A, NM_001360.2:c.453G>A, NM_001360.2:c.506C>T, NM_001360.2:c.356A>T, NM_001360.2:c.1228G>A, NM_001360.2:c.1A>G, NM_001360.2:c.976G>T, NM_001360.2:c.964-1G>C, NM_001360.2:c.682C>T, NM_001360.2:c.452G>A, NM_001360.2:c.1337G>A, NM_001360.2:c.1342G>A, NM_001360.2:c.730G>A, NM_001360.2:c.292C>T, NM_001360.2:c.904T>C, NM_001360.2:c.907G>A, NM_001360.2:c.841G>A, NM_001360.2:c.744G>T, NM_001360.2:c.724C>T, NM_001360.2:c.725G>A, NM_001360.2:c.866C>T, NM_001360.2:c.278C>T, NM_001360.2:c.839A>G, NM_001360.2:c.832-1G>C	Smith-Lemli-Opitz syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHCR7 gene located on chromosomal region 11q13.4. The age of onset is neonatal/infantile. This disease is characterized by multiple congenital anomalies, intellectual deficit, and behavioral problems. The prevalence is 1/20,000 to 1/40,000 newborn.	250,600
DHDDS	Retinitis pigmentosa type 59	NM_024887.3	NM_024887.3:c.328delA, NM_024887.3:c.998C>G, NM_024887.3:c.124A>G	Retinitis pigmentosa type 59 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHDDS gene located on chromosomal region 1p36.11. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000.	600
DKC1	Dyskeratosis congenita, X-linked	NM_001363.4	NM_001363.4:c.91C>A, NM_001363.4:c.214_215delCTinsTA, NM_001363.4:c.194G>C, NM_001363.4:c.838A>C, NM_001363.4:c.91C>G, NM_001363.4:c.196A>G	Dyskeratosis congenital, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DKC1 gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by the mucocutaneous triad of abnormal skin pigmentation, nail dystrophy and mucosal leucoplakia. The prevalence is 1-9/1,000,000.	600
DKC1	Hoyeraal-Hreidarsson syndrome	NM_001363.4	NM_001363.4:c.200C>T, NM_001363.4:c.204C>A	Hoyeraal-Hreidarsson syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DKC1 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by intrauterine growth retardation, microcephaly, cerebellar hypoplasia, progressive combined immune deficiency and aplastic anemia. The prevalence is below 1/1,000,000.	600
DLD	Dihydrolipoamide dehydrogenase deficiency E3	NM_000108.4	NM_000108.4:c.916_926delTGTGATGTACT, NM_000108.4:c.105_106insA, NM_000108.4:c.1483A>G	Dihydrolipoamide dehydrogenase deficiency E3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DLD gene located on chromosomal region 7q31-q32. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting and a maple syrup odor in the cerumen (and later in urine) noted soon after birth, followed by progressive encephalopathy and central respiratory failure if untreated. The prevalence is 1/1,000,000 to 9/1,000,000.	600
DLL3	Spondylocostal dysostosis type 1	NM_016941.3	NM_016941.3:c.231C>A, NM_016941.3:c.712C>T	Spondylocostal dysostosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DLL3 gene located on chromosomal region 19q13. The age of onset is neonatal/infantile. This disease is associated with vertebral and rib segmentation defects and characterised by a short neck with limited mobility, winged scapulae, a short trunk, and short stature with multiple vertebral anomalies at all levels of the spine. The prevalence is below 1/1,000,000.	600
DMD	Becker muscular dystrophy	NM_004006.2	NM_004006.2:c.3432+3A>G, NM_004006.2:c.3432+1G>A, NM_004006.2:c.137A>T	Becker muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/18,000 to 1/31,000 male newborns and the prevalence is 1/10,000 to 5/10,000.	600
DMD	Becker muscular dystrophy	-	insBecker, delBecker (Detection by MLPA)	Becker muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/18,000 to 1/31,000 male newborns and the prevalence is 1/10,000 to 5/10,000.	600
DMD	Dilated cardiomyopathy type 3B	NM_004006.2	NM_004006.2:c.5922+3G>C	Dilated cardiomyopathy type 3B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is variable. This disease is characterized by ventricular dilatation and impaired systolic function. Patients with DCM suffer from heart failure, arrhythmia, and are at risk of premature death. The incidence is 1/3,300 male newborns and the prevalence is 1/16,000 to 1/125,000.	600
DMD	Duchenne muscular dystrophy	NM_004006.2	NM_004006.2:c.1261C>T, NM_004006.2:c.1286C>A, NM_004006.2:c.1070delC, NM_004006.2:c.10086+1G>A, NM_004006.2:c.1886C>A, NM_004006.2:c.1900A>T, NM_004006.2:c.10774delA, NM_004006.2:c.204dupC, NM_004006.2:c.1900_1903dupAAGT, NM_004006.2:c.10141C>T, NM_004006.2:c.10033C>T, NM_004006.2:c.10453_10454delCT, NM_004006.2:c.1012G>T, NM_004006.2:c.1048G>T, NM_004006.2:c.2302C>T, NM_004006.2:c.1734delA, NM_004006.2:c.2380+1G>C, NM_004006.2:c.2380+2T>C, NM_004006.2:c.2479delG, NM_004006.2:c.2482T>G, NM_004006.2:c.2484T>G, NM_004006.2:c.251delT, NM_004006.2:c.2523delA, NM_004006.2:c.10446_10447delCT, NM_004006.2:c.2650C>T, NM_004006.2:c.10454delT, NM_004006.2:c.2294_2297delCCAT, NM_004006.2:c.2803+1G>A, NM_004006.2:c.2803+1G>T, NM_004006.2:c.2804-1G>A, NM_004006.2:c.2804-2A>T, NM_004006.2:c.2815_2816delTT, NM_004006.2:c.1306dupG, NM_004006.2:c.1332-9A>G, NM_004006.2:c.133C>T, NM_004006.2:c.1341_1342dupAG, NM_004006.2:c.2547delT, NM_004006.2:c.1371delG, NM_004006.2:c.2755A>T, NM_004006.2:c.2758C>T, NM_004006.2:c.1529_1530delTC, NM_004006.2:c.160_162delCTC, NM_004006.2:c.3295C>T, NM_004006.2:c.6182delC, NM_004006.2:c.6226G>T, NM_004006.2:c.3639dupA, NM_004006.2:c.199G>T, NM_004006.2:c.3747delG, NM_004006.2:c.2125delC, NM_004006.2:c.137_138dupAT, NM_004006.2:c.4117C>T, NM_004006.2:c.412_413delAA, NM_004006.2:c.2281_2285delGAAAA, NM_004006.2:c.4375C>T, NM_004006.2:c.4405C>T, NM_004006.2:c.2332C>T, NM_004006.2:c.4471_4472delAA, NM_004006.2:c.4486delG, NM_004006.2:c.4500delA, NM_004006.2:c.4518+5G>A, NM_004006.2:c.4735G>T, NM_004006.2:c.4806A>T, NM_004006.2:c.4843A>T, NM_004006.2:c.489G>A, NM_004006.2:c.5287C>T, NM_004006.2:c.530+1delG, NM_004006.2:c.5313dupT, NM_004006.2:c.5353C>T, NM_004006.2:c.5363C>G, NM_004006.2:c.5530C>T, NM_004006.2:c.5554C>T, NM_004006.2:c.5570_5571dupAA, NM_004006.2:c.5640T>A, NM_004006.2:c.5671A>T, NM_004006.2:c.5697delA, NM_004006.2:c.5773G>T, NM_004006.2:c.5807T>A, NM_004006.2:c.583C>T, NM_004006.2:c.8944C>T, NM_004006.2:c.1489C>T, NM_004006.2:c.6000T>A, NM_004006.2:c.6014_6017delCTCA, NM_004006.2:c.615T>A, NM_004006.2:c.9346C>T, NM_004006.2:c.9361+1G>A, NM_004006.2:c.6238delC, NM_004006.2:c.3697delC, NM_004006.2:c.6292C>T, NM_004006.2:c.3779_3785delCTTTGGAinsGG, NM_004006.2:c.4071G>C, NM_004006.2:c.6391_6392delCA, NM_004006.2:c.6392_6393insCA, NM_004006.2:c.433C>T, NM_004006.2:c.676_678delAAG, NM_004006.2:c.6834delT, NM_004006.2:c.4409_4412dupGTCT, NM_004006.2:c.6936delA, NM_004006.2:c.6943G>T, NM_004006.2:c.6964delG, NM_004006.2:c.6982A>T, NM_004006.2:c.6986dupA, NM_004006.2:c.7682G>A, NM_004006.2:c.7683G>A, NM_004006.2:c.7764dupT, NM_004006.2:c.7771G>T, NM_004006.2:c.7894C>T, NM_004006.2:c.7922delA, NM_004006.2:c.8064_8065delTA, NM_004006.2:c.8069T>G, NM_004006.2:c.8086delC, NM_004006.2:c.8358G>A, NM_004006.2:c.8374_8375delAA, NM_004006.2:c.8443C>T, NM_004006.2:c.8464C>T, NM_004006.2:c.8608C>T, NM_004006.2:c.8652_8653delCT, NM_004006.2:c.8656C>T, NM_004006.2:c.8668G>A, NM_004006.2:c.8713C>T, NM_004006.2:c.3121C>T, NM_004006.2:c.9164-1G>C, NM_004006.2:c.9164-1G>T, NM_004006.2:c.9337C>T, NM_004006.2:c.6906G>A, NM_004006.2:c.9361+1G>C, NM_004006.2:c.9380C>G, NM_004006.2:c.9564-1G>A, NM_004006.2:c.9568C>T, NM_004006.2:c.9612_9613ins341, NM_004006.2:c.9650-2A>G, NM_004006.2:c.9767dupG, NM_004006.2:c.9851G>A, NM_004006.2:c.9854_9863delTGAGACTGGA, NM_004006.2:c.9862G>T, NM_004006.2:c.3276+1G>A, NM_004006.2:c.2866C>T, NM_004006.2:c.2929dupC, NM_004006.2:c.3022A>T, NM_004006.2:c.2816T>A, NM_004006.2:c.3087G>A, NM_004006.2:c.5899C>T, NM_004006.2:c.3124A>T, NM_004006.2:c.3076G>T, NM_004006.2:c.6373C>T, NM_004006.2:c.627delA, NM_004006.2:c.2137C>T, NM_004006.2:c.3246_3247insTTTCTAAAAA, NM_004006.2:c.220delC, NM_004006.2:c.2169-3_2169-1delinsAA, NM_004006.2:c.6340A>T, NM_004006.2:c.6763-2A>G	Duchenne muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/3,300 male newborns and the prevalence is 1/16,000 to 1/125,000.	600
DMD	Duchenne muscular dystrophy	-	insDuchenne, delDuchenne (Detection by MLPA)	Duchenne muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/3,300 male newborns and the prevalence is 1/16,000 to 1/125,000.	600
DMP1	Hypophosphatemic rickets type 1, autosomal recessive	NM_004407.3	NM_004407.3:c.1A>G, NM_004407.3:c.55-1G>C, NM_004407.3:c.31delT, NM_004407.3:c.362delC	Hypophosphatemic rickets type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DMP1 gene located on chromosomal region 4q21. The age of onset is variable. This disease is associated with vertebral and rib segmentation defects and characterised by hypophosphatemia, rickets and/or osteomalacia and slow growth. The prevalence is below 1/20,000 newborns.	600
DNAJC19	Dilated cardiomyopathy with ataxia	NM_145261.3	NM_145261.3:c.300delA	Dilated cardiomyopathy with ataxia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DNAJC19 gene located on chromosomal region 3q26.33. The age of onset is infantile. This disease is characterised by severe early onset (before the age of three years) dilated cardiomyopathy with conduction defects (long QT syndrome), non-progressive cerebellar ataxia, testicular dysgenesis, and 3-methylglutaconic aciduria.	600
DPAGT1	Congenital disorder of glycosylation type 1j	NM_001382.3	NM_001382.3:c.791T>G, NM_001382.3:c.358C>A, NM_001382.3:c.643+1G>A, NM_001382.3:c.902G>A, NM_001382.3:c.349G>A, NM_001382.3:c.980_981delCT	Congenital disorder of glycosylation type 1j follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPAGT1 gene located on chromosomal region 11q23.3. The age of onset is neonatal/infantile. This disease is characterised by severe psychomotor delay, seizures, hypotonia and dysmorphism (microcephaly, ocular exotropia, micrognathia and clinodactyly). The prevalence is below 1,000,000.	600
DPM1	Congenital disorders of glycosylation type 1e	NM_003859.1	NM_003859.1:c.564-1G>A, NM_003859.1:c.628delC, NM_003859.1:c.274C>G, NM_003859.1:c.679-1G>T, NM_003859.1:c.742T>C	Congenital disorder of glycosylation type 1e follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPM1 gene located on chromosomal region 20q13.13. The age of onset is neonatal/infantile. This disease is characterised by psychomotor delay, seizures, hypotonia, facial dysmorphism and microcephaly. The prevalence is below 1,000,000.	600
DPYD	Dihydropyrimidine dehydrogenase deficiency	NM_000110.3	NM_000110.3:c.775A>G, NM_000110.3:c.1679T>G, NM_000110.3:c.299_302delTCAT, NM_000110.3:c.703C>T, NM_000110.3:c.1109_1110delTA, NM_000110.3:c.1905+1G>A, NM_000110.3:c.257C>T	Dihydropyrimidine dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPYD gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterised by mental and motor retardation and convulsions.	250,600
DSP	Cardiomyopathy, arrhythmogenic	NM_004415.2	NM_004415.2:c.7000C>T, NM_004415.2:c.88G>A, NM_004415.2:c.6370_6371delCT, NM_004415.2:c.7180_7181delAG, NM_004415.2:c.643G>A, NM_004415.2:c.3098delA, NM_004415.2:c.8188C>T	Cardiomyopathy, arrhythmogenic follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is a heart condition in which the heart muscle fibers are gradually replaced by fibrous or fibro-fatty tissue, causing abnormal heart electrical rhythms and heart failure. Consequently pumping blood to the body is weakened and sometimes leads to sudden cardiac death. The prevalence is below 1,000,000.	250,600
DSP	Cardiomyopathy, dilated, with woolly hair and keratoderma	NM_004415.2	NM_004415.2:c.5513G>A	Cardiomyopathy, dilated, with woolly hair and keratoderma follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterized by a generalized striate keratoderma particularly affecting the palmoplantar epidermis, woolly hair, and dilated left ventricular cardiomyopathy. The prevalence is below 1,000,000.	250,600
DSP	Lethal acantholytic epidermolysis bullosa	NM_004415.2	NM_004415.2:c.5800C>T	Lethal acantholytic epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterised by generalized oozing erosions, usually in the absence of blisters. The prevalence is below 1,000,000.	250,600
DYSF	Dysferlinopathy	NM_003494.3	NM_003494.3:c.1398-2A>G, NM_003494.3:c.1392dupA, NM_003494.3:c.1398-1G>A, NM_003494.3:c.5266C>T, NM_003494.3:c.1620delA, NM_003494.3:c.1481-1G>A, NM_003494.3:c.3041A>G, NM_003494.3:c.3985C>G, NM_003494.3:c.4090C>T, NM_003494.3:c.5713C>T, NM_003494.3:c.1053+1G>A, NM_003494.3:c.200_201delTGinsAT, NM_003494.3:c.2869C>T, NM_003494.3:c.2870_2874delAGACC, NM_003494.3:c.458-390C>T, NM_003494.3:c.757C>T, NM_003494.3:c.3065G>A, NM_003494.3:c.393_394delCC, NM_003494.3:c.3859A>T, NM_003494.3:c.5429G>A, NM_003494.3:c.3130C>T, NM_003494.3:c.3444_3445delTGinsAA, NM_003494.3:c.1638+2T>A, NM_003494.3:c.4108_4109delGT, NM_003494.3:c.3641delC, NM_003494.3:c.1368C>A, NM_003494.3:c.4872_4876delGCCCGinsCCCC, NM_003494.3:c.5341-2A>C, NM_003494.3:c.509C>A, NM_003494.3:c.5836_5839delCAGC, NM_003494.3:c.5644C>T, NM_003494.3:c.1861G>C, NM_003494.3:c.5429+1G>T, NM_003494.3:c.3957delC, NM_003494.3:c.5998C>T, NM_003494.3:c.3724C>T, NM_003494.3:c.5525+1G>A, NM_003494.3:c.3477C>A, NM_003494.3:c.3708delA, NM_003494.3:c.5992G>T, NM_003494.3:c.3113G>C, NM_003494.3:c.1216T>C, NM_003494.3:c.3903delG	Dysferlinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. Dysferlinopathy includes a spectrum of muscle disease characterized by two main phenotypes: Miyoshi myopathy with primarily distal weakness and limb-girdle muscular dystrophy type 2B (LGMD2B) with primarily proximal weakness. Miyoshi myopathy (median age of onset 19 years) is characterized by muscle weakness and atrophy, most marked in the distal parts of the legs, especially the gastrocnemius and soleus muscles. Over a period of years, the weakness and atrophy spread to the thighs and gluteal muscles. The forearms may become mildly atrophic with decrease in grip strength; the small muscles of the hands are spared. LGMD2B is characterized by early weakness and atrophy of the pelvic and shoulder girdle muscles in adolescence or young adulthood, with slow progression. Other phenotypes are scapuloperoneal syndrome, distal myopathy with anterior tibial onset, elevated serum CK concentration only, and congenital muscular dystrophy. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
DYSF	Miyoshi myopathy	NM_003494.3	NM_003494.3:c.1555G>A, NM_003494.3:c.5509G>A, NM_003494.3:c.5077C>T, NM_003494.3:c.5698_5699delAG, NM_003494.3:c.3892A>G, NM_003494.3:c.286A>C, NM_003494.3:c.1120G>C, NM_003494.3:c.1284+2T>C, NM_003494.3:c.5497G>T, NM_003494.3:c.3478C>T, NM_003494.3:c.2997G>T, NM_003494.3:c.3121C>T, NM_003494.3:c.1813C>T, NM_003494.3:c.3181_3182insAGGCGG, NM_003494.3:c.937+1G>A, NM_003494.3:c.3158T>G, NM_003494.3:c.1276G>A, NM_003494.3:c.701G>A, NM_003494.3:c.610C>T, NM_003494.3:c.5594delG, NM_003494.3:c.3112C>T, NM_003494.3:c.4199C>A, NM_003494.3:c.5999G>A, NM_003494.3:c.4756C>T, NM_003494.3:c.6124C>T, NM_003494.3:c.2966C>T, NM_003494.3:c.663+1G>C, NM_003494.3:c.3175-2A>T, NM_003494.3:c.895G>T, NM_003494.3:c.4985C>T, NM_003494.3:c.6203C>T	Miyoshi myopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. This disease is characterised by weakness in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
DYSF	Muscular dystrophy, limb girdle type 2B	NM_003494.3	NM_003494.3:c.5979dupA, NM_003494.3:c.565C>G, NM_003494.3:c.1663C>T, NM_003494.3:c.1873G>T, NM_003494.3:c.1834C>T, NM_003494.3:c.5201A>G, NM_003494.3:c.895G>A, NM_003494.3:c.3805G>T, NM_003494.3:c.4003G>A, NM_003494.3:c.4253G>A	Muscular dystrophy, limb girdle type 2B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. This disease is characterised by limb-girdle weakness and atrophy mostly in the shoulder pelvic girdle. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
EDA	Hypohidrotic ectodermal dysplasia, X-linked	NM_001399.4	NM_001399.4:c.206G>T, NM_001399.4:c.463C>T, NM_001399.4:c.187G>A, NM_001399.4:c.573_574insT, NM_001399.4:c.466C>T, NM_001399.4:c.826C>T, NM_001399.4:c.183C>G, NM_001399.4:c.181T>C, NM_001399.4:c.467G>A, NM_001399.4:c.671G>C, NM_001399.4:c.1045G>A	Hypohidrotic ectodermal dysplasia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EDA gene located on chromosomal region Xq12-q13.1. The age of onset is neonatal/infantile. This disease is characterized by malformation of ectodermal structures such as skin, hair, teeth and sweat glands. The prevalence is 1/5,000 to 1/10,000 newborns.	250,600
EDN3	Shah-Waardenburg syndrome type 4B	NM_207034.1	NM_207034.1:c.277C>G, NM_207034.1:c.568_569delGA, NM_207034.1:c.262_263delGCinsT, NM_207034.1:c.559_560insA, NM_207034.1:c.565_566insA, NM_207034.1:c.476G>T	Waardenburg-Shah syndrome type 4B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EDN3 gene located on chromosomal region 20q13.2-q13.3. The age of onset is neonatal/infantile. This disease is characterised by the association of Waardenburg syndrome (sensorineural hearing loss and pigmentary abnormalities) and Hirschsprung disease (signs of intestinal obstruction). The prevalence is below 1/40,000.	600
EDNRB	Shah-Waardenburg syndrome type 4A	NM_000115.3	NM_000115.3:c.914C>A, NM_000115.3:c.548C>G, NM_000115.3:c.828G>T, NM_000115.3:c.-51-946delC	Waardenburg-Shah syndrome type 4A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EDNRB gene located on chromosomal region 13q22. The age of onset is neonatal/infantile. This disease is characterised by the association of Waardenburg syndrome (sensorineural hearing loss and pigmentary abnormalities) and Hirschsprung disease (signs of intestinal obstruction). The prevalence is below 1/1,000,000.	600
EGR2	Charcot-Marie-Tooth disease type 4E	NM_000399.3	NM_000399.3:c.803T>A	Charcot-Marie-Tooth disease type 4E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EGR2 gene located on chromosomal region 10q21.1. The age of onset is neonatal/infantile. This disease is characterised by distal muscle weakness and atrophy associated with sensory loss and, frequently, pes cavus foot deformity. The prevalence is 15/100,000 to 20/100,000.	600
EIF2AK3	Wolcott-Rallison syndrome	NM_004836.5	NM_004836.5:c.994G>T, NM_004836.5:c.1763G>A	Wolcott-Rallison syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EIF2AK3 gene located on chromosomal region 2p12. The age of onset is neonatal/infantile. This disease is characterised by permanent neonatal diabetes mellitus with multiple epiphyseal dysplasia and other clinical manifestations, including recurrent episodes of acute liver failure. The prevalence is above 1/10,000 newborns.	600
EMD	Emery-Dreifuss muscular dystrophy type 1, X-linked	NM_000117.2	NM_000117.2:c.547C>A, NM_000117.2:c.631_635delCGTGC	Emery-Dreifuss muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EMD gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by muscular weakness and atrophy, with early joint contractures and cardiomyopathy. The prevalence is 1/100,000.	600
ENO3	Glycogen storage disease type 13	NM_053013.3	NM_053013.3:c.667+1G>T, NM_053013.3:c.1121G>A, NM_053013.3:c.953delA, NM_053013.3:c.692_707dupTCCAGGCGGCTGGTTA, NM_053013.3:c.467G>A, NM_053013.3:c.1303T>C	Glycogen storage disease type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENO3 gene located on chromosomal region 17p13.2. The age of onset is adult. This disease is characterised by exercise intolerance and myalgia due to severe enolase deficiency in muscle. The prevalence is below 1/1,000,000.	250,600
ENPP1	Generalized arterial calcification of infancy and pseudoxanthoma elasticum	NM_006208.2	NM_006208.2:c.1612G>C	Idiopathic infantile arterial calcification follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENPP1 gene located on chromosomal region 6q22-q23. The age of onset is neonatal/infancy. A severe autosomal recessive disorder characterized by calcification of the internal elastic lamina of muscular arteries and stenosis due to myointimal proliferation. The disorder is often fatal within the first 6 months of life because of myocardial ischemia resulting in refractory heart failure.	600
ENPP1	Hypophosphatemic rickets type 2, Autosomal recessive	NM_006208.2	NM_006208.2:c.797G>T, NM_006208.2:c.2702A>C	Hypophosphatemic rickets type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENPP1 gene located on chromosomal region 6q22-q23. The age of onset is variable. This disease is characterised by hypophosphatemia, rickets and/or osteomalacia and slow growth.	600
ENPP1	Idiopathic infantile arterial calcification	NM_006208.2	NM_006208.2:c.1112A>T, NM_006208.2:c.1025G>T, NM_006208.2:c.783C>G, NM_006208.2:c.2677G>T, NM_006208.2:c.913C>A, NM_006208.2:c.2230C>T, NM_006208.2:c.900G>A	Idiopathic infantile arterial calcification follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENPP1 gene located on chromosomal region 6q22-q23. The age of onset is neonatal/infancy. A severe autosomal recessive disorder characterized by calcification of the internal elastic lamina of muscular arteries and stenosis due to myointimal proliferation. The disorder is often fatal within the first 6 months of life because of myocardial ischemia resulting in refractory heart failure.	600
ERCC2	Trichothiodystrophy	NM_000400.3	NM_000400.3:c.1972C>T	Trichothiodystrophy is a heterogeneous group of disorders that follows an autosomal recessive pattern of inheritance. It is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.32. The age of onset is neonatal or infantile. This disease is characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. The abnormalities are usually obvious at birth, with variable clinical expression.	250,600
ERCC2	Xeroderma pigmentosum complementation group D	NM_000400.3	NM_000400.3:c.1308-1G>A, NM_000400.3:c.1454T>C, NM_000400.3:c.1621A>C, NM_000400.3:c.1703_1704delTT, NM_000400.3:c.1381C>G, NM_000400.3:c.719-1G>A, NM_000400.3:c.2230_2233dupCTAG, NM_000400.3:c.183+2T>A, NM_000400.3:c.567G>A, NM_000400.3:c.1354C>T, NM_000400.3:c.2047C>T, NM_000400.3:c.1304T>G, NM_000400.3:c.2176C>T, NM_000400.3:c.950-2A>G, NM_000400.3:c.949+1G>A	Xeroderma pigmentosum complementation group D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.3. The age of onset is variable. This disease is characterised by typical xeroderma pigmentosum manifestations (photosensitivity of skin with burning, freckling, and dryness of skin, skin cancers) associated with a spectrum of neurological anomalies (from no abnormality to severe neurological disease).	250,600
ERCC3	Xeroderma pigmentosum complementation group B	NM_000122.1	NM_000122.1:c.1633C>T, NM_000122.1:c.1757_1758delAG, NM_000122.1:c.296T>C, NM_000122.1:c.1273C>T, NM_000122.1:c.1757delA, NM_000122.1:c.1858delG	Xeroderma pigmentosum complementation group B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC3 gene located on chromosomal region 2q21. The age of onset is variable. This disease is characterised by classic xeroderma pigmentosum features of varying severity (photosensitivity of skin with burning and freckling, skin and eye tumors) and mild neurological abnormalities, or in other cases classical xeroderma pigmentosum features with systemic and neurological manifestations of Cockayne syndrome such as short stature, bilateral sensorineural hearing loss and hyperreflexia. The prevalence is 1/1,000,000.	600
ERCC4	Xeroderma pigmentosum complementation group F	NM_005236.2	NM_005236.2:c.49G>T, NM_005236.2:c.1467_1468insA, NM_005236.2:c.2281_2284delTTTG, NM_005236.2:c.2T>C, NM_005236.2:c.538_539delAG, NM_005236.2:c.706T>C, NM_005236.2:c.2395C>T	Xeroderma pigmentosum complementation group F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC4 gene located on chromosomal region 16p13.12. The age of onset is variable. This disease is characterised very mild skin symptoms and no ocular or neurological disease. The prevalence is 1/1,000,000.	250,600
ERCC5	Xeroderma pigmentosum complementation group G	NM_000123.3	NM_000123.3:c.2620G>A, NM_000123.3:c.463_464insA, NM_000123.3:c.526C>T, NM_000123.3:c.88+2T>C, NM_000123.3:c.2144dupA, NM_000123.3:c.2375C>T, NM_000123.3:c.381-2A>G, NM_000123.3:c.2573T>C, NM_000123.3:c.406C>T, NM_000123.3:c.215C>A, NM_000123.3:c.787C>T, NM_000123.3:c.2751delA	Xeroderma pigmentosum complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC5 gene located on chromosomal region 13q33. The age of onset is variable. This disease is characterised by variable clinical manifestations, as some patients present with a mild xeroderma pigmentosum phenotype (UV sensitivity, hyper- or hypo-pigmented skin lesions and increased incidence of skin cancer) and others combine symptoms of xeroderma pigmentosum with systemic and neurological manifestations of Cockayne syndrome. The prevalence is 1/1,000,000.	250,600
ERCC6	Cerebrooculofacioskeletal syndrome tipo 1	NM_000124.3	NM_000124.3:c.2047C>T	Cerebrooculofacioskeletal syndrome tipo 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterised by congenital microcephaly, congenital cataract and/or microphthalmia, arthrogryposis, severe psychomotor developmental delay, height-weight growth delay (principally postnatal) and facial dysmorphism (prominent metopic suture, micrognathism). The prevalence is below 1,000,000.	250,600
ERCC6	Cockayne syndrome type B	NM_000124.3	NM_000124.3:c.207_208insG, NM_000124.3:c.2203C>T, NM_000124.3:c.1357C>T, NM_000124.3:c.48_49delCT, NM_000124.3:c.3592_3593insGA, NM_000124.3:c.422+1G>A, NM_000124.3:c.1550G>A, NM_000124.3:c.3284C>G, NM_000124.3:c.2587C>T, NM_000124.3:c.3862C>T	Cockayne syndrome type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterised by growth failure at birth, with little or no postnatal neurologic development.	250,600
ERCC8	Cockayne syndrome type A	NM_000082.3	NM_000082.3:c.1103_1108delAGTTinsTTATATGAACCTTATATGAA, NM_000082.3:c.618-1G>A, NM_000082.3:c.593_594dupAT, NM_000082.3:c.613G>C, NM_000082.3:c.966C>A, NM_000082.3:c.37G>T	Cockayne syndrome type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC8 gene located on chromosomal region 5q12.1. The age of onset is variable. This disease is characterised by normal prenatal growth with the onset of growth and developmental abnormalities in the first two years. The prevalence is 2.7/1,000,000 newborns in Western Europe.	600
ESCO2	Roberts syndrome	NM_001017420.2	NM_001017420.2:c.1615T>G, NM_001017420.2:c.879_880delAG, NM_001017420.2:c.1597dupT, NM_001017420.2:c.505C>T, NM_001017420.2:c.291_292insGA, NM_001017420.2:c.308_309delAA, NM_001017420.2:c.876_879delCAGA, NM_001017420.2:c.874_877delGACA	Roberts syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESCO2 gene located on chromosomal region 8p21.1. The age of onset is neonatal/infantile. This disease is characterised by pre- and postnatal growth retardation, severe symmetric limb reduction defects, craniofacial anomalies and severe intellectual deficit.	600
ESCO2	SC Phocomelia syndrome	NM_001017420.2	NM_001017420.2:c.1269G>A, NM_001017420.2:c.604C>T	SC phocomelia syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESCO2 gene located on chromosomal region 8p21.1. The age of onset is neonatal/infantile. This disease has a milder phenotype than Roberts syndrome, with a lesser degree of symmetric limb reduction and additionally includes flexion contractures of various joints, midfacial hemangioma, hypoplastic cartilage of ears and nose, scant silvery-blond hair, and cloudy corneae. Although microcephaly is present, mental retardation may be mild and survival into adulthood is common.	600
ESPN	Deafness type 36, autosomal recessive	NM_031475.2	NM_031475.2:c.1988_1991delAGAG, NM_031475.2:c.2230G>A, NM_031475.2:c.2470_2473delTCAG	Autosomal recessive nonsyndromic sensorineural deafness type DFNB36 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESPN gene located on chromosomal region 1p36.31. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	600
ESRRB	Deafness type 35, autosomal recessive	NM_004452.3	NM_004452.3:c.329C>T	Autosomal recessive nonsyndromic sensorineural deafness type DFNB35 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESRRB gene located on chromosomal region 14q24.3. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	600
ETFA	Glutaric acidemia type 2A	NM_000126.3	NM_000126.3:c.470T>G, NM_000126.3:c.797C>T	Glutaric acidemia type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFA gene located on chromosomal region 15q23-q25. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.	600
ETFB	Glutaric acidemia type 2B	NM_001985.2	NM_001985.2:c.278_279insG, NM_001985.2:c.490C>T, NM_001985.2:c.491G>A, NM_001985.2:c.382G>A, NM_001985.2:c.58-53_58-52insG, NM_001985.2:c.61C>T, NM_001985.2:c.614_616delAGA	Glutaric acidemia type 2B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFB gene located on chromosomal region 19q13.3. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.	600
ETFDH	Glutaric acidemia type 2C	NM_004453.3	NM_004453.3:c.1823delG, NM_004453.3:c.1570_1571delCT, NM_004453.3:c.2T>C, NM_004453.3:c.1234G>T, NM_004453.3:c.250G>A, NM_004453.3:c.1351G>C, NM_004453.3:c.1367C>T, NM_004453.3:c.524G>T, NM_004453.3:c.1001T>C, NM_004453.3:c.1773_1774delAT, NM_004453.3:c.1832G>A, NM_004453.3:c.508G>T, NM_004453.3:c.413T>G, NM_004453.3:c.643G>A	Glutaric acidemia type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFDH gene located on chromosomal region 4q32-q35. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.	600
ETHE1	Ethylmalonic encephalopathy	NM_014297.3	NM_014297.3:c.487C>T, NM_014297.3:c.554T>G, NM_014297.3:c.440_450delACAGCATGGCC, NM_014297.3:c.604dupG, NM_014297.3:c.221dupA, NM_014297.3:c.488G>A	Ethylmalonic encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETHE1 gene located on chromosomal region 19q13.31. The age of onset is neonatal/infantile. This disease is characterised by elevated excretion of ethylmalonic acid with recurrent petechiae, orthostatic acrocyanosis and chronic diarrhoea associated with neurodevelopmental delay, psychomotor regression and hypotonia with brain magnetic resonance imaging abnormalities. The prevalence is below 1/1,000,000, with total of 30 cases of patients reported worldwide, mainly for Mediterranean and Arab populations.	600
EYS	Retinitis pigmentosa type 25	NM_001142800.1	NM_001142800.1:c.5044G>T, NM_001142800.1:c.9036delT, NM_001142800.1:c.490C>T, NM_001142800.1:c.5928-2A>G, NM_001142800.1:c.571dupA, NM_001142800.1:c.4597_4613delTCAAGCAACCAGAGACT, NM_001142800.1:c.7822C>T, NM_001142800.1:c.5857G>T, NM_001142800.1:c.6170delA, NM_001142800.1:c.8569G>T, NM_001142800.1:c.232delT, NM_001142800.1:c.6102_6103insT, NM_001142800.1:c.8834G>A, NM_001142800.1:c.1211_1212insA, NM_001142800.1:c.4350_4356delTATAGCT, NM_001142800.1:c.4469_4470insAGCCCCTC, NM_001142800.1:c.8648_8655delCATGCAGA, NM_001142800.1:c.4120C>T, NM_001142800.1:c.863-4_863-3insT, NM_001142800.1:c.8629_8632dupACAG, NM_001142800.1:c.9299_9302delCTCA, NM_001142800.1:c.103C>T, NM_001142800.1:c.2826_2827delAT, NM_001142800.1:c.4045C>T, NM_001142800.1:c.5757_5758insT, NM_001142800.1:c.8408dupA, NM_001142800.1:c.7095T>G, NM_001142800.1:c.3329C>G, NM_001142800.1:c.9405T>A	Retinitis pigmentosa 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EYS gene located on chromosomal region 6q12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000.	250,600
F11	Factor 11 deficiency	NM_000128.3	NM_000128.3:c.1613C>T, NM_000128.3:c.166T>C, NM_000128.3:c.403G>T, NM_000128.3:c.731A>G, NM_000128.3:c.809A>T, NM_000128.3:c.1693G>A, NM_000128.3:c.1211C>A, NM_000128.3:c.901T>C, NM_000128.3:c.595+3A>G, NM_000128.3:c.438C>A	Factor 11 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F11 gene located on chromosomal region 4q35. The age of onset is variable. This disease is characterized by reduced levels and activity of factor XI resulting in moderate bleeding symptoms, usually occurring after trauma or surgery. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
F5	Factor 5 deficiency	NM_000130.4	NM_000130.4:c.4876delA, NM_000130.4:c.439G>T, NM_000130.4:c.6419G>A, NM_000130.4:c.2401C>T, NM_000130.4:c.5521G>A, NM_000130.4:c.1083G>A, NM_000130.4:c.5189A>G, NM_000130.4:c.3799delC, NM_000130.4:c.6304C>T	Factor 5 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F5 gene located on chromosomal region 1q23. The age of onset is variable. This disease is characterized by mild to severe bleeding symptoms usually occurring after trauma or surgery. In severe forms of the disease, there can be a risk of intracranial, pulmonary or gastrointestinal bleedings. The severity of the bleeding manifestations correlates with the FV levels. The prevalence is 1/5,000.	250,600
F5	Thrombosis	NM_000130.4	NM_000130.4:c.1000A>G	Deep venous thrombosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F5 gene located on chromosomal region 1q23. The age of onset is variable. This disease is characterized by a poor anticoagulant response to activated Protein C and an increased risk for venous thromboembolism. Deep venous thrombosis and pulmonary embolism are the most common manifestations, but thrombosis in unusual locations also occurs. The prevalence is 1/5,000.	250,600
F8	Hemophilia A	NM_000132.3	NM_000132.3:c.1075_1078delAATG, NM_000132.3:c.1042T>C, NM_000132.3:c.1078_1079delGA, NM_000132.3:c.120delC, NM_000132.3:c.1214T>G, NM_000132.3:c.1090G>A, NM_000132.3:c.1207C>G, NM_000132.3:c.1331_1332delAAinsT, NM_000132.3:c.1175C>A, NM_000132.3:c.1335dupC, NM_000132.3:c.1203G>A, NM_000132.3:c.128dupT, NM_000132.3:c.1331A>C, NM_000132.3:c.1301G>A, NM_000132.3:c.1234T>C, NM_000132.3:c.1316G>A, NM_000132.3:c.1293delG, NM_000132.3:c.1200_1201delTT, NM_000132.3:c.1310delG, NM_000132.3:c.1331_1332delAA, NM_000132.3:c.1410_1413delTTTA, NM_000132.3:c.1420G>T, NM_000132.3:c.143+1G>A, NM_000132.3:c.1432G>A, NM_000132.3:c.1438_1439delCT, NM_000132.3:c.1440_1441insA, NM_000132.3:c.144-11T>G, NM_000132.3:c.1442_1443dupTG, NM_000132.3:c.1175C>G, NM_000132.3:c.1324T>A, NM_000132.3:c.1324T>C, NM_000132.3:c.1325A>G, NM_000132.3:c.144-5C>G, NM_000132.3:c.1463C>G, NM_000132.3:c.1463C>T, NM_000132.3:c.1467_1472dupCAGACC, NM_000132.3:c.1477A>G, NM_000132.3:c.1538-1G>T, NM_000132.3:c.1538-2A>T, NM_000132.3:c.1560delT, NM_000132.3:c.1564_1565delATinsTA, NM_000132.3:c.1585A>G, NM_000132.3:c.1594T>G, NM_000132.3:c.1189_1190insC, NM_000132.3:c.1443+3A>C, NM_000132.3:c.1596G>A, NM_000132.3:c.1618C>A, NM_000132.3:c.1619C>G, NM_000132.3:c.1630G>A, NM_000132.3:c.1639T>C, NM_000132.3:c.1337G>A, NM_000132.3:c.1337G>C, NM_000132.3:c.1338delA, NM_000132.3:c.1348T>G, NM_000132.3:c.1357G>T, NM_000132.3:c.1390G>T, NM_000132.3:c.1595G>A, NM_000132.3:c.1596dupG, NM_000132.3:c.1400T>G, NM_000132.3:c.1406G>C, NM_000132.3:c.1736A>T, NM_000132.3:c.173delC, NM_000132.3:c.1752+5G>C, NM_000132.3:c.185C>G, NM_000132.3:c.1904-1G>A, NM_000132.3:c.1904-37G>A, NM_000132.3:c.1912G>A, NM_000132.3:c.1913G>A, NM_000132.3:c.1924_1927delGATA, NM_000132.3:c.1934A>C, NM_000132.3:c.1941_1944delAGTT, NM_000132.3:c.1943_1946delTTTG, NM_000132.3:c.1952A>C, NM_000132.3:c.195C>A, NM_000132.3:c.1985G>C, NM_000132.3:c.1988C>T, NM_000132.3:c.1990_1991delCA, NM_000132.3:c.1991A>C, NM_000132.3:c.199_200delAA, NM_000132.3:c.1992_1995dupGACT, NM_000132.3:c.1996_1999delGACT, NM_000132.3:c.1999delT, NM_000132.3:c.199A>G, NM_000132.3:c.1A>G, NM_000132.3:c.2009_2011delTCT, NM_000132.3:c.200A>C, NM_000132.3:c.201G>T, NM_000132.3:c.202_203insGA, NM_000132.3:c.202_207delACTCTG, NM_000132.3:c.2029T>C, NM_000132.3:c.2032A>T, NM_000132.3:c.203C>A, NM_000132.3:c.2057C>G, NM_000132.3:c.2058_2059delAC, NM_000132.3:c.2060T>C, NM_000132.3:c.2066T>G, NM_000132.3:c.1394C>G, NM_000132.3:c.1397G>A, NM_000132.3:c.2077_2078delTCinsCT, NM_000132.3:c.2088_2089delTG, NM_000132.3:c.2090T>A, NM_000132.3:c.2095A>C, NM_000132.3:c.2095A>G, NM_000132.3:c.2095A>T, NM_000132.3:c.1086G>A, NM_000132.3:c.2097G>A, NM_000132.3:c.1164delC, NM_000132.3:c.1172G>C, NM_000132.3:c.214G>A, NM_000132.3:c.217T>C, NM_000132.3:c.1187A>T, NM_000132.3:c.224delA, NM_000132.3:c.225T>A, NM_000132.3:c.1202G>A, NM_000132.3:c.2338delA, NM_000132.3:c.2360delA, NM_000132.3:c.2372dupG, NM_000132.3:c.2374delT, NM_000132.3:c.2383A>G, NM_000132.3:c.2384_2388delGAACA, NM_000132.3:c.2397delT, NM_000132.3:c.2404C>T, NM_000132.3:c.2409delT, NM_000132.3:c.2412_2421delCTCCTCTAGT, NM_000132.3:c.2419dupA, NM_000132.3:c.2462_2463delGG, NM_000132.3:c.250_255delAGGCCA, NM_000132.3:c.250A>G, NM_000132.3:c.253_255delCCA, NM_000132.3:c.265+1G>T, NM_000132.3:c.265G>A, NM_000132.3:c.3031A>T, NM_000132.3:c.3034G>C, NM_000132.3:c.3053delA, NM_000132.3:c.3150_3151insTC, NM_000132.3:c.3152delT, NM_000132.3:c.3168_3187delTGAGTTTAAAAAAGTGACAC, NM_000132.3:c.3196C>T, NM_000132.3:c.3202_3203delAG, NM_000132.3:c.3224delC, NM_000132.3:c.3251C>G, NM_000132.3:c.3255_3258delTAAA, NM_000132.3:c.3279G>A, NM_000132.3:c.3289C>T, NM_000132.3:c.3295delA, NM_000132.3:c.3298A>T, NM_000132.3:c.3302_3303delAG, NM_000132.3:c.3344delT, NM_000132.3:c.3371C>A, NM_000132.3:c.144-26A>T, NM_000132.3:c.1443+1G>A, NM_000132.3:c.1443+2T>C, NM_000132.3:c.3409_3410delCT, NM_000132.3:c.3416_3417delCT, NM_000132.3:c.3417dupT, NM_000132.3:c.3421C>T, NM_000132.3:c.3490delT, NM_000132.3:c.3493G>T, NM_000132.3:c.3496A>T, NM_000132.3:c.3500dupA, NM_000132.3:c.3505delG, NM_000132.3:c.3540delA, NM_000132.3:c.3548_3549delAA, NM_000132.3:c.3565dupA, NM_000132.3:c.3607G>T, NM_000132.3:c.3624delT, NM_000132.3:c.3631A>T, NM_000132.3:c.3651delA, NM_000132.3:c.3652delG, NM_000132.3:c.3710delC, NM_000132.3:c.3721_3739del19ins6, NM_000132.3:c.3735_3744delCCTTTTCTTAinsATTTCTTTTTCTTT, NM_000132.3:c.3736delC, NM_000132.3:c.3756delG, NM_000132.3:c.3766G>T, NM_000132.3:c.3771delT, NM_000132.3:c.3827C>G, NM_000132.3:c.3830delC, NM_000132.3:c.3833delA, NM_000132.3:c.3842_3844delAGAinsGG, NM_000132.3:c.3844A>T, NM_000132.3:c.3847_3848delCA, NM_000132.3:c.3858delT, NM_000132.3:c.3860delT, NM_000132.3:c.3863dupC, NM_000132.3:c.3870dupA, NM_000132.3:c.3886delT, NM_000132.3:c.3902delA, NM_000132.3:c.3907_3911delACCAA, NM_000132.3:c.3913C>T, NM_000132.3:c.3922G>T, NM_000132.3:c.3940A>C, NM_000132.3:c.3964C>T, NM_000132.3:c.3967C>T, NM_000132.3:c.3982C>T, NM_000132.3:c.3984dupA, NM_000132.3:c.3991_3992delAA, NM_000132.3:c.3994_3997delAGAG, NM_000132.3:c.4006C>T, NM_000132.3:c.4034delA, NM_000132.3:c.403G>A, NM_000132.3:c.4045delA, NM_000132.3:c.404A>G, NM_000132.3:c.405T>A, NM_000132.3:c.4072C>T, NM_000132.3:c.407A>C, NM_000132.3:c.4093_4099delCATTTGA, NM_000132.3:c.4100delC, NM_000132.3:c.4113_4153dup41, NM_000132.3:c.4156C>T, NM_000132.3:c.415C>T, NM_000132.3:c.4197delC, NM_000132.3:c.4201C>T, NM_000132.3:c.421G>T, NM_000132.3:c.4241C>A, NM_000132.3:c.4242dupA, NM_000132.3:c.4264_4265delTA, NM_000132.3:c.2071C>A, NM_000132.3:c.2072C>T, NM_000132.3:c.4293_4297delCTCTT, NM_000132.3:c.4296_4300delTTCTC, NM_000132.3:c.430G>T, NM_000132.3:c.4318delT, NM_000132.3:c.4336delG, NM_000132.3:c.4339dupG, NM_000132.3:c.2096T>A, NM_000132.3:c.4345delG, NM_000132.3:c.209T>C, NM_000132.3:c.2101_2105delATGGA, NM_000132.3:c.4363C>T, NM_000132.3:c.4382_4383delAC, NM_000132.3:c.223G>T, NM_000132.3:c.4408G>T, NM_000132.3:c.440T>A, NM_000132.3:c.230T>C, NM_000132.3:c.4424_4425delAA, NM_000132.3:c.4426_4427delAG, NM_000132.3:c.4429_4430delGA, NM_000132.3:c.4446dupG, NM_000132.3:c.4450delA, NM_000132.3:c.4458delA, NM_000132.3:c.446delC, NM_000132.3:c.4473C>A, NM_000132.3:c.4473C>G, NM_000132.3:c.4474A>T, NM_000132.3:c.4483delG, NM_000132.3:c.4483G>T, NM_000132.3:c.4491_4492delTG, NM_000132.3:c.4491_4495delTGTTC, NM_000132.3:c.4492_4496delGTTCT, NM_000132.3:c.4492delG, NM_000132.3:c.4512_4513ins32, NM_000132.3:c.4512delG, NM_000132.3:c.4513_4515delCCCinsGCAAAGTTGGTTTGCCAAAACCATGTTGCCG, NM_000132.3:c.4519delA, NM_000132.3:c.4531G>A, NM_000132.3:c.4542delT, NM_000132.3:c.4543_4544delCCinsA, NM_000132.3:c.4549_4550delGT, NM_000132.3:c.4561C>T, NM_000132.3:c.4619delT, NM_000132.3:c.4658delA, NM_000132.3:c.4662_4663delGA, NM_000132.3:c.4665_4688del24insAAGGAA, NM_000132.3:c.4672_4675delAACA, NM_000132.3:c.4683delA, NM_000132.3:c.4687delG, NM_000132.3:c.4694_4697delTTCT, NM_000132.3:c.4697_4701dupTGAGA, NM_000132.3:c.4710_4713delAGAA, NM_000132.3:c.3385delC, NM_000132.3:c.3388delA, NM_000132.3:c.3402delG, NM_000132.3:c.472C>T, NM_000132.3:c.476T>C, NM_000132.3:c.4770T>A, NM_000132.3:c.4794G>T, NM_000132.3:c.4798A>T, NM_000132.3:c.4805_4806delAA, NM_000132.3:c.4805delA, NM_000132.3:c.4814C>A, NM_000132.3:c.4825delA, NM_000132.3:c.4828G>T, NM_000132.3:c.4841delA, NM_000132.3:c.4848delC, NM_000132.3:c.4856delC, NM_000132.3:c.4858delC, NM_000132.3:c.4864G>A, NM_000132.3:c.4895delT, NM_000132.3:c.4895dupT, NM_000132.3:c.4899delT, NM_000132.3:c.489T>A, NM_000132.3:c.4918G>T, NM_000132.3:c.4922dupT, NM_000132.3:c.4925A>G, NM_000132.3:c.4926delA, NM_000132.3:c.4934G>A, NM_000132.3:c.4935G>A, NM_000132.3:c.493C>T, NM_000132.3:c.4942C>T, NM_000132.3:c.4969C>T, NM_000132.3:c.4979C>T, NM_000132.3:c.4987A>T, NM_000132.3:c.4996C>T, NM_000132.3:c.4999delC, NM_000132.3:c.5010delT, NM_000132.3:c.5012G>A, NM_000132.3:c.514_515insTCAAGATA, NM_000132.3:c.514T>C, NM_000132.3:c.515G>A, NM_000132.3:c.519_523delTACCT, NM_000132.3:c.5220-1G>A, NM_000132.3:c.5226_5227delGA, NM_000132.3:c.5243delA, NM_000132.3:c.5251A>T, NM_000132.3:c.5254delG, NM_000132.3:c.525C>A, NM_000132.3:c.5269delT, NM_000132.3:c.5269T>C, NM_000132.3:c.5291A>G, NM_000132.3:c.5301C>A, NM_000132.3:c.5308G>A, NM_000132.3:c.5321A>T, NM_000132.3:c.532C>G, NM_000132.3:c.5330T>C, NM_000132.3:c.5337delG, NM_000132.3:c.5339C>T, NM_000132.3:c.5343T>A, NM_000132.3:c.5345T>G, NM_000132.3:c.5348_5357delGAGCAGAAGT, NM_000132.3:c.535T>C, NM_000132.3:c.545A>T, NM_000132.3:c.553A>G, NM_000132.3:c.556G>A, NM_000132.3:c.557_559delACT, NM_000132.3:c.557A>G, NM_000132.3:c.560T>A, NM_000132.3:c.566C>A, NM_000132.3:c.5674G>A, NM_000132.3:c.5675dupT, NM_000132.3:c.5680G>A, NM_000132.3:c.5686G>C, NM_000132.3:c.5689_5690delCT, NM_000132.3:c.5696dupT, NM_000132.3:c.5697delC, NM_000132.3:c.5712G>C, NM_000132.3:c.5718dupA, NM_000132.3:c.5719A>T, NM_000132.3:c.571C>T, NM_000132.3:c.5721C>G, NM_000132.3:c.5722_5723delTGinsTCATCAAAGTACTTCAAAAA, NM_000132.3:c.5752delT, NM_000132.3:c.5766C>A, NM_000132.3:c.577G>A, NM_000132.3:c.5816-14delGTinsTA, NM_000132.3:c.5816C>A, NM_000132.3:c.5816C>T, NM_000132.3:c.5825G>T, NM_000132.3:c.5833A>G, NM_000132.3:c.5853A>C, NM_000132.3:c.5861_5866delCTCAGG, NM_000132.3:c.5869C>T, NM_000132.3:c.5879G>T, NM_000132.3:c.5881T>A, NM_000132.3:c.5884T>G, NM_000132.3:c.5888T>C, NM_000132.3:c.5891T>C, NM_000132.3:c.5894G>T, NM_000132.3:c.589_591delGTA, NM_000132.3:c.5914_5915delAT, NM_000132.3:c.5923dupA, NM_000132.3:c.5924T>A, NM_000132.3:c.5934T>G, NM_000132.3:c.5939A>C, NM_000132.3:c.5953delC, NM_000132.3:c.5954G>C, NM_000132.3:c.5955_5956delAA, NM_000132.3:c.5955delA, NM_000132.3:c.5964_5967dupGGAG, NM_000132.3:c.5999G>C, NM_000132.3:c.6016G>T, NM_000132.3:c.6037G>A, NM_000132.3:c.6046C>G, NM_000132.3:c.6070dupC, NM_000132.3:c.6078_6079delTG, NM_000132.3:c.6082delG, NM_000132.3:c.6089dupG, NM_000132.3:c.6094C>T, NM_000132.3:c.6099delT, NM_000132.3:c.6107A>G, NM_000132.3:c.6115+1G>A, NM_000132.3:c.6115+2T>C, NM_000132.3:c.6115+3G>T, NM_000132.3:c.6115+4A>G, NM_000132.3:c.6115+6T>A, NM_000132.3:c.6116-2A>G, NM_000132.3:c.6116_6117delAG, NM_000132.3:c.6120_6135delTCAGACTCCCCTGGGA, NM_000132.3:c.6120T>A, NM_000132.3:c.6127delC, NM_000132.3:c.6134G>T, NM_000132.3:c.6135dupA, NM_000132.3:c.6194G>A, NM_000132.3:c.6202_6257dup56, NM_000132.3:c.6213A>T, NM_000132.3:c.6239C>T, NM_000132.3:c.6242G>C, NM_000132.3:c.6243G>C, NM_000132.3:c.6250A>T, NM_000132.3:c.6253G>T, NM_000132.3:c.6263C>T, NM_000132.3:c.6269T>A, NM_000132.3:c.6273+1G>A, NM_000132.3:c.6430-3C>G, NM_000132.3:c.6449A>T, NM_000132.3:c.6464_6465delAA, NM_000132.3:c.6465delA, NM_000132.3:c.6467_6468delAC, NM_000132.3:c.6469_6470delAA, NM_000132.3:c.6473delT, NM_000132.3:c.6482C>A, NM_000132.3:c.6482C>T, NM_000132.3:c.6488T>G, NM_000132.3:c.6489delT, NM_000132.3:c.6494delC, NM_000132.3:c.6497delG, NM_000132.3:c.6501delC, NM_000132.3:c.6515C>G, NM_000132.3:c.6517_6519dupACT, NM_000132.3:c.6520C>G, NM_000132.3:c.6533G>A, NM_000132.3:c.6537C>G, NM_000132.3:c.6544C>G, NM_000132.3:c.6548T>G, NM_000132.3:c.6551A>T, NM_000132.3:c.6565_6566delGA, NM_000132.3:c.6574+1G>A, NM_000132.3:c.6574+1G>T, NM_000132.3:c.6574+3A>C, NM_000132.3:c.6574+5G>C, NM_000132.3:c.65G>C, NM_000132.3:c.6738delA, NM_000132.3:c.6739_6740delGA, NM_000132.3:c.6739G>T, NM_000132.3:c.6743G>C, NM_000132.3:c.6746T>G, NM_000132.3:c.6752T>A, NM_000132.3:c.6760C>T, NM_000132.3:c.6760delC, NM_000132.3:c.676A>T, NM_000132.3:c.6780_6788delAGGAGTAAC, NM_000132.3:c.6786_6787insCAA, NM_000132.3:c.6796G>A, NM_000132.3:c.6797delG, NM_000132.3:c.6797G>A, NM_000132.3:c.6804delA, NM_000132.3:c.680G>A, NM_000132.3:c.6825T>A, NM_000132.3:c.6827T>G, NM_000132.3:c.6836T>C, NM_000132.3:c.6836T>G, NM_000132.3:c.6839T>C, NM_000132.3:c.6842T>C, NM_000132.3:c.684_685delCT, NM_000132.3:c.6856_6866delGATGGCCATCA, NM_000132.3:c.6865C>T, NM_000132.3:c.6869G>T, NM_000132.3:c.6870G>A, NM_000132.3:c.687_688delAG, NM_000132.3:c.6886delA, NM_000132.3:c.6900+1G>A, NM_000132.3:c.6901-2A>G, NM_000132.3:c.6904T>G, NM_000132.3:c.6905T>C, NM_000132.3:c.6912_6916delAAATC, NM_000132.3:c.6915delT, NM_000132.3:c.6919_6920delGA, NM_000132.3:c.6921delC, NM_000132.3:c.693_696delAAAG, NM_000132.3:c.6969_6977delCTACCTTCG, NM_000132.3:c.6976C>G, NM_000132.3:c.6986C>T, NM_000132.3:c.6988delC, NM_000132.3:c.6995G>C, NM_000132.3:c.6996G>A, NM_000132.3:c.6997delG, NM_000132.3:c.7012delC, NM_000132.3:c.7016G>T, NM_000132.3:c.7021G>T, NM_000132.3:c.7030G>A, NM_000132.3:c.7030G>T, NM_000132.3:c.7031G>A, NM_000132.3:c.7033_7040delTGCGAGGC, NM_000132.3:c.7034G>A, NM_000132.3:c.709C>T, NM_000132.3:c.729delT, NM_000132.3:c.73delT, NM_000132.3:c.755C>A, NM_000132.3:c.760A>T, NM_000132.3:c.764G>A, NM_000132.3:c.770_771insCC, NM_000132.3:c.775A>T, NM_000132.3:c.779C>G, NM_000132.3:c.77T>C, NM_000132.3:c.787+2T>C, NM_000132.3:c.787G>C, NM_000132.3:c.788-1G>A, NM_000132.3:c.788-1G>C, NM_000132.3:c.788-1G>T, NM_000132.3:c.788-2A>T, NM_000132.3:c.796G>T, NM_000132.3:c.820T>C, NM_000132.3:c.822G>A, NM_000132.3:c.824A>G, NM_000132.3:c.832G>A, NM_000132.3:c.836T>A, NM_000132.3:c.849delT, NM_000132.3:c.850G>A, NM_000132.3:c.850G>T, NM_000132.3:c.86T>G, NM_000132.3:c.871G>T, NM_000132.3:c.872A>G, NM_000132.3:c.883T>C, NM_000132.3:c.886C>T, NM_000132.3:c.889delG, NM_000132.3:c.88G>A, NM_000132.3:c.899A>C, NM_000132.3:c.899A>T, NM_000132.3:c.902G>C, NM_000132.3:c.906delG, NM_000132.3:c.912C>T, NM_000132.3:c.918delA, NM_000132.3:c.920T>G, NM_000132.3:c.935delT, NM_000132.3:c.941C>T, NM_000132.3:c.943delG, NM_000132.3:c.948_951delAACA, NM_000132.3:c.967G>A, NM_000132.3:c.974_975delTT, NM_000132.3:c.97T>G, NM_000132.3:c.984delT, NM_000132.3:c.985dupT, NM_000132.3:c.986G>A, NM_000132.3:c.986G>C, NM_000132.3:c.986G>T, NM_000132.3:c.98G>A, NM_000132.3:c.1726G>T, NM_000132.3:c.4345G>T, NM_000132.3:c.435_436insTTT, NM_000132.3:c.433G>C, NM_000132.3:c.4719_4729delTGCAAAGACTC, NM_000132.3:c.439_447dupGTCTTCCCT, NM_000132.3:c.4720delG, NM_000132.3:c.1661G>A, NM_000132.3:c.4423C>T, NM_000132.3:c.1703G>T, NM_000132.3:c.1640G>A, NM_000132.3:c.1682A>C, NM_000132.3:c.1681G>A, NM_000132.3:c.1667T>A, NM_000132.3:c.4272delC, NM_000132.3:c.1653T>G, NM_000132.3:c.471G>A, NM_000132.3:c.1688C>G, NM_000132.3:c.4280delT, NM_000132.3:c.1675G>T	Hemophilia A follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F8 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor VIII deficiency. The prevalence is 1/4,000 to 1/ 5,000 male newborns.	600
F8	Hemophilia A	-	Inv22 (Detection by PCR)	Hemophilia A follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F8 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor VIII deficiency. The prevalence is 1/4,000 to 1/ 5,000 male newborns.	600
F9	Hemophilia B	NM_000133.3	NM_000133.3:c.1150C>T, NM_000133.3:c.52T>C, NM_000133.3:c.1031T>C, NM_000133.3:c.82T>C, NM_000133.3:c.1136G>A, NM_000133.3:c.79G>A, NM_000133.3:c.19A>T, NM_000133.3:c.80A>T	Hemophilia B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F9 gene located on chromosomal region Xq27.1-q27.2. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor IX deficiency. The prevalence is 1/100,000 to 9/100,000.	250,600
FAH	Tyrosinemia type 1	NM_000137.2	NM_000137.2:c.1141A>G, NM_000137.2:c.1069G>T, NM_000137.2:c.1090G>T, NM_000137.2:c.401C>A, NM_000137.2:c.456G>A, NM_000137.2:c.192G>T, NM_000137.2:c.607-6T>G, NM_000137.2:c.707-1G>A, NM_000137.2:c.939delC, NM_000137.2:c.103G>A, NM_000137.2:c.982C>T, NM_000137.2:c.837+1G>A, NM_000137.2:c.1009G>A, NM_000137.2:c.47A>T, NM_000137.2:c.554-1G>T, NM_000137.2:c.1027G>T, NM_000137.2:c.1062+5G>A, NM_000137.2:c.786G>A, NM_000137.2:c.1021C>T, NM_000137.2:c.782C>T	Tyrosinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAH gene located on chromosomal region 15q25.1. The age of onset is variable. This disease is characterized by progressive liver disease, renal tubular dysfunction, porphyria-like crises and a dramatic improvement in prognosis following treatment with nitisinone. The birth incidence is 1/100,000, notably in Québec, Canada, and the prevalence is 1/100,000 to 1/120,000 newborns.	250,600
FAM126A	Hypomyelination and congenital cataract	NM_032581.3	NM_032581.3:c.191A>G, NM_032581.3:c.158T>C	Hypomyelination - congenital cataract follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAM126A gene located on chromosomal region 7p15.3. The age of onset is neonatal/infantile. This disease is characterized by the onset of cataract either at birth or in the first two months of life, delayed psychomotor development by the end of the first year of life and moderate intellectual deficit. The prevalence is below 1/1,000,000.	600
FAM20C	Osteosclerotic bone dysplasia	NM_020223.3	NM_020223.3:c.1093G>C, NM_020223.3:c.773T>A, NM_020223.3:c.1364-5C>T, NM_020223.3:c.1163T>G, NM_020223.3:c.838G>A, NM_020223.3:c.1351G>A	Osteosclerotic bone dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAM20C gene located on chromosomal region 7p22.3. The age of onset is neonatal/infantile. This disease is characterized by generalized osteosclerosis with periosteal bone formation, characteristic facial dysmorphism, brain abnormalities including intracerebral calcifications, and neonatal lethal course. The prevalence is below 1/1,000,000.	600
FANCA	Fanconi anemia, complementation group A	NM_000135.2	NM_000135.2:c.3788_3790delTCT, NM_000135.2:c.2303T>C, NM_000135.2:c.3558_3559insG, NM_000135.2:c.4130C>G, NM_000135.2:c.233_236delTTGA, NM_000135.2:c.3763G>T, NM_000135.2:c.1115_1118delTTGG, NM_000135.2:c.131_132insA	Fanconi anemia complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCA gene located on chromosomal region 16q24.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCC	Fanconi anemia, complementation group C	NM_000136.2	NM_000136.2:c.1642C>T, NM_000136.2:c.37C>T, NM_000136.2:c.996+1G>T, NM_000136.2:c.67delG, NM_000136.2:c.416G>A, NM_000136.2:c.1015delA, NM_000136.2:c.1487T>G, NM_000136.2:c.1103_1104delTG	Fanconi anemia complementation group C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCC gene located on chromosomal region 9q22.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCD2	Fanconi anemia, complementation group D2	NM_033084.3	NM_033084.3:c.1278+1delG, NM_033084.3:c.2152C>T, NM_033084.3:c.2494+2T>C, NM_033084.3:c.958C>T, NM_033084.3:c.2444G>A, NM_033084.3:c.782A>T, NM_033084.3:c.904C>T	Fanconi anemia complementation group D2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCD2 gene located on chromosomal region 3p26. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCE	Fanconi anemia, complementation group E	NM_021922.2	NM_021922.2:c.1501C>T, NM_021922.2:c.929_930insC, NM_021922.2:c.421C>T, NM_021922.2:c.1114-8G>A, NM_021922.2:c.922_923insC, NM_021922.2:c.355C>T	Fanconi anemia complementation group E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCE gene located on chromosomal region 6p22-p21. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	600
FANCG	Fanconi anemia, complementation group G	NM_004629.1	NM_004629.1:c.1795_1804delTGGATCCGTC, NM_004629.1:c.313G>T, NM_004629.1:c.637_643delTACCGCC, NM_004629.1:c.1480+1G>C, NM_004629.1:c.1852_1853delAA, NM_004629.1:c.510+1G>A, NM_004629.1:c.1077-2A>G, NM_004629.1:c.908_909insCT	Fanconi anemia complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCG gene located on chromosomal region 9p13. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCI	Fanconi anemia, complementation group I	NM_001113378.1	NM_001113378.1:c.3816+1G>A, NM_001113378.1:c.52C>T, NM_001113378.1:c.989_991delTAA, NM_001113378.1:c.2097C>G, NM_001113378.1:c.3466G>C, NM_001113378.1:c.2292-1G>A, NM_001113378.1:c.3492delG, NM_001113378.1:c.3853C>T, NM_001113378.1:c.3626_3627delGT, NM_001113378.1:c.3854G>A	Fanconi anemia complementation group I follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCI gene located on chromosomal region 15q26.1. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCL	Fanconi anemia, complementation group L	NM_018062.3	NM_018062.3:c.1051_1052delAG, NM_018062.3:c.1066_1067delAG, NM_018062.3:c.1096_1099dupATTA, NM_018062.3:c.1099_1100insATTA	Fanconi anemia complementation group L follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCL gene located on chromosomal region 2p16.1. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCM	Fanconi anemia, complementation group M	NM_020937.2	NM_020937.2:c.2171C>A, NM_020937.2:c.5766_5769delGACT, NM_020937.2:c.5101C>T, NM_020937.2:c.1072G>T, NM_020937.2:c.2996_2997insC, NM_020937.2:c.2586_2589delAAAA, NM_020937.2:c.5791C>T, NM_020937.2:c.624_625delAA, NM_020937.2:c.5569G>A, NM_020937.2:c.5764_5767delCTGA	Fanconi anemia complementation group M follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCM gene located on chromosomal region 14q21.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FGA	Congenital fibrinogen deficiency (gene FGA)	NM_021871.2	NM_021871.2:c.1039C>T, NM_021871.2:c.1441delG, NM_021871.2:c.675_676insC, NM_021871.2:c.1359dupC, NM_021871.2:c.*1086delG, NM_021871.2:c.1906_1907insC	Congenital fibrinogen deficiency (gene FGA) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGA gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000.	600
FGB	Congenital afibrinogenemia	NM_005141.4	NM_005141.4:c.1289G>A, NM_005141.4:c.1148T>G, NM_005141.4:c.794C>T	Congenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGB gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FGD4	Charcot-Marie-Tooth disease type 4H	NM_139241.2	NM_139241.2:c.1325G>A, NM_139241.2:c.893T>G, NM_139241.2:c.893T>C, NM_139241.2:c.670C>T	Charcot-Marie-Tooth disease type 4H follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGD4 gene located on chromosomal region 12p11.21. The age of onset is neonatal/infantile. This disease is characterized by slowly progressive muscle weakness in the distal extremities, and other common features include delayed walking, an abnormal gait, scoliosis and pes equines with toe retraction. The prevalence is 1/3,300.	600
FH	Fumaric aciduria	NM_000143.3	NM_000143.3:c.1067T>A, NM_000143.3:c.697C>T, NM_000143.3:c.698G>A, NM_000143.3:c.1236+1G>C, NM_000143.3:c.901dupA, NM_000143.3:c.320A>C, NM_000143.3:c.760C>T, NM_000143.3:c.1431_1433dupAAA, NM_000143.3:c.521C>G, NM_000143.3:c.1093A>G, NM_000143.3:c.1189G>A, NM_000143.3:c.1200delT, NM_000143.3:c.1394A>G, NM_000143.3:c.1255T>C, NM_000143.3:c.793G>A, NM_000143.3:c.40_41insC, NM_000143.3:c.1446_1449delAAAG, NM_000143.3:c.1293delA	Fumaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FH gene located on chromosomal region 1q42.1. The age of onset is neonatal/infantile. This disease is characterized by hypotonia, severe psychomotor impairment, convulsions, respiratory distress, feeding difficulties and frequent cerebral malformations, along with a distinctive facies, although some patients present with only moderate intellectual impairment. The prevalence is below 1,000,000.	600
FHL1	Emery-Dreifuss muscular dystrophy type 6	NM_001449.4	NM_001449.4:c.625T>C	Emery-Dreifuss muscular dystrophy tipe 6 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FHL1 gene located on chromosomal region Xq26. The age of onset is infantile. This disease is by muscular weakness and atrophy, with early joint contractures and cardiomyopathy. The prevalence is 1/1,000,000 to 9/1,000,000.	600
FHL1	Myopathy, reducing body	NM_001449.4	NM_001449.4:c.689-479G>A, NM_001449.4:c.310T>C	Reducing body myopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FH gene located on chromosomal region 1q42.1. The age of onset is neonatal/infantile. This disease is characterized by progressive muscle weakness and the presence of characteristic inclusion bodies in affected muscle fibres. The prevalence is below 1,000,000.	600
FIG4	Charcot-Marie-Tooth disease type 4J	NM_014845.5	NM_014845.5:c.592C>T, NM_014845.5:c.831_838delTAAATTTG, NM_014845.5:c.547C>T, NM_014845.5:c.501C>G, NM_014845.5:c.737G>A, NM_014845.5:c.122T>C, NM_014845.5:c.2296_2297insG	Charcot-Marie-Tooth disease type 4J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by rapidly progressive, asymmetric motor neuron degeneration with slow nerve conduction velocities, weakness and paralysis, without sensory loss. The prevalence is 4/100,000 to 8/100,000.	250,600
FIG4	Yunis-Varon syndrome	NM_014845.5	NM_014845.5:c.311G>A	Yunis-Varon syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by skeletal defects, including cleidocranial dysplasia and digital anomalies, and severe neurologic involvement with neuronal loss. Enlarged cytoplasmic vacuoles are found in neurons, muscle, and cartilage. The disorder is usually lethal in infancy. The prevalence is 4/100,000 to 8/100,000.	250,600
FKRP	Congenital muscular dystrophy type 5B	NM_024301.4	NM_024301.4:c.235G>A, NM_024301.4:c.1343C>T, NM_024301.4:c.1387A>G, NM_024301.4:c.1154C>A	Congenital muscular dystrophy type 5B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is neonatal/infantile. This disease is characterized by hypotonia, muscle wasting, weakness or delayed motor milestones. The prevalence is 1/14,500 to 1/123,000.	250,600
FKRP	Limb-girdle muscular dystrophy type 2I, autosomal recessive	NM_024301.4	NM_024301.4:c.160C>T	Autosomal recessive limb-girdle muscular dystrophy type 2I follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is infantile. This disease is characterized by proximal limb girdle weakness predominant in the legs, together with bilateral moderate scapulae winging, abdominal muscle weakness, waddling gait, calf hypertrophy, cardiomyopathy and respiratory insufficiency. The prevalence is 1/14,500 to 1/123,000.	250,600
FKTN	Fukuyama congenital muscular dystrophy	NM_001079802.1	NM_001079802.1:c.1112A>G, NM_001079802.1:c.509C>A, NM_001079802.1:c.411C>A, NM_001079802.1:c.1167dupA	Fukuyama congenital muscular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKTN gene located on chromosomal region 9q31-q33. The age of onset is infantile. This disease is characterized by brain malformation (cobblestone lissencephaly), dystrophic changes in skeletal muscle, severe intellectual deficit, epilepsy and motor impairment. The annual incidence is 1/50,000 to 2:50,000 live births in Japans and the prevalence is 1:1,000,000- 9:1,000,000.	600
FKTN	Muscular dystrophy, limb girdle, type 2M	NM_001079802.1	NM_001079802.1:c.1380dupA, NM_001079802.1:c.766C>T, NM_001079802.1:c.527T>C, NM_001079802.1:c.340G>A	Limb-girdle muscular dystrophy type 2M follows autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKTN gene located on chromosomal region 9q31-q33. The age of onset is from birth to early infancy. This disease is characterized by muscle weakness, joint contractures and spinal deformities. The prevalence is 1.92:100,000-3.68:100,000.	600
FLNA	Frontometaphyseal dysplasia	NM_001456.3	NM_001456.3:c.4447_4448insAT, NM_001456.3:c.760G>A, NM_001456.3:c.3476A>C, NM_001456.3:c.3557C>T	Fronto-metaphyseal dysplasia (FMD) follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FLNA gene located on chromosomal region Xq28. The age of onset is neonatal/infancy This disease is characterized by a characteristic face (prominent supraorbital ridges, hypertelorism, downslanted palpebral fissures, broad nasal bridge, and micrognathia with anomalies of teeth) and skeletal anomalies (fusion of carpal bones, increased density of long bone diaphyses, flared metaphyses and scoliosis). The prevalence is <1 / 1,000,000.	600
FLNA	Periventricular heterotopia	NM_001456.3	NM_001456.3:c.4543C>T, NM_001456.3:c.7129C>T, NM_001456.3:c.7733-1G>C, NM_001456.3:c.7527_7528+6delAGGTGAGC, NM_001456.3:c.5108_5109delTCinsAA, NM_001456.3:c.2761C>T, NM_001456.3:c.4777_4778dupAA	Periventricular heterotopia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FLNA gene located on chromosomal region Xq28. The age of onset is neonatal/infancy This disease is a brain malformation, due to abnormal neuronal migration, in which a subset of neurons fails to migrate into the developing cerebral cortex and remains as nodules that line the ventricular surface. Classical form is a rare X-linked dominant disorder far more frequent in females who present normal intelligence to borderline intellectual deficit, epilepsy of variable severity and extra-central nervous system signs, especially cardiovascular defects or coagulopathy. The disorder is generally associated with prenatal lethality in males. The prevalence is <1 / 1,000,000.	600
FLVCR1	Ataxia, posterior column, with retinitis pigmentosa	NM_014053.3	NM_014053.3:c.361A>G, NM_014053.3:c.574T>C, NM_014053.3:c.739-2delA	Posterior column ataxia - Retinitis pigmentosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FLVCR1 gene located on chromosomal region 1q32.3. The age of onset is childhood. This disease is characterized by sensory ataxia, proprioceptive loss and blindness. The prevalence is <1 / 1.000.000.	600
FMR1	Fragile X syndrome	-	(CGG)n pre-mutated allele (Detection by PCR and TP-PCR)	Fragile X syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FMR1 gene located on chromosomal region Xq27.3. The symptoms are variable depending on the range of CGG triplet expansion. In complete mutation the onset is infantile in men and is characterized by intellectual disability, characteristic appearance (large head, long face, prominent forehead and chin, protruding ears) joint laxity and large testes after puberty. In carrier female, the symptoms are milder and include primary ovarian insufficiency. The prevalence is 1/2,500 (full mutation allele) to 1/4,000 (prevalence of symptomatic cases) for both genders.	250,600
FOXN1	T-cell immunodeficiency, congenital alopecia, and nail dystrophy	NM_003593.2	NM_003593.2:c.763C>T	Severe T-cell immunodeficiency - congenital alopecia - nail dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FOXN1 gene located on chromosomal region 17q11.2. The age of onset is infantile. This disease is characterized by T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. The prevalence is <1:1,000,000.	600
FRAS1	Fraser syndrome	NM_025074.6	NM_025074.6:c.7813C>T, NM_025074.6:c.832_835delTGTG, NM_025074.6:c.11159_11166delAGCTGGAG, NM_025074.6:c.776T>G, NM_025074.6:c.6991_6992insGG, NM_025074.6:c.6433C>T, NM_025074.6:c.3799C>T, NM_025074.6:c.1071+1_1071+4delGTGA, NM_025074.6:c.4969+1_4969+2insTAGC, NM_025074.6:c.5605_5606insT	Fraser syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the genes FRAS1 (located on chromosomal region 4q21.21) and FREM2 (located on chromosomal region 13q13.3). The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000.	250,600
FREM2	Fraser syndrome	NM_207361.5	NM_207361.5:c.2361_2362insC, NM_207361.5:c.8409+1G>A, NM_207361.5:c.5914G>A, NM_207361.5:c.5920G>A, NM_207361.5:c.3792_3795delTTAT	Fraser syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the genes FRAS1 (located on chromosomal region 4q21.21) and FREM2 (located on chromosomal region 13q13.3). The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000.	600
FUCA1	Fucosidosis	NM_000147.4	NM_000147.4:c.244C>T, NM_000147.4:c.1279C>T, NM_000147.4:c.856C>T, NM_000147.4:c.648C>A, NM_000147.4:c.1229T>G, NM_000147.4:c.433T>C	Fucosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FUCA1 gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is characterized by facial dysmorphism, dysostosis multiplex, moderate hepatomegaly, severe intellectual deficit, deafness, and according to age, angiokeratomas. The prevalence is <1:1,000,000.	600
FXN	Friedreich ataxia	NM_000144.4	NM_000144.4:c.389G>T, NM_000144.4:c.460A>T, NM_000144.4:c.385-2A>G, NM_000144.4:c.317T>G	Friedreich ataxia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FXN gene located on chromosomal region 9q21.11. The age of onset is between age 10 and 15 years and usually before age 25 years. This disease is characterized by slowly progressive ataxia, dysarthria, muscle weakness, spasticity in the lower limbs, scoliosis, bladder dysfunction, absent lower limb reflexes, and loss of position and vibration sense. The prevalence is 2:100,000-4:100,000.	600
G6PC	Glycogen storage disease type 1a	NM_000151.3	NM_000151.3:c.508C>T, NM_000151.3:c.551G>A, NM_000151.3:c.447-1G>A, NM_000151.3:c.1039C>T, NM_000151.3:c.562G>C, NM_000151.3:c.380_381insTA, NM_000151.3:c.497T>G, NM_000151.3:c.247C>T, NM_000151.3:c.113A>T, NM_000151.3:c.229T>C, NM_000151.3:c.230+1G>C, NM_000151.3:c.47C>G, NM_000151.3:c.883C>T, NM_000151.3:c.370G>A, NM_000151.3:c.626A>G, NM_000151.3:c.248G>A	Glycogen storage disease type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000.	250,600
G6PC3	Severe congenital neutropenia type 4	NM_138387.3	NM_138387.3:c.346A>G, NM_138387.3:c.141C>G, NM_138387.3:c.778G>C, NM_138387.3:c.758G>A, NM_138387.3:c.935_936insT, NM_138387.3:c.784G>C	Severe congenital neutropenia type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC3 gene located on chromosomal region 17q21.31. This disease is characterized by familial pulmonary arterial hypertension, cardiac abnormalities including atrial septal defect, leukopenia including intermittent neutropenia, lymphopenia, monocytosis, and anemia. The prevalence is 1:100,000.	600
GAA	Glycogen storage disease type 2	NM_000152.3	NM_000152.3:c.118C>T, NM_000152.3:c.1316T>A, NM_000152.3:c.1799G>A, NM_000152.3:c.1827_1828insA, NM_000152.3:c.1846_1847insA, NM_000152.3:c.1115A>T, NM_000152.3:c.1552-3C>G, NM_000152.3:c.1445C>T, NM_000152.3:c.2238G>C, NM_000152.3:c.1327-2A>G, NM_000152.3:c.1650dupG, NM_000152.3:c.2238G>A, NM_000152.3:c.307T>G, NM_000152.3:c.230_240delCAGTGCCCACA, NM_000152.3:c.2512C>T, NM_000152.3:c.1431delT, NM_000152.3:c.1561G>A, NM_000152.3:c.1465G>A, NM_000152.3:c.1548G>A, NM_000152.3:c.546G>A, NM_000152.3:c.1064T>C, NM_000152.3:c.877G>A, NM_000152.3:c.925G>A, NM_000152.3:c.768_769insT, NM_000152.3:c.2560C>T, NM_000152.3:c.655G>A, NM_000152.3:c.1408_1410delAAC, NM_000152.3:c.953T>C, NM_000152.3:c.1933G>T, NM_000152.3:c.1935C>A, NM_000152.3:c.1585_1586delTCinsGT, NM_000152.3:c.1927G>A, NM_000152.3:c.2041-1G>A, NM_000152.3:c.2066_2070dupAGCCG, NM_000152.3:c.2105G>T, NM_000152.3:c.2237G>A, NM_000152.3:c.525delT, NM_000152.3:c.546+1_546+4delGTGG, NM_000152.3:c.2544delC, NM_000152.3:c.1912G>T, NM_000152.3:c.1634C>T, NM_000152.3:c.710C>T, NM_000152.3:c.2015G>A, NM_000152.3:c.546G>C, NM_000152.3:c.2012T>G, NM_000152.3:c.853C>T, NM_000152.3:c.697delA	Glycogen storage disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAA gene located on chromosomal region 17q25.3. There are two forms: adult and infantile.The age of onset in this last form is before the age of three months. This disease is characterized by severe hypotonia, hypertrophic cardiomyopathy and progressive hepatomegaly. The incidence is 1/57,000 for the adult form and 1/138,000 for infantile form.	250,600
GALC	Krabbe disease	NM_000153.3	NM_000153.3:c.1591C>T, NM_000153.3:c.1161+2T>G, NM_000153.3:c.1586C>T, NM_000153.3:c.1592G>A, NM_000153.3:c.1489+1_1489+2delGT, NM_000153.3:c.582+1G>A, NM_000153.3:c.388G>A, NM_000153.3:c.430delA, NM_000153.3:c.1695delT, NM_000153.3:c.1472delA, NM_000153.3:c.1004A>G, NM_000153.3:c.1153G>T, NM_000153.3:c.658C>T, NM_000153.3:c.1543G>A, NM_000153.3:c.332G>A, NM_000153.3:c.334A>G, NM_000153.3:c.205C>T, NM_000153.3:c.1796T>G, NM_000153.3:c.1814dupA, NM_000153.3:c.1700A>C, NM_000153.3:c.1723_1724insT, NM_000153.3:c.1964delC, NM_000153.3:c.236G>A, NM_000153.3:c.1488_1489+2delTGGT, NM_000153.3:c.453G>A, NM_000153.3:c.1488_1489delTG, NM_000153.3:c.628A>T, NM_000153.3:c.655C>T, NM_000153.3:c.953C>G, NM_000153.3:c.2056T>C	Krabbe disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALC gene located on chromosomal region 14q31.3. There are two forms of the disease: infantile form (2-6 months onset) more severe and adult form less severe. It is a degenerative disorder that affects the nervous system characterized by a muscle stiffness, blindness, deafness, and eventually death. The incidence is 1/100,000-1/250,000 and the prevalence is 1/100,000.	250,600
GALT	Galactosemia	NM_000155.3	NM_000155.3:c.130G>A, NM_000155.3:c.132delG, NM_000155.3:c.118G>T, NM_000155.3:c.265T>G, NM_000155.3:c.289_291delAAC, NM_000155.3:c.1138T>C, NM_000155.3:c.113A>C, NM_000155.3:c.152G>A, NM_000155.3:c.1048delA, NM_000155.3:c.290A>G, NM_000155.3:c.221T>C, NM_000155.3:c.253-2A>G, NM_000155.3:c.425T>A, NM_000155.3:c.428C>T, NM_000155.3:c.442C>T, NM_000155.3:c.143G>C, NM_000155.3:c.443G>A, NM_000155.3:c.158G>A, NM_000155.3:c.18delC, NM_000155.3:c.199C>T, NM_000155.3:c.200G>A, NM_000155.3:c.203A>C, NM_000155.3:c.218_219delCT, NM_000155.3:c.512T>C, NM_000155.3:c.547C>A, NM_000155.3:c.552C>A, NM_000155.3:c.563A>G, NM_000155.3:c.565_578delGTATGGGCCAGCAG, NM_000155.3:c.568T>C, NM_000155.3:c.580T>C, NM_000155.3:c.584T>C, NM_000155.3:c.598delC, NM_000155.3:c.601C>T, NM_000155.3:c.602G>A, NM_000155.3:c.1030C>A, NM_000155.3:c.510C>A, NM_000155.3:c.617A>G, NM_000155.3:c.619C>T, NM_000155.3:c.626A>G, NM_000155.3:c.634C>T, NM_000155.3:c.688-2A>C, NM_000155.3:c.692G>A, NM_000155.3:c.292G>A, NM_000155.3:c.329-2A>C, NM_000155.3:c.367C>T, NM_000155.3:c.377+7A>C, NM_000155.3:c.386T>C, NM_000155.3:c.607G>A, NM_000155.3:c.610C>T, NM_000155.3:c.413C>T, NM_000155.3:c.416T>G, NM_000155.3:c.41delinsTT, NM_000155.3:c.904+1G>T, NM_000155.3:c.905-2A>G, NM_000155.3:c.907G>A, NM_000155.3:c.442G>A, NM_000155.3:c.947G>A, NM_000155.3:c.443G>C, NM_000155.3:c.445dupG, NM_000155.3:c.997C>G, NM_000155.3:c.997C>T, NM_000155.3:c.998G>A, NM_000155.3:c.793C>G, NM_000155.3:c.820+13A>G, NM_000155.3:c.1052delC, NM_000155.3:c.844C>G, NM_000155.3:c.855G>T, NM_000155.3:c.719_728delTAGTACTGGT, NM_000155.3:c.772C>T, NM_000155.3:c.939G>A, NM_000155.3:c.71_72insA, NM_000155.3:c.404C>T, NM_000155.3:c.508-1G>C, NM_000155.3:c.775C>T, NM_000155.3:c.400delT, NM_000155.3:c.502_504delGTG, NM_000155.3:c.957C>A, NM_000155.3:c.823C>G, NM_000155.3:c.505C>A, NM_000155.3:c.1006A>T, NM_000155.3:c.985T>C, NM_000155.3:c.790delC, NM_000155.3:c.790_792delinsTAG	Galactosemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALT gene located on chromosomal region 9p13.3. The age of onset is neonatal. This disease is characterized by feeding difficulties, lethargy, and severe liver disease. Long-term complications appear including cognitive impairments, motor deficits, and ovarian dysfunction with reduced fertility in women and diminished bone density. The prevalence is 1/40,000-1/60,000.	250,600
GAMT	Guanidinoacetate methyltransferase deficiency	NM_000156.5	NM_000156.5:c.506G>A, NM_000156.5:c.590T>C	Guanidinoacetate methyltransferase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAMT gene located on chromosomal region 19p13.3. The age of onset is infantile. This disease is characterized by intellectual disability, seizures and behavioral problems, often in conjunction with pyramidal and/or extrapyramidal manifestations with muscular hypotony. Biochemical symptoms are also included with high urinary excretion of guanidinoacetate, low urinary excretion of creatinine and creatine depletion in brain and muscles.	600
GAN	Giant axonal neuropathy	NM_022041.3	NM_022041.3:c.1447C>T, NM_022041.3:c.1456G>A, NM_022041.3:c.1684C>G, NM_022041.3:c.1429C>T, NM_022041.3:c.601C>T, NM_022041.3:c.413G>A, NM_022041.3:c.505G>A, NM_022041.3:c.1268T>C	Giant axonal neuropathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAN gene located on chromosomal region 16q23.2. The age of onset is infantile. This disease is characterized by a progressive motor and sensitive peripheral and central nervous system neuropathy. Twenty families have been reported with this disease but the frequency is likely to be under-estimated.	250,600
GBA	Gaucher disease	NM_001005741.2	NM_001005741.2:c.1093G>A, NM_001005741.2:c.1090G>A, NM_001005741.2:c.1043C>T, NM_001005741.2:c.1274dupA, NM_001005741.2:c.1098dupA, NM_001005741.2:c.1085C>T, NM_001005741.2:c.1102C>T, NM_001005741.2:c.1049A>G, NM_001005741.2:c.1240G>T, NM_001005741.2:c.1246G>A, NM_001005741.2:c.1301G>C, NM_001005741.2:c.1088T>C, NM_001005741.2:c.1348T>A, NM_001005741.2:c.1361C>G, NM_001005741.2:c.1342G>C, NM_001005741.2:c.1448T>C, NM_001005741.2:c.1448T>G, NM_001005741.2:c.1504C>T, NM_001005741.2:c.1447_1466delCTGGACGCAGTGGCACTGATinsTG, NM_001005741.2:c.254G>A, NM_001005741.2:c.259C>T, NM_001005741.2:c.1053G>T, NM_001005741.2:c.160G>T, NM_001005741.2:c.431T>G, NM_001005741.2:c.475C>T, NM_001005741.2:c.476G>A, NM_001005741.2:c.481C>T, NM_001005741.2:c.487delG, NM_001005741.2:c.497A>T, NM_001005741.2:c.508C>T, NM_001005741.2:c.1141T>G, NM_001005741.2:c.115+1G>A, NM_001005741.2:c.1171G>C, NM_001005741.2:c.1174C>G, NM_001005741.2:c.354G>C, NM_001005741.2:c.1060G>C, NM_001005741.2:c.1208G>C, NM_001005741.2:c.1228C>G, NM_001005741.2:c.123A>G, NM_001005741.2:c.1240G>C, NM_001005741.2:c.914delC, NM_001005741.2:c.517A>C, NM_001005741.2:c.1295G>T, NM_001005741.2:c.1307T>C, NM_001005741.2:c.1265_1319del, NM_001005741.2:c.1319C>T, NM_001005741.2:c.1309G>T, NM_001005741.2:c.1226A>G, NM_001005741.2:c.407C>A, NM_001005741.2:c.1343A>T, NM_001005741.2:c.84_85insG, NM_001005741.2:c.518C>T, NM_001005741.2:c.1391A>C, NM_001005741.2:c.509G>T, NM_001005741.2:c.1604G>A, NM_001005741.2:c.84dupG, NM_001005741.2:c.535G>C, NM_001005741.2:c.586A>C, NM_001005741.2:c.1297G>T, NM_001005741.2:c.1184C>T, NM_001005741.2:c.1192C>T	Gaucher disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBA gene located on chromosomal region 1q22. Gaucher disease encompasses a continuum of clinical findings from a perinatal lethal disorder to an asymptomatic type. There are three major clinical types (1, 2, and 3) and two other subtypes (perinatal-lethal and cardiovascular). Type 1 is characterized by the presence of clinical or radiographic evidence of bone disease, hepatosplenomegaly, anemia and thrombocytopenia, lung disease, and the absence of primary central nervous system disease. GD types 2 and 3 are characterized by the presence of primary neurologic disease. Type 2 has an onset before age two years, limited psychomotor development, and a rapidly progressive course with death by age two to four years. Type 3 may have onset before age two years, but often have a more slowly progressive course, with survival into the third or fourth decade. The perinatal-lethal form is associated with ichthyosiform or collodion skin abnormalities or with nonimmune hydrops fetalis. The cardiovascular form is characterized by calcification of the aortic and mitral valves, mild splenomegaly, corneal opacities, and supranuclear ophthalmoplegia. Cardiopulmonary complications have been described with all the clinical subtypes, although varying in frequency and severity. The incidence is 1/60,000 and the prevalence is approximately 1/100,000.	250,600
GBE1	Glycogen storage disease type 4	NM_000158.3	NM_000158.3:c.1571G>A, NM_000158.3:c.1570C>T, NM_000158.3:c.1774G>T, NM_000158.3:c.771T>A, NM_000158.3:c.1543C>T, NM_000158.3:c.1883A>G, NM_000158.3:c.2052+1G>A, NM_000158.3:c.986A>C, NM_000158.3:c.466_470delCGTAT, NM_000158.3:c.1604A>G	Glycogen storage disease type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is infantile. This disease is characterized by failure to thrive; hepatomegaly, liver dysfunction, and progressive liver cirrhosis; hypotonia; cardiomyopathy and, finally, death.	250,600
GBE1	Polyglucosan body disease, adult	NM_000158.3	NM_000158.3:c.986A>G	Polyglucosan body disease, adult form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is late-onset, slowly progressive disorder affecting the central and peripheral nervous systems. This disease is characterized by a variable combination of cognitive impairment, pyramidal tetraparesis, peripheral neuropathy, and neurogenic bladder. Other manifestations include cerebellar dysfunction and extrapyramidal signs.	250,600
GCDH	Glutaric acidemia type 1	NM_000159.3	NM_000159.3:c.1093G>A, NM_000159.3:c.1060G>C, NM_000159.3:c.542A>G, NM_000159.3:c.442G>A, NM_000159.3:c.1199dupT, NM_000159.3:c.572T>C, NM_000159.3:c.1060G>A, NM_000159.3:c.1247C>T, NM_000159.3:c.74C>A, NM_000159.3:c.947C>A, NM_000159.3:c.1168G>C, NM_000159.3:c.416C>T, NM_000159.3:c.1198G>A, NM_000159.3:c.636-1G>A, NM_000159.3:c.1204C>T, NM_000159.3:c.1244-2A>C, NM_000159.3:c.751C>T, NM_000159.3:c.1262C>T, NM_000159.3:c.1148G>A, NM_000159.3:c.680G>C, NM_000159.3:c.883T>C, NM_000159.3:c.1015A>G, NM_000159.3:c.764C>T, NM_000159.3:c.271+1G>A, NM_000159.3:c.743C>T, NM_000159.3:c.877G>A, NM_000159.3:c.914C>T, NM_000159.3:c.1002_1003delGA, NM_000159.3:c.383G>A, NM_000159.3:c.769C>T	Glutaric acidemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCDH gene located on chromosomal region 19p13.2. The age of onset is infantile or neonatal. This disease is characterized by encephalopathic crises resulting in striatal injury and a severe dystonic dyskinetic movement disorder. The prevalence is 1 in 100,000 births.	250,600
GCSH	Glycine encephalopathy (GCSH)	NM_004483.4	NM_004483.4:c.337dupT	Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCSH gene located on chromosomal region 16q23.2. The age of onset is neonatal. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures.	600
GDAP1	Charcot-Marie-Tooth disease type 4A	NM_018972.2	NM_018972.2:c.358C>T, NM_018972.2:c.487C>T, NM_018972.2:c.311-1G>A, NM_018972.2:c.844C>T, NM_018972.2:c.715C>T, NM_018972.2:c.92G>A	Charcot-Marie-Tooth disease type 4A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GDAP1 gene located on chromosomal region 8q21.11. It is a severe, early-onset form of demyelinating CMT peripheral sensorimotor polyneuropathy characterized by severe motor retardation and progressive scoliosis. Vocal cord paresis may also occur.	600
GFM1	Combined oxidative phosphorylation deficiency type 1	NM_024996.5	NM_024996.5:c.1294_1297delACAG, NM_024996.5:c.748C>T, NM_024996.5:c.139C>T, NM_024996.5:c.1528_1529delAG, NM_024996.5:c.521A>G	Combined oxidative phosphorylation deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GFM1 gene located on chromosomal region 3q25.32. The age of onset is from early infancy until adult. This disease is characterized by ptosis, external ophthalmoplegia, proximal myopathy and exercise intolerance, cardiomyopathy, sensorineural deafness, optic atrophy, pigmentary retinopathy, and diabetes mellitus.	600
GJA1	Oculodentodigital dysplasia	NM_000165.4	NM_000165.4:c.227G>A, NM_000165.4:c.97C>T	Oculodentodigital dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJA1 gene located on chromosomal region 6q22.31. The age of onset is infantile. This disease is characterized by craniofacial, neurologic, limb and ocular abnormalities.	600
GJB2	Deafness type 1A, autosomal recessive	NM_004004.5	NM_004004.5:c.176_191delGCTGCAAGAACGTGTG, NM_004004.5:c.169C>T, NM_004004.5:c.270dupA, NM_004004.5:c.239A>C, NM_004004.5:c.269T>C, NM_004004.5:c.427C>T, NM_004004.5:c.299_300delAT, NM_004004.5:c.250G>T, NM_004004.5:c.230G>A, NM_004004.5:c.516G>A, NM_004004.5:c.439G>A, NM_004004.5:c.465T>A, NM_004004.5:c.229T>C, NM_004004.5:c.241C>G, NM_004004.5:c.235delC, NM_004004.5:c.238C>T, NM_004004.5:c.557C>T, NM_004004.5:c.269_270insT, NM_004004.5:c.617A>G, NM_004004.5:c.231G>A, NM_004004.5:c.310_323delAGGAAGTTCATCAA, NM_004004.5:c.313_326delAAGTTCATCAAGGG, NM_004004.5:c.358_360delGAG, NM_004004.5:c.35delG, NM_004004.5:c.249C>G, NM_004004.5:c.334_335delAA, NM_004004.5:c.402delG, NM_004004.5:c.413G>A, NM_004004.5:c.416G>A, NM_004004.5:c.299A>T, NM_004004.5:c.250G>C, NM_004004.5:c.550C>T, NM_004004.5:c.551G>C, NM_004004.5:c.503A>G, NM_004004.5:c.227T>C, NM_004004.5:c.380G>A, NM_004004.5:c.132G>A, NM_004004.5:c.365A>T, NM_004004.5:c.139G>T	Deafness, autosomal recessive type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 and GJB3 genes located on chromosomal regions 13q12.11 and 1p34.3 respectively. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.	250,600
GJB3	Deafness type 1A, autosomal recessive	NM_024009.2	NM_024009.2:c.529T>G, NM_024009.2:c.580G>A, NM_024009.2:c.94C>T	Deafness, autosomal recessive type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 and GJB3 genes located on chromosomal regions 13q12.11 and 1p34.3 respectively. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.	250,600
GJB6	Deafness type 1B, autosomal recessive	NM_006783.4	NM_006783.4:c.261dupA, NM_006783.4:c.169C>T, NM_006783.4:c.485dupA, NM_006783.4:c.689dupA, NM_006783.4:c.14C>T, NM_006783.4:c.443delC, NM_006783.4:c.383_384delTA, NM_006783.4:c.689_690insA	Nonsyndromic sensorineural deafness, autosomal recessive type DFNB1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB6 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.	250,600
GJC2	Pelizaeus-Merzbacher-like disease type 1	NM_020435.3	NM_020435.3:c.857T>C, NM_020435.3:c.814T>G, NM_020435.3:c.613C>T, NM_020435.3:c.787G>A, NM_020435.3:c.718C>T, NM_020435.3:c.268C>T	Pelizaeus-Merzbacher-like disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJC2 gene located on chromosomal region 1q42.13. It is an autosomal recessive leukodystrophy sharing identical clinical and radiological features as X-linked Pelizaeus-Merzbacher disease. The age of onset is early infantile. This disease is characterized by nystagmus, delayed motor milestones, ataxia, progressive spasticity, partial seizures, mild peripheral neuropathy, and diffuse leukodystrophy. The prevalence is <1.27:100,000.	600
GLB1	GM1 Gangliosidosis	NM_000404.2	NM_000404.2:c.1369C>T, NM_000404.2:c.1370G>A, NM_000404.2:c.1452C>G, NM_000404.2:c.176G>A, NM_000404.2:c.276G>A, NM_000404.2:c.1733A>G, NM_000404.2:c.1355dupA, NM_000404.2:c.442C>A, NM_000404.2:c.202C>T, NM_000404.2:c.591_592insT, NM_000404.2:c.622C>T, NM_000404.2:c.1549G>T, NM_000404.2:c.442C>T, NM_000404.2:c.457+2T>C, NM_000404.2:c.947A>G, NM_000404.2:c.438_440delTCT, NM_000404.2:c.601C>T, NM_000404.2:c.602G>A, NM_000404.2:c.1068+1G>T, NM_000404.2:c.1174_1175delCT, NM_000404.2:c.1004C>T, NM_000404.2:c.1051C>T, NM_000404.2:c.171C>G, NM_000404.2:c.1321G>A, NM_000404.2:c.1325G>A, NM_000404.2:c.818G>T, NM_000404.2:c.152T>C, NM_000404.2:c.1456_1466dupGGTGCATATAT, NM_000404.2:c.145C>T, NM_000404.2:c.175C>T, NM_000404.2:c.901G>A, NM_000404.2:c.1646C>T, NM_000404.2:c.1577dupG, NM_000404.2:c.1310A>T	Gangliosidosis GM1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. Although the three types differ in severity, their features can overlap significantly. The age of onset in type 1 is infantile, in type 2 is late-infantile or juvenile and adult in type3. This disease is characterized by arrest/regression of neurological development, hypotonia, visceromegaly, macular cherry-red spots, dysostosis and coarse facial features. The prevalence is 1:100,000 a 200,000 newborn.	250,600
GLB1	Mucopolysaccharidosis type 4B	NM_000404.2	NM_000404.2:c.1444C>T, NM_000404.2:c.1313G>A, NM_000404.2:c.817T>C, NM_000404.2:c.1445G>A, NM_000404.2:c.1223A>C	Mucopolysaccharidosis type 4B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. The age of onset is variable infantile/juvenile. In addition to skeletal involvement, significant morbidity can result from respiratory compromise, obstructive sleep apnea, valvular heart disease, hearing impairment, corneal clouding, and spinal cord compression. The prevalence is 1:200,000-1:300,000.	250,600
GLDC	Glycine encephalopathy	NM_000170.2	NM_000170.2:c.322G>T, NM_000170.2:c.1229G>A, NM_000170.2:c.1545G>C, NM_000170.2:c.1691G>T, NM_000170.2:c.1166C>T, NM_000170.2:c.2113G>A, NM_000170.2:c.2284G>A, NM_000170.2:c.1705G>A, NM_000170.2:c.2216G>A, NM_000170.2:c.2405C>T	Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMT and GLDC genes located on chromosomal regions 3p21.31 and 9p24.1 respectively. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000.	250,600
GLE1	Lethal arthrogryposis with anterior horn cell disease	NM_001003722.1	NM_001003722.1:c.2051T>C, NM_001003722.1:c.1412_1413delAG, NM_001003722.1:c.898-2A>G, NM_001003722.1:c.2069_2072delTTCT, NM_001003722.1:c.1807C>T	Lethal arthrogryposis with anterior horn cell disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLE1 gene located on chromosomal region 9q34.11. The age of onset is fetal. This disease is characterized by fetal akinesia, arthrogryposis and motor neuron loss. The fetus often survives delivery, but dies early as a result of respiratory failure. Neuropathological findings resemble those of lethal congenital contracture syndrome type 1, but are less severe.	250,600
GM2A	GM2 Gangliosidosis	NM_000405.4	NM_000405.4:c.285delC, NM_000405.4:c.160G>T, NM_000405.4:c.506G>C	GM2-gangliosidosis, AB variant follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GM2A gene located on chromosomal region 5q33.1. The age of onset is infantile. This disease is characterized by a group of neurodegenerative disorders: seizures, blindness, spasticity, eventual total incapacitation, and death. The prevalence is <1:100.000.	600
GNE	Distal myopathy Nonaka type	NM_005476.5	NM_005476.5:c.2116T>C, NM_005476.5:c.2135T>C, NM_005476.5:c.2086G>A, NM_005476.5:c.478C>T, NM_005476.5:c.1844C>G, NM_005476.5:c.737G>A, NM_005476.5:c.385C>T, NM_005476.5:c.1714G>T, NM_005476.5:c.1798G>A, NM_005476.5:c.2086G>T, NM_005476.5:c.787C>T, NM_005476.5:c.2023T>C, NM_005476.5:c.1993G>A, NM_005476.5:c.673G>A, NM_005476.5:c.909T>A, NM_005476.5:c.1727G>A	Distal myopathy, Nonaka type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNE gene located on chromosomal region 9p13.3. The age of onset is adult. This disease is characterized by progressive muscle weakness and joint deformity. The prevalence is 1:500-1:1,000.	250,600
GNPTAB	Mucolipidosis type 2/type 3	NM_024312.4	NM_024312.4:c.1931C>T, NM_024312.4:c.1799delC, NM_024312.4:c.3503_3504delTC, NM_024312.4:c.3173C>G, NM_024312.4:c.25C>T, NM_024312.4:c.3663delG, NM_024312.4:c.1906dupA, NM_024312.4:c.2383delG, NM_024312.4:c.732_733delAA, NM_024312.4:c.749dupA, NM_024312.4:c.2896delA, NM_024312.4:c.648_651delAGAA, NM_024312.4:c.3326dupA, NM_024312.4:c.3410T>A, NM_024312.4:c.10A>C, NM_024312.4:c.1000C>T, NM_024312.4:c.1196C>T, NM_024312.4:c.1759C>T, NM_024312.4:c.3565C>T, NM_024312.4:c.616_619delACAG, NM_024312.4:c.99delC, NM_024312.4:c.3598G>A, NM_024312.4:c.3560_3561delAG	Mucolipidosis type 2/type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNPTAB gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by growth retardation, skeletal abnormalities, facial dysmorphism, stiff skin, developmental delay and cardiomegaly and that is lethal in childhood. The prevalence is 1:123,500-1:625,500.	250,600
GNS	Mucopolysaccharidosis type 3D	NM_002076.3	NM_002076.3:c.1063C>T, NM_002076.3:c.1226dupG, NM_002076.3:c.1169delA, NM_002076.3:c.1168C>T, NM_002076.3:c.413C>G	Mucolipidosis type 3D (Sanfilippo disease) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNS gene located on chromosomal region 12q14.3. The age of onset is infantile. This disease is characterized by joint stiffness and pain initially in the shoulders, hips, and fingers; and gradual mild coarsening of facial features, cardiorespiratory complications and mild cognitive impairment. The incidence is 1:70,000 newborn.	600
GPR143	Ocular albinism, X-linked	NM_000273.2	NM_000273.2:c.992_993insCG, NM_000273.2:c.695C>A	X-linked recessive ocular albinism follows an X-linked pattern of inheritance and is caused by pathogenic variants in the GPR143 gene located on chromosomal region Xp22.2. The age of onset is infantile. This disease is characterized by ocular hypopigmentation, foveal hypoplasia, nystagmus, photodysphoria, and reduced visual acuity. The prevalence is 1/60,000 to 1/150,000 live male births.	600
GPR179	Night blindness, congenital stationary type 1E	NM_001004334.3	NM_001004334.3:c.1784+1G>A, NM_001004334.3:c.1368delT, NM_001004334.3:c.3656_3657delCT, NM_001004334.3:c.6847_6848delCT, NM_001004334.3:c.984delC, NM_001004334.3:c.1807C>T, NM_001004334.3:c.278_279insC, NM_001004334.3:c.5693_5694insT, NM_001004334.3:c.278delC, NM_001004334.3:c.1236G>A, NM_001004334.3:c.376G>C, NM_001004334.3:c.3233_3234delCT, NM_001004334.3:c.5763_5764delGA, NM_001004334.3:c.839_842delATCA, NM_001004334.3:c.4699_4700delAG	Congenital stationary night blindness type 1E follow an autosomal recessive, dominant or X-linked pattern of inheritance and is caused by pathogenic variants in the GPR179 gene located on chromosomal region 17q12. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity.	250,600
GPR98	Usher syndrome type 2C	NM_032119.3	NM_032119.3:c.11377G>T, NM_032119.3:c.8713_8716dupAACA, NM_032119.3:c.2864C>A, NM_032119.3:c.18131A>G, NM_032119.3:c.2258_2270delAAGTGCTGAAATC, NM_032119.3:c.6275-1G>A, NM_032119.3:c.2636C>T, NM_032119.3:c.14973-1G>C, NM_032119.3:c.17668_17669delAT, NM_032119.3:c.5357_5358delAA, NM_032119.3:c.5747C>T, NM_032119.3:c.15196_15199dupCAAA, NM_032119.3:c.3151G>T, NM_032119.3:c.6901C>T, NM_032119.3:c.8790delC, NM_032119.3:c.5830G>A, NM_032119.3:c.6311_6312insT	Usher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR98 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32 respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000.	250,600
GRHPR	Primary hyperoxaluria type 2	NM_012203.1	NM_012203.1:c.103delG, NM_012203.1:c.295C>T, NM_012203.1:c.755dupA, NM_012203.1:c.622C>T, NM_012203.1:c.435G>A	Primary hyperoxaluria type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRHPR gene located on chromosomal region 9p13.2. The age of onset is infantile. This disease is characterized by recurrent nephrolithiasis, nephrocalcinosis and end-stage renal disease with subsequent systemic oxalosis.	600
GRM6	Night blindness, congenital stationary type 1B	NM_000843.3	NM_000843.3:c.2341G>A, NM_000843.3:c.727_728insG, NM_000843.3:c.2213_2219delCCAGAGG, NM_000843.3:c.1861C>T, NM_000843.3:c.2560C>T, NM_000843.3:c.712C>T, NM_000843.3:c.2122C>T, NM_000843.3:c.719_720insG, NM_000843.3:c.1214T>C, NM_000843.3:c.1336C>T, NM_000843.3:c.1258C>T, NM_000843.3:c.1565G>A	Congenital stationary night blindness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRM6 gene located on chromosomal region 5q35.3. The age of onset is early infancy. This disease is characterized by hemeralopia with a moderate loss of visual acuity.	250,600
GRXCR1	Deafness type 25, autosomal recessive	NM_001080476.2	NM_001080476.2:c.229C>T, NM_001080476.2:c.190G>A, NM_001080476.2:c.710_711delAT	Autosomal recessive nonsyndromic sensorineural deafness type DFNB25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRXCR1 gene located on chromosomal region 4p13. The age of onset is infantile. This disease is characterized by hearing loss which is not associated visible abnormalities of the external ear or any related medical problems.	600
GSS	Glutathione synthetase deficiency	NM_000178.2	NM_000178.2:c.656A>G, NM_000178.2:c.847C>T, NM_000178.2:c.754C>T, NM_000178.2:c.799C>T, NM_000178.2:c.4delG, NM_000178.2:c.656A>C, NM_000178.2:c.491G>A, NM_000178.2:c.832C>T	Glutathione synthetase deficiency with 5-oxoprolinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GSS gene located on chromosomal region 20q11.22. The severity and age of onset are variable. This disease is characterized by affectation of the neutrophil respiratory burst and can increase host susceptibility to infections, is associated with hemolytic anemia and intellectual disability. The prevalence is <1:1,000,000.	600
GUCY2D	Leber congenital amaurosis type 1	NM_000180.3	NM_000180.3:c.1694T>C, NM_000180.3:c.2735_2736delTT, NM_000180.3:c.456C>A, NM_000180.3:c.622delC, NM_000180.3:c.2734_2735delTT, NM_000180.3:c.2945delG	Leber congenital amaurosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUCY2D gene located on chromosomal region 17p13.1. The age of onset is infantile. This disease is characterized by blindness, nystagmus, roving eye movement and severe visual impairment.	600
GUSB	Mucopolysaccharidosis type 7	NM_000181.3	NM_000181.3:c.1065+1G>T, NM_000181.3:c.1084G>A, NM_000181.3:c.1144C>T, NM_000181.3:c.1337G>A, NM_000181.3:c.1222C>T, NM_000181.3:c.1730G>T, NM_000181.3:c.1831C>T, NM_000181.3:c.1856C>T, NM_000181.3:c.1881G>T, NM_000181.3:c.442C>T, NM_000181.3:c.499C>T, NM_000181.3:c.526C>T, NM_000181.3:c.646C>T, NM_000181.3:c.820_821delAC, NM_000181.3:c.1061C>T, NM_000181.3:c.1050G>C, NM_000181.3:c.1534G>A, NM_000181.3:c.1244C>T, NM_000181.3:c.1219_1220insC, NM_000181.3:c.866G>A, NM_000181.3:c.1244+1G>A, NM_000181.3:c.1521G>A, NM_000181.3:c.1429C>T, NM_000181.3:c.1618G>T, NM_000181.3:c.1338G>A	Mucopolysaccharidosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUSB gene located on chromosomal region 7q11.21. The age of onset is variable. There are prenatal forms with non-immune hydrops fetalis, and severe neonatal forms with dysmorphism, hernias, hepatosplenomegaly, club feet, dysostosis, severe hypotonia and neurological disorders that ultimately lead to profound intellectual deficit and small stature in patients that survive. Finally, there are also very mild cases that are discovered during adolescence or adulthood following presentation with thoracic kyphosis. The prevalence is 1:250,000 in newborn.	250,600
HADHA	Trifunctional protein deficiency	NM_000182.4	NM_000182.4:c.1918C>T, NM_000182.4:c.274_278delTCATC, NM_000182.4:c.2131C>A, NM_000182.4:c.1793_1794delAT, NM_000182.4:c.1620+2_1620+6delTAAGG, NM_000182.4:c.2027G>A, NM_000182.4:c.1678C>T, NM_000182.4:c.2132_2133insC, NM_000182.4:c.2146+1G>A, NM_000182.4:c.919-2A>G, NM_000182.4:c.1644delC, NM_000182.4:c.1132C>T, NM_000182.4:c.1528G>C, NM_000182.4:c.499delA, NM_000182.4:c.845T>A, NM_000182.4:c.1422dupT	Mitochondrial trifunctional protein deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA and HADHB genes located on chromosomal region 2p23.3. The age of onset is neonatal/infancy. It is characterized by a wide clinical spectrum ranging from severe neonatal manifestations including cardiomyopathy, hypoglycemia, metabolic acidosis, skeletal myopathy and neuropathy, liver disease and death to a mild phenotype with peripheral polyneuropathy, episodic rhabdomyolysis and pigmentary retinopathy. The prevalence is <1 / 1,000,000.	250,600
HADHB	Trifunctional protein deficiency	NM_000183.2	NM_000183.2:c.788A>G, NM_000183.2:c.1364T>G, NM_000183.2:c.1331G>A	Mitochondrial trifunctional protein deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA and HADHB genes located on chromosomal region 2p23.3. The age of onset is neonatal/infancy. It is characterized by a wide clinical spectrum ranging from severe neonatal manifestations including cardiomyopathy, hypoglycemia, metabolic acidosis, skeletal myopathy and neuropathy, liver disease and death to a mild phenotype with peripheral polyneuropathy, episodic rhabdomyolysis and pigmentary retinopathy. The prevalence is <1 / 1,000,000.	600
HAL	Histidinemia	NM_002108.3	NM_002108.3:c.890_891insT, NM_002108.3:c.146_152delATGACGC, NM_002108.3:c.1287+2T>C, NM_002108.3:c.102_103insGC, NM_002108.3:c.903+1G>A	Histidinemia follows a pattern of inheritance and is caused by pathogenic variants in the HAL gene located on chromosomal region 12q23.1. The age of onset is infantile ans is characterized by high concentration of Histidine in blood and urine. This disease seems to be benign in most of cases but 2/3 of the patients could show mild development delay.	600
HBA	Alpha-thalassemia	-	--MED, --SEA, --THAI, -α4.2, -α3.7, --FIL, -(α)20.5 (Detection by PCR)	Alpha-thalassemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBA gene located on chromosomal region 16p13.3. The age of onset is infantile. It is characterized by impaired synthesis of alpha-globin chains leading to a variable clinical picture depending on the number of affected alleles. The disease can be classified into clinical subtypes of increasing severity: silent alpha thalassemia, alpha thalassemia trait (or alpha thalassemia minor), hemoglobin H disease (HbH), and Hb Bart's hydrops fetalis (see these terms). A rare form called alpha-thalassemia-intellectual deficit syndrome has also been identified (see these terms). Alpha thalassemia trait causes microcytosis and hypochromia with absent or mild anemia (often detected on routine blood tests), generally with no other symptoms. HbH patients develop moderate hemolytic anemia with variable amounts of HbH along with occasionally severe splenomegaly, sometimes complicated by hypersplenism. Hb Bart's hydrops fetalis involves a severe deficiency in alpha-globin with serious developmental implications. Alpha-thalassemia-intellectual deficit syndrome is characterized by very mild to severe anemia associated with developmental abnormalities. The prevalence is 1:10,000-5:10,000.	600
HBB	Beta-thalassemia	NM_000518.4	NM_000518.4:c.135delC, NM_000518.4:c.118C>T, NM_000518.4:c.217dupA, NM_000518.4:c.92+5G>C, NM_000518.4:c.208G>A, NM_000518.4:c.85_86insC, NM_000518.4:c.92+5G>A, NM_000518.4:c.27dupG, NM_000518.4:c.126_129delCTTT, NM_000518.4:c.93-23T>C, NM_000518.4:c.92+1G>A, NM_000518.4:c.-50-u32C>T, NM_000518.4:c.82G>T, NM_000518.4:c.315+1G>A, NM_000518.4:c.52A>T, NM_000518.4:c.380T>A, NM_000518.4:c.93-21G>A, NM_000518.4:c.79G>A, NM_000518.4:c.112delT, NM_000518.4:c.92+6T>C, NM_000518.4:c.59A>G, NM_000518.4:c.364G>A	Beta-thalassemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBB gene located on chromosomal region 11p15.4. The age of onset is infantile. Three main types of BT have been described, thalassemia minor is usually asymptomatic, thalassemia major is associated with splenomegaly and microcytic and hypochromic anemia and thalassemia intermedia, in which the anemia is less severe. The incidence is 1/100,000.	250,600
HBB	Sickle cell anaemia	NM_000518.4	NM_000518.4:c.19G>A, NM_000518.4:c.20A>T	Sickle cell anemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBB gene located on chromosomal region 11p15.4. The age of onset is infantile. This disease is characterized by chronic severe anemia, bacterial infections, and ischemic vaso-occlusive accidents. This results in tissue ischemia leading to acute and chronic pain as well as organ damage that can affect any organ in the body, including the bones, lungs, liver, kidneys, brain, eyes, and joints. The highest frequency of sickle cell disease is found in tropical regions, particularly sub-Saharan Africa, India and the Middle-East.	250,600
HESX1	Combined pituitary hormone deficiencies, genetic forms	NM_003865.2	NM_003865.2:c.374A>G, NM_003865.2:c.77T>C, NM_003865.2:c.445G>A, NM_003865.2:c.450_451delCA, NM_003865.2:c.18G>C	Combined pituitary hormone deficiencies, genetic forms follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the HESX1 gene located on chromosomal region 3p14.3. The age of onset is infantile. These diseases are characterized by short stature, cognitive alterations or delayed puberty. The incidence is 1:3,000 and 1:4,000 births.	250,600
HEXA	Tay-Sachs disease	NM_000520.4	NM_000520.4:c.1176G>A, NM_000520.4:c.1495C>T, NM_000520.4:c.1177C>T, NM_000520.4:c.116T>G, NM_000520.4:c.1510delC, NM_000520.4:c.1496G>A, NM_000520.4:c.1260G>C, NM_000520.4:c.1351C>G, NM_000520.4:c.1511G>A, NM_000520.4:c.1499delT, NM_000520.4:c.1510C>T, NM_000520.4:c.380T>G, NM_000520.4:c.459+5G>A, NM_000520.4:c.508C>T, NM_000520.4:c.509G>A, NM_000520.4:c.532C>T, NM_000520.4:c.533G>A, NM_000520.4:c.533G>T, NM_000520.4:c.1528C>T, NM_000520.4:c.173G>A, NM_000520.4:c.1A>G, NM_000520.4:c.1A>T, NM_000520.4:c.1444G>A, NM_000520.4:c.1453T>C, NM_000520.4:c.739C>T, NM_000520.4:c.745C>T, NM_000520.4:c.749G>A, NM_000520.4:c.759_774dupGCTTGCAGAGTTTGAC, NM_000520.4:c.772G>C, NM_000520.4:c.1214_1215delinsG, NM_000520.4:c.78G>A, NM_000520.4:c.538T>C, NM_000520.4:c.540C>G, NM_000520.4:c.805G>A, NM_000520.4:c.915_917delCTT, NM_000520.4:c.254-1G>C, NM_000520.4:c.2T>C, NM_000520.4:c.1537C>T, NM_000520.4:c.1490A>G, NM_000520.4:c.77G>A, NM_000520.4:c.1422G>C, NM_000520.4:c.805+1G>A, NM_000520.4:c.805+1G>C, NM_000520.4:c.672+1G>A, NM_000520.4:c.629C>T, NM_000520.4:c.987G>A, NM_000520.4:c.632T>C, NM_000520.4:c.1278_1279insTATC, NM_000520.4:c.1274_1277dupTATC, NM_000520.4:c.986+3A>G, NM_000520.4:c.611A>G, NM_000520.4:c.1277_1278insTAT	Tay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births.	250,600
HEXB	Sandhoff disease	NM_000521.3	NM_000521.3:c.1310_1311delCA, NM_000521.3:c.1380G>A, NM_000521.3:c.1367A>C, NM_000521.3:c.1238_1242delCAAAG, NM_000521.3:c.298delC, NM_000521.3:c.1345delT, NM_000521.3:c.797A>G, NM_000521.3:c.1539_1540delCT, NM_000521.3:c.1375G>T, NM_000521.3:c.508C>T, NM_000521.3:c.1517_1529dupCAAGTGCTGTTGG, NM_000521.3:c.841C>T, NM_000521.3:c.202_203insGG, NM_000521.3:c.1250C>T, NM_000521.3:c.1619_1620insTTCATGTTATCTACAGACGTG, NM_000521.3:c.1537_1538delCT, NM_000521.3:c.170delG, NM_000521.3:c.115delG, NM_000521.3:c.171delG, NM_000521.3:c.850C>T	Sandhoff disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXB gene located on chromosomal region 5q13.3. The age of onset is adult or infantile. This disease is characterized by central nervous system degeneration, with startle reactions, early blindness, progressive motor and mental deterioration, macrocephaly and cherry-red spots on the macula. The prevalence is 1/130.000.	250,600
HFE	Haemochromatosis	NM_000410.3	NM_000410.3:c.18G>C, NM_000410.3:c.252G>A, NM_000410.3:c.989G>T, NM_000410.3:c.314T>C, NM_000410.3:c.193A>T, NM_000410.3:c.829G>A, NM_000410.3:c.277G>C	Hemochromatosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HFE gene located on chromosomal region 6p22.2. The age of onset is adult. This disease is characterized by chronic fatigue, bronzed skin pigmentation and tissue damage in the liver, pancreas, joints, bone, endocrine glands, heart. The prevalence is 1/200 - 1/1.000.	250,600
HGD	Alkaptonuria	NM_000187.3	NM_000187.3:c.140C>T, NM_000187.3:c.16-1G>A, NM_000187.3:c.342+1G>A, NM_000187.3:c.1111_1112insC, NM_000187.3:c.899T>G, NM_000187.3:c.1189-2A>G, NM_000187.3:c.674G>A, NM_000187.3:c.175delA, NM_000187.3:c.283-5delT, NM_000187.3:c.172A>T, NM_000187.3:c.873C>A, NM_000187.3:c.283-4C>T, NM_000187.3:c.808G>A, NM_000187.3:c.1102A>G, NM_000187.3:c.469+2T>C, NM_000187.3:c.688C>T, NM_000187.3:c.481G>A	Alkaptonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGD gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by darkening of the urine when it is left exposed to air, grey-blue colouration of the eye sclerae and the ear helix (ochronosis), and a disabling joint disease involving both the axial and peripheral joints (ochronotic arthropathy). The prevalence is 1:250,000-1:1.000.000 newborn.	250,600
HGF	Deafness type 39, autosomal recessive	NM_000601.4	NM_000601.4:c.2028delA, NM_000601.4:c.1597C>T	Autosomal recessive nonsyndromic sensorineural deafness type DFNB239 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGF gene located on chromosomal region 7q21.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600
HGSNAT	Mucopolysaccharidosis type 3C	NM_152419.2	NM_152419.2:c.1378-1G>A, NM_152419.2:c.1843G>A, NM_152419.2:c.607C>T, NM_152419.2:c.1250+1G>A, NM_152419.2:c.848C>T, NM_152419.2:c.1464+1G>A, NM_152419.2:c.1501delA, NM_152419.2:c.1030C>T, NM_152419.2:c.1503delA, NM_152419.2:c.1553C>T, NM_152419.2:c.1622C>T, NM_152419.2:c.493+1G>A	Mucopolysaccharidosis type 3C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGSNAT gene located on chromosomal region 8p11.21. The age of onset is infantile. This disease is characterized by defective or missing enzymes to break down mucopolysaccharides are missing or are defective. The prevalence is <1:70.000 newborn.	250,600
HIBCH	3-Hydroxyisobutryl-CoA hydrolase deficiency	NM_014362.3	NM_014362.3:c.1012A>T, NM_014362.3:c.79-3C>G, NM_014362.3:c.494_495delTT, NM_014362.3:c.365A>G, NM_014362.3:c.220-9T>G	3-Hydroxyisobutryl-CoA hydrolase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HIBCH gene located on chromosomal region 2q32.2. The age of onset is infantile. This disease is characterized by delayed motor development, hypotonia and progressive neurodegeneration. The prevalence is <1:1,000,000.	600
HMGCL	3-hydroxy-3-methylglutaric aciduria	NM_000191.2	NM_000191.2:c.835G>A, NM_000191.2:c.230delT, NM_000191.2:c.122G>A, NM_000191.2:c.698A>G, NM_000191.2:c.206_207delCT, NM_000191.2:c.505_506delTC	3-hydroxy-3-methylglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HMGCL gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is is an organic aciduria, due to deficiency of 3-hydroxy-3-methylglutaryl-CoA-lyase (a key enzyme in ketogenesis and leucine metabolism) usually presenting in infancy with episodes of metabolic decompensation triggered by periods of fasting or infections, which when left untreated are life-threatening and may lead to neurological sequelae.	600
HPD	Tyrosinemia type 3	NM_002150.2	NM_002150.2:c.600C>G, NM_002150.2:c.774T>G, NM_002150.2:c.1005C>G, NM_002150.2:c.987delA	Tyrosinemia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPD gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by intellectual deficit and ataxia. The prevalence is 1:100,000-1:120,000 newborn.	250,600
HPRT1	Lesch-Nyhan syndrome	NM_000194.2	NM_000194.2:c.486-1G>A, NM_000194.2:c.508C>T, NM_000194.2:c.610-2A>G, NM_000194.2:c.532+2T>G	Lesch-Nyhan syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the HPRT1 gene located on chromosomal region Xq26.2-q26.3. The age of onset is infantile. This disease is characterized by acid overproduction, neurological troubles, and behavioral problems. The prevalence is 1:380,000.	600
HPS1	Hermansky-Pudlak syndrome type 1	NM_000195.3	NM_000195.3:c.972_973insC, NM_000195.3:c.972delC, NM_000195.3:c.1996G>T, NM_000195.3:c.398+5G>A, NM_000195.3:c.1472_1487dupCCAGCAGGGGAGGCCC, NM_000195.3:c.397G>T	Hermansky-Pudlak syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPS1 gene located on chromosomal region 10q24.2. The age of onset is early childhood. This disease is characterized by oculocutaneous albinism, bleeding diathesis and, in some cases, neutropenia, pulmonary fibrosis, or granulomatous colitis. The prevalence is 1/500,000 - 1/1,000,000.	600
HSD17B4	D-bifunctional protein deficiency	NM_000414.3	NM_000414.3:c.1369A>T, NM_000414.3:c.46G>A, NM_000414.3:c.972+1G>T, NM_000414.3:c.317G>C	Bifunctional enzyme deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSD17B4 gene located on chromosomal region 5q23. The age of onset is juvenile. This disease is characterized by slowly progressive cerebellar atrophy and ataxia, intellectual decline, hearing loss, hypogonadism, hyperreflexia, a demyelinating sensorimotor neuropathy.	600
HSD17B4	Perrault syndrome	NM_000414.3	NM_000414.3:c.650A>G	Perrault syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSD17B4 gene located on chromosomal region 5q23.1. The age of onset is adult. This disease is characterized by ovarian dysgenesis in females with sensorineural hearing impairment and other neurological alterations. The prevalence is <1:1,000,000.	600
HSPD1	Leukodystrophy hypomyelinating type 4	NM_002156.4	NM_002156.4:c.1381C>G, NM_002156.4:c.292G>A	Leukodystrophy hypomyelinating type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSPD1 gene located on chromosomal region 2q33.1. The age of onset is infantile. A severe autosomal recessive hypomyelinating leukodystrophy. Clinically characterized by infantile-onset rotary nystagmus, progressive spastic paraplegia, neurologic regression, motor impairment, profound mental retardation. Death usually occurs within the first two decades of life.	600
HSPG2	Schwartz-Jampel syndrome type 1	NM_005529.6	NM_005529.6:c.13075delC, NM_005529.6:c.1653_1654insT, NM_005529.6:c.10355G>A, NM_005529.6:c.1125C>A, NM_005529.6:c.9326delA, NM_005529.6:c.8464+4A>G	Schwartz-Jampel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSPG2 gene located on chromosomal region 1p36.12. The age of onset is infantile. This disease is characterized by myotonia and osteoarticular abnormalities. The prevalence is <1:1,000,000.	600
HTRA1	CARASIL syndrome	NM_002775.4	NM_002775.4:c.1108C>T, NM_002775.4:c.883G>A, NM_002775.4:c.904C>T, NM_002775.4:c.754G>A, NM_002775.4:c.889G>A	Cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy (CARASIL syndrome) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HTRA1 gene located on chromosomal region 10q26.13. The age of onset is adult. This disease is characterized by early-onset gait disturbances, premature scalp alopecia, ischemic stroke, acute mid to lower back pain and progressive cognitive disturbances leading to severe dementia. About 50 people diagnosed, mainly in Japan and China.	600
HYLS1	Hydrolethalus syndrome type 1	NM_145014.2	NM_145014.2:c.632A>G, NM_145014.2:c.724C>T, NM_145014.2:c.669G>A	Hydrolethalus syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HYLS1 gene located on chromosomal region 11q24.2. The age of onset is fetal. This disease is characterized by craniofacial dysmorphic features, central nervous system, cardiac, respiratory tract and limb abnormalities. The incidence is 1/20,000 in Finland and the prevalence is <1:1,000,000.	600
IDH3B	Retinitis pigmentosa type 46	NM_006899.3	NM_006899.3:c.395T>C, NM_006899.3:c.490C>T, NM_006899.3:c.589delA	Retinitis pigmentosa 46 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IDH3B gene located on chromosomal region 20p13. The age of onset is variable. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness. The prevalence is 1/3,000 to 1/5,000.	600
IDS	Mucopolysaccharidosis type 2	NM_000202.6	NM_000202.6:c.1464G>T, NM_000202.6:c.1466G>C, NM_000202.6:c.1505G>C, NM_000202.6:c.283A>G, NM_000202.6:c.208dupC, NM_000202.6:c.596_599delAACA, NM_000202.6:c.597delA, NM_000202.6:c.683C>T, NM_000202.6:c.1148delC, NM_000202.6:c.880-8A>G, NM_000202.6:c.937C>T, NM_000202.6:c.998C>T, NM_000202.6:c.690_691insT, NM_000202.6:c.1122C>T, NM_000202.6:c.587T>C, NM_000202.6:c.314_317dupTCAA, NM_000202.6:c.278delC, NM_000202.6:c.514C>T, NM_000202.6:c.1508T>A, NM_000202.6:c.388_389insG, NM_000202.6:c.240+1G>A, NM_000202.6:c.404A>G	Mucopolysaccharidosis type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IDS gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by distinctive coarse facial features, short stature, cardio-respiratory involvement and skeletal abnormalities. The prevalence is 1:100,000-1:170,000 mannewborn.	600
IFT80	Short-rib thoracic dysplasia type 2 with or without polydactyly	NM_020800.2	NM_020800.2:c.701C>G, NM_020800.2:c.721G>C, NM_020800.2:c.315C>G	Short-rib thoracic dysplasia type 2 with or without polydactyly an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IFT80 gene located on chromosomal region 3q25.33. The age of onset is antenatal/neonatal. This is, a group of autosomal recessive ciliopathies that are characterized by a constricted thoracic cage, short ribs, shortened tubular bones, and a trident appearance of the acetabular roof. Polydactyly is variably present. Non-skeletal involvement can include cleft lip/palate as well as anomalies of major organs such as the brain, eye, heart, kidneys, liver, pancreas, intestines, and genitalia. Some forms of the disease are lethal in the neonatal period due to respiratory insufficiency secondary to a severely restricted thoracic cage, whereas others are compatible with life. Disease spectrum encompasses Ellis-van Creveld syndrome, asphyxiating thoracic dystrophy (Jeune syndrome), Mainzer-Saldino syndrome, and short rib-polydactyly syndrome. The incidence is 1-5/500,000.	600
IGF1	Growth delay due to insulin-like growth factor type 1 deficiency	NM_000618.3	NM_000618.3:c.274G>A	Growth delay due to insulin-like growth factor type 1 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGF1 gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by the association of intrauterine and postnatal growth retardation with sensorineural deafness and intellectual deficit, addition clinical features include microcephaly, adiposity, and insulin resistance. The prevalence is <1:1,000,000.	600
IGHMBP2	Spinal muscular atrophy, distal, type 1, autosomal recessive	NM_002180.2	NM_002180.2:c.1488C>A, NM_002180.2:c.2611+1G>T, NM_002180.2:c.1540G>A, NM_002180.2:c.1738G>A, NM_002180.2:c.661delA, NM_002180.2:c.121C>T, NM_002180.2:c.1101_1116delCTACTTCGACGTGGTG, NM_002180.2:c.2922T>G, NM_002180.2:c.1107C>G, NM_002180.2:c.2362C>T, NM_002180.2:c.638A>G	Autosomal recessive distal spinal muscular atrophy type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGHMBP2 gene located on chromosomal region 11q13.3. The age of onset is infantile. This disease is characterized by neuromuscular disorder characterized by progressive weakness and atrophy of the diaphragm and skeletal muscles, leading to death in childhood. The prevalence is 4:100,000-10:100,000.	250,600
IKBKAP	Familial dysautonomia	NM_003640.3	NM_003640.3:c.3332delC, NM_003640.3:c.1460+2T>C, NM_003640.3:c.2204+6T>C, NM_003640.3:c.2328delT, NM_003640.3:c.2741C>T, NM_003640.3:c.2087G>C, NM_003640.3:c.2087G>A	Familial dysautonomia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IKBKAP gene located on chromosomal region 9q31.3. The age of onset is infantile. This disease is characterized by sensory dysfunction and severe impairment of the autonomic nervous system activity, resulting in multisystem dysfunction. The prevalence is <1:1,000,000	600
IL2RG	Severe combined immunodeficiency T-B+; X-linked	NM_000206.2	NM_000206.2:c.454+1G>A, NM_000206.2:c.452T>C, NM_000206.2:c.186T>A, NM_000206.2:c.664C>T, NM_000206.2:c.343T>C, NM_000206.2:c.854G>A, NM_000206.2:c.341G>A, NM_000206.2:c.355A>T	T-B+ severe combined immunodeficiency, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IL2RG gene located on chromosomal region Xq13.1. The age of onset is infantile. This disease is characterized by absent or markedly reduced numbers of T cells, leading to recurrent infections. The prevalence is 1:50,000-1:100,000.	600
IMPDH1	Retinitis pigmentosa type 10	NM_000883.3	NM_000883.3:c.1057G>A, NM_000883.3:c.1390delC, NM_000883.3:c.931G>A	Retinitis pigmentosa type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IMPDH1 gene located on chromosomal region 7q32.1. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades. The prevalence is 1/4,000.	250,600
IMPG2	Retinitis pigmentosa type 56	NM_016247.3	NM_016247.3:c.635C>G, NM_016247.3:c.3262C>T, NM_016247.3:c.502-1G>C, NM_016247.3:c.2890C>T	Retinitis pigmentosa type 56 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IMPG2 gene located on chromosomal region 3q12.3. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades. The prevalence is 1/4.000.	600
INPP5E	Joubert syndrome type 1	NM_019892.4	NM_019892.4:c.1132C>T, NM_019892.4:c.855_856insCG, NM_019892.4:c.1688G>A, NM_019892.4:c.1543C>T, NM_019892.4:c.1304G>A	Joubert syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized by congenital malformation of the brainstem and agenesis or hypoplasia of the cerebellar vermis leading to an abnormal respiratory pattern, nystagmus, hypotonia, ataxia, and delay in achieving motor milestones.. The prevalence is 1/100.000.	250,600
INPP5E	MORM syndrome	NM_019892.4	NM_019892.4:c.1879C>T	MORM syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized by the association of intellectual deficit, truncal obesity, retinal dystrophy and micropenis. The prevalence is 1/100.000.	250,600
INSR	Diabetes mellitus, insulin-resistant	NM_000208.2	NM_000208.2:c.3079C>T, NM_000208.2:c.3680G>C, NM_000208.2:c.3034G>A, NM_000208.2:c.1114C>T, NM_000208.2:c.1378A>G	Diabetes mellitus, insulin-resistant follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by the triad of hyperinsulinemia, acanthosis nigricans (skin lesions associated with insulin resistance), and signs of hyperandrogenism in females without lipodystrophy and who are not overweight. It is generally diagnosed in young women with marked signs of hyperandrogenism, but insulin resistance and acanthosis nigricans may be observed in men and in childhood. Acromegaloid facies or muscular cramps are sometimes associated. Hyperinsulinemia, a biological marker for insulin resistance, is often associated with glucose tolerance defects over the course of the disease, and diabetes progressively sets in. Hyperandrogenism (associated with polycystic ovarian syndrome (see this term) or ovarian hyperthecoses) leads to fertility problems. The prevalence is <1:1,000,000.	250,600
INSR	Leprechaunism	NM_000208.2	NM_000208.2:c.2668C>T, NM_000208.2:c.172G>A	Leprechaunism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by intrauterine and mainly postnatal severe growth retardation, extreme insulin resistance. The prevalence is <1:1,000,000.	250,600
IQCB1	Senior-Loken syndrome type 5	NM_001023570.2	NM_001023570.2:c.1036G>T, NM_001023570.2:c.817G>T, NM_001023570.2:c.1381C>T, NM_001023570.2:c.1465C>T, NM_001023570.2:c.1090C>T, NM_001023570.2:c.1518_1519delCA, NM_001023570.2:c.1069C>T	Senior-Loken syndrome type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IQCB1 gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by the association of nephronophthisis (NPHP), a chronic kidney disease, with retinal dystrophy. The prevalence is 1/1.000.000.	600
ISCU	Myopathy with deficiency of ISCU	NM_213595.3	NM_213595.3:c.338_339+2delCGGT, NM_213595.3:c.149G>A	Hereditary myopathy with lactic acidosis due to ISCU deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ISCU gene located on chromosomal region 12q23.3. The age of onset is infantile. This disease is characterized by myopathy with severe exercise intolerance.	600
ITGA6	Epidermolysis bullosa, junctional with pyloric atresia	NM_000210.2	NM_000210.2:c.791delC, NM_000210.2:c.1255dupA	Junctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGA6 and ITGB4 genes located on chromosomal regions 2q31.1 and 17q25.1 respectively. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract.	600
ITGB4	Epidermolysis bullosa, junctional with pyloric atresia	NM_001005731.1	NM_001005731.1:c.112T>C, NM_001005731.1:c.1684T>C, NM_001005731.1:c.1150delG, NM_001005731.1:c.1544G>A, NM_001005731.1:c.3977-19T>A, NM_001005731.1:c.4410delG, NM_001005731.1:c.4433G>A, NM_001005731.1:c.5119+2T>C, NM_001005731.1:c.3321_3331delACTGGACCGGA, NM_001005731.1:c.4618C>T, NM_001005731.1:c.182G>A, NM_001005731.1:c.2607delC, NM_001005731.1:c.3801_3802insT, NM_001005731.1:c.3841C>T, NM_001005731.1:c.2608delC, NM_001005731.1:c.3793+1G>A, NM_001005731.1:c.1660C>T, NM_001005731.1:c.3674G>A	Junctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGA6 and ITGB4 genes located on chromosomal regions 2q31.1 and 17q25.1 respectively. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract.	250,600
ITGB4	Epidermolysis bullosa, without pyloric atresia	NM_001005731.1	NM_001005731.1:c.2792G>A	Junctional epidermolysis bullosa with piloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGB4 gene located on chromosomal region 17q25.1. The age of onset is neonatal. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. More than 100 cases have been reported around the world.	250,600
IVD	Isovaleric acidemia	NM_002225.3	NM_002225.3:c.158G>C, NM_002225.3:c.1208A>G, NM_002225.3:c.157C>T, NM_002225.3:c.1141T>C, NM_002225.3:c.243+1G>A, NM_002225.3:c.1147+1_1147+4delGTGA, NM_002225.3:c.367G>A, NM_002225.3:c.605G>T, NM_002225.3:c.1145_1147+4delTTGGTGA, NM_002225.3:c.559+1G>A, NM_002225.3:c.134T>C, NM_002225.3:c.941C>T, NM_002225.3:c.627delT, NM_002225.3:c.793+1G>A, NM_002225.3:c.2T>G, NM_002225.3:c.1183C>T, NM_002225.3:c.390delT, NM_002225.3:c.406_407delTG, NM_002225.3:c.158G>A, NM_002225.3:c.593G>A, NM_002225.3:c.507delG, NM_002225.3:c.1188delT, NM_002225.3:c.465+2T>C, NM_002225.3:c.434_437dupATGA, NM_002225.3:c.860G>A, NM_002225.3:c.994_995delAT, NM_002225.3:c.1192C>T, NM_002225.3:c.478_479insGT	Isovaleric academia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IVD gene located on chromosomal region 15q15.1. The age of onset is neonatal. This disease is characterized by vomiting, dehydration, coma and abnormal movements. The prevalence is 1/100,000.	250,600
JAK3	Severe combined immunodeficiency T-B+NK-	NM_000215.3	NM_000215.3:c.452C>G, NM_000215.3:c.1765G>A, NM_000215.3:c.1333C>T, NM_000215.3:c.1172_1173insG, NM_000215.3:c.1837C>T, NM_000215.3:c.299A>G, NM_000215.3:c.1695C>A	Severe combined immunodeficiency T-B+NK- follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the JAK3 gene located on chromosomal region 19p13.11. The age of onset is infantile. This disease is characterized by chronic diarrhea, failure to thrive, recurrent respiratory infections and/or generalized infections due to opportunistic pathogens. The incidence is 1/100,000 and 1/1,000,000.	250,600
KCNJ1	Bartter syndrome type 2	NM_000220.4	NM_000220.4:c.1012C>T, NM_000220.4:c.1070T>C, NM_000220.4:c.592G>A, NM_000220.4:c.322G>C, NM_000220.4:c.372T>A, NM_000220.4:c.500G>A, NM_000220.4:c.237C>G, NM_000220.4:c.1014delA, NM_000220.4:c.641C>T, NM_000220.4:c.657C>G, NM_000220.4:c.996_999delAAAG, NM_000220.4:c.942T>G	Bartter syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ1 gene located on chromosomal region 11q24.3. The age of onset is antenatal. This disease is characterized by severe polyhydramnios in mother leading to premature delivery, postnatally newborns suffer from recurrent episodes of severe dehydration and electrolyte imbalance which can lead to fatal outcome.	250,600
KCNJ13	Leber congenital amaurosis type 16	NM_002242.4	NM_002242.4:c.722T>C	Leber congenital amaurosis type 16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ13 gene located on chromosomal region 2q37.1. The age of onset is early infantile. This disease is characterized by retinal dystrophy defined by blindness, nystagmus, roving eye movement, leading to severe visual impairment within the first year of life.	600
KCNV2	Retinal cone dystrophy type 3B	NM_133497.3	NM_133497.3:c.1016_1024delACCTGGTGG, NM_133497.3:c.1376G>A, NM_133497.3:c.427G>T, NM_133497.3:c.226C>T, NM_133497.3:c.325C>T, NM_133497.3:c.357_358insC, NM_133497.3:c.1480A>C, NM_133497.3:c.1132_1133insT, NM_133497.3:c.854T>G, NM_133497.3:c.491T>C, NM_133497.3:c.767C>G, NM_133497.3:c.916G>T, NM_133497.3:c.778A>T, NM_133497.3:c.442G>T	Retinal cone dystrophy type 3B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNV2 gene located on 9p24.2. The age of onset is in the first or second decade of life. This disease is characterized by is characterized by onset in the first or second decade of life of very marked photophobia, myopia, reduced color vision along the red-green axis with relatively preserved tritan discrimination, and central scotomata with peripheral widespread sensitivity loss predominating in the superior visual field. Nyctalopia is a later feature of the disorder. There is often retinal pigment epithelium disturbance at the macula with a normal retinal periphery.	250,600
KIF7	Acrocallosal syndrome	NM_198525.2	NM_198525.2:c.2473G>T, NM_198525.2:c.687delG, NM_198525.2:c.3001C>T, NM_198525.2:c.460C>T, NM_198525.2:c.61C>T, NM_198525.2:c.2896_2897delGC, NM_198525.2:c.3778_3779insC	Acrocallosal syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KIF7 gene located on chromosomal region 15q26.1. The age of onset is infantile. This disease is characterized by y agenesis of corpus callosum (CC), distal anomalies of limbs, minor craniofacial anomalies and intellectual deficit. The prevalence is <1:1,000,000.	600
L1CAM	MASA sindrome/hydrocephalus	NM_000425.4	NM_000425.4:c.3489_3490delTG, NM_000425.4:c.3201T>G, NM_000425.4:c.719C>T, NM_000425.4:c.3581C>T, NM_000425.4:c.2879delA, NM_000425.4:c.791G>A, NM_000425.4:c.2092G>A, NM_000425.4:c.924C>T, NM_000425.4:c.536T>G, NM_000425.4:c.23delT, NM_000425.4:c.2254G>A, NM_000425.4:c.800dupA, NM_000425.4:c.772C>T, NM_000425.4:c.1354G>A, NM_000425.4:c.551G>A, NM_000425.4:c.1792G>A, NM_000425.4:c.1108G>A	MASA sindrome/hydrocephalus follows an X-linked pattern of inheritance and is caused by pathogenic variants in the L1CAM gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by adducted thumbs, hypotonia progressing to spasticity or spastic paraplegia, delayed development of speech, mild to moderate intellectual deficit, and mild to moderate distension of the cerebral ventricles. Hydrocephalus appears frequently. The prevalence is 1:25,000-1:60,000 male.	600
LAMA2	Congenital muscular dystrophy type 1A	NM_000426.3	NM_000426.3:c.184G>T, NM_000426.3:c.1612C>T, NM_000426.3:c.3718C>T, NM_000426.3:c.2750-1G>C, NM_000426.3:c.2049_2050delAG, NM_000426.3:c.5050G>T, NM_000426.3:c.1634T>A, NM_000426.3:c.2045_2046delAG, NM_000426.3:c.4645C>T, NM_000426.3:c.2962C>T, NM_000426.3:c.2098_2099delTT, NM_000426.3:c.4437-5T>A, NM_000426.3:c.2901C>A, NM_000426.3:c.112+1G>A, NM_000426.3:c.7732C>T, NM_000426.3:c.6038delT, NM_000426.3:c.7888C>T, NM_000426.3:c.825delC, NM_000426.3:c.8314delA, NM_000426.3:c.3976C>T, NM_000426.3:c.9101_9104dupAACA, NM_000426.3:c.9253C>T, NM_000426.3:c.2323-2A>T, NM_000426.3:c.8748delA, NM_000426.3:c.6334A>T, NM_000426.3:c.1050delT, NM_000426.3:c.7536delC, NM_000426.3:c.8705delT, NM_000426.3:c.9221delA, NM_000426.3:c.5227G>T, NM_000426.3:c.6429+1G>A, NM_000426.3:c.6617delT, NM_000426.3:c.2451-2A>G, NM_000426.3:c.6011delA, NM_000426.3:c.7810C>T, NM_000426.3:c.8684C>G, NM_000426.3:c.3630delT, NM_000426.3:c.3215delG, NM_000426.3:c.3623_3645delAGGGCATTGTTTTTCAACATCCA, NM_000426.3:c.6955C>T, NM_000426.3:c.7279_7280delCT, NM_000426.3:c.725G>A, NM_000426.3:c.7147C>T, NM_000426.3:c.3237C>A	Congenital muscular dystrophy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMA2 gene located on chromosomal region 6q22.33. The age of onset is early infancy. This disease is characterized by hypotonia, muscle weakness and muscle wasting and motor development delayed. The prevalence is 1/30,000.	250,600
LAMA3	Epidermolysis bullosa, junctional	NM_000227.3	NM_000227.3:c.-122061G>T, NM_000227.3:c.335delG, NM_000227.3:c.4878dupT, NM_000227.3:c.2116A>T, NM_000227.3:c.4135C>T, NM_000227.3:c.751G>T, NM_000227.3:c.1981C>T, NM_000227.3:c.3350+2T>G, NM_000227.3:c.1182delG, NM_000227.3:c.4335_4336insA, NM_000227.3:c.2662C>T	Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 and LAMC2 genes located on chromosomal regions 1q32.2 and 1q25.3 respectively. The age of onset is infantile. It is a lethal form of junctional epidermolysis bullosa, a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement. In the Herlitz type, death occurs usually within the first six months of life. Occasionally, children survive to teens. It is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic.	600
LAMB3	Epidermolysis bullosa, junctional	NM_000228.2	NM_000228.2:c.1587_1588delAG, NM_000228.2:c.124C>T, NM_000228.2:c.1438_1442delCCGTG, NM_000228.2:c.1830G>A, NM_000228.2:c.565-2A>G, NM_000228.2:c.2806C>T, NM_000228.2:c.904delT, NM_000228.2:c.1357delT, NM_000228.2:c.3228+1G>T, NM_000228.2:c.628+1delG, NM_000228.2:c.496C>T, NM_000228.2:c.1903C>T, NM_000228.2:c.628G>A, NM_000228.2:c.3228+1G>A, NM_000228.2:c.727C>T	Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 and LAMC2 genes located on chromosomal regions 1q32.2 and 1q25.3 respectively. The age of onset is infantile. It is a lethal form of junctional epidermolysis bullosa, a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement. In the Herlitz type, death occurs usually within the first six months of life. Occasionally, children survive to teens. It is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic.	250,600
LAMC2	Epidermolysis bullosa, junctional	NM_005562.2	NM_005562.2:c.1659C>A, NM_005562.2:c.3069+1G>A, NM_005562.2:c.1782_1783delGC, NM_005562.2:c.2137_2143delCAGAACC, NM_005562.2:c.283C>T, NM_005562.2:c.343C>T, NM_005562.2:c.3512_3513insA, NM_005562.2:c.405-1G>A, NM_005562.2:c.3120_3121insA	Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 and LAMC2 genes located on chromosomal regions 1q32.2 and 1q25.3 respectively. The age of onset is infantile. It is a lethal form of junctional epidermolysis bullosa, a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement. In the Herlitz type, death occurs usually within the first six months of life. Occasionally, children survive to teens. It is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic.	600
LARGE	Muscular dystrophy-dystroglycanopathy type 6	NM_004737.4	NM_004737.4:c.1102C>T, NM_004737.4:c.992C>T, NM_004737.4:c.1525G>A, NM_004737.4:c.1483T>C	Muscular dystrophy-dystroglycanopathy type 6follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LARGE gene located on chromosomal region 22q12.3. The age of onset is infantile. There are two subtypes. Subtype 6A is associated with cobblestone lissencephaly and other brain anomalies, eye malformations, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Subtype 6B is associated with profound mental retardation, white matter changes and structural brain abnormalities. Skeletal muscle biopsies show reduced immunolabeling of alpha-dystroglycan. The prevalence is 1:100,000-9:100,000.	600
LBR	Greenberg skeletal dysplasia	NM_002296.3	NM_002296.3:c.1748G>A, NM_002296.3:c.1402delT, NM_002296.3:c.1114C>T, NM_002296.3:c.32_35delTGGT	Greenberg dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LBR gene located on chromosomal region 1q42.12. The age of onset is fetal. This disease is characterized by fetal hydrops, short limbs and abnormal chondro-osseous calcification. The prevalence is <1:1,000,000.	600
LDHA	Glycogen storage disease type 11	NM_005566.3	NM_005566.3:c.126+1_126+4delGTAA, NM_005566.3:c.126+1G>A, NM_005566.3:c.310G>T, NM_005566.3:c.126+1_126+4del, NM_005566.3:c.397G>T, NM_005566.3:c.213+1_213+4delGTAA, NM_005566.3:c.640_641delCT	Glycogen storage disease type 11 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LDHA gene located on chromosomal region 11p15.1. The age of onset is infantile. This disease is characterized by hepatic glycogenosis and renal Fanconi syndrome.	600
LEPRE1	Osteogenesis imperfecta type 8	NM_022356.3	NM_022356.3:c.2055+13_2055+31del19, NM_022356.3:c.1656C>A, NM_022356.3:c.1365_1366delAGinsC, NM_022356.3:c.2068_2086delCGAGCGGGTGAGAGCAGCT, NM_022356.3:c.747delC, NM_022356.3:c.1102C>T, NM_022356.3:c.1473+1G>T	Osteogenesis imperfecta type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LEPRE1 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by bone fragility, low bone mass and susceptibility to bone fractures. The prevalence is 6:100,000-7:100,000.	600
LHFPL5	Deafness type 67, autosomal recessive	NM_182548.3	NM_182548.3:c.494C>T, NM_182548.3:c.476G>A, NM_182548.3:c.649delG, NM_182548.3:c.250delC, NM_182548.3:c.380A>G	Autosomal recessive nonsyndromic sensorineural deafness type DFNB67 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LHFPL5 gene located on chromosomal region 6p21.31. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600
LHX3	Combined pituitary hormone deficiency type 3	NM_014564.3	NM_014564.3:c.687G>A, NM_014564.3:c.347A>G	Combined pituitary hormone deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LHX3 gene located on chromosomal region 9q34.3. The age of onset is infantile, etc/. This disease is characterized by somatolactotroph, thyrotroph and gonadotroph deficiencies, limited head and neck rotation associated with spinal abnormalities. The prevalence is <1 /1,000,000.	600
LIFR	Stuve-Wiedemann syndrome	NM_002310.5	NM_002310.5:c.2013_2014insT, NM_002310.5:c.653dupT, NM_002310.5:c.1018_1022delAATTG, NM_002310.5:c.2503G>T, NM_002310.5:c.171_174delTAAC, NM_002310.5:c.1789C>T	Stüve-Wiedemann syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LIFR gene located on chromosomal region 5p13.1. The age of onset is neonatal. This disease is characterized by small stature, congenital bowing of the long bones and campodactyly.	600
LIG4	LIG4 syndrome	NM_002312.3	NM_002312.3:c.1271_1275delAAAGA, NM_002312.3:c.833G>A, NM_002312.3:c.1738C>T, NM_002312.3:c.2440C>T, NM_002312.3:c.1406G>A, NM_002312.3:c.1455_1456delTG, NM_002312.3:c.1369_1372delGGAC, NM_002312.3:c.1512_1513delTC	LIG4 syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LIG4 gene located on chromosomal region 10p13. The age of onset is infantile. It is associated with impaired DNA double-strand break repair mechanisms and characterized by microcephaly, unusual facial features (''bird-like''), growth and developmental delay, skin anomalies including photosensitivity and psoriatic-like lesions, and pancytopenia. The disease is associated with immunodeficiency. Some patients have been reported as having telangiectasias, leukemia, lymphoma, bone marrow abnormalities, and type 2 diabetes. The prevalence 1-9/1.000.000.	600
LMNA	Cardiomyopathy, dilated type 1A	NM_170707.3	NM_170707.3:c.1366A>C, NM_170707.3:c.1930C>T, NM_170707.3:c.1567G>A, NM_170707.3:c.1786G>A	Dilated cardiomyopathy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death.	250,600
LMNA	Hutchinson-Gilford progeria syndrome	NM_170707.3	NM_170707.3:c.1579C>T, NM_170707.3:c.1411C>T, NM_170707.3:c.1824C>T, NM_170707.3:c.1626G>C	Hutchinson-Gilford progeria syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/infancy. It is characterized by growth reduction, failure to thrive, a typical facial appearance (prominent forehead, protuberant eyes, thin nose with a beaked tip, thin lips, micrognathia and protruding ears) and distinct dermatologic features (generalized alopecia, aged-looking skin, sclerotic and dimpled skin over the abdomen and extremities, prominent cutaneous vasculature, dyspigmentation, nail hypoplasia and loss of subcutaneous fat).	250,600
LMNA	Lipodystrophy, familial partial, type 2	NM_170707.3	NM_170707.3:c.1318G>A	Lipodystrophy, familial partial, type2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by the loss of subcutaneous adipose tissue in the lower parts of the body (limbs, buttocks, trunk). It is accompanied by an accumulation of adipose tissue in the face and neck causing a double chin, fat neck, or cushingoid appearance. Adipose tissue may also accumulate in the axillae, back, labia majora, and intraabdominal region. Affected patients are insulin-resistant and may develop glucose intolerance and diabetes mellitus after age 20 years,hypertriglyceridemia, and low levels of high density lipoprotein cholesterol.	250,600
LMNA	Mandibuloacral dysplasia	NM_170707.3	NM_170707.3:c.1586C>T, NM_170707.3:c.1580G>A, NM_170707.3:c.1585G>A, NM_170707.3:c.1228C>T	Mandibuloacral dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/. This disease is characterized by postnatal growth retardation, craniofacial anomalies, skeletal malformations, and mottled cutaneous pigmentation. The prevalence is 1:2,700-1:5,000.	250,600
LMNA	Muscular dystrophy, Emery-Dreifuss type 3	NM_170707.3	NM_170707.3:c.1072G>A, NM_170707.3:c.419T>C, NM_170707.3:c.1488+1G>A, NM_170707.3:c.1583C>A	Emery-Dreifuss muscular dystrophy type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by weakness and atrophy of muscle without involvement of the nervous system, early contractures of the elbows, Achilles tendons and spine, and cardiomyopathy associated with cardiac conduction defects.	250,600
LOXHD1	Deafness type 77, autosomal recessive	NM_144612.6	NM_144612.6:c.2008C>T, NM_144612.6:c.2T>A, NM_144612.6:c.3874C>T, NM_144612.6:c.4526G>A, NM_144612.6:c.3924C>A, NM_144612.6:c.512-1G>A, NM_144612.6:c.4524_4525delAG, NM_144612.6:c.4714C>T, NM_144612.6:c.457_461dupCGCCA	Autosomal recessive nonsyndromic sensorineural deafness type DFNB77 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LOXHD1 gene located on chromosomal region 18q21.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600
LRAT	Leber congenital amaurosis type 14	NM_004744.3	NM_004744.3:c.217_218delAT, NM_004744.3:c.588dupT	Leber congenital amaurosis 14 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRAT gene located on chromosomal region 4q32.1. The age of onset is infantile. This disease is characterized by blindness, nystagmus, roving eye movement. The prevalence is 2:100,000-3:100,000 newborn.	600
LRAT	Retinal dystrophy, early-onset severe	NM_004744.3	NM_004744.3:c.525T>A	Retinal dystrophy, early-onset severe follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRAT gene located on chromosomal region 4q32.1. The age of onset is infantile. It is a mild form of Leber congenital amaurosis that is characterized by a severe night blindness, nystagmus, and sluggish pupil responses. A relatively good central vision well into the second decade of life and blindness by the age of 30 years is generally observed. The prevalence is 2:100,000-3:100,000 newborn.	600
LRP2	Donnai-Barrow syndrome	NM_004525.2	NM_004525.2:c.11469_11472delTTTG, NM_004525.2:c.2640-1G>A, NM_004525.2:c.13139_13140insC, NM_004525.2:c.1093C>T, NM_004525.2:c.11663G>A, NM_004525.2:c.7564T>C, NM_004525.2:c.8519_8522delATTT, NM_004525.2:c.1341+2T>G, NM_004525.2:c.10769-2A>G, NM_004525.2:c.9484_9485delGT, NM_004525.2:c.13388+2T>C, NM_004525.2:c.11636-1G>T	Donnai-Barrow syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP2 gene located on chromosomal region 2q31.1. The age of onset is infantile. This disease is characterized by diaphragmatic hernia, ocular findings, hipertelorism, agenesis of the corpus callosum, hearing loss and facial dimorphism. The prevalence is <1:1,000,000.	600
LRP5	Exudative vitreoretinopathy type 4	NM_002335.3	NM_002335.3:c.2254C>G, NM_002335.3:c.518C>T, NM_002335.3:c.1709G>A, NM_002335.3:c.804_813delGGGGAAGAGG, NM_002335.3:c.4099G>A	Exudative vitreoretinopathy type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile or juvenile. This disease is characterized by abnormal or incomplete vascularization of the peripheral retina leading to variable clinical manifestations ranging from no effects to minor anomalies, or even retinal detachment with blindness.	250,600
LRP5	Isolated polycystic liver disease	NM_002335.3	NM_002335.3:c.4651G>A	Isolated polycystic liver disease due to LRP5 gene located on chromosomal region 11q13.2 follows an autosomal recessive pattern of inheritance. The age of onset is variable. This disease is characterized by the appearance of numerous cysts spread throughout the liver.	250,600
LRP5	Osteoporosis-pseudoglioma syndrome	NM_002335.3	NM_002335.3:c.1481G>A, NM_002335.3:c.1453G>T, NM_002335.3:c.1468delG, NM_002335.3:c.2305delG, NM_002335.3:c.2202G>A, NM_002335.3:c.1708C>T, NM_002335.3:c.3107G>A, NM_002335.3:c.2557C>T	Osteoporosis-pseudoglioma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by congenital or infancy-onset blindness and severe juvenile-onset osteoporosis and spontaneous fractures. The prevalence is 1:2,000,000.	250,600
LRPPRC	Leigh syndrome, French-Canadian type	NM_133259.3	NM_133259.3:c.1061C>T, NM_133259.3:c.3830_3839delGTGGTGCAATinsAG	French-Canadian type Leigh syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRPPRC gene located on chromosomal region 2p21. The age of onset is infantile. This disease is characterized by chronic metabolic acidosis, hypotonia, facial dysmorphism and delayed development. The prevalence is 1:2,000 newborn.	600
LRTOMT	Deafness type 63, utosomal recessive	NM_001145308.4	NM_001145308.4:c.242G>A	Autosomal recessive nonsyndromic sensorineural deafness type DFNB63 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRTOMT gene located on chromosomal region 11q13.4. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600
MAK	Retinitis pigmentosa type 62	NM_001242957.1	NM_001242957.1:c.37G>A, NM_001242957.1:c.719_720dupAG, NM_001242957.1:c.1087_1088delAG, NM_001242957.1:c.718C>T, NM_001242957.1:c.388A>C	Retinitis pigmentosa type 62 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAK gene located on chromosomal region 6p24.2. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades.	600
MAN2B1	Alpha-mannosidosis	NM_000528.3	NM_000528.3:c.215A>T, NM_000528.3:c.2401G>T, NM_000528.3:c.2278C>T, NM_000528.3:c.2368C>T, NM_000528.3:c.2119C>T, NM_000528.3:c.2013delT, NM_000528.3:c.1A>G, NM_000528.3:c.1067C>G, NM_000528.3:c.384G>A, NM_000528.3:c.2398G>A, NM_000528.3:c.1915C>T, NM_000528.3:c.2426T>C, NM_000528.3:c.2436+2T>C, NM_000528.3:c.1259G>T, NM_000528.3:c.1780C>T, NM_000528.3:c.1929G>A, NM_000528.3:c.2686_2687delCTinsG, NM_000528.3:c.1830+1G>C	Alpha-mannosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAN2B1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by immunodeficiency, facial and skeletal abnormalities, hearing impairment and intellectual disability. The prevalence is 1:1,000,000-9:1,000,000.	250,600
MARVELD2	Deafness type 49, autosomal recessive	NM_001038603.2	NM_001038603.2:c.1363C>T, NM_001038603.2:c.1183-1G>A	Autosomal recessive nonsyndromic sensorineural deafness type DFNB49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MARVELD2 gene located on chromosomal region 5q13.2. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600
MAT1A	Methionine adenosyltransferase deficiency	NM_000429.2	NM_000429.2:c.1006G>A, NM_000429.2:c.1070C>T, NM_000429.2:c.595C>T, NM_000429.2:c.1043_1044delTG, NM_000429.2:c.790C>T, NM_000429.2:c.827_828insG, NM_000429.2:c.538_539insTG, NM_000429.2:c.914T>C, NM_000429.2:c.791G>A, NM_000429.2:c.966T>G	Methionine adenosyltransferase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAT1A gene located on chromosomal region 10q23.1. This disease is characterized by brain demyelination (rarely leading to neurological disorders) and isolated hepatic hypermethioninemia. The prevalence is <1:1,000,000.	600
MATN3	Multiple epiphyseal dysplasia type 5	NM_002381.4	NM_002381.4:c.1405+2T>C, NM_002381.4:c.910T>A, NM_002381.4:c.1303G>A, NM_002381.4:c.693G>C	Multiple epiphyseal dysplasia type 5 type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MATN3 gene located on chromosomal region 2p24.1. The age of onset is infantile. It is relatively mild and clinically variable. It is primarily characterized by delayed and irregular ossification of the epiphyses and early-onset osteoarthritis.The prevalence is <1:1,000,000.	600
MBTPS2	Ichthyosis follicularis-atrichia-photophobia	NM_015884.3	NM_015884.3:c.1286G>A, NM_015884.3:c.1424T>C, NM_015884.3:c.677G>T, NM_015884.3:c.261G>A	Ichthyosis follicularis - alopecia – photophobia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the MBTPS2 gene located on chromosomal region Xp22.12-p22.11. The age of onset is infantile. This disease is characterized by the triad of ichthyosis follicularis, alopecia, and photophobia. The prevalence is 1:200,000.	600
MCCC1	3-Methylcrotonyl-CoA carboxylase type 1 deficiency	NM_020166.4	NM_020166.4:c.1155A>C, NM_020166.4:c.1930G>T, NM_020166.4:c.2079delA, NM_020166.4:c.388G>A, NM_020166.4:c.559T>C, NM_020166.4:c.343C>T, NM_020166.4:c.640-2A>G, NM_020166.4:c.1942G>A, NM_020166.4:c.1905delA, NM_020166.4:c.640-1G>A, NM_020166.4:c.1074delG, NM_020166.4:c.1114C>T, NM_020166.4:c.558delA, NM_020166.4:c.1277T>C, NM_020166.4:c.1526delG, NM_020166.4:c.1380T>G, NM_020166.4:c.310C>T, NM_020166.4:c.1310T>C	3-methylcrotonyl-CoA carboxylase deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC1 gene located on chromosomal region 3q27.1. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn.	600
MCCC2	3-Methylcrotonyl-CoA carboxylase 2 deficiency, type 2	NM_022132.4	NM_022132.4:c.295G>C, NM_022132.4:c.380C>G, NM_022132.4:c.1309A>G, NM_022132.4:c.515_516insT, NM_022132.4:c.1015G>A, NM_022132.4:c.464G>A, NM_022132.4:c.641delG, NM_022132.4:c.1576_1577insT, NM_022132.4:c.735_736insC, NM_022132.4:c.517_518insT, NM_022132.4:c.838G>T, NM_022132.4:c.499T>C, NM_022132.4:c.1367C>T, NM_022132.4:c.929C>G, NM_022132.4:c.1065A>T, NM_022132.4:c.1580G>A, NM_022132.4:c.994C>T, NM_022132.4:c.1072+1G>A	3-methylcrotonyl-CoA carboxylase deficiency type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC2 gene located on chromosomal region 5q13.2. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn.	250,600
MCEE	Methylmalonic acidemia due to methylmalonyl-CoA epimerase deficiency	NM_032601.3	NM_032601.3:c.178A>C, NM_032601.3:c.2T>C, NM_032601.3:c.139C>T	Methylmalonic acidemia due to methylmalonyl-CoA epimerase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCEE gene located on chromosomal region 2p13.3. The age of onset is neonatal. This disease is characterized by lethargy, vomiting, hypotonia, hypothermia, respiratory distress, severe ketoacidosis, hyperammonemia, neutropenia, and thrombocytopenia. The prevalence is 1:50,000-1:80,000.	600
MCOLN1	Mucolipidosis type 4	NM_020533.2	NM_020533.2:c.1084G>T, NM_020533.2:c.304C>T, NM_020533.2:c.1207C>T, NM_020533.2:c.964C>T	Mucolipidosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCOLN1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismus. The prevalence is 1:40,000.	600
MCPH1	Microcephaly, primary, type 1, autosomal recessive	NM_024596.3	NM_024596.3:c.1973+1G>A, NM_024596.3:c.2221C>T, NM_024596.3:c.427_428insA, NM_024596.3:c.1561G>T, NM_024596.3:c.1935+1G>T, NM_024596.3:c.215C>T, NM_024596.3:c.1249_1250insT	Autosomal recessive primary microcephaly type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCPH1 gene located on chromosomal region 8p23.1. The age of onset is neonatal. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. The incidence is 1/1,000,000.	600
MECP2	Rett syndrome	NM_004992.3	NM_004992.3:c.1048_1050delAGC, NM_004992.3:c.215dupC, NM_004992.3:c.611C>G, NM_004992.3:c.1282G>A, NM_004992.3:c.916C>T, NM_004992.3:c.806delG, NM_004992.3:c.502C>T, NM_004992.3:c.880C>T, NM_004992.3:c.674C>T, NM_004992.3:c.964C>T, NM_004992.3:c.705G>A, NM_004992.3:c.808C>T, NM_004992.3:c.730C>T, NM_004992.3:c.683C>G, NM_004992.3:c.753delC, NM_004992.3:c.965C>T, NM_004992.3:c.763C>T	Rett syndrome an X -linked pattern of inheritance and is caused by pathogenic variants in the MECP2 gene located on chromosomal region Xq28. The age of onset is neonatal. An X-linked dominant neurodevelopmental disorder, and one of the most common causes of mental retardation in females. Patients appear to develop normally until 6 to 18 months of age, then gradually lose speech and purposeful hand movements, and develop microcephaly, seizures, autism, ataxia, mental retardation and stereotypic hand movements. After initial regression, the condition stabilizes and patients usually survive into adulthood. The prevalence is 1:8,500.	600
MED12	Ohdo syndrome	NM_005120.2	NM_005120.2:c.3493T>C, NM_005120.2:c.5185C>A, NM_005120.2:c.3443G>A	Ohdo syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the MED12 gene located on chromosomal region Xq13.1. The age of onset is infantile. It is characterized by mental retardation, feeding problems, and distinctive facial appearance with coarse facial features, severe blepharophimosis, ptosis, a bulbous nose, micrognathia and a small mouth. Dental hypoplasia and deafness can be considered as common manifestations of the syndrome. Male patients show cryptorchidism and scrotal hypoplasia.	600
MED25	Charcot-Marie-Tooth disease type 2B2	NM_030973.3	NM_030973.3:c.316delG, NM_030973.3:c.1366C>T, NM_030973.3:c.1004C>T	Charcot-Marie-Tooth disease type 2B2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MED25 gene located on chromosomal region 19q13.33. The age of onset is adult. This disease is characterized by symmetric moderate to severe weakness of the distal muscles, predominantly affecting the lower extremities. Marked sensory deficits were also reported.	250,600
MEFV	Familial mediterranean fever	NM_000243.2	NM_000243.2:c.163_164insA, NM_000243.2:c.1437C>G, NM_000243.2:c.2282G>A, NM_000243.2:c.163dupA, NM_000243.2:c.2076_2078delAAT, NM_000243.2:c.1958G>A, NM_000243.2:c.443A>T, NM_000243.2:c.656_657insG, NM_000243.2:c.688G>A, NM_000243.2:c.800C>T, NM_000243.2:c.1223G>A, NM_000243.2:c.501G>C, NM_000243.2:c.2040G>A, NM_000243.2:c.2040G>C, NM_000243.2:c.2084A>G, NM_000243.2:c.1141C>T, NM_000243.2:c.1016C>T, NM_000243.2:c.2177T>C, NM_000243.2:c.1772T>C, NM_000243.2:c.2080A>G, NM_000243.2:c.2082G>A, NM_000243.2:c.2230G>T	Familial Mediterranean fever follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MEFV gene located on chromosomal region 16p13.3. The age of onset is infantile or adult (before the age of 30). This disease is characterized by recurrent short episodes of fever and serositis resulting in pain in the abdomen, chest, joints and muscles. The prevalence is 1:10,000-5:10,000.	250,600
MERTK	Retinitis pigmentosa type 38	NM_006343.2	NM_006343.2:c.2189+1G>T, NM_006343.2:c.1605-2A>G, NM_006343.2:c.2070_2074delAGGAC, NM_006343.2:c.2784_2785insTA, NM_006343.2:c.2785_2786dupTA, NM_006343.2:c.2323C>T, NM_006343.2:c.2207_2210delCTGT	Retinitis pigmentosa type 38 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MERTK gene located on chromosomal region 2q13. The age of onset is infantile. This disease is characterized by. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness.	250,600
MFRP	Microphthalmia - Retinitis pigmentosa - foveoschisis - optic disc drusen	NM_031433.3	NM_031433.3:c.498delC, NM_031433.3:c.523C>T, NM_031433.3:c.629G>T, NM_031433.3:c.1150_1151insC, NM_031433.3:c.545T>C, NM_031433.3:c.1124+1G>T	Microphthalmia - Retinitis pigmentosa - foveoschisis - optic disc drusen follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFRP gene located on chromosomal region 11q23.3. The age of onset is infantile. This disease is characterized by posterior microphthalmos, retinitis pigmentosa, foveoschisis, and optic disk drusen.	250,600
MFSD8	Ceroid lipofuscinosis, neuronal, type 7	NM_152778.2	NM_152778.2:c.1286G>A, NM_152778.2:c.999-2A>G, NM_152778.2:c.1235C>T, NM_152778.2:c.1090delA, NM_152778.2:c.362A>G, NM_152778.2:c.881C>A, NM_152778.2:c.929G>A, NM_152778.2:c.1525_1526delCT, NM_152778.2:c.894T>G	Neuronal ceroid lipofuscinosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFSD8 gene located on chromosomal region 4q28.2. The age of onset is late infantile. This disease is characterized by decline of mental and motor capacities, epilepsy, and vision loss through retinal degeneration. The prevalence is 0.56:100,000-3.9:100,000.	600
MGAT2	Congenital disorders of glycosylation 2a type	NM_002408.3	NM_002408.3:c.869C>T, NM_002408.3:c.785A>G, NM_002408.3:c.1017T>A	Congenital disorder of glycosylation type 2a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MGAT2 gene located on chromosomal region 14q21.3. The age of onset is infantile. This disease is characterized by severe psychomotor delay, postnatal growth retardation, facial dysmorphology and bleeding tendency. It has been described in four children.	600
MKKS	Bardet-Biedl/McKusick-Kaufman syndrome	NM_018848.3	NM_018848.3:c.353delG	Bardet-Biedl syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. McKusick-Kaufman syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is fetal. This disease is characterized by hydrometrocolpos, post-axial polydactyly, and to a lesser extent cardiac defects.	250,600
MKKS	Bardet-Biedl syndrome type 6	NM_018848.3	NM_018848.3:c.830T>C, NM_018848.3:c.1436C>G	Bardet-Biedl syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.	250,600
MKKS	McKusick-Kaufman syndrome	NM_018848.3	NM_018848.3:c.250C>T, NM_018848.3:c.1225_1226delGG, NM_018848.3:c.724G>T	McKusick-Kaufman syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is fetal. This disease is characterized by hydrometrocolpos, post-axial polydactyly, and to a lesser extent cardiac defects.	250,600
MKS1	Bardet-Biedl syndrome type 13	NM_017777.3	NM_017777.3:c.1349T>C	Bardet-Biedl syndrome type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.	250,600
MKS1	Meckel type 1/Bardet-Biedl syndrome	NM_017777.3	NM_017777.3:c.1024+1G>A, NM_017777.3:c.857A>G, NM_017777.3:c.1319T>C, NM_017777.3:c.814G>C, NM_017777.3:c.508C>T, NM_017777.3:c.1319G>C	Meckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is infantile, etc/. This disease is characterized by a combination of renal cysts and variably associated features, including developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and cysts, and polydactyly.. The prevalence is 1:1,000,000-9:1,000,000. Bardet-Biedl syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.	250,600
MLC1	Megalencephalic leukoencephalopathy with subcortical cysts 1	NM_015166.3	NM_015166.3:c.135_136insC, NM_015166.3:c.206C>T, NM_015166.3:c.278C>T, NM_015166.3:c.424-2A>C, NM_015166.3:c.422A>G, NM_015166.3:c.274C>T, NM_015166.3:c.839C>T, NM_015166.3:c.423C>A, NM_015166.3:c.33_34insC	Megalencephalic leukoencephalopathy with subcortical cysts follows an autosomal recessive patternof inheritance and is caused by pathogenic variants in the MLC1 gene located on chromosomal region 22q13.33. The age of onset is infantile. This disease is characterized by ataxia followed by progressive signs of pyramidal tract involvement and mental deterioration.	600
MLYCD	Malonyl-CoA decarboxylase deficiency	NM_012213.2	NM_012213.2:c.758delT, NM_012213.2:c.679delinsATGAAGC, NM_012213.2:c.560C>G	Malonyl-CoA decarboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MLYCD gene located on chromosomal region 16q23.3. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000.	600
MMAA	Vitamin B12-responsive methylmalonic acidemia type cblA	NM_172250.2	NM_172250.2:c.1034delT, NM_172250.2:c.283C>T, NM_172250.2:c.440G>A, NM_172250.2:c.451delC, NM_172250.2:c.592_595delCTGA, NM_172250.2:c.503delC, NM_172250.2:c.450_451insG, NM_172250.2:c.811G>T, NM_172250.2:c.586C>T, NM_172250.2:c.387C>A, NM_172250.2:c.620A>G	Vitamin B12-responsive methylmalonic acidemia type cblA follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAA gene located on chromosomal region 4q31.21. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000.	600
MMAB	Vitamin B12-responsive methylmalonic acidemia type cblB	NM_052845.3	NM_052845.3:c.557G>A, NM_052845.3:c.556C>T, NM_052845.3:c.569G>A, NM_052845.3:c.568C>T, NM_052845.3:c.577G>A, NM_052845.3:c.197-1G>T, NM_052845.3:c.700C>T, NM_052845.3:c.548A>T, NM_052845.3:c.220G>T, NM_052845.3:c.197-1G>A	Vitamin B12-responsive methylmalonic acidemia type cbl B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAB gene located on chromosomal region 12q24.31. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000.	600
MMACHC	Methylmalonic aciduria cblC type, with homocystinuria	NM_015506.2	NM_015506.2:c.389A>G, NM_015506.2:c.388T>C, NM_015506.2:c.482G>A, NM_015506.2:c.609G>A, NM_015506.2:c.688C>T, NM_015506.2:c.394C>T, NM_015506.2:c.440G>C, NM_015506.2:c.608G>A, NM_015506.2:c.481C>T, NM_015506.2:c.619_620insG, NM_015506.2:c.547_548delGT, NM_015506.2:c.347T>C, NM_015506.2:c.658_660delAAG, NM_015506.2:c.388_390delTAC, NM_015506.2:c.615C>A, NM_015506.2:c.331C>T, NM_015506.2:c.616C>T, NM_015506.2:c.270_271insA, NM_015506.2:c.271dupA, NM_015506.2:c.615C>G	Methylmalonic acidemia with homocystinuria, type cblC follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMACHC gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by failure to thrive, acute neurological deterioration, intellectual deficit, lethargy, seizures, microcephaly, a salt-and-pepper retinopathy, and signs of megaloblastic anemia. The prevalence is <1:1,000,000.	250,600
MMADHC	methylmalonic aciduria cblD type, with homocystinuria	NM_015702.2	NM_015702.2:c.545C>A, NM_015702.2:c.746A>G, NM_015702.2:c.419dupA, NM_015702.2:c.748C>T, NM_015702.2:c.795_796insT, NM_015702.2:c.57_64delCTCTTTAG, NM_015702.2:c.737A>G, NM_015702.2:c.776T>C, NM_015702.2:c.478+1G>T	Methylmalonic acidemia with homocystinuria, type cblD follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMADHC gene located on chromosomal region 2q23.2. The age of onset is variable (infantile to adult). This disease is characterized by developmental delay, severe learning difficulties, seizures, movement and gait abnormalities, behavioral problems and signs of megaloblastic anemia (pallor, fatigue, anorexia). The prevalence is 1:50,000-1:80,000.	600
MOCS1	Molybdenum cofactor deficiency type A	NM_005943.5	NM_005943.5:c.218G>A, NM_005943.5:c.397_406delCCGGACGTGG, NM_005943.5:c.217C>T, NM_005943.5:c.956G>A, NM_005943.5:c.1027C>T	Molybdenum cofactor deficiency type A (gene MOCS1) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS1 gene located on chromosomal region 6p21.2. The age of onset is infantile. This disease is characterized by severe neurological abnormalities, dislocated ocular early death.	600
MOCS2	Molybdenum cofactor deficiency type B	NM_176806.3	NM_176806.3:c.106_107delAT, NM_176806.3:c.297+1G>A, NM_176806.3:c.58delT, NM_176806.3:c.245delT, NM_176806.3:c.190G>A, NM_176806.3:c.16C>T, NM_176806.3:c.487A>C, NM_176806.3:c.422G>A, NM_176806.3:c.26_27delAT, NM_176806.3:c.539_540delAA, NM_176806.3:c.459_*460delAA	Molybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death.	250,600
MPI	Congenital disorders of glycosylation type 1b	NM_002435.2	NM_002435.2:c.305C>T, NM_002435.2:c.656G>A, NM_002435.2:c.982C>T, NM_002435.2:c.413T>C, NM_002435.2:c.884G>A, NM_002435.2:c.1016_1019delACCC	Congenital disorder of glycosylation type 1b follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MPI gene located on chromosomal region 15q24.1. The age of onset is infantile. This disease is characterized by hepatic-intestinal manifestations (diarrhoea, vomiting, and hepatomegaly associated with hepatic fibrosis).	600
MPV17	Mitochondrial DNA depletion syndrome type 6	NM_002437.4	NM_002437.4:c.263_265delAGA, NM_002437.4:c.148C>T, NM_002437.4:c.149G>A, NM_002437.4:c.263A>T, NM_002437.4:c.284_285insG, NM_002437.4:c.498C>A, NM_002437.4:c.462-2A>C, NM_002437.4:c.70G>T, NM_002437.4:c.359G>A	Mitochondrial DNA depletion syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MPV17 gene located on chromosomal region 2p23.3. The age of onset is infantile. It is a disease due to mitochondrial dysfunction. It is characterized by infantile onset of progressive liver failure, often leading to death in the first year of life, peripheral neuropathy, corneal scarring, acral ulceration and osteomyelitis leading to autoamputation, cerebral leukoencephalopathy, failure to thrive, and recurrent metabolic acidosis with intercurrent infections.	600
MPZ	Dejerine-Sottas syndrome (MPZ)	NM_000530.6	NM_000530.6:c.661G>A, NM_000530.6:c.380G>A, NM_000530.6:c.123_125delTGT, NM_000530.6:c.407T>A, NM_000530.6:c.560_563dupAGGC, NM_000530.6:c.355_356insTCTACT, NM_000530.6:c.661_662dupGC, NM_000530.6:c.411C>T, NM_000530.6:c.188C>G, NM_000530.6:c.506delT, NM_000530.6:c.190_192delTTC, NM_000530.6:c.496_499delCTCGinsTCC, NM_000530.6:c.372_377delGTTCAC, NM_000530.6:c.89T>C, NM_000530.6:c.499G>C, NM_000530.6:c.368G>A	Dejerine-Sottas syndrome follows autosomal recessive and dominant patterns of inheritance and is caused by pathogenic variants in the MPZ gene located on chromosomal region 1q23.3. The age of onset is infantile. A severe degenerating neuropathy of the demyelinating Charcot-Marie-Tooth disease category, with onset by age 2 years. It is characterized by motor and sensory neuropathy with very slow nerve conduction velocities, increased cerebrospinal fluid protein concentrations, hypertrophic nerve changes, and delayed age of walking as well as areflexia.	600
MPZ	Neuropathy, congenital hypomyelinating or amyelinating	NM_000530.6	NM_000530.6:c.588dupT, NM_000530.6:c.626_630delCGTCG, NM_000530.6:c.392A>G, NM_000530.6:c.578G>A, NM_000530.6:c.397C>T, NM_000530.6:c.164G>T, NM_000530.6:c.150C>G, NM_000530.6:c.142C>G, NM_000530.6:c.130_137delTCCCGGGT, NM_000530.6:c.128G>T, NM_000530.6:c.549dupG, NM_000530.6:c.106A>G, NM_000530.6:c.410G>C, NM_000530.6:c.332C>T, NM_000530.6:c.371C>A, NM_000530.6:c.368_382delGCACGTTCACTTGTG, NM_000530.6:c.382G>A, NM_000530.6:c.393C>A, NM_000530.6:c.103G>T, NM_000530.6:c.88A>T, NM_000530.6:c.106A>T, NM_000530.6:c.419C>G	Neuropathy, congenital hypomyelinating or amyelinating follows an autosomal recessive or dominant patterns of inheritance and is caused by pathogenic variants in the MPZ gene located on chromosomal region 1q23.3. The age of onset is infantile. A severe degenerating neuropathy that results from a congenital impairment in myelin formation. It is clinically characterized by early onset of hypotonia, areflexia, distal muscle weakness, and very slow nerve conduction velocities (as low as 3m/s). Some patients manifest nearly complete absence of spontaneous limb movements, respiratory distress at birth, and complete absence of myelin shown by electron microscopy of peripheral nerves.	600
MRPS16	Combined oxidative phosphorylation deficiency type 2	NM_016065.3	NM_016065.3:c.2T>C, NM_016065.3:c.331C>T	Combined oxidative phosphorylation defect type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MRPS16 gene located on chromosomal region 10q22.2. The age of onset is infantile. This disease is characterized by agenesis of corpus callosum, dismorphism and fatal lactic acidosis.	600
MRPS22	Combined oxidative phosphorylation deficiency type 5	NM_020191.2	NM_020191.2:c.509G>A, NM_020191.2:c.644T>C, NM_020191.2:c.40_41insA	Combined oxidative phosphorylation defect type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MRPS22 gene located on chromosomal region 3q23. The age of onset is infantile. This disease is characterized by evere hypotonia, lactic academia and congenital hyperammonaemia.	600
MTHFR	Homocystinuria due to MTHFR deficiency	NM_005957.4	NM_005957.4:c.1743G>A, NM_005957.4:c.3G>A, NM_005957.4:c.547C>T, NM_005957.4:c.1129C>T, NM_005957.4:c.1768delC, NM_005957.4:c.968T>C, NM_005957.4:c.971A>G, NM_005957.4:c.439C>T	Homocystinuria due to methylene tetrahydrofolate reductase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTHFR gene located on chromosomal region 1p36.22. There are some forms with onset during childhood, adolescence, or adulthood beginning with mental regression, ataxia, and, most often, common psychiatric disorders of the schizophrenic type that may be linked to cerebrovascular accidents. Other symptoms are recurrent apnoea, microcephaly and convulsions.	600
MTM1	Myotubular myopathy, X-linked	NM_000252.2	NM_000252.2:c.1415_1416delGT, NM_000252.2:c.1357_1358delCC, NM_000252.2:c.461T>G, NM_000252.2:c.420C>G, NM_000252.2:c.595_599delCCTGC, NM_000252.2:c.1261-10A>G, NM_000252.2:c.780T>A, NM_000252.2:c.670C>T, NM_000252.2:c.1306_1310dupCCTAT, NM_000252.2:c.969delA, NM_000252.2:c.721C>T, NM_000252.2:c.70C>T, NM_000252.2:c.969dupA	X-linked centronuclear myopathy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the MTM1 gene located on chromosomal region Xq28. The age of onset is infantile, etc/. This disease is characterized by severe phenotype in males presenting at birth with marked weakness, hypotonia and respiratory failure. The incidence is 1/50,000 newborn man.	600
MTMR2	Charcot-Marie-Tooth disease type 4B1	NM_016156.5	NM_016156.5:c.88C>T, NM_016156.5:c.304C>T, NM_016156.5:c.1276C>T, NM_016156.5:c.88A>T	Charcot-Marie-Tooth disease type 4B1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTMR2 gene located on chromosomal region 11q21. The age of onset is early infantile. This disease is characterized by distal and proximal muscular weakness starting in the lower extremities, sensory loss and cranial nerve involvement, foot deformities and diaphragmatic and facial involvement.	600
MTTP	Abetalipoproteinemia	NM_000253.3	NM_000253.3:c.1769G>T, NM_000253.3:c.2030delC, NM_000253.3:c.1619G>A, NM_000253.3:c.2593G>T, NM_000253.3:c.708_709delCA, NM_000253.3:c.1867+1G>A, NM_000253.3:c.703_704delAC	Abetalipoproteinemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTP gene located on chromosomal region 4q23. The age of onset is infantile. This disease is characterized by growth delay, malabsorption, hepatomegaly, and neurological and neuromuscular manifestations. The prevalence is <1:1,000,000.	250,600
MUT	Methylmalonic acidemia	NM_000255.3	NM_000255.3:c.1420C>T, NM_000255.3:c.1445-2A>G, NM_000255.3:c.2080C>T, NM_000255.3:c.1867G>A, NM_000255.3:c.607G>A, NM_000255.3:c.1658delT, NM_000255.3:c.1280G>A, NM_000255.3:c.1399C>T, NM_000255.3:c.914T>C, NM_000255.3:c.643G>A, NM_000255.3:c.655A>T, NM_000255.3:c.1741C>T, NM_000255.3:c.1106G>A, NM_000255.3:c.1871A>G, NM_000255.3:c.1924G>C, NM_000255.3:c.682C>T, NM_000255.3:c.572C>A, NM_000255.3:c.313T>C, NM_000255.3:c.1181T>A, NM_000255.3:c.278G>A, NM_000255.3:c.678_679insAATTTATG, NM_000255.3:c.794dupT, NM_000255.3:c.671_678dupAATTTATG, NM_000255.3:c.2150G>T, NM_000255.3:c.280G>A, NM_000255.3:c.91C>T, NM_000255.3:c.1207C>T	Methylmalonic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MUT gene located on chromosomal region 6p12.3. The age of onset is very early infantile. This disease is characterized by recurrent ketoacidotic comas or transient vomiting, dehydration, hypotonia and intellectual deficit, which does not respond to administration of vitamin B12.	250,600
MVK	Hyper-IgD syndrome	NM_000431.3	NM_000431.3:c.829C>T, NM_000431.3:c.803T>C, NM_000431.3:c.185G>A, NM_000431.3:c.494C>T, NM_000431.3:c.59A>C, NM_000431.3:c.1129G>A	Hyper IgD syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by periodic attacks of fever and a systemic inflammatory reaction (cervical lymphadenopathy, abdominal pain, vomiting, diarrhea, arthralgias and skin signs).	250,600
MVK	Mevalonic aciduria	NM_000431.3	NM_000431.3:c.1000G>A, NM_000431.3:c.902A>C, NM_000431.3:c.928G>A	Mevalonic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by psychomotor retardation, failure to thrive, progressive cerebellar ataxia, dysmorphic features, progressive visual impairment and recurrent febrile crises. The prevalence is <1:1,000,000.	250,600
MYO15A	Deafness type 3, autosomal recessive	NM_016239.3	NM_016239.3:c.3385C>T, NM_016239.3:c.6003delG, NM_016239.3:c.6004delG, NM_016239.3:c.10573delA, NM_016239.3:c.3313G>T, NM_016239.3:c.3336delG, NM_016239.3:c.755dupA, NM_016239.3:c.5492G>T, NM_016239.3:c.4351G>A, NM_016239.3:c.6864_6874delGGACCTGGAGC, NM_016239.3:c.4751_4752dupTC, NM_016239.3:c.625G>T, NM_016239.3:c.3693-2A>G, NM_016239.3:c.6614C>T, NM_016239.3:c.6743C>T, NM_016239.3:c.6046+2T>G, NM_016239.3:c.5326C>T, NM_016239.3:c.3756+1G>T, NM_016239.3:c.8410A>T, NM_016239.3:c.8429_8447delGCGGGCAGCTGCGGGTCCT, NM_016239.3:c.8148G>T, NM_016239.3:c.9958_9961delGACT, NM_016239.3:c.4750_4751insTC, NM_016239.3:c.8548C>T	Deafness autosomal recessive type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO15A gene located on chromosomal region 17p11.2. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	250,600
MYO3A	Deafness type 30, autosomal recessive	NM_017433.4	NM_017433.4:c.1086T>G, NM_017433.4:c.2793+2T>A, NM_017433.4:c.4586+2T>G, NM_017433.4:c.4730+1G>A, NM_017433.4:c.1A>G, NM_017433.4:c.2506-1G>A, NM_017433.4:c.1777-12G>A, NM_017433.4:c.1952delC, NM_017433.4:c.1193C>A, NM_017433.4:c.770C>G, NM_017433.4:c.3154C>T, NM_017433.4:c.585+5G>C, NM_017433.4:c.2243delA, NM_017433.4:c.3112-2A>G, NM_017433.4:c.732-2A>G	Deafness autosomal recessive type 30 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO3A gene located on chromosomal region 10p12.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	250,600
MYO5A	Griscelli syndrome type 1	NM_000259.3	NM_000259.3:c.1145delC, NM_000259.3:c.2332C>T	Griscelli disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO5A gene located on chromosomal region 15q21.2. The age of onset is infantile. This disease is characterized by is characterised by silvery gray sheen of the hair and hypopigmentation of the skin which can be associated to neurological impairment. The prevalence is <1:1,000,000.	600
MYO6	Deafness type 37, autosomal recessive	NM_004999.3	NM_004999.3:c.2897_2899delAAG, NM_004999.3:c.2840G>A, NM_004999.3:c.647A>T, NM_004999.3:c.3496C>T, NM_004999.3:c.3808C>T, NM_004999.3:c.1446_1447insT	Deafness autosomal recessive type 37 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO6 gene located on chromosomal region 6q14.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	250,600
MYO7A	Deafness type 2, autosomal recessive	NM_000260.3	NM_000260.3:c.1797G>A, NM_000260.3:c.2023C>T, NM_000260.3:c.731G>C, NM_000260.3:c.3596dupT, NM_000260.3:c.1184G>A, NM_000260.3:c.133-2A>G	Deafness autosomal recessive type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	250,600
MYO7A	Usher syndrome type 1B	NM_000260.3	NM_000260.3:c.1996C>T, NM_000260.3:c.1884C>A, NM_000260.3:c.448C>T, NM_000260.3:c.2476G>A, NM_000260.3:c.4024delT, NM_000260.3:c.2617C>T, NM_000260.3:c.5227C>T, NM_000260.3:c.1344-1G>A, NM_000260.3:c.5507T>G, NM_000260.3:c.5886_5889delCTTT, NM_000260.3:c.3504-1G>C, NM_000260.3:c.3508G>A, NM_000260.3:c.4018G>A, NM_000260.3:c.5392C>T, NM_000260.3:c.640G>A, NM_000260.3:c.3134T>C, NM_000260.3:c.5824G>T, NM_000260.3:c.3G>A, NM_000260.3:c.494C>T, NM_000260.3:c.5618G>A, NM_000260.3:c.5884_5887delTTCT, NM_000260.3:c.634C>T, NM_000260.3:c.3719G>A, NM_000260.3:c.5967C>G, NM_000260.3:c.3763delA, NM_000260.3:c.635G>A, NM_000260.3:c.6025delG	Usher syndrome type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 1:100,000-9:100,000.	250,600
NAGA	Schindler disease	NM_000262.2	NM_000262.2:c.973G>A, NM_000262.2:c.985C>T, NM_000262.2:c.986G>A, NM_000262.2:c.577G>T	Schindler disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGA gene located on chromosomal region 22q13.2. The age of onset is infantile. This disease is characterized by early-onset neuroaxonal dystrophy and neurological signs (convulsion during fever, epilepsy, psychomotor retardation and hypotonia). NAGA deficiency is typically classified in three main phenotypes: NAGA deficiency type I (Schindler disease or Schindler disease type I) with severe manifestations; NAGA deficiency type II (Kanzazi disease or Schindler disease type II) which is mild; NAGA deficiency type III (Schindler disease type III) characterized by mild-to-moderate neurologic manifestations. NAGA deficiency results in the increased urinary excretion of glycopeptides and oligosaccharides containing alpha-N-acetylgalactosaminyl moieties.	250,600
NAGS	Hyperammonemia due to N-acetylglutamate synthetase deficiency	NM_153006.2	NM_153006.2:c.971G>A, NM_153006.2:c.1289T>C, NM_153006.2:c.1025delG, NM_153006.2:c.916-2A>T, NM_153006.2:c.1307dupT, NM_153006.2:c.1299G>C	Hyperammonemia due to N-acetylglutamate synthetase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGS gene located on chromosomal region 17q21.31. The age of onset is infantile, etc/. This disease is characterized by vomiting, hyperactivity or lethargy, diarrhoea, poor feeding, seizures, hypotonia, delayed psychomotor development and respiratory distress. The prevalence is <1:1,000,000.	600
NDRG1	Charcot-Marie-Tooth disease, type 4D	NM_006096.3	NM_006096.3:c.16C>T, NM_006096.3:c.-18-2_-18-1delAG, NM_006096.3:c.538-1G>A, NM_006096.3:c.-18-2_-18-1del1, NM_006096.3:c.928C>T, NM_006096.3:c.442C>T	Charcot-Marie-Tooth disease type 4D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NDRG1 gene located on chromosomal region 8q24.22. The age of onset is infantile, etc/. This disease is characterized by demyelination and hearing loss.	600
NEB	Nemaline myopathy type 2	NM_004543.4	NM_004543.4:c.11474_11475delTG, NM_004543.4:c.19119_19120delGA, NM_004543.4:c.19306-1G>A, NM_004543.4:c.19606G>T, NM_004543.4:c.6105dupT, NM_004543.4:c.3191A>G, NM_004543.4:c.18318_18319delAG, NM_004543.4:c.11473_11474delAT, NM_004543.4:c.2173G>T, NM_004543.4:c.19097_19098delTT, NM_004543.4:c.19836+1_19836+2insATGGA, NM_004543.4:c.18825+1370C>T, NM_004543.4:c.5567G>A, NM_004543.4:c.6105_6106insT, NM_004543.4:c.16842+1G>A, NM_004543.4:c.843T>G, NM_004543.4:c.8031_8041delAAATAAACGAG, NM_004543.4:c.14182_14183delGCinsAA, NM_004543.4:c.15973C>T	Nemaline myopathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEB gene located on chromosomal region 2q23.3. The age of onset is infantile or adult. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:100,000-9:100,000 and the incidence is 1/50.000 newborn.	250,600
NEFL	Charcot-Marie-Tooth disease type 1F	NM_006158.3	NM_006158.3:c.418G>T, NM_006158.3:c.628G>T, NM_006158.3:c.361G>T	Charcot-Marie-Tooth disease type 1F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEFL gene located on chromosomal region 8p21.2. The age of onset is infantile. This disease is characterized by a progressive peripheral motor and sensory neuropathy with variable clinical, distal weakness and wasting of the muscles of the lower limbs. The prevalence is 15:100,000-20:100,000.	600
NEUROG3	Diarrhea type 4, malabsorptive, congenital	NM_020999.3	NM_020999.3:c.319C>A, NM_020999.3:c.278G>T	Congenital malabsorptive diarrhea type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEUROG3 gene located on chromosomal region 10q22.1. The age of onset is early infantile. This disease is characterized by generalized malabsorption, a paucity of enteroendocrine cells, those symptoms lead to vomiting, diarrhea, dehydration, and a severe hyperchloremic metabolic acidosis after the ingestion of standard cow's milk-based formula. The prevalence is <1:1,000,000.	600
NHP2	Dyskeratosis congenita type 2, autosomal recessive	NM_017838.3	NM_017838.3:c.415T>C, NM_017838.3:c.460T>A, NM_017838.3:c.289_290delAT	Dyskeratosis congenita 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NHP2 gene located on chromosomal region 5q35.3. The age of onset is variable from infancy to adult. It is a multisystem disorder caused by defective telomere maintenance. Clinical manifestations include mucocutaneous abnormalities, bone marrow failure, and an increased predisposition to cancer, among other variable features.	600
NMNAT1	Leber congenital amaurosis type 9	NM_022787.3	NM_022787.3:c.451G>T, NM_022787.3:c.25G>A, NM_022787.3:c.457C>G, NM_022787.3:c.507G>A, NM_022787.3:c.710G>T, NM_022787.3:c.619C>T, NM_022787.3:c.769G>A	Leber congenital amaurosis type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NMNAT1 gene located on chromosomal region 1p36.22. The age of onset is early infantile. This disease is characterized by blindness, nystagmus, roving eye movement, leading to severe visual impairment.	250,600
NOP10	Dyskeratosis congenita type 1, autosomal recessive	NM_018648.3	NM_018648.3:c.34G>C, NM_018648.3:c.100C>T	Dyskeratosis congenita autosomal recessive type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NOP10 gene located on chromosomal region 15q14. The age of onset is infantile. This disease is characterized by the mucocutaneous triad of abnormal skin pigmentation, nail dystrophy and mucosal leucoplakia. The prevalence is 1:1,000,000.	600
NPC1	Niemann-Pick disease type C1	NM_000271.4	NM_000271.4:c.1042C>T, NM_000271.4:c.2842G>A, NM_000271.4:c.1628C>T, NM_000271.4:c.2974G>T, NM_000271.4:c.3019C>G, NM_000271.4:c.1211G>A, NM_000271.4:c.2072C>T, NM_000271.4:c.2324A>C, NM_000271.4:c.337T>C, NM_000271.4:c.3107C>T, NM_000271.4:c.530G>A, NM_000271.4:c.743G>T, NM_000271.4:c.3611_3614delTTAC, NM_000271.4:c.813_815delCAT, NM_000271.4:c.2932C>T, NM_000271.4:c.3425T>C, NM_000271.4:c.2761C>T, NM_000271.4:c.3104C>T, NM_000271.4:c.3662delT, NM_000271.4:c.2972_2973delAG, NM_000271.4:c.2974G>A, NM_000271.4:c.2873G>A, NM_000271.4:c.352_353delAG, NM_000271.4:c.3182T>C, NM_000271.4:c.3467A>G, NM_000271.4:c.3175C>T, NM_000271.4:c.2861C>T, NM_000271.4:c.2848G>A	Niemann-Pick disease type C1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC1 gene located on chromosomal region 18q11.2. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000.	250,600
NPC2	Niemann-Pick disease type C2	NM_006432.3	NM_006432.3:c.115G>A, NM_006432.3:c.190+5G>A, NM_006432.3:c.27delG, NM_006432.3:c.352G>T, NM_006432.3:c.58G>T, NM_006432.3:c.358C>T, NM_006432.3:c.295T>C, NM_006432.3:c.441+1G>A, NM_006432.3:c.436C>T	Niemann-Pick disease type C2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC2 gene located on chromosomal region 14q24.3. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000.	250,600
NPHP1	Nephronophthisis type 1	NM_000272.3	NM_000272.3:c.80T>A, NM_000272.3:c.1delA, NM_000272.3:c.555_556insA, NM_000272.3:c.829C>T, NM_000272.3:c.455C>G, NM_000272.3:c.1884+1G>T, NM_000272.3:c.1184dupC	Nephronophthisis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP1 gene located on chromosomal region 2q13. The age of onset is juvenile. This disease is characterized by anemia, polyuria, polydipsia, isosthenuria and death in uremia. Symmetrical destruction of the kidneys involving both tubules and glomeruli occurs. The underlying pathology is a chronic tubulo-interstitial nephropathy with characteristic tubular basement membrane thickening and medullary cyst formation. Associations with extrarenal symptoms, especially ocular lesions, are frequent.	600
NPHP3	Nephronophthisis type 3	NM_153240.4	NM_153240.4:c.1817G>A, NM_153240.4:c.434_437delAAAG, NM_153240.4:c.1119-2A>G, NM_153240.4:c.1729C>T, NM_153240.4:c.2694-2A>G, NM_153240.4:c.1985+5G>A, NM_153240.4:c.3406C>T, NM_153240.4:c.3373C>T, NM_153240.4:c.1381G>T, NM_153240.4:c.2694-2_2694-1delAG, NM_153240.4:c.1157A>G, NM_153240.4:c.2369T>C, NM_153240.4:c.3550G>A, NM_153240.4:c.2541delG, NM_153240.4:c.2570+1G>T, NM_153240.4:c.3156_3157insA, NM_153240.4:c.3662C>T	Nephronophthisis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP3 gene located on chromosomal region 3q22.1. The age of onset is adult. This disease is characterized by polyuria, polydipsia, anemia. Onset of terminal renal failure occur significantly later (median age, 19 years) than in juvenile nephronophthisis. Renal pathology is characterized by alterations of tubular basement membranes, tubular atrophy and dilation, sclerosing tubulointerstitial nephropathy, and renal cyst development predominantly at the corticomedullary junction. The prevalence is <1:1,000,000.	250,600
NPHP4	Nephronophthisis type 4	NM_015102.4	NM_015102.4:c.4179T>A, NM_015102.4:c.3767_3768insAA, NM_015102.4:c.3674C>T, NM_015102.4:c.556_557insT, NM_015102.4:c.2940_2944dupGCTCC, NM_015102.4:c.3231+1G>C, NM_015102.4:c.517C>T, NM_015102.4:c.2335C>T, NM_015102.4:c.2219G>A, NM_015102.4:c.7G>T, NM_015102.4:c.1972C>T, NM_015102.4:c.1120-1G>C	Nephronophthisis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP4 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease results in end-stage renal disease at age ranging between 6 and 35 years. It is a progressive tubulo-interstitial kidney disorder characterized by polydipsia, polyuria, anemia and growth retardation. The prevalence is 1:1,000,000-9:1,000,000.	250,600
NPHS1	Nephrotic syndrome type 1	NM_004646.3	NM_004646.3:c.59-5C>G, NM_004646.3:c.3109+1G>A, NM_004646.3:c.3478C>T, NM_004646.3:c.121_122delCT, NM_004646.3:c.1481delC, NM_004646.3:c.2456A>T, NM_004646.3:c.2491C>T, NM_004646.3:c.2464G>A, NM_004646.3:c.1307_1308dupAC, NM_004646.3:c.3250delG, NM_004646.3:c.3325C>T, NM_004646.3:c.2928G>T, NM_004646.3:c.3250_3251insG, NM_004646.3:c.2746G>T, NM_004646.3:c.1715G>A	Nephrotic syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHS1 gene located on chromosomal region 19q13.12. The age of onset is fetal- infantile. This disease is characterized by fetal proteinuria and nephritic infantile syndrome. The prevalence is 1 in 8 200 births.	250,600
NR0B1	Cytomegalic congenital adrenal hypoplasia	NM_000475.4	NM_000475.4:c.513G>A, NM_000475.4:c.591C>A, NM_000475.4:c.315G>C, NM_000475.4:c.873G>C, NM_000475.4:c.800G>C, NM_000475.4:c.788T>A, NM_000475.4:c.704G>A, NM_000475.4:c.1319A>T, NM_000475.4:c.388_389delTA, NM_000475.4:c.273C>A, NM_000475.4:c.813C>G, NM_000475.4:c.847C>T, NM_000475.4:c.1107G>A, NM_000475.4:c.890T>C, NM_000475.4:c.1316T>G	Cytomegalic congenital adrenal hypoplasia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the NR0B1 gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by adrenal insufficiency with vomiting, feeding difficulty, dehydration, and shock caused by a salt-wasting episode and hypoglycemia.	600
NR2E3	Enhaced S-Cone Syndrome	NM_014249.3	NM_014249.3:c.119-2A>C, NM_014249.3:c.297_298delGT, NM_014249.3:c.932G>A, NM_014249.3:c.226C>T, NM_014249.3:c.361G>A, NM_014249.3:c.227G>A, NM_014249.3:c.1034_1038delTGCAG	Enhaced S-Cone Syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NR2E3 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by night blindness, reduced bilateral visual acuity, and typical fundus findings (progressive pigmentary degenerative changes, macular edema, retinoschisis).	250,600
NTRK1	Hereditary sensory and autonomic neuropathy type 4	NM_001012331.1	NM_001012331.1:c.1076A>G, NM_001012331.1:c.1711G>C, NM_001012331.1:c.1741A>G, NM_001012331.1:c.1908_1909insT, NM_001012331.1:c.1709delT, NM_001012331.1:c.1942C>T, NM_001012331.1:c.1852C>T, NM_001012331.1:c.1456G>A, NM_001012331.1:c.2321G>C, NM_001012331.1:c.2066C>T	Hereditary sensory and autonomic neuropathy type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NTRK1 gene located on chromosomal region 1q23.1. The age of onset is infantile. This disease is characterized by anhidrosis, insensitivity to pain, self-mutilating behavior and episodes of fever.	600
NUP62	Infantile striatal degeneration	NM_153719.3	NM_153719.3:c.1172A>C	Infantile striatal degeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NUP62 gene located on chromosomal region 19q13.33. The age of onset is infantile. This disease is characterized by choreoathetosis, dystonia, rigidity, spasticity, dysphagia, optic atrophy, intellectual deficit, developmental regression of motor and verbal skills, failure to thrive, myoclonus, quadriparesis, cerebellar ataxia and nystagmus. The prevalence is <1:1,000,000.	600
NYX	Night blindness, congenital stationary , type 1A, X-linked	NM_022567.2	NM_022567.2:c.1049G>A	Congenital stationary night blindness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NYX gene located on chromosomal region Xp11.4. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity.	600
OAT	Gyrate atrophy of choroid and retina with or without ornithinemia	NM_000274.3	NM_000274.3:c.1250C>T, NM_000274.3:c.159delC, NM_000274.3:c.1205T>C, NM_000274.3:c.901-2A>G, NM_000274.3:c.533G>A, NM_000274.3:c.1276C>T, NM_000274.3:c.824G>A, NM_000274.3:c.268C>G, NM_000274.3:c.952delG, NM_000274.3:c.994G>A, NM_000274.3:c.955C>T, NM_000274.3:c.677C>T, NM_000274.3:c.278G>T, NM_000274.3:c.627T>A, NM_000274.3:c.812G>A, NM_000274.3:c.952G>A, NM_000274.3:c.539G>C, NM_000274.3:c.596C>A	Gyrate atrophy of choroid and retina follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OAT gene located on chromosomal region 10q26.13. The age of onset is infantile. This disease is characterized by gyrate atrophy of the choroid and retina that begins during childhood with myopia and night blindness, followed by concentric shrinking of the visual field (tunnel vision) and a peculiar aspect of retinopathy on the funduscopy.	600
OCA2	Oculocutaneous albinism type 2	NM_000275.2	NM_000275.2:c.1610A>G, NM_000275.2:c.1960delG, NM_000275.2:c.2359G>A, NM_000275.2:c.819_822delCTGGinsGGTC, NM_000275.2:c.2228C>T, NM_000275.2:c.1025A>G, NM_000275.2:c.1842+1G>T, NM_000275.2:c.157delA, NM_000275.2:c.1182G>A, NM_000275.2:c.1182+2T>C, NM_000275.2:c.1441G>A, NM_000275.2:c.79G>A, NM_000275.2:c.1465A>G, NM_000275.2:c.1327G>A, NM_000275.2:c.1364+1G>T	Oculocutaneous albinism type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OCA2 gene located on chromosomal region 15q12-q13. The age of onset is infantile. This disease is characterized by variable hypopigmentation of the skin and hair, numerous characteristic ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1/38,000-1/40,000	250,600
OCRL	Lowe syndrome	NM_000276.3	NM_000276.3:c.2299C>T, NM_000276.3:c.909_910delAG, NM_000276.3:c.2535delA, NM_000276.3:c.2403dupA, NM_000276.3:c.1499G>A, NM_000276.3:c.2530C>T	Lowe syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the OCRL gene located on chromosomal region Xq25-q26. The age of onset is infantile. This disease is characterized by proximal tubule dysfunction, hypercalcinuria, mild intellectual impairment, hypotonia and sub-clinical cataract. The prevalence is 1:100,000-10:100,000 newborn.	600
OFD1	Joubert syndrome type 10	NM_003611.2	NM_003611.2:c.2582dupT, NM_003611.2:c.2321_2322insT, NM_003611.2:c.277G>T	Joubert syndrome type 10 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the OFD1 gene located on chromosomal region Xp22.2. The age of onset is early. A disorder presenting with cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy and renal disease.	600
OFD1	Orofaciodigital syndrome type 1	NM_003611.2	NM_003611.2:c.43_44delAG, NM_003611.2:c.52G>T, NM_003611.2:c.65dupA, NM_003611.2:c.221C>T, NM_003611.2:c.274T>C, NM_003611.2:c.616_617delGA, NM_003611.2:c.260A>G, NM_003611.2:c.13-10T>A, NM_003611.2:c.312+1delG, NM_003611.2:c.224A>C, NM_003611.2:c.294_312delTGGTTTGGCAAAAGAAAAG, NM_003611.2:c.62_63insT, NM_003611.2:c.275_276delCT, NM_003611.2:c.614_617delGAGA, NM_003611.2:c.225C>G, NM_003611.2:c.602delA, NM_003611.2:c.628C>T, NM_003611.2:c.653delA, NM_003611.2:c.1365_1368delACAA, NM_003611.2:c.619_624delATAGAA, NM_003611.2:c.1303A>C, NM_003611.2:c.1318delC, NM_003611.2:c.654+2_654+3delTA, NM_003611.2:c.1268_1272delAAAAC, NM_003611.2:c.1323_1326delAGAA, NM_003611.2:c.1360_1363delCTTA, NM_003611.2:c.1358T>A, NM_003611.2:c.1840delG, NM_003611.2:c.1612C>T, NM_003611.2:c.1757delG, NM_003611.2:c.1821delG, NM_003611.2:c.1319delT, NM_003611.2:c.1859_1860delCCinsG, NM_003611.2:c.2261-1G>T, NM_003611.2:c.235G>A, NM_003611.2:c.607_610delTATA, NM_003611.2:c.594_598delAAAGC, NM_003611.2:c.247C>T, NM_003611.2:c.2387+1G>C, NM_003611.2:c.290A>G, NM_003611.2:c.454C>T, NM_003611.2:c.312+2_312+7delTAAAGT, NM_003611.2:c.413-10T>G, NM_003611.2:c.2349delC, NM_003611.2:c.518-1G>A, NM_003611.2:c.1322_1326delAAGAA, NM_003611.2:c.541dupG, NM_003611.2:c.243C>G, NM_003611.2:c.241C>G	Orofaciodigital syndrome type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the OFD1 gene located on chromosomal region Xp22.2. It is a group of heterogeneous disorders characterized by abnormalities in the oral cavity, face, and digits and associated phenotypic abnormalities that lead to the delineation of various subtypes. OFD1 is X-linked dominant syndrome, lethal in males. Craniofacial findings consist of facial asymmetry, hypertelorism, median cleft, or pseudocleft of the upper lip, hypoplasia of the alae nasi, oral clefts and abnormal frenulea, tongue anomalies (clefting, cysts, hamartoma), and anomalous dentition involving missing or extra teeth. Asymmetric brachydactyly and/or syndactyly of the fingers and toes occur frequently. Approximately 50% of OFD1 females have some degree of intellectual disability. Some patients have structural central nervous system anomalies such as agenesis of the corpus callosum, cerebellar agenesis, or a Dandy-Walker malformation. Patients with OFD1 can develop fibrocystic disease of the liver and pancreas, in addition to polycystic kidneys.	600
OPA3	3-methylglutaconic aciduria type 3	NM_025136.3	NM_025136.3:c.*24136delG, NM_025136.3:c.221delG	3-methylglutaconic aciduria type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OPA3 gene located on chromosomal region 19q13.32. The age of onset is infantile. This disease is characterized by the association of optic atrophy and choreoathetosis with 3-methylglutaconic aciduria. The prevalence is 1:10,000-5:10,000.	600
OSTM1	Osteopetrosis type 5, autosomal recessive	NM_014028.3	NM_014028.3:c.415_416delAG	Osteopetrosis, autosomal recessive type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OSTM1 gene located on chromosomal region 6p21. The age of onset is infantile. This disease is characterized by osteopetrosis, agenesis del cuerpo calloso, atrofia cerebral e hipocampo pequeño.	600
OTC	Ornithine transcarbamylase deficiency	NM_000531.5	NM_000531.5:c.119G>A, NM_000531.5:c.259G>A, NM_000531.5:c.118C>T, NM_000531.5:c.617T>G, NM_000531.5:c.646C>G, NM_000531.5:c.148G>T, NM_000531.5:c.589G>T, NM_000531.5:c.77G>A, NM_000531.5:c.829C>T, NM_000531.5:c.674C>T, NM_000531.5:c.717+2T>C, NM_000531.5:c.563G>T, NM_000531.5:c.275G>A, NM_000531.5:c.245T>G, NM_000531.5:c.460G>T, NM_000531.5:c.134T>C, NM_000531.5:c.332T>C, NM_000531.5:c.238A>G, NM_000531.5:c.421C>T	Ornithine transcarbamylase deficiency follows an X-linked pattern of inheritance and is caused by pathogenic variants in the OTC gene located on chromosomal region Xp11.4. The age of onset is infantile. This disease is characterized by severe neonatal hyperammonemic coma that generally proves to be fatal, in males. Females may be also affected by symptoms with various degrees of intensity, ranging from dislike for proteins to chronic vomiting, growth retardation, hypotonia, psychomotor retardation, hyperammonemic coma, or psychiatric disorders. The prevalence is 1:80,000.	600
OTOA	Deafness type 22, autosomal recessive	NM_144672.3	NM_144672.3:c.2301+1G>T, NM_144672.3:c.2359G>T, NM_144672.3:c.121-1G>A, NM_144672.3:c.827delT, NM_144672.3:c.1725_1726delCA	Deafness, autosomal recessive type 22 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOA gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems.	250,600
OTOF	Deaffness type 9, autosomal recessive	NM_194248.2	NM_194248.2:c.149G>A, NM_194248.2:c.1867G>A, NM_194248.2:c.1669G>A, NM_194248.2:c.2381G>A, NM_194248.2:c.1498C>T, NM_194248.2:c.1544T>C, NM_194248.2:c.5473C>G, NM_194248.2:c.1150G>A, NM_194248.2:c.1778delT, NM_194248.2:c.5103+2T>A, NM_194248.2:c.227+2T>C, NM_194248.2:c.5474_5475delCC, NM_194248.2:c.5332G>A, NM_194248.2:c.584-1G>C, NM_194248.2:c.98G>A, NM_194248.2:c.2348delG, NM_194248.2:c.3032T>C, NM_194248.2:c.4559G>A, NM_194248.2:c.4491T>A, NM_194248.2:c.5816G>A, NM_194248.2:c.766-2A>G, NM_194248.2:c.2485C>T, NM_194248.2:c.2401G>T	Deaffness, autosomal recessive type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems.	250,600
PAH	Phenylketonuria	NM_000277.1	NM_000277.1:c.1139C>T, NM_000277.1:c.1066-3C>T, NM_000277.1:c.117C>G, NM_000277.1:c.1166delC, NM_000277.1:c.1068C>A, NM_000277.1:c.1315+1G>A, NM_000277.1:c.1162G>A, NM_000277.1:c.143T>C, NM_000277.1:c.1243G>A, NM_000277.1:c.1169A>G, NM_000277.1:c.136G>A, NM_000277.1:c.1184C>A, NM_000277.1:c.194T>C, NM_000277.1:c.1199+17G>A, NM_000277.1:c.232G>A, NM_000277.1:c.1045T>C, NM_000277.1:c.1197A>T, NM_000277.1:c.441+1G>A, NM_000277.1:c.442-1G>A, NM_000277.1:c.442-5C>G, NM_000277.1:c.450_451insA, NM_000277.1:c.472C>T, NM_000277.1:c.204A>T, NM_000277.1:c.482T>C, NM_000277.1:c.250G>T, NM_000277.1:c.261C>A, NM_000277.1:c.1030G>A, NM_000277.1:c.1199+1G>A, NM_000277.1:c.1238G>C, NM_000277.1:c.1241A>G, NM_000277.1:c.673C>G, NM_000277.1:c.688G>A, NM_000277.1:c.721C>T, NM_000277.1:c.722delG, NM_000277.1:c.722G>A, NM_000277.1:c.727C>T, NM_000277.1:c.728G>A, NM_000277.1:c.733G>C, NM_000277.1:c.734T>C, NM_000277.1:c.737C>A, NM_000277.1:c.745C>T, NM_000277.1:c.1042C>G, NM_000277.1:c.638T>C, NM_000277.1:c.764T>C, NM_000277.1:c.782G>A, NM_000277.1:c.806delT, NM_000277.1:c.809G>A, NM_000277.1:c.814G>T, NM_000277.1:c.818C>T, NM_000277.1:c.823C>T, NM_000277.1:c.829T>G, NM_000277.1:c.898G>T, NM_000277.1:c.912+1G>A, NM_000277.1:c.284_286delTCA, NM_000277.1:c.754C>T, NM_000277.1:c.755G>A, NM_000277.1:c.357delC, NM_000277.1:c.1217T>C, NM_000277.1:c.1222C>T, NM_000277.1:c.157C>T, NM_000277.1:c.158G>A, NM_000277.1:c.165T>G, NM_000277.1:c.473G>A, NM_000277.1:c.490A>G, NM_000277.1:c.503delA, NM_000277.1:c.508C>G, NM_000277.1:c.533A>G, NM_000277.1:c.665A>G, NM_000277.1:c.838G>A, NM_000277.1:c.842+5G>A, NM_000277.1:c.896T>G, NM_000277.1:c.320A>G, NM_000277.1:c.441+5G>T, NM_000277.1:c.311C>A, NM_000277.1:c.527G>T, NM_000277.1:c.529G>A, NM_000277.1:c.47_48delCT, NM_000277.1:c.1208C>T, NM_000277.1:c.331C>T, NM_000277.1:c.926C>T, NM_000277.1:c.955G>T, NM_000277.1:c.926C>A, NM_000277.1:c.509+1G>A, NM_000277.1:c.1033G>T, NM_000277.1:c.611A>G, NM_000277.1:c.1066-11G>A, NM_000277.1:c.569T>C	Phenylketonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAH gene located on chromosomal region 12q23.2. The age of onset is neonatal. This disease is characterized by gradual developmental delay, stunted growth, microcephaly, seizures, tremors, eczema, vomiting, and musty odor. Untreated patients subsequently develop intellectual disability, behavioral disorders (hyperactivity) and motor disorders. The prevalence is 1:2,600-1:200,000.	250,600
PALB2	Fanconi anemia, complementation group N	NM_024675.3	NM_024675.3:c.1882_1890delAAGTCCTGC, NM_024675.3:c.2962C>T, NM_024675.3:c.50T>G, NM_024675.3:c.3116delA, NM_024675.3:c.3287A>G, NM_024675.3:c.3549C>G, NM_024675.3:c.3113G>A, NM_024675.3:c.2816T>G, NM_024675.3:c.1240C>T, NM_024675.3:c.557_558insA	Fanconi anemia, complementation group N follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PALB2 gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:1,000,000-9:1,000,000.	250,600
PANK2	Pantothenate kinase-associated neurodegeneration	NM_153638.2	NM_153638.2:c.1561G>A, NM_153638.2:c.688G>A, NM_153638.2:c.790C>T, NM_153638.2:c.821_822delCT, NM_153638.2:c.1583C>T, NM_153638.2:c.1211A>T	Pantothenate kinase-associated neurodegeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PANK2 gene located on chromosomal region 20p13. The age of onset is infantile. This disease is characterized by progressive extrapyramidal dysfunction (dystonia, rigidity, choreoathetosis), iron accumulation on the brain and axonal spheroids in the central nervous system. The prevalence is 1-2/1,000,000.	250,600
PAX3	Waardenburg syndrome type 3	NM_181457.3	NM_181457.3:c.268T>C, NM_181457.3:c.251C>T	Waardenburg syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAX3 gene located on chromosomal region 2q36.1. The age of onset is infantile. This disease is characterized by limb anomalies in association with congenital hearing loss, minor defects in structures arising from neural crest resulting in pigmentation anomalies of eyes, hair, and skin.	600
PAX6	Aniridia	NM_000280.4	NM_000280.4:c.1032+3A>T, NM_000280.4:c.978_979delCA, NM_000280.4:c.949C>T, NM_000280.4:c.1124C>A, NM_000280.4:c.1032+3_1032+6delAAGT, NM_000280.4:c.917-2A>T, NM_000280.4:c.1000_1001insTGGCATATAACCT, NM_000280.4:c.891delA, NM_000280.4:c.889dupC, NM_000280.4:c.890_905delAACCAATTCCACAACC, NM_000280.4:c.921_924dupCTCC, NM_000280.4:c.888C>G, NM_000280.4:c.887dupA, NM_000280.4:c.889C>T, NM_000280.4:c.888C>A, NM_000280.4:c.868_871dupAGTT, NM_000280.4:c.847_854dupAGTCATAT, NM_000280.4:c.879dupC, NM_000280.4:c.875G>T, NM_000280.4:c.839delA, NM_000280.4:c.829C>T, NM_000280.4:c.818delA, NM_000280.4:c.844_845delCC, NM_000280.4:c.812_813delTG, NM_000280.4:c.808A>T, NM_000280.4:c.799A>T, NM_000280.4:c.818dupA, NM_000280.4:c.794G>A, NM_000280.4:c.781C>T, NM_000280.4:c.775dupT, NM_000280.4:c.795G>A, NM_000280.4:c.1031A>G, NM_000280.4:c.1016_1019delATAA, NM_000280.4:c.1017delT, NM_000280.4:c.766-1G>C, NM_000280.4:c.766-2delA, NM_000280.4:c.760_765+9delATACAGGTACCGAGA, NM_000280.4:c.765G>C, NM_000280.4:c.765G>T, NM_000280.4:c.763C>T, NM_000280.4:c.742_752delGATCTACCTGA, NM_000280.4:c.745delC, NM_000280.4:c.916+2T>G, NM_000280.4:c.847_848dupAG, NM_000280.4:c.916+1G>C, NM_000280.4:c.689delA, NM_000280.4:c.683-2A>C, NM_000280.4:c.683-5_683-4delTTinsAAC, NM_000280.4:c.683-6T>A, NM_000280.4:c.683-9C>G, NM_000280.4:c.682+2T>A, NM_000280.4:c.673delC, NM_000280.4:c.668delA, NM_000280.4:c.656_665delAAGAGCAAAT, NM_000280.4:c.661C>T, NM_000280.4:c.658G>T, NM_000280.4:c.655C>T, NM_000280.4:c.646T>C, NM_000280.4:c.642A>C, NM_000280.4:c.639_640delTA, NM_000280.4:c.640A>G, NM_000280.4:c.640A>T, NM_000280.4:c.631C>T, NM_000280.4:c.623G>A, NM_000280.4:c.622C>T, NM_000280.4:c.613C>T, NM_000280.4:c.607C>T, NM_000280.4:c.601C>T, NM_000280.4:c.595G>T, NM_000280.4:c.580G>T, NM_000280.4:c.773T>C, NM_000280.4:c.771G>A, NM_000280.4:c.770G>A, NM_000280.4:c.766-1G>A, NM_000280.4:c.535C>T, NM_000280.4:c.534G>T, NM_000280.4:c.532C>T, NM_000280.4:c.524-2A>G, NM_000280.4:c.520C>T, NM_000280.4:c.500_501delCGinsGA, NM_000280.4:c.490_500delCCGGGGACTTCinsTCGGTA, NM_000280.4:c.500C>A, NM_000280.4:c.495delG, NM_000280.4:c.491delC, NM_000280.4:c.489T>G, NM_000280.4:c.480delT, NM_000280.4:c.475delC, NM_000280.4:c.470delG, NM_000280.4:c.468G>A, NM_000280.4:c.467G>A, NM_000280.4:c.464delG, NM_000280.4:c.459dupC, NM_000280.4:c.454C>T, NM_000280.4:c.450delC, NM_000280.4:c.432dupT, NM_000280.4:c.428_431delATGA, NM_000280.4:c.406C>T, NM_000280.4:c.403C>T, NM_000280.4:c.402delG, NM_000280.4:c.397G>T, NM_000280.4:c.383G>C, NM_000280.4:c.382C>T, NM_000280.4:c.366_379delAATAAACAGAGTTC, NM_000280.4:c.377T>A, NM_000280.4:c.375_376delAG, NM_000280.4:c.370_373delAACA, NM_000280.4:c.371delA, NM_000280.4:c.362_368dupCATCAAT, NM_000280.4:c.365C>A, NM_000280.4:c.362C>T, NM_000280.4:c.361T>C, NM_000280.4:c.358-1G>A, NM_000280.4:c.358-1G>C, NM_000280.4:c.357_357+5delCGTAAG, NM_000280.4:c.357+5G>A, NM_000280.4:c.357+2dupT, NM_000280.4:c.357+1G>A, NM_000280.4:c.357+1G>C, NM_000280.4:c.357+1G>T, NM_000280.4:c.349_357delATACCAAGC, NM_000280.4:c.339_357dupCAACGATAACATACCAAGC, NM_000280.4:c.353_357dupCAAGC, NM_000280.4:c.357C>G, NM_000280.4:c.357C>A, NM_000280.4:c.343_356dupGATAACATACCAAG, NM_000280.4:c.342_355delCGATAACATACCAA, NM_000280.4:c.350_354dupTACCA, NM_000280.4:c.353C>G, NM_000280.4:c.353C>A, NM_000280.4:c.348delC, NM_000280.4:c.344delA, NM_000280.4:c.331delG, NM_000280.4:c.331dupG, NM_000280.4:c.316_326delTTACTGTCCGA, NM_000280.4:c.316_326delTTACTGTCCGAinsCCCCCCGTT, NM_000280.4:c.325_326delGAinsCAG, NM_000280.4:c.325G>T, NM_000280.4:c.317T>A, NM_000280.4:c.307C>T, NM_000280.4:c.301delG, NM_000280.4:c.300G>A, NM_000280.4:c.299G>A, NM_000280.4:c.295G>C, NM_000280.4:c.284dupC, NM_000280.4:c.277G>A, NM_000280.4:c.277G>T, NM_000280.4:c.270delT, NM_000280.4:c.265dupC, NM_000280.4:c.265C>T, NM_000280.4:c.260T>G, NM_000280.4:c.260T>A, NM_000280.4:c.251dupT, NM_000280.4:c.236_244delCGACTCCAGinsTTGTAAGCAA, NM_000280.4:c.235_238dupGCGA, NM_000280.4:c.236_237delCGinsTTTGCTTACA, NM_000280.4:c.236C>A, NM_000280.4:c.233T>C, NM_000280.4:c.215_228delGTGGTAGTAAACCG, NM_000280.4:c.222_228dupTAAACCG, NM_000280.4:c.227C>G, NM_000280.4:c.220A>G, NM_000280.4:c.218G>A, NM_000280.4:c.215dupG, NM_000280.4:c.214G>A, NM_000280.4:c.210_213delAATCinsGGTAGTACACCCAG, NM_000280.4:c.202C>T, NM_000280.4:c.199A>T, NM_000280.4:c.191G>T, NM_000280.4:c.181_189delTACGAGACTinsCA, NM_000280.4:c.184_188dupGAGAC, NM_000280.4:c.187A>C, NM_000280.4:c.183delC, NM_000280.4:c.183C>A, NM_000280.4:c.177delG, NM_000280.4:c.175delA, NM_000280.4:c.170_174delTGGGC, NM_000280.4:c.164_170delAAATTCT, NM_000280.4:c.168delT, NM_000280.4:c.167T>C, NM_000280.4:c.164A>G, NM_000280.4:c.158_159delTG, NM_000280.4:c.157G>C, NM_000280.4:c.154T>C, NM_000280.4:c.142-1_153dupGGTGTCCAACGGA, NM_000280.4:c.152G>C, NM_000280.4:c.152G>T, NM_000280.4:c.151G>A, NM_000280.4:c.146C>T, NM_000280.4:c.143T>A, NM_000280.4:c.142delG, NM_000280.4:c.142-1G>T, NM_000280.4:c.555_556delGA, NM_000280.4:c.541G>T, NM_000280.4:c.539delA, NM_000280.4:c.538C>T, NM_000280.4:c.10+5G>C, NM_000280.4:c.10+3_10+4delAAinsGC, NM_000280.4:c.4delC, NM_000280.4:c.4C>T, NM_000280.4:c.3delG, NM_000280.4:c.1_2delATinsCA, NM_000280.4:c.2T>A, NM_000280.4:c.2T>G, NM_000280.4:c.1A>G, NM_000280.4:c.917-1G>C, NM_000280.4:c.736A>T, NM_000280.4:c.916+1G>A, NM_000280.4:c.711_712delGT, NM_000280.4:c.142-99A>G, NM_000280.4:c.901C>T, NM_000280.4:c.924delC, NM_000280.4:c.1032+2T>A, NM_000280.4:c.917-1G>A, NM_000280.4:c.142-3C>G, NM_000280.4:c.142-117T>A, NM_000280.4:c.1032+1G>A, NM_000280.4:c.718C>T, NM_000280.4:c.142-2A>G	Aniridia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAX6 gene located on chromosomal region 11p13. The age of onset is infantile. A congenital, bilateral, panocular disorder characterized by complete absence of the iris or extreme iris hypoplasia. Aniridia is not just an isolated defect in iris development but it is associated with macular and optic nerve hypoplasia, cataract, corneal changes, nystagmus. Visual acuity is generally low but is unrelated to the degree of iris hypoplasia. Glaucoma is a secondary problem causing additional visual loss over time.	600
PC	Pyruvate carboxylase deficiency	NM_000920.3	NM_000920.3:c.434T>C, NM_000920.3:c.1748G>T, NM_000920.3:c.496G>A	Pyruvate carboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PC gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by metabolic acidosis, failure to thrive, developmental delay, and recurrent seizures. The prevalence is 1:250,000.	250,600
PCCA	Propionic acidemia type 1	NM_000282.3	NM_000282.3:c.1598_1601delTTGT, NM_000282.3:c.412G>A, NM_000282.3:c.1226_1227delTT, NM_000282.3:c.1891G>C, NM_000282.3:c.1899+1_1899+4delGTAA, NM_000282.3:c.1284+1G>A, NM_000282.3:c.229C>T, NM_000282.3:c.1023dupT, NM_000282.3:c.600+1G>A, NM_000282.3:c.261_262insT, NM_000282.3:c.1118T>A, NM_000282.3:c.862A>T	Propionic acidemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCA gene located on chromosomal region 13q32.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000.	250,600
PCCB	Propionic acidemia type 2	NM_000532.4	NM_000532.4:c.1279_1291delGTTCCCinsAA, NM_000532.4:c.1283C>T, NM_000532.4:c.337C>T, NM_000532.4:c.1538_1540dupCCC, NM_000532.4:c.990dupT, NM_000532.4:c.1304A>G, NM_000532.4:c.1228C>T, NM_000532.4:c.1229_1230insT, NM_000532.4:c.1606A>G, NM_000532.4:c.1223_1226delTCAT, NM_000532.4:c.1490C>T, NM_000532.4:c.1534C>T, NM_000532.4:c.1173_1174insT, NM_000532.4:c.1540_1541insCCC, NM_000532.4:c.331C>T, NM_000532.4:c.683C>T, NM_000532.4:c.797G>T, NM_000532.4:c.737G>T, NM_000532.4:c.1218_1231delinsTAGAGCACAGGA, NM_000532.4:c.502G>A, NM_000532.4:c.562G>A, NM_000532.4:c.1219_1224delGGCATCinsAA	Propionic acidemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCB gene located on chromosomal region 3q22.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy.. The prevalence is 1:100,000.	250,600
PCDH15	Usher syndrome type 1F	NM_033056.3	NM_033056.3:c.1583T>A, NM_033056.3:c.4885delA, NM_033056.3:c.4961_4962insTGAT, NM_033056.3:c.5659A>T, NM_033056.3:c.4937_4940dupTGAT, NM_033056.3:c.785G>A, NM_033056.3:c.5622_5624delAAC, NM_033056.3:c.400C>T, NM_033056.3:c.5724_5755delACGCACAAATGTTTCAGAACTTCAAACTATGT, NM_033056.3:c.4864delA, NM_033056.3:c.1737C>G, NM_033056.3:c.1021C>T, NM_033056.3:c.1088delT, NM_033056.3:c.1006C>T, NM_033056.3:c.1940C>G, NM_033056.3:c.400C>G, NM_033056.3:c.3718-2A>G, NM_033056.3:c.4548_4551dupATCT, NM_033056.3:c.7C>T, NM_033056.3:c.2645_2646delAT	Usher syndrome type 1F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCDH15 gene located on chromosomal region 10q21.1. The age of onset is early. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 4.4:100,000.	250,600
PDE6A	Retinitis pigmentosa type 43	NM_000440.2	NM_000440.2:c.1683G>A, NM_000440.2:c.1113+1G>T, NM_000440.2:c.718-4_718-3insT, NM_000440.2:c.1749C>G, NM_000440.2:c.2053G>A, NM_000440.2:c.1560_1561insA, NM_000440.2:c.304C>A, NM_000440.2:c.1040C>T, NM_000440.2:c.1113+1G>A	Retinitis pigmentosa 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	250,600
PDE6B	Retinitis pigmentosa type 43	NM_000283.3	NM_000283.3:c.1580T>C, NM_000283.3:c.655T>C, NM_000283.3:c.1540delC, NM_000283.3:c.1572delC, NM_000283.3:c.1920+2T>C, NM_000283.3:c.1669C>T, NM_000283.3:c.892C>T	Retinitis pigmentosa 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	250,600
PDE6C	Cone dystrophy type 4	NM_006204.3	NM_006204.3:c.1682dupA, NM_006204.3:c.1805A>T, NM_006204.3:c.2283+1G>C, NM_006204.3:c.256_257insAG, NM_006204.3:c.1066G>T, NM_006204.3:c.881G>A, NM_006204.3:c.481-12T>A, NM_006204.3:c.1363A>G, NM_006204.3:c.2457T>A, NM_006204.3:c.826C>T, NM_006204.3:c.633G>C, NM_006204.3:c.2036+1G>T, NM_006204.3:c.85C>T, NM_006204.3:c.180_186delCCTGTGC	Progressive cone dystrophy 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6C gene located on chromosomal region 10q23.33. The age of onset is infantile. This disease is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, eccentric fixation, and reduced or complete loss of color discrimination.	600
PDE6G	Retinitis pigmentosa type 57	NM_002602.3	NM_002602.3:c.187+1G>T	Retinitis pigmentosa type 57 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6G gene located on chromosomal region 17q25.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife.	600
PDHA1	Pyruvate dehydrogenase E1-alpha deficiency	NM_000284.3	NM_000284.3:c.262C>T, NM_000284.3:c.787C>G, NM_000284.3:c.871G>A, NM_000284.3:c.773A>C	Pyruvate dehydrogenase E1-alpha deficiency follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PDHA1 gene located on chromosomal region Xp22.12. The age of onset is variable. This disease is characterized by primary lactic acidosis in children. It is associated with a broad clinical spectrum ranging from fatal lactic acidosis in the newborn to chronic neurologic dysfunction with structural abnormalities in the central nervous system without systemic acidosis.The prevalence is >1:40,000 newborn.	600
PDP1	Pyruvate dehydrogenase phosphatase deficiency	NM_018444.3	NM_018444.3:c.597_601delCTTTA, NM_018444.3:c.1606C>T, NM_018444.3:c.277G>T, NM_018444.3:c.803delC, NM_018444.3:c.669_673delTTACT, NM_018444.3:c.672_676delCTTTA, NM_018444.3:c.878delC, NM_018444.3:c.851_853delTTC	Pyruvate dehydrogenase phosphatase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDP1 gene located on chromosomal region 8q22.1. The age of onset is neonatal. This disease is characterized by lactic acidosis and hypotonia.	600
PDSS1	Coenzyme Q10 deficiency, primary, type 2	NM_014317.3	NM_014317.3:c.319dupT, NM_014317.3:c.924T>G	Coenzyme Q10 deficiency, primary, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDSS1 gene located on chromosome 10p12.1. The age of onset is neonatal/infantile. This disease is characterized by multisystem disorder with early-onset deafness, optic atrophy, mild mental retardation, peripheral neuropathy, obesity and cardiac valvulopathy.	600
PDSS2	Coenzyme Q10 deficiency, primary, type 3	NM_020381.3	NM_020381.3:c.964C>T, NM_020381.3:c.129_130insC, NM_020381.3:c.1145C>T	Coenzyme Q10 deficiency, primary, type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDSS2 gene located on chromosomal region 6q21. The age of onset is infantile. This disease is characterized by onset of symptoms typically between age three and 12 months, often following a viral infection. Neurologic features include hypotonia, spasticity, movement disorders, cerebellar ataxia, and peripheral neuropathy.	600
PDX1	Pancreatic agenesis	NM_000209.3	NM_000209.3:c.532G>A, NM_000209.3:c.533A>G, NM_000209.3:c.492G>T	Pancreatic agenesis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDX1 gene located on chromosomal region 13q12.1. The age of onset is infantile. This disease is characterized by the congenital absence of a critical mass of pancreatic tissue, pancreaticobiliary duct anomalies, leading to acute or chronic pancreatitis, hyperglycemia (50% of cases) and polysplenia.	600
PDZD7	Usher syndrome type 2C	NM_001195263.1	NM_001195263.1:c.1543C>T, NM_001195263.1:c.166_167insC, NM_001195263.1:c.2107delA, NM_001195263.1:c.144_145insA	Usher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR98 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32 respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000.	600
PEX1	Peroxisome biogenesis disorder type 1A	NM_000466.2	NM_000466.2:c.2097dupT, NM_000466.2:c.2916delA, NM_000466.2:c.1842delA, NM_000466.2:c.1991T>C, NM_000466.2:c.1239+1G>T	Peroxisome biogenesis disorder type 1A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. The age of onset is early. This disease is characterized by neuronal migration defects in the brain, dysmorphic craniofacial features, profound hypotonia, neonatal seizures, and liver dysfunction. The prevalence is 1:1,000,000.	250,600
PEX1	Peroxisome biogenesis disorder type 1B	NM_000466.2	NM_000466.2:c.2097_2098insT, NM_000466.2:c.1952_1960dupCAGTGTGGA, NM_000466.2:c.877C>T, NM_000466.2:c.3505_3517delCAGTTGTTTTCAC, NM_000466.2:c.2528G>A	Peroxisome biogenesis disorder type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. The age of onset is early. This disease includes neonatal adrenoleukodystrophy and infantile Refsum disease, two milder manifestations of the Zellweger disease spectrum. The clinical course of patients is variable and may include developmental delay, hypotonia, liver dysfunction, sensorineural hearing loss, retinal dystrophy and vision impairment.	250,600
PEX12	Peroxisome biogenesis disorder complementation group 6	NM_000286.2	NM_000286.2:c.959C>T, NM_000286.2:c.894delC, NM_000286.2:c.888_889delCT, NM_000286.2:c.538C>T, NM_000286.2:c.455_459dupGGAAA, NM_000286.2:c.771delC	Peroxisome biogenesis disorder complementation group 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX12 gene located on chromosomal region 17q12. The age of onset is early. This is a peroxisomal disorder arising from a failure of protein import into the peroxisomal membrane or matrix. The peroxisome biogenesis disorders are genetically heterogeneous with at least 14 distinct genetic groups as concluded from complementation studies. Include disorders are: Zellweger syndrome, neonatal adrenoleukodystrophy, infantile Refsum disease, and classical rhizomelic chondrodysplasia punctata.	600
PEX2	Peroxisome biogenesis disorder complementation group 5	NM_000318.2	NM_000318.2:c.163G>A, NM_000318.2:c.789_790delCT	Peroxisome biogenesis disorder complementation group 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX2 gene located on chromosomal region 8q21.11. The age of onset is early. This is a peroxisomal disorder arising from a failure of protein import into the peroxisomal membrane or matrix. The peroxisome biogenesis disorders are genetically heterogeneous with at least 14 distinct genetic groups as concluded from complementation studies. Include disorders are: Zellweger syndrome, neonatal adrenoleukodystrophy, infantile Refsum disease, and classical rhizomelic chondrodysplasia punctata.	600
PEX26	Peroxisome biogenesis disorder type 7	NM_017929.5	NM_017929.5:c.292C>T, NM_017929.5:c.254dupT, NM_017929.5:c.265G>A, NM_017929.5:c.353C>G	Peroxisome biogenesis disorder complementation group 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX26 gene located on chromosomal region 22q11.21. The age of onset is early. This is a peroxisomal disorder arising from a failure of protein import into the peroxisomal membrane or matrix. The peroxisome biogenesis disorders are genetically heterogeneous with at least 14 distinct genetic groups as concluded from complementation studies. Include disorders are: Zellweger syndrome, neonatal adrenoleukodystrophy, infantile Refsum disease, and classical rhizomelic chondrodysplasia punctata. The prevalence is 1:1,000,000.	600
PEX5	Peroxisome biogenesis disorder type 2	NM_001131025.1	NM_001131025.1:c.1578T>G, NM_001131025.1:c.1279C>T, NM_001131025.1:c.*20G>C	Peroxisome biogenesis disorder complementation group 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX26 gene located on chromosomal region 22q11.21. The age of onset is early. This is a peroxisomal disorder arising from a failure of protein import into the peroxisomal membrane or matrix. The peroxisome biogenesis disorders are genetically heterogeneous with at least 14 distinct genetic groups as concluded from complementation studies. Include disorders are: Zellweger syndrome, neonatal adrenoleukodystrophy, infantile Refsum disease, and classical rhizomelic chondrodysplasia punctata. The prevalence is 1:1,000,000.	600
PEX7	Rhizomelic chondrodysplasia punctata type 1	NM_000288.3	NM_000288.3:c.694C>T, NM_000288.3:c.649G>A, NM_000288.3:c.618G>A, NM_000288.3:c.722A>T, NM_000288.3:c.875T>A, NM_000288.3:c.653C>T, NM_000288.3:c.854A>G, NM_000288.3:c.532C>T, NM_000288.3:c.903+1G>C	Rhizomelic chondrodysplasia punctata type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX7 gene located on chromosomal region 6q23.3. The age of onset is early. This disease is characterized by proximal shortening of the humerus and to a lesser degree the femur (rhizomelia), punctate calcifications in cartilage with epiphyseal and metaphyseal abnormalities (chondrodysplasia punctata), coronal clefts of the vertebral bodies, cataracts, postnatal growth deficiency is profound, intellectual disability is severe, seizures. The prevalence is <1:100,000.	250,600
PGM1	Congenital disorder of glycosylation, type 1T	NM_002633.2	NM_002633.2:c.343A>G, NM_002633.2:c.361G>C, NM_002633.2:c.1507C>T, NM_002633.2:c.300+1G>A, NM_002633.2:c.787G>T	Congenital disorder of glycosylation, type 1T follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PGM1 gene located on chromosomal region 1p31.3. The age of onset is infantile. It is a multisystem disorder caused by a defect in glycoprotein biosynthesis and characterized by under-glycosylated serum glycoproteins. Congenital disorders of glycosylation result in a wide variety of clinical features, such as defects in the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. The prevalence is <1:1,000,000.	600
PHKG2	Glycogen storage disease type 9C	NM_000294.2	NM_000294.2:c.958C>T, NM_000294.2:c.553C>T, NM_000294.2:c.130C>T, NM_000294.2:c.393-2A>G	Glycogen storage disease type 9C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHKG2 gene located on chromosomal region 16p12.1-p11.2. The age of onset is infantile. This disease is characterized by hepatomegaly, growth retardation, and mild delay in motor development during childhood. The incidence is <1:100.000 births.	600
PHYH	Refsum disease	NM_006214.3	NM_006214.3:c.135-2A>G, NM_006214.3:c.497-2A>G, NM_006214.3:c.135-1G>C, NM_006214.3:c.805A>C, NM_006214.3:c.678+5G>T, NM_006214.3:c.823C>T, NM_006214.3:c.530A>G, NM_006214.3:c.164delT, NM_006214.3:c.678+2T>G, NM_006214.3:c.824G>A	Refsum disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHYH gene located on chromosomal region 10p13. The age of onset is variable. This disease is characterized by hemeralopia (loss of vision in the dark), followed by episods of chronic distal motor polyneuropathy. Other associated signs include perceptive deafness, anosmia, cerebellous ataxia and sometimes, severe intellectual deficiency. Over the course of time cutaneous signs appear (ichtyosis), along with polyepiphyseal dysplasia, myocardiopathy, elevated protein in cerebrospinal fluid, and pigmentary retinitis that may result in blindness. The prevalence is 1:1.000,000-9:1.000,000.	250,600
PKHD1	Polycystic kidney disease, autosomal recessive	NM_138694.3	NM_138694.3:c.10515C>A, NM_138694.3:c.11363_11372delCTTCCCTGGA, NM_138694.3:c.10585G>C, NM_138694.3:c.107C>T, NM_138694.3:c.10452dupT, NM_138694.3:c.2452C>T, NM_138694.3:c.2747A>C, NM_138694.3:c.12027C>G, NM_138694.3:c.11284C>A, NM_138694.3:c.3367G>A, NM_138694.3:c.353delG, NM_138694.3:c.2827_2828delGA, NM_138694.3:c.2854G>A, NM_138694.3:c.1342G>C, NM_138694.3:c.1409G>A, NM_138694.3:c.11611T>C, NM_138694.3:c.3761_3762delCCinsG, NM_138694.3:c.2414C>T, NM_138694.3:c.5895_5896insA, NM_138694.3:c.5895dupA, NM_138694.3:c.6499C>T, NM_138694.3:c.664A>G, NM_138694.3:c.682A>G, NM_138694.3:c.6854G>A, NM_138694.3:c.370C>T, NM_138694.3:c.8407T>C, NM_138694.3:c.3766delC, NM_138694.3:c.3940delA, NM_138694.3:c.1486C>T, NM_138694.3:c.2341C>T, NM_138694.3:c.10219C>T, NM_138694.3:c.9107T>G, NM_138694.3:c.930delC, NM_138694.3:c.9370C>T, NM_138694.3:c.9530T>C, NM_138694.3:c.9689delA, NM_138694.3:c.982C>T, NM_138694.3:c.9866G>T, NM_138694.3:c.10036T>C, NM_138694.3:c.3229-2A>C, NM_138694.3:c.4870C>T, NM_138694.3:c.4165C>A, NM_138694.3:c.9719G>A, NM_138694.3:c.5325_5326delAG, NM_138694.3:c.5498C>T, NM_138694.3:c.8824C>T, NM_138694.3:c.85G>T, NM_138694.3:c.10412T>G, NM_138694.3:c.8518C>T, NM_138694.3:c.8408G>A, NM_138694.3:c.8317G>T, NM_138694.3:c.8870T>C	Autosomal recessive polycystic kidney disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKHD1 gene located on chromosomal region 6p12.3-p12.2. The age of onset is early. This disease is characterized by the development of cysts affecting the collecting ducts. It is frequently associated with hepatic involvement. After birth, in addition to nephromegaly, arterial hypertension and urinary tract infections are common and often severe. The prevalence is 1:10,000-1:40,000.	250,600
PKLR	Hemolytic anemia due to red cell pyruvate kinase deficiency	NM_000298.5	NM_000298.5:c.1151C>T, NM_000298.5:c.1706G>A, NM_000298.5:c.1529G>A, NM_000298.5:c.1528C>T, NM_000298.5:c.1595G>A, NM_000298.5:c.721G>T, NM_000298.5:c.1076G>A, NM_000298.5:c.1675C>T, NM_000298.5:c.1261C>A, NM_000298.5:c.1436G>A, NM_000298.5:c.1456C>T	Hemolytic anemia due to red cell pyruvate kinase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKLR gene located on chromosomal region 1q22. The age of onset is early. This disease is characterized by highly variable degree of chronic hemolysis, with severe neonatal jaundice and fatal anemia at birth, severe transfusion-dependent chronic hemolysis, and moderate hemolysis with exacerbation during infection. The prevalence is 1:20,000.	250,600
PLA2G6	Infantile neuroaxonal dystrophy	NM_003560.2	NM_003560.2:c.1634A>C, NM_003560.2:c.238G>A, NM_003560.2:c.1903C>T, NM_003560.2:c.109C>T, NM_003560.2:c.1612C>T, NM_003560.2:c.2370T>G, NM_003560.2:c.929T>A, NM_003560.2:c.1894C>T, NM_003560.2:c.2239C>T	Infantile neuroaxonal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLA2G6 gene located on chromosomal region 22q13.1. The age of onset is infantile. This disease is a type of neurodegeneration with brain iron accumulation characterized by psychomotor delay and regression, increasing neurological involvement with symmetrical pyramidal tract signs and spastic tetraplegia. INAD may be classic or atypical and patients present with symptoms anywhere along a continuum between the two.	600
PLCE1	Nephrotic syndrome type 3	NM_016341.3	NM_016341.3:c.3346C>T, NM_016341.3:c.4808delA, NM_016341.3:c.3846delG, NM_016341.3:c.3736C>T, NM_016341.3:c.5560C>T, NM_016341.3:c.4451C>T, NM_016341.3:c.5669C>T, NM_016341.3:c.961C>T	Nephrotic syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLCE1 gene located on chromosomal region 10q23.33. The age of onset is variable. This disease is characterized by low blood protein levels, high cholesterol levels, high triglyceride levels, and presence of protein in the urine. The prevalence is 2:100,000-7:100,000 Children; 3:100,000 adults.	250,600
PLEC	Epidermolysis bullosa simplex with muscular dystrophy	NM_000445.4	NM_000445.4:c.6955C>T, NM_000445.4:c.9250_9251delCT, NM_000445.4:c.10971_10972delGA, NM_000445.4:c.2493+1G>C	Epidermolysis bullosa simplex with muscular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLEC gene located on chromosomal region 8q24. The age of onset is early. This disease is characterized by generalized blistering associated with muscular dystrophy, dystrophic nails, and focal keratoderma of the palms and soles. The prevalence is 1:30,000-1:50,000.	600
PLEC	Epidermolysis bullosa simplex with pyloric atresia	NM_000445.4	NM_000445.4:c.9085C>T, NM_000445.4:c.913C>T, NM_000445.4:c.906+1G>A, NM_000445.4:c.12043_12044insG, NM_000445.4:c.11446G>T	Epidermolysis bullosa simplex with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLEC gene located on chromosomal region 8q24. The age of onset is early. This disease is characterized by generalized severe blistering with widespread congenital absence of skin and pyloric atresia. The prevalence is <1:1,000,000.	600
PLEKHG5	Charcot-Marie-Tooth disease, intermediate type C	NM_020631.4	NM_020631.4:c.440-2A>G, NM_020631.4:c.3166C>T, NM_020631.4:c.1940T>C, NM_020631.4:c.2935C>T	Charcot-Marie-Tooth disease, intermediate type C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLEKHG5 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease is a disorder of the peripheral nervous system, characterized by progressive weakness and atrophy, initially of the peroneal muscles and later of the distal muscles of the arms. Recessive intermediate forms of Charcot-Marie-Tooth disease are characterized by clinical and pathologic features intermediate between demyelinating and axonal peripheral neuropathies, and motor median nerve conduction velocities ranging from 25 to 45 m/sec.	600
PLG	Congenital plasminogen deficiency type 1	NM_000301.3	NM_000301.3:c.704G>A, NM_000301.3:c.1848G>A, NM_000301.3:c.1435G>T, NM_000301.3:c.693_695delGAA, NM_000301.3:c.1120G>T, NM_000301.3:c.112A>G	Plasminogen deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLG gene located on chromosomal region 6q26. The age of onset is infantile.This disease is characterized by markedly impaired extracellular fibrinolysis leading to the formation of ligneous (fibrin-rich) pseudomembranes on mucosae during wound healing. The prevalence is 1:1,000,000-9:1,000,000.	250,600
PLOD1	Ehlers-Danlos syndrome, type 6	NM_000302.3	NM_000302.3:c.955C>T, NM_000302.3:c.2032G>A, NM_000302.3:c.1533C>G, NM_000302.3:c.1836G>C, NM_000302.3:c.2008C>T, NM_000302.3:c.466+1G>A	Ehlers-Danlos syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLOD1 gene located on chromosomal region 1p36. The age of onset is early. This disease is characterized by progressive scoliosis from birth, severe muscle hypotonia, hyperextensible joints and fragile eyeballs. The weakness can lead to ocular retinal hemorrhage, glaucoma, coloring of the sclera or even to rupture of the globe. The prevalence is <1:5,000.	600
PLP1	Pelizaeus-Merzbacher disease	NM_000533.3	NM_000533.3:c.128C>T, NM_000533.3:c.593delG, NM_000533.3:c.231_232insC, NM_000533.3:c.3G>A, NM_000533.3:c.487T>C, NM_000533.3:c.725C>T, NM_000533.3:c.737G>C, NM_000533.3:c.169G>T	Pelizaeus-Merzbacher disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PLP1 gene located on chromosomal region Xq22.2. The age of onset is infantile. It is a hypomyelinative leukodystrophy in which myelin is not formed properly in the central nervous system. It is characterized clinically by nystagmus, spastic quadriplegia, ataxia, and developmental delay.	600
PLP1	Spastic paraplegia type 2, X-linked	NM_000533.3	NM_000533.3:c.409C>T	Spastic paraplegia type 2, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PLP1 gene located on chromosomal region Xq22.2. The age of onset is infantile. This disease is characterized by spastic gait and autonomic dysfunction.	600
PMM2	Congenital disorders of glycosylation type 1a	NM_000303.2	NM_000303.2:c.349G>C, NM_000303.2:c.357C>A, NM_000303.2:c.255+2T>C, NM_000303.2:c.127G>C, NM_000303.2:c.395T>C, NM_000303.2:c.415G>A, NM_000303.2:c.368G>A, NM_000303.2:c.385G>A, NM_000303.2:c.470T>C, NM_000303.2:c.484C>T, NM_000303.2:c.422G>A, NM_000303.2:c.442G>A, NM_000303.2:c.623G>C, NM_000303.2:c.647A>T, NM_000303.2:c.652C>G, NM_000303.2:c.323C>T, NM_000303.2:c.677C>G, NM_000303.2:c.691G>A, NM_000303.2:c.710C>G, NM_000303.2:c.669C>G, NM_000303.2:c.95_96delTAinsGC, NM_000303.2:c.95T>G, NM_000303.2:c.53C>G, NM_000303.2:c.710C>T, NM_000303.2:c.620T>C, NM_000303.2:c.97C>T, NM_000303.2:c.193G>T, NM_000303.2:c.338C>T, NM_000303.2:c.563A>G, NM_000303.2:c.131T>C, NM_000303.2:c.26G>A, NM_000303.2:c.109C>T, NM_000303.2:c.317A>T, NM_000303.2:c.190delT, NM_000303.2:c.256-1G>C	Congenital disorder of glycosylation type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PMM2 gene located on chromosomal region 16p13.2. The age of onset is infantile. This disease is characterized by highly variable clinical manifestations that may include feeding problems, vomiting, and diarrhea with failure to thrive in infants, and severe encephalopathy with axial hypotonia, abnormal eye movement, marked psychomotor retardation, peripheral neuropathy, cerebellar hypoplasia, stroke-like episodes, and retinitis pigmentosa in late infancy, childhood or adulthood.	250,600
PNPO	PNPO deficiency	NM_018129.3	NM_018129.3:c.685C>T, NM_018129.3:c.674G>A	PNPO deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PNPO gene located on chromosomal region 17q21.32. The age of onset is early. This disease is characterized by onset of severe seizures within hours of birth that are not responsive to anticonvulsants.	600
POLG	Mitochondrial DNA depletion syndrome, Alpers type	NM_002693.2	NM_002693.2:c.2617G>T, NM_002693.2:c.1120C>T, NM_002693.2:c.830A>T, NM_002693.2:c.3218C>T, NM_002693.2:c.3630dupC	Mitochondrial DNA depletion syndrome, Alpers type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by the clinical triad of psychomotor regression, seizures, and liver disease. The prevalence is 1:1,600 newborn.	250,600
POLG	Progressive external ophthalmoplegia	NM_002693.2	NM_002693.2:c.1437C>G, NM_002693.2:c.2591A>G, NM_002693.2:c.1754G>A, NM_002693.2:c.1399G>A, NM_002693.2:c.1491G>C, NM_002693.2:c.3151G>C, NM_002693.2:c.803G>C, NM_002693.2:c.3286C>T, NM_002693.2:c.2794C>T, NM_002693.2:c.752C>T, NM_002693.2:c.3644-1G>A, NM_002693.2:c.1879C>T, NM_002693.2:c.2605C>T, NM_002693.2:c.911T>G, NM_002693.2:c.1760C>T, NM_002693.2:c.2542G>A, NM_002693.2:c.1550G>T, NM_002693.2:c.2557C>T, NM_002693.2:c.2207A>G, NM_002693.2:c.2243G>C, NM_002693.2:c.2209G>C	Progressive external ophthalmoplegia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by ptosis, paralysis of the extraocular muscles, oropharyngeal weakness, and variably severe proximal limb weakness.	250,600
POMGNT1	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3	NM_017739.3	NM_017739.3:c.1425G>A, NM_017739.3:c.1545delC, NM_017739.3:c.1274G>C, NM_017739.3:c.1864delC, NM_017739.3:c.1411A>T, NM_017739.3:c.1469G>A, NM_017739.3:c.1539+1G>A, NM_017739.3:c.92dupA, NM_017739.3:c.1539+1G>T, NM_017739.3:c.932G>A, NM_017739.3:c.794G>A, NM_017739.3:c.880-1G>A, NM_017739.3:c.652+1G>A, NM_017739.3:c.931C>T, NM_017739.3:c.1666G>A, NM_017739.3:c.1814G>C, NM_017739.3:c.636C>T, NM_017739.3:c.187C>T	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3 which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMGNT1 gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent psychomotor development, eye involvement and seizures. The prevalence is 1-9:100,000.	250,600
POMT1	Congenital muscular dystrophy with intellectual disability type B1	NM_007171.3	NM_007171.3:c.598G>C, NM_007171.3:c.193G>A, NM_007171.3:c.1770G>C, NM_007171.3:c.2005G>A, NM_007171.3:c.2163C>A, NM_007171.3:c.1746G>C, NM_007171.3:c.793C>T	Congenital muscular dystrophy with intellectual disability type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 gene located on chromosomal region 9q34.13. The age of onset is early. This disease is associated with mental retardation and mild structural brain abnormalities.	250,600
POMT1	Walker-Warburg syndrome	NM_007171.3	NM_007171.3:c.1540C>T, NM_007171.3:c.226G>A, NM_007171.3:c.1611C>G, NM_007171.3:c.1242-2A>G, NM_007171.3:c.907C>T, NM_007171.3:c.2163_2164insG, NM_007171.3:c.2167dupG, NM_007171.3:c.1153C>T, NM_007171.3:c.1261_1262insC, NM_007171.3:c.831C>G, NM_007171.3:c.1545C>G, NM_007171.3:c.1280_1281delAGinsTC	Walker-Warburg syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 and POMT2 genes located on chromosomal regions 9q34.13 and 14q24.3 respectively. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent or very poor psychomotor development, eye involvement and seizures. The prevalence is 1:100,000-9:100,000.	250,600
POMT2	Congenital muscular dystrophy with intellectual disability type A2	NM_013382.5	NM_013382.5:c.2243G>C, NM_013382.5:c.1997A>G, NM_013382.5:c.2242T>C, NM_013382.5:c.1445G>T, NM_013382.5:c.2177G>A, NM_013382.5:c.1238G>C, NM_013382.5:c.1941G>A, NM_013382.5:c.1057G>A, NM_013382.5:c.551C>T	Congenital muscular dystrophy with intellectual disability type A2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT2 gene located on chromosomal region 14q24.3. The age of onset is early. This disorder characterized by congenital muscular dystrophy associated with cobblestone lissencephaly and other brain anomalies, eye malformations, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease.	250,600
POMT2	Walker-Warburg syndrome	NM_013382.5	NM_013382.5:c.1726-2A>G, NM_013382.5:c.1417C>T, NM_013382.5:c.1912C>T, NM_013382.5:c.1608_1609delCA, NM_013382.5:c.1045_1052delinsG	Walker-Warburg syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 and POMT2 genes located on chromosomal regions 9q34.13 and 14q24.3 respectively. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent or very poor psychomotor development, eye involvement and seizures. The prevalence is 1:100,000-9:100,000.	250,600
POU1F1	Pituitary hormone deficiency, combined, type 1	NM_000306.3	NM_000306.3:c.472G>C, NM_000306.3:c.428G>A, NM_000306.3:c.577T>C, NM_000306.3:c.514C>T, NM_000306.3:c.515G>A, NM_000306.3:c.71C>T, NM_000306.3:c.433A>T, NM_000306.3:c.715C>T, NM_000306.3:c.515G>C, NM_000306.3:c.391G>T, NM_000306.3:c.688G>A, NM_000306.3:c.793C>T, NM_000306.3:c.748G>T, NM_000306.3:c.811C>T, NM_000306.3:c.404T>G	Pituitary hormone deficiency, combined, type 1. Genetic forms follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POU1F1 gene located on chromosomal region 3p11.2. The age of onset is early. This disease is characterized by short stature, cognitive alterations or delayed puberty. The prevalence is 1:8,000.	600
POU3F4	Deafness type 2, X-linked	NM_000307.4	NM_000307.4:c.604A>T, NM_000307.4:c.499C>T	X-linked deafness type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the POU3F4 gene located on chromosomal region Xq21.1. The age of onset is infantile. This disease is characterized by both conductive hearing loss resulting from stapes (perilymphatic gusher) fixation, and progressive sensorineural deafness.	600
PPT1	Neuronal ceroid-lipofuscinoses type 1	NM_000310.3	NM_000310.3:c.29T>A, NM_000310.3:c.223A>C, NM_000310.3:c.627+1G>T, NM_000310.3:c.169_170insA, NM_000310.3:c.451C>T, NM_000310.3:c.541G>T, NM_000310.3:c.840_841insA	Neuronal ceroid lipofuscinoses, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PPT1 gene located on chromosomal region 1p32. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 1.5:1,000,000-9:1,000,000.	250,600
PRCD	Retinitis pigmentosa 36	NM_001077620.2	NM_001077620.2:c.64C>T, NM_001077620.2:c.52C>T	Retinitis pigmentosa 36 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRCD gene located on chromosomal region 17q25.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife.	600
PRKRA	Dystonia tipo 16	NM_003690.4	NM_003690.4:c.665C>T	Dystonia 16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRKRA gene located on chromosomal region 2q31.2. The age of onset is early. This disease is characterized by progressive limb dystonia, laryngeal and oromandibular dystonia and parkinsonism.	600
PRODH	Hyperprolinemia type 1	NM_016335.4	NM_016335.4:c.865T>A, NM_016335.4:c.1331G>A	Hyperprolinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRODH gene located on chromosomal region 22q11.2. The age of onset is variable. This disease is characterized by benign symptoms, but associations with renal abnormalities, epileptic seizures, and other neurological manifestations, as well as certain forms of schizophrenia have been reported.	250,600
PROM1	Retinitis pigmentosa type 41	NM_006017.2	NM_006017.2:c.1841delG, NM_006017.2:c.1354_1355insT, NM_006017.2:c.1726C>T, NM_006017.2:c.199C>T, NM_006017.2:c.2490-2A>G, NM_006017.2:c.1177_1178delAT	Retinitis pigmentosa 41 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROM1 gene located on chromosomal region 4p15.32. The age of onset is early. This disease is characterized by night blindness often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 19:100,000-27:100,000.	250,600
PROP1	Pituitary hormone deficiency, combined, type 2	NM_006261.4	NM_006261.4:c.2T>C, NM_006261.4:c.150delA, NM_006261.4:c.349T>A, NM_006261.4:c.112_124delTCGAGTGCTCCAC, NM_006261.4:c.310delC, NM_006261.4:c.343-11C>G, NM_006261.4:c.217C>T, NM_006261.4:c.218G>A, NM_006261.4:c.373C>T, NM_006261.4:c.157delA, NM_006261.4:c.295C>T, NM_006261.4:c.469_470insT, NM_006261.4:c.301_302delAG, NM_006261.4:c.358C>T, NM_006261.4:c.247C>T, NM_006261.4:c.263T>C, NM_006261.4:c.4delG	Pituitary hormone deficiency, combined, type 2, genetic forms follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROP1 gene located on chromosomal region 5q35.3. The age of onset is early. This disease is characterized by short stature, cognitive alterations or delayed puberty.	600
PRPS1	Charcot-Marie-Tooth disease type 5, X-linked recessive	NM_002764.3	NM_002764.3:c.344T>C	X-linked Charcot-Marie-Tooth disease type 5 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PRPS1 gene located on chromosomal region Xq22.3. The age of onset is infantile. This disease is characterized by peripheral neuropathy, early-onset (prelingual) bilateral profound sensorineural hearing loss, and optic neuropathy. The prevalence is <1:1,000,000.	600
PRPS1	Deafness, X-linked	NM_002764.3	NM_002764.3:c.916G>A, NM_002764.3:c.869T>C	Sensorineural deafness, nonsyndromic, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PRPS1 gene located on chromosomal region Xq22.1-q24. The age of onset is early. This is a form of deafness characterized by progressive, severe-to-profound sensorineural hearing loss in males. Females manifest mild to moderate hearing loss.	600
PRPS1	Phosphoribosylpyrophosphate synthetase superactivity	NM_002764.3	NM_002764.3:c.398A>C, NM_002764.3:c.455T>C	Phosphoribosylpyrophosphate synthetase superactivity follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PRPS1 gene located on chromosomal region Xq22.1-q24. This disease is characterized by excessive purine production, gout and uric acid urolithiasis.	600
PRPS1	Sensorineural deafness, nonsyndromic, X-linked	NM_002764.3	NM_002764.3:c.193G>A	Sensorineural deafness, nonsyndromic, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PRPS1 gene located on chromosomal region Xq22.1-q24. The age of onset is early. This is a form of deafness characterized by progressive, severe-to-profound sensorineural hearing loss in males. Females manifest mild to moderate hearing loss.	600
PRX	Charcot-Marie-Tooth disease type 4F	NM_181882.2	NM_181882.2:c.2553_2556delTCTC, NM_181882.2:c.1362delA, NM_181882.2:c.1951G>A, NM_181882.2:c.3208C>T, NM_181882.2:c.2145T>A, NM_181882.2:c.2098delG	Charcot-Marie-Tooth disease, type 4F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRX gene located on chromosomal region 19q13.2. The age of onset is infantile. This disease is characterized by delayed motor milestones, and proximal and distal muscle weakness. The prevalence is <1:1,000,000.	600
PRX	Dejerine-Sottas syndrome (PRX)	NM_181882.2	NM_181882.2:c.247delC, NM_181882.2:c.1102C>T, NM_181882.2:c.2857C>T	There are both autosomal dominant and autosomal recessive forms of Dejerine-Sottas syndrome. Autosomal recessive form is caused by pathogenic variants in the PRX gene located on chromosomal region 19q13.2. The age of onset is infantile. This disease is characterized by motor and sensory neuropathy with very slow nerve conduction velocities, increased cerebrospinal fluid protein concentrations, hypertrophic nerve changes, and delayed age of walking as well as areflexia. The prevalence is <1:1,000,000.	600
PSAP	Atypical Gaucher disease due to saposin C deficiency	NM_002778.2	NM_002778.2:c.643A>C, NM_002778.2:c.607C>T, NM_002778.2:c.1A>T, NM_002778.2:c.1046T>C, NM_002778.2:c.1288C>T	Gaucher disease, atypical, due to saposin C deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PSAP gene located on chromosomal region 10q21. The age of onset is early. This disease is characterized by marked glucosylceramide accumulation in the spleen without having a deficiency of glucosylceramide-beta glucosidase characteristic of classic Gaucher disease. Gaucher disease is a lysosomal storage disorder characterized by skeletal deterioration, hepatosplenomegaly, and organ dysfunction. There are several subtypes based on the presence and severity of neurological involvement.	600
PSAT1	Phosphoserine aminotransferase deficiency	NM_058179.3	NM_058179.3:c.1029_1030delCT, NM_058179.3:c.299A>C	Phosphoserine aminotransferase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PSAT1 gene located on chromosomal region 9q21.2. The age of onset is early. This disease is characterized by acquired microcephaly, psychomotor retardation, intractable seizures and hypertonia. The prevalence is <1:1,000,000.	600
PYGM	McArdle disease	NM_005609.2	NM_005609.2:c.1628A>C, NM_005609.2:c.1466C>G, NM_005609.2:c.1094C>T, NM_005609.2:c.1827G>A, NM_005609.2:c.13_14delCT, NM_005609.2:c.1A>G, NM_005609.2:c.2009C>T, NM_005609.2:c.2128_2130delTTC, NM_005609.2:c.393delG, NM_005609.2:c.2392T>C, NM_005609.2:c.148C>T, NM_005609.2:c.1621G>T, NM_005609.2:c.613G>A, NM_005609.2:c.1963G>A, NM_005609.2:c.2262delA, NM_005609.2:c.1722T>G, NM_005609.2:c.255C>A, NM_005609.2:c.280C>T, NM_005609.2:c.1768+1G>A, NM_005609.2:c.501dupT, NM_005609.2:c.481C>T, NM_005609.2:c.1726C>T	McArdle disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PYGM gene located on chromosomal region 11q13.1. The age of onset is infantile. This disease is characterized by muscular exercise intolerance with myalgia, cramps, fatigue, and muscle weakness.	250,600
RAB23	Carpenter syndrome	NM_183227.2	NM_183227.2:c.407dupC, NM_183227.2:c.434T>A	Carpenter syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB23 gene located on chromosomal region 6p11.2. The age of onset is early. This disease is characterized by acrocephaly, peculiar facies, brachydactyly and syndactyly in the hands, and preaxial polydactyly and syndactyly of the toes. The prevalence is <1:1,000,000.	600
RAB27A	Griscelli syndrome, type 2	NM_004580.4	NM_004580.4:c.259G>C, NM_004580.4:c.382dupA, NM_004580.4:c.217T>G, NM_004580.4:c.352C>T, NM_004580.4:c.389T>C, NM_004580.4:c.454G>C	Griscelli disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB27A gene located on chromosome 15q15-q21.1. The age of onset is infantile. This disease is characterized by immune system abnormalities in addition to having hypopigmented skin and hair. Affected individuals are prone to recurrent infections. They also develop an immune condition called hemophagocytic lymphohistiocytosis, in which the immune system produces too many activated immune cells called T-lymphocytes and macrophages (histiocytes).	600
RAB3GAP1	Warburg micro syndrome type 1	NM_012233.2	NM_012233.2:c.1734G>A, NM_012233.2:c.496_497delTT, NM_012233.2:c.937dupA, NM_012233.2:c.1393_1396delTGTA, NM_012233.2:c.1410C>A, NM_012233.2:c.899+1G>A, NM_012233.2:c.2011C>T, NM_012233.2:c.748+1G>A	Warburg micro syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB3GAP1 gene located on chromosomal region 2q21.3. The age of onset is infantile. This disease is characterized by microcephaly, microphthalmia, microcornia, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. The prevalence is <1:1,000,000.	600
RAB3GAP2	Warburg micro syndrome type 2	NM_012414.3	NM_012414.3:c.1648C>T, NM_012414.3:c.1485C>A, NM_012414.3:c.325_328delAAAG, NM_012414.3:c.1276C>T	Warburg micro syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB3GAP2 gene located on chromosomal region 1q41. The age of onset is early. This disease is characterized by microcephaly, microphthalmia, microcornia, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. The prevalence is <1:1,000,000.	600
RAD51C	Fanconi anemia, complementation group O	NM_058216.2	NM_058216.2:c.706-2A>G, NM_058216.2:c.838-2A>T, NM_058216.2:c.133G>A, NM_058216.2:c.773G>A	Fanconi anemia complementation group O follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAD51C gene located on chromosomal region 17q22. The age of onset is early. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:360,000 newborn.	600
RAG1	Immunodeficiency severe combined B cell-negative	NM_000448.2	NM_000448.2:c.2333G>A, NM_000448.2:c.2320G>T, NM_000448.2:c.2164G>A, NM_000448.2:c.940C>T, NM_000448.2:c.2814T>G, NM_000448.2:c.2923C>T, NM_000448.2:c.2326C>T	Severe combined immunodeficiency, autosomal recessive, T cell-negative, B cell negative, NK cell positive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 gene located on chromosomal region 11p13. The age of onset is early. This disease is characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development.	250,600
RAG1	Omenn syndrome	NM_000448.2	NM_000448.2:c.983G>A, NM_000448.2:c.3016A>G, NM_000448.2:c.256_257delAA, NM_000448.2:c.1682G>A, NM_000448.2:c.1681C>T	Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency.	250,600
RAG2	Combined immunodeficiency with skin granulomas	NM_000536.3	NM_000536.3:c.115A>G, NM_000536.3:c.686G>A, NM_000536.3:c.283G>A, NM_000536.3:c.601C>T, NM_000536.3:c.230C>A, NM_000536.3:c.1352G>C	Combined immunodeficiency with skin granulomas follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG2 gene located on chromosome 11p13. This disease is characterized by severe infections, hypogammaglobulinemia and defective T-cell function, multiple facial papulonodular.	600
RAG2	Omenn syndrome	NM_000536.3	NM_000536.3:c.685C>T, NM_000536.3:c.1504A>G	Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency.	600
RAPSN	Congenital myasthenic syndrome	NM_005055.4	NM_005055.4:c.484G>A, NM_005055.4:c.264C>A, NM_005055.4:c.807C>A, NM_005055.4:c.848T>C, NM_005055.4:c.490C>T, NM_005055.4:c.603C>A	Congenital myasthenic syndromes follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by fatigable weakness of skeletal muscle (e.g., ocular, bulbar, limb muscles) with onset at or shortly after birth or in early childhood; rarely, symptoms may not manifest until later in childhood. Cardiac and smooth muscle are not involved. Severity and course of disease are highly variable, ranging from minor symptoms to progressive disabling weakness. The prevalence is 1:3,000.	250,600
RAPSN	Fetal akinesia deformation sequence	NM_005055.4	NM_005055.4:c.416T>C, NM_005055.4:c.566C>T	Fetal akinesia deformation sequence follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by multiple joint contractures, facial anomalies and pulmonary hypoplasia. The prevalence is 1:3,000.	250,600
RAX	Isolated microphthalmia type 3	NM_013435.2	NM_013435.2:c.909C>G, NM_013435.2:c.18C>A, NM_013435.2:c.197G>C, NM_013435.2:c.439C>T, NM_013435.2:c.383_384delAG	Isolated microphthalmia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAX gene located on chromosomal region 18q21.32. Microphthalmia designates a heterogeneous group of ocular malformations with a more or less evident reduction in the size of the eyeball. Additional features include high hypermetropia and a short axial length.	250,600
RDH12	Leber congenital amaurosis type 13	NM_152443.2	NM_152443.2:c.184C>T, NM_152443.2:c.146C>T, NM_152443.2:c.152T>A, NM_152443.2:c.451C>A, NM_152443.2:c.295C>A, NM_152443.2:c.377C>T, NM_152443.2:c.379G>T, NM_152443.2:c.565C>T, NM_152443.2:c.677A>G, NM_152443.2:c.805_809delGCCCT, NM_152443.2:c.164C>T, NM_152443.2:c.210dupC, NM_152443.2:c.448+1_448+4delGTAA, NM_152443.2:c.451C>G, NM_152443.2:c.464C>T, NM_152443.2:c.523T>C	Leber congenital amaurosis type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDH12 gene located on chromosomal region 14q24.1. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.	250,600
RDX	Deafness type 24, autosomal recessive	NM_002906.3	NM_002906.3:c.1405dupG, NM_002906.3:c.342_346delGATAT	Autosomal recessive nonsyndromic sensorineural deafness type DFNB24 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDX gene located on chromosomal region 11q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	600
RELN	Lissencephaly syndrome, Norman-Roberts type	NM_005045.3	NM_005045.3:c.6646C>T, NM_005045.3:c.5615-1G>A	Lissencephaly syndrome, Norman-Roberts type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RELN gene located on chromosomal region 7q22. The age of onset is early. This disease is characterized by craniofacial anomalies (severe microcephaly, a low sloping forehead, a broad and prominent nasal bridge and widely set eyes) and postnatal growth retardation, severe intellectual deficit, spasticity and epilepsy. The prevalence is 1:1,000,000-9:1,000,000.	600
REN	Renal tubular dysgenesis	NM_000537.3	NM_000537.3:c.404C>A, NM_000537.3:c.127C>T, NM_000537.3:c.145C>T	Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.	600
RGR	Retinitis pigmentosa type 44	NM_001012720.1	NM_001012720.1:c.196A>C, NM_001012720.1:c.249_250insGGCTCGGA, NM_001012720.1:c.261_262insGGCTCGGA, NM_001012720.1:c.454C>A, NM_001012720.1:c.865C>T, NM_001012720.1:c.877C>T	Retinitis pigmentosa type 44 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RGR gene located on chromosomal region 10q23.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	250,600
RHO	Retinitis pigmentosa type 4	NM_000539.3	NM_000539.3:c.152G>C, NM_000539.3:c.173C>T, NM_000539.3:c.448G>A, NM_000539.3:c.620T>G, NM_000539.3:c.670G>A, NM_000539.3:c.745G>T, NM_000539.3:c.659T>G	Retinitis pigmentosa type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RHO gene located on chromosomal region 3q22.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	250,600
RLBP1	Retinitis punctata albescens	NM_000326.4	NM_000326.4:c.333T>G, NM_000326.4:c.452G>A, NM_000326.4:c.700C>T, NM_000326.4:c.875C>T	Retinitis punctata albescens follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RLBP1 gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by night blindness from early childhood, delay in the regeneration of cone and rod photopigments in young adults, followed by macular degeneration and a decrease in visual acuity that led to legal blindness in early adulthood.	250,600
RP2	Retinitis pigmentosa type 2	NM_006915.2	NM_006915.2:c.235delG, NM_006915.2:c.305_306insT, NM_006915.2:c.352delC, NM_006915.2:c.353G>A, NM_006915.2:c.353G>T, NM_006915.2:c.358C>T, NM_006915.2:c.453C>G, NM_006915.2:c.453delC, NM_006915.2:c.631delC	Retinitis pigmentosa type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the RP2 gene located on chromosomal region Xp11.23. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	600
RPE65	Leber congenital amaurosis type 2	NM_000329.2	NM_000329.2:c.1067delA, NM_000329.2:c.1301C>T, NM_000329.2:c.1292A>G, NM_000329.2:c.272G>A, NM_000329.2:c.907A>T, NM_000329.2:c.514_515delGT	Leber congenital amaurosis 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus.	250,600
RPE65	Retinitis pigmentosa type 20	NM_000329.2	NM_000329.2:c.1022T>C, NM_000329.2:c.1087C>A, NM_000329.2:c.1102T>C, NM_000329.2:c.271C>T, NM_000329.2:c.1355T>G, NM_000329.2:c.1543C>T, NM_000329.2:c.394G>A, NM_000329.2:c.881A>C	Retinitis pigmentosa type 20 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	250,600
RPGR	Retinitis pigmentosa type 3	NM_001034853.1	NM_001034853.1:c.155-2A>G, NM_001034853.1:c.173_174insA, NM_001034853.1:c.179G>T, NM_001034853.1:c.296C>A, NM_001034853.1:c.389T>G, NM_001034853.1:c.505G>T, NM_001034853.1:c.517G>C, NM_001034853.1:c.642_656delTGGAGAACCTGAGAAinsC, NM_001034853.1:c.654_655delGA, NM_001034853.1:c.674_675delCC, NM_001034853.1:c.703C>T, NM_001034853.1:c.806G>A, NM_001034853.1:c.823G>A, NM_001034853.1:c.846_847delAA	Retinitis pigmentosa type 3 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the RPGR gene located on chromosomal region Xp11.4. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	600
RPGRIP1L	Joubert syndrome type 7	NM_015272.2	NM_015272.2:c.1177G>A, NM_015272.2:c.1326_1329delAAAA, NM_015272.2:c.1329_1330insA, NM_015272.2:c.1843A>C, NM_015272.2:c.1975T>C, NM_015272.2:c.2030C>T, NM_015272.2:c.2050C>T, NM_015272.2:c.2413C>T, NM_015272.2:c.757C>T, NM_015272.2:c.3548C>G, NM_015272.2:c.697A>T, NM_015272.2:c.3634_3637delGAAA, NM_015272.2:c.776+1G>A, NM_015272.2:c.2794_2795delTT	Joubert syndrome type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. This disease is characterized by cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy and renal disease.	250,600
RPGRIP1L	Meckel syndrome type 5	NM_015272.2	NM_015272.2:c.394A>T, NM_015272.2:c.3706C>T, NM_015272.2:c.2614C>T	Meckel syndrome, type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. This disease is characterized by a combination of renal cysts and variably associated features, including developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and cysts, and polydactyly. The prevalence is <1:1,000,000.	250,600
RYR1	Central core disease	NM_000540.2	NM_000540.2:c.1021G>A, NM_000540.2:c.10343C>T, NM_000540.2:c.10579C>T, NM_000540.2:c.10616G>A, NM_000540.2:c.11798A>G, NM_000540.2:c.1205T>C, NM_000540.2:c.13480G>T, NM_000540.2:c.13513G>C, NM_000540.2:c.14365-2A>T, NM_000540.2:c.14511+1_14511+2delGT, NM_000540.2:c.14545G>A, NM_000540.2:c.1739_1742dupATCA, NM_000540.2:c.1841G>T, NM_000540.2:c.325C>T, NM_000540.2:c.4076delG, NM_000540.2:c.4178A>G, NM_000540.2:c.4405C>T, NM_000540.2:c.487C>T, NM_000540.2:c.5036G>A, NM_000540.2:c.5333C>A, NM_000540.2:c.5726_5727delAG, NM_000540.2:c.6082C>T, NM_000540.2:c.6104A>T, NM_000540.2:c.631+2T>C, NM_000540.2:c.6961A>G, NM_000540.2:c.7025A>G, NM_000540.2:c.7268T>A, NM_000540.2:c.7300G>A, NM_000540.2:c.7360C>T, NM_000540.2:c.7373G>A, NM_000540.2:c.738T>G, NM_000540.2:c.7463_7475delCAAAGATGTCAGC, NM_000540.2:c.9000+1G>T, NM_000540.2:c.14126C>T, NM_000540.2:c.1655G>A, NM_000540.2:c.4729G>A, NM_000540.2:c.7781C>A, NM_000540.2:c.7836-1G>A, NM_000540.2:c.8360C>G, NM_000540.2:c.9868G>A, NM_000540.2:c.9905_9906insC, NM_000540.2:c.1186G>T, NM_000540.2:c.6721C>T	Central core disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RYR1 gene located on chromosomal region 19q13.2. Typical central core disease is a relatively mild congenital myopathy, usually characterized by motor developmental delay and signs of mild proximal weakness most pronounced in the hip girdle musculature. Orthopedic complications, particularly congenital dislocation of the hips and scoliosis, are common, and patients are at risk of having malignant hyperthermia. Onset is usually in childhood, although adult onset has also been reported.	250,600
SACS	Spastic ataxia, Charlevoix-Saguenay type	NM_014363.5	NM_014363.5:c.10907G>A, NM_014363.5:c.10954C>A, NM_014363.5:c.11624G>A, NM_014363.5:c.12160C>T, NM_014363.5:c.517C>T, NM_014363.5:c.6355C>T, NM_014363.5:c.6781C>A, NM_014363.5:c.7504C>T, NM_014363.5:c.8107C>T, NM_014363.5:c.8844delT, NM_014363.5:c.994A>T, NM_014363.5:c.13237C>T, NM_014363.5:c.3198T>A, NM_014363.5:c.4933C>T, NM_014363.5:c.5618_5619delAT, NM_014363.5:c.6563T>A	Spastic ataxia, Charlevoix-Saguenay type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SACS gene located on chromosomal region 13q11. The age of onset is early. This disease is characterized by early-onset cerebellar ataxia with spasticity, a pyramidal syndrome and peripheral neuropathy. The prevalence is 1:1,500-1:2,000.	250,600
SAG	Oguchi disease	NM_000541.4	NM_000541.4:c.293_294insG, NM_000541.4:c.523C>T, NM_000541.4:c.577C>T, NM_000541.4:c.874C>T, NM_000541.4:c.916G>T, NM_000541.4:c.926delA, NM_000541.4:c.993C>G	Oguchi disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SAG gene located on chromosomal region 2q37. The age of onset is infantile. This disease is characterized by congenital stationary night blindness and the Mizuo-Nakamura phenomenon which is a unique morphological and functional abnormality of the retina that presents with a typical golden-yellow or silver-gray discoloration of the fundus in the presence of light that disappears after dark-adaptation and appears again after the onset of light.	250,600
SBDS	Shwachman-Diamond syndrome	NM_016038.2	NM_016038.2:c.120delG, NM_016038.2:c.127G>T, NM_016038.2:c.183_184delTAinsCT, NM_016038.2:c.184A>T, NM_016038.2:c.377G>C, NM_016038.2:c.505C>T, NM_016038.2:c.652C>T, NM_016038.2:c.258+2T>C	Shwachman-Diamond syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBDS gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by chronic and usually mild neutropenia, pancreatic exocrine insufficiency associated with steatorrhea and growth failure, skeletal dysplasia with short stature, and an increased risk of bone marrow aplasia or leukemic transformation, cutaneous (eczema or ichthyosis) and dental anomalies, and psychomotor retardation. The prevalence is 1:76,000 newborn.	250,600
SBF2	Charcot-Marie-Tooth disease type 4B2	NM_030962.3	NM_030962.3:c.1459C>T, NM_030962.3:c.2875C>T, NM_030962.3:c.3586C>T, NM_030962.3:c.3154A>T, NM_030962.3:c.5539_5540insATCT	Charcot-Marie-Tooth disease, type 4B2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBF2 gene located on chromosomal region 11p15.4. The age of onset is infantile. This disease is characterized by muscle weakness, sensory loss, reduced nerve conduction velocities, characteristic myelin outfoldings and a severe disease course.	600
SC5D	Lathosterolosis	NM_006918.4	NM_006918.4:c.86G>A	Lathosterolosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SC5D gene located on chromosomal region 11q23.3. The age of onset is early. This disease is characterized by malformations, intellectual deficit and liver disease. The prevalence is <1:1,000,000.	600
SCNN1A	Pseudohypoaldosteronism, type 1	NM_001038.5	NM_001038.5:c.1305delC, NM_001038.5:c.1482delC, NM_001038.5:c.1522C>T, NM_001038.5:c.1765C>T, NM_001038.5:c.1834C>T, NM_001038.5:c.203_204delTC, NM_001038.5:c.340G>A	Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.	600
SCNN1B	Pseudohypoaldosteronism, type 1	NM_000336.2	NM_000336.2:c.109G>A	Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.	250,600
SCNN1G	Pseudohypoaldosteronism, type 1	NM_001039.3	NM_001039.3:c.1373+2T>C, NM_001039.3:c.1570-1G>A, NM_001039.3:c.1627delG, NM_001039.3:c.598_599insA	Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.	250,600
SEMA4A	Retinitis pigmentosa type 35	NM_022367.3	NM_022367.3:c.1033G>C, NM_022367.3:c.1049T>G	Retinitis pigmentosa type 35 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SEMA4A gene located on chromosomal region 1q22. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife.	600
SEPN1	Muscular dystrophy, rigid spine, type 1	NM_020451.2	NM_020451.2:c.1315C>T, NM_020451.2:c.818G>A, NM_020451.2:c.883G>A, NM_020451.2:c.943G>A, NM_020451.2:c.943G>C, NM_020451.2:c.1384T>G, NM_020451.2:c.713_714insA, NM_020451.2:c.871C>T	Rigid spine syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SEPN1 gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is characterized by contractures of the spinal extensor muscles associated with abnormal posture (limitation of neck and trunk flexure), progressive scoliosis of the spine, early marked cervico-axial muscle weakness with relatively preserved strength and function of the extremities and progressive respiratory insufficiency. The prevalence is 3.5:100,000–5:100,000.	600
SERPINA1	Alpha1-antitrypsin deficiency	NM_000295.4	NM_000295.4:c.1177C>T, NM_000295.4:c.187C>T, NM_000295.4:c.194T>C, NM_000295.4:c.230C>T, NM_000295.4:c.250G>A, NM_000295.4:c.272G>A, NM_000295.4:c.347T>A, NM_000295.4:c.415G>A, NM_000295.4:c.514G>A, NM_000295.4:c.514G>T, NM_000295.4:c.739C>T, NM_000295.4:c.839A>T, NM_000295.4:c.1093G>A, NM_000295.4:c.848A>T	Alpha-1-antitrypsin deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SERPINA1 gene located on chromosomal region 14q32.13. The age of onset is variable. This disease is characterized by emphysema, which becomes evident by the third to fourth decade. A less common manifestation of the deficiency is liver disease, which occurs in children and adults, and may result in cirrhosis and liver failure. Environmental factors, particularly cigarette smoking, greatly increase the risk of emphysema at an earlier age. The prevalence is 1:1,500-1:3,500 in European.	250,600
SETX	Spinocerebellar ataxia with axonal neuropathy type 2	NM_015046.5	NM_015046.5:c.1027G>T, NM_015046.5:c.1166T>C, NM_015046.5:c.1807A>G, NM_015046.5:c.2602C>T, NM_015046.5:c.3880C>T, NM_015046.5:c.4087C>T, NM_015046.5:c.5630delG, NM_015046.5:c.5927T>G, NM_015046.5:c.6848_6851delCAGA, NM_015046.5:c.994C>T, NM_015046.5:c.5308_5311delGAGA, NM_015046.5:c.5549-1G>T, NM_015046.5:c.6834_6839delAACAAA	Spinocerebellar ataxia with axonal neuropathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SETX gene located on chromosomal region 9q34.13. The age of onset is infantile. This disease is characterized by progressive cerebellar ataxia, axonal sensorimotor neuropathy with oculomotor apraxia, fixation instability, extrapyramidal features and an elevated serum alpha-fetoprotein level. The prevalence is 4:100,000-8:100,000.	250,600
SGCA	Limb-girdle muscular dystrophy type 2D	NM_000023.2	NM_000023.2:c.101G>A, NM_000023.2:c.229C>T, NM_000023.2:c.371T>C, NM_000023.2:c.518T>C, NM_000023.2:c.574C>T, NM_000023.2:c.850C>T, NM_000023.2:c.662G>A, NM_000023.2:c.739G>A, NM_000023.2:c.904_905insCC	Autosomal recessive limb-girdle muscular dystrophy type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCA gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness and calf pseudohypertrophy. The prevalence is 1:1,000,000-9:1,000,000.	250,600
SGCB	Muscular dystrophy, limb-girdle, type 2E	NM_000232.4	NM_000232.4:c.272G>C, NM_000232.4:c.272G>T, NM_000232.4:c.299T>A, NM_000232.4:c.323T>G, NM_000232.4:c.341C>T, NM_000232.4:c.452C>G, NM_000232.4:c.552T>G	Autosomal recessive limb-girdle muscular dystrophy type 2E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCB gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness, particularly of the pelvic girdle muscles.	600
SGCG	Limb-girdle muscular dystrophy type 2C	NM_000231.2	NM_000231.2:c.195+4_195+7delAGTA, NM_000231.2:c.505+1G>A, NM_000231.2:c.787G>A, NM_000231.2:c.848G>A, NM_000231.2:c.88delG, NM_000231.2:c.521delT	Autosomal recessive limb-girdle muscular dystrophy type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCG gene located on chromosomal region 13q12.12. The age of onset is variable. This disease is characterized by limb-girdle weakness, calf hypertrophy, diaphragmatic weakness, and variable cardiac abnormalities.	250,600
SGSH	Mucopolysaccharidosis type 3A (Sanfilippo disease type A)	NM_000199.3	NM_000199.3:c.1167C>A, NM_000199.3:c.1298G>A, NM_000199.3:c.130G>A, NM_000199.3:c.1339G>A, NM_000199.3:c.1380delT, NM_000199.3:c.197C>G, NM_000199.3:c.220C>T, NM_000199.3:c.235A>C, NM_000199.3:c.320delT, NM_000199.3:c.337_345delinsGCACAGGTGAG, NM_000199.3:c.364G>A, NM_000199.3:c.383C>T, NM_000199.3:c.416C>T, NM_000199.3:c.449G>A, NM_000199.3:c.466A>T, NM_000199.3:c.617G>C, NM_000199.3:c.752G>C, NM_000199.3:c.757delG, NM_000199.3:c.877C>T, NM_000199.3:c.892T>C	Mucopolysaccharidosis type 3A (Sanfilippo syndrome type A) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGSH gene located on chromosomal region 17q25.3. The age of onset is infantile. This disease is characterized by behavioural disorders (hyperkinesia, aggressiveness) and intellectual deterioration, sleep disorders and very mild dysmorphism. The prevalence is >1:70,000 newborn.	250,600
SH2D1A	Lymphoproliferative syndrome type 1, X-linked	NM_002351.4	NM_002351.4:c.163C>T, NM_002351.4:c.164G>T, NM_002351.4:c.172C>T, NM_002351.4:c.203C>T, NM_002351.4:c.302C>T, NM_002351.4:c.3G>T, NM_002351.4:c.95G>C	X-linked lymphoproliferative disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the SH2D1A gene located on chromosomal region Xq25. The age of onset is infantile. This disease is characterized by an inadequate immune response to infection with the Epstein-Barr virus: fulminant infectious mononucleosis, macrophage-activation syndrome or hemophagocytic lymphohistiocytosis (HLH) (see these terms), and/or progressive hypogammaglobulinemia and/or lymphomas. The prevalence is 1:1, 000,000 men.	600
SH3TC2	Charcot-Marie-Tooth disease type 4C	NM_024577.3	NM_024577.3:c.1586G>A, NM_024577.3:c.1747_1748delAG, NM_024577.3:c.1969G>A, NM_024577.3:c.1972C>T, NM_024577.3:c.1982T>C, NM_024577.3:c.217_227delGCTGCTCGGAGinsCCAGTAA, NM_024577.3:c.2191delG, NM_024577.3:c.2491_2492delAG, NM_024577.3:c.2710C>T, NM_024577.3:c.2829T>G, NM_024577.3:c.2860C>T, NM_024577.3:c.28delG, NM_024577.3:c.2993_2994insC, NM_024577.3:c.3325C>T, NM_024577.3:c.3326G>C, NM_024577.3:c.3341delC, NM_024577.3:c.3601C>T, NM_024577.3:c.3686A>T, NM_024577.3:c.505T>C, NM_024577.3:c.52+1delG, NM_024577.3:c.530-2A>G, NM_024577.3:c.735G>A, NM_024577.3:c.920G>A, NM_024577.3:c.3676-1G>A, NM_024577.3:c.1724T>A, NM_024577.3:c.53-1G>C	Charcot-Marie-Tooth disease, type 4C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SH3TC2 gene located on chromosomal region 5q32. The age of onset is infantile. This disease is characterized by scoliosis or kyphoscoliosis, neuropathy, foot deformities, respiratory insufficiency, hypoacousis and deafness.	250,600
SIL1	Marinesco-Sjögren syndrome	NM_022464.4	NM_022464.4:c.1312C>T, NM_022464.4:c.274C>T, NM_022464.4:c.331C>T	Marinesco-Sjögren syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SIL1 gene located on chromosomal region 5q31.2. The age of onset is infantile. This disease is characterized by dysarthria, nystagmus, muscle weakness and hypotonia. The prevalence is <1:1,000,000.	600
SIX6	Anophthalmia or microphthalmia, isolated	NM_007374.2	NM_007374.2:c.493A>G, NM_007374.2:c.532_536delAACCG, NM_007374.2:c.635C>T, NM_007374.2:c.725G>T	Anophthalmia or microphthalmia, isolated follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SIX6 gene located on chromosomal region 14q23.1. The age of onset is infantile. A disorder of eye formation, ranging from small size of a single eye to complete bilateral absence of ocular tissues. Ocular abnormalities like opacities of the cornea and lens, scarring of the retina and choroid, and other abnormalities may also be present.	600
SLC12A1	Bartter syndrome type 1	NM_000338.2	NM_000338.2:c.1875G>A, NM_000338.2:c.1942G>A, NM_000338.2:c.2805_2806insA, NM_000338.2:c.347G>A, NM_000338.2:c.611T>C, NM_000338.2:c.628+2T>C, NM_000338.2:c.814G>T, NM_000338.2:c.223C>T, NM_000338.2:c.2952_2955delCAAA	Bartter syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A1 gene located on chromosomal region 15q15-21. The age of onset is infantile. This disease is characterized by polyhydramnios, premature delivery, polyuria, dehydration, hypercalciuria and nephrocalcinosis. The prevalence is 1:1,000,000.	250,600
SLC12A6	Agenesis of the corpus callosum with neuropathy	NM_133647.1	NM_133647.1:c.1584_1585delCTinsG, NM_133647.1:c.2023C>T, NM_133647.1:c.3031C>T, NM_133647.1:c.619C>T, NM_133647.1:c.316+1G>A, NM_133647.1:c.366T>G	Corpus callosum agenesis with neuronopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A6 gene located on chromosomal region 15q13-q14. The age of onset is early. This disease is characterized by a delay in developmental milestones, a severe sensory-motor polyneuropathy with areflexia, a variable degree of agenesis of the corpus callosum, amyotrophy, hypotonia, and cognitive impairment. The prevalence is 1:2,117.	600
SLC17A5	Sialic acid storage disease	NM_012434.4	NM_012434.4:c.115C>T, NM_012434.4:c.406A>G, NM_012434.4:c.43G>T, NM_012434.4:c.918T>G, NM_012434.4:c.1259+1G>A, NM_012434.4:c.500T>C	Sialic acid storage diseases, follow an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC17A5 gene located on chromosomal region 6q13. The age of onset is from infantile to adult forms. The main symptoms are hypotonia, cerebellar ataxia, and mental retardation; visceromegaly and coarse features are also present in the infantile cases.	250,600
SLC24A1	Night blindness, congenital stationary type 1D	NM_004727.2	NM_004727.2:c.1963C>T	Night blindness, congenital stationary type 1D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC24A1 gene located on chromosomal region 15q22.31. The age of onset is early. This disease is characterized by hemeralopia with a moderate loss of visual acuity.	250,600
SLC25A13	Citrullinemia type 2	NM_014251.2	NM_014251.2:c.1078C>T, NM_014251.2:c.1177+1G>A, NM_014251.2:c.1311+1G>A, NM_014251.2:c.1592G>A, NM_014251.2:c.1799dupA, NM_014251.2:c.1801G>A, NM_014251.2:c.1801G>T, NM_014251.2:c.1813C>T, NM_014251.2:c.615+1G>C, NM_014251.2:c.615+5G>A, NM_014251.2:c.674C>A, NM_014251.2:c.674C>T, NM_014251.2:c.852_855delTATG, NM_014251.2:c.1231-1G>A, NM_014251.2:c.1411_1412delCT	Citrullinemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A13 gene located on chromosomal region 7q21.3. The age of onset is early. This disease is characterized by hyperammonemia and associated neuropsychiatric symptoms such as nocturnal delirium, confusion, restlessness, disorientation, drowsiness, memory loss, abnormal behavior (aggression, irritability, and hyperactivity), seizures, and coma. The prevalence is 1:17,000-1:230,000.	600
SLC25A15	Hyperornithinemia - hyperammonemia - homocitrullinuria syndrome	NM_014252.3	NM_014252.3:c.110T>G, NM_014252.3:c.212T>A, NM_014252.3:c.535C>T, NM_014252.3:c.538G>A, NM_014252.3:c.562_564delTTC, NM_014252.3:c.569G>A, NM_014252.3:c.658G>A, NM_014252.3:c.815C>T, NM_014252.3:c.824G>A, NM_014252.3:c.44C>T	Hyperornithinemia-hyperammonemia-homocitrullinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A15 gene located on chromosomal region 13q14.11. The age of onset is early. This disease is characterized by coma due to hyperammonemia, convulsions, and hypotonia. The prevalence is 1:5,500.	600
SLC25A22	Epileptic encephalopathy, early infantile, type 3	NM_024698.5	NM_024698.5:c.617C>T, NM_024698.5:c.706G>T	Early infantile epileptic encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A22 gene located on chromosomal region 11p15.5. The age of onset is early. This disease is characterized by the onset of tonic spasms within the first 3 months of life leading to psychomotor impairment and death. The prevalence is <1:1,000,000.	600
SLC26A2	Achondrogenesis type 1B	NM_000112.3	NM_000112.3:c.1020_1022delTGT, NM_000112.3:c.1273A>G, NM_000112.3:c.532C>T, NM_000112.3:c.2033G>T	Achondrogenesis type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by severe micromelia with very short fingers and toes, a flat face, a short neck, thickened soft tissue around the neck, hypoplasia of the thorax, protuberant abdomen, a hydropic fetal appearance and distinctive histological features of the cartilage. The prevalence is 1:20,000.	250,600
SLC26A2	Atelosteogenesis type 2	NM_000112.3	NM_000112.3:c.1535C>A, NM_000112.3:c.835C>T	Atelosteogenesis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by limb shortening, normal sized skull with cleft palate, hitchhiker thumbs, distinctive facial dysmorphism and radiographic skeletal features. The prevalence is 1:20,000.	250,600
SLC26A2	Diastrophic dysplasia	NM_000112.3	NM_000112.3:c.1724delA, NM_000112.3:c.1878delG, NM_000112.3:c.1361A>C, NM_000112.3:c.767T>C, NM_000112.3:c.833delC, NM_000112.3:c.496G>A, NM_000112.3:c.1957T>A	Diastrophic dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by short stature with short extremities (final adult height is 120cm), and joint malformations leading to multiple joint contractures (principally involving the shoulders, elbows, interphalangeal joints and hips). The prevalence is 1:20,000.	250,600
SLC26A4	Deafness type 4, autosomal recessive	NM_000441.1	NM_000441.1:c.1001G>T, NM_000441.1:c.1034T>A, NM_000441.1:c.2162C>T, NM_000441.1:c.1975G>C, NM_000441.1:c.1174A>T, NM_000441.1:c.2131G>A, NM_000441.1:c.1454C>T, NM_000441.1:c.1468A>C, NM_000441.1:c.2211G>C, NM_000441.1:c.269C>T, NM_000441.1:c.916dupG, NM_000441.1:c.281C>T, NM_000441.1:c.1634T>G, NM_000441.1:c.1707+5G>A, NM_000441.1:c.1489G>A, NM_000441.1:c.961A>T, NM_000441.1:c.2048T>C, NM_000441.1:c.898A>C, NM_000441.1:c.918+2T>C, NM_000441.1:c.1001+1G>T, NM_000441.1:c.970A>T, NM_000441.1:c.563T>C	Autosomal recessive nonsyndromic sensorineural deafness type DFNB4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	250,600
SLC26A4	Pendred syndrome	NM_000441.1	NM_000441.1:c.1246A>C, NM_000441.1:c.1826T>G, NM_000441.1:c.1229C>T, NM_000441.1:c.1263+1G>A, NM_000441.1:c.1061T>C, NM_000441.1:c.1790T>C, NM_000441.1:c.2168A>G, NM_000441.1:c.1151A>G, NM_000441.1:c.1226G>A, NM_000441.1:c.1003T>C, NM_000441.1:c.919-2A>G, NM_000441.1:c.554G>C, NM_000441.1:c.626G>T, NM_000441.1:c.1334T>G, NM_000441.1:c.1198delT, NM_000441.1:c.412G>T, NM_000441.1:c.707T>C	Pendred syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. The main presenting clinical sign is prelingual sensorineural deafness, although occasionally the hearing loss develops later in childhood. The degree of hearing loss is variable: it can be mild-to-moderate and progressive in some patients, and severe-to-profound in others. Fluctuations in hearing are also common and may be associated with or preceded by vertigo. The onset and presentation of euthyroid goiter (75%) is highly variable within and between families, with thyroid enlargement usually developing in late childhood or early adulthood. The thyromegaly reflects a defect in iodide transport from the thyrocyte to the colloid, although organification itself is not impaired. Hypothyroidism may develop if nutritional iodide intake is low.	250,600
SLC26A5	Deafness type 61, autosomal recessive	NM_198999.2	NM_198999.2:c.209G>A, NM_198999.2:c.390A>C, NM_198999.2:c.152+1G>A, NM_198999.2:c.1A>G	Autosomal recessive nonsyndromic sensorineural deafness type DFNB16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A5 gene located on chromosomal region 7q22.1. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	600
SLC35A1	Congenital disorder of glycosylation type 2F	NM_006416.4	NM_006416.4:c.277_280delGTGCinsTG	Congenital disorder of glycosylation type 2F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35A1 gene located on chromosomal region 6q15. The age of onset is early. This disease is characterized by repeated hemorrhagic incidents, including severe pulmonary hemorrhage.	600
SLC35C1	Congenital disorder of glycosylation 2c	NM_018389.4	NM_018389.4:c.439C>T, NM_018389.4:c.91G>T, NM_018389.4:c.923C>G, NM_018389.4:c.290dupG, NM_018389.4:c.503_505delTCT	Congenital disorder of glycosylation type 2c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35C1 gene located on chromosomal region 11p11.2. The age of onset is infantile. This disease is characterized by recurrent bacterial infections, severe growth delay and severe intellectual deficit.	600
SLC35D1	Schneckenbecken dysplasia	NM_015139.2	NM_015139.2:c.319C>T, NM_015139.2:c.932G>A	Schneckenbecken dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35D1 gene located on chromosomal region 1p31.3. The age of onset is fetal. This disease is characterized by nail-like configuration of the hypoplastic iliac bone, flattened hypoplastic vertebral bodies, short ribs, short and wide fibulae, short and broad long bones with a dumbbell-like appearance, and precocious ossification of the tarsus.	600
SLC37A4	Glycogen storage disease types 1b, 1c and 1d	NM_001164278.1	NM_001164278.1:c.1042_1043delCT, NM_001164278.1:c.1081G>T, NM_001164278.1:c.1082G>A, NM_001164278.1:c.1108_1109delCT, NM_001164278.1:c.1129G>T, NM_001164278.1:c.1190-2_1190-1delAG, NM_001164278.1:c.1309C>T, NM_001164278.1:c.287G>A, NM_001164278.1:c.352T>C, NM_001164278.1:c.593A>T, NM_001164278.1:c.706_708delGTG, NM_001164278.1:c.83G>A, NM_001164278.1:c.899G>A	Glycogen storage disease due to glucose-6-phosphatase deficiency types 1b, 1c and 1d follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC37A4 gene located on chromosomal region 11q23. The age of onset is early. This disease is characterized by impairment of terminal steps of glycogenolysis and gluconeogenesis. Patients manifest a wide range of clinical symptoms and biochemical abnormalities, including hypoglycemia, severe hepatomegaly due to excessive accumulation of glycogen, kidney enlargement, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. Glycogen storage disease type 1B patients also present a tendency towards infections associated with neutropenia, relapsing aphthous gingivostomatitis, and inflammatory bowel disease. The incidence is 1:100,000.	250,600
SLC45A2	Albinism, oculocutaneous, type 4	NM_016180.3	NM_016180.3:c.1121delT, NM_016180.3:c.469G>A, NM_016180.3:c.986delC	Oculocutaneous albinism type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC45A2 gene located on chromosomal region 5p13.2. The age of onset is early. This disease is characterized by skin and hair hypopigmentation, numerous ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1:100.000.	600
SLC4A11	Congenital hereditary endothelial dystrophy type 2	NM_032034.3	NM_032034.3:c.1038_1039insA, NM_032034.3:c.1391G>A, NM_032034.3:c.2318C>T, NM_032034.3:c.1466C>T, NM_032034.3:c.1813C>T, NM_032034.3:c.2264G>A, NM_032034.3:c.2605C>T, NM_032034.3:c.2399C>T, NM_032034.3:c.554_561delGCTTCGCC, NM_032034.3:c.2606G>A	Congenital hereditary endothelial dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by a diffuse ground-glass appearance of the corneas and marked corneal thickening from birth with nystagmus, and blurred vision.	250,600
SLC4A11	Corneal dystrophy and perceptive deafness	NM_032034.3	NM_032034.3:c.2528T>C, NM_032034.3:c.1463G>A, NM_032034.3:c.473_480delGCTTCGCC, NM_032034.3:c.2566A>G, NM_032034.3:c.637T>C, NM_032034.3:c.625C>T, NM_032034.3:c.2224G>A, NM_032034.3:c.2240_2240+1insTATGACAC	Corneal dystrophy - perceptive deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by the association of congenital hereditary endothelial dystrophy with progressive, postlingual sensorineural hearing loss.	250,600
SLC6A8	Cerebral creatine deficiency syndrome type 1	NM_005629.3	NM_005629.3:c.1011C>G, NM_005629.3:c.1141G>C, NM_005629.3:c.1222_1224delTTC, NM_005629.3:c.1540C>T, NM_005629.3:c.321_323delCTT, NM_005629.3:c.395G>T	X-linked creatine transporter deficiency follows an X-linked pattern of inheritance and is caused by pathogenic variants in the SLC6A8 gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by intellectual deficit, seizures, severe speech delay and sometimes midface hypoplasia, microcephaly, long, thin face, and prominent chin in the cases of affected male patients reported to date. The prevalence is 11:1,000.	600
SLX4	Fanconi anemia, complementation group P	NM_032444.2	NM_032444.2:c.1093delC, NM_032444.2:c.286delA, NM_032444.2:c.4921_4922insG, NM_032444.2:c.5097_5098delTC, NM_032444.2:c.5408_5409insAC, NM_032444.2:c.4739+1G>T, NM_032444.2:c.2808_2809delAG	Fanconi anemia complementation group P follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLX4 gene located on chromosomal region 16p13.3. The age of onset is early. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:160,000.	250,600
SMN1	Spinal muscular atrophy	-	del ex7, del ex7-8, del ex8 (Detection by MLPA)	Spinal muscular atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMN1 gene located on chromosomal region 5q13.2. The age of onset is variable. This disease comprise a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. Autosomal recessive forms are classified according to the age of onset, the maximum muscular activity achieved, and survivorship. The severity of the disease is mainly determined by the copy number of SMN2, a copy gene which predominantly produces exon 7-skipped transcripts and only low amount of full-length transcripts that encode for a protein identical to SMN1. Only about 4% of patients bear one SMN1 copy with an intragenic mutation. Type 1 is a severe form, with onset before 6 months of age. Patients never achieve the ability to sit. Type 2 has intermediate severity, with onset between 6 and 18 months. Patients do not reach the motor milestone of standing, and survive into adulthood. Type 3 onset is after 18 months. Patients develop ability to stand and walk and survive into adulthood. Type 4 onset is in adulthood, disease progression is slow, and patients can stand and walk. The incidence is 1:10,000 and the prevalence is 1:80,000.	250,600
SMPD1	Niemann-Pick disease	NM_000543.4	NM_000543.4:c.103_118delCTGGTGCTGGCGCTGG, NM_000543.4:c.103_119delCTGGTGCTGGCGCTGGC, NM_000543.4:c.103_107delCTGGT, NM_000543.4:c.103_113delCTGGTGCTGGCGinsCTGGTG, NM_000543.4:c.1092-1G>C, NM_000543.4:c.1117C>T, NM_000543.4:c.106delG, NM_000543.4:c.108_124delGCTGGCGCTGGCGCTGGC, NM_000543.4:c.1267C>T, NM_000543.4:c.1299T>G, NM_000543.4:c.1327C>T, NM_000543.4:c.1420_1421delCT, NM_000543.4:c.1426C>T, NM_000543.4:c.1624C>T, NM_000543.4:c.1630delA, NM_000543.4:c.1805G>A, NM_000543.4:c.354delC, NM_000543.4:c.475T>C, NM_000543.4:c.551C>T, NM_000543.4:c.557C>T, NM_000543.4:c.558_559insC, NM_000543.4:c.558_574delGCCCCCCAAACCCCCTA, NM_000543.4:c.564delC, NM_000543.4:c.573delT, NM_000543.4:c.689G>A, NM_000543.4:c.730G>A, NM_000543.4:c.739G>A, NM_000543.4:c.740delG, NM_000543.4:c.742G>A, NM_000543.4:c.757G>C, NM_000543.4:c.785_807delTGTTGAGTGGGCTGGGCCCAGCC, NM_000543.4:c.788T>A, NM_000543.4:c.842_849dupTCCCCGCA, NM_000543.4:c.911T>C, NM_000543.4:c.940G>A, NM_000543.4:c.96G>A, NM_000543.4:c.996delC, NM_000543.4:c.688C>T, NM_000543.4:c.995C>G, NM_000543.4:c.1829_1831delGCC, NM_000543.4:c.1264-1G>T, NM_000543.4:c.1152G>A	Niemann-Pick disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMPD1 gene located on chromosomal region 11p15.4. The clinical phenotype ranges from a severe infantile form with neurologic degeneration resulting in death usually by 3 years of age (type A) to a later-onset nonneurologic form (type B) that is compatible with survival into adulthood.	250,600
SNAI2	Waardenburg syndrome type 2	NM_003068.4	NM_003068.4:c.357C>A	Waardenburg syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SNAI2 gene located on chromosome 8q11.21. The age of onset is early. This disease is characterized by pigmentary abnormalities of the hair, skin, and eyes, congenital sensorineural hearing loss and the lateral displacement of the inner canthus of each eye. The prevalence is 1:100,000-9:100,000.	600
SNAP29	Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome	NM_004782.3	NM_004782.3:c.487dupA	Cerebral dysgenesis-neuropathy-ichthyosis-palmoplantar keratoderma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SNAP29 gene located on chromosomal region 22q11.2. The age of onset is early. This disease is characterized by severe developmental abnormalities of the nervous system and aberrant differentiation of the epidermis. The prevalence is <1:1,000,000.	600
SPG11	Spastic paraplegia type 11	NM_025137.3	NM_025137.3:c.118C>T, NM_025137.3:c.529_533delATATT, NM_025137.3:c.5623C>T, NM_025137.3:c.1339_1342dupGGCT, NM_025137.3:c.342delT, NM_025137.3:c.7152-1G>C, NM_025137.3:c.733_734delAT, NM_025137.3:c.6805_6806delCT, NM_025137.3:c.1736-1G>C, NM_025137.3:c.6100C>T, NM_025137.3:c.6848_6849insTC	Spastic paraplegia type 11 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG11 gene located on chromosomal region 13q13.3. The age of onset is infantile. This disease is characterized by progressive spasticity and weakness of the lower limbs frequently associated with the following: mild intellectual disability with learning difficulties in childhood and/or progressive cognitive decline; peripheral neuropathy; pseudobulbar involvement; and increased reflexes in the upper limbs. The prevalence is 5:100.000.	250,600
SPG20	Spastic paraplegia type 20, autosomal recessive	NM_015087.4	NM_015087.4:c.1110delA, NM_015087.4:c.364_365delAT	Autosomal recessive spastic paraplegia type 20 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG20 gene located on chromosomal region 13q13.3. The age of onset is infantile. This disease is characterized by progressive spastic paraparesis, dysarthria, and pseudobulbar palsy; distal amyotrophy; motor and cognitive delays; short stature; and subtle skeletal abnormalities.	600
SPG7	Spastic paraplegia type 7	NM_003119.3	NM_003119.3:c.1457G>A, NM_003119.3:c.1529C>T, NM_003119.3:c.2075G>C, NM_003119.3:c.233T>A, NM_003119.3:c.1676delA, NM_003119.3:c.1749G>C, NM_003119.3:c.773_774delTG, NM_003119.3:c.1045G>A, NM_003119.3:c.1124delG, NM_003119.3:c.679C>T, NM_003119.3:c.758+2T>C, NM_003119.3:c.286+1G>T	Spastic paraplegia type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG7 gene located on chromosomal region 16q24.3. The age of onset is adult. This disease is characterized by insidiously progressive bilateral lower limb weakness and spasticity. The prevalence is 1:100,000-9:100,000.	250,600
STAR	Lipoid adrenal hyperplasia	NM_000349.2	NM_000349.2:c.545G>T, NM_000349.2:c.559G>A, NM_000349.2:c.545G>A, NM_000349.2:c.749G>A, NM_000349.2:c.772C>T, NM_000349.2:c.562C>T, NM_000349.2:c.577C>T	Congenital lipoid adrenal hyperplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STAR gene located on chromosomal region 8p11.23. The age of onset is early. This disease is characterized by severe adrenal insufficiency and sex reversal in males. The prevalence is 1:300,000.	600
STIL	Microcephaly primary, type 7, autosomal recessive	NM_003035.2	NM_003035.2:c.3655delG, NM_003035.2:c.3715C>T, NM_003035.2:c.3843_3846delACAG, NM_003035.2:c.2392T>G, NM_003035.2:c.2826+1G>A	Autosomal recessive primary microcephaly type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STIL gene located on chromosomal region 1p33. The age of onset is early. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. The incidence is 1:1,000,000.	600
STRA6	Syndromic microphthalmia type 9	NM_022369.3	NM_022369.3:c.1678G>C, NM_022369.3:c.1699C>T, NM_022369.3:c.147delC, NM_022369.3:c.1521-1G>A, NM_022369.3:c.1964G>A, NM_022369.3:c.277_278insCC, NM_022369.3:c.1931C>T, NM_022369.3:c.1963C>T, NM_022369.3:c.69G>A, NM_022369.3:c.878C>T, NM_022369.3:c.910_911delGGinsAA, NM_022369.3:c.52_53delTAinsC, NM_022369.3:c.527_528insG	Syndromic microphthalmia type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRA6 gene located on chromosomal region 15q24.1. The age of onset is early. This disease is characterized by anophthalmia or severe microphthalmia, and pulmonary hypoplasia or aplasia. The prevalence is 1:10,000.	600
STRC	Deafness type 16, autosomal recessive	NM_153700.2	NM_153700.2:c.4561_4562insC, NM_153700.2:c.5188C>T, NM_153700.2:c.3556C>T, NM_153700.2:c.5168_5171delTTCT, NM_153700.2:c.5185C>T, NM_153700.2:c.4545+1G>C	Autosomal recessive nonsyndromic sensorineural deafness type DFNB16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRC gene located on chromosomal region 15q15.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	250,600
SUCLG1	Fatal infantile lactic acidosis with methylmalonic aciduria	NM_003849.3	NM_003849.3:c.152_153delAT, NM_003849.3:c.626C>A	Fatal infantile lactic acidosis with methylmalonic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SUCLG1 gene located on chromosomal region 2p11.2. The age of onset is early. This disease is characterized by polypnea, severe hypotonia, lethargy, and vomiting, after a silent period during which the children were considered as normal. Facial dysmorphism and cerebral malformations may be noted, as well as diverse organ involvement such as hypertrophic myocardiopathy, tubulopathy, or liver insufficiency.	600
SUOX	Sulfocysteinuria	NM_000456.2	NM_000456.2:c.37C>T, NM_000456.2:c.894_895delCT, NM_000456.2:c.650G>A, NM_000456.2:c.794C>A	Sulfocysteinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SUOX gene located on chromosome 12q13.13. The age of onset is early. This disease is characterized by seizures, reduced muscle tone, psychomotor retardation, lens dislocation.	600
TAF1	Dystonia-Parkinsonism, X-linked	NM_004606.4	NM_004606.4:c.417_418insCATAATCTATGATAATGATAAT	X-linked dystonia-parkinsonism follows an X-linked pattern of inheritance and is caused by pathogenic variants in the TAF1 gene located on chromosomal region Xq13.1. The age of onset is adult. This disease is characterized by adult-onset Parkinsonism that is frequently accompanied by focal dystonia, which becomes generalized over time, and that has a highly variable clinical course. The prevalence is 1:300,000.	600
TAT	Tyrosinemia type 2	NM_000353.2	NM_000353.2:c.1249C>T, NM_000353.2:c.236-5A>G, NM_000353.2:c.668C>G, NM_000353.2:c.1297C>T, NM_000353.2:c.169C>T	Tyrosinemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TAT gene located on chromosomal region 16q22.1. The age of onset is early. This disease is characterized by hypertyrosinemia with oculocutaneous manifestations and, in some cases, intellectual deficit. The prevalence is 1:100,000-1:120,000 newborn.	600
TBCE	Hypoparathyroidism-retardation-dysmorphism syndrome	NM_003193.4	NM_003193.4:c.1491_1492insGTAAA	Hypoparathyroidism - retardation - dysmorphism syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TBCE gene located on chromosomal region 1q42.3. The age of onset is early. This disease is characterized by congenital hypoparathyroidism, growth retardation, intellectual deficit, seizures, and dysmorphic features including microcephaly, facial, ocular and dental abnormalities, and short hands and feet.	600
TCAP	Cardiomyopathy, hypertrophic, type 25	NM_003673.3	NM_003673.3:c.260G>A, NM_003673.3:c.316C>T	Cardiomyopathy, hypertrophic, type 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by dyspnea, syncope, collapse, palpitations, and chest pain. They can be readily provoked by exercise. The disorder has inter- and intrafamilial variability ranging from benign to malignant forms with high risk of cardiac failure and sudden cardiac death.	250,600
TCAP	Limb-girdle muscular dystrophy type 2G	NM_003673.3	NM_003673.3:c.157C>T	Autosomal recessive limb-girdle muscular dystrophy type 2G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by muscle weakness in the four limbs, mild scapular winging, severe atrophy of the quadriceps and anterior tibialis muscles, calf hypertrophy, and lack of respiratory and cardiac involvement.	250,600
TCIRG1	Osteopetrosis type 1, autosomal recessive	NM_006019.3	NM_006019.3:c.1331G>T, NM_006019.3:c.1674-1G>A, NM_006019.3:c.179A>G, NM_006019.3:c.2236+1G>A, NM_006019.3:c.2415-3C>G, NM_006019.3:c.112_113delAG, NM_006019.3:c.1213G>A	Autosomal recessive osteopetrosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCIRG1 gene located on chromosomal region 11q13.2. The age of onset is early. This disease is characterized by bone marrow failure, fractures and visual impairment. The incidence is 1:200.000 live births and the prevalence is 1:250,000.	250,600
TECTA	Deafness type 21, autosomal recessive	NM_005422.2	NM_005422.2:c.2428C>T, NM_005422.2:c.2941+1G>A, NM_005422.2:c.651_652insC, NM_005422.2:c.4370_4371insTCAGTGCGACCCGC, NM_005422.2:c.4601G>A	Autosomal recessive nonsyndromic sensorineural deafness type DFNB21 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TECTA gene located on chromosomal region 11q23.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	600
TERT	Dyskeratosis congenita, autosomal recessive	NM_198253.2	NM_198253.2:c.1234C>T, NM_198253.2:c.835G>A, NM_198253.2:c.2701C>T, NM_198253.2:c.2431C>T	Dyskeratosis congenita, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TERT gene located on chromosomal region 5p15.33. The age of onset is early. This disease has a wide phenotypic spectrum and age onset. It usually manifests during childhood with the triad of dysplastic nails, lacy reticular pigmentation and atrophy of the skin at the level of the neck and upper chest, and oral leukoplakia. Patients show an increased risk for progressive bone marrow failure and may develop myelodysplastic syndrome or acute myelogenous leukemia at any age (the risk increasing with age). There is also an increased risk for solid tumors, typically squamous cell carcinoma of head and neck (see this term) or anogenital cancer. Various additional clinical findings have been reported and may include: developmental delay, short stature, microcephaly, blepharitis, epiphora, periodontal disease, taurodontism, decreased teeth/root ratio, esophageal stenosis, liver disease, urethral stenosis, osteoporosis, avascular necrosis of femur and/or humerus, premature hair greying/alopecia, or abnormal eyelashes. Individuals with DC are at high risk of pulmonary fibrosis. The prevalence is 1:1.000.000.	250,600
TFR2	Hemochromatosis, type 3	NM_003227.3	NM_003227.3:c.1330G>A, NM_003227.3:c.1403G>A, NM_003227.3:c.1469T>G, NM_003227.3:c.1235_1237delACA, NM_003227.3:c.1861_1872delGCCGTGGCCCAG, NM_003227.3:c.2343G>A, NM_003227.3:c.313C>T, NM_003227.3:c.1665delC, NM_003227.3:c.750C>G, NM_003227.3:c.840C>G, NM_003227.3:c.949C>T, NM_003227.3:c.515T>A, NM_003227.3:c.1632_1633delGA, NM_003227.3:c.2014C>T, NM_003227.3:c.2374G>A, NM_003227.3:c.1473+1G>A, NM_003227.3:c.1186C>T	Hemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000.	250,600
TH	Segawa syndrome, autosomal recessive	NM_000360.3	NM_000360.3:c.1141C>A, NM_000360.3:c.614T>C, NM_000360.3:c.733A>C, NM_000360.3:c.1388C>T, NM_000360.3:c.605G>A, NM_000360.3:c.917G>A	Segawa syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TH gene located on chromosomal region 11p15.5. This disease is characterized by dystonia presenting in infancy or early childhood. Dystonia is defined by the presence of sustained involuntary muscle contractions, often leading to abnormal postures. Some cases present with parkinsonian symptoms in infancy. Unlike all other forms of dystonia, it is an eminently treatable condition, due to a favorable response to L-DOPA. The prevalence is 1:1,000,000-9:1,000,000.	600
TIMM8A	Mohr-Tranebjaerg syndrome	NM_004085.3	NM_004085.3:c.198C>G, NM_004085.3:c.238C>T, NM_004085.3:c.112C>T	Mohr-Tranebjaerg syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the TIMM8A gene located on chromosomal region Xq22. The age of onset is infantile. This disease is characterized by hearing loss, followed by adolescent onset progressive dystonia or ataxia, visual impairment from early adulthood onwards and dementia from the 4th decade onwards. The prevalence is <1:1,000,000.	600
TK2	Mitochondrial DNA depletion syndrome type 2	NM_004614.4	NM_004614.4:c.323C>T, NM_004614.4:c.361C>A, NM_004614.4:c.373C>T, NM_004614.4:c.500G>A, NM_004614.4:c.604_606delAAG, NM_004614.4:c.635T>A, NM_004614.4:c.623A>G, NM_004614.4:c.159C>G, NM_004614.4:c.268C>T	Mitochondrial DNA depletion syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TK2 gene located on chromosomal region 16q21. The age of onset is infantile. This disease is characterized by generalized hypotonia, proximal muscle weakness, loss of previously acquired motor skills, poor feeding, and respiratory difficulties leading to respiratory failure and death within a few years after diagnosis. The prevalence is 1.2:100,000.	250,600
TMC1	Deafness type 7, autosomal recessive	NM_138691.2	NM_138691.2:c.1763+3A>G, NM_138691.2:c.1842G>A, NM_138691.2:c.100C>T, NM_138691.2:c.1165C>T, NM_138691.2:c.425G>A, NM_138691.2:c.454-1G>C, NM_138691.2:c.1960A>G	Autosomal recessive nonsyndromic sensorineural deafness type DFNB7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMC1 gene located on chromosomal region 9q21.13. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	600
TMEM216	Joubert syndrome type 2	NM_001173990.2	NM_001173990.2:c.218G>T, NM_001173990.2:c.218G>A, NM_001173990.2:c.79_82delAACG	Joubert syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM216 gene located on chromosomal region 11q12.2. The age of onset is early. This disease is characterized by the neurological features associated with both renal and ocular disease; retinal involvement (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:80,000-1:100,000.	600
TMEM216	Meckel syndrome type 2	NM_001173990.2	NM_001173990.2:c.230G>C, NM_001173990.2:c.253C>T, NM_001173990.2:c.341T>G	Meckel syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM216 gene located on chromosomal region 11q12.2. The age of onset is antenatal. It is a disorder characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically encephalocele), hepatic ductal dysplasia and cysts, and polydactyly. The prevalence is 1:80,000-1:100,000.	600
TMEM67	COACH syndrome	NM_153704.5	NM_153704.5:c.1769T>C, NM_153704.5:c.2498T>C	COACH syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is variable. This disease is characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable.	250,600
TMEM67	Joubert syndrome type 6	NM_153704.5	NM_153704.5:c.130C>T, NM_153704.5:c.148_149insTAAT, NM_153704.5:c.1538A>G	Joubert syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is infantile. This disease is characterized by an irregular breathing pattern (episodic tachypnea and/or apnea), and nystagmus. During infancy, hypotonia may appear. Cerebellar ataxia (staggering gait and imbalance) may develop later. Delayed acquisition of motor milestones is common. Cognitive abilities are variable, ranging from severe intellectual deficit to normal intelligence. Neuro-ophthalmologic examination may show oculomotor apraxia. In some cases, seizures occur. Careful examination of the face shows a characteristic appearance: large head, prominent forehead, high rounded eyebrows, epicanthal folds, ptosis (occasionally), an upturned nose with prominent nostrils, an open mouth (which tends to have an oval shape early on, a 'rhomboid' appearance later, and finally can appear triangular with downturned angles), tongue protrusion and rhythmic tongue motions, and occasionally low-set and tilted ears. Other features sometimes present in Joubert syndrome include retinal dystrophy, nephronophthisis, and polydactyly. The prevalence is 1:80,000-1:100,000.	250,600
TMEM67	Meckel syndrome type 3	NM_153704.5	NM_153704.5:c.1309C>G, NM_153704.5:c.755T>C, NM_153704.5:c.1046T>C, NM_153704.5:c.653G>C, NM_153704.5:c.406+1402_406+1403insTAAT, NM_153704.5:c.622A>T	Meckel syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is variable. This disease is characterized multiple congenital anomaly disorder characterized by the triad of brain malformation mainly occipital encephalocele (see this term), large polycystic kidneys, and polydactyly as well as associated abnormalities that may include cleft lip/palate (see these terms), cardiac and genital anomalies, central nervous system (CNS) malformations, liver fibrosis, and bone dysplasia.	250,600
TMIE	Deafness type 6, autosomal recessive	NM_147196.2	NM_147196.2:c.241C>T, NM_147196.2:c.250C>T, NM_147196.2:c.170G>A, NM_147196.2:c.257G>A	Autosomal recessive nonsyndromic sensorineural deafness type DFNB6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMIE gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness.	600
TMPRSS3	Deafness types 8/10, autosomal recessive	NM_024022.2	NM_024022.2:c.1211C>T, NM_024022.2:c.1276G>A, NM_024022.2:c.1159G>A, NM_024022.2:c.413C>A, NM_024022.2:c.446+1G>T, NM_024022.2:c.647G>T, NM_024022.2:c.753G>C, NM_024022.2:c.646C>T, NM_024022.2:c.208delC, NM_024022.2:c.242C>G	Autosomal recessive nonsyndromic sensorineural deafness type DFNB10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMPRSS3 gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness.	250,600
TNNT1	Nemaline myopathy type 5	NM_003283.5	NM_003283.5:c.538G>T	Nemaline myopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TNNT1 gene located on chromosomal region 19q13.4. The age of onset is from birth to adulthood. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:50,000 newborn.	600
TPP1	Neuronal ceroid-lipofuscinoses type 2	NM_000391.3	NM_000391.3:c.1093T>C, NM_000391.3:c.616C>T, NM_000391.3:c.622C>T, NM_000391.3:c.1340G>A, NM_000391.3:c.141_144delGAGT, NM_000391.3:c.827A>T, NM_000391.3:c.509-1G>C, NM_000391.3:c.851G>T	Neuronal ceroid lipofuscinosis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPP1 gene located on chromosomal region 11p15.4. Age of onset is infantile. This disease is characterized by epilepsy, followed by regression of developmental milestones, myoclonic ataxia, and pyramidal signs. Visual impairment typically appears at age four to six years and rapidly progresses to light/dark awareness only. Life expectancy ranges from age six years to early teenage. The prevalence is 1.5:1,000,000-9:1,000,000.	250,600
TPRN	Deafness type 79, autosomal recessive	NM_001128228.2	NM_001128228.2:c.1427delC, NM_001128228.2:c.1239G>A	Autosomal recessive nonsyndromic sensorineural deafness type DFNB79 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPRN gene located on chromosomal region 9q34.3. The age of onset is early. This disease is characterized by hearing loss and deafness.	600
TREX1	Aicardi-Goutieres syndrome type 1	NM_033629.4	NM_033629.4:c.341G>A, NM_033629.4:c.144_145insC, NM_033629.4:c.490C>T, NM_033629.4:c.506G>A	Aicardi-Goutières syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TREX1 gene located on chromosomal region 3p21.31. The age of onset is early. This disease is characterized by subacute encephalopathy (feeding problems, irritability and psychomotor regression or delay) associated with epilepsy (53% of cases), chilblain skin lesions on the extremities (43% of cases) and episodes of aseptic febrile illness (40% of cases). The prevalence is <1:1,000,000.	600
TRIM32	Limb-girdle muscular dystrophy type 2H	NM_012210.3	NM_012210.3:c.1459G>A, NM_012210.3:c.1560delC	Autosomal recessive limb-girdle muscular dystrophy type 2H follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIM32 gene located on chromosomal region 9q31-q33. The age of onset is variable. This disease is characterized by proximal muscle weakness and facial muscle wasting.	600
TRIM37	Mulibrey nanism	NM_015294.3	NM_015294.3:c.1346_1347insA, NM_015294.3:c.1411C>T, NM_015294.3:c.1037_1040dupAGAT, NM_015294.3:c.2056C>T, NM_015294.3:c.2212delG, NM_015294.3:c.227T>C, NM_015294.3:c.326G>C, NM_015294.3:c.496_500delAGGAA, NM_015294.3:c.745C>T, NM_015294.3:c.965G>T, NM_015294.3:c.1478_1479delAG, NM_015294.3:c.1668-1G>C	Mulibrey nanism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIM37 gene located on chromosomal region 17q22. The age of onset is prenatal. This disease is characterized by pre- and postnatal growth restriction, characteristic craniofacial features with scaphocephaly, triangular face, high and broad forehead, low nasal bridge and yellowish dots in retinal mid peripheral region. The prevalence is <1:1,000,000.	600
TRIOBP	Deafness type 28, autosomal recessive	NM_001039141.2	NM_001039141.2:c.2362C>T, NM_001039141.2:c.3194delT, NM_001039141.2:c.1039C>T, NM_001039141.2:c.1741C>T, NM_001039141.2:c.4577C>G, NM_001039141.2:c.2639_2640insTCAC, NM_001039141.2:c.5316G>A, NM_001039141.2:c.3202C>T, NM_001039141.2:c.4429_4430insG	Deafness autosomal recessive type 28 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIOBP gene located on chromosomal region 22q13.1. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	250,600
TSEN54	Pontocerebellar hypoplasia	NM_207346.2	NM_207346.2:c.670_671delAA, NM_207346.2:c.736C>T, NM_207346.2:c.1027C>T, NM_207346.2:c.1039A>T, NM_207346.2:c.887G>A, NM_207346.2:c.919G>T	Pontocerebellar hypoplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSEN54 gene located on chromosomal region 17q25.1. Pontocerebellar hypoplasia (PCH) refers to a group of severe neurodegenerative disorders affecting growth and function of the brainstem and cerebellum, resulting in little or no development. Different types were classified based on the clinical picture and the spectrum of pathologic changes.	250,600
TSFM	Combined oxidative phosphorylation deficiency type 3	NM_001172696.1	NM_001172696.1:c.1_2delAT, NM_001172696.1:c.580delC, NM_001172696.1:c.919C>T, NM_001172696.1:c.21_22delGC	Combined oxidative phosphorylation deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSFM gene located on chromosomal region 12q14.1. The age of onset is early. This disease is characterized by hypotonia, lactic acidosis, and hepatic insufficiency, with progressive encephalomyopathy or hypertrophic cardiomyopathy.	250,600
TSHB	Isolated thyroid-stimulating hormone deficiency	NM_000549.4	NM_000549.4:c.94G>T, NM_000549.4:c.205C>T, NM_000549.4:c.145G>A	Isolated thyroid-stimulating hormone deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSHB gene located on chromosomal region 1p13. The age of onset is early. This disease is characterized by decreased activity and increased sleep, feeding difficulty and constipation, prolonged jaundice, myxedematous facies, large fontanels (especially posterior), macroglossia, a distended abdomen with umbilical hernia and hypotonia. Slow linear growth and developmental delay are usually apparent by 4-6 months of age.	600
TSHR	Hypothyroidism	NM_000369.2	NM_000369.2:c.100G>A, NM_000369.2:c.1170T>G, NM_000369.2:c.484C>G, NM_000369.2:c.500T>A, NM_000369.2:c.122G>C, NM_000369.2:c.326G>A, NM_000369.2:c.1741_1742insC, NM_000369.2:c.202C>T	Hypothyroidism due to TSH receptor mutations follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSHR gene located on chromosomal region 14q31. The age of onset is early. This disease is characterized by decreased activity and increased sleep, feeding difficulty and constipation, prolonged jaundice, myxedematous facies, large fontanels (especially posterior), macroglossia, a distended abdomen with umbilical hernia, and hypotonia. Slow linear growth and developmental delay are usually apparent by 4-6 months of age. Without treatment CH results in severe intellectual deficit and short stature. The prevalence is 1:3,000-1:4,000 newborn.	250,600
TTN	Cardiomyopathy, dilated/Tibial muscular dystrophy	NM_133378.4	NM_133378.4:c.13149C>A, NM_133378.4:c.22246G>A, NM_133378.4:c.31780G>A, NM_133378.4:c.40211dupT, NM_133378.4:c.44668delG, NM_133378.4:c.52977dupT, NM_133378.4:c.61640C>G, NM_133378.4:c.84669_84675delTGAATTC, NM_133378.4:c.94567C>T, NM_133378.4:c.96388C>T, NM_133378.4:c.96388delC, NM_133378.4:c.98366_98367delAT, NM_133378.4:c.12064C>T, NM_133378.4:c.28739-1G>A, NM_133378.4:c.3165-1G>T, NM_133378.4:c.4724_4728delTGAAA, NM_133378.4:c.48944-1G>A, NM_133378.4:c.91114_91117delTCCA, NM_133378.4:c.100185delA, NM_133378.4:c.40549delA, NM_133378.4:c.24568_24571delAGCA	Cardiomyopathy, dilated/Tibial muscular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTN gene located on chromosomal region 2q31.2. The age of onset is variable. This disease is characterized by slowly progressive weakness and atrophy of the anterior tibial muscles with decreased dorsiflexion. Sometimes it could be companied by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death. The prevalence is >9:100,000.	250,600
TTPA	Ataxia with vitamin E deficiency	NM_000370.3	NM_000370.3:c.661C>T, NM_000370.3:c.744delA, NM_000370.3:c.575G>A	Ataxia with vitamin E deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTPA gene located on chromosomal region 8q13. The age of onset is variable. This disease is characterized by progressive spino-cerebellar ataxia, loss of proprioception, areflexia, and is associated with a marked deficiency in vitamin E. The prevalence is 0.56:1,000,000-3.5:1,000,000.	250,600
TULP1	Leber congenital amaurosis type 15	NM_003322.4	NM_003322.4:c.1198C>T, NM_003322.4:c.1204G>T	Leber congenital amaurosis 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TULP1 gene located on chromosomal region 6p21.31. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.	600
TULP1	Retinitis pigmentosa type 14	NM_003322.4	NM_003322.4:c.1259G>C, NM_003322.4:c.1318C>T, NM_003322.4:c.1471T>C, NM_003322.4:c.1511_1521delTGCAGTTCGGC, NM_003322.4:c.1376T>A, NM_003322.4:c.1444C>T	Retinitis pigmentosa type 14 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TULP1 gene located on chromosomal region 6p21.31. The age of onset is early. This disease is characterized by night blindness often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1/4,000.	600
TYR	Oculocutaneous albinism type 1	NM_000372.4	NM_000372.4:c.1012_1013insC, NM_000372.4:c.1146C>A, NM_000372.4:c.1164delT, NM_000372.4:c.1177delG, NM_000372.4:c.1147G>A, NM_000372.4:c.115T>G, NM_000372.4:c.1255G>A, NM_000372.4:c.1265G>A, NM_000372.4:c.1209G>T, NM_000372.4:c.1217C>T, NM_000372.4:c.140G>A, NM_000372.4:c.1467dupT, NM_000372.4:c.1501dupC, NM_000372.4:c.164G>A, NM_000372.4:c.1A>G, NM_000372.4:c.230G>A, NM_000372.4:c.242C>T, NM_000372.4:c.265T>C, NM_000372.4:c.272G>A, NM_000372.4:c.286dupA, NM_000372.4:c.533G>A, NM_000372.4:c.1336G>A, NM_000372.4:c.1342G>A, NM_000372.4:c.646T>A, NM_000372.4:c.650G>A, NM_000372.4:c.823G>T, NM_000372.4:c.896G>A, NM_000372.4:c.1111A>G, NM_000372.4:c.1118C>A, NM_000372.4:c.325G>A, NM_000372.4:c.572delG, NM_000372.4:c.616G>A	Oculocutaneous albinism type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYR gene located on chromosomal region 11q14.2. The age of onset is early. This disease is characterized by white hair and skin, blue, fully translucent irises, nystagmus and misrouting of the optic nerves.	250,600
TYRP1	Oculocutaneous albinism type 3	NM_000550.2	NM_000550.2:c.107delT, NM_000550.2:c.1103delA, NM_000550.2:c.1057_1060delAACA, NM_000550.2:c.1067G>A, NM_000550.2:c.1557T>G, NM_000550.2:c.176C>G, NM_000550.2:c.497C>G, NM_000550.2:c.1120C>T, NM_000550.2:c.1369_1370insCAGA	Type 3 oculocutaneous albinism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYRP1 gene located on chromosomal region 9p23. The age of onset is early. This disease is characterized by rufous or brown albinism and occurring mainly in the African population. The prevalence is of 1/8,500 individuals in Africa.	250,600
UBA1	Spinal muscular atrophy type 2, X-linked	NM_003334.3	NM_003334.3:c.1731C>T	X-linked spinal muscular atrophy type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the UBA1 gene located on chromosomal region Xp11.23. The age of onset is infantile. This disease is characterized by congenital hypotonia and areflexia and evidence of degeneration and loss of anterior horn cells (i.e., lower motor neurons) in the spinal cord and brain stem. Often congenital contractures and/or fractures are present. Life span is shortened because of progressive ventilatory insufficiency resulting from chest muscle involvement.	600
UBR1	Johanson-Blizzard syndrome	NM_174916.2	NM_174916.2:c.869C>G, NM_174916.2:c.4254G>A, NM_174916.2:c.1281+1G>T, NM_174916.2:c.1537C>T	Johanson-Blizzard syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UBR1 gene located on chromosomal region 15q15.2. The age of onset is early. This disease is characterized by congenital exocrine pancreatic insufficiency and aplasia/hypoplasia of alae nasi, together with a variety of other abnormalities including aplasia cutis, anorectal anomalies and failure to thrive. The prevalence is <1:1,000,000.	600
UGT1A1	Crigler-Najjar syndrome type 1	NM_000463.2	NM_000463.2:c.1021C>T, NM_000463.2:c.1070A>G	Crigler-Najjar syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by severe neonatal unconjugated hyperbilirubinemia, persistent jaundice and bilirubin encephalopathy manifesting as hypotonia, deafness, oculomotor palsy and lethargy. Neurologic defects can occur, generally associated with intellectual and motor impairment.	250,600
UGT1A1	Crigler-Najjar syndrome type 2	NM_000463.2	NM_000463.2:c.1207C>T, NM_000463.2:c.674T>G, NM_000463.2:c.1130G>T, NM_000463.2:c.524T>A, NM_000463.2:c.44T>G	Crigler-Najjar syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by unconjugated hyperbilirubinemia due to reduced and inducible activity of hepatic bilirubin glucuronosyltransferase with pigmented bile that contains bilirubin glucuronides, and generally do not present neurologic or intellectual impairment. Bilirubin encephalopathy may develop in later life when patients experience a superimposed infection or stress.	250,600
UGT1A1	Gilbert syndrome	NM_000463.2	NM_000463.2:c.1211T>C, NM_000463.2:c.1456T>G	Gilbert syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by jaundice due to unconjugated hyperbilirubinemia, resulting a partial deficiency in hepatic bilirubin glucuronosyltransferase activity.	250,600
UQCRB	Mitochondrial complex III deficiency, nuclear type 3	NM_006294.4	NM_006294.4:c.306_309delAAAA	Mitochondrial complex III deficiency, nuclear type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UQCRB gene located on chromosomal region 8q22.1. The age of onset is infantile. This disease is characterized by a highly variable phenotype depending on which tissues are affected. Clinical features include mitochondrial encephalopathy, psychomotor retardation, ataxia, severe failure to thrive, liver dysfunction, renal tubulopathy, muscle weakness and exercise intolerance.	600
UQCRQ	Mitochondrial complex III deficiency, nuclear type 4	NM_014402.4	NM_014402.4:c.134C>T	Mitochondrial complex III deficiency, nuclear type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UQCRQ gene located on chromosomal region 5q31.1. The age of onset is infantile. This disease is characterized by severe psychomotor retardation and extrapyramidal signs. Neurologic features included dystonia, athetoid movements, ataxia, mild axial hypotonia, increased tone, hyperreflexia, and inability to walk unsupported.	600
USH1C	Usher syndrome type 1C	NM_153676.3	NM_153676.3:c.216G>A, NM_153676.3:c.2362G>A, NM_153676.3:c.2622_2623delCA, NM_153676.3:c.2688_2695dupAATTCACC, NM_153676.3:c.238_239insC, NM_153676.3:c.238delC, NM_153676.3:c.2547-1G>T, NM_153676.3:c.2695_2696insAATTCACC, NM_153676.3:c.388G>A	Usher syndrome type 1C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1C gene located on chromosomal region 11p15.1. The age of onset is infantile. This disease is characterized by the association of sensorineural deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 3:100,000-4:100,000.	250,600
USH1G	Usher syndrome type 1G	NM_173477.4	NM_173477.4:c.186_187delCA, NM_173477.4:c.394_395insG, NM_173477.4:c.832_851delTCGGACGAGGACAGCGTCTC, NM_173477.4:c.649C>T, NM_173477.4:c.805C>T	Usher syndrome type 1G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1G gene located on chromosomal region 17q25.1. The age of onset is infantile. This disease is characterized by the association of sensorineural deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 4.4:100,000.	600
USH2A	Retinitis pigmentosa type 39	NM_206933.2	NM_206933.2:c.10073G>A, NM_206933.2:c.2296T>C, NM_206933.2:c.14519T>C, NM_206933.2:c.7364G>A, NM_206933.2:c.12574C>T, NM_206933.2:c.2276G>T	Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 39 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.	250,600
USH2A	Usher syndrome type 2A	NM_206933.2	NM_206933.2:c.10636G>A, NM_206933.2:c.10561T>C, NM_206933.2:c.15371delT, NM_206933.2:c.2167+5G>A, NM_206933.2:c.11864G>A, NM_206933.2:c.14803C>T, NM_206933.2:c.2898delG, NM_206933.2:c.3491_3492delCT, NM_206933.2:c.11549-5_11549-4insT, NM_206933.2:c.2299delG, NM_206933.2:c.5975A>G, NM_206933.2:c.6670G>T, NM_206933.2:c.6862G>T, NM_206933.2:c.5743_5744delAG, NM_206933.2:c.779T>G, NM_206933.2:c.820C>T, NM_206933.2:c.8981G>A, NM_206933.2:c.956G>A, NM_206933.2:c.9799T>C, NM_206933.2:c.15089C>A, NM_206933.2:c.2135delC, NM_206933.2:c.4338_4339delCT, NM_206933.2:c.5573-2A>G, NM_206933.2:c.920_923dupGCCA, NM_206933.2:c.13709delG, NM_206933.2:c.14926G>A, NM_206933.2:c.15520-1G>A, NM_206933.2:c.8431C>A, NM_206933.2:c.12234_12235delGA, NM_206933.2:c.14442C>A	Usher syndrome type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. The age of onset is infantile. This disease is characterized by the association of sensorineural deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 3:100,000-4:100,000.	250,600
VDR	Rickets, vitamin D-resistant, type 2A	NM_001017535.1	NM_001017535.1:c.137G>A, NM_001017535.1:c.149G>A, NM_001017535.1:c.885C>A, NM_001017535.1:c.88C>T, NM_001017535.1:c.239G>A, NM_001017535.1:c.821G>T, NM_001017535.1:c.88C>G, NM_001017535.1:c.915C>G, NM_001017535.1:c.985G>A	Vitamin D-dependent rickets type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VDR gene located on chromosomal region 12q13.11. The age of onset is early. This disease is characterized by hypocalcemia, severe rickets and in many cases alopecia. The prevalence is 1:10,000-5:10,000.	600
VLDLR	Cerebellar ataxia, mental retardation, and dysequilibrium syndrome type 1	NM_003383.3	NM_003383.3:c.2339delT, NM_003383.3:c.2302_2303delGA, NM_003383.3:c.844C>T, NM_003383.3:c.769C>T	Cerebellar ataxia - intellectual deficit - dysequilibrium syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VLDLR gene located on chromosomal region 9p24.2. The age of onset is early. This disease is characterized by non-progressive congenital ataxia that is predominantly truncal and results in delayed ambulation, moderate-to-profound intellectual disability, dysarthria, strabismus, and seizures. The prevalence is 1:100,000-9:100,000.	600
VPS13A	Choreoacanthocytosis	NM_033305.2	NM_033305.2:c.622C>T, NM_033305.2:c.9109C>T, NM_033305.2:c.2898T>G, NM_033305.2:c.3091delG, NM_033305.2:c.9275+1G>T	Chorea-acanthocytosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VPS13A gene located on chromosomal region 9q21. The age of onset is adult. This disease is characterized by progressive neurological symptoms including movement disorders, psychiatric manifestations and cognitive disturbances.	600
VPS33B	Arthrogryposis-renal dysfunction-cholestasis type 1	NM_018668.4	NM_018668.4:c.1246C>T, NM_018668.4:c.1312C>T, NM_018668.4:c.1498G>A, NM_018668.4:c.440_449delCTCTTGATGT, NM_018668.4:c.1594C>T, NM_018668.4:c.1480-1G>T, NM_018668.4:c.603+2T>A	Arthrogryposis - renal dysfunction – cholestasis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VPS33B gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by neurogenic arthrogryposis multiplex congenita, renal tubular dysfunction and neonatal cholestasis. The prevalence is <1:1,000,000.	600
WAS	Neutropenia, severe congenital, X-linked	NM_000377.2	NM_000377.2:c.881T>C, NM_000377.2:c.809T>C, NM_000377.2:c.814T>C	X-linked severe congenital neutropenia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the WAS gene located on chromosomal region Xp11.23. The age of onset is early. This disease is characterized by recurrent major bacterial infections, severe congenital neutropenia, and monocytopenia. The prevalence is <1:1,000,000.	600
WAS	Thrombocytopaenia type 1	NM_000377.2	NM_000377.2:c.167C>T, NM_000377.2:c.173C>G, NM_000377.2:c.1442T>A	Thrombocytopaenia type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the WAS gene located on chromosomal region Xp11.23. The age of onset is early. Thrombocytopenia is defined by a decrease in the number of platelets in circulating blood, resulting in the potential for increased bleeding and decreased ability for clotting. The prevalence is <1:1,000,000.	600
WAS	Wiskott-Aldrich syndrome	NM_000377.2	NM_000377.2:c.134C>T	Wiskott-Aldrich síndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the WAS gene located on chromosomal region Xp11.23. The age of onset is infantile. This disease is characterized by microthrombocytopenia, eczema, infections and an increased risk for autoimmune manifestations and malignancies. The incidence is less than 1 in 100,000 live births and the prevalence is 1:1,000,000-10:1,000,000 men.	600
WDR62	Microcephaly primary, type 2, autosomal recessive	NM_001083961.1	NM_001083961.1:c.1313G>A, NM_001083961.1:c.3514+1delG, NM_001083961.1:c.3574delA, NM_001083961.1:c.1408C>T, NM_001083961.1:c.193G>A, NM_001083961.1:c.702dupG, NM_001083961.1:c.671G>C, NM_001083961.1:c.557G>A	Autosomal recessive primary microcephalyc type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WDR62 gene located on chromosomal region 19q13.12. The age of onset is early. This disease is characterized by reduced head circumference at birth without gross anomalies of brain architecture and variable degrees of intellectual impairment. The incidence is 1:1,000,000.	600
WFS1	Wolfram syndrome	NM_006005.3	NM_006005.3:c.1234_1237delGTCT, NM_006005.3:c.1511C>T, NM_006005.3:c.2168T>C, NM_006005.3:c.2171C>T, NM_006005.3:c.1944G>A, NM_006005.3:c.2084G>T, NM_006005.3:c.577A>C, NM_006005.3:c.676C>T, NM_006005.3:c.2327A>T, NM_006005.3:c.407_408insGGGCCGTCGCGAGGCT, NM_006005.3:c.2576G>A, NM_006005.3:c.2643_2644delCT, NM_006005.3:c.616C>T, NM_006005.3:c.1060_1062delTTC, NM_006005.3:c.400G>A, NM_006005.3:c.1943G>A, NM_006005.3:c.1230_1233delCTCT	Wolfram syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WFS1 gene located on chromosomal region 4p16.1. The age of onset is infantile. This disease is characterized by diabetes mellitus type I, diabetes insipidus, optical atrophy and neurological signs. The prevalence is 1:1,000,000-9:1,000,000.	250,600
WNT10A	Hypohidrotic ectodermal dysplasia, autosomal recessive	NM_025216.2	NM_025216.2:c.347T>C, NM_025216.2:c.383G>A, NM_025216.2:c.321C>A	Hypohidrotic ectodermal displasia, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by sparse hair (atrichosis or hypotrichosis), abnormal or missing teeth and the inability to sweat due to the absence of sweat glands. The prevalence is <1:1,000,000.	250,600
WNT10A	Odontoonychodermal dysplasia	NM_025216.2	NM_025216.2:c.697G>T	Odonto-onycho-dermal dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by hyperkeratosis and hyperhidrosis of the palms and soles, atrophic malar patches, hypodontia, conical teeth, onychodysplasia, and dry and sparse hair. The prevalence is <1:1,000,000.	250,600
WNT7A	Fuhrmann syndrome	NM_004625.3	NM_004625.3:c.874C>T	Fuhrmann syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT7A gene located on chromosomal region 3p25.1. The age of onset is neonatal/infancy. This disease is characterized by bowing of the femora, aplasia or hypoplasia of the fibulae and poly-, oligo-, and syndactyly. Most of the patients also have a hypoplastic pelvis and hypoplasia of the fingers and fingernails. Some had congenital dislocation of the hip, absence or fusion of tarsal bones, absence of various metatarsals, and hypoplasia and aplasia of the toes. The prevalence is <1:1,000,000.	600
WNT7A	Ulna and fibula, absence of, with sever limb deficiency	NM_004625.3	NM_004625.3:c.325G>A	Aplasia/hypoplasia of limbs and pelvis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT7A gene located on chromosomal region 3p25.1. The age of onset is early. This disease is characterized by intercalary limb deficiencies (phocomelia sometimes combined with polydactyly, oligodactyly or ectrodactyly), absent or hypoplastic pelvic bones (including sacral agenesis or hypoplasia), skull defects (frequently a defect of the occipital bone with or without meningocele)	600
XPA	Xeroderma pigmentosum Group A	NM_000380.3	NM_000380.3:c.323G>T, NM_000380.3:c.619C>T, NM_000380.3:c.727C>T, NM_000380.3:c.731A>G, NM_000380.3:c.348T>A, NM_000380.3:c.501delG	Xeroderma pigmentosum complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the gene XPA located on chromosomal region 9q22.33. The age of onset is variable. This disease is characterized by photosensitivity of skin with burning, freckling, and skin cancers. It is associated with a spectrum of mild to severe neurological anomalies (e.g. cognitive deterioration, dysarthria, balance disturbance, areflexia) and sometimes delay of growth and sexual development. The prevalence is 1:1,000,000.	600
ZFYVE26	Spastic paraplegia type 15, autosomal recessive	NM_015346.3	NM_015346.3:c.3206G>A, NM_015346.3:c.3642_3643insCCACACTTAG, NM_015346.3:c.1477C>T, NM_015346.3:c.2887G>C, NM_015346.3:c.5422C>T, NM_015346.3:c.5485-1G>A, NM_015346.3:c.4312C>T, NM_015346.3:c.4936C>T, NM_015346.3:c.3182delT, NM_015346.3:c.2114_2115insC	Spastic paraplegia type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZFYVE26 gene located on chromosomal region 14q24.1. The age of onset is infancy. This disease is characterized by progressive spasticity primarily affecting the lower limbs. It is a complex form of spastic paraplegia, associated with other neurologic dysfunction, including variable mental retardation, hearing and visual defects, and thin corpus callosum. The prevalence is <1 / 1,000,000.	250,600
ZMPSTE24	Mandibuloacral dysplasia with type B lipodystrophy	NM_005857.4	NM_005857.4:c.121C>T, NM_005857.4:c.1263dupT, NM_005857.4:c.1018T>C, NM_005857.4:c.955-1G>A, NM_005857.4:c.1349G>A	Mandibuloacral dysplasia with type B lipodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZMPSTE24 gene located on chromosomal region 1p34.2. The age of onset is early. This disease is characterized by postnatal growth retardation, craniofacial anomalies and skeletal malformations, such as mandibular and clavicular hypoplasia; mottled cutaneous pigmentation and generalized lipoatrophy.	600
ZMPSTE24	Restrictive dermopathy, lethal	NM_005857.4	NM_005857.4:c.1076_1077insT, NM_005857.4:c.54dupT, NM_005857.4:c.1085_1086insT	Lethal restrictive dermopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZMPSTE24 gene located on chromosomal region 1p34.2. The age of onset is early. This disease is characterized by the skin being drawn tightly over the face causing a narrow, pinched nose, small mouth, limited jaw mobility, and entropion. Ears are malformed, with the auricle attached to the skin of scalp. Most infants die after a few hours from pulmonary distress. The prevalence is <1:1,000,000.	600
ZNF469	Brittle cornea syndrome	NM_001127464.1	NM_001127464.1:c.6673delC, NM_001127464.1:c.11452_11453insC, NM_001127464.1:c.4174G>T	Brittle cornea syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZNF469 gene located on chromosomal region 16q24.2. The age of onset is infantile. This disease is characterized by severe ocular manifestations due to extreme corneal thinning and fragility with rupture in the absence of significant trauma. BCS generally progresses to blindness. The prevalence is <1:1,000,000.	600

Gene	Disease	Transcript	Mutations	Disease.description	products
ABCA4	Stargardt disease type 1; Cone-rod dystrophy type 3	NM_000350.2	NM_000350.2:c.6449G>A, NM_000350.2:c.6394G>T, NM_000350.2:c.6320G>A, NM_000350.2:c.6118C>T, NM_000350.2:c.6089G>A, NM_000350.2:c.5912T>G, NM_000350.2:c.5882G>A, NM_000350.2:c.5881G>A, NM_000350.2:c.5819T>C, NM_000350.2:c.5714+5G>A, NM_000350.2:c.5512delC, NM_000350.2:c.5461-10T>C, NM_000350.2:c.5338C>G, NM_000350.2:c.4793C>A, NM_000350.2:c.4469G>A, NM_000350.2:c.4457C>T, NM_000350.2:c.4429C>T, NM_000350.2:c.4139C>T, NM_000350.2:c.3970delG, NM_000350.2:c.3364G>A, NM_000350.2:c.3322C>T, NM_000350.2:c.3210_3211dupGT, NM_000350.2:c.3106G>A, NM_000350.2:c.3083C>T, NM_000350.2:c.2791G>A, NM_000350.2:c.2616_2617delCT, NM_000350.2:c.2588G>C, NM_000350.2:c.2300T>A, NM_000350.2:c.2160+1G>T, NM_000350.2:c.1964T>G, NM_000350.2:c.1938-1G>A, NM_000350.2:c.1848delA, NM_000350.2:c.1804C>T, NM_000350.2:c.1771delT, NM_000350.2:c.1755delA, NM_000350.2:c.1622T>C, NM_000350.2:c.1225delA, NM_000350.2:c.1222C>T, NM_000350.2:c.1018T>G, NM_000350.2:c.763C>T, NM_000350.2:c.634C>T, NM_000350.2:c.286A>G, NM_000350.2:c.67-2A>G, NM_000350.2:c.52C>T	Stargardt disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by progressive central vision loss, mild loss of color vision, delayed dark adaptation and macular atrophy with or without paramacular flecks and degeneration of the underlying retinal pigment ephitelium. The estimated prevalence is 1:8,000-10,000. Mutations in the ABCA4 gene account also for 30 to 60 percent of cases of cone-rod dystrophy that are inherited in an autosomal recessive pattern. The problems associated with this condition include a loss of visual sharpness (acuity), an increased sensitivity to light (photophobia), and impaired color vision. These vision problems worsen over time.	600,25
ABCB7	X-linked sideroblastic anemia and ataxia (XLSA/A)	NM_004299.4	NM_004299.4:c.1300G>A, NM_004299.4:c.1234G>C, NM_004299.4:c.1203T>G	XLSA/A is caused by pathogenic variants in the ABCB7 gene located on chromosomal region Xq13.3. The age of onset is neonatal/infantile. XLSA/A is a rare condition characterized by a blood disorder called sideroblastic anemia and movement problems known as ataxia. This condition occurs only in males. People with X-linked sideroblastic anemia and ataxia have mature red blood cells that are smaller than normal (microcytic) and appear pale (hypochromic) because of the shortage of hemoglobin. This disorder also leads to an abnormal accumulation of iron in red blood cells but does not cause a potentially dangerous buildup of iron in the body. The anemia is typically mild and usually does not cause any symptoms. The prevalence is very rare, estimated at <1:1,000,000.	600
ACAD9	Mitochondrial complex I deficiency due to ACAD9	NM_014049.4	NM_014049.4:c.23delT, NM_014049.4:c.130T>A, NM_014049.4:c.359delT, NM_014049.4:c.453+1G>A, NM_014049.4:c.797G>A, NM_014049.4:c.976G>C, NM_014049.4:c.1240C>T, NM_014049.4:c.1249C>T, NM_014049.4:c.1594C>T	Mitochondrial complex I deficiency due to ACAD9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAD9 gene located on chromosomal region 3q21.3. The age of onset is neonatal/infantile. This disease is a multisystem disorder characterized by infantile onset of acute metabolic acidosis, hypertrophic cardiomyopathy, and muscle weakness associated with a deficiency of mitochondrial complex I activity in muscle, liver, and fibroblasts (summary by Haack et al., 2010).	600,25
ACADM	Medium-chain acyl-CoA dehydrogenase deficiency	NM_001286043.1	NM_001286043.1:c.250C>T, NM_001286043.1:c.386-2A>G, NM_001286043.1:c.461C>T, NM_001286043.1:c.548_551delCTGA, NM_001286043.1:c.546G>A, NM_001286043.1:c.715C>T, NM_001286043.1:c.716G>A, NM_001286043.1:c.833C>T, NM_001286043.1:c.896A>G, NM_001286043.1:c.898G>A, NM_001286043.1:c.916_928delGCAATGGGAGCTT, NM_001286043.1:c.1083delG, NM_001286043.1:c.1084A>G, NM_001286043.1:c.1201_1204delTTAG	Medium-chain acyl-CoA dehydrogenase (MCAD) deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADM gene located on chromosomal region 1p31. Inherited deficiency of MCAD is a condition that prevents the body from converting certain fats to energy, particularly during periods without food (fasting). Signs and symptoms of MCAD deficiency typically appear during infancy or early childhood and can include vomiting, lack of energy (lethargy), and low blood sugar (hypoglycemia). Individuals with MCAD deficiency are at risk of serious complications such as seizures, breathing difficulties, liver problems, brain damage, coma, and sudden death. The estimated prevalence is 1:4,900-1:27,000 in Caucasian populations and 1:14,600 in worldwide populations.	600,25
ACADS	Short-chain acyl-CoA dehydrogenase deficiency	NM_000017.3	NM_000017.3:c.136C>T, NM_000017.3:c.319C>T, NM_000017.3:c.417G>C, NM_000017.3:c.529T>C, NM_000017.3:c.561_568delCAATGCCT, NM_000017.3:c.1095G>T, NM_000017.3:c.1147C>T	Short-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADS gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by seizures, developmental delay, failure to grow with poor feeding, and usually muscle weakness and hypotonia. The prevalence is <1:50,000.	600,25
ACADSB	Short/branched-chain acyl-CoA dehydrogenase deficiency	NM_001609.3	NM_001609.3:c.303+1G>A, NM_001609.3:c.443C>T, NM_001609.3:c.621G>A, NM_001609.3:c.763C>T	Short/branched-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADSB gene located on chromosomal region 10q26.3. The age of onset is neonatal/infantile. This disease is characterized by muscle hypotonia, cerebral palsy, developmental delay, lethargy, hypoglycemia, and metabolic acidosis. The prevalence is <1:1,000,000.	600,25
ACADVL	Very long-chain acyl-CoA dehydrogenase deficiency	NM_001270447.1	NM_001270447.1:c.347-1G>A, NM_001270447.1:c.367_368delCA, NM_001270447.1:c.412delG, NM_001270447.1:c.469C>T, NM_001270447.1:c.546+1G>C, NM_001270447.1:c.589G>A, NM_001270447.1:c.754C>T, NM_001270447.1:c.822-2A>C, NM_001270447.1:c.917T>C, NM_001270447.1:c.965_967delAGA, NM_001270447.1:c.1165C>T, NM_001270447.1:c.1166G>A, NM_001270447.1:c.1175T>C, NM_001270447.1:c.1210_1212delGAG, NM_001270447.1:c.1251+1G>A, NM_001270447.1:c.1426C>T, NM_001270447.1:c.1444dupC, NM_001270447.1:c.1458dupG, NM_001270447.1:c.1475G>A, NM_001270447.1:c.1537G>C, NM_001270447.1:c.1601+1G>A, NM_001270447.1:c.1906C>T, NM_001270447.1:c.1912C>T, NM_001270447.1:c.1951delC	Very long-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADVL gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by cardiomyopathy, hypoketotic hypoglycemia, liver disease, exercise intolerance and rhabdomyolysis. The prevalence is 1:100,000-9:100,000.	600,25
ACAT1	Alpha-methylacetoacetic aciduria	NM_000019.3	NM_000019.3:c.2T>A, NM_000019.3:c.412_419delCAAAGTCT, NM_000019.3:c.547G>A, NM_000019.3:c.622C>T, NM_000019.3:c.905delA, NM_000019.3:c.1035_1037delAGA, NM_000019.3:c.1083dupA, NM_000019.3:c.1136G>T, NM_000019.3:c.1138G>A	Alpha-methylacetoacetic aciduria, also known as 3-ketothiolase deficiency, is an inborn error of isoleucine catabolism characterized by urinary excretion of 2-methyl-3-hydroxybutyric acid, 2-methylacetoacetic acid, tiglylglycine, and 2-butanone. This deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAT1 gene located on chromosomal region 11q22.3. The age of onset is neonatal/infantile. This disease is characterized by normal early development followed by a progressive loss of mental and motor skills. The prevalence is < 1:1,000,000.	600
ACE	Renal tubular dysgenesis	NM_000789.3	NM_000789.3:c.798C>G, NM_000789.3:c.1319_1322delTGGA, NM_000789.3:c.1486C>T, NM_000789.3:c.1511delC, NM_000789.3:c.1587-2A>G, NM_000789.3:c.2371C>T	Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and the most common cause are pathogenic variants in the ACE (chromosomal region 17q23.3). The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.	600,25
ACOX1	Peroxisomal acyl-CoA oxidase deficiency	NM_004035.6	NM_004035.6:c.832A>G, NM_004035.6:c.591delG, NM_004035.6:c.532G>T	Peroxisomal acyl-CoA oxidase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACOX1 gene located on chromosomal region 17q25.1. The age of onset is neonatal/infantile. This disease is characterized by hypotonia and seizures in the neonatal period and neurological regression in early infancy. The prevalence is < 1:1,000,000.	600
ADA	Adenosine deaminase deficiency / Severe combined immunodeficiency due to ADA deficiency	NM_000022.3	NM_000022.3:c.986C>T, NM_000022.3:c.956_960delAAGAG, NM_000022.3:c.890C>A, NM_000022.3:c.872C>T, NM_000022.3:c.632G>A, NM_000022.3:c.320T>C	Adenosine deaminase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADA gene located on chromosomal region 20q13.12. The age of onset is neonatal/infantile. This disease is characterized by profound lymphopenia and very low immunoglobulin levels of all isotypes resulting in severe and recurrent opportunistic infections. The annual incidence is 1:200,000-1:1,000,000. The prevalence is 1:100,000-9:100,000.	600,25
ADAMTS2	Ehlers-Danlos syndrome, dermatosparaxis type	NM_014244.4	NM_014244.4:c.2384G>A	Ehlers-Danlos syndrome dermatosparaxis type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADAMTS2 gene located on chromosomal region 5q35.3. The age of onset is neonatal/infantile. This disease is characterized by extremely fragile tissues, hyperextensible skin and easy bruising. The prevalence is <1:1,000,000.	600
ADAMTSL2	Geleophysic dysplasia type 1	NM_001145320.1	NM_001145320.1:c.338G>A, NM_001145320.1:c.340G>A, NM_001145320.1:c.440C>T, NM_001145320.1:c.661C>T	Geleophysic dysplasia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADAMTSL2 gene located on chromosomal region 9q34.2. The age of onset is infantile. This disease is characterized by extremely by short stature, prominent abnormalities in hands and feet, and a characteristic facial appearance. The prevalence is <1:1,000,000.	600
ADGRV1	Usher syndrome, type 2C	NM_032119.3	NM_032119.3:c.2258_2270delAAGTGCTGAAATC, NM_032119.3:c.2864C>A, NM_032119.3:c.5357_5358delAA, NM_032119.3:c.6275-1G>A, NM_032119.3:c.6312dupT, NM_032119.3:c.6901C>T, NM_032119.3:c.8713_8716dupAACA, NM_032119.3:c.8790delC, NM_032119.3:c.11377G>T, NM_032119.3:c.14973-1G>C, NM_032119.3:c.15196_15199dupCAAA, NM_032119.3:c.17668_17669delAT, NM_032119.3:c.18131A>G	Usher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADGRV1 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32 respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000.	600,25
AGA	Aspartylglucosaminuria	NM_000027.3	NM_000027.3:c.904G>A, NM_000027.3:c.800dupT, NM_000027.3:c.755G>A, NM_000027.3:c.488G>C, NM_000027.3:c.302C>T, NM_000027.3:c.214T>C	Aspartylglucosaminuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGA gene located on chromosomal region 4q34.3. The age of onset is infantile. This disease is characterized by slowly developping mental retardation, beginning with clumsiness, late speech, and hyperkinesia, mild facial dysmorphism, and slight kyphoscoliosis.	600
AGL	Glycogen storage disease type 3	NM_000028.2	NM_000028.2:c.16C>T, NM_000028.2:c.18_19delGA, NM_000028.2:c.294-2A>T, NM_000028.2:c.1222C>T, NM_000028.2:c.1485delT, NM_000028.2:c.1783C>T, NM_000028.2:c.1999delC, NM_000028.2:c.2039G>A, NM_000028.2:c.2590C>T, NM_000028.2:c.3216_3217delGA, NM_000028.2:c.3980G>A, NM_000028.2:c.4260-12A>G, NM_000028.2:c.4260-1G>T, NM_000028.2:c.4342G>C, NM_000028.2:c.4456delT, NM_000028.2:c.4529dupA	Glycogen storage disease (GSD) type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGL gene located on chromosomal region 1p21.2. The age of onset is infantile. This metabolic disorder is caused by deficiency of the glycogen debrancher enzyme and is associated with an accumulation of abnormal glycogen with short outer chains. Most patients are enzyme-deficient in both liver and muscle (IIIa), but about 15% are enzyme-deficient in liver only (IIIb) (Shen et al., 1996). These subtypes have been explained by differences in tissue expression of the deficient enzyme (Endo et al., 2006). In rare cases, selective loss of only 1 of the 2 debranching activities, glucosidase or transferase, results in type IIIc or IIId, respectively (Van Hoof and Hers, 1967; Ding et al., 1990). Clinically, patients with GSD type 3 present in infancy or early childhood with hepatomegaly, hypoglycemia, and growth retardation. Muscle weakness in those with IIIa is minimal in childhood but can become more severe in adults; some patients develop cardiomyopathy (Shen et al., 1996).	600,25
AGPS	Rhizomelic chondrodysplasia punctata, type 3	NM_003659.3	NM_003659.3:c.926C>T, NM_003659.3:c.1256G>A, NM_003659.3:c.1406T>C, NM_003659.3:c.1703C>T	Rhizomelic chondrodysplasia punctata type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGPS gene located on chromosomal region 2q31.2. The age of onset is neonatal/infantile. This disease is characterized by shortness of the femur and humerus, vertebral disorders, cataract, cutaneous lesions and severe intellectual deficit. The prevalence is 1:100,000-9:100,000.	600
AGT	Renal tubular dysgenesis	NM_000029.3	NM_000029.3:c.1290dupT, NM_000029.3:c.1290delT, NM_000029.3:c.1124G>A, NM_000029.3:c.604C>T	Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.	600
AGTR1	Renal tubular dysgenesis	NM_004835.4	NM_004835.4:c.215dupT, NM_004835.4:c.259dupG, NM_004835.4:c.481delC, NM_004835.4:c.481C>T	Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.	600
AGXT	Hyperoxaluria, primary, type 1	NM_000030.2	NM_000030.2:c.33dupC, NM_000030.2:c.121G>A, NM_000030.2:c.166-2A>G, NM_000030.2:c.245G>A, NM_000030.2:c.248A>G, NM_000030.2:c.322T>C, NM_000030.2:c.454T>A, NM_000030.2:c.466G>A, NM_000030.2:c.508G>A, NM_000030.2:c.560C>T, NM_000030.2:c.613T>C, NM_000030.2:c.697C>T, NM_000030.2:c.698G>A, NM_000030.2:c.731T>C, NM_000030.2:c.738G>A	Primary hyperoxaluria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGXT gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by variable clinical presentation, ranging from occasional symptomatic nephrolithiasis to nephrocalcinosis and end-stage renal disease with systemic involvement. The prevalence is 1:1,000,000-9:1,000,000.	600,25
AHI1	Joubert syndrome type 3	NM_001134830.1	NM_001134830.1:c.3263_3264delGG, NM_001134830.1:c.2295dupA, NM_001134830.1:c.2168G>A, NM_001134830.1:c.1484G>A, NM_001134830.1:c.1303C>T, NM_001134830.1:c.1052G>T, NM_001134830.1:c.1051C>T, NM_001134830.1:c.985C>T	Joubert syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AHI1 gene located on chromosomal region 6q23.3. The age of onset is variable. This disease is characterized by the neurological features of Joubert syndrome (neonatal hypotonia, developmental delay, mild to severe intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia and primary position nystagmus) associated with retinal dystrophy.	600,25
AIPL1	Leber congenital amaurosis type 4	NM_014336.4	NM_014336.4:c.1053_1064delTGCAGAGCCACC, NM_014336.4:c.834G>A, NM_014336.4:c.715T>C, NM_014336.4:c.589G>C	Leber congenital amaurosis type 4 (LCA4) is a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus. Mutations in the AIPL1 gene may cause approximately 20% of recessive LCA. Other conditions caused by pathogenic variants in the AIPL1 gene are cone rod dystrophy and the less agressive form, juvenile retinitis pigmentosa. Cone-rod dystropy is characterized by decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness.	600,25
ALAS2	X-linked sideroblastic anemia, type 1 (XLSA or SIDBA1)	NM_000032.4	NM_000032.4:c.1706_1709delAGTG, NM_000032.4:c.1699_1700delAT, NM_000032.4:c.1354C>T	X-linked sideroblastic anemia type 1 is caused by pathogenic variants in the ALAS2 gene, located on chromosomal region Xp11.21. This disease is characterized by clinical features of anemia and/or iron overload such as pallor, fatigue, weakness, and more rarely breathlessness, mild splenomegaly, cardiac problems, abnormal liver function, hyperglycemia, glucose intolerance and skin hyperpigmentation. The age of clinical onset of the disorder can vary from in utero to the ninth decade. Whereas males are preferentially affected, females may present with clinically severe anemia. More commonly, female carriers of the disease have an increased red blood cell distribution width and sometimes erythrocyte dimorphism.	600
ALDH4A1	Hyperprolinemia, type 2	NM_003748.3	NM_003748.3:c.1055C>T	Hyperprolinemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDH4A1 gene located on chromosomal region 1p36. The age of onset is variable. This disease is characterized by seizures, intellectual deficit and mild developmental delay.	600
ALDH5A1	Succinic semialdehyde dehydrogenase deficiency	NM_170740.1	NM_170740.1:c.612G>A, NM_170740.1:c.842G>A, NM_170740.1:c.1265G>A, NM_170740.1:c.1273C>T, NM_170740.1:c.1579C>T	Succinic semialdehyde dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDH451 gene located on chromosomal region 6p22. The age of onset is infantile. This disease is characterized by psychomotor retardation, delayed speech development, hypotonia and ataxia. It is a rare disease with around 350 cases reported.	600
ALDOA	Glycogen storage disease type 12	NM_001243177.1	NM_001243177.1:c.548A>G, NM_001243177.1:c.781G>A	Glycogen storage disease type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOA gene located on chromosomal region 16p11.2. The age of onset is neonatal/infantile. This disease is characterized by myopathy with exercise intolerance and rhabdomyolysis associated with hemolytic anaemia.ﾠ	600
ALDOB	Fructose intolerance, hereditary	NM_000035.3	NM_000035.3:c.1067C>A, NM_000035.3:c.1013C>T, NM_000035.3:c.1005C>G, NM_000035.3:c.720C>A, NM_000035.3:c.612T>A, NM_000035.3:c.524C>A, NM_000035.3:c.448G>C, NM_000035.3:c.442T>C, NM_000035.3:c.360_363delCAAA, NM_000035.3:c.178C>T, NM_000035.3:c.113-1_115delGGTA, NM_000035.3:c.10C>T, NM_000035.3:c.2T>C	Hereditary fructose intolerance follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOB gene located on chromosomal region 9q21.3-q22.2. The age of onset is neonatal/infantile. This disease is characterized by severe abdominal pain, vomiting, and hypoglycemia following ingestion of fructose or other sugars metabolised through fructose-1-phosphate. The prevalence is 1:100,000-9:100,000.	600,25
ALG1	Congenital disorder of glycosylation, type 1k	NM_019109.4	NM_019109.4:c.434G>A, NM_019109.4:c.450C>G, NM_019109.4:c.773C>T, NM_019109.4:c.1079C>T, NM_019109.4:c.1129A>G, NM_019109.4:c.1187+1G>A	Congenital disorder of glycosylation type 1k follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG1 gene located on chromosomal region 16p13.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay, seizures, microcephaly and coagulation anomalies. The prevalence is <1:1,000,000.	600
ALG6	Congenital disorder of glycosylation, type 1c	NM_013339.3	NM_013339.3:c.316C>T, NM_013339.3:c.897_899delAAT, NM_013339.3:c.998C>T, NM_013339.3:c.1432T>C	Congenital disorder of glycosylation type 1c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG6 gene located on chromosomal region 1p31.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay and muscular hypotonia, and possible coagulation anomalies, hormonal abnormalities and seizures. The prevalence is <1:1,000,000.	600,25
ALMS1	Alstr�m syndrome	NM_015120.4	NM_015120.4:c.2323C>T, NM_015120.4:c.4246delC, NM_015120.4:c.5584C>T, NM_015120.4:c.8383C>T, NM_015120.4:c.9614_9618delCAGAA, NM_015120.4:c.11443C>T, NM_015120.4:c.11453dupA, NM_015120.4:c.11612_11613delCT, NM_015120.4:c.12439C>T, NM_015120.4:c.12445C>T	Alstr�m syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALMS1 gene located on chromosomal region 2p13.1. The age of onset is neonatal/infantile. This disease is characterized by cone-rod dystrophy, hearing loss, obesity, insulin resistance and hyperinsulinemia, type 2 diabetes mellitus, dilated cardiomyopathy and progressive hepatic and renal dysfunction. The prevalence is 1:10,000-1:1,000,000.	600,25
ALPL	Hypophosphatasia, childhood/infantile	NM_000478.5	NM_000478.5:c.98C>T, NM_000478.5:c.211C>T, NM_000478.5:c.212G>C, NM_000478.5:c.323C>T, NM_000478.5:c.346G>A, NM_000478.5:c.407G>A, NM_000478.5:c.526G>A, NM_000478.5:c.535G>A, NM_000478.5:c.571G>A, NM_000478.5:c.620A>C, NM_000478.5:c.814C>T, NM_000478.5:c.881A>C, NM_000478.5:c.892G>A, NM_000478.5:c.1001G>A, NM_000478.5:c.1133A>T, NM_000478.5:c.1250A>G, NM_000478.5:c.1306T>C, NM_000478.5:c.1366G>A	Childhood-onset hypophosphatasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALPL gene located on chromosomal region 1p36.12. The age of onset is infantile. This inborn error of metabolism is characterized clinically by defective bone mineralization ranging from stillbirth without mineralized bone to pathologic fractures of the lower extremities in later adulthood; biochemically is characterized by deficient activity of the tissue-nonspecific isoenzyme of alkaline phosphatase.	600
AMT	Glycine encephalopathy	NM_000481.3	NM_000481.3:c.959G>A, NM_000481.3:c.826G>C, NM_000481.3:c.806G>A, NM_000481.3:c.574C>T, NM_000481.3:c.259-1G>C, NM_000481.3:c.125A>G	Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMT and GLDC genes located on chromosomal regions 3p21.31 and 9p24.1 respectively. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000.	600
ANO5	Limb-girdle muscular dystrophy type 12 (LGMDR12; formerly LGMD2L)	NM_213599.2	NM_213599.2:c.172C>T, NM_213599.2:c.191dupA, NM_213599.2:c.206_207delAT, NM_213599.2:c.692G>T, NM_213599.2:c.1210C>T, NM_213599.2:c.1295C>G, NM_213599.2:c.1407+5G>A, NM_213599.2:c.1627dupA, NM_213599.2:c.1733T>C, NM_213599.2:c.1887delA, NM_213599.2:c.1898+1G>A, NM_213599.2:c.1914G>A	Limb-girdle muscular dystrophy type 12 (LGMDR12, formerly LGMD2L) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ANO5 gene located on chromosomal region 11p14.3. This disease is characterized by weakness and wasting restricted to the limb musculature. Most often is characterized by an adult onset (but ranging from 11 to 51 years) of mainly proximal lower limb weakness, with difficulties standing on tiptoes being one of the initial signs. Proximal upper limb and distal lower limb weakness is also common, as well as atrophy of the quadriceps (most commonly), biceps brachii, and lower leg muscles. Calf hypertrophy has also been reported in some cases. LGMDR12 progresses slowly, with most patients remaining ambulatory until late adulthood. The estimated prevalence is <1:1,000,000.	600,25
APTX	Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia	NM_001195248.1	NM_001195248.1:c.917-1G>A, NM_001195248.1:c.879G>A, NM_001195248.1:c.830T>G, NM_001195248.1:c.659C>T, NM_001195248.1:c.362delC, NM_001195248.1:c.209delT, NM_001195248.1:c.176-2A>G, NM_001195248.1:c.166C>T	Ataxia, early-onset, with oculomotor apraxia and hipoalbuminemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the APTX gene located on chromosomal region 9p13.1. Ataxia-oculomotor apraxia syndrome is an early-onset autosomal recessive, progressive, cerebellar ataxia with peripheral axonal neuropathy, oculomotor apraxia (defined as the limitation of ocular movements on command), and hypoalbuminemia. The prevalence is unknown.	600,25
AR	Androgen insensitivity syndrome, complete	NM_000044.3	NM_000044.3:c.340C>T, NM_000044.3:c.1771A>T, NM_000044.3:c.2323C>T, NM_000044.3:c.2391G>A, NM_000044.3:c.2395C>G, NM_000044.3:c.2567G>A, NM_000044.3:c.2650A>T	The complete androgen insensitivity syndrome (CAIS) follows an X-linked pattern of inheritance and is caused by pathogenic variants in the AR gene located on chromosomal region Xq12. Affected males have female external genitalia, female breast development, blind vagina, absent uterus and female adnexa, and abdominal or inguinal testes, despite a normal male 46,XY karyotype. There is unresponsiveness to age-appropriate levels of androgens. There is also a partial androgen insensitivity syndrome (PAIS; OMIM 312300) caused by mutations in the AR gene, called Reifenstein syndrome, which results in hypospadias and micropenis with gynecomastia. Note: A specific type of mutation in the AR gene (a CAG repeat expansion) also cause a rare condition known as Spinal and bulbar muscular atrophy or Kennedy disease; this mutation is not tested by this carrier test.	600,25
ARG1	Argininemia	NM_001244438.1	NM_001244438.1:c.32T>C, NM_001244438.1:c.61C>T, NM_001244438.1:c.389G>A, NM_001244438.1:c.437G>T, NM_001244438.1:c.727G>C, NM_001244438.1:c.895C>T	Argininemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARG1 gene located on chromosomal region 6q23. The age of onset is neonatal/infantile. This disease is characterized by variable degrees of hyperammonemia, developing from about 3 years of age, and leading to progressive loss of developmental milestones and spasticity in the absence of treatment. The prevalence is 1:350,000-1:1,000,000.	600
ARL13B	Joubert syndrome type 8	NM_001174150.1	NM_001174150.1:c.246G>A, NM_001174150.1:c.598C>T, NM_001174150.1:c.1252C>T	Joubert syndrome type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL13B gene located on chromosomal region 3q11.1. The age of onset is neonatal/infantile. This disease is characterized by congenital malformation of the brainstem and agenesis or hypoplasia of the cerebellar vermis leading to an abnormal respiratory pattern, nystagmus, hypotonia, ataxia and delay in achieving motor milestones. The prevalence is 1/80,000 to 1/100,000.	600
ARL6	Bardet-Biedl syndrome type 3	NM_001323513.1	NM_001323513.1:c.4G>T, NM_001323513.1:c.92C>G, NM_001323513.1:c.92C>T, NM_001323513.1:c.266C>T, NM_001323513.1:c.281T>C, NM_001323513.1:c.364C>T	Bardet-Biedl syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL6 gene located on chromosomal region 3q11.2. The age of onset is early. A syndrome characterized by usually severe pigmentary retinopathy, early-onset obesity, polydactyly, hypogenitalism, renal malformation and mental retardation. Secondary features include diabetes mellitus, hypertension and congenital heart disease.	600
ARSA	Metachromatic leukodystrophy	NM_000487.5	NM_000487.5:c.1408_1418delGCAGCTGTGAC, NM_000487.5:c.1401_1411delGTTAGACGCAG, NM_000487.5:c.1283C>T, NM_000487.5:c.1241delC, NM_000487.5:c.1232C>T, NM_000487.5:c.1210+1G>A, NM_000487.5:c.1175G>A, NM_000487.5:c.1174C>T, NM_000487.5:c.1150G>A, NM_000487.5:c.1125_1126delCT, NM_000487.5:c.1108-2A>G, NM_000487.5:c.991G>T, NM_000487.5:c.986C>T, NM_000487.5:c.979G>A, NM_000487.5:c.938G>A, NM_000487.5:c.937C>T, NM_000487.5:c.931G>A, NM_000487.5:c.899T>C, NM_000487.5:c.883G>A, NM_000487.5:c.869G>A, NM_000487.5:c.854+1G>A, NM_000487.5:c.827C>T, NM_000487.5:c.763G>A, NM_000487.5:c.739G>A, NM_000487.5:c.737G>A, NM_000487.5:c.641C>T, NM_000487.5:c.583delT, NM_000487.5:c.582delC, NM_000487.5:c.542dupT, NM_000487.5:c.542T>G, NM_000487.5:c.465+1G>A, NM_000487.5:c.346C>T, NM_000487.5:c.302G>A, NM_000487.5:c.293C>T, NM_000487.5:c.257G>A, NM_000487.5:c.195delC, NM_000487.5:c.34delG	Metachromatic leukodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSA gene located on chromosomal region 22q13.33. The age of onset is variable. This disease is characterized by hypotonia, walking difficulties, optic atrophy and motor regression preceding mental impairment in the late infantile form, arrested intellectual development, followed by motor regression, epileptic seizures and ataxia in the juvenile form, and motor or psychiatric disorders, but with slow progression in the adult form. The incidence is 0.5:5,000-1:50,000ﾠand the prevalence is 1:10,000 -5/10,000.	600,25
ARSB	Mucopolysaccharidosis type 6 (Maroteaux-Lamy)	NM_000046.3	NM_000046.3:c.1438dupG, NM_000046.3:c.1366C>T, NM_000046.3:c.1214G>A, NM_000046.3:c.1178A>C, NM_000046.3:c.1161dupC, NM_000046.3:c.1143-1G>C, NM_000046.3:c.1143-8T>G, NM_000046.3:c.979C>T, NM_000046.3:c.971G>T, NM_000046.3:c.944G>A, NM_000046.3:c.937C>G, NM_000046.3:c.921delA, NM_000046.3:c.753C>G, NM_000046.3:c.629A>G, NM_000046.3:c.589C>T, NM_000046.3:c.571C>T, NM_000046.3:c.427delG, NM_000046.3:c.349T>C	Mucopolysaccharidosis type 6 (Maroteaux-Lamy) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSB gene located on chromosomal region 5q14.1. The age of onset is infantile. This lysosomal storage disorder resulting from a deficiency of arylsulfatase B is characterized by educed pulmonary function, hepatosplenomegaly, hearing loss, sleep apnea, corneal clouding, carpal tunnel disease and occasionally central nervous system findings may include cervical cord compression caused by cervical spinal instability, meningeal thickening and/or bony stenosis, communicating hydrocephalus, optic nerve atrophy and blindness. The prevalence is 1:250,000-1:600,000 newborns.	600,25
ARSE	Chondrodysplasia punctata, X-linked recessive	NM_001282628.1	NM_001282628.1:c.1807C>T, NM_001282628.1:c.1517C>T, NM_001282628.1:c.1504delG, NM_001282628.1:c.485G>T, NM_001282628.1:c.194T>G, NM_001282628.1:c.99-1G>A	X-linked chondrodysplasia punctata follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARSE gene located on chromosomal region Xp22.33. The age of onset is neonatal. Thisﾠis a disorder of cartilage and bone development that occurs almost exclusively in males. Include short stature and unusually short fingertips and ends of the toes. This condition is also associated with distinctive facial features, particularly a flattened-appearing nose with crescent-shaped nostrils and a flat nasal bridge. People with X-linked chondrodysplasia punctata 1 typically have normal intelligence and a normal life expectancy. However, some affected individuals have had serious or life-threatening complications including abnormal thickening (stenosis) of the cartilage that makes up the airways, which restricts breathing. Also, abnormalities of spinal bones in the neck can lead to pinching (compression) of the spinal cord, which can cause pain, numbness, and weakness. Other, less common features of X-linked chondrodysplasia punctata 1 include delayed development, hearing loss, vision abnormalities, and heart defects. The prevalence is 1:500,000.	600,25
ARX	Epileptic encephalopathy, early infantile, type 1; ARX-related developmental disorders	NM_139058.2	NM_139058.2:c.1058C>T, NM_139058.2:c.980_983delAACA	Early infantile epileptic encephalopathy type 1 (EIEE1) follows an X-linked recessive pattern of inheritance and is caused by pathogenic variants in the ARX gene located on chromosomal region Xp21.3. The age of onset is early. This severe disease is characterized by the onset of tonic spasms within the first 3 months of life leading to psychomotor impairment and death. Particularly,it is characterized by frequent tonic seizures or spasms beginning in infancy with a specific EEG finding of suppression-burst patterns, with high-voltage bursts alternating with almost flat suppression phases. Approximately 75% of EIEE patients progress to 'West syndrome,' which is characterized by tonic spasms with clustering, arrest of psychomotor development, and hypsarrhythmia on EEG (Kato et al., 2007). EIEE1 is part of a phenotypic spectrum of disorders caused by mutation in the ARX gene comprising a nearly continuous series of developmental disorders ranging from lissencephaly (LISX2; 300215) to Proud syndrome (300004) to infantile spasms without brain malformations (EIEE1) to syndromic (Partington syndrome; 309510) and nonsyndromic (Mental retardation, X-linked type 29; 300419) mental retardation. Although males with ARX mutations are often more severely affected, female mutation carriers may also be affected (Kato et al., 2004; Wallerstein et al., 2008). The prevalence is <1:1,000,000.	600
ASL	Argininosuccinic aciduria	NM_000048.3	NM_000048.3:c.35G>A, NM_000048.3:c.337C>T, NM_000048.3:c.346C>T, NM_000048.3:c.446+1G>A, NM_000048.3:c.525-2A>T, NM_000048.3:c.532G>A, NM_000048.3:c.539T>G, NM_000048.3:c.544C>T, NM_000048.3:c.578G>A, NM_000048.3:c.602+1G>A, NM_000048.3:c.857A>G, NM_000048.3:c.1045_1057delGTCATCTCTACGC, NM_000048.3:c.1060C>T, NM_000048.3:c.1135C>T, NM_000048.3:c.1144-2A>G, NM_000048.3:c.1153C>T, NM_000048.3:c.1255_1256delCT, NM_000048.3:c.1369dupG	Argininosuccinic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASL gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by severe hyperammonemic coma, hypotonia, growth failure, anorexia and chronic vomiting or behavioral disorders during childhood, and hyperammonemic coma or behavioral disorders that simulate psychiatric disorders later in life. The prevalence is 1:70,000 newborns.	600,25
ASPA	Canavan disease	NM_000049.2	NM_000049.2:c.212G>A, NM_000049.2:c.433-2A>G, NM_000049.2:c.654C>A, NM_000049.2:c.693C>A, NM_000049.2:c.854A>C, NM_000049.2:c.914C>A	Canavan disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPA gene located on chromosomal region 17p13.3. The age of onset is neonatal/infantile. This disease is characterized by a variable spectrum between severe forms with leukodystrophy, macrocephaly and severe developmental delay, and a very rare mild/juvenile form characterized by mild developmental delay. The prevalence is 1:6,400- 1:13,500 in Askenazis Jewis.	600,25
ASPM	Primary microcephaly type 5, autosomal recessive	NM_018136.4	NM_018136.4:c.10059C>A, NM_018136.4:c.9789T>A, NM_018136.4:c.9754delA, NM_018136.4:c.9747_9748delCT, NM_018136.4:c.9730C>T, NM_018136.4:c.9697C>T, NM_018136.4:c.9685delA, NM_018136.4:c.9677dupG, NM_018136.4:c.9557C>G, NM_018136.4:c.9492T>G, NM_018136.4:c.9319C>T, NM_018136.4:c.9238A>T, NM_018136.4:c.9190C>T, NM_018136.4:c.9178C>T, NM_018136.4:c.9159delA, NM_018136.4:c.9115_9118dupCATT, NM_018136.4:c.8844delC, NM_018136.4:c.8711_8712delAA, NM_018136.4:c.8668C>T, NM_018136.4:c.8508_8509delGA, NM_018136.4:c.8378delT, NM_018136.4:c.8230dupA, NM_018136.4:c.8131_8132delAA, NM_018136.4:c.7894C>T, NM_018136.4:c.7860_7861delGA, NM_018136.4:c.7782_7783delGA, NM_018136.4:c.7761T>G, NM_018136.4:c.7491_7495delTATTA, NM_018136.4:c.6732delA, NM_018136.4:c.6337_6338delAT, NM_018136.4:c.6232C>T, NM_018136.4:c.6189T>G, NM_018136.4:c.6073delG, NM_018136.4:c.5439_5440delAG, NM_018136.4:c.5149delA, NM_018136.4:c.5136C>A, NM_018136.4:c.4858_4859delAT, NM_018136.4:c.4795C>T, NM_018136.4:c.4583delA, NM_018136.4:c.4195dupA, NM_018136.4:c.3979C>T, NM_018136.4:c.3978G>A, NM_018136.4:c.3811C>T, NM_018136.4:c.3796G>T, NM_018136.4:c.3710C>G, NM_018136.4:c.3663delG, NM_018136.4:c.3527C>G, NM_018136.4:c.3477_3481delCGCTA, NM_018136.4:c.3188T>G, NM_018136.4:c.3082G>A, NM_018136.4:c.3055C>T, NM_018136.4:c.2967G>A, NM_018136.4:c.2389C>T, NM_018136.4:c.1990C>T, NM_018136.4:c.1959_1962delCAAA, NM_018136.4:c.1729_1730delAG, NM_018136.4:c.1590delA, NM_018136.4:c.1406_1413delATCCTAAA, NM_018136.4:c.1366G>T, NM_018136.4:c.1260_1266delTCAAGTC, NM_018136.4:c.1179delT, NM_018136.4:c.1154_1155delAG, NM_018136.4:c.1002delA, NM_018136.4:c.719_720delCT, NM_018136.4:c.577C>T, NM_018136.4:c.349C>T	Primary autosomal recessive microcephaly type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPM gene located on chromosomal region 1q31. The age of onset is neonatal/infantile. This disease is characterized by a reduction in head circumference at birth, mild to moderate non-progressive intellectual impairment and delay in early motor milestones, speech delay and hyperactive behavior are common.ﾠThe annual incidence is 1:1,000,000.	600,25
ASS1	Citrullinemia type 1	NM_000050.4	NM_000050.4:c.40G>A, NM_000050.4:c.256C>T, NM_000050.4:c.257G>A, NM_000050.4:c.349G>A, NM_000050.4:c.421-2A>G, NM_000050.4:c.470G>A, NM_000050.4:c.496-2A>G, NM_000050.4:c.535T>C, NM_000050.4:c.539G>A, NM_000050.4:c.571G>A, NM_000050.4:c.787G>A, NM_000050.4:c.793C>T, NM_000050.4:c.794G>A, NM_000050.4:c.805G>A, NM_000050.4:c.814C>T, NM_000050.4:c.835C>T, NM_000050.4:c.836G>A, NM_000050.4:c.910C>T, NM_000050.4:c.919C>T, NM_000050.4:c.970G>A, NM_000050.4:c.970+5G>A, NM_000050.4:c.1085G>T, NM_000050.4:c.1087C>T, NM_000050.4:c.1088G>A, NM_000050.4:c.1168G>A, NM_000050.4:c.1194-1G>C	Citrullinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASS1 gene located on chromosomal region 9q34.1. The age of onset is variable. This disease is characterized by hyperammonemia, progressive lethargy, poor feeding and vomiting in the neonatal form and by variable hyperammonemia in the later-onset form. The prevalence is 1:100,000-9:100,000.	600,25
ATIC	AICA-ribosiduria due to ATIC deficiency	NM_004044.6	NM_004044.6:c.1277A>G	AICA-ribosiduria due to ATIC deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATIC gene located on chromosomal region 2q35. The age of onset is neonatal/infantile. This disease is characterized by profound intellectual deficit, epilepsy, dysmorphic features of the knees, elbows, and shoulders and congenital blindness. The prevalence is <1:1,000,000.	600,25
ATP7A	Menkes disease	NM_000052.6	NM_000052.6:c.1639C>T, NM_000052.6:c.1974_1977dupGTTT, NM_000052.6:c.2938C>T, NM_000052.6:c.2981C>T, NM_000052.6:c.3257_3258delAC, NM_000052.6:c.3294+2T>G, NM_000052.6:c.3911A>G, NM_000052.6:c.3915_3921delCTCCCCA	Menkes disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ATP7A gene located on chromosomal region Xq21.1. The age of onset is neonatal/infantile. This disease is characterized by progressive neurodegeneration and marked connective tissue anomalies as well as typical sparse abnormal steely hair. The birth incidence is 1:300,000 in Europe, 1:360,000 in Japan and 1:50,000-1:100,000 in Australia, and the prevalence is 1:100,000 newborns. Mutations in the ATP7A can also cause Occipital horn syndrome, which is considered a mild form of Menkes syndrome.	600
ATP7B	Wilson disease	NM_000053.3	NM_000053.3:c.4088C>T, NM_000053.3:c.4058G>A, NM_000053.3:c.3990_3993delTTAT, NM_000053.3:c.3955C>T, NM_000053.3:c.3809A>G, NM_000053.3:c.3796G>A, NM_000053.3:c.3694A>C, NM_000053.3:c.3359T>A, NM_000053.3:c.3207C>A, NM_000053.3:c.3083delA, NM_000053.3:c.2975C>T, NM_000053.3:c.2972C>T, NM_000053.3:c.2930C>T, NM_000053.3:c.2906G>A, NM_000053.3:c.2807T>A, NM_000053.3:c.2804C>T, NM_000053.3:c.2795C>A, NM_000053.3:c.2755C>T, NM_000053.3:c.2755C>G, NM_000053.3:c.2621C>T, NM_000053.3:c.2605G>A, NM_000053.3:c.2532delA, NM_000053.3:c.2356-2A>G, NM_000053.3:c.2305A>G, NM_000053.3:c.2297C>G, NM_000053.3:c.2123T>C, NM_000053.3:c.2071G>A, NM_000053.3:c.1934T>G, NM_000053.3:c.1846C>T, NM_000053.3:c.1745_1746delTA, NM_000053.3:c.1512dupT, NM_000053.3:c.1145_1151delCCCAACT, NM_000053.3:c.915T>A, NM_000053.3:c.562C>T, NM_000053.3:c.19_20delCA	Wilson disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATP7B gene located on chromosomal region 13q14.3. The age of onset is infantile. This disease is characterized by the toxic accumulation of copper, mainly in the liver and central nervous system, and symptomatic patients may present with hepatic, neurologic or psychiatric forms. The birth incidence is 1:30,000-1:100,000 in France and The prevalence is 1:10,000-1:30,000.	600,25
ATR	Seckel syndrome type 1	NM_001184.3	NM_001184.3:c.6488delT, NM_001184.3:c.6037dupA, NM_001184.3:c.5645delA, NM_001184.3:c.5635G>T, NM_001184.3:c.2341+1G>A, NM_001184.3:c.975_976delCT	Seckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATR gene located on chromosomal region 3q23. The age of onset is neonatal/infantile. This disease is characterized by a proportionate dwarfism of prenatal onset, a severe microcephaly with a bird-headed like appearance and mental retardation.ﾠThe prevalence is <1:1,000,000.	600,25
AUH	3-methylglutaconic aciduria, type 1	NM_001698.2	NM_001698.2:c.991A>T, NM_001698.2:c.943-2A>G, NM_001698.2:c.895-1G>A, NM_001698.2:c.656-2A>G, NM_001698.2:c.650G>A, NM_001698.2:c.589C>T, NM_001698.2:c.559G>A, NM_001698.2:c.471delT	3-Methylglutaconic aciduria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AUH gene located on chromosomal region 9q22.31. The age of onset is neonatal/infantile. This disease is characterized by a variable clinical phenotype ranging from mildly delayed speech to psychomotor retardation, coma, failure to thrive, metabolic acidosis and dystonia.ﾠThe prevalence is <1:1,000,000.	600
B4GALT1	Congenital disorder of glycosylation, type 2d	NM_001497.3	NM_001497.3:c.1031dupC	Congenital disorder of glycosylation type 2d follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the B4GALT1 gene located on chromosomal region 9p13. The age of onset is neonatal/infantile. This disease is characterized by macrocephaly, hydrocephaly, hypotonia, myopathy and coagulation anomalies. The prevalence is <1:1,000,000.	600
B9D2	Joubert syndrome type 34; Meckel syndrome type 10	NM_030578.3	NM_030578.3:c.301A>C	Joubert syndrome (JBTS) 34 is an autosomal recessive disorder presenting with cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy, renal disease, liver fibrosis, and polydactyly. On the other side, Meckel syndrome (MKS) type 10 (MKS10) is a very rare autosomal-recessive disorder resulting in perinatal lethality and characterized by renal cysts, hepatic ductal plate malformation, and central nervous system defects, such as occipital encephalocele. JBST34 and MKS10 are caused by pathogenic variants in the B9D2 gene located on chromosomal region 19q13.2.	600
BCKDHA	Maple syrup urine disease, type 1a	NM_000709.3	NM_000709.3:c.14delT, NM_000709.3:c.632C>T, NM_000709.3:c.659C>T, NM_000709.3:c.741dupT, NM_000709.3:c.797delA, NM_000709.3:c.853G>C, NM_000709.3:c.868G>A, NM_000709.3:c.905A>C, NM_000709.3:c.909_910delGT, NM_000709.3:c.917delT, NM_000709.3:c.929C>G, NM_000709.3:c.964C>T, NM_000709.3:c.979G>A, NM_000709.3:c.1036C>T, NM_000709.3:c.1037G>A, NM_000709.3:c.1234G>A	Maple syrup urine disease type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHA gene located on chromosomal region 19q13.1-13.2. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:1,000,000-9:1,000,000.	600,25
BCKDHB	Maple syrup urine disease, type 1b	NM_000056.4	NM_000056.4:c.302G>A, NM_000056.4:c.342T>G, NM_000056.4:c.344-1G>A, NM_000056.4:c.356T>G, NM_000056.4:c.479T>G, NM_000056.4:c.488A>T, NM_000056.4:c.508C>A, NM_000056.4:c.508C>G, NM_000056.4:c.508C>T, NM_000056.4:c.509G>A, NM_000056.4:c.526A>T, NM_000056.4:c.547C>T, NM_000056.4:c.548G>C, NM_000056.4:c.748G>T, NM_000056.4:c.752T>C, NM_000056.4:c.799C>T, NM_000056.4:c.832G>A, NM_000056.4:c.853C>T, NM_000056.4:c.885delT, NM_000056.4:c.902T>G, NM_000056.4:c.952-1G>A, NM_000056.4:c.970C>T, NM_000056.4:c.1046G>A, NM_000056.4:c.1114G>T	Maple syrup urine disease type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHB gene located on chromosomal region 6q14.1. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:10,000-5:10,000.	600
BCS1L	BCS1L-related disorders, including Leigh syndrome	NM_001079866.1	NM_001079866.1:c.103G>C, NM_001079866.1:c.133C>T, NM_001079866.1:c.148A>G, NM_001079866.1:c.166C>T, NM_001079866.1:c.232A>G, NM_001079866.1:c.547C>T, NM_001079866.1:c.548G>A, NM_001079866.1:c.550C>T, NM_001079866.1:c.696delT, NM_001079866.1:c.830G>A, NM_001079866.1:c.1057G>A	Leigh syndrome caused by mutations in the BCS1L gene -located on chromosomal region 2q35- follows an autosomal recessive pattern of inheritance. Leigh syndrome is a clinically and genetically heterogeneous disorder resulting from defective mitochondrial energy generation; It presents extensive genetic heterogeneity (more than 75 different genes) with mutations identified in both nuclear- and mitochondrial-encoded genes involved in energy metabolism, including mitochondrial respiratory chain complexes I, II, III, IV, and V. It most commonly presents as a progressive and severe neurodegenerative disorder with onset within the first months or years of life, and may result in early death. Affected individuals usually show global developmental delay or developmental regression, hypotonia, ataxia, dystonia, and ophthalmologic abnormalities, such as nystagmus or optic atrophy. The BCS1L protein is critical for the formation of mitochondrial complex III. This syndrome affects at least 1 in 40,000 newborns.	600,25
BEST1	Bestrophinopathy, AR	NM_001139443.1	NM_001139443.1:c.242G>A, NM_001139443.1:c.341_342delTG, NM_001139443.1:c.344delG, NM_001139443.1:c.418C>T, NM_001139443.1:c.434T>C, NM_001139443.1:c.502G>A, NM_001139443.1:c.754G>A, NM_001139443.1:c.769G>A, NM_001139443.1:c.1129_1130insCCAAAGA, NM_001139443.1:c.1203_1204insGCCTTGATGGA, NM_001139443.1:c.1311_1317dupCAAAGAC	Bestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram. Genetic heterogeneity: Mutations in this gene may cause dominant phenotypes like Macular dystrophy, vitelliform, 2 ( OMIM 153700) and Vitreoretinochoroidopathy (193220).	600,25
BEST1	Bestrophinopathy, AR	NM_004183.3	NM_004183.3:c.122T>C	Bestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram. Genetic heterogeneity: Mutations in this gene may cause dominant phenotypes like Macular dystrophy, vitelliform, 2 ( OMIM 153700) and Vitreoretinochoroidopathy (193220).	600,25
BSCL2	Congenital generalized lipodystrophy, type 2; Encephalopathy, progressive, with or without lipodystrophy	NM_001122955.3	NM_001122955.3:c.1166_1167insG, NM_001122955.3:c.1015C>T, NM_001122955.3:c.985C>T, NM_001122955.3:c.974dupG, NM_001122955.3:c.864-3C>G, NM_001122955.3:c.863+5G>A, NM_001122955.3:c.826G>C, NM_001122955.3:c.604C>T	Congenital generalized lipodystrophy (also called Berardinelli-Seip congenital lipodystrophy) type 2 is a rare condition caused by pathogenic variants in the BSCL2 gene located on chromosomal region 11q12.3. Its characterized by an almost total absence of adipose tissue and a very muscular appearance. A shortage of adipose tissue leads to multiple health problems, including high levels of fats called triglycerides circulating in the bloodstream (hypertriglyceridemia) and diabetes mellitus. In some cases, this form of the condition is also associated with intellectual disability, which is usually mild to moderate. Progressive encephalopathy follows an autosomal recessive pattern of inheritance and is also caused by pathogenic variants in the BSCL2 gene. This is a severe neurodegenerative disorder characterized by developmental regression of motor and cognitive skills in the first years of life, often leading to death in the first decade. Patients may show a mild or typical lipodystrophic appearance.	600
BSND	Bartter syndrome, type 4a	NM_057176.2	NM_057176.2:c.1A>T, NM_057176.2:c.3G>A, NM_057176.2:c.10G>T, NM_057176.2:c.22C>T, NM_057176.2:c.23G>T, NM_057176.2:c.35T>C, NM_057176.2:c.139G>A	Bartter syndrome type 4A with deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSND gene located on chromosomal region 1p32.3. The age of onset is neonatal/infantile. This disease is characterized by maternal polyhydramnios, premature delivery, polyuria, sensorineural deafness and is associated with hypokalemic alkalosis, increased levels of plasma renin and aldosterone, low blood pressure, and vascular resistance to angiotensin II.	600,25
BTD	Biotinidase deficiency	NM_001281723.2	NM_001281723.2:c.190G>A, NM_001281723.2:c.241C>T, NM_001281723.2:c.340G>C, NM_001281723.2:c.449G>A, NM_001281723.2:c.517G>A, NM_001281723.2:c.534G>T, NM_001281723.2:c.563G>A, NM_001281723.2:c.589A>G, NM_001281723.2:c.601G>A, NM_001281723.2:c.635A>G, NM_001281723.2:c.637C>T, NM_001281723.2:c.649C>T, NM_001281723.2:c.670G>A, NM_001281723.2:c.761A>G, NM_001281723.2:c.800A>T, NM_001281723.2:c.939delT, NM_001281723.2:c.1330delG, NM_001281723.2:c.1345C>T, NM_001281723.2:c.1358G>A, NM_001281723.2:c.1374A>C, NM_001281723.2:c.1495C>T, NM_001281723.2:c.1514_1518delGGATG, NM_001281723.2:c.1601C>T, NM_001281723.2:c.1618C>T	Biotinidase deficiency an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BTD gene located on chromosomal region 3p25. The age of onset is neonatal/infantile. This disease is characterized by seizures, breathing difficulties, hypotonia, skin rash, alopecia, hearing loss and delayed development.	600,25
BTK	Agammaglobulinemia X-linked, type 1	NM_001287344.1	NM_001287344.1:c.2008G>T, NM_001287344.1:c.1991T>A, NM_001287344.1:c.1940G>A, NM_001287344.1:c.1922C>A, NM_001287344.1:c.1875C>A, NM_001287344.1:c.1868A>G, NM_001287344.1:c.1661G>A, NM_001287344.1:c.1660C>T, NM_001287344.1:c.1618T>C, NM_001287344.1:c.1608C>A, NM_001287344.1:c.1390A>G, NM_001287344.1:c.1377C>A, NM_001287344.1:c.1325T>C, NM_001287344.1:c.1227T>G, NM_001287344.1:c.1184A>G, NM_001287344.1:c.1103A>C, NM_001287344.1:c.1021A>G, NM_001287344.1:c.964C>T, NM_001287344.1:c.865C>T, NM_001287344.1:c.857G>A, NM_001287344.1:c.820G>T, NM_001287344.1:c.440T>A	Agammaglobulinemia X-linked (XLA), type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the BTK gene located on chromosomal region Xq21.33-q22. The age of onset is neonatal. Individuals with XLA are more susceptible to infections because their body makes very few antibodies. In children with XLA, infections generally take longer to get better and then they come back again, even with antibiotic medications. The most common bacterial infections that occur in people with XLA are lung infections (pneumonia and bronchitis), ear infections (otitis), pink eye (conjunctivitis), and sinus infections (sinusitis). Infections that cause chronic diarrhea are also common. Recurrent infections can lead to organ damage. The X-linked form accounts for approximately 85 to 90% of cases of agammaglobulinemia. The prevalence is 3:1,000,000-6:1,000,000 men.	600
C3	Complement C3 deficiency	NM_000064.3	NM_000064.3:c.4851-1G>A, NM_000064.3:c.3627_3628insGGGGCCC, NM_000064.3:c.3116dupT, NM_000064.3:c.2562C>G, NM_000064.3:c.2354+1G>A, NM_000064.3:c.1119+1G>T, NM_000064.3:c.1004-2A>T	C3 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C3 gene located on chromosomal region 19p13.3-p13.2. The age of onset is infantile. It is a rare defect of the complement classical pathway. The main clinical manifestation of primary C3 deficiency is childhood-onset of recurrent bacterial infections, mainly caused by gram-negative bacteria, such as Neisseria meningitidis, Enterobacter aerogenes, Haemophilus influenzae, and Escherichia coli; infections with gram-positive bacteria also occur. Infections in the upper and lower respiratory tract, including pneumonia, episodes of sinusitis, tonsillitis, and otitis, are the most frequent consequence of the C3 deficiency. Approximately 26% of patients with C3 deficiency develop immune complex-mediated autoimmune diseases resembling systemic lupus erythematosus, and about 26% of patients develop mesangiocapillary or membranoproliferative glomerulonephritis, resulting in renal failure (summary by Reis et al., 2006). The prevalence is <1:1.000.000.	600
CA2	Osteopetrosis, autosomal recessive type 3	NM_000067.2	NM_000067.2:c.120T>G, NM_000067.2:c.319C>T, NM_000067.2:c.663+2T>C	Osteopetrosis, autosomal recessive, type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CA2 gene located on chromosomal region 8q22. The age of onset is neonatal/infantile. This disease is characterized by osteopetrosis, renal tubular acidosis, and neurological disorders related to cerebral calcifications. The prevalence is <1:1.000.000.	600
CAPN3	Limb-girdle muscular dystrophy type 1 (LGMDR1; formerly LGMD2A)	NM_000070.2	NM_000070.2:c.133G>A, NM_000070.2:c.223dupT, NM_000070.2:c.257C>T, NM_000070.2:c.328C>T, NM_000070.2:c.550delA, NM_000070.2:c.580delT, NM_000070.2:c.598_612delTTCTGGAGTGCTCTG, NM_000070.2:c.855_864dupGTTGATTGCA, NM_000070.2:c.956C>T, NM_000070.2:c.1322delG, NM_000070.2:c.1466G>A, NM_000070.2:c.1468C>T, NM_000070.2:c.1469G>A, NM_000070.2:c.1599_1602delGAGC, NM_000070.2:c.1715G>A, NM_000070.2:c.1795dupA, NM_000070.2:c.1838delA, NM_000070.2:c.2120A>G, NM_000070.2:c.2212C>T, NM_000070.2:c.2243G>A, NM_000070.2:c.2251_2254dupGTCA, NM_000070.2:c.2306G>A, NM_000070.2:c.2362_2363delAGinsTCATCT	Limb-girdle muscular dystrophy type 1 (LGMDR1; formerly LGMD2A) follows an autosomal recessive pattern of inheritance and is caused by biallelic pathogenic variants in the CAPN3 gene located on chromosomal region 15q15.1. The age of onset is variable. This disease is characterized by a variable age of onset of progressive, typically symmetrical and selective weakness and atrophy of proximal shoulder- and pelvic-girdle muscles (gluteus maximus, thigh adductors, and muscles of the posterior compartment of the limbs are most commonly affected) without cardiac or facial involvement. Clinical manifestations include exercise intolerance, a waddling gait, scapular winging and calf pseudo-hypertrophy.The prevalence is 1:100,000- 9:100,000. Genetic heterogeneity: Heterozygous mutation in the CAPN3 gene can cause autosomal dominant limb-girdle muscular dystrophy-4 (LGMDD4; OMIM 618129), which has a later onset and milder features.	600,25
CBS	Homocystinuria, B6-responsive and nonresponsive types	NM_000071.2	NM_000071.2:c.1330G>A, NM_000071.2:c.1280C>T, NM_000071.2:c.1150A>G, NM_000071.2:c.1136G>A, NM_000071.2:c.1058C>T, NM_000071.2:c.1006C>T, NM_000071.2:c.992C>A, NM_000071.2:c.969G>A, NM_000071.2:c.959T>C, NM_000071.2:c.919G>A, NM_000071.2:c.833T>C, NM_000071.2:c.797G>A, NM_000071.2:c.689delT, NM_000071.2:c.676G>A, NM_000071.2:c.572C>T, NM_000071.2:c.526G>T, NM_000071.2:c.502G>A, NM_000071.2:c.434C>T, NM_000071.2:c.430G>A, NM_000071.2:c.415G>A, NM_000071.2:c.393G>C, NM_000071.2:c.374G>A, NM_000071.2:c.341C>T, NM_000071.2:c.325T>C, NM_000071.2:c.162G>A, NM_000071.2:c.146C>T	Homocystinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CBS gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by the multiple involvement of the eye, skeleton, central nervous system and vascular system. The prevalence is 1:200,000-1:335,000.	600,25
CC2D2A	Joubert syndrome type 9; Meckel syndrome type 6	NM_001080522.2	NM_001080522.2:c.2486+1G>C, NM_001080522.2:c.2848C>T, NM_001080522.2:c.3145C>T, NM_001080522.2:c.3289delG, NM_001080522.2:c.3364C>T, NM_001080522.2:c.3594+1G>A, NM_001080522.2:c.4179+1delG, NM_001080522.2:c.4181delG, NM_001080522.2:c.4333C>T, NM_001080522.2:c.4582C>T, NM_001080522.2:c.4667A>T	Joubert syndrome type 9 defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized neonatal hypotonia, developmental delay, intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia, primary position nystagmus and congenital hepatic fibrosis.	600,25
CD40LG	Immunodeficiency, X-linked, with hyper-IgM	NM_000074.2	NM_000074.2:c.107T>G, NM_000074.2:c.368C>A	Immunodeficiency, X-linked, with hyper-IgM follows an X-linked pattern of inheritance and is caused by pathogenic variants in the CD40LG gene located on chromosomal region Xq26. The age of onset is neonatal/infantile. This disease is characterized by lower-respiratory tract bacterial infections, opportunistic infections, recurrent or protracted diarrhea associated with failure to thrive, neutropenia, thrombocytopenia and anemia. The prevalence is 2:1,000,000 male newborns.	600
CDH23	Usher syndrome, type 1D	NM_022124.5	NM_022124.5:c.146-2A>G, NM_022124.5:c.193delC, NM_022124.5:c.288+1G>A, NM_022124.5:c.1858+2T>G, NM_022124.5:c.3141C>A, NM_022124.5:c.3516_3519delATCC, NM_022124.5:c.3579+2T>C, NM_022124.5:c.4504C>T, NM_022124.5:c.5237G>A, NM_022124.5:c.5663T>C, NM_022124.5:c.6050-9G>A, NM_022124.5:c.6393delC, NM_022124.5:c.6442G>A	Non-syndromic autosomal recessive deafness type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	600,25
CDH3	Ectodermal dysplasia, ectrodactyly, and macular dystrophy	NM_001793.5	NM_001793.5:c.461dupC, NM_001793.5:c.830delG, NM_001793.5:c.965A>T, NM_001793.5:c.981delG, NM_001793.5:c.1508G>A	Ectodermal dysplasia, ectrodactyly, and macular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH3 gene located on chromosomal region 16q22.1. The age of onset is neonatal/infantile. This disease is characterized by the association of ectodermal dysplasia, ectrodactyly, and macular dystrophy. The prevalence is <1:1,000,000.	600
CDHR1	Cone-rod dystrophy, type 15	NM_033100.3	NM_033100.3:c.338delG, NM_033100.3:c.524dupA, NM_033100.3:c.640delG, NM_033100.3:c.1112delC, NM_033100.3:c.1463delG, NM_033100.3:c.1485+2T>C, NM_033100.3:c.1485+2T>G	Cone-rod dystrophy, type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDHR1 gene located on chromosomal region 10q23.1. This disease is characterized by decreased visual acuity and sensitivity in the central visual field, followed by loss of peripheral vision. The overall prevalence of all types of cone-rod dystrophy is 1-9:100,000.	600,25
CDK5RAP2	Primary microcephaly type 3, autosomal recessive	NM_018249.5	NM_018249.5:c.4672C>T, NM_018249.5:c.4658_4661dupTATT, NM_018249.5:c.4546G>T, NM_018249.5:c.700G>T, NM_018249.5:c.524_528delAGGCA, NM_018249.5:c.246T>A, NM_018249.5:c.127+1G>C	Primary autosomal recessive microcephaly type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDK5RAP2 gene located on chromosomal region 9q33.2. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.	600
CENPJ	Primary microcephaly type 6, autosomal recessive	NM_018451.4	NM_018451.4:c.3842_3843dupTA, NM_018451.4:c.3704A>T, NM_018451.4:c.3699_3702dupAATA, NM_018451.4:c.3568_3571dupGTCA, NM_018451.4:c.3415G>T, NM_018451.4:c.3243_3246delTCAG, NM_018451.4:c.2968_2972delAAAAA, NM_018451.4:c.2614delT, NM_018451.4:c.2460_2463delGACG, NM_018451.4:c.1949_1952dupAGTG, NM_018451.4:c.757_760delGTCT, NM_018451.4:c.289dupA, NM_018451.4:c.232_236delCAGAA, NM_018451.4:c.40C>T	Primary autosomal recessive microcephaly type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CENPJ gene located on chromosomal region 13q12.12.ﾠThe age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.	600,25
CEP152	Primary microcephaly type 9, autosomal recessive	NM_001194998.1	NM_001194998.1:c.2034T>G, NM_001194998.1:c.1578-1G>A, NM_001194998.1:c.794A>C, NM_001194998.1:c.749_750delGA	Primary autosomal recessive microcephaly type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP152 gene located on chromosomal region 15q21.1. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.	600
CEP290	Meckel syndrome type 4; Joubert syndrome type 5	NM_025114.3	NM_025114.3:c.7341dupA, NM_025114.3:c.7341delA, NM_025114.3:c.7324G>T, NM_025114.3:c.6798G>A, NM_025114.3:c.6645+1G>A, NM_025114.3:c.6624delG, NM_025114.3:c.6448_6455delCAGTTGAA, NM_025114.3:c.5668G>T, NM_025114.3:c.5611_5614delCAAA, NM_025114.3:c.4962_4963delAA, NM_025114.3:c.4916C>A, NM_025114.3:c.4723A>T, NM_025114.3:c.4705-1G>T, NM_025114.3:c.4656delA, NM_025114.3:c.4393C>T, NM_025114.3:c.3185delT, NM_025114.3:c.2249T>G, NM_025114.3:c.1681C>T, NM_025114.3:c.1665_1666delAA, NM_025114.3:c.1501G>T, NM_025114.3:c.613C>T, NM_025114.3:c.384_387delTAGA, NM_025114.3:c.164_167delCTCA, NM_025114.3:c.21G>T	Meckel syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is neonatal. This disease is characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically occipital encephalocele), hepatic ductal dysplasia and cysts, and postaxial polydactyly. The prevalence is <1/1,000,000.	600,25
CERKL	Retinitis pigmentosa type 26	NM_001030311.2	NM_001030311.2:c.1090C>T, NM_001030311.2:c.858delT, NM_001030311.2:c.847C>T, NM_001030311.2:c.312delA	Retinitis pigmentosa 26 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CERKL gene located on chromosomal region 2q31.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	600,25
CFH	Complement factor H deficiency	NM_000186.3	NM_000186.3:c.380G>T, NM_000186.3:c.1606T>C, NM_000186.3:c.2876G>A	Complement factor H deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFH gene located on chromosomal region 1q32. This disease is characterized by increased susceptibility to recurrent, usually severe, infections (particularly by Neisseria meningitidis, Escherichia coli, and Haemophilus influenzae), renal impairment and/or autoimmune diseases.	600,25
CFTR	Cystic fibrosis	NM_000492.3	NM_000492.3:c.1A>G, NM_000492.3:c.4C>T, NM_000492.3:c.11C>A, NM_000492.3:c.50delT, NM_000492.3:c.44T>C, NM_000492.3:c.53+1G>T, NM_000492.3:c.57G>A, NM_000492.3:c.79G>T, NM_000492.3:c.88C>T, NM_000492.3:c.115C>T, NM_000492.3:c.137C>A, NM_000492.3:c.164+1G>A, NM_000492.3:c.164+1G>T, NM_000492.3:c.164+2T>C, NM_000492.3:c.164+4dupT, NM_000492.3:c.165-3C>T, NM_000492.3:c.165-1G>A, NM_000492.3:c.166G>A, NM_000492.3:c.169T>G, NM_000492.3:c.170G>A, NM_000492.3:c.171G>A, NM_000492.3:c.174_177delTAGA, NM_000492.3:c.175dupA, NM_000492.3:c.178G>A, NM_000492.3:c.178G>T, NM_000492.3:c.200C>T, NM_000492.3:c.223C>T, NM_000492.3:c.233dupT, NM_000492.3:c.254G>A, NM_000492.3:c.262_263delTT, NM_000492.3:c.263T>A, NM_000492.3:c.263T>G, NM_000492.3:c.271G>A, NM_000492.3:c.273+1G>A, NM_000492.3:c.273+3A>C, NM_000492.3:c.274-2A>G, NM_000492.3:c.274-1G>A, NM_000492.3:c.274G>A, NM_000492.3:c.274G>T, NM_000492.3:c.292C>T, NM_000492.3:c.305T>G, NM_000492.3:c.310delA, NM_000492.3:c.313delA, NM_000492.3:c.325_327delTATinsG, NM_000492.3:c.328G>C, NM_000492.3:c.328G>T, NM_000492.3:c.349C>T, NM_000492.3:c.350G>A, NM_000492.3:c.350G>T, NM_000492.3:c.366T>A, NM_000492.3:c.409delC, NM_000492.3:c.413_415dupTAC, NM_000492.3:c.416A>G, NM_000492.3:c.442delA, NM_000492.3:c.445G>A, NM_000492.3:c.445G>T, NM_000492.3:c.446G>T, NM_000492.3:c.489+1G>T, NM_000492.3:c.531delT, NM_000492.3:c.532G>A, NM_000492.3:c.543_546delTAGT, NM_000492.3:c.571T>G, NM_000492.3:c.577G>T, NM_000492.3:c.579+1G>T, NM_000492.3:c.579+3A>G, NM_000492.3:c.579+5G>A, NM_000492.3:c.580-1G>T, NM_000492.3:c.595C>T, NM_000492.3:c.613C>T, NM_000492.3:c.617T>G, NM_000492.3:c.647G>A, NM_000492.3:c.658C>T, NM_000492.3:c.680T>G, NM_000492.3:c.695T>A, NM_000492.3:c.708delT, NM_000492.3:c.717delG, NM_000492.3:c.803delA, NM_000492.3:c.825C>G, NM_000492.3:c.828C>A, NM_000492.3:c.850dupA, NM_000492.3:c.861_865delCTTAA, NM_000492.3:c.935_937delTCT, NM_000492.3:c.933C>G, NM_000492.3:c.948delT, NM_000492.3:c.987delA, NM_000492.3:c.988G>T, NM_000492.3:c.1000C>T, NM_000492.3:c.1001G>T, NM_000492.3:c.1006_1007insG, NM_000492.3:c.1007T>A, NM_000492.3:c.1013C>T, NM_000492.3:c.1021_1022dupTC, NM_000492.3:c.1021T>C, NM_000492.3:c.1029delC, NM_000492.3:c.1037T>C, NM_000492.3:c.1040G>A, NM_000492.3:c.1040G>C, NM_000492.3:c.1055G>A, NM_000492.3:c.1075C>A, NM_000492.3:c.1079C>A, NM_000492.3:c.1081delT, NM_000492.3:c.1116+1G>A, NM_000492.3:c.1117-1G>A, NM_000492.3:c.1130dupA, NM_000492.3:c.1155_1156dupTA, NM_000492.3:c.1202G>A, NM_000492.3:c.1203G>A, NM_000492.3:c.1209+1G>A, NM_000492.3:c.1211delG, NM_000492.3:c.1240C>T, NM_000492.3:c.1301_1307delCACTTCT, NM_000492.3:c.1327_1330dupGATA, NM_000492.3:c.1340delA, NM_000492.3:c.1364C>A, NM_000492.3:c.1365_1366delGG, NM_000492.3:c.1393-2A>G, NM_000492.3:c.1393-1G>A, NM_000492.3:c.1397C>A, NM_000492.3:c.1397C>G, NM_000492.3:c.1400T>C, NM_000492.3:c.1418delG, NM_000492.3:c.1420G>A, NM_000492.3:c.1438G>T, NM_000492.3:c.1466C>A, NM_000492.3:c.1475C>T, NM_000492.3:c.1477_1478delCA, NM_000492.3:c.1477C>T, NM_000492.3:c.1487G>A, NM_000492.3:c.1505T>C, NM_000492.3:c.1519_1521delATC, NM_000492.3:c.1516A>G, NM_000492.3:c.1519A>G, NM_000492.3:c.1521_1523delCTT, NM_000492.3:c.1523T>G, NM_000492.3:c.1538A>G, NM_000492.3:c.1545_1546delTA, NM_000492.3:c.1558G>T, NM_000492.3:c.1572C>A, NM_000492.3:c.1573C>T, NM_000492.3:c.1584+1G>A, NM_000492.3:c.1585-8G>A, NM_000492.3:c.1585-1G>A, NM_000492.3:c.1624G>T, NM_000492.3:c.1645A>C, NM_000492.3:c.1646G>A, NM_000492.3:c.1647T>G, NM_000492.3:c.1648G>T, NM_000492.3:c.1650delA, NM_000492.3:c.1651G>A, NM_000492.3:c.1652G>A, NM_000492.3:c.1654C>T, NM_000492.3:c.1657C>T, NM_000492.3:c.1670delC, NM_000492.3:c.1673T>C, NM_000492.3:c.1675G>A, NM_000492.3:c.1679G>A, NM_000492.3:c.1679G>C, NM_000492.3:c.1679+1G>A, NM_000492.3:c.1679+1G>C, NM_000492.3:c.1680-886A>G, NM_000492.3:c.1680-1G>A, NM_000492.3:c.1682C>A, NM_000492.3:c.1692delA, NM_000492.3:c.1703delT, NM_000492.3:c.1705T>G, NM_000492.3:c.1721C>A, NM_000492.3:c.1753G>T, NM_000492.3:c.1766+1G>A, NM_000492.3:c.1766+1G>C, NM_000492.3:c.1766+1G>T, NM_000492.3:c.1766+3A>G, NM_000492.3:c.1766+5G>T, NM_000492.3:c.1792_1798delAAAACTA, NM_000492.3:c.1826A>G, NM_000492.3:c.1882G>C, NM_000492.3:c.1923_1931delCTCAAAACTinsA, NM_000492.3:c.1973_1985delGAAATTCAATCCTinsAGAAA, NM_000492.3:c.1986_1989delAACT, NM_000492.3:c.2012delT, NM_000492.3:c.2017G>T, NM_000492.3:c.2052dupA, NM_000492.3:c.2052delA, NM_000492.3:c.2051_2052delAAinsG, NM_000492.3:c.2053dupC, NM_000492.3:c.2053C>T, NM_000492.3:c.2125C>T, NM_000492.3:c.2128A>T, NM_000492.3:c.2143C>T, NM_000492.3:c.2158C>T, NM_000492.3:c.2175dupA, NM_000492.3:c.2195T>G, NM_000492.3:c.2215delG, NM_000492.3:c.2241_2248delGATACTGC, NM_000492.3:c.2290C>T, NM_000492.3:c.2353C>T, NM_000492.3:c.2374C>T, NM_000492.3:c.2423_2424dupAT, NM_000492.3:c.2453delT, NM_000492.3:c.2463_2464delTG, NM_000492.3:c.2464G>T, NM_000492.3:c.2490+1G>A, NM_000492.3:c.2491G>T, NM_000492.3:c.2537G>A, NM_000492.3:c.2538G>A, NM_000492.3:c.2547C>A, NM_000492.3:c.2551C>T, NM_000492.3:c.2583delT, NM_000492.3:c.2589_2599delAATTTGGTGCT, NM_000492.3:c.2601dupA, NM_000492.3:c.2645G>A, NM_000492.3:c.2657+5G>A, NM_000492.3:c.2658-1G>C, NM_000492.3:c.2668C>T, NM_000492.3:c.2735C>A, NM_000492.3:c.2737_2738insG, NM_000492.3:c.2739T>A, NM_000492.3:c.2763_2764dupAG, NM_000492.3:c.2780T>C, NM_000492.3:c.2810dupT, NM_000492.3:c.2825delT, NM_000492.3:c.2834C>T, NM_000492.3:c.2869_2870insG, NM_000492.3:c.2875delG, NM_000492.3:c.2896delA, NM_000492.3:c.2908G>C, NM_000492.3:c.2930C>T, NM_000492.3:c.2936A>T, NM_000492.3:c.2988G>A, NM_000492.3:c.2988+1G>A, NM_000492.3:c.2989-2A>G, NM_000492.3:c.2989-1G>A, NM_000492.3:c.3002_3003delTG, NM_000492.3:c.3011_3019delCTATAGCAG, NM_000492.3:c.3017C>A, NM_000492.3:c.3039dupC, NM_000492.3:c.3039delC, NM_000492.3:c.3067_3072delATAGTG, NM_000492.3:c.3080T>C, NM_000492.3:c.3107C>A, NM_000492.3:c.3124C>T, NM_000492.3:c.3139_3139+1delGG, NM_000492.3:c.3140-26A>G, NM_000492.3:c.3160C>G, NM_000492.3:c.3181G>C, NM_000492.3:c.3194T>C, NM_000492.3:c.3196C>T, NM_000492.3:c.3197G>A, NM_000492.3:c.3205G>A, NM_000492.3:c.3209G>A, NM_000492.3:c.3230T>C, NM_000492.3:c.3266G>A, NM_000492.3:c.3276C>A, NM_000492.3:c.3276C>G, NM_000492.3:c.3292T>C, NM_000492.3:c.3293G>A, NM_000492.3:c.3294G>A, NM_000492.3:c.3294G>C, NM_000492.3:c.3294G>T, NM_000492.3:c.3302T>A, NM_000492.3:c.3302T>G, NM_000492.3:c.3304A>T, NM_000492.3:c.3310G>T, NM_000492.3:c.3353C>T, NM_000492.3:c.3368-2A>G, NM_000492.3:c.3435G>A, NM_000492.3:c.3454G>C, NM_000492.3:c.3468G>A, NM_000492.3:c.3468+5G>A, NM_000492.3:c.3472C>T, NM_000492.3:c.3484C>T, NM_000492.3:c.3528delC, NM_000492.3:c.3532_3535dupTCAA, NM_000492.3:c.3536_3539delCCAA, NM_000492.3:c.3587C>G, NM_000492.3:c.3605delA, NM_000492.3:c.3611G>A, NM_000492.3:c.3612G>A, NM_000492.3:c.3659delC, NM_000492.3:c.3691delT, NM_000492.3:c.3700A>G, NM_000492.3:c.3717+4A>G, NM_000492.3:c.3717+5G>A, NM_000492.3:c.3717+40A>G, NM_000492.3:c.3718-2477C>T, NM_000492.3:c.3718-3T>G, NM_000492.3:c.3718-1G>A, NM_000492.3:c.3719T>G, NM_000492.3:c.3731G>A, NM_000492.3:c.3744delA, NM_000492.3:c.3747delG, NM_000492.3:c.3752G>A, NM_000492.3:c.3761T>G, NM_000492.3:c.3763T>C, NM_000492.3:c.3764C>A, NM_000492.3:c.3773dupT, NM_000492.3:c.3846G>A, NM_000492.3:c.3848G>T, NM_000492.3:c.3873+1G>A, NM_000492.3:c.3873+2T>C, NM_000492.3:c.3883_3886delATTT, NM_000492.3:c.3883delA, NM_000492.3:c.3889dupT, NM_000492.3:c.3891dupT, NM_000492.3:c.3908delA, NM_000492.3:c.3909C>G, NM_000492.3:c.3937C>T, NM_000492.3:c.3971T>C, NM_000492.3:c.4036_4042delCTAAGCC, NM_000492.3:c.4046G>A, NM_000492.3:c.4077_4080delTGTTinsAA, NM_000492.3:c.4086dupT, NM_000492.3:c.4111G>T, NM_000492.3:c.4127_4131delTGGAT, NM_000492.3:c.4144C>T, NM_000492.3:c.4147dupA, NM_000492.3:c.4197_4198delCT, NM_000492.3:c.4231C>T, NM_000492.3:c.4234C>T, NM_000492.3:c.4242+1G>A, NM_000492.3:c.4242+1G>T, NM_000492.3:c.4251delA, NM_000492.3:c.4300_4301dupAG, NM_000492.3:c.4426C>T	Cystic fibrosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFTR gene located on chromosomal region 7q31.2. The age of onset of severe form is neonatal or infantile but there are also variants associated with moderate clinical or late onset. This disease is characterized by the production of sweat with a high salt content, mucus secretions with an abnormal viscosity, chronic bronchitis, pancreatic insufficiency, adolescent diabetes and, more rarely, stercoral obstruction and cirrhosis. Male sterility is a constant feature. Late-onset forms, which are usually only mild or monosymptomatic. The prevalence is 1:10,000-9:10,000.	600,25
CHST6	Macular corneal dystrophy	NM_021615.4	NM_021615.4:c.853delC, NM_021615.4:c.820G>T, NM_021615.4:c.392C>A, NM_021615.4:c.327_328delCT	Macular corneal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CHST6 gene located on chromosomal region 16q22. The age of onset is variable. This disease is characterized by bilateral ill-defined cloudy regions within a hazy stroma, and eventually severe visual impairment. The prevalence is 1:100,000-9:100,000.	600,25
CLCN1	Myotonia congenita, recessive	NM_000083.2	NM_000083.2:c.180+3A>T, NM_000083.2:c.225dupC, NM_000083.2:c.409T>G, NM_000083.2:c.871G>A, NM_000083.2:c.1238T>G, NM_000083.2:c.1453A>G, NM_000083.2:c.2680C>T	Myotonia congenita follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN1 gene located on chromosomal region 7q35. The age of onset is neonatal/infantile. This is a nondystrophic skeletal muscle disorder characterized by muscle stiffness and an inability of the muscle to relax after voluntary contraction. Most patients have symptom onset in the legs, which later progresses to the arms, neck, and facial muscles. Many patients show marked hypertrophy of the lower limb muscles. The prevalence is 1:100,000.	600,25
CLCN7	Osteopetrosis, autosomal recessive type 4	NM_001287.5	NM_001287.5:c.781A>T, NM_001287.5:c.622C>T	Osteopetrosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN7 gene located on chromosomal region 16p13. The age of onset is neonatal/infantile. This disease is characterized bone marrow failure, fractures and visual impairment. The incidence is 1:200,000 live births and the prevalence is 1:100,000.	600
CLDN14	Deafness type 29, autosomal recessive	NM_001146077.1	NM_001146077.1:c.398delT, NM_001146077.1:c.301G>A, NM_001146077.1:c.254T>A	Deafness type 29, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN14 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	600
CLDN19	Rena hypomagnesemia type 5, with ocular involvement	NM_148960.2	NM_148960.2:c.425_437delCCCTGGTGACCCA, NM_148960.2:c.269T>C, NM_148960.2:c.169C>G, NM_148960.2:c.59G>A	Renal hypomagnesemia type 5, with ocular involvement follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN19 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by excessive magnesium and calcium renal wasting, bilateral nephrocalcinosis, progressive renal failure and severe ocular abnormalities. The prevalence is <1:1,000,000.	600,25
CLN3	Ceroid lipofuscinosis, neuronal, type 3	NM_000086.2	NM_000086.2:c.1272delG, NM_000086.2:c.883G>A, NM_000086.2:c.622dupT, NM_000086.2:c.597C>A	Juvenile neuronal ceroid lipofuscinosis 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN3 gene located on chromosomal region 16p12.1. The age of onset is infantile. This disease is characterized by onset at early school age with vision loss due to retinopathy, seizures and the decline of mental and motor capacities. The annual birth incidence is 1:217,000-1:450,000 in Sweden and 1:143,000 in Germany, and the prevalence is 1.5:1,000,000-9:1,000,000.	600
CLN5	Ceroid lipofuscinosis, neuronal, type 5	NM_006493.2	NM_006493.2:c.335G>C, NM_006493.2:c.377G>A, NM_006493.2:c.433C>T, NM_006493.2:c.524T>G, NM_006493.2:c.526dupA, NM_006493.2:c.565C>T, NM_006493.2:c.575A>G, NM_006493.2:c.593T>C, NM_006493.2:c.595C>T, NM_006493.2:c.613C>T, NM_006493.2:c.620G>C, NM_006493.2:c.669dupC, NM_006493.2:c.835G>A, NM_006493.2:c.919delA, NM_006493.2:c.924_925delAT, NM_006493.2:c.1026C>A	Neuronal ceroid lipofuscinosis type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN5 gene located on chromosomal region 3q21.1-q32. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy and vision loss through retinal degeneration. The prevalence is <1:1,000,000.	600
CLN6	Ceroid lipofuscinosis, neuronal, type 6	NM_017882.2	NM_017882.2:c.663C>G, NM_017882.2:c.214G>T, NM_017882.2:c.200T>C	Neuronal ceroid lipofuscinosis 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN6 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy and vision loss through retinal degeneration. The prevalence is <1:1,000,000.	600
CLN8	Ceroid lipofuscinosis, neuronal, type 8	NM_018941.3	NM_018941.3:c.88delG, NM_018941.3:c.88G>C, NM_018941.3:c.610C>T, NM_018941.3:c.789G>C	Neuronal ceroid lipofuscinosis 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN8 gene located on chromosomal region 8p23.3. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy, and vision loss through retinal degeneration. The prevalence is <1:1,000,000.	600
CLRN1	Usher syndrome, type 3A	NM_001195794.1	NM_001195794.1:c.669_670insT, NM_001195794.1:c.630dupT, NM_001195794.1:c.189C>A, NM_001195794.1:c.144T>G, NM_001195794.1:c.118T>G, NM_001195794.1:c.92C>T	Usher syndrome type 3A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1 gene located on chromosomal region 3q25.1. The age of onset is neonatal/infantile. This disease is characterized by the association of sensorineural deafness with retinitis pigmentosa and progressive vision loss. The prevalence is 1:1.000.000- 9/1.000.000.	600,25
CNGA1	Retinitis pigmentosa type 49	NM_001142564.1	NM_001142564.1:c.2179delA, NM_001142564.1:c.2134C>T, NM_001142564.1:c.1747C>T, NM_001142564.1:c.1166C>T, NM_001142564.1:c.1001G>A, NM_001142564.1:c.656+2T>C, NM_001142564.1:c.445G>T, NM_001142564.1:c.304dupA	Retinitis pigmentosa 49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGA1 gene located on chromosomal region 4p12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	600,25
CNGB1	Retinitis pigmentosa type 45	NM_001297.4	NM_001297.4:c.3462+1G>A, NM_001297.4:c.3425delT, NM_001297.4:c.3150delG, NM_001297.4:c.2762_2765delACGA, NM_001297.4:c.2653delG, NM_001297.4:c.2492+2T>G, NM_001297.4:c.1958-1G>A, NM_001297.4:c.1122-2A>T, NM_001297.4:c.952C>T, NM_001297.4:c.413-1G>A, NM_001297.4:c.218-2A>G	Retinitis pigmentosa 45 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB1 gene located on chromosomal region 16q13. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000 to 5:10,000.	600,25
CNGB3	Achromatopsia type 3	NM_019098.4	NM_019098.4:c.2048_2049delCA, NM_019098.4:c.2011G>T, NM_019098.4:c.1148delC, NM_019098.4:c.1063C>T, NM_019098.4:c.893_897delCAAAA, NM_019098.4:c.887_896delCTTCTACAAA, NM_019098.4:c.886_890delACTTC, NM_019098.4:c.819_826delCAGACTCC, NM_019098.4:c.446_447insT	Achromatopsia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is neonatal/Infantile. This disease is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, and reduced or complete loss of color discrimination. Most individuals have complete form, with total lack of function in all three types of cones. Rarely, individuals have incomplete form, with similar, but generally less severe symptoms. The prevalence is 1/30,000-1/50,000.	600,25
COL11A1	Fibrochondrogenesis type 1	NM_080629.2	NM_080629.2:c.3745-1G>A, NM_080629.2:c.2386G>C, NM_080629.2:c.1786dupG	Fibrochondrogenesis type 1 (FBCG1) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL11A1 gene located on chromosomal region 1p21. The age of onset is neonatal. Fibrochondrogenesis is a severe short-limbed skeletal dysplasia clinically characterized by a flat midface with a small nose and anteverted nares, significant shortening of all limb segments but relatively normal hands and feet, and a small bell-shaped thorax with a protuberant abdomen. Radiographically, the long bones are short and have broad metaphyseal ends, giving them a dumb-bell shape. The vertebral bodies are flat and, on lateral view, have a distinctive pinched appearance, with a hypoplastic posterior end and a rounded anterior end. The ribs are typically short and wide and have metaphyseal cupping at both ends (Tompson et al., 2010). Genetic heterogeneity: Fibrochondrogenesis type 2 (FBCG2; OMIM 614524) is caused by mutations in the COL11A2 gene on chromosome 6p21.3.	600
COL17A1	Epidermolysis bullosa, junctional, non-Herlitz type	NM_000494.3	NM_000494.3:c.4319dupC, NM_000494.3:c.4003_4004delGG, NM_000494.3:c.3908G>A, NM_000494.3:c.3897_3900delATCT, NM_000494.3:c.3827dupC, NM_000494.3:c.3795delC, NM_000494.3:c.3676C>T, NM_000494.3:c.3277+1G>A, NM_000494.3:c.3067C>T, NM_000494.3:c.3043C>T, NM_000494.3:c.2965delA, NM_000494.3:c.2944_2947+1delGAAGG, NM_000494.3:c.2564T>G, NM_000494.3:c.2551+1G>T, NM_000494.3:c.2430_2431insCCGA, NM_000494.3:c.2383C>T, NM_000494.3:c.2336-1G>T, NM_000494.3:c.2336-2A>G, NM_000494.3:c.2228-3_2235delCAGGTCCTGCTinsTTG, NM_000494.3:c.1898G>A, NM_000494.3:c.1706delC, NM_000494.3:c.520_521delAG, NM_000494.3:c.433C>T	Epidermolysis bullosa, junctional, non-Herlitz type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL17A1 gene located on chromosomal region 10q24.3. The age of onset is neonatal/infantile. This disease is characterized by a generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.	600,25
COL18A1	Knobloch syndrome, type 1	NM_130444.2	NM_130444.2:c.1700_1701insGACGTGAAAGAGGGG, NM_130444.2:c.2240_2241insGACGTGAAAGAGGGG, NM_130444.2:c.3294_3295delAG, NM_130444.2:c.3502C>T, NM_130444.2:c.4072_4084delCCCCCAGGCCCAC, NM_130444.2:c.4214_4223delCAGGGCCCCC, NM_130444.2:c.4222_4223delCC, NM_130444.2:c.4323_4323+1delGG, NM_130444.2:c.4759_4760delCT, NM_130444.2:c.5168dupG	Knobloch syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL18A1 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by vitreoretinal and macular degeneration, and occipital encephalocele.ﾠThe prevalence is <1:1,000,000.	600,25
COL1A2	Ehlers-Danlos syndrome, cardiac valvular type	NM_000089.3	NM_000089.3:c.133-1G>A, NM_000089.3:c.241_248delTATGATGG, NM_000089.3:c.293dupC, NM_000089.3:c.1404+1G>A, NM_000089.3:c.1404+1G>C, NM_000089.3:c.3601G>T	Ehlers-Danlos syndrome, cardiac valvular type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL1A2 gene located on chromosomal region 7q22.1. The age of onset is neonatal/infantile. This disease is characterized by joint hypermobility, skin hyperextensibility and cardiac valvular defects.ﾠThe prevalence is 6/100,000 to 7/100,000.	600
COL4A3	Alport syndrome, autosomal recessive	NM_000091.4	NM_000091.4:c.345delG, NM_000091.4:c.898G>A, NM_000091.4:c.2083G>A, NM_000091.4:c.2111delC, NM_000091.4:c.2954G>T, NM_000091.4:c.4420_4424delCTTTT, NM_000091.4:c.4441C>T, NM_000091.4:c.4571C>G	Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.	600,25
COL4A4	Alport syndrome, autosomal recessive	NM_000092.4	NM_000092.4:c.4923C>A, NM_000092.4:c.4129C>T, NM_000092.4:c.3713C>A, NM_000092.4:c.3601G>A, NM_000092.4:c.2312delG, NM_000092.4:c.71+1G>A	Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.	600,25
COL7A1	Epidermolysis bullosa dystrophica, AR	NM_000094.3	NM_000094.3:c.8524_8527+10delGAAGGTGAGGACAG, NM_000094.3:c.8479C>T, NM_000094.3:c.8440C>T, NM_000094.3:c.8393T>A, NM_000094.3:c.8245G>A, NM_000094.3:c.7957G>A, NM_000094.3:c.7930-1G>C, NM_000094.3:c.7912G>T, NM_000094.3:c.7411C>T, NM_000094.3:c.7345-1G>A, NM_000094.3:c.6946G>A, NM_000094.3:c.6859G>A, NM_000094.3:c.6752G>A, NM_000094.3:c.6670G>T, NM_000094.3:c.6573+1G>T, NM_000094.3:c.6527dupC, NM_000094.3:c.6205C>T, NM_000094.3:c.6187C>T, NM_000094.3:c.6091G>A, NM_000094.3:c.5821-1G>A, NM_000094.3:c.5532+1G>A, NM_000094.3:c.5287C>T, NM_000094.3:c.5096C>T, NM_000094.3:c.5052+1G>A, NM_000094.3:c.4888C>T, NM_000094.3:c.4783G>C, NM_000094.3:c.4373C>T, NM_000094.3:c.4119+1G>T, NM_000094.3:c.4039G>C, NM_000094.3:c.3831+1G>T, NM_000094.3:c.2471dupG, NM_000094.3:c.933C>A, NM_000094.3:c.887delG, NM_000094.3:c.706C>T, NM_000094.3:c.425A>G, NM_000094.3:c.336C>G	Epidermolysis bullosa dystrophica follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL7A1 gene located on chromosomal region 3p21.1. The age of onset is neonatal/infantile. This disease is characterized by generalized cutaneous and mucosal blistering and scarring associated with severe deformities and major extracutaneous involvement. The prevalence is <1:1,000,000.	600,25
COL9A1	Stickler syndrome, type 4	NM_001851.4	NM_001851.4:c.883C>T, NM_001851.4:c.706C>T	Stickler syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL9A1 gene located on chromosomal region 6q13. The age of onset is infantile. This disease is characterized by opthalmological (myopia, retinal detachment and cataracts), orofacial (micrognathia, midface hypoplasia and cleft palate) auditory (sensorineural hearing loss) and articular (epiphyseal dysplasia) symptoms. The prevalence is <1:1,000,000.	600
COQ2	Primary coenzyme Q10 deficiency, type 1	NM_015697.7	NM_015697.7:c.1197delT, NM_015697.7:c.890A>G, NM_015697.7:c.723delT, NM_015697.7:c.683A>G, NM_015697.7:c.590G>A	Primary coenzyme Q10 deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ2 gene located on chromosomal region 4q21.23. The age of onset is neonatal/infantile. The phenotypes include an encephalomyopathic form with seizures and ataxia; a multisystem infantile form with encephalopathy, cardiomyopathy and renal failure; a predominantly cerebellar form with ataxia and cerebellar atrophy; Leigh syndrome with growth retardation; and an isolated myopathic form.	600,25
COQ8A	Primary coenzyme Q10 deficiency, type 4	NM_020247.4	NM_020247.4:c.589-3C>G, NM_020247.4:c.637C>T, NM_020247.4:c.815G>A, NM_020247.4:c.815G>T, NM_020247.4:c.911C>T, NM_020247.4:c.1541A>G, NM_020247.4:c.1645G>A, NM_020247.4:c.1651G>A, NM_020247.4:c.1750_1752delACC, NM_020247.4:c.1813dupG	Primary coenzyme Q10 deficiency type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ8A gene located on chromosomal region 1q42.13. The age of onset is infantile. This disease is characterized by progressive ataxia, cerebellar atrophy, and often exercise intolerance with elevated lactate levels and mild intellectual deficit.	600,25
CPS1	Carbamoylphosphate synthetase 1 deficiency	NM_001122633.2	NM_001122633.2:c.1649C>T, NM_001122633.2:c.1930C>T, NM_001122633.2:c.3574delA	Carbamoylphosphate synthetase deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPS1 gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by congenital hyperammonemia and defective citrulline synthesis. The prevalence is 1:800,000 newborn in Japan.	600
CPT1A	Carnitine palmitoyltransferase type 1A deficiency, hepatic	NM_001876.3	NM_001876.3:c.1436C>T, NM_001876.3:c.1393G>T, NM_001876.3:c.1361A>G, NM_001876.3:c.1241C>T, NM_001876.3:c.1216C>T, NM_001876.3:c.1079A>G, NM_001876.3:c.335_336delCC, NM_001876.3:c.298C>T, NM_001876.3:c.281+1G>A, NM_001876.3:c.222C>A	Carnitine palmitoyl transferase 1A deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT1A gene located on chromosomal region 11q13.2. The age of onset is neonatal/infantile. This disease is characterized by recurrent attacks of fasting-induced hypoketotic hypoglycemia and risk of liver failure. The prevalence is 1.3:1,000 newborn.	600
CPT2	Carnitine palmitoyltransferase type 2 deficiency, lethal neonatal	NM_000098.2	NM_000098.2:c.149C>A, NM_000098.2:c.338C>T, NM_000098.2:c.359A>G, NM_000098.2:c.370C>T, NM_000098.2:c.452G>A, NM_000098.2:c.464dupT, NM_000098.2:c.520G>A, NM_000098.2:c.638A>G, NM_000098.2:c.680C>T, NM_000098.2:c.725_726delAC, NM_000098.2:c.886C>T, NM_000098.2:c.1148T>A, NM_000098.2:c.1237C>T, NM_000098.2:c.1239_1240delGA, NM_000098.2:c.1369A>T, NM_000098.2:c.1437C>G, NM_000098.2:c.1784delC, NM_000098.2:c.1883A>C, NM_000098.2:c.1891C>T	Carnitine palmitoyltransferase deficiency, type 2, lethal neonatal form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT2 gene located on chromosomal region 1p32. The age of onset is neonatal/infantile. This disease is characterized by a severe fasting intolerance leading to metabolic derangements of hypoketotic hypoglycemia, resulting in coma and seizures, and hepatic encephalopathy leading to liver failure.ﾠThe prevalence is <1:1,000,000.	600,25
CRB1	Retinitis pigmentosa type 12, AR; Leber congenital amaurosis type 8	NM_201253.2	NM_201253.2:c.498_506delAATTGATGG, NM_201253.2:c.613_619delATAGGAA, NM_201253.2:c.2290C>T, NM_201253.2:c.2401A>T, NM_201253.2:c.2416G>T, NM_201253.2:c.2688T>A, NM_201253.2:c.2983G>T, NM_201253.2:c.3055_3059dupTATAT, NM_201253.2:c.3122T>C, NM_201253.2:c.3299T>C, NM_201253.2:c.3299T>G, NM_201253.2:c.3383delT, NM_201253.2:c.3419T>A, NM_201253.2:c.3997G>T	Retinitis pigmentosa type 12 and leber congenital amaurosis type 8 follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. Retinitis pigmentosa type 12 is characterized by night blindness, peripheral visual field impairment and over time loss of central visionm, and its prevalence is 1-5:10,000. Leber congenital amaurosis, with a neonatal/infantile age of onset, comprises a group of early-onset childhood retinal dystrophies characterized by vision loss, nystagmus, and severe retinal dysfunction. Patients usually present at birth with profound vision loss and pendular nystagmus. Other clinical findings of this disease may include high hypermetropia, photodysphoria, oculodigital sign, keratoconus, cataracts, and a variable appearance to the fundus.	600,25
CRLF1	Cold-induced sweating syndrome type 1	NM_004750.4	NM_004750.4:c.1137C>G, NM_004750.4:c.1125delG, NM_004750.4:c.935G>A, NM_004750.4:c.856-1G>A, NM_004750.4:c.852G>T, NM_004750.4:c.845_846delTG, NM_004750.4:c.829C>T, NM_004750.4:c.713dupC, NM_004750.4:c.708_709delCCinsT, NM_004750.4:c.676dupA, NM_004750.4:c.538C>T, NM_004750.4:c.527+5G>A, NM_004750.4:c.413C>T, NM_004750.4:c.397+1G>A, NM_004750.4:c.303delC, NM_004750.4:c.226T>G	Cold-induced sweating syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRLF1 gene located on chromosomal region 19p12. The age of onset is infantile. This disease is characterized by profuse sweating (involving the chest, face, arms and trunk) induced by cold ambient temperature kyphoscoliosis, a high-arched palate, depressed nasal bridge and impaired peripheral sensitivity to pain and temperature. The prevalence is <1:1,000,000.	600
CRTAP	Osteogenesis imperfecta, type 7	NM_006371.4	NM_006371.4:c.180G>A, NM_006371.4:c.561T>G, NM_006371.4:c.634C>T, NM_006371.4:c.826C>T	Osteogenesis imperfecta type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRTAP gene located on chromosomal region 3p22.3. The age of onset is variable. This disease is characterized by increased bone fragility, low bone mass, and susceptibility to bone fractures with variable severity. The prevalence is 6:100,000-7:100,000.	600
CSTB	Epilepsy, progressive myoclonic type 1A (Unverricht and Lundborg)	NM_000100.3	NM_000100.3:c.212A>C, NM_000100.3:c.202C>T	Progressive myoclonic epilepsy type 1A (Unverricht and Lundborg) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CSTB gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by severe, stimulus-sensitive myoclonus and tonic-clonic seizures. The onset, occurring between 6 and 13 years of age, is characterized by convulsions. Myoclonus begins 1 to 5 years later. The twitchings occur predominantly in the proximal muscles of the extremities and are bilaterally symmetrical, although asynchronous. At first small, they become late in the clinical course so violent that the victim is thrown to the floor. Mental deterioration and eventually dementia develop. The prevalence is 1:20,000 newborn.	600
CTNS	Cystinosis (atypical/juvenile/ocular) nephropathic	NM_001031681.2	NM_001031681.2:c.283G>T, NM_001031681.2:c.329G>T, NM_001031681.2:c.357_360delCAGC, NM_001031681.2:c.397_398delAT, NM_001031681.2:c.414G>A, NM_001031681.2:c.416C>T, NM_001031681.2:c.506G>A, NM_001031681.2:c.589G>A, NM_001031681.2:c.646dupA, NM_001031681.2:c.853-3C>G, NM_001031681.2:c.1015G>A	Nephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. This disease is characterized by hypothyroidism, insulin-dependent diabetes, hepatosplenomegaly with portal hypertension, and muscle, cerebral and ocular involvement, caused by cystine deposits in various organs. The prevalence is 1:100,000-1:200,000.	600,25
CTSD	Ceroid lipofuscinosis, neuronal, type 10	NM_001909.4	NM_001909.4:c.1149G>C, NM_001909.4:c.685T>A	Neuronal ceroid lipofuscinosis type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSD gene located on chromosomal region 11p15.5. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 2:100,000-4:100,000 newborn.	600
CTSK	Pycnodysostosis	NM_000396.3	NM_000396.3:c.926T>C, NM_000396.3:c.721C>T, NM_000396.3:c.436G>C, NM_000396.3:c.236G>A, NM_000396.3:c.154A>T	Pycnodysostosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSK gene located on chromosomal region 1q21. The age of onset is variable. This disease is characterized by osteosclerosis, short stature or dwarfism, acroosteolysis of the distal phalanges, fragile bones associated with spontaneous fractures and dysplasia of the clavicles. The prevalence is 1/1,000,000 to 9/1,000,000.	600,25
CYP21A2	Congenital adrenal hyperplasia due to 21-hydroxylase deficiency	-0	NM_000500.7:c.92C>T, NM_000500.7:c.293-13A/C>G, NM_000500.7:c.332_339del, NM_000500.7:c.518T>A, NM_000500.7:c.[710T>A;713T>A;719T>A], NM_000500.7:c.710T>A, NM_000500.7:c.713T>A, NM_000500.7:c.844G>T, NM_000500.7:c.923_924insT, NM_000500.7:c.955C>T, NM_000500.7:c.1069C>T, NM_000500.7:c.1360C>T, NM_000500.7:c.[710T>A;713T>A], NM_000500.7:c.[710T>A;719T>A], NM_000500.7:c.[713T>A;719T>A], Abnormal CNV, Large gene conversion, NM_000500.7:c.955C>T+CYP21A2dup	Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP21A2 gene located on chromosomal region 6p21.3. The age of onset is neonatal/infantile. This disease is characterized by simple virilizing or salt wasting forms that can manifest with genital ambiguity in females, and in both sexes with adrenal insufficiency with dehydration during the neonatal period, life threatening hypoglycemia and hyperandrogenia. The prevalence is 1/100,000 to 9/100,000. There is a common milder form of congenital adrenal hyperplasia (Nonclassic) characterized by a later onset of androgen excess symptoms seen in females and precocious pseudopuberty in both sexes. Cortisol and aldosterone levels are normal but there is an increased amount of androgens. Nonclassic form onset occurs in adolescence with variable degrees of postnatal androgen excess (precocious pubarche, hirsutism, acne, alopecia, anovulation and menstrual irregularies and in the post-pubertal period it can mimic polycystic ovary syndrome. It is also sometimes asymptomatic. The prevalence ranges from 1/1,000-1/500 in the general Caucasian population, but up to 1-2% among inbred populations, such as Eastern European (Ashkenazi) Jews.	600
CYP4V2	Bietti crystalline corneoretinal dystrophy	NM_207352.3	NM_207352.3:c.130T>A, NM_207352.3:c.327+1G>A, NM_207352.3:c.332T>C, NM_207352.3:c.1523G>A	Bietti crystalline corneoretinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP4V2 gene located on chromosomal region 4q35.2. The age of onset is adult. This disease is characterized by nightblindness, decreased vision, paracentral scotoma, and, in the end stages of the disease, legal blindness.	600,25
CYP7B1	Spastic paraplegia type 5A, autosomal recessive	NM_004820.4	NM_004820.4:c.1460dupT, NM_004820.4:c.1456C>T, NM_004820.4:c.1162C>T, NM_004820.4:c.889A>G, NM_004820.4:c.825T>A, NM_004820.4:c.321_324delACAA, NM_004820.4:c.187C>T	Spastic paraplegia type 5A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. The prevalence is below 1,000,000.	600,25
D2HGDH	D-2-hydroxyglutaric aciduria	NM_152783.4	NM_152783.4:c.440T>G, NM_152783.4:c.1123G>T, NM_152783.4:c.1315A>G, NM_152783.4:c.1331T>C, NM_152783.4:c.1333_1334delAC	D-2-Hydroxyglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the D2HGDH gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by extremely variable clinical manifestations, with severe cases characterized by neonatal or early infantile-onset epileptic encephalopathy, and marked hypotonia, and cerebral visual failure, developmental delay, seizures, involuntary movements, and cardiomyopathy are also common in these cases. The prevalence is below 1,000,000.	600,25
DBT	Maple syrup urine disease, type 2	NM_001918.3	NM_001918.3:c.1281+1G>A, NM_001918.3:c.939G>C, NM_001918.3:c.901C>T, NM_001918.3:c.871C>T, NM_001918.3:c.827T>G, NM_001918.3:c.772+1G>A, NM_001918.3:c.670G>T, NM_001918.3:c.581C>G, NM_001918.3:c.294C>G, NM_001918.3:c.272_275delCAGT, NM_001918.3:c.126T>G	Maple syrup urine disease, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DBT gene located on chromosomal region 1p21.2. The age of onset in neonatal/infantil. This disease is characterized by a maple syrup odor to the urine, deficient diet, lethargy and focal dystonia, followed by progressive encephalopathy and central respiratory failure if not treated. The prevalence is 1-5/10,000.	600,25
DCLRE1C	Omenn syndrome; Severe combined immunodeficiency, Athabascan type	NM_001033855.2	NM_001033855.2:c.1639G>T, NM_001033855.2:c.1558dupA, NM_001033855.2:c.780+1delG, NM_001033855.2:c.597C>A, NM_001033855.2:c.2T>C	Omenn syndrome and Athabascan type severe combined immunodeficiency follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the DCLRE1C gene located on chromosomal region 10p13. Omenn syndrome has an early age of onset and it is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. The age of onset of Athabascan type severe combined immunodeficiency is neonatal/infantile and it is characterized by severe and recurrent infections, diarrhea, failure to thrive, and cell sensitivity to ionizing radiation. The prevalence is 1-9/1,000,000.	600,25
DDB2	Xeroderma pigmentosum, group E	NM_000107.2	NM_000107.2:c.730A>G, NM_000107.2:c.818G>A, NM_000107.2:c.919G>T, NM_000107.2:c.937C>T	Xeroderma pigmentosum complementation group E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DDB2 gene located on chromosomal region 11p12-p11. The age of onset is variable. This disease is characterized by mild xeroderma pigmentosum symptoms and no neurological abnormalities. The prevalence is 1/1,000,000.	600
DDC	Aromatic L-amino acid decarboxylase deficiency	NM_000790.3	NM_000790.3:c.1040G>A, NM_000790.3:c.823G>A, NM_000790.3:c.749C>T, NM_000790.3:c.304G>A, NM_000790.3:c.272C>T, NM_000790.3:c.100delG	Aromatic L-amino acid decarboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DDC gene located on chromosomal region 7p12.2. The age of onset is neonatal/infantile. This disease is characterized by severe developmental delay, weak muscle tone (hypotonia), muscle stiffness, difficulty moving, and involuntary writhing movements of the limbs (athetosis). The prevalence is below 1,000,000.	600
DGUOK	DGUOK-related mitochondrial DNA depletion syndrome	NM_080916.2	NM_080916.2:c.137A>G, NM_080916.2:c.313C>T, NM_080916.2:c.425G>A, NM_080916.2:c.494A>T, NM_080916.2:c.707+2T>G, NM_080916.2:c.763G>T	Mitochondrial DNA depletion syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DGUOK gene located on chromosomal region 2p13. The age of onset is neonatal/infantile. This disease is characterized by progressive liver failure, hypoglycemia and neurologic abnormalities including hypotonia, encephalopathy and peripheral neuropathy	600,25
DHCR7	Smith-Lemli-Opitz syndrome	NM_001163817.1	NM_001163817.1:c.1342G>A, NM_001163817.1:c.1337G>A, NM_001163817.1:c.1228G>A, NM_001163817.1:c.1210C>T, NM_001163817.1:c.1055G>A, NM_001163817.1:c.1054C>T, NM_001163817.1:c.976G>T, NM_001163817.1:c.964-1G>C, NM_001163817.1:c.907G>A, NM_001163817.1:c.866C>T, NM_001163817.1:c.841G>A, NM_001163817.1:c.839A>G, NM_001163817.1:c.832-1G>C, NM_001163817.1:c.744G>T, NM_001163817.1:c.730G>A, NM_001163817.1:c.725G>A, NM_001163817.1:c.724C>T, NM_001163817.1:c.506C>T, NM_001163817.1:c.461C>G, NM_001163817.1:c.453G>A, NM_001163817.1:c.452G>A, NM_001163817.1:c.356A>T, NM_001163817.1:c.292C>T, NM_001163817.1:c.278C>T, NM_001163817.1:c.151C>T, NM_001163817.1:c.1A>G	Smith-Lemli-Opitz syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHCR7 gene located on chromosomal region 11q13.4. The age of onset is neonatal/infantile. This disease is characterized by multiple congenital anomalies, intellectual deficit, and behavioral problems.ﾠThe prevalence is 1/20,000 to 1/40,000 newborn.	600,25
DHDDS	Retinitis pigmentosa type 59	NM_024887.3	NM_024887.3:c.124A>G, NM_024887.3:c.330delA, NM_024887.3:c.998C>G	Retinitis pigmentosa type 59 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHDDS gene located on chromosomal region 1p36.11. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000.	600
DKC1	Dyskeratosis congenita, X-linked	NM_001363.4	NM_001363.4:c.91C>A, NM_001363.4:c.91C>G, NM_001363.4:c.194G>C, NM_001363.4:c.196A>G, NM_001363.4:c.200C>T, NM_001363.4:c.204C>A, NM_001363.4:c.214_215delCTinsTA	X-linked dyskeratosis congenita follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DKC1 gene located on chromosomal region Xq28. Tha age of onset is infantile. This disease is classically defined by the triad of abnormal skin pigmentation, nail dystrophy, and leukoplakia of the oral mucosa. Progressive bone marrow failure occurs in over 80% of cases and is the main cause of early mortality. The phenotype is highly variable, and affected individuals may have multiple additional features.	600
DLD	Dihydrolipoamide dehydrogenase deficiency	NM_000108.4	NM_000108.4:c.105_106insA, NM_000108.4:c.916_926delTGTGATGTACT, NM_000108.4:c.1483A>G	Dihydrolipoamide dehydrogenase deficiency E3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DLD gene located on chromosomal region 7q31-q32. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting and a maple syrup odor in the cerumen (and later in urine) noted soon after birth, followed by progressive encephalopathy and central respiratory failure if untreated. The prevalence is 1/1,000,000 to 9/1,000,000.	600
DLL3	Spondylocostal dysostosis type 1	NM_016941.3	NM_016941.3:c.231C>A, NM_016941.3:c.712C>T	Spondylocostal dysostosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DLL3 gene located on chromosomal region 19q13. The age of onset is neonatal/infantile. This disease is associated with vertebral and rib segmentation defects and characterised by a short neck with limited mobility, winged scapulae, a short trunk, and short stature with multiple vertebral anomalies at all levels of the spine. The prevalence is below 1/1,000,000.	600
DMD	Duchenne/Becker muscular dystrophy	-0	NM_004006.2:c.10774delA, NM_004006.2:c.10454delT, NM_004006.2:c.10453_10454delCT, NM_004006.2:c.10447_10448delTC, NM_004006.2:c.10141C>T, NM_004006.2:c.10086+1G>A, NM_004006.2:c.10033C>T, NM_004006.2:c.9854_9863delTGAGACTGGA, NM_004006.2:c.9862G>T, NM_004006.2:c.9851G>A, NM_004006.2:c.9767dupG, NM_004006.2:c.9650-2A>G, NM_004006.2:c.9568C>T, NM_004006.2:c.9564-1G>A, NM_004006.2:c.9380C>G, NM_004006.2:c.9361+1G>C, NM_004006.2:c.9361+1G>A, NM_004006.2:c.9346C>T, NM_004006.2:c.9337C>T, NM_004006.2:c.9164-1G>T, NM_004006.2:c.9164-1G>C, NM_004006.2:c.8944C>T, NM_004006.2:c.8713C>T, NM_004006.2:c.8656C>T, NM_004006.2:c.8652_8653delCT, NM_004006.2:c.8608C>T, NM_004006.2:c.8464C>T, NM_004006.2:c.8443C>T, NM_004006.2:c.8374_8375delAA, NM_004006.2:c.8358G>A, NM_004006.2:c.8086delC, NM_004006.2:c.8069T>G, NM_004006.2:c.8064_8065delTA, NM_004006.2:c.7922delA, NM_004006.2:c.7894C>T, NM_004006.2:c.7771G>T, NM_004006.2:c.7764dupT, NM_004006.2:c.7683G>A, NM_004006.2:c.7682G>A, NM_004006.2:c.6986dupA, NM_004006.2:c.6982A>T, NM_004006.2:c.6964delG, NM_004006.2:c.6943G>T, NM_004006.2:c.6936delA, NM_004006.2:c.6906G>A, NM_004006.2:c.6834delT, NM_004006.2:c.6763-2A>G, NM_004006.2:c.6391_6392dupCA, NM_004006.2:c.6391_6392delCA, NM_004006.2:c.6373C>T, NM_004006.2:c.6340A>T, NM_004006.2:c.6292C>T, NM_004006.2:c.6238delC, NM_004006.2:c.6226G>T, NM_004006.2:c.6182delC, NM_004006.2:c.6014_6017delCTCA, NM_004006.2:c.6000T>A, NM_004006.2:c.5899C>T, NM_004006.2:c.5807T>A, NM_004006.2:c.5773G>T, NM_004006.2:c.5697delA, NM_004006.2:c.5671A>T, NM_004006.2:c.5640T>A, NM_004006.2:c.5570_5571dupAA, NM_004006.2:c.5554C>T, NM_004006.2:c.5530C>T, NM_004006.2:c.5363C>G, NM_004006.2:c.5353C>T, NM_004006.2:c.5313dupT, NM_004006.2:c.5287C>T, NM_004006.2:c.4843A>T, NM_004006.2:c.4735G>T, NM_004006.2:c.4518+5G>A, NM_004006.2:c.4500delA, NM_004006.2:c.4486delG, NM_004006.2:c.4471_4472delAA, NM_004006.2:c.4409_4412dupGTCT, NM_004006.2:c.4405C>T, NM_004006.2:c.4375C>T, NM_004006.2:c.4117C>T, NM_004006.2:c.3779_3785delCTTTGGAinsGG, NM_004006.2:c.3747delG, NM_004006.2:c.3697delC, NM_004006.2:c.3639dupA, NM_004006.2:c.3432+3A>G, NM_004006.2:c.3432+1G>A, NM_004006.2:c.3295C>T, NM_004006.2:c.3276+1G>A, NM_004006.2:c.3246_3247insTTTCTAAAAA, NM_004006.2:c.3124A>T, NM_004006.2:c.3121C>T, NM_004006.2:c.3087G>A, NM_004006.2:c.3076G>T, NM_004006.2:c.3022A>T, NM_004006.2:c.2929dupC, NM_004006.2:c.2866C>T, NM_004006.2:c.2815_2816delTT, NM_004006.2:c.2816T>A, NM_004006.2:c.2804-1G>A, NM_004006.2:c.2804-2A>T, NM_004006.2:c.2803+1G>T, NM_004006.2:c.2803+1G>A, NM_004006.2:c.2758C>T, NM_004006.2:c.2755A>T, NM_004006.2:c.2650C>T, NM_004006.2:c.2547delT, NM_004006.2:c.2523delA, NM_004006.2:c.2484T>G, NM_004006.2:c.2479delG, NM_004006.2:c.2380+2T>C, NM_004006.2:c.2380+1G>C, NM_004006.2:c.2332C>T, NM_004006.2:c.2302C>T, NM_004006.2:c.2294_2297delCCAT, NM_004006.2:c.2281_2285delGAAAA, NM_004006.2:c.2137C>T, NM_004006.2:c.2125delC, NM_004006.2:c.1900_1903dupAAGT, NM_004006.2:c.1900A>T, NM_004006.2:c.1886C>A, NM_004006.2:c.1734delA, NM_004006.2:c.1529_1530delTC, NM_004006.2:c.1489C>T, NM_004006.2:c.1371delG, NM_004006.2:c.1341_1342dupAG, NM_004006.2:c.1332-9A>G, NM_004006.2:c.1306dupG, NM_004006.2:c.1286C>A, NM_004006.2:c.1261C>T, NM_004006.2:c.1070delC, NM_004006.2:c.1048G>T, NM_004006.2:c.1012G>T, NM_004006.2:c.676_678delAAG, NM_004006.2:c.627delA, NM_004006.2:c.615T>A, NM_004006.2:c.583C>T, NM_004006.2:c.530+1delG, NM_004006.2:c.489G>A, NM_004006.2:c.433C>T, NM_004006.2:c.412_413delAA, NM_004006.2:c.251delT, NM_004006.2:c.220delC, NM_004006.2:c.204dupC, NM_004006.2:c.199G>T, NM_004006.2:c.160_162delCTC, NM_004006.2:c.137_138dupAT, NM_004006.2:c.133C>T, delDuchenne, insDuchenne, delBecker, insBecker	Duchenne muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/3,300 male newborns and the prevalence is 1/16,000 to 1/125,000. Becker muscular dystrophy is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/18,000 to 1/31,000 male newborns and the prevalence is 1/10,000 to 5/10,000.	600
DMP1	Hypophosphatemic rickets, autosomal recessive	NM_004407.3	NM_004407.3:c.1A>G, NM_004407.3:c.31delT, NM_004407.3:c.55-1G>C, NM_004407.3:c.362delC	Hypophosphatemic rickets follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DMP1 gene located on chromosomal region 4q21. The age of onset is variable. This disease is associated with vertebral and rib segmentation defects and characterised by hypophosphatemia, rickets and/or osteomalacia and slow growth. The prevalence is below 1/20,000 newborns.	600
DNAJC19	3-methylglutaconic aciduria, type 5	NM_145261.3	NM_145261.3:c.300delA	3-methylglutaconic aciduria, type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DNAJC19 gene located on chromosomal region 3q26.33. The age of onset is infantile. This disease is characterized by severe early onset (before the age of three years) dilated cardiomyopathy with conduction defects (long QT syndrome), non-progressive cerebellar ataxia, testicular dysgenesis, and 3-methylglutaconic aciduria.	600
DPAGT1	Congenital disorder of glycosylation, type 1j	NM_001382.3	NM_001382.3:c.980_981delCT, NM_001382.3:c.791T>G, NM_001382.3:c.643+1G>A, NM_001382.3:c.358C>A, NM_001382.3:c.349G>A	Congenital disorder of glycosylation, type 1j follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPAGT1 gene located on chromosomal region 11q23.3. The age of onset is neonatal/infantile. This disease is characterized by severe psychomotor delay, seizures, hypotonia and dysmorphism (microcephaly, ocular exotropia, micrognathia and clinodactyly). The prevalence is below 1,000,000.	600
DPM1	Congenital disorder of glycosylation, type 1e	NM_001317034.1	NM_001317034.1:c.847T>C, NM_001317034.1:c.784-1G>T, NM_001317034.1:c.733delC, NM_001317034.1:c.669-1G>A, NM_001317034.1:c.274C>G	Congenital disorder of glycosylation, type 1e follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPM1 gene located on chromosomal region 20q13.13. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay, seizures, hypotonia, facial dysmorphism and microcephaly. The prevalence is below 1,000,000.	600
DPYD	Dihydropyrimidine dehydrogenase deficiency	NM_000110.3	NM_000110.3:c.1905+1G>A, NM_000110.3:c.1679T>G, NM_000110.3:c.1109_1110delTA, NM_000110.3:c.299_302delTCAT	Dihydropyrimidine dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPYD gene located on chromosomal region 1p22. This disease shows large phenotypic variability, ranging from no symptoms to a convulsive disorder with motor and mental retardation in homozygous patients. In people with severe dihydropyrimidine dehydrogenase deficiency, the disorder becomes apparent in infancy. These affected individuals have recurrent seizures (epilepsy), intellectual disability, a small head size (microcephaly), increased muscle tone (hypertonia), delayed development of motor skills such as walking, and autistic behaviors that affect communication and social interaction. The prevalence is unknow. In addition, homozygous and heterozygous mutation carriers can develop severe toxicity after the administration of the antineoplastic drug 5-fluorouracil (5FU).	600,25
DSP	Cardiomyopathy, dilated, with woolly hair and keratoderma; Epidermolysis bullosa, lethal acantholytic	NM_004415.3	NM_004415.3:c.3098delA, NM_004415.3:c.5800C>T, NM_004415.3:c.6370_6371delCT, NM_004415.3:c.7000C>T, NM_004415.3:c.7180_7181delAG, NM_004415.3:c.8188C>T	Dilated cardiomyopathy with woolly hair and keratoderma, known as Carvajal syndrome, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterized by woolly hair is present at birth and the palmoplantar keratoderma appears during the first year of life. The cardiac anomaly presents during childhood and is marked by dilation of the left ventricle accompanied by alterations in muscle contractility. The dilated cardiomyopathy may lead to life-threatening congestive heart failure and death. The prevalence is below 1,000,000. Furthermore, mutations in the DSP gene have been identified in people with an autosomal recessive disorder called lethal acantholytic epidermolysis bullosa. Features of this condition include very fragile skin that blisters and detaches easily, a complete absence of hair (alopecia), abnormal or missing fingernails, teeth that are present from birth (neonatal teeth), and abnormalities of the heart muscle (cardiomyopathy). The skin abnormalities lead to a severe loss of fluids and death in early infancy.	600,25
DYSF	Miyoshi muscular dystrophy, type 1; Muscular dystrophy, limb-girdle, autosomal recessive, type 2	NM_001130978.1	NM_001130978.1:c.1481-1G>A	Miyoshi muscular dystrophy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is young adulthood. This disease is characterized by weakness and atrophy in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000. Mutations in the DYSF gene can also cause muscular dystrophy, limb-girdle, autosomal recessive, type 2. This disease is characterized by an onset in late adolescence or early adulthood of slowly progressive, proximal weakness and atrophy of shoulder and pelvic girdle muscles. Cardiac and respiratory muscles are not involved. Hypertrophy of the calf muscles and highly elevated serum creatine kinase levels are frequently observed.	600,25
DYSF	Miyoshi muscular dystrophy, type 1; Muscular dystrophy, limb-girdle, autosomal recessive, type 2	NM_001130987.1	NM_001130987.1:c.203_204delTGinsAT, NM_001130987.1:c.396_397delCC, NM_001130987.1:c.706C>T, NM_001130987.1:c.759+1G>C, NM_001130987.1:c.797G>A, NM_001130987.1:c.853C>T, NM_001130987.1:c.991G>A, NM_001130987.1:c.991G>T, NM_001130987.1:c.1033+1G>A, NM_001130987.1:c.1149+1G>A, NM_001130987.1:c.1372G>A, NM_001130987.1:c.1380+2T>C, NM_001130987.1:c.1464C>A, NM_001130987.1:c.1488dupA, NM_001130987.1:c.1494-2A>G, NM_001130987.1:c.1494-1G>A, NM_001130987.1:c.1609G>A, NM_001130987.1:c.1674delA, NM_001130987.1:c.1692+2T>A, NM_001130987.1:c.1717C>T, NM_001130987.1:c.1867C>T, NM_001130987.1:c.1888C>T, NM_001130987.1:c.1927G>T, NM_001130987.1:c.2924_2928delAGACC, NM_001130987.1:c.2923C>T, NM_001130987.1:c.3051G>T, NM_001130987.1:c.3095A>G, NM_001130987.1:c.3166C>T, NM_001130987.1:c.3229-2A>T, NM_001130987.1:c.3498_3499delTGinsAA, NM_001130987.1:c.3531C>A, NM_001130987.1:c.3532C>T, NM_001130987.1:c.3695delC, NM_001130987.1:c.3762delA, NM_001130987.1:c.3859G>T, NM_001130987.1:c.3957+1delG, NM_001130987.1:c.4011delC, NM_001130987.1:c.4144C>T, NM_001130987.1:c.4162_4163delGT, NM_001130987.1:c.4307G>A, NM_001130987.1:c.4873C>T, NM_001130987.1:c.4989_4993delGCCCGinsCCCC, NM_001130987.1:c.5194C>T, NM_001130987.1:c.5318A>G, NM_001130987.1:c.5383C>T, NM_001130987.1:c.5458-2A>C, NM_001130987.1:c.5546G>A, NM_001130987.1:c.5546+1G>T, NM_001130987.1:c.5614G>T, NM_001130987.1:c.5626G>A, NM_001130987.1:c.5642+1G>A, NM_001130987.1:c.5711delG, NM_001130987.1:c.5761C>T, NM_001130987.1:c.5815_5816delAG, NM_001130987.1:c.5830C>T, NM_001130987.1:c.5953_5956delCAGC, NM_001130987.1:c.6096dupA, NM_001130987.1:c.6109G>T, NM_001130987.1:c.6241C>T	Miyoshi muscular dystrophy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is young adulthood. This disease is characterized by weakness and atrophy in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000. Mutations in the DYSF gene can also cause muscular dystrophy, limb-girdle, autosomal recessive, type 2. This disease is characterized by an onset in late adolescence or early adulthood of slowly progressive, proximal weakness and atrophy of shoulder and pelvic girdle muscles. Cardiac and respiratory muscles are not involved. Hypertrophy of the calf muscles and highly elevated serum creatine kinase levels are frequently observed.	600,25
EDA	Ectodermal dysplasia, type 1, hypohidrotic, X-linked	NM_001399.4	NM_001399.4:c.181T>C, NM_001399.4:c.183C>G, NM_001399.4:c.187G>A, NM_001399.4:c.463C>T, NM_001399.4:c.466C>T, NM_001399.4:c.467G>A, NM_001399.4:c.573_574insT, NM_001399.4:c.671G>C, NM_001399.4:c.826C>T, NM_001399.4:c.1045G>A	Hypohidrotic ectodermal dysplasia, type 1, hypohidrotic, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EDA gene located on chromosomal region Xq12-q13.1. The age of onset is neonatal/infantile. This disease is characterized by malformation of ectodermal structures such as skin, hair, teeth and sweat glands. The prevalence is 1/5,000 to 1/10,000 newborns.	600,25
EDN3	Waardenburg syndrome, type 4B	NM_207034.2	NM_207034.2:c.262_263delGCinsT, NM_207034.2:c.277C>G, NM_207034.2:c.476G>T, NM_207034.2:c.568_569delGA	Waardenburg-Shah syndrome, type 4B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EDN3 gene located on chromosomal region 20q13.2-q13.3. The age of onset is neonatal/infantile. This disease is characterized by the association of Waardenburg syndrome (sensorineural hearing loss and pigmentary abnormalities) and Hirschsprung disease (signs of intestinal obstruction). The prevalence is below 1/40,000.	600
EDNRB	ABCD syndrome	NM_001201397.1	NM_001201397.1:c.1098G>T, NM_001201397.1:c.818C>G, NM_001201397.1:c.46delC	ABCD syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EDNRB gene located on chromosomal region 13q22.3. This disease is characterized by albinism, black lock at temporal occipital region, bilateral deafness, aganglionosis of the large intestine and total absence of neurocytes and nerve fibers in the small intestine. ABCD syndrome is not a separate entity, but rather an expression of Shah-Waardenburg syndrome (WS4)	600
EIF2AK3	Wolcott-Rallison syndrome	NM_004836.6	NM_004836.6:c.1763G>A, NM_004836.6:c.994G>T	Wolcott-Rallison syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EIF2AK3 gene located on chromosomal region 2p12. The age of onset is neonatal/infantile. This disease is characterized by permanent neonatal diabetes mellitus with multiple epiphyseal dysplasia and other clinical manifestations, including recurrent episodes of acute liver failure. The prevalence is above 1/10,000 newborns.	600
ELP1	Dysautonomia, familial	NM_003640.4	NM_003640.4:c.3332delC, NM_003640.4:c.2741C>T, NM_003640.4:c.2328delT, NM_003640.4:c.2204+6T>C, NM_003640.4:c.2087G>C, NM_003640.4:c.1460+2T>C	Familial dysautonomia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ELP1 gene located on chromosomal region 9q31.3. The age of onset is infantile. This disease is characterized by sensory dysfunction and severe impairment of the autonomic nervous system activity, resulting in multisystem dysfunction. The prevalence is <1:1,000,000	600
EMD	Emery-Dreifuss muscular dystrophy, type 1, X-linked	NM_000117.2	NM_000117.2:c.547C>A, NM_000117.2:c.631_635delCGTGC	Emery-Dreifuss muscular dystrophy, type 1, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EMD gene located on chromosomal region Xq28. ﾠThis is a condition that primarily affects muscles used for movement (skeletalﾠmuscles) and the heart (cardiac muscle). Among the earliest features of this disorder are joint deformities called contractures. Contractures restrict the movement of certain joints, most often the elbows, ankles, and neck, and usually become noticeable in early childhood. Most affected individuals also experience muscle weakness andﾠwastingﾠthat worsen slowly over time, beginning in muscles of the upper arms and lower legs and later also affecting muscles in the shoulders and hips. Almost all people with Emery-Dreifuss muscular dystrophy develop heart problems by adulthood. The X-linked type of this disorder affects an estimated 1 in 100,000 people.	600
ENPP1	Arterial calcification, generalized, of infancy, type 1	NM_006208.2	NM_006208.2:c.783C>G, NM_006208.2:c.797G>T, NM_006208.2:c.900G>A, NM_006208.2:c.913C>A, NM_006208.2:c.1025G>T, NM_006208.2:c.1112A>T, NM_006208.2:c.1612G>C, NM_006208.2:c.2230C>T, NM_006208.2:c.2677G>T, NM_006208.2:c.2702A>C	Arterial calcification, generalized, of infancy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENPP1 gene located on chromosomal region 6q22-q23. The age of onset is neonatal/infancy. A severe autosomal recessive disorder characterized by calcification of the internal elastic lamina of muscular arteries and stenosis due to myointimal proliferation. The disorder is often fatal within the first 6 months of life because of myocardial ischemia resulting in refractory heart failure.	600
ERCC2	Trichothiodystrophy, type 1	NM_000400.3	NM_000400.3:c.2230_2233dupCTAG, NM_000400.3:c.2176C>T, NM_000400.3:c.2047C>T, NM_000400.3:c.1972C>T, NM_000400.3:c.1703_1704delTT, NM_000400.3:c.1621A>C, NM_000400.3:c.1454T>C, NM_000400.3:c.1381C>G, NM_000400.3:c.1354C>T, NM_000400.3:c.1308-1G>A, NM_000400.3:c.950-2A>G, NM_000400.3:c.949+1G>A, NM_000400.3:c.719-1G>A, NM_000400.3:c.567G>A, NM_000400.3:c.183+2T>A	Trichothiodystrophy (TTD), type 1 is a heterogeneous group of disorders that follows an autosomal recessive pattern of inheritance. It is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.32. The age of onset is neonatal or infantile. This disease, with variable clinical expression, is characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. About half of the patients with TTD exhibit marked photosensitivity.	600,25
ERCC3	Trichothiodystrophy, type 2	NM_000122.1	NM_000122.1:c.1858delG, NM_000122.1:c.1757_1758delAG, NM_000122.1:c.1757delA, NM_000122.1:c.1633C>T, NM_000122.1:c.1273C>T, NM_000122.1:c.296T>C	Trichothiodystrophy (TTD), type 2 is a heterogeneous group of disorders that follows an autosomal recessive pattern of inheritance. It is caused by pathogenic variants in the ERCC3 gene located on chromosomal region 2q14.3. The age of onset is neonatal or infantile. This disease, with variable clinical expression, is characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. About half of the patients with TTD exhibit marked photosensitivity.	600
ERCC5	Cerebrooculofacioskeletal syndrome, type 3	NM_000123.3	NM_000123.3:c.88+2T>C, NM_000123.3:c.215C>A, NM_000123.3:c.381-2A>G, NM_000123.3:c.406C>T, NM_000123.3:c.464dupA, NM_000123.3:c.526C>T, NM_000123.3:c.787C>T, NM_000123.3:c.2144dupA, NM_000123.3:c.2375C>T, NM_000123.3:c.2573T>C, NM_000123.3:c.2751delA	Cerebrooculofacioskeletal syndrome type 3, also known as COFS syndrome, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC5 gene located on chromosomal region 13q33.1. COFS syndrome is characterized by prenatal onset of arthrogryposis, microcephaly and growth failure. Postnatal features include severe developmental delay, congenital cataracts (in some), and marked UV sensitivity of the skin. Survival beyond 6 years of age is rare. The prevalence is below 1/1,000,000.	600,25
ERCC6	Cockayne syndrome, type B; Cerebrooculofacioskeletal syndrome, type 1	NM_000124.3	NM_000124.3:c.3862C>T, NM_000124.3:c.3591_3592dupGA, NM_000124.3:c.2587C>T, NM_000124.3:c.2203C>T, NM_000124.3:c.2047C>T, NM_000124.3:c.1550G>A, NM_000124.3:c.1357C>T, NM_000124.3:c.422+1G>A, NM_000124.3:c.207dupG, NM_000124.3:c.48_49delCT	Cockayne syndrome (CS), type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterized by short stature, a characteristic facial appearance, premature aging, photosensitivity, progressive neurological dysfunction, and intellectual deficit. Mutations in the ERRC6 gene have been also found in patients with COFS syndrome type 1, an extreme prenatal form of the CS clinical spectrum. This autosomal recessive progressive neurodegenerative disorder is characterized by microcephaly, congenital cataracts, severe mental retardation, facial dysmorphism, and arthrogryposis.	600,25
ERCC8	Cockayne syndrome, type A	NM_000082.3	NM_000082.3:c.966C>A, NM_000082.3:c.618-1G>A, NM_000082.3:c.593_594dupAT, NM_000082.3:c.37G>T	Cockayne syndrome, type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC8 gene located on chromosomal region 5q12.1. The age of onset is variable. This disease is characterized by short stature, a characteristic facial appearance, premature aging, photosensitivity, progressive neurological dysfunction, and intellectual deficit. The prevalence is 2.7/1,000,000 newborns in Western Europe.	600
ESCO2	Roberts syndrome	NM_001017420.2	NM_001017420.2:c.296_297dupGA, NM_001017420.2:c.308_309delAA, NM_001017420.2:c.505C>T, NM_001017420.2:c.604C>T, NM_001017420.2:c.876_879delCAGA, NM_001017420.2:c.879_880delAG, NM_001017420.2:c.1269G>A, NM_001017420.2:c.1597dupT, NM_001017420.2:c.1615T>G	Roberts syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESCO2 gene located on chromosomal region 8p21.1. The age of onset is neonatal/infantile. This disease is characterized by pre- and postnatal growth retardation, severe symmetric limb reduction defects, craniofacial anomalies and severe intellectual deficit.	600
ESPN	Deafness, autosomal recessive, type 36	NM_031475.2	NM_031475.2:c.1988_1991delAGAG, NM_031475.2:c.2470_2473delTCAG	Autosomal recessive nonsyndromic sensorineural deafness type 36 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESPN gene located on chromosomal region 1p36.31. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	600
ESRRB	Deafness, autosomal recessive, type 35	NM_004452.3	NM_004452.3:c.329C>T	Autosomal recessive nonsyndromic sensorineural deafness type 35 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESRRB gene located on chromosomal region 14q24.3. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	600
ETFA	Glutaric acidemia, type 2A	NM_000126.3	NM_000126.3:c.797C>T, NM_000126.3:c.470T>G	Glutaric acidemia, type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFA gene located on chromosomal region 15q23-q25. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.	600
ETFB	Glutaric acidemia, type 2B	NM_001014763.1	NM_001014763.1:c.887_889delAGA, NM_001014763.1:c.764G>A, NM_001014763.1:c.655G>A, NM_001014763.1:c.551_552insG, NM_001014763.1:c.334C>T, NM_001014763.1:c.278_279insG	Glutaric acidemia, type 2B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFB gene located on chromosomal region 19q13.3. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.	600
ETFDH	Glutaric acidemia, type 2C	NM_004453.3	NM_004453.3:c.2T>C, NM_004453.3:c.250G>A, NM_004453.3:c.413T>G, NM_004453.3:c.524G>T, NM_004453.3:c.1001T>C, NM_004453.3:c.1234G>T, NM_004453.3:c.1367C>T, NM_004453.3:c.1570_1571delCT, NM_004453.3:c.1823delG, NM_004453.3:c.1832G>A	Glutaric acidemia, type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFDH gene located on chromosomal region 4q32-q35. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.	600
ETHE1	Ethylmalonic encephalopathy	NM_014297.4	NM_014297.4:c.604dupG, NM_014297.4:c.554T>G, NM_014297.4:c.488G>A, NM_014297.4:c.487C>T, NM_014297.4:c.440_450delACAGCATGGCC, NM_014297.4:c.221dupA	Ethylmalonic encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETHE1 gene located on chromosomal region 19q13.31. The age of onset is neonatal/infantile. This disease is characterized by elevated excretion of ethylmalonic acid with recurrent petechiae, orthostatic acrocyanosis and chronic diarrhoea associated with neurodevelopmental delay, psychomotor regression and hypotonia with brain magnetic resonance imaging abnormalities. The prevalence is below 1/1,000,000, with total of 30 cases of patients reported worldwide, mainly for Mediterranean and Arab populations.	600
EYS	Retinitis pigmentosa, type 25	NM_001292009.1	NM_001292009.1:c.9468T>A, NM_001292009.1:c.9362_9365delCTCA, NM_001292009.1:c.9099delT, NM_001292009.1:c.8711_8718delCATGCAGA, NM_001292009.1:c.8692_8695dupACAG, NM_001292009.1:c.8632G>T, NM_001292009.1:c.8471dupA, NM_001292009.1:c.7822C>T, NM_001292009.1:c.7095T>G, NM_001292009.1:c.6170delA, NM_001292009.1:c.6102dupT, NM_001292009.1:c.5928-2A>G, NM_001292009.1:c.5857G>T, NM_001292009.1:c.5757dupT, NM_001292009.1:c.4462_4469dupAGCCCCTC, NM_001292009.1:c.4350_4356delTATAGCT, NM_001292009.1:c.4120C>T, NM_001292009.1:c.4045C>T, NM_001292009.1:c.2826_2827delAT, NM_001292009.1:c.1211dupA, NM_001292009.1:c.571dupA, NM_001292009.1:c.490C>T, NM_001292009.1:c.232delT, NM_001292009.1:c.103C>T	Retinitis pigmentosa, type 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EYS gene located on chromosomal region 6q12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000.	600,25
F11	Factor XI deficiency, autosomal recessive	NM_000128.3	NM_000128.3:c.166T>C, NM_000128.3:c.403G>T, NM_000128.3:c.438C>A, NM_000128.3:c.595+3A>G, NM_000128.3:c.901T>C, NM_000128.3:c.1211C>A, NM_000128.3:c.1613C>T, NM_000128.3:c.1693G>A	Factor XI deficiency, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F11 gene located on chromosomal region 4q35. The age of onset is variable. This disease is characterized by reduced levels and activity of factor XI resulting in moderate bleeding symptoms, usually occurring after trauma or surgery. The prevalence is 1/1,000,000 to 9/1,000,000.	600,25
F8	Hemophilia A	-0	Inv22	Hemophilia A follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F8 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor VIII deficiency. The prevalence is 1/4,000 to 1/ 5,000 male newborns.	600
F8	Hemophilia A	NM_000132.3	NM_000132.3:c.7033_7040delTGCGAGGC, NM_000132.3:c.7034G>A, NM_000132.3:c.7031G>A, NM_000132.3:c.7030G>T, NM_000132.3:c.7030G>A, NM_000132.3:c.7021G>T, NM_000132.3:c.7016G>T, NM_000132.3:c.7012delC, NM_000132.3:c.6997delG, NM_000132.3:c.6996G>A, NM_000132.3:c.6995G>C, NM_000132.3:c.6988delC, NM_000132.3:c.6986C>T, NM_000132.3:c.6976C>G, NM_000132.3:c.6914_6918delATCAA, NM_000132.3:c.6915delT, NM_000132.3:c.6905T>C, NM_000132.3:c.6904T>G, NM_000132.3:c.6901-2A>G, NM_000132.3:c.6900+1G>A, NM_000132.3:c.6887delA, NM_000132.3:c.6870G>A, NM_000132.3:c.6869G>T, NM_000132.3:c.6857_6867delATGGCCATCAG, NM_000132.3:c.6865C>T, NM_000132.3:c.6842T>C, NM_000132.3:c.6839T>C, NM_000132.3:c.6836T>G, NM_000132.3:c.6836T>C, NM_000132.3:c.6825T>A, NM_000132.3:c.6804delA, NM_000132.3:c.6797delG, NM_000132.3:c.6797G>A, NM_000132.3:c.6796G>A, NM_000132.3:c.6780_6788delAGGAGTAAC, NM_000132.3:c.6786_6787insCAA, NM_000132.3:c.6760delC, NM_000132.3:c.6760C>T, NM_000132.3:c.6752T>A, NM_000132.3:c.6746T>G, NM_000132.3:c.6743G>C, NM_000132.3:c.6740_6741delAG, NM_000132.3:c.6739G>T, NM_000132.3:c.6738delA, NM_000132.3:c.6574+5G>C, NM_000132.3:c.6574+3A>C, NM_000132.3:c.6574+1G>T, NM_000132.3:c.6574+1G>A, NM_000132.3:c.6565_6566delGA, NM_000132.3:c.6551A>T, NM_000132.3:c.6548T>G, NM_000132.3:c.6544C>G, NM_000132.3:c.6537C>G, NM_000132.3:c.6533G>A, NM_000132.3:c.6520C>G, NM_000132.3:c.6515C>G, NM_000132.3:c.6501delC, NM_000132.3:c.6497delG, NM_000132.3:c.6494delC, NM_000132.3:c.6489delT, NM_000132.3:c.6488T>G, NM_000132.3:c.6482C>T, NM_000132.3:c.6482C>A, NM_000132.3:c.6477delT, NM_000132.3:c.6469_6470delAA, NM_000132.3:c.6465delA, NM_000132.3:c.6464_6465delAA, NM_000132.3:c.6449A>T, NM_000132.3:c.6430-3C>G, NM_000132.3:c.6273+1G>A, NM_000132.3:c.6269T>A, NM_000132.3:c.6263C>T, NM_000132.3:c.6253G>T, NM_000132.3:c.6250A>T, NM_000132.3:c.6243G>C, NM_000132.3:c.6242G>C, NM_000132.3:c.6239C>T, NM_000132.3:c.6213A>T, NM_000132.3:c.6194G>A, NM_000132.3:c.6136dupA, NM_000132.3:c.6134G>T, NM_000132.3:c.6130delC, NM_000132.3:c.6120T>A, NM_000132.3:c.6116-2A>G, NM_000132.3:c.6115+6T>A, NM_000132.3:c.6115+4A>G, NM_000132.3:c.6115+3G>T, NM_000132.3:c.6115+2T>C, NM_000132.3:c.6115+1G>A, NM_000132.3:c.6107A>G, NM_000132.3:c.6099delT, NM_000132.3:c.6089dupG, NM_000132.3:c.6084delG, NM_000132.3:c.6078_6079delTG, NM_000132.3:c.6070dupC, NM_000132.3:c.6046C>G, NM_000132.3:c.6037G>A, NM_000132.3:c.6016G>T, NM_000132.3:c.5999G>C, NM_000132.3:c.5964_5967dupGGAG, NM_000132.3:c.5961delA, NM_000132.3:c.5960_5961delAA, NM_000132.3:c.5954G>C, NM_000132.3:c.5953delC, NM_000132.3:c.5939A>C, NM_000132.3:c.5934T>G, NM_000132.3:c.5923dupA, NM_000132.3:c.5924T>A, NM_000132.3:c.5914_5915delAT, NM_000132.3:c.5894G>T, NM_000132.3:c.5888T>C, NM_000132.3:c.5884T>G, NM_000132.3:c.5881T>A, NM_000132.3:c.5879G>T, NM_000132.3:c.5869C>T, NM_000132.3:c.5861_5866delCTCAGG, NM_000132.3:c.5853A>C, NM_000132.3:c.5833A>G, NM_000132.3:c.5825G>T, NM_000132.3:c.5816C>A, NM_000132.3:c.5766C>A, NM_000132.3:c.5752delT, NM_000132.3:c.5721C>G, NM_000132.3:c.5719dupA, NM_000132.3:c.5719A>T, NM_000132.3:c.5712G>C, NM_000132.3:c.5697delC, NM_000132.3:c.5696dupT, NM_000132.3:c.5689_5690delCT, NM_000132.3:c.5686G>C, NM_000132.3:c.5680G>A, NM_000132.3:c.5675dupT, NM_000132.3:c.5674G>A, NM_000132.3:c.5348_5357delGAGCAGAAGT, NM_000132.3:c.5345T>G, NM_000132.3:c.5343T>A, NM_000132.3:c.5339C>T, NM_000132.3:c.5337delG, NM_000132.3:c.5330T>C, NM_000132.3:c.5321A>T, NM_000132.3:c.5308G>A, NM_000132.3:c.5301C>A, NM_000132.3:c.5291A>G, NM_000132.3:c.5269delT, NM_000132.3:c.5269T>C, NM_000132.3:c.5254delG, NM_000132.3:c.5251A>T, NM_000132.3:c.5243delA, NM_000132.3:c.5227_5228delAG, NM_000132.3:c.5220-1G>A, NM_000132.3:c.5012G>A, NM_000132.3:c.5010delT, NM_000132.3:c.4999delC, NM_000132.3:c.4996C>T, NM_000132.3:c.4987A>T, NM_000132.3:c.4979C>T, NM_000132.3:c.4969C>T, NM_000132.3:c.4942C>T, NM_000132.3:c.4935G>A, NM_000132.3:c.4934G>A, NM_000132.3:c.4926delA, NM_000132.3:c.4922dupT, NM_000132.3:c.4918G>T, NM_000132.3:c.4899delT, NM_000132.3:c.4895dupT, NM_000132.3:c.4895delT, NM_000132.3:c.4864G>A, NM_000132.3:c.4858delC, NM_000132.3:c.4848delC, NM_000132.3:c.4841delA, NM_000132.3:c.4828G>T, NM_000132.3:c.4825delA, NM_000132.3:c.4814C>A, NM_000132.3:c.4806delA, NM_000132.3:c.4805_4806delAA, NM_000132.3:c.4798A>T, NM_000132.3:c.4794G>T, NM_000132.3:c.4770T>A, NM_000132.3:c.4719_4729delTGCAAAGACTC, NM_000132.3:c.4720delG, NM_000132.3:c.4712_4715delAAAG, NM_000132.3:c.4694_4697delTTCT, NM_000132.3:c.4687delG, NM_000132.3:c.4686delA, NM_000132.3:c.4662_4663delGA, NM_000132.3:c.4658delA, NM_000132.3:c.4619delT, NM_000132.3:c.4561C>T, NM_000132.3:c.4542delT, NM_000132.3:c.4519delA, NM_000132.3:c.4512delG, NM_000132.3:c.4492_4496delGTTCT, NM_000132.3:c.4492_4493delGT, NM_000132.3:c.4492delG, NM_000132.3:c.4483delG, NM_000132.3:c.4483G>T, NM_000132.3:c.4474A>T, NM_000132.3:c.4473C>G, NM_000132.3:c.4473C>A, NM_000132.3:c.4460delA, NM_000132.3:c.4450delA, NM_000132.3:c.4446dupG, NM_000132.3:c.4430_4431delAG, NM_000132.3:c.4425_4426delAA, NM_000132.3:c.4423C>T, NM_000132.3:c.4408G>T, NM_000132.3:c.4382_4383delAC, NM_000132.3:c.4363C>T, NM_000132.3:c.4345G>T, NM_000132.3:c.4339dupG, NM_000132.3:c.4339delG, NM_000132.3:c.4318delT, NM_000132.3:c.4296_4300delTTCTC, NM_000132.3:c.4280delT, NM_000132.3:c.4272delC, NM_000132.3:c.4265_4266delAT, NM_000132.3:c.4242dupA, NM_000132.3:c.4241C>A, NM_000132.3:c.4201C>T, NM_000132.3:c.4199delC, NM_000132.3:c.4156C>T, NM_000132.3:c.4103delC, NM_000132.3:c.4094_4100delATTTGAC, NM_000132.3:c.4072C>T, NM_000132.3:c.4045delA, NM_000132.3:c.4035delA, NM_000132.3:c.4006C>T, NM_000132.3:c.3994_3997delAGAG, NM_000132.3:c.3991_3992delAA, NM_000132.3:c.3984dupA, NM_000132.3:c.3982C>T, NM_000132.3:c.3967C>T, NM_000132.3:c.3964C>T, NM_000132.3:c.3922G>T, NM_000132.3:c.3913C>T, NM_000132.3:c.3907_3911delACCAA, NM_000132.3:c.3902delA, NM_000132.3:c.3870dupA, NM_000132.3:c.3863dupC, NM_000132.3:c.3860delT, NM_000132.3:c.3851_3852delCA, NM_000132.3:c.3844A>T, NM_000132.3:c.3842_3844delAGAinsGG, NM_000132.3:c.3833delA, NM_000132.3:c.3830delC, NM_000132.3:c.3827C>G, NM_000132.3:c.3772delT, NM_000132.3:c.3766G>T, NM_000132.3:c.3756delG, NM_000132.3:c.3735_3744delCCTTTTCTTAinsATTTCTTTTTCTTT, NM_000132.3:c.3736delC, NM_000132.3:c.3710delC, NM_000132.3:c.3652delG, NM_000132.3:c.3631A>T, NM_000132.3:c.3624delT, NM_000132.3:c.3607G>T, NM_000132.3:c.3565dupA, NM_000132.3:c.3548_3549delAA, NM_000132.3:c.3500dupA, NM_000132.3:c.3496A>T, NM_000132.3:c.3493G>T, NM_000132.3:c.3490delT, NM_000132.3:c.3421C>T, NM_000132.3:c.3417dupT, NM_000132.3:c.3416_3417delCT, NM_000132.3:c.3409_3410delCT, NM_000132.3:c.3388delA, NM_000132.3:c.3385delC, NM_000132.3:c.3371C>A, NM_000132.3:c.3344delT, NM_000132.3:c.3302_3303delAG, NM_000132.3:c.3300delA, NM_000132.3:c.3298A>T, NM_000132.3:c.3289C>T, NM_000132.3:c.3251C>G, NM_000132.3:c.3224delC, NM_000132.3:c.3203_3204delGA, NM_000132.3:c.3196C>T, NM_000132.3:c.3152delT, NM_000132.3:c.3150_3151insTC, NM_000132.3:c.3053delA, NM_000132.3:c.3034G>C, NM_000132.3:c.3031A>T, NM_000132.3:c.2412_2421delCTCCTCTAGT, NM_000132.3:c.2419dupA, NM_000132.3:c.2409delT, NM_000132.3:c.2404C>T, NM_000132.3:c.2397delT, NM_000132.3:c.2384_2388delGAACA, NM_000132.3:c.2373dupG, NM_000132.3:c.2360delA, NM_000132.3:c.2102_2106delTGGAA, NM_000132.3:c.2097G>A, NM_000132.3:c.2096T>A, NM_000132.3:c.2095A>T, NM_000132.3:c.2095A>G, NM_000132.3:c.2095A>C, NM_000132.3:c.2089_2090delGT, NM_000132.3:c.2090T>A, NM_000132.3:c.2066T>G, NM_000132.3:c.2060T>C, NM_000132.3:c.2058_2059delAC, NM_000132.3:c.2057C>G, NM_000132.3:c.2032A>T, NM_000132.3:c.2029T>C, NM_000132.3:c.2015_2017delTCT, NM_000132.3:c.2000delT, NM_000132.3:c.1996_1999dupGACT, NM_000132.3:c.1996_1999delGACT, NM_000132.3:c.1990_1991delCA, NM_000132.3:c.1991A>C, NM_000132.3:c.1988C>T, NM_000132.3:c.1985G>C, NM_000132.3:c.1952A>C, NM_000132.3:c.1947_1950delTTTG, NM_000132.3:c.1941_1944delAGTT, NM_000132.3:c.1934A>C, NM_000132.3:c.1913G>A, NM_000132.3:c.1912G>A, NM_000132.3:c.1904-1G>A, NM_000132.3:c.1904-37G>A, NM_000132.3:c.1752+5G>C, NM_000132.3:c.1736A>T, NM_000132.3:c.1726G>T, NM_000132.3:c.1703G>T, NM_000132.3:c.1688C>G, NM_000132.3:c.1682A>C, NM_000132.3:c.1681G>A, NM_000132.3:c.1675G>T, NM_000132.3:c.1667T>A, NM_000132.3:c.1661G>A, NM_000132.3:c.1653T>G, NM_000132.3:c.1640G>A, NM_000132.3:c.1639T>C, NM_000132.3:c.1630G>A, NM_000132.3:c.1619C>G, NM_000132.3:c.1618C>A, NM_000132.3:c.1596dupG, NM_000132.3:c.1596G>A, NM_000132.3:c.1595G>A, NM_000132.3:c.1594T>G, NM_000132.3:c.1585A>G, NM_000132.3:c.1560delT, NM_000132.3:c.1538-1G>T, NM_000132.3:c.1538-2A>T, NM_000132.3:c.1477A>G, NM_000132.3:c.1463C>T, NM_000132.3:c.1463C>G, NM_000132.3:c.1443+3A>C, NM_000132.3:c.1443+2T>C, NM_000132.3:c.1442_1443dupTG, NM_000132.3:c.1443+1G>A, NM_000132.3:c.1432G>A, NM_000132.3:c.1420G>T, NM_000132.3:c.1410_1413delTTTA, NM_000132.3:c.1406G>C, NM_000132.3:c.1400T>G, NM_000132.3:c.1397G>A, NM_000132.3:c.1394C>G, NM_000132.3:c.1390G>T, NM_000132.3:c.1357G>T, NM_000132.3:c.1348T>G, NM_000132.3:c.1338delA, NM_000132.3:c.1336dupC, NM_000132.3:c.1337G>C, NM_000132.3:c.1337G>A, NM_000132.3:c.1331_1332delAA, NM_000132.3:c.1331_1332delAAinsT, NM_000132.3:c.1331A>C, NM_000132.3:c.1325A>G, NM_000132.3:c.1324T>C, NM_000132.3:c.1324T>A, NM_000132.3:c.1316G>A, NM_000132.3:c.1311delG, NM_000132.3:c.1301G>A, NM_000132.3:c.1293delG, NM_000132.3:c.1234T>C, NM_000132.3:c.1214T>G, NM_000132.3:c.1207C>G, NM_000132.3:c.1203G>A, NM_000132.3:c.1202G>A, NM_000132.3:c.1200_1201delTT, NM_000132.3:c.1189dupC, NM_000132.3:c.1175C>G, NM_000132.3:c.1175C>A, NM_000132.3:c.1172G>C, NM_000132.3:c.1165delC, NM_000132.3:c.1077_1080delTGAA, NM_000132.3:c.1078_1079delGA, NM_000132.3:c.1042T>C, NM_000132.3:c.986G>T, NM_000132.3:c.985dupT, NM_000132.3:c.986G>C, NM_000132.3:c.986G>A, NM_000132.3:c.984delT, NM_000132.3:c.974_975delTT, NM_000132.3:c.967G>A, NM_000132.3:c.948_951delAACA, NM_000132.3:c.943delG, NM_000132.3:c.941C>T, NM_000132.3:c.935delT, NM_000132.3:c.920T>G, NM_000132.3:c.919delA, NM_000132.3:c.907delG, NM_000132.3:c.902G>C, NM_000132.3:c.899A>T, NM_000132.3:c.899A>C, NM_000132.3:c.889delG, NM_000132.3:c.886C>T, NM_000132.3:c.883T>C, NM_000132.3:c.872A>G, NM_000132.3:c.871G>T, NM_000132.3:c.850G>T, NM_000132.3:c.850G>A, NM_000132.3:c.849delT, NM_000132.3:c.836T>A, NM_000132.3:c.832G>A, NM_000132.3:c.824A>G, NM_000132.3:c.822G>A, NM_000132.3:c.796G>T, NM_000132.3:c.788-1G>T, NM_000132.3:c.788-1G>C, NM_000132.3:c.788-1G>A, NM_000132.3:c.788-2A>T, NM_000132.3:c.787+2T>C, NM_000132.3:c.787G>C, NM_000132.3:c.779C>G, NM_000132.3:c.775A>T, NM_000132.3:c.770_771insCC, NM_000132.3:c.764G>A, NM_000132.3:c.760A>T, NM_000132.3:c.755C>A, NM_000132.3:c.729delT, NM_000132.3:c.709C>T, NM_000132.3:c.695_698delAGAA, NM_000132.3:c.688_689delGA, NM_000132.3:c.685_686delTC, NM_000132.3:c.680G>A, NM_000132.3:c.676A>T, NM_000132.3:c.577G>A, NM_000132.3:c.571C>T, NM_000132.3:c.566C>A, NM_000132.3:c.560T>A, NM_000132.3:c.557A>G, NM_000132.3:c.556G>A, NM_000132.3:c.553A>G, NM_000132.3:c.545A>T, NM_000132.3:c.535T>C, NM_000132.3:c.532C>G, NM_000132.3:c.525C>A, NM_000132.3:c.519_523delTACCT, NM_000132.3:c.514_515insTCAAGATA, NM_000132.3:c.515G>A, NM_000132.3:c.514T>C, NM_000132.3:c.493C>T, NM_000132.3:c.489T>A, NM_000132.3:c.476T>C, NM_000132.3:c.472C>T, NM_000132.3:c.471G>A, NM_000132.3:c.446delC, NM_000132.3:c.440T>A, NM_000132.3:c.435_436insTTT, NM_000132.3:c.433G>C, NM_000132.3:c.430G>T, NM_000132.3:c.421G>T, NM_000132.3:c.415C>T, NM_000132.3:c.407A>C, NM_000132.3:c.405T>A, NM_000132.3:c.404A>G, NM_000132.3:c.403G>A, NM_000132.3:c.265+1G>T, NM_000132.3:c.265G>A, NM_000132.3:c.255_257delACC, NM_000132.3:c.250A>G, NM_000132.3:c.230T>C, NM_000132.3:c.225T>A, NM_000132.3:c.224delA, NM_000132.3:c.223G>T, NM_000132.3:c.217T>C, NM_000132.3:c.214G>A, NM_000132.3:c.209T>C, NM_000132.3:c.201_202dupGA, NM_000132.3:c.203C>A, NM_000132.3:c.201G>T, NM_000132.3:c.199_200delAA, NM_000132.3:c.200A>C, NM_000132.3:c.199A>G, NM_000132.3:c.195C>A, NM_000132.3:c.185C>G, NM_000132.3:c.173delC, NM_000132.3:c.144-5C>G, NM_000132.3:c.144-11T>G, NM_000132.3:c.144-26A>T, NM_000132.3:c.143+1G>A, NM_000132.3:c.120delC, NM_000132.3:c.98G>A, NM_000132.3:c.97T>G, NM_000132.3:c.88G>A, NM_000132.3:c.86T>G, NM_000132.3:c.77T>C, NM_000132.3:c.65G>C, NM_000132.3:c.1A>G	Hemophilia A follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F8 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor VIII deficiency. The prevalence is 1/4,000 to 1/ 5,000 male newborns.	600
F9	Hemophilia B	NM_000133.3	NM_000133.3:c.82T>C, NM_000133.3:c.1031T>C, NM_000133.3:c.1136G>A, NM_000133.3:c.1150C>T	Hemophilia B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F9 gene located on chromosomal region Xq27.1-q27.2. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor IX deficiency. The prevalence is 1/100,000 to 9/100,000.	600,25
FAH	Tyrosinemia, type 1	NM_000137.2	NM_000137.2:c.47A>T, NM_000137.2:c.192G>T, NM_000137.2:c.401C>A, NM_000137.2:c.456G>A, NM_000137.2:c.554-1G>T, NM_000137.2:c.707-1G>A, NM_000137.2:c.782C>T, NM_000137.2:c.786G>A, NM_000137.2:c.837+1G>A, NM_000137.2:c.939delC, NM_000137.2:c.982C>T, NM_000137.2:c.1009G>A, NM_000137.2:c.1027G>T, NM_000137.2:c.1062+5G>A, NM_000137.2:c.1069G>T, NM_000137.2:c.1090G>T, NM_000137.2:c.1141A>G	Tyrosinemia, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAH gene located on chromosomal region 15q25.1. The age of onset is variable. This disease is characterized by progressive liver disease, renal tubular dysfunction, porphyria-like crises and a dramatic improvement in prognosis following treatment with nitisinone. The birth incidence is 1/100,000, notably in Qu�bec, Canada, and the prevalence is 1/100,000 to 1/120,000 newborns.	600,25
FAM126A	Hypomyelinating leukodystrophy, type 5	NM_032581.3	NM_032581.3:c.158T>C	Hypomyelinating leukodystrophy, type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAM126A gene located on chromosomal region 7p15.3. The age of onset is neonatal/infantile. This disease is characterized by the onset of cataract either at birth or in the first two months of life, delayed psychomotor development by the end of the first year of life and moderate intellectual deficit. The prevalence is below 1/1,000,000.	600
FAM20C	Raine syndrome	NM_020223.3	NM_020223.3:c.1093G>C, NM_020223.3:c.1163T>G	Raine syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAM20C gene located on chromosomal region 7p22.3. The age of onset is neonatal/infantile. This disease is characterized by generalized osteosclerosis with periosteal bone formation, characteristic facial dysmorphism, brain abnormalities including intracerebral calcifications, and neonatal lethal course. The prevalence is below 1/1,000,000.	600
FANCA	Fanconi anemia, complementation group A	NM_000135.2	NM_000135.2:c.4130C>G, NM_000135.2:c.3788_3790delTCT, NM_000135.2:c.3763G>T, NM_000135.2:c.3558dupG, NM_000135.2:c.2303T>C, NM_000135.2:c.1115_1118delTTGG, NM_000135.2:c.233_236delTTGA, NM_000135.2:c.131dupA	Fanconi anemia, complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCA gene located on chromosomal region 16q24.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	600,25
FANCC	Fanconi anemia, complementation group C	NM_000136.2	NM_000136.2:c.1642C>T, NM_000136.2:c.1487T>G, NM_000136.2:c.1103_1104delTG, NM_000136.2:c.1015delA, NM_000136.2:c.996+1G>T, NM_000136.2:c.67delG, NM_000136.2:c.37C>T	Fanconi anemia, complementation group C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCC gene located on chromosomal region 9q22.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	600,25
FANCG	Fanconi anemia, complementation group G	NM_004629.1	NM_004629.1:c.1852_1853delAA, NM_004629.1:c.1795_1804delTGGATCCGTC, NM_004629.1:c.1480+1G>C, NM_004629.1:c.1077-2A>G, NM_004629.1:c.907_908dupCT, NM_004629.1:c.637_643delTACCGCC, NM_004629.1:c.510+1G>A, NM_004629.1:c.313G>T	Fanconi anemia, complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCG gene located on chromosomal region 9p13. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	600,25
FGA	Afibrinogenemia, congenital	NM_000508.4	NM_000508.4:c.1441delG, NM_000508.4:c.1359dupC, NM_000508.4:c.1039C>T	Congenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGA gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000.	600
FGA	Afibrinogenemia, congenital	NM_021871.3	NM_021871.3:c.1906dupC	Congenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGA gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000.	600
FGB	Congenital afibrinogenemia	NM_005141.4	NM_005141.4:c.1148T>G, NM_005141.4:c.1289G>A	Congenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGB gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000.	600,25
FGD4	Charcot-Marie-Tooth disease, type 4H	NM_001304480.1	NM_001304480.1:c.1006C>T, NM_001304480.1:c.1229T>C, NM_001304480.1:c.1229T>G, NM_001304480.1:c.1661G>A	Charcot-Marie-Tooth disease, type 4H follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGD4 gene located on chromosomal region 12p11.21. The age of onset is neonatal/infantile. This disease is characterized by slowly progressive muscle weakness in the distal extremities, and other common features include delayed walking, an abnormal gait, scoliosis and pes equines with toe retraction. The prevalence is 1/3,300.	600
FH	Fumarase deficiency	NM_000143.3	NM_000143.3:c.1446_1449delAAAG, NM_000143.3:c.1431_1433dupAAA, NM_000143.3:c.1394A>G, NM_000143.3:c.1293delA, NM_000143.3:c.1255T>C, NM_000143.3:c.1236+1G>C, NM_000143.3:c.1200delT, NM_000143.3:c.1189G>A, NM_000143.3:c.1093A>G, NM_000143.3:c.1067T>A, NM_000143.3:c.901dupA, NM_000143.3:c.793G>A, NM_000143.3:c.760C>T, NM_000143.3:c.698G>A, NM_000143.3:c.697C>T, NM_000143.3:c.521C>G, NM_000143.3:c.320A>C, NM_000143.3:c.40dupC	Fumarase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FH gene located on chromosomal region 1q42.1. The age of onset is neonatal/infantile. This disease is characterized byﾠhypotonia, severe psychomotor impairment, convulsions, respiratory distress, feeding difficulties and frequent cerebral malformations, along with a distinctive facies, although some patients present with only moderate intellectual impairment. The prevalence is below 1,000,000.	600
FHL1	Emery-Dreifuss muscular dystrophy, type 6, X-linked	NM_001159702.2	NM_001159702.2:c.310T>C, NM_001159702.2:c.625T>C, NM_001159702.2:c.838G>A	Emery-Dreifuss muscular dystrophy, type 6, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FHL1 gene located on chromosomal region Xq26. ﾠThis is a condition that primarily affects muscles used for movement (skeletalﾠmuscles) and the heart (cardiac muscle). Among the earliest features of this disorder are joint deformities called contractures. Contractures restrict the movement of certain joints, most often the elbows, ankles, and neck, and usually become noticeable in early childhood. Most affected individuals also experience muscle weakness andﾠwastingﾠthat worsen slowly over time, beginning in muscles of the upper arms and lower legs and later also affecting muscles in the shoulders and hips. Almost all people with Emery-Dreifuss muscular dystrophy develop heart problems by adulthood. The X-linked type of this disorder affects an estimated 1 in 100,000 people.	600
FIG4	Charcot-Marie-Tooth disease, type 4J; Yunis-Varon syndrome	NM_014845.5	NM_014845.5:c.122T>C, NM_014845.5:c.311G>A, NM_014845.5:c.501C>G, NM_014845.5:c.547C>T, NM_014845.5:c.592C>T, NM_014845.5:c.737G>A, NM_014845.5:c.831_838delTAAATTTG, NM_014845.5:c.2299dupG	Charcot-Marie-Tooth disease, type 4J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by rapidly progressive, asymmetric motor neuron degeneration with slow nerve conduction velocities, weakness and paralysis, without sensory loss. The prevalence is 4/100,000 to 8/100,000. Mutations in the FIG4 gene have been also found in patient with Yunis-Varon syndrome. This disease is a severe autosomal recessive disorder characterized by skeletal defects, including cleidocranial dysplasia and digital anomalies, and severe neurologic involvement with neuronal loss. Enlarged cytoplasmic vacuoles are found in neurons, muscle, and cartilage. The disorder is usually lethal in infancy.	600,25
FKRP	Muscular dystrophy-dystroglycanopathy, type 5A, 5B and 5C	NM_001039885.2	NM_001039885.2:c.160C>T, NM_001039885.2:c.1154C>A, NM_001039885.2:c.1343C>T, NM_001039885.2:c.1387A>G	Muscular dystrophy-dystroglycanopathy type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is neonatal or early infancy. There are three subtypes of dystroglycanopathies related to FKRP gene: subtype 5A, 5B and 5C. Subtype 5A is the most severe phenotype and is associated with congenital brain and eye anomalies, cobblestone lissencephaly, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Subtype 5B represents an intermediate phenotype with or without congenital mental retardation, white matter changes and structural brain abnormalities. Finally, subtype 5C is the less severe phenotype characterized by limb-girdle muscular dystrophy, variable age at onset, normal cognition, and no structural brain changes.	600,25
FKTN	Muscular dystrophy-dystroglycanopathy, type 4A, 4B and 4C	NM_001079802.1	NM_001079802.1:c.411C>A, NM_001079802.1:c.509C>A, NM_001079802.1:c.527T>C, NM_001079802.1:c.766C>T, NM_001079802.1:c.1112A>G, NM_001079802.1:c.1167dupA, NM_001079802.1:c.1380dupA	Muscular dystrophy-dystroglycanopathy type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKTN gene located on chromosomal region 9q31.2. The age of onset is neonatal or early infancy. There are three subtypes of dystroglycanopathies related to FKTN gene: subtype 4A, 4B and 4C. Subtype 4A is the most severe phenotype and is associated with congenital brain and eye anomalies, seizures, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Subtype 4B represents an intermediate phenotype and congenital mental retardation is not a feature. Finally, subtype 4C is the less severe phenotype characterized by limb-girdle muscular dystrophy, onset in early childhood and cognition and brain structure are usually normal.	600
FLNA	FLNA-related disorders	NM_001110556.1	NM_001110556.1:c.7757-1G>C, NM_001110556.1:c.7551_7552+6delAGGTGAGC, NM_001110556.1:c.7153C>T, NM_001110556.1:c.5132_5133delTCinsAA, NM_001110556.1:c.4777_4778dupAA, NM_001110556.1:c.4543C>T, NM_001110556.1:c.4446_4447dupAT, NM_001110556.1:c.3557C>T, NM_001110556.1:c.3476A>C, NM_001110556.1:c.2761C>T, NM_001110556.1:c.760G>A	Mutation in FLNA causes a wide spectrum of disease including skeletal dysplasia, neuronal migration abnormality, cardiovascular malformation, intellectual disability and intestinal obstruction. FLNA-related disorders can be X-linked recessive (XLR) or X-linked dominant (XLD). Frontometaphyseal dysplasia-1 (FMD1;XLR) is 1 of 4 otopalatodigital syndromes caused by mutations in the FLNA gene. The disorders, which include otopalatodigital syndrome-1 (OPD1; XLD; OMIMﾠ311300), otopalatodigital syndrome-2 (OPD2; XLD;ﾠ304120), and Melnick-Needles syndrome (MNS; XLD;ﾠ309350), constitute a phenotypic spectrum. At the mild end of the spectrum, males with OPD1 have cleft palate and mild skeletal anomalies with conductive deafness caused by ossicular anomalies. FMD1 is characterized by a generalized skeletal dysplasia, deafness, and urogenital defects. Males with OPD2 have disabling skeletal anomalies in addition to variable malformations in the hindbrain, heart, intestines, and kidneys that frequently lead to perinatal death. The most severe phenotype, MNS, is characterized by a skeletal dysplasia in the heterozygote. Affected males exhibit severe malformations similar to those observed in individuals with OPD2, resulting in prenatal lethality or death in the first few months of life (review byﾠRobertson, 2005).ﾠVerloes et al. (2000)ﾠsuggested that these disorders constitute a single entity, which they termed 'frontootopalatodigital osteodysplasia.' Other studies confirm an association between FLNA gene mutation and lung disease, seen in more than 80% of patients with cerebral periventricular nodular heterotopia (PVNH; XLD; 300049); FLNA mutation also cause cardiac valvular dysplasia (XLR; 314400). De novo mutations and mosaic cases have been described.	600
FLVCR1	Posterior column ataxia-retinitis pigmentosa syndrome	NM_014053.3	NM_014053.3:c.361A>G, NM_014053.3:c.574T>C, NM_014053.3:c.739-2delA	Posterior column ataxia-retinitis pigmentosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FLVCR1 gene located on chromosomal region 1q32.3. The age of onset is childhood. This disease is characterized by sensory ataxia, proprioceptive loss and blindness. The prevalence is <1 / 1.000.000.	600
FMR1	Fragile X syndrome	-0	(CGG)n pre-mutated allele	Fragile X syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FMR1 gene located on chromosomal region Xq27.3. The symptoms are variable depending on the range of CGG triplet expansion. In complete mutation the onset is infantile in men and is characterized by intellectual disability, characteristic appearance (large head, long face, prominent forehead and chin, protruding ears) joint laxity and large testes after puberty. In carrier female, the symptoms are milder and include primary ovarian insufficiency. The prevalence is 1/2,500 (full mutation allele) to 1/4,000 (prevalence of symptomatic cases) for both genders.	600,25
FOXN1	T-cell immunodeficiency, congenital alopecia and nail dystrophy	NM_003593.2	NM_003593.2:c.763C>T	T-cell immunodeficiency, congenital alopecia and nail dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FOXN1 gene located on chromosomal region 17q11.2. The age of onset is infantile. This disease is characterized by T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. The prevalence is <1:1,000,000.	600
FRAS1	Fraser syndrome, type 1	NM_025074.6	NM_025074.6:c.835_838delGTGT, NM_025074.6:c.3799C>T, NM_025074.6:c.5605_5606insT, NM_025074.6:c.6433C>T, NM_025074.6:c.6991_6992insGG, NM_025074.6:c.7813C>T, NM_025074.6:c.11160_11167delGCTGGAGA	Fraser syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the gene FRAS1 located on chromosomal region 4q21.21. The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000.	600,25
FREM2	Fraser syndrome, type 2	NM_207361.5	NM_207361.5:c.2366dupC, NM_207361.5:c.3792_3795delTTAT, NM_207361.5:c.5920G>A, NM_207361.5:c.8409+1G>A	Fraser syndrome, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the gene FREM2 located on chromosomal region 13q13.3. The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000.	600
FUCA1	Fucosidosis	NM_000147.4	NM_000147.4:c.1279C>T, NM_000147.4:c.1229T>G, NM_000147.4:c.856C>T, NM_000147.4:c.648C>A, NM_000147.4:c.244C>T	Fucosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FUCA1 gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is characterized by facial dysmorphism, dysostosis multiplex, moderate hepatomegaly, severe intellectual deficit, deafness, and according to age, angiokeratomas. The prevalence is <1:1,000,000.	600
G6PC	Glycogen storage disease, type 1A	NM_000151.3	NM_000151.3:c.113A>T, NM_000151.3:c.229T>C, NM_000151.3:c.230+1G>C, NM_000151.3:c.247C>T, NM_000151.3:c.248G>A, NM_000151.3:c.370G>A, NM_000151.3:c.379_380dupTA, NM_000151.3:c.447-1G>A, NM_000151.3:c.497T>G, NM_000151.3:c.508C>T, NM_000151.3:c.562G>C, NM_000151.3:c.883C>T, NM_000151.3:c.1039C>T	Glycogen storage disease, type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000.	600,25
G6PC	Glycogen storage disease, type 1A	NM_001270397.1	NM_001270397.1:c.474G>A	Glycogen storage disease, type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000.	600,25
G6PC3	Dursun syndrome	NM_138387.3	NM_138387.3:c.141C>G, NM_138387.3:c.346A>G, NM_138387.3:c.758G>A, NM_138387.3:c.778G>C, NM_138387.3:c.784G>C, NM_138387.3:c.935dupT	Dursun syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC3 gene located on chromosomal region 17q21.31. This disease is characterized by familial pulmonary arterial hypertension, cardiac abnormalities including atrial septal defect, leukopenia including intermittent neutropenia, lymphopenia, monocytosis, and anemia. The prevalence is 1:100,000.	600
GAA	Glycogen storage disease 2	NM_000152.4	NM_000152.4:c.118C>T, NM_000152.4:c.236_246delCCACACAGTGC, NM_000152.4:c.307T>G, NM_000152.4:c.525delT, NM_000152.4:c.546+2_546+5delTGGG, NM_000152.4:c.546G>A, NM_000152.4:c.546G>C, NM_000152.4:c.655G>A, NM_000152.4:c.698delA, NM_000152.4:c.768dupT, NM_000152.4:c.853C>T, NM_000152.4:c.877G>A, NM_000152.4:c.925G>A, NM_000152.4:c.1064T>C, NM_000152.4:c.1115A>T, NM_000152.4:c.1316T>A, NM_000152.4:c.1327-2A>G, NM_000152.4:c.1431delT, NM_000152.4:c.1465G>A, NM_000152.4:c.1548G>A, NM_000152.4:c.1552-3C>G, NM_000152.4:c.1561G>A, NM_000152.4:c.1585_1586delTCinsGT, NM_000152.4:c.1634C>T, NM_000152.4:c.1650dupG, NM_000152.4:c.1799G>A, NM_000152.4:c.1827_1828insA, NM_000152.4:c.1847dupA, NM_000152.4:c.1912G>T, NM_000152.4:c.1927G>A, NM_000152.4:c.1933G>T, NM_000152.4:c.1935C>A, NM_000152.4:c.2012T>G, NM_000152.4:c.2015G>A, NM_000152.4:c.2041-1G>A, NM_000152.4:c.2066_2070dupAGCCG, NM_000152.4:c.2105G>T, NM_000152.4:c.2237G>A, NM_000152.4:c.2238G>A, NM_000152.4:c.2238G>C, NM_000152.4:c.2512C>T, NM_000152.4:c.2544delC, NM_000152.4:c.2560C>T	Glycogen storage disease, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAA gene located on chromosomal region 17q25.3. There are two forms: adult and infantile.The age of onset in this last form is before the age of three months. This disease is characterized by severe hypotonia, hypertrophic cardiomyopathy and progressive hepatomegaly. The incidence is 1/57,000 for the adult form and 1/138,000 for infantile form.	600,25
GALC	Krabbe disease	NM_000153.3	NM_000153.3:c.2056T>C, NM_000153.3:c.1964delC, NM_000153.3:c.1814dupA, NM_000153.3:c.1796T>G, NM_000153.3:c.1723_1724insT, NM_000153.3:c.1700A>C, NM_000153.3:c.1695delT, NM_000153.3:c.1592G>A, NM_000153.3:c.1591C>T, NM_000153.3:c.1586C>T, NM_000153.3:c.1543G>A, NM_000153.3:c.1489+1_1489+2delGT, NM_000153.3:c.1488_1489+2delTGGT, NM_000153.3:c.1488_1489delTG, NM_000153.3:c.1472delA, NM_000153.3:c.1161+2T>G, NM_000153.3:c.1153G>T, NM_000153.3:c.953C>G, NM_000153.3:c.658C>T, NM_000153.3:c.655C>T, NM_000153.3:c.628A>T, NM_000153.3:c.582+1G>A, NM_000153.3:c.453G>A, NM_000153.3:c.430delA, NM_000153.3:c.388G>A, NM_000153.3:c.205C>T	Krabbe disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALC gene located on chromosomal region 14q31.3. There are two forms of the disease: infantile form (2-6 months onset) more severe and adult form less severe. It is a degenerative disorder that affects the nervous system characterized by a muscle stiffness, blindness, deafness, and eventually death. The incidence is 1/100,000-1/250,000 and the prevalence is 1/100,000.	600,25
GALT	Galactosemia	NM_000155.3	NM_000155.3:c.18delC, NM_000155.3:c.41delCinsTT, NM_000155.3:c.71_72insA, NM_000155.3:c.113A>C, NM_000155.3:c.118G>T, NM_000155.3:c.130G>A, NM_000155.3:c.132delG, NM_000155.3:c.152G>A, NM_000155.3:c.158G>A, NM_000155.3:c.199C>T, NM_000155.3:c.203A>C, NM_000155.3:c.220_221delCT, NM_000155.3:c.221T>C, NM_000155.3:c.253-2A>G, NM_000155.3:c.265T>G, NM_000155.3:c.289_291delAAC, NM_000155.3:c.290A>G, NM_000155.3:c.292G>A, NM_000155.3:c.329-2A>C, NM_000155.3:c.367C>T, NM_000155.3:c.386T>C, NM_000155.3:c.400delT, NM_000155.3:c.404C>T, NM_000155.3:c.413C>T, NM_000155.3:c.425T>A, NM_000155.3:c.428C>T, NM_000155.3:c.445dupG, NM_000155.3:c.442C>T, NM_000155.3:c.443G>A, NM_000155.3:c.502_504delGTG, NM_000155.3:c.505C>A, NM_000155.3:c.508-1G>C, NM_000155.3:c.512T>C, NM_000155.3:c.547C>A, NM_000155.3:c.552C>A, NM_000155.3:c.563A>G, NM_000155.3:c.565_578delGTATGGGCCAGCAG, NM_000155.3:c.568T>C, NM_000155.3:c.580T>C, NM_000155.3:c.584T>C, NM_000155.3:c.598delC, NM_000155.3:c.601C>T, NM_000155.3:c.602G>A, NM_000155.3:c.607G>A, NM_000155.3:c.610C>T, NM_000155.3:c.619C>T, NM_000155.3:c.626A>G, NM_000155.3:c.634C>T, NM_000155.3:c.688-2A>C, NM_000155.3:c.692G>A, NM_000155.3:c.719_728delTAGTACTGGT, NM_000155.3:c.772C>T, NM_000155.3:c.775C>T, NM_000155.3:c.790delC, NM_000155.3:c.790_792delCTAinsTAG, NM_000155.3:c.820+13A>G, NM_000155.3:c.844C>G, NM_000155.3:c.855G>T, NM_000155.3:c.904+1G>T, NM_000155.3:c.905-2A>G, NM_000155.3:c.939G>A, NM_000155.3:c.947G>A, NM_000155.3:c.957C>A, NM_000155.3:c.985T>C, NM_000155.3:c.997C>G, NM_000155.3:c.997C>T, NM_000155.3:c.998G>A, NM_000155.3:c.1006A>T, NM_000155.3:c.1030C>A, NM_000155.3:c.1048delA, NM_000155.3:c.1052delC, NM_000155.3:c.1138T>C	Galactosemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALT gene located on chromosomal region 9p13.3. The age of onset is neonatal. This disease is characterized by feeding difficulties, lethargy, and severe liver disease. Long-term complications appear including cognitive impairments, motor deficits, and ovarian dysfunction with reduced fertility in women and diminished bone density. The prevalence is 1/40,000-1/60,000.	600,25
GAMT	Cerebral creatine deficiency syndrome type 2	NM_138924.2	NM_138924.2:c.506G>A	Cerebral creatine deficiency syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAMT gene located on chromosomal region 19p13.3. The age of onset is infantile. This disease is characterized by intellectual disability, seizures and behavioral problems, often in conjunction with pyramidal and/or extrapyramidal manifestations with muscular hypotony. Biochemical symptoms are also included with high urinary excretion of guanidinoacetate, low urinary excretion of creatinine and creatine depletion in brain and muscles.	600
GAN	Giant axonal neuropathy, type 1	NM_022041.3	NM_022041.3:c.413G>A, NM_022041.3:c.505G>A, NM_022041.3:c.601C>T, NM_022041.3:c.1268T>C, NM_022041.3:c.1429C>T, NM_022041.3:c.1447C>T, NM_022041.3:c.1456G>A	Giant axonal neuropathy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAN gene located on chromosomal region 16q23.2. The age of onset is infantile. This disease is characterized by a progressive motor and sensitive peripheral and central nervous system neuropathy. Twenty families have been reported with this disease but the frequency is likely to be under-estimated.	600,25
GBA	Gaucher disease	NM_000157.3	NM_000157.3:c.1604G>A, NM_000157.3:c.1504C>T, NM_000157.3:c.1448T>G, NM_000157.3:c.1448T>C, NM_000157.3:c.1361C>G, NM_000157.3:c.1348T>A, NM_000157.3:c.1343A>T, NM_000157.3:c.1342G>C, NM_000157.3:c.1319C>T, NM_000157.3:c.1309G>T, NM_000157.3:c.1307T>C, NM_000157.3:c.1301G>C, NM_000157.3:c.1297G>T, NM_000157.3:c.1295G>T, NM_000157.3:c.1274dupA, NM_000157.3:c.1246G>A, NM_000157.3:c.1240G>T, NM_000157.3:c.1240G>C, NM_000157.3:c.1228C>G, NM_000157.3:c.1226A>G, NM_000157.3:c.1208G>C, NM_000157.3:c.1192C>T, NM_000157.3:c.1184C>T, NM_000157.3:c.1174C>G, NM_000157.3:c.1171G>C, NM_000157.3:c.1141T>G, NM_000157.3:c.1098dupA, NM_000157.3:c.1090G>A, NM_000157.3:c.1085C>T, NM_000157.3:c.1060G>C, NM_000157.3:c.1053G>T, NM_000157.3:c.1049A>G, NM_000157.3:c.1043C>T, NM_000157.3:c.914delC, NM_000157.3:c.586A>C, NM_000157.3:c.509G>T, NM_000157.3:c.508C>T, NM_000157.3:c.487delG, NM_000157.3:c.481C>T, NM_000157.3:c.476G>A, NM_000157.3:c.475C>T, NM_000157.3:c.431T>G, NM_000157.3:c.407C>A, NM_000157.3:c.354G>C, NM_000157.3:c.259C>T, NM_000157.3:c.254G>A, NM_000157.3:c.160G>T, NM_000157.3:c.115+1G>A, NM_000157.3:c.84dupG	Gaucher disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBA gene located on chromosomal region 1q22. Gaucher disease encompasses a continuum of clinical findings from a perinatal lethal disorder to an asymptomatic type. There are three major clinical types (1, 2, and 3) and two other subtypes (perinatal-lethal and cardiovascular). Type 1 is characterized by the presence of clinical or radiographic evidence of bone disease, hepatosplenomegaly, anemia and thrombocytopenia, lung disease, and the absence of primary central nervous system disease. GD types 2 and 3 are characterized by the presence of primary neurologic disease. Type 2 has an onset before age two years, limited psychomotor development, and a rapidly progressive course with death by age two to four years. Type 3 may have onset before age two years, but often have a more slowly progressive course, with survival into the third or fourth decade. The perinatal-lethal form is associated with ichthyosiform or collodion skin abnormalities or with nonimmune hydrops fetalis. The cardiovascular form is characterized by calcification of the aortic and mitral valves, mild splenomegaly, corneal opacities, and supranuclear ophthalmoplegia. Cardiopulmonary complications have been described with all the clinical subtypes, although varying in frequency and severity. The incidence is 1/60,000 and the prevalence is approximately 1/100,000.	600,25
GBE1	Glycogen storage disease, type 4	NM_000158.3	NM_000158.3:c.2052+1G>A, NM_000158.3:c.1883A>G, NM_000158.3:c.1774G>T, NM_000158.3:c.1604A>G, NM_000158.3:c.1571G>A, NM_000158.3:c.1570C>T, NM_000158.3:c.1543C>T, NM_000158.3:c.986A>C, NM_000158.3:c.771T>A, NM_000158.3:c.466_470delCGTAT	Glycogen storage disease, type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is infantile. This disease is characterized by failure to thrive; hepatomegaly, liver dysfunction, and progressive liver cirrhosis; hypotonia; cardiomyopathy and, finally, death.	600,25
GCDH	Glutaricaciduria, type 1	NM_000159.3	NM_000159.3:c.74C>A, NM_000159.3:c.271+1G>A, NM_000159.3:c.383G>A, NM_000159.3:c.416C>T, NM_000159.3:c.542A>G, NM_000159.3:c.572T>C, NM_000159.3:c.636-1G>A, NM_000159.3:c.680G>C, NM_000159.3:c.743C>T, NM_000159.3:c.751C>T, NM_000159.3:c.764C>T, NM_000159.3:c.769C>T, NM_000159.3:c.877G>A, NM_000159.3:c.883T>C, NM_000159.3:c.914C>T, NM_000159.3:c.1002_1003delGA, NM_000159.3:c.1060G>A, NM_000159.3:c.1093G>A, NM_000159.3:c.1168G>C, NM_000159.3:c.1198G>A, NM_000159.3:c.1199dupT, NM_000159.3:c.1204C>T, NM_000159.3:c.1244-2A>C, NM_000159.3:c.1247C>T, NM_000159.3:c.1262C>T	Glutaricaciduria, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCDH gene located on chromosomal region 19p13.2. The age of onset is infantile or neonatal. This disease is characterized by encephalopathic crises resulting in striatal injury and a severe dystonic dyskinetic movement disorder. The prevalence is 1 in 100,000 births.	600,25
GDAP1	Charcot-Marie-Tooth disease, recessive intermediate, type A	NM_018972.2	NM_018972.2:c.92G>A, NM_018972.2:c.311-1G>A, NM_018972.2:c.358C>T, NM_018972.2:c.487C>T, NM_018972.2:c.715C>T, NM_018972.2:c.844C>T	Autosomal recessive intermediate Charcot-Marie-Tooth disease type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GDAP1 gene located on chromosomal region 8q21.11. The age of onset is usually in early childhood. This disease is characterized by by distal sensory impairment predominantly affecting the lower limbs and resulting in walking difficulties due to muscle weakness and atrophy. The upper limbs may also be affected. The prevalence is below 1/1,000,000.	600
GFM1	Combined oxidative phosphorylation deficiency, type 1	NM_001308164.1	NM_001308164.1:c.139C>T, NM_001308164.1:c.521A>G, NM_001308164.1:c.805C>T, NM_001308164.1:c.1354_1357delGACA, NM_001308164.1:c.1589_1590delAG	Combined oxidative phosphorylation deficiency, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GFM1 gene located on chromosomal region 3q25.32. The age of onset is from early infancy until adult. This disease is characterized by ptosis, external ophthalmoplegia, proximal myopathy and exercise intolerance, cardiomyopathy, sensorineural deafness, optic atrophy, pigmentary retinopathy, and diabetes mellitus.	600
GJA1	Craniometaphyseal dysplasia, autosomal recessive	NM_000165.4	NM_000165.4:c.97C>T, NM_000165.4:c.227G>A	Craniometaphyseal dysplasia, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJA1 gene located on chromosomal region 6q22.31. The age of onset is infantile. This disease is characterized by hyperostosis and sclerosis of the craniofacial bones associated with abnormal modeling of the metaphyses. Sclerosis of the skull may lead to asymmetry of the mandible, as well as to cranial nerve compression, that may finally result in hearing loss and facial pals. The prevalence is below 1/1,000,000.	600
GJB2	Deafness, autosomal recessive, type 1A	NM_004004.5	NM_004004.5:c.617A>G, NM_004004.5:c.551G>C, NM_004004.5:c.550C>T, NM_004004.5:c.516G>A, NM_004004.5:c.465T>A, NM_004004.5:c.439G>A, NM_004004.5:c.427C>T, NM_004004.5:c.416G>A, NM_004004.5:c.402delG, NM_004004.5:c.365A>T, NM_004004.5:c.358_360delGAG, NM_004004.5:c.334_335delAA, NM_004004.5:c.313_326delAAGTTCATCAAGGG, NM_004004.5:c.310_323delAGGAAGTTCATCAA, NM_004004.5:c.299_300delAT, NM_004004.5:c.299A>T, NM_004004.5:c.270dupA, NM_004004.5:c.269dupT, NM_004004.5:c.269T>C, NM_004004.5:c.250G>T, NM_004004.5:c.250G>C, NM_004004.5:c.239A>C, NM_004004.5:c.238C>T, NM_004004.5:c.235delC, NM_004004.5:c.231G>A, NM_004004.5:c.230G>A, NM_004004.5:c.229T>C, NM_004004.5:c.169C>T, NM_004004.5:c.139G>T, NM_004004.5:c.132G>A, NM_004004.5:c.35delG	Autosomal recessive nonsyndromic sensorineural deafness type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.	600,25
GJB6	Deafness, autosomal recessive, type 1B	NM_001110219.2	NM_001110219.2:c.485dupA, NM_001110219.2:c.443delC, NM_001110219.2:c.383_384delTA, NM_001110219.2:c.261dupA, NM_001110219.2:c.169C>T, NM_001110219.2:c.14C>T	Autosomal recessive nonsyndromic sensorineural deafness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB6 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.	600,25
GJC2	Spastic paraplegia, type 44, autosomal recessive	NM_020435.3	NM_020435.3:c.268C>T, NM_020435.3:c.613C>T, NM_020435.3:c.718C>T, NM_020435.3:c.787G>A, NM_020435.3:c.814T>G, NM_020435.3:c.857T>C	Autosomal recessive spastic paraplegia type 44 (SPG44) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJC2 gene located on chromosomal region 1q42.13. This disease is characterized by a late-onset, slowly progressive spastic paraplegia associated with mild ataxia and dysarthria, upper extremity involvement (i.e. loss of finger dexterity, dysmetria), and mild cognitive impairment, without the presence of nystagmus. A hypomyelinating leukodystrophy and thin corpus callosum is observed in all cases and psychomotor development is normal or near normal. The prevalence is below 1/1,000,000.	600
GLB1	GM1-gangliosidosis, type 1	NM_001317040.1	NM_001317040.1:c.1877A>G, NM_001317040.1:c.1790C>T, NM_001317040.1:c.1721dupG, NM_001317040.1:c.1693G>T, NM_001317040.1:c.1600_1610dupGGTGCATATAT, NM_001317040.1:c.1589G>A, NM_001317040.1:c.1514G>A, NM_001317040.1:c.1513C>T, NM_001317040.1:c.1499dupA, NM_001317040.1:c.1469G>A, NM_001317040.1:c.1465G>A, NM_001317040.1:c.1457G>A, NM_001317040.1:c.1318_1319delCT, NM_001317040.1:c.1212+1G>T, NM_001317040.1:c.1195C>T, NM_001317040.1:c.1148C>T, NM_001317040.1:c.1091A>G, NM_001317040.1:c.1045G>A, NM_001317040.1:c.962G>T, NM_001317040.1:c.766C>T, NM_001317040.1:c.746G>A, NM_001317040.1:c.745C>T, NM_001317040.1:c.735dupT, NM_001317040.1:c.601+2T>C, NM_001317040.1:c.586C>T, NM_001317040.1:c.586C>A, NM_001317040.1:c.582_584delTCT, NM_001317040.1:c.420G>A, NM_001317040.1:c.346C>T, NM_001317040.1:c.320G>A, NM_001317040.1:c.319C>T, NM_001317040.1:c.315C>G, NM_001317040.1:c.296T>C, NM_001317040.1:c.289C>T	Gangliosidosis GM1, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. Although the three types differ in severity, their features can overlap significantly. The age of onset in type 1 is infantile, in type 2 is late-infantile or juvenile and adult in type3. This disease is characterized by arrest/regression of neurological development, hypotonia, visceromegaly, macular cherry-red spots, dysostosis and coarse facial features. The prevalence is 1:100,000 a 200,000 newborn.	600,25
GLDC	Glycine encephalopathy	NM_000170.2	NM_000170.2:c.2405C>T, NM_000170.2:c.2284G>A, NM_000170.2:c.2216G>A, NM_000170.2:c.1691G>T, NM_000170.2:c.1545G>C, NM_000170.2:c.1166C>T, NM_000170.2:c.322G>T	Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in GLDC gene located on chromosomal region 9p24.1. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000.	600,25
GLE1	Lethal congenital contracture syndrome, type 1	NM_001003722.1	NM_001003722.1:c.898-2A>G, NM_001003722.1:c.1412_1413delAG, NM_001003722.1:c.2051T>C, NM_001003722.1:c.2069_2072delTTCT	Lethal congenital contracture syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLE1 gene located on chromosomal region 9q34.11. The age of onset is neonatal. This disease is characterized by total fetal akinesia (detectable since the 13th week of gestation) accompanied by hydrops, micrognathia, pulmonary hypoplasia, pterygia and multiple joint contractures (usually flexion contractures in the elbows and extension in the knees), leading invariably to death before the 32nd week of gestation. Lack of anterior horn motoneurons, severe atrophy of the ventral spinal cord and severe skeletal muscle hypoplasia are characteristic neuropathological findings, with no evidence of other organ structural anomalies.	600,25
GM2A	GM2-gangliosidosis, AB variant	NM_000405.4	NM_000405.4:c.160G>T, NM_000405.4:c.285delC, NM_000405.4:c.506G>C	GM2-gangliosidosis, AB variant follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GM2A gene located on chromosomal region 5q33.1. The age of onset is infantile. This disease is characterized by a group of neurodegenerative disorders: seizures, blindness, spasticity, eventual total incapacitation, and death. The prevalence is <1:100.000.	600
GNE	Inclusion body myopathy, type 2 (Nonaka myopathy)	NM_001128227.2	NM_001128227.2:c.2228T>C, NM_001128227.2:c.2179G>A, NM_001128227.2:c.1937C>G, NM_001128227.2:c.1891G>A, NM_001128227.2:c.1820G>A, NM_001128227.2:c.1002T>A, NM_001128227.2:c.880C>T, NM_001128227.2:c.830G>A, NM_001128227.2:c.478C>T	Inclusion body myopathy, type 2 (Nonaka myopathy) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNE gene located on chromosomal region 9p13.3. The age of onset is adult. This disease is characterized by progressive muscle weakness and joint deformity. The prevalence is 1:500-1:1,000.	600,25
GNPTAB	Mucolipidosis 2 alpha/beta	NM_024312.4	NM_024312.4:c.3663delG, NM_024312.4:c.3565C>T, NM_024312.4:c.3560_3561delAG, NM_024312.4:c.3503_3504delTC, NM_024312.4:c.3410T>A, NM_024312.4:c.3326dupA, NM_024312.4:c.3173C>G, NM_024312.4:c.2896delA, NM_024312.4:c.2383delG, NM_024312.4:c.1906dupA, NM_024312.4:c.1759C>T, NM_024312.4:c.1196C>T, NM_024312.4:c.1000C>T, NM_024312.4:c.749dupA, NM_024312.4:c.732_733delAA, NM_024312.4:c.648_651delAGAA, NM_024312.4:c.616_619delACAG, NM_024312.4:c.99delC, NM_024312.4:c.25C>T, NM_024312.4:c.10A>C	Mucolipidosis type 2 alpha/beta follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNPTAB gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by growth retardation, short stature, skeletal abnormalities, facial dysmorphism, stiff skin, developmental delay and cardiomegaly and that is lethal in childhood. The prevalence is 1:123,500-1:625,500.	600,25
GNS	Mucopolysaccharidosis, type 3D (Sanfilippo D)	NM_002076.3	NM_002076.3:c.1226dupG, NM_002076.3:c.1169delA, NM_002076.3:c.1168C>T, NM_002076.3:c.1063C>T, NM_002076.3:c.413C>G	Mucolipidosis type 3D (Sanfilippo disease) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNS gene located on chromosomal region 12q14.3. The age of onset is infantile. This disease is characterized by joint stiffness and pain initially in the shoulders, hips, and fingers; and gradual mild coarsening of facial features, cardiorespiratory complications and mild cognitive impairment. The incidence is 1:70,000 newborn.	600
GPR143	Ocular albinism, type 1 (Nettleship-Falls type)	NM_000273.2	NM_000273.2:c.992_993insCG, NM_000273.2:c.695C>A	X-linked recessive ocular albinism follows an X-linked pattern of inheritance and is caused by pathogenic variants in the GPR143 gene located on chromosomal region Xp22.2. The age of onset is infantile. This condition reduces the coloring (pigmentation) of the iris, which is the colored part of the eye, and the retina, which is the light-sensitive tissue at the back of the eye. Pigmentation in the eye is essential for normal vision. Ocular albinism type I (OA1) is the most common form of ocular albinism. Clinical presentation of OA1 in Caucasians is characterized by nystagmus, impaired visual acuity, iris hypopigmentation with translucency, albinotic fundus, macular hypoplasia, and normally pigmented skin and hair. Carrier females usually have punctate iris translucency and a mottled pattern of fundus pigmentation. In contrast to Caucasian patients, black or Japanese patients with OA1 often have brown irides with little or no translucency and varying degrees of fundus hypopigmentation, the so-called 'nonalbinotic fundus' (summary by Xiao and Zhang, 2009). The prevalence is 1/60,000 to 1/150,000 live male births.	600
GPR179	Night blindness, congenital stationary (complete), type 1E, autosomal recessive	NM_001004334.3	NM_001004334.3:c.6847_6848delCT, NM_001004334.3:c.5763_5764delGA, NM_001004334.3:c.5693dupT, NM_001004334.3:c.4699_4700delAG, NM_001004334.3:c.3233_3234delCT, NM_001004334.3:c.1807C>T, NM_001004334.3:c.1784+1G>A, NM_001004334.3:c.1368delT, NM_001004334.3:c.1236G>A, NM_001004334.3:c.984delC, NM_001004334.3:c.839_842delATCA, NM_001004334.3:c.278dupC, NM_001004334.3:c.278delC	Congenital stationary night blindness type 1E follow an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR179 gene located on chromosomal region 17q12. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity.	600,25
GRHPR	Hyperoxaluria, primary, type 2	NM_012203.1	NM_012203.1:c.103delG, NM_012203.1:c.295C>T, NM_012203.1:c.435G>A, NM_012203.1:c.622C>T, NM_012203.1:c.755dupA	Primary hyperoxaluria, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRHPR gene located on chromosomal region 9p13.2. The age of onset is infantile. This disease is characterized by recurrent nephrolithiasis, nephrocalcinosis and end-stage renal disease with subsequent systemic oxalosis.	600
GRM6	Night blindness, congenital stationary (complete), type 1B, autosomal recessive	NM_000843.3	NM_000843.3:c.2560C>T, NM_000843.3:c.2341G>A, NM_000843.3:c.2213_2219delCCAGAGG, NM_000843.3:c.2122C>T, NM_000843.3:c.1861C>T, NM_000843.3:c.1565G>A, NM_000843.3:c.1336C>T, NM_000843.3:c.1258C>T, NM_000843.3:c.1214T>C, NM_000843.3:c.727dupG, NM_000843.3:c.719_720insG, NM_000843.3:c.712C>T	Congenital stationary night blindness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRM6 gene located on chromosomal region 5q35.3. The age of onset is early infancy. This disease is characterized by hemeralopia with a moderate loss of visual acuity.	600,25
GRXCR1	Deafness, autosomal recessive, type 25	NM_001080476.2	NM_001080476.2:c.229C>T, NM_001080476.2:c.710_711delAT	Autosomal recessive nonsyndromic sensorineural deafness type 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRXCR1 gene located on chromosomal region 4p13. The age of onset is infantile. This disease is characterized by hearing loss which is not associated visible abnormalities of the external ear or any related medical problems.	600
GSS	Glutathione synthetase deficiency	NM_000178.3	NM_000178.3:c.847C>T, NM_000178.3:c.832C>T, NM_000178.3:c.799C>T, NM_000178.3:c.754C>T, NM_000178.3:c.656A>G, NM_000178.3:c.656A>C, NM_000178.3:c.491G>A	Glutathione synthetase deficiency with 5-oxoprolinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GSS gene located on chromosomal region 20q11.22. The severity and age of onset are variable. This disease is characterized by affectation of the neutrophil respiratory burst and can increase host susceptibility to infections, is associated with hemolytic anemia and intellectual disability. The prevalence is <1:1,000,000.	600
GUCY2D	Leber congenital amaurosis, type 1	NM_000180.3	NM_000180.3:c.456C>A, NM_000180.3:c.622delC, NM_000180.3:c.1694T>C, NM_000180.3:c.2735_2736delTT, NM_000180.3:c.2945delG	Leber congenital amaurosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUCY2D gene located on chromosomal region 17p13.1. The age of onset is infantile. This disease is characterized by blindness, nystagmus, roving eye movement and severe visual impairment.	600
GUSB	Mucopolysaccharidosis, type 7	NM_000181.3	NM_000181.3:c.1881G>T, NM_000181.3:c.1856C>T, NM_000181.3:c.1831C>T, NM_000181.3:c.1730G>T, NM_000181.3:c.1618G>T, NM_000181.3:c.1534G>A, NM_000181.3:c.1521G>A, NM_000181.3:c.1429C>T, NM_000181.3:c.1338G>A, NM_000181.3:c.1337G>A, NM_000181.3:c.1244+1G>A, NM_000181.3:c.1219_1220insC, NM_000181.3:c.1144C>T, NM_000181.3:c.1084G>A, NM_000181.3:c.1065+1G>T, NM_000181.3:c.1061C>T, NM_000181.3:c.1050G>C, NM_000181.3:c.866G>A, NM_000181.3:c.820_821delAC, NM_000181.3:c.646C>T, NM_000181.3:c.526C>T, NM_000181.3:c.499C>T, NM_000181.3:c.442C>T	Mucopolysaccharidosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUSB gene located on chromosomal region 7q11.21. The age of onset is variable. There are prenatal forms with non-immune hydrops fetalis, and severe neonatal forms with dysmorphism, hernias, hepatosplenomegaly, club feet, dysostosis, severe hypotonia and neurological disorders that ultimately lead to profound intellectual deficit and small stature in patients that survive. Finally, there are also very mild cases that are discovered during adolescence or adulthood following presentation with thoracic kyphosis. The prevalence is 1:250,000 in newborn.	600,25
HADHA	LCHAD deficiency	NM_000182.4	NM_000182.4:c.2146+1G>A, NM_000182.4:c.2132dupC, NM_000182.4:c.1918C>T, NM_000182.4:c.1793_1794delAT, NM_000182.4:c.1678C>T, NM_000182.4:c.1644delC, NM_000182.4:c.1620+2_1620+6delTAAGG, NM_000182.4:c.1528G>C, NM_000182.4:c.1422dupT, NM_000182.4:c.1132C>T, NM_000182.4:c.919-2A>G, NM_000182.4:c.845T>A, NM_000182.4:c.499delA, NM_000182.4:c.274_278delTCATC	Isolated deficiency of long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD deficiency) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA gene located on chromosomal region 2p23.3. This disease is characterized in infancy/early childhood of hypoketotic hypoglycemia, metabolic acidosis, liver disease, hypotonia and, frequently, cardiac involvement with arrhythmias and/or cardiomyopathy. The prevalence is 1/250,000.	600,25
HADHB	Trifunctional protein deficiency	NM_000183.2	NM_000183.2:c.788A>G, NM_000183.2:c.1331G>A, NM_000183.2:c.1364T>G	Mitochondrial trifunctional protein deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in HADHB gene located on chromosomal region 2p23.3. The age of onset is neonatal/infancy. It is characterized by a wide clinical spectrum ranging from severe neonatal manifestations including cardiomyopathy, hypoglycemia, metabolic acidosis, skeletal myopathy and neuropathy, liver disease and death to a mild phenotype with peripheral polyneuropathy, episodic rhabdomyolysis and pigmentary retinopathy. The prevalence is <1 / 1,000,000.	600
HBA1/HBA2	Thalassemia, alpha-	-0	-?3.7, -?4.2, -(?)20.5, --SEA, --MED, --FIL, --THAI	Alpha-thalassemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBA1 gene located on chromosomal region 16p13.3. The age of onset is infantile. It is characterized by impaired synthesis of alpha-globin chains leading to a variable clinical picture depending on the number of affected alleles. The disease can be classified into clinical subtypes of increasing severity: silent alpha thalassemia, alpha thalassemia trait (or alpha thalassemia minor), hemoglobin H disease (HbH), and Hb Bart's hydrops fetalis (see these terms). A rare form called alpha-thalassemia-intellectual deficit syndrome has also been identified (see these terms). Alpha thalassemia trait causes microcytosis and hypochromia with absent or mild anemia (often detected on routine blood tests), generally with no other symptoms. HbH patients develop moderate hemolytic anemia with variable amounts of HbH along with occasionally severe splenomegaly, sometimes complicated by hypersplenism. Hb Bart's hydrops fetalis involves a severe deficiency in alpha-globin with serious developmental implications. Alpha-thalassemia-intellectual deficit syndrome is characterized by very mild to severe anemia associated with developmental abnormalities. The prevalence is 1:10,000-5:10,000.	600
HBB	HBB-related hemoglobinopathy	NM_000518.4	NM_000518.4:c.*110T>C, NM_000518.4:c.440_441dupAC, NM_000518.4:c.440A>T, NM_000518.4:c.440A>C, NM_000518.4:c.439C>G, NM_000518.4:c.438T>A, NM_000518.4:c.437A>G, NM_000518.4:c.436T>C, NM_000518.4:c.435G>C, NM_000518.4:c.431A>C, NM_000518.4:c.428C>A, NM_000518.4:c.421G>A, NM_000518.4:c.383A>C, NM_000518.4:c.371_378delCCCCACCA, NM_000518.4:c.364G>T, NM_000518.4:c.364G>A, NM_000518.4:c.347C>A, NM_000518.4:c.344T>C, NM_000518.4:c.343_344delCTinsG, NM_000518.4:c.341T>A, NM_000518.4:c.332T>C, NM_000518.4:c.328delG, NM_000518.4:c.328G>A, NM_000518.4:c.323dupG, NM_000518.4:c.320T>G, NM_000518.4:c.316-1G>T, NM_000518.4:c.316-1G>A, NM_000518.4:c.316-2A>G, NM_000518.4:c.316-2A>C, NM_000518.4:c.316-3C>A, NM_000518.4:c.316-106C>G, NM_000518.4:c.316-146T>G, NM_000518.4:c.316-197C>T, NM_000518.4:c.315+2T>G, NM_000518.4:c.315+1G>C, NM_000518.4:c.315+1G>A, NM_000518.4:c.312C>G, NM_000518.4:c.306G>C, NM_000518.4:c.305A>G, NM_000518.4:c.304G>A, NM_000518.4:c.302C>T, NM_000518.4:c.299A>T, NM_000518.4:c.299A>G, NM_000518.4:c.299A>C, NM_000518.4:c.298G>T, NM_000518.4:c.298G>C, NM_000518.4:c.298G>A, NM_000518.4:c.295G>A, NM_000518.4:c.293A>T, NM_000518.4:c.287dupA, NM_000518.4:c.282_283dupTG, NM_000518.4:c.283G>C, NM_000518.4:c.277C>T, NM_000518.4:c.277C>A, NM_000518.4:c.275T>C, NM_000518.4:c.271G>T, NM_000518.4:c.269G>A, NM_000518.4:c.268A>C, NM_000518.4:c.257T>C, NM_000518.4:c.251delG, NM_000518.4:c.248A>T, NM_000518.4:c.248A>C, NM_000518.4:c.247A>G, NM_000518.4:c.230delC, NM_000518.4:c.226delC, NM_000518.4:c.217_221delAGTGAinsT, NM_000518.4:c.217dupA, NM_000518.4:c.216dupT, NM_000518.4:c.208G>A, NM_000518.4:c.206T>A, NM_000518.4:c.203_204delTG, NM_000518.4:c.201delA, NM_000518.4:c.199A>G, NM_000518.4:c.194delG, NM_000518.4:c.190C>T, NM_000518.4:c.184A>T, NM_000518.4:c.182T>A, NM_000518.4:c.179A>C, NM_000518.4:c.176C>G, NM_000518.4:c.162delT, NM_000518.4:c.143_146dupATCT, NM_000518.4:c.143dupA, NM_000518.4:c.135delC, NM_000518.4:c.134C>G, NM_000518.4:c.130G>T, NM_000518.4:c.126_129delCTTT, NM_000518.4:c.128T>C, NM_000518.4:c.127T>G, NM_000518.4:c.127T>C, NM_000518.4:c.114_120delGACCCAG, NM_000518.4:c.117_118delCC, NM_000518.4:c.118C>T, NM_000518.4:c.114G>A, NM_000518.4:c.113G>A, NM_000518.4:c.112delT, NM_000518.4:c.110delC, NM_000518.4:c.108C>A, NM_000518.4:c.103G>T, NM_000518.4:c.93G>T, NM_000518.4:c.93-1G>C, NM_000518.4:c.93-1G>A, NM_000518.4:c.93-2A>C, NM_000518.4:c.93-21G>A, NM_000518.4:c.92+6T>C, NM_000518.4:c.92+5G>T, NM_000518.4:c.92+5G>C, NM_000518.4:c.92+5G>A, NM_000518.4:c.92+2T>C, NM_000518.4:c.92+2T>A, NM_000518.4:c.92+1G>T, NM_000518.4:c.92+1G>A, NM_000518.4:c.92G>C, NM_000518.4:c.92G>A, NM_000518.4:c.91A>C, NM_000518.4:c.90C>T, NM_000518.4:c.86T>A, NM_000518.4:c.85dupC, NM_000518.4:c.82G>T, NM_000518.4:c.80A>G, NM_000518.4:c.79_80insT, NM_000518.4:c.79G>T, NM_000518.4:c.79G>A, NM_000518.4:c.75T>A, NM_000518.4:c.68_74delAAGTTGG, NM_000518.4:c.64dupG, NM_000518.4:c.59A>G, NM_000518.4:c.52A>T, NM_000518.4:c.51delC, NM_000518.4:c.48G>A, NM_000518.4:c.47G>A, NM_000518.4:c.46delT, NM_000518.4:c.45dupG, NM_000518.4:c.36delT, NM_000518.4:c.27dupG, NM_000518.4:c.25_26delAA, NM_000518.4:c.20delA, NM_000518.4:c.20A>T, NM_000518.4:c.19G>A, NM_000518.4:c.17_18delCT, NM_000518.4:c.8A>C, NM_000518.4:c.4delG, NM_000518.4:c.4G>T, NM_000518.4:c.3G>A, NM_000518.4:c.2T>G, NM_000518.4:c.2T>C, NM_000518.4:c.2T>A, NM_000518.4:c.1A>G, NM_000518.4:c.-50A>C, NM_000518.4:c.-75G>C, NM_000518.4:c.-78A>G, NM_000518.4:c.-78A>C, NM_000518.4:c.-79A>G, NM_000518.4:c.-80T>A, NM_000518.4:c.-137C>G, NM_000518.4:c.-137C>A, NM_000518.4:c.-138C>T, NM_000518.4:c.-151C>T	DNA variations in the HBB gene result in the production of different versions of beta-globin. Some of these variations may affect a person's health while other variations cause no noticeable signs or symptoms. Two of the most common HBB-related conditions are beta-thalassemia and sickle cell anemia (SCA). Beta thalassemia is caused by HBB gene mutations that prevent or decrease beta-globin production, subunits that make up hemoglobin. A lack of hemoglobin disrupts the normal development of red blood cells. A shortage of mature red blood cells can reduce the amount of oxygen that is delivered to tissues to below what is needed to satisfy the body's energy needs. A lack of oxygen in the body's tissues can lead to poor growth, organ damage, and other health problems associated with beta thalassemia. SCA is a multisystem disease associated with episodes of acute illness and progressive organ damage. SCA-associated mutations cause red blood cells assuming an abnormal, rigid, sickle shape promoting cell break down prematurely, which can lead to anemia. Anemia can cause shortness of breath, fatigue, and delayed growth and development in children.	600,25
HESX1	Growth hormone deficiency with pituitary anomalies	NM_003865.2	NM_003865.2:c.450_451delCA, NM_003865.2:c.445G>A, NM_003865.2:c.77T>C, NM_003865.2:c.18G>C	Growth hormone deficiency with pituitary anomalies follows an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the HESX1 gene located on chromosomal region 3p14.3. The age of onset is infantile. These diseases are characterized by short stature, cognitive alterations or delayed puberty. The incidence is 1:3,000 and 1:4,000 births.	600,25
HEXA	Tay-Sachs disease	NM_000520.5	NM_000520.5:c.254-1G>C	Tay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births.	600,25
HEXA	Tay-Sachs disease	NM_001318825.1	NM_001318825.1:c.1570C>T, NM_001318825.1:c.1561C>T, NM_001318825.1:c.1544G>A, NM_001318825.1:c.1543delC, NM_001318825.1:c.1543C>T, NM_001318825.1:c.1532delT, NM_001318825.1:c.1529G>A, NM_001318825.1:c.1528C>T, NM_001318825.1:c.1477G>A, NM_001318825.1:c.1455G>C, NM_001318825.1:c.1311_1312insTATC, NM_001318825.1:c.1307_1310dupTATC, NM_001318825.1:c.1293G>C, NM_001318825.1:c.1247_1248delAAinsG, NM_001318825.1:c.1210C>T, NM_001318825.1:c.1209G>A, NM_001318825.1:c.1020G>A, NM_001318825.1:c.1019+3A>G, NM_001318825.1:c.948_950delCTT, NM_001318825.1:c.838+1G>C, NM_001318825.1:c.838+1G>A, NM_001318825.1:c.838G>A, NM_001318825.1:c.805G>C, NM_001318825.1:c.782G>A, NM_001318825.1:c.705+1G>A, NM_001318825.1:c.665T>C, NM_001318825.1:c.662C>T, NM_001318825.1:c.573C>G, NM_001318825.1:c.571T>C, NM_001318825.1:c.566G>T, NM_001318825.1:c.566G>A, NM_001318825.1:c.565C>T, NM_001318825.1:c.542G>A, NM_001318825.1:c.541C>T, NM_001318825.1:c.492+5G>A, NM_001318825.1:c.413T>G, NM_001318825.1:c.173G>A, NM_001318825.1:c.116T>G, NM_001318825.1:c.78G>A, NM_001318825.1:c.77G>A, NM_001318825.1:c.2T>C, NM_001318825.1:c.1A>T, NM_001318825.1:c.1A>G	Tay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births.	600,25
HEXB	Sandhoff disease, infantile, juvenile, and adult forms	NM_000521.3	NM_000521.3:c.115delG, NM_000521.3:c.171delG, NM_000521.3:c.202_203insGG, NM_000521.3:c.298delC, NM_000521.3:c.508C>T, NM_000521.3:c.797A>G, NM_000521.3:c.841C>T, NM_000521.3:c.850C>T, NM_000521.3:c.1238_1242delCAAAG, NM_000521.3:c.1250C>T, NM_000521.3:c.1310_1311delCA, NM_000521.3:c.1345delT, NM_000521.3:c.1375G>T, NM_000521.3:c.1380G>A, NM_000521.3:c.1517_1529dupCAAGTGCTGTTGG, NM_000521.3:c.1539_1540delCT	Sandhoff disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXB gene located on chromosomal region 5q13.3. The age of onset is adult or infantile. This disease is characterized by central nervous system degeneration, with startle reactions, early blindness, progressive motor and mental deterioration, macrocephaly and cherry-red spots on the macula. The prevalence is 1/130.000.	600,25
HGD	Alkaptonuria	NM_000187.3	NM_000187.3:c.1189-2A>G, NM_000187.3:c.1111dupC, NM_000187.3:c.1102A>G, NM_000187.3:c.899T>G, NM_000187.3:c.808G>A, NM_000187.3:c.688C>T, NM_000187.3:c.674G>A, NM_000187.3:c.481G>A, NM_000187.3:c.469+2T>C, NM_000187.3:c.342+1G>A, NM_000187.3:c.175delA, NM_000187.3:c.172A>T, NM_000187.3:c.140C>T, NM_000187.3:c.16-1G>A	Alkaptonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGD gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by darkening of the urine when it is left exposed to air, grey-blue colouration of the eye sclerae and the ear helix (ochronosis), and a disabling joint disease involving both the axial and peripheral joints (ochronotic arthropathy). The prevalence is 1:250,000-1:1.000.000 newborn.	600,25
HGF	Deafness, autosomal recessive, type 39	NM_000601.5	NM_000601.5:c.2028delA, NM_000601.5:c.1597C>T	Autosomal recessive nonsyndromic sensorineural deafness type 39 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGF gene located on chromosomal region 7q21.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600
HGSNAT	Mucopolysaccharidosis type 3C (Sanfilippo C)	NM_152419.2	NM_152419.2:c.493+1G>A, NM_152419.2:c.607C>T, NM_152419.2:c.848C>T, NM_152419.2:c.1030C>T, NM_152419.2:c.1250+1G>A, NM_152419.2:c.1378-1G>A, NM_152419.2:c.1464+1G>A, NM_152419.2:c.1503delA, NM_152419.2:c.1553C>T, NM_152419.2:c.1622C>T	Mucopolysaccharidosis type 3C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGSNAT gene located on chromosomal region 8p11.21. The age of onset is infantile. This disease is characterized by defective or missing enzymes to break down mucopolysaccharides are missing or are defective. The prevalence is <1:70.000 newborn.	600,25
HIBCH	3-hydroxyisobutryl-CoA hydrolase deficiency	NM_014362.3	NM_014362.3:c.1012A>T, NM_014362.3:c.494_495delTT, NM_014362.3:c.365A>G, NM_014362.3:c.220-9T>G, NM_014362.3:c.79-3C>G	3-Hydroxyisobutryl-CoA hydrolase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HIBCH gene located on chromosomal region 2q32.2. The age of onset is infantile. This disease is characterized by delayed motor development, hypotonia and progressive neurodegeneration. The prevalence is <1:1,000,000.	600
HMGCL	HMG-CoA lyase deficiency	NM_000191.2	NM_000191.2:c.835G>A, NM_000191.2:c.698A>G, NM_000191.2:c.505_506delTC, NM_000191.2:c.230delT, NM_000191.2:c.206_207delCT, NM_000191.2:c.122G>A	3-hydroxy-3-methylglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HMGCL gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is is an organic aciduria, due to deficiency of 3-hydroxy-3-methylglutaryl-CoA-lyase (a key enzyme in ketogenesis and leucine metabolism) usually presenting in infancy with episodes of metabolic decompensation triggered by periods of fasting or infections, which when left untreated are life-threatening and may lead to neurological sequelae.	600
HPD	Tyrosinemia, type 3	NM_002150.2	NM_002150.2:c.987delA, NM_002150.2:c.774T>G, NM_002150.2:c.600C>G	Tyrosinemia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPD gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by intellectual deficit and ataxia. The prevalence is 1:100,000-1:120,000 newborn.	600,25
HPRT1	Lesch-Nyhan syndrome	NM_000194.2	NM_000194.2:c.486-1G>A, NM_000194.2:c.508C>T, NM_000194.2:c.532+2T>G, NM_000194.2:c.610-2A>G	Lesch-Nyhan syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the HPRT1 gene located on chromosomal region Xq26.2-q26.3. The age of onset is infantile. This disease is characterized by acid overproduction, neurological troubles, and behavioral problems. The prevalence is 1:380,000.	600
HPS1	Hermansky-Pudlak syndrome, type 1	NM_000195.4	NM_000195.4:c.1996G>T, NM_000195.4:c.972dupC, NM_000195.4:c.972delC, NM_000195.4:c.398+5G>A, NM_000195.4:c.397G>T	Hermansky-Pudlak syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPS1 gene located on chromosomal region 10q24.2. The age of onset is early childhood. This disease is characterized by oculocutaneous albinism, bleeding diathesis and, in some cases, neutropenia, pulmonary fibrosis, or granulomatous colitis. The prevalence is 1/500,000 - 1/1,000,000.	600
HSD17B4	D-bifunctional protein deficiency	NM_000414.3	NM_000414.3:c.46G>A	Bifunctional enzyme deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSD17B4 gene located on chromosomal region 5q23. The age of onset is juvenile. This disease is characterized by slowly progressive cerebellar atrophy and ataxia, intellectual decline, hearing loss, hypogonadism, hyperreflexia, a demyelinating sensorimotor neuropathy.	600
HSD17B4	D-bifunctional protein deficiency	NM_001199291.2	NM_001199291.2:c.392G>C, NM_001199291.2:c.725A>G, NM_001199291.2:c.1047+1G>T, NM_001199291.2:c.1444A>T	Bifunctional enzyme deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSD17B4 gene located on chromosomal region 5q23. The age of onset is juvenile. This disease is characterized by slowly progressive cerebellar atrophy and ataxia, intellectual decline, hearing loss, hypogonadism, hyperreflexia, a demyelinating sensorimotor neuropathy.	600
HSPD1	Leukodystrophy, hypomyelinating, type 4	NM_002156.4	NM_002156.4:c.292G>A	Leukodystrophy hypomyelinating, type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSPD1 gene located on chromosomal region 2q33.1. The age of onset is infantile. A severe autosomal recessive hypomyelinating leukodystrophy. Clinically characterized by infantile-onset rotary nystagmus, progressive spastic paraplegia, neurologic regression, motor impairment, profound mental retardation. Death usually occurs within the first two decades of life.	600
HSPG2	Dyssegmental dysplasia, Silverman-Handmaker type	NM_001291860.1	NM_001291860.1:c.13078delC, NM_001291860.1:c.9329delA, NM_001291860.1:c.8467+4A>G, NM_001291860.1:c.1656_1657insT, NM_001291860.1:c.1125C>A	Dyssegmental dysplasia, Silverman-Handmaker type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSPG2 gene located on chromosomal region 1p36.12. The age of onset is prenatal/neonatal. This disease is characterized by anisospondyly, severe short stature and limb shortening, metaphyseal flaring and distinct dysmorphic features (i.e. flat facial appearance, abnormal ears, short neck, narrow thorax). Additional features may include other skeletal findings (e.g. joint contractures, bowed limbs, talipes equinovarus) and urogenital and cardiovascular abnormalities. The prevalence is below 1/1,000,000.	600
HTRA1	CARASIL syndrome	NM_002775.4	NM_002775.4:c.754G>A, NM_002775.4:c.883G>A, NM_002775.4:c.889G>A, NM_002775.4:c.904C>T, NM_002775.4:c.1108C>T	Cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy (CARASIL syndrome) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HTRA1 gene located on chromosomal region 10q26.13. The age of onset is adult. This disease is characterized by early-onset gait disturbances, premature scalp alopecia, ischemic stroke, acute mid to lower back pain and progressive cognitive disturbances leading to severe dementia. About 50 people diagnosed, mainly in Japan and China.	600
HYLS1	Hydrolethalus syndrome	NM_001134793.1	NM_001134793.1:c.632A>G, NM_001134793.1:c.669G>A, NM_001134793.1:c.724C>T	Hydrolethalus syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HYLS1 gene located on chromosomal region 11q24.2. The age of onset is fetal. This disease is characterized by craniofacial dysmorphic features, central nervous system, cardiac, respiratory tract and limb abnormalities. The incidence is 1/20,000 in Finland and the prevalence is <1:1,000,000.	600
IDH3B	Retinitis pigmentosa, type 46	NM_006899.4	NM_006899.4:c.589delA, NM_006899.4:c.490C>T, NM_006899.4:c.395T>C	Retinitis pigmentosa, type 46 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IDH3B gene located on chromosomal region 20p13. The age of onset is variable. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness. The prevalence is 1/3,000 to 1/5,000.	600
IDS	Mucopolysaccharidosis, type 2	NM_000202.7	NM_000202.7:c.1508T>A, NM_000202.7:c.1505G>C, NM_000202.7:c.1148delC, NM_000202.7:c.1122C>T, NM_000202.7:c.998C>T, NM_000202.7:c.880-8A>G, NM_000202.7:c.690_691insT, NM_000202.7:c.683C>T, NM_000202.7:c.596_599delAACA, NM_000202.7:c.597delA, NM_000202.7:c.587T>C, NM_000202.7:c.514C>T, NM_000202.7:c.404A>G, NM_000202.7:c.388_389insG, NM_000202.7:c.314_317dupTCAA, NM_000202.7:c.278delC, NM_000202.7:c.240+1G>A, NM_000202.7:c.208dupC	Mucopolysaccharidosis, type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IDS gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by distinctive coarse facial features, short stature, cardio-respiratory involvement and skeletal abnormalities. The prevalence is 1:100,000-1:170,000 mannewborn.	600
IDS	Mucopolysaccharidosis, type 2	NM_001166550.3	NM_001166550.3:c.15-2A>G	Mucopolysaccharidosis, type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IDS gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by distinctive coarse facial features, short stature, cardio-respiratory involvement and skeletal abnormalities. The prevalence is 1:100,000-1:170,000 mannewborn.	600
IFT80	Short-rib thoracic dysplasia, type 2, with or without polydactyly	NM_020800.2	NM_020800.2:c.701C>G, NM_020800.2:c.315C>G	Short-rib thoracic dysplasia type 2 with or without polydactyly an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IFT80 gene located on chromosomal region 3q25.33. The age of onset is antenatal/neonatal. This is, a group of autosomal recessive ciliopathies that are characterized by a constricted thoracic cage, short ribs, shortened tubular bones, and a trident appearance of the acetabular roof. Polydactyly is variably present. Non-skeletal involvement can include cleft lip/palate as well as anomalies of major organs such as the brain, eye, heart, kidneys, liver, pancreas, intestines, and genitalia. Some forms of the disease are lethal in the neonatal period due to respiratory insufficiency secondary to a severely restricted thoracic cage, whereas others are compatible with life. Disease spectrum encompasses Ellis-van Creveld syndrome, asphyxiating thoracic dystrophy (Jeune syndrome), Mainzer-Saldino syndrome, and short rib-polydactyly syndrome. The incidence is 1-5/500,000.	600
IGF1	Growth retardation with deafness and mental retardation due to IGF1 deficiency	NM_001111285.2	NM_001111285.2:c.274G>A	Growth retardation with deafness and mental retardation due to IGF1 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGF1 gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by the association of intrauterine and postnatal growth retardation with sensorineural deafness and intellectual deficit, addition clinical features include microcephaly, adiposity, and insulin resistance. The prevalence is <1:1,000,000.	600
IGHMBP2	Charcot-Marie-Tooth disease, axonal, type 2S	NM_002180.2	NM_002180.2:c.121C>T, NM_002180.2:c.638A>G, NM_002180.2:c.661delA, NM_002180.2:c.1107C>G, NM_002180.2:c.1488C>A, NM_002180.2:c.1540G>A, NM_002180.2:c.1738G>A, NM_002180.2:c.2362C>T, NM_002180.2:c.2611+1G>T	Charcot-Marie-Tooth disease, axonal, type 2S follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGHMBP2 gene located on chromosomal region 11q13.3. The age of onset can be infancy, childhood, adult or adolescent. This disease is characterized by progressive distal muscle weakness and atrophy of both the lower and upper limbs, absent or reduced deep tendon reflexes, mild sensory loss, foot drop, and pes cavus leading eventually to wheelchair dependence. Some patients present with early hypotonia and delayed motor development. Scoliosis and variable autonomic disturbances may be associated. The prevalence is below 1/1,000,000.	600,25
IL2RG	Severe combined immunodeficiency, X-linked	NM_000206.2	NM_000206.2:c.854G>A, NM_000206.2:c.664C>T, NM_000206.2:c.454+1G>A, NM_000206.2:c.452T>C, NM_000206.2:c.355A>T, NM_000206.2:c.343T>C, NM_000206.2:c.341G>A, NM_000206.2:c.186T>A	Severe combined immunodeficiency, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IL2RG gene located on chromosomal region Xq13.1. The age of onset is infantile. This disease is characterized by absent or markedly reduced numbers of T cells, leading to recurrent infections. The prevalence is 1:50,000-1:100,000.	600
IMPG2	Retinitis pigmentosa, type 56	NM_016247.3	NM_016247.3:c.3262C>T, NM_016247.3:c.2890C>T, NM_016247.3:c.635C>G, NM_016247.3:c.502-1G>C	Retinitis pigmentosa type 56 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IMPG2 gene located on chromosomal region 3q12.3. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades. The prevalence is 1/4.000.	600
INPP5E	Joubert syndrome, type 1	NM_019892.5	NM_019892.5:c.1879C>T, NM_019892.5:c.1688G>A, NM_019892.5:c.1543C>T, NM_019892.5:c.1304G>A, NM_019892.5:c.1132C>T, NM_019892.5:c.855_856insCG	Joubert syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:100,000.	600,25
INSR	Diabetes mellitus, insulin-resistant, with acanthosis nigricans, type A	NM_000208.3	NM_000208.3:c.3680G>C, NM_000208.3:c.3079C>T, NM_000208.3:c.2668C>T, NM_000208.3:c.1114C>T, NM_000208.3:c.172G>A	Diabetes mellitus, insulin-resistant, with acanthosis nigricans type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by the triad of hyperinsulinemia, acanthosis nigricans (skin lesions associated with insulin resistance), and signs of hyperandrogenism in females without lipodystrophy and who are not overweight. It is generally diagnosed in young women with marked signs of hyperandrogenism, but insulin resistance and acanthosis nigricans may be observed in men and in childhood. Acromegaloid facies or muscular cramps are sometimes associated. Hyperinsulinemia, a biological marker for insulin resistance, is often associated with glucose tolerance defects over the course of the disease, and diabetes progressively sets in. Hyperandrogenism (associated with polycystic ovarian syndrome (see this term) or ovarian hyperthecoses) leads to fertility problems. The prevalence is <1:1,000,000.	600,25
IQCB1	Senior-Loken syndrome, type 5	NM_001023570.3	NM_001023570.3:c.1518_1519delCA, NM_001023570.3:c.1465C>T, NM_001023570.3:c.1381C>T, NM_001023570.3:c.1090C>T, NM_001023570.3:c.1069C>T, NM_001023570.3:c.1036G>T, NM_001023570.3:c.817G>T	Senior-Loken syndrome, type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IQCB1 gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by the association of nephronophthisis (NPHP), a chronic kidney disease, with retinal dystrophy. The prevalence is 1/1.000.000.	600
ISCU	Myopathy with lactic acidosis, hereditary	NM_213595.3	NM_213595.3:c.149G>A, NM_213595.3:c.338_339+2delCGGT	Hereditary myopathy with lactic acidosis due to ISCU deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ISCU gene located on chromosomal region 12q23.3. The age of onset is infantile. This disease is characterized by myopathy with severe exercise intolerance.	600
ITGA6	Epidermolysis bullosa, junctional, with pyloric stenosis	NM_001079818.2	NM_001079818.2:c.791delC, NM_001079818.2:c.1255dupA	Junctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGA6 gene located on chromosomal region 2q31.1 . The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract.	600
ITGB4	Epidermolysis bullosa, junctional, with pyloric atresia	NM_000213.4	NM_000213.4:c.112T>C, NM_000213.4:c.182G>A, NM_000213.4:c.1150delG, NM_000213.4:c.1660C>T, NM_000213.4:c.1684T>C, NM_000213.4:c.2608delC, NM_000213.4:c.2792G>A, NM_000213.4:c.3321_3331delACTGGACCGGA, NM_000213.4:c.3674G>A, NM_000213.4:c.3793+1G>A, NM_000213.4:c.3801dupT, NM_000213.4:c.3841C>T, NM_000213.4:c.4620delG, NM_000213.4:c.4643G>A, NM_000213.4:c.4828C>T, NM_000213.4:c.5329+2T>C	Junctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGB4 gene located on chromosomal region 17q25.1. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. More than 100 cases have been reported around the world.	600,25
IVD	Isovaleric acidemia	NM_002225.3	NM_002225.3:c.2T>G, NM_002225.3:c.134T>C, NM_002225.3:c.157C>T, NM_002225.3:c.158G>A, NM_002225.3:c.158G>C, NM_002225.3:c.243+1G>A, NM_002225.3:c.367G>A, NM_002225.3:c.390delT, NM_002225.3:c.406_407delTG, NM_002225.3:c.434_437dupATGA, NM_002225.3:c.465+2T>C, NM_002225.3:c.478_479insGT, NM_002225.3:c.507delG, NM_002225.3:c.559+1G>A, NM_002225.3:c.593G>A, NM_002225.3:c.605G>T, NM_002225.3:c.627delT, NM_002225.3:c.793+1G>A, NM_002225.3:c.941C>T, NM_002225.3:c.994_995delAT, NM_002225.3:c.1141T>C, NM_002225.3:c.1145_1147+4delTTGGTGA, NM_002225.3:c.1183C>T, NM_002225.3:c.1188delT, NM_002225.3:c.1192C>T, NM_002225.3:c.1208A>G	Isovaleric academia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IVD gene located on chromosomal region 15q15.1. The age of onset is neonatal. This disease is characterized by vomiting, dehydration, coma and abnormal movements. The prevalence is 1/100,000.	600,25
JAK3	Severe Combined Immunodeficiency, autosomal recessive, T-negative/B-positive type	NM_000215.3	NM_000215.3:c.1837C>T, NM_000215.3:c.1765G>A, NM_000215.3:c.1695C>A, NM_000215.3:c.1333C>T, NM_000215.3:c.1172_1173insG, NM_000215.3:c.299A>G	Severe combined immunodeficiency, T-B+ type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the JAK3 gene located on chromosomal region 19p13.11. The age of onset is infantile. This disease is characterized by chronic diarrhea, failure to thrive, recurrent respiratory infections and/or generalized infections due to opportunistic pathogens. The incidence is 1/100,000 and 1/1,000,000.	600,25
KCNJ1	Bartter syndrome, type 2	NM_000220.4	NM_000220.4:c.1014delA, NM_000220.4:c.1012C>T, NM_000220.4:c.996_999delAAAG, NM_000220.4:c.942T>G, NM_000220.4:c.657C>G, NM_000220.4:c.641C>T, NM_000220.4:c.592G>A, NM_000220.4:c.500G>A, NM_000220.4:c.372T>A, NM_000220.4:c.322G>C, NM_000220.4:c.237C>G	Bartter syndrome, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ1 gene located on chromosomal region 11q24.3. The age of onset is antenatal. This disease is characterized by severe polyhydramnios in mother leading to premature delivery, postnatally newborns suffer from recurrent episodes of severe dehydration and electrolyte imbalance which can lead to fatal outcome.	600,25
KCNJ13	Leber congenital amaurosis, type 16	NM_002242.4	NM_002242.4:c.722T>C	Leber congenital amaurosis, type 16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ13 gene located on chromosomal region 2q37.1. The age of onset is early infantile. This disease is characterized by retinal dystrophy defined by blindness, nystagmus, roving eye movement, leading to severe visual impairment within the first year of life.	600
KCNV2	Retinal cone dystrophy, type 3B	NM_133497.3	NM_133497.3:c.226C>T, NM_133497.3:c.325C>T, NM_133497.3:c.357dupC, NM_133497.3:c.427G>T, NM_133497.3:c.442G>T, NM_133497.3:c.491T>C, NM_133497.3:c.767C>G, NM_133497.3:c.778A>T, NM_133497.3:c.916G>T, NM_133497.3:c.1016_1024delACCTGGTGG, NM_133497.3:c.1133dupT, NM_133497.3:c.1376G>A	Retinal cone dystrophy, type 3B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNV2 gene located on 9p24.2. The age of onset is in the first or second decade of life. This disease is characterized by is characterized by onset in the first or second decade of life of very marked photophobia, myopia, reduced color vision along the red-green axis with relatively preserved tritan discrimination, and central scotomata with peripheral widespread sensitivity loss predominating in the superior visual field. Nyctalopia is a later feature of the disorder. There is often retinal pigment epithelium disturbance at the macula with a normal retinal periphery.	600,25
KIF7	Acrocallosal syndrome; Joubert syndrome, type 12	NM_198525.2	NM_198525.2:c.3772_3773insC, NM_198525.2:c.3001C>T, NM_198525.2:c.2896_2897delGC, NM_198525.2:c.2473G>T, NM_198525.2:c.687delG, NM_198525.2:c.460C>T, NM_198525.2:c.61C>T	Acrocallosal syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KIF7 gene located on chromosomal region 15q26.1. The age of onset is infantile. This disease is considered a ciliopathy and is characterized by mental retardation, brain abnormalities such as corpus callosum agenesis and/or Dandy-Walker malformation as well as dysmorphic features, postaxial polydactyly of the hands, and preaxial polydactyly of the feet. The prevalence is below 1/1,000,000. Mutations in KIF7 gene are also associated with Joubert syndrome type 12, a disorder with an acrocallosal syndrome overlapping phenotype characterized by the hallmark finding of the molar tooth sign (MTS) on brain MRI.	600
L1CAM	L1 Syndrome	NM_000425.4	NM_000425.4:c.3581C>T, NM_000425.4:c.3489_3490delTG, NM_000425.4:c.3201T>G, NM_000425.4:c.2879delA, NM_000425.4:c.2254G>A, NM_000425.4:c.2092G>A, NM_000425.4:c.1792G>A, NM_000425.4:c.1354G>A, NM_000425.4:c.1108G>A, NM_000425.4:c.924C>T, NM_000425.4:c.800dupA, NM_000425.4:c.791G>A, NM_000425.4:c.772C>T, NM_000425.4:c.719C>T, NM_000425.4:c.551G>A, NM_000425.4:c.536T>G, NM_000425.4:c.23delT	L1 syndromeﾠdescribes a group of conditions that primarily affect the nervous system and occur almost exclusively in males. These conditions vary in severity and include, from most severe to least, X-linked hydrocephalus with stenosis of the aqueduct of Sylvius (HSAS), MASA syndrome, spastic paraplegia type 1, and X-linked complicated corpus callosum agenesis. HSAS is an acronym for the characteristic features of the condition: fluid in the brain (hydrocephalus), muscle stiffness (spasticity), thumbs that are permanently bent toward the palms (adducted thumbs), and narrowing (stenosis) of the aqueduct of Sylvius in the brain. Individuals with HSAS often have severe intellectual disability and may have seizures. MASA syndrome include intellectual disability (mental retardation), mild to moderate, delayed speech (aphasia), spasticity, and adducted thumbs. Individuals with MASA syndrome may have mild enlargement of the ventricles. Spastic paraplegia type 1 is characterized by progressive muscle stiffness (spasticity) and the development of paralysis of the limbs (paraplegia). Affected individuals also have mild to moderate intellectual disability. X-linked complicated corpus callosum agenesis is defined by underdevelopment (hypoplasia) or absence (agenesis) of the tissue that connects the left and right halves of the brain (the corpus callosum). The life expectancy of individuals with L1 syndrome varies depending on the severity of the signs and symptoms.	600
LAMA2	LAMA2-related muscular dystrophy	NM_000426.3	NM_000426.3:c.112+1G>A, NM_000426.3:c.184G>T, NM_000426.3:c.825delC, NM_000426.3:c.1050delT, NM_000426.3:c.1612C>T, NM_000426.3:c.2049_2050delAG, NM_000426.3:c.2098_2099delTT, NM_000426.3:c.2323-2A>T, NM_000426.3:c.2451-2A>G, NM_000426.3:c.2750-1G>C, NM_000426.3:c.2901C>A, NM_000426.3:c.2962C>T, NM_000426.3:c.3215delG, NM_000426.3:c.3237C>A, NM_000426.3:c.3630delT, NM_000426.3:c.3718C>T, NM_000426.3:c.3976C>T, NM_000426.3:c.4645C>T, NM_000426.3:c.5050G>T, NM_000426.3:c.5227G>T, NM_000426.3:c.6011delA, NM_000426.3:c.6038delT, NM_000426.3:c.6334A>T, NM_000426.3:c.6429+1G>A, NM_000426.3:c.6617delT, NM_000426.3:c.6955C>T, NM_000426.3:c.7147C>T, NM_000426.3:c.7279_7280delCT, NM_000426.3:c.7536delC, NM_000426.3:c.7732C>T, NM_000426.3:c.7810C>T, NM_000426.3:c.7888C>T, NM_000426.3:c.8314delA, NM_000426.3:c.8705delT, NM_000426.3:c.8748delA, NM_000426.3:c.9101_9104dupAACA, NM_000426.3:c.9221delA, NM_000426.3:c.9253C>T	LAMA2-related muscular dystrophy 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMA2 gene located on chromosomal region 6q22.33. LAMA2-related muscular dystrophy is a disorder that causes weakness and atrophy of skeletal muscles. This condition varies in severity, from a severe, early-onset type to a milder, late-onset form. Early-onset LAMA2-related muscular dystrophy is apparent at birth or within the first few months of life, called merosin-deficient congenital muscular dystrophy type 1A (607855). Patients show hypotonia, poor suck and cry, and delayed motor development; most never achieve independent ambulation. Most patients also have periventricular white matter abnormalities on brain imaging, but mental retardation and/or seizures occur only rarely. Symptoms of late-onset LAMA2-related muscular dystrophy become evident later in childhood or adulthood, and are similar to those of a group of muscle disorders classified as autosomal recessive limb-girdle muscular dystrophies, type 23. This group is characterized by slowly progressive proximal muscle weakness primarily affecting the lower limbs and resulting in gait difficulties. Additional features include white matter abnormalities on brain imaging, increased serum creatine kinase, and dystrophic features, with partial LAMA2 deficiency on muscle biopsy. Some patients may have additional neurologic features, including executive deficits, seizures, and peripheral neuropathy. Patients remain ambulatory well into adulthood. The prevalence is 1/30,000.	600,25
LAMA3	Junctional epidermolysis bullosa, Herlitz and non-Herlitz type	NM_198129.2	NM_198129.2:c.5162delG, NM_198129.2:c.6009delG, NM_198129.2:c.6808C>T, NM_198129.2:c.6943A>T, NM_198129.2:c.7489C>T, NM_198129.2:c.8177+2T>G, NM_198129.2:c.8962C>T, NM_198129.2:c.9162dupA, NM_198129.2:c.9705dupT	Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMA3 gene located on chromosomal region 18q11.2. The age of onset is neonatal/infancy. Junctional epidermolysis bullosa (JEB) is a group of genetic conditions that cause the skin to be very fragile and to blister easily. Blisters and skin erosions form in response to minor injury or friction, such as rubbing or scratching. Researchers classify junctional epidermolysis bullosa into two main types based on severity: Herlitz JEB and non-Herlitz JEB. Herlitz type is more severe phenotype characterized by blisters and erosions, localized to the skin and mucous membranes and often results in early death. More than 30 mutations in the LAMA3 gene have been identified in people with Herlitz JEB. Other LAMA3 gene mutations cause the milder form non-Herlitz JEB, phenotype characterized by generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.	600
LAMB3	Junctional epidermolysis bullosa, Herlitz and non-Herlitz type	NM_000228.2	NM_000228.2:c.3228+1G>T, NM_000228.2:c.3228+1G>A, NM_000228.2:c.2806C>T, NM_000228.2:c.1903C>T, NM_000228.2:c.1830G>A, NM_000228.2:c.1587_1588delAG, NM_000228.2:c.1438_1442delCCGTG, NM_000228.2:c.1357delT, NM_000228.2:c.904delT, NM_000228.2:c.727C>T, NM_000228.2:c.628+1delG, NM_000228.2:c.628G>A, NM_000228.2:c.565-2A>G, NM_000228.2:c.496C>T, NM_000228.2:c.124C>T	Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 gene located on chromosomal region 1q32.2. The age of onset is neonatal/infancy. Junctional epidermolysis bullosa (JEB) is a group of genetic conditions that cause the skin to be very fragile and to blister easily. Blisters and skin erosions form in response to minor injury or friction, such as rubbing or scratching. Researchers classify junctional epidermolysis bullosa into two main types based on severity: Herlitz JEB and non-Herlitz JEB. Herlitz type is more severe phenotype characterized by blisters and erosions, localized to the skin and mucous membranes and often results in early death. More than 80 mutations in the LAMB3 gene have been identified in people with Herlitz JEB. Other LAMB3 gene mutations cause the milder form non-Herlitz JEB, disease characterized by generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.	600,25
LAMC2	Junctional epidermolysis bullosa, Herlitz and non-Herlitz type	NM_005562.2	NM_005562.2:c.283C>T, NM_005562.2:c.343C>T, NM_005562.2:c.405-1G>A, NM_005562.2:c.1659C>A, NM_005562.2:c.1782_1783delGC, NM_005562.2:c.2137_2143delCAGAACC, NM_005562.2:c.3069+1G>A, NM_005562.2:c.3120_3121insA, NM_005562.2:c.3512dupA	Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMC2 gene located on chromosomal region 1q25.3. The age of onset is neonatal/infancy. Junctional epidermolysis bullosa (JEB) is a group of genetic conditions that cause the skin to be very fragile and to blister easily. Blisters and skin erosions form in response to minor injury or friction, such as rubbing or scratching. Researchers classify junctional epidermolysis bullosa into two main types based on severity: Herlitz JEB and non-Herlitz JEB. Herlitz type is more severe phenotype characterized by blisters and erosions, localized to the skin and mucous membranes and often results in early death. More than 30 mutations in the LAMC2 gene have been identified in people with Herlitz JEB. Other LAMC2 gene mutations cause the milder form non-Herlitz JEB, disease characterized by generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.	600
LARGE1	Muscular dystrophy-dystroglycanopathy, type 6A and 6B	NM_004737.4	NM_004737.4:c.1525G>A, NM_004737.4:c.1483T>C, NM_004737.4:c.1102C>T, NM_004737.4:c.992C>T	Muscular dystrophy-dystroglycanopathy, type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LARGE1 gene located on chromosomal region 22q12.3. The age of onset is infantile. There are two subtypes of dystroglycanopathies related to LARGE1 gene: subtype 6A and 6B. Subtype 6A is the most severe phenotype and is associated with congenital brain and eye anomalies, cobblestone lissencephaly, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Subtype 6B represents an intermediate phenotype with or without congenital mental retardation, white matter changes and structural brain abnormalities. The prevalence is 1:100,000-9:100,000.	600
LBR	Greenberg skeletal dysplasia	NM_002296.3	NM_002296.3:c.1748G>A, NM_002296.3:c.1402delT, NM_002296.3:c.1114C>T, NM_002296.3:c.32_35delTGGT	Greenberg dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LBR gene located on chromosomal region 1q42.12. The age of onset is fetal. This disease is characterized by fetal hydrops, short limbs and abnormal chondro-osseous calcification. The prevalence is <1:1,000,000.	600
LDHA	Glycogen storage disease type 11	NM_001165414.1	NM_001165414.1:c.213+1G>A, NM_001165414.1:c.727_728delCT	Glycogen storage disease type 11 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LDHA gene located on chromosomal region 11p15.1. The age of onset is infantile. This disease is characterized by hepatic glycogenosis and renal Fanconi syndrome.	600
LHFPL5	Deafness, autosomal recessive type 67	NM_182548.3	NM_182548.3:c.250delC, NM_182548.3:c.380A>G, NM_182548.3:c.494C>T, NM_182548.3:c.649+1delG	Autosomal recessive nonsyndromic sensorineural deafness type 67 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LHFPL5 gene located on chromosomal region 6p21.31. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600
LHX3	Pituitary hormone deficiency, combined, type 3	NM_014564.4	NM_014564.4:c.687G>A, NM_014564.4:c.347A>G	Combined pituitary hormone deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LHX3 gene located on chromosomal region 9q34.3. The age of onset is infantile, etc/. This disease is characterized by somatolactotroph, thyrotroph and gonadotroph deficiencies, limited head and neck rotation associated with spinal abnormalities. The prevalence is <1 /1,000,000.	600
LIFR	Stuve-Wiedemann syndrome / Schwartz-Jampel type 2 syndrome	NM_001127671.1	NM_001127671.1:c.2503G>T, NM_001127671.1:c.2013dupT, NM_001127671.1:c.1789C>T, NM_001127671.1:c.1018_1022delAATTG, NM_001127671.1:c.653dupT, NM_001127671.1:c.171_174delTAAC	St�ve-Wiedemann syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LIFR gene located on chromosomal region 5p13.1. The age of onset is neonatal. This disease is characterized by small stature, congenital bowing of the long bones and campodactyly.	600
LIG4	LIG4 syndrome	NM_001098268.1	NM_001098268.1:c.2440C>T, NM_001098268.1:c.1738C>T, NM_001098268.1:c.1512_1513delTC, NM_001098268.1:c.1455_1456delTG, NM_001098268.1:c.1406G>A, NM_001098268.1:c.1369_1372delGGAC, NM_001098268.1:c.1271_1275delAAAGA, NM_001098268.1:c.833G>A	LIG4 syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LIG4 gene located on chromosomal region 10p13. The age of onset is infantile. It is associated with impaired DNA double-strand break repair mechanisms and characterized by microcephaly, unusual facial features (''bird-like''), growth and developmental delay, skin anomalies including photosensitivity and psoriatic-like lesions, and pancytopenia. The disease is associated with immunodeficiency. Some patients have been reported as having telangiectasias, leukemia, lymphoma, bone marrow abnormalities, and type 2 diabetes. The prevalence 1-9/1.000.000.	600
LMNA	LMNA-related disorders, autosomal recessive	NM_001282626.1	NM_001282626.1:c.1818+6C>T	LMNA-related disorders, autosomal recessive, are caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22, and include Charcot-Marie-Tooth disease, type 2B1, Emery-Dreifuss muscular dystrophy type 3, mandibuloacral dysplasia, lethal restrictive dermopathy among others. Charcot-Marie-Tooth disease constitutes a clinically and genetically heterogeneous group of hereditary motor and sensory neuropathies. Emery-Dreifuss muscular dystrophy is characterized classically by the triad of weakness of the shoulder and pelvic girdle muscles, contractures of the elbows, neck, and Achilles tendon, and cardiac involvement, most commonly arrhythmias. Mandibuloacral dysplasia is characterized by growth retardation, craniofacial anomalies with mandibular hypoplasia, skeletal abnormalities with progressive osteolysis of the distal phalanges and clavicles, and pigmentary skin changes. Restrictive dermopathy is a rare, lethal genodermatosis characterized by thin, tightly adherent translucent skin with erosions at flexure sites, superficial vessels, typical facial dysmorphism, and generalized joint ankylosis.	600,25
LMNA	LMNA-related disorders, autosomal recessive	NM_170707.3	NM_170707.3:c.419T>C, NM_170707.3:c.1072G>A, NM_170707.3:c.1228C>T, NM_170707.3:c.1366A>C, NM_170707.3:c.1411C>T, NM_170707.3:c.1488+1G>A, NM_170707.3:c.1579C>T, NM_170707.3:c.1580G>A, NM_170707.3:c.1583C>A, NM_170707.3:c.1585G>A, NM_170707.3:c.1586C>T, NM_170707.3:c.1626G>C	LMNA-related disorders, autosomal recessive, are caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22, and include Charcot-Marie-Tooth disease, type 2B1, Emery-Dreifuss muscular dystrophy type 3, mandibuloacral dysplasia, lethal restrictive dermopathy among others. Charcot-Marie-Tooth disease constitutes a clinically and genetically heterogeneous group of hereditary motor and sensory neuropathies. Emery-Dreifuss muscular dystrophy is characterized classically by the triad of weakness of the shoulder and pelvic girdle muscles, contractures of the elbows, neck, and Achilles tendon, and cardiac involvement, most commonly arrhythmias. Mandibuloacral dysplasia is characterized by growth retardation, craniofacial anomalies with mandibular hypoplasia, skeletal abnormalities with progressive osteolysis of the distal phalanges and clavicles, and pigmentary skin changes. Restrictive dermopathy is a rare, lethal genodermatosis characterized by thin, tightly adherent translucent skin with erosions at flexure sites, superficial vessels, typical facial dysmorphism, and generalized joint ankylosis.	600,25
LOXHD1	Deafness, autosomal recessive type 77	NM_144612.6	NM_144612.6:c.4714C>T, NM_144612.6:c.4524_4525delAG, NM_144612.6:c.3924C>A, NM_144612.6:c.2008C>T, NM_144612.6:c.512-1G>A, NM_144612.6:c.457_461dupCGCCA	Autosomal recessive nonsyndromic sensorineural deafness type 77 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LOXHD1 gene located on chromosomal region 18q21.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600
LRAT	Leber congenital amaurosis type 14	NM_001301645.1	NM_001301645.1:c.217_218delAT, NM_001301645.1:c.525T>A, NM_001301645.1:c.588dupT	Leber congenital amaurosis type 14 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRAT gene located on chromosomal region 4q32.1. The age of onset is infantile. This disease is characterized by blindness, nystagmus, roving eye movement. The prevalence is 2:100,000-3:100,000 newborn.	600
LRP2	Donnai-Barrow syndrome	NM_004525.2	NM_004525.2:c.13388+2T>C, NM_004525.2:c.13139dupC, NM_004525.2:c.11636-1G>T, NM_004525.2:c.11469_11472delTTTG, NM_004525.2:c.10769-2A>G, NM_004525.2:c.9484_9485delGT, NM_004525.2:c.8519_8522delATTT, NM_004525.2:c.7564T>C, NM_004525.2:c.2640-1G>A, NM_004525.2:c.1341+2T>G, NM_004525.2:c.1093C>T	Donnai-Barrow syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP2 gene located on chromosomal region 2q31.1. The age of onset is infantile. This disease is characterized by diaphragmatic hernia, ocular findings, hipertelorism, agenesis of the corpus callosum, hearing loss and facial dimorphism. The prevalence is <1:1,000,000.	600
LRP5	Osteoporosis-pseudoglioma syndrome	NM_002335.3	NM_002335.3:c.804_813delGGGGAAGAGG, NM_002335.3:c.1453G>T, NM_002335.3:c.1468delG, NM_002335.3:c.1481G>A, NM_002335.3:c.1708C>T, NM_002335.3:c.1709G>A, NM_002335.3:c.2202G>A, NM_002335.3:c.2254C>G, NM_002335.3:c.2305delG, NM_002335.3:c.2557C>T, NM_002335.3:c.4099G>A, NM_002335.3:c.4651G>A	Osteoporosis-pseudoglioma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by congenital or infancy-onset blindness and severe juvenile-onset osteoporosis and spontaneous fractures. The prevalence is 1:2,000,000.	600,25
LRPPRC	Leigh syndrome, French-Canadian type	NM_133259.3	NM_133259.3:c.3830_3839delGTGGTGCAATinsAG, NM_133259.3:c.1061C>T	French-Canadian type Leigh syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRPPRC gene located on chromosomal region 2p21. The age of onset is infantile. This disease is characterized by chronic metabolic acidosis, hypotonia, facial dysmorphism and delayed development. The prevalence is 1:2,000 newborn.	600
LRTOMT	Deafness, autosomal recessive type 63	NM_001145308.4	NM_001145308.4:c.242G>A	Autosomal recessive nonsyndromic sensorineural deafness type 63 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRTOMT gene located on chromosomal region 11q13.4. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600
MAK	Retinitis pigmentosa type 62	NM_001242957.2	NM_001242957.2:c.1087_1088delAG, NM_001242957.2:c.719_720dupAG, NM_001242957.2:c.718C>T, NM_001242957.2:c.388A>C, NM_001242957.2:c.37G>A	Retinitis pigmentosa type 62 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAK gene located on chromosomal region 6p24.2. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades.	600
MAN2B1	Mannosidosis, alpha-, types I and II	NM_000528.3	NM_000528.3:c.2686_2687delCTinsG, NM_000528.3:c.2436+2T>C, NM_000528.3:c.2426T>C, NM_000528.3:c.2398G>A, NM_000528.3:c.2368C>T, NM_000528.3:c.2278C>T, NM_000528.3:c.2119C>T, NM_000528.3:c.2013delT, NM_000528.3:c.1929G>A, NM_000528.3:c.1915C>T, NM_000528.3:c.1830+1G>C, NM_000528.3:c.1780C>T, NM_000528.3:c.384G>A, NM_000528.3:c.1A>G	Alpha-mannosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAN2B1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by immunodeficiency, facial and skeletal abnormalities, hearing impairment and intellectual disability. The prevalence is 1:1,000,000-9:1,000,000.	600,25
MARVELD2	Deafness, autosomal recessive type 49	NM_001038603.2	NM_001038603.2:c.1183-1G>A, NM_001038603.2:c.1363C>T	Autosomal recessive nonsyndromic sensorineural deafness type 49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MARVELD2 gene located on chromosomal region 5q13.2. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600
MAT1A	Methionine adenosyltransferase deficiency, autosomal recessive	NM_000429.2	NM_000429.2:c.1070C>T, NM_000429.2:c.1043_1044delTG, NM_000429.2:c.1006G>A, NM_000429.2:c.966T>G, NM_000429.2:c.914T>C, NM_000429.2:c.827_828insG, NM_000429.2:c.791G>A, NM_000429.2:c.790C>T, NM_000429.2:c.538_539insTG	Methionine adenosyltransferase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAT1A gene located on chromosomal region 10q23.1. This disease is characterized by brain demyelination (rarely leading to neurological disorders) and isolated hepatic hypermethioninemia. The prevalence is <1:1,000,000.	600
MBTPS2	IFAP/BRESHECK syndrome; Osteogenesis imperfecta, type 19	NM_015884.3	NM_015884.3:c.261G>A, NM_015884.3:c.677G>T, NM_015884.3:c.1286G>A, NM_015884.3:c.1424T>C	IFAP/BRESHECK syndrome and Osteogenesis imperfecta, type 19 follow an X-linked pattern of inheritance and are caused by pathogenic variants in the MBTPS2 gene located on chromosomal region Xp22.12-p22.11. IFAP/ BRESHECK syndrome's age of onset is infantile and it is characterized by the triad of ichthyosis follicularis, alopecia, and photophobia. Some patients have additional features, including mental retardation, brain anomalies, Hirschsprung disease, corneal opacifications, kidney dysplasia, cryptorchidism, cleft palate, and skeletal malformations, which constitutes BRESHECK syndrom . The prevalence of this syndrome is 1:200,000. Osteogenesis imperfecta type 19 is characterized by prenatal fractures and generalized osteopenia, with severe short stature in adulthood, as well as variable scoliosis and pectal deformity, and marked anterior angulation of the tibia.	600
MCCC1	3-Methylcrotonyl-CoA carboxylase type 1 deficiency	NM_020166.4	NM_020166.4:c.2079delA, NM_020166.4:c.1930G>T, NM_020166.4:c.1905delA, NM_020166.4:c.1526delG, NM_020166.4:c.1380T>G, NM_020166.4:c.1310T>C, NM_020166.4:c.1277T>C, NM_020166.4:c.1155A>C, NM_020166.4:c.1114C>T, NM_020166.4:c.1074delG, NM_020166.4:c.640-1G>A, NM_020166.4:c.640-2A>G, NM_020166.4:c.558delA, NM_020166.4:c.343C>T, NM_020166.4:c.310C>T	3-methylcrotonyl-CoA carboxylase deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC1 gene located on chromosomal region 3q27.1. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn.	600
MCCC2	3-Methylcrotonyl-CoA carboxylase type 2, deficiency	NM_022132.4	NM_022132.4:c.295G>C, NM_022132.4:c.380C>G, NM_022132.4:c.464G>A, NM_022132.4:c.499T>C, NM_022132.4:c.517dupT, NM_022132.4:c.641delG, NM_022132.4:c.735dupC, NM_022132.4:c.838G>T, NM_022132.4:c.929C>G, NM_022132.4:c.994C>T, NM_022132.4:c.1015G>A, NM_022132.4:c.1065A>T, NM_022132.4:c.1072+1G>A, NM_022132.4:c.1577dupT, NM_022132.4:c.1580G>A	3-methylcrotonyl-CoA carboxylase deficiency type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC2 gene located on chromosomal region 5q13.2. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn.	600,25
MCEE	Methylmalonyl-CoA epimerase deficiency	NM_032601.3	NM_032601.3:c.139C>T, NM_032601.3:c.2T>C	Methylmalonic acidemia due to methylmalonyl-CoA epimerase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCEE gene located on chromosomal region 2p13.3. The age of onset is neonatal. This disease is characterized by lethargy, vomiting, hypotonia, hypothermia, respiratory distress, severe ketoacidosis, hyperammonemia, neutropenia, and thrombocytopenia. The prevalence is 1:50,000-1:80,000.	600
MCOLN1	Mucolipidosis type 4	NM_020533.2	NM_020533.2:c.304C>T, NM_020533.2:c.964C>T, NM_020533.2:c.1084G>T, NM_020533.2:c.1207C>T	Mucolipidosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCOLN1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismus. The prevalence is 1:40,000.	600
MCPH1	Microcephaly type 1, primary, autosomal recessive	NM_001322042.1	NM_001322042.1:c.215C>T, NM_001322042.1:c.427dupA, NM_001322042.1:c.1249dupT, NM_001322042.1:c.1935+1G>T, NM_001322042.1:c.1973+1G>A, NM_001322042.1:c.2221C>T	Autosomal recessive primary microcephaly type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCPH1 gene located on chromosomal region 8p23.1. The age of onset is neonatal. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. The incidence is 1/1,000,000.	600
MECP2	Encephalopathy, neonatal severe	NM_001110792.1	NM_001110792.1:c.1001C>T, NM_001110792.1:c.1000C>T, NM_001110792.1:c.952C>T, NM_001110792.1:c.916C>T, NM_001110792.1:c.844C>T, NM_001110792.1:c.842delG, NM_001110792.1:c.799C>T, NM_001110792.1:c.789delC, NM_001110792.1:c.766C>T, NM_001110792.1:c.710C>T, NM_001110792.1:c.647C>G, NM_001110792.1:c.538C>T, NM_001110792.1:c.251dupC	Encephalopathy, neonatal severe follows an X -linked pattern of inheritance and is caused by pathogenic variants in the MECP2 gene located on chromosomal region Xq28. The age of onset is neonatal. This neurological disorder primarily affects males and causes brain dysfunction (encephalopathy). Affected males have microcephaly, poor muscle tone (hypotonia), movement disorders, rigidity, and seizures. Individuals with MECP2-related severe neonatal encephalopathy have severe to profound intellectual disability. Genetic heterogeneity: Many of the mutations causing male's phenotype also cause Rett syndrome, a severe neurodevelopmental disorder that almost always occurs in females. Most severe neonatal encephalopathy cases are surviving male sibs of patients with Rett syndrome. Males with non-Rett syndrome mutations in the MECP2 gene can demonstrate a wide variety of phenotypes. Note: other conditions are also associated to the MECP2 gene, like MECP2 duplication syndrome, a condition characterized by intellectual disability, delayed development, and seizures. It is caused by a duplication of the MECP2 gene and surrounding DNA; this duplication is not tested in the CGT analysis.	600
MED12	Lujan-Fryns syndrome	NM_005120.2	NM_005120.2:c.3443G>A, NM_005120.2:c.3493T>C, NM_005120.2:c.5185C>A	Lujan-Fryns syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the MED12 gene located on chromosomal region Xq13.1. The age of onset is neonatal. It is characterized by mild to moderate intellectual disability, behavioral problems (such as hyperactivity, aggressiveness, extreme shyness, and excessive attention-seeking), and certain physical features such as tall, thin body and an unusually large head (macrocephaly). Almost all people with this condition have weak muscle tone (hypotonia).	600
MED25	Basel-Vanagait-Smirin-Yosef syndrome	NM_030973.3	NM_030973.3:c.320delG, NM_030973.3:c.1366C>T	Basel-Vanagait-Smirin-Yosef syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MED25 gene located on chromosomal region 19q13.33. The age of onset neonatal/infantile. This syndrome is characterized by eye, brain, cardiac and palatal abnormalities as well as growth retardation, microcephaly and severe intellectual disability.	600,25
MEFV	Familial Mediterranean fever, AR	NM_000243.2	NM_000243.2:c.2282G>A, NM_000243.2:c.2230G>T, NM_000243.2:c.2177T>C, NM_000243.2:c.2084A>G, NM_000243.2:c.2082G>A, NM_000243.2:c.2080A>G, NM_000243.2:c.2076_2078delAAT, NM_000243.2:c.2040G>C, NM_000243.2:c.2040G>A, NM_000243.2:c.1958G>A, NM_000243.2:c.1437C>G, NM_000243.2:c.1141C>T, NM_000243.2:c.656dupG, NM_000243.2:c.501G>C, NM_000243.2:c.163dupA	Familial Mediterranean fever follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MEFV gene located on chromosomal region 16p13.3. The age of onset is infantile or adult (before the age of 30). This disease is characterized by recurrent short episodes of fever and serositis resulting in pain in the abdomen, chest, joints and muscles. The prevalence is 1:10,000-5:10,000.	600,25
MERTK	Retinitis pigmentosa type 38	NM_006343.2	NM_006343.2:c.1605-2A>G, NM_006343.2:c.2070_2074delAGGAC, NM_006343.2:c.2189+1G>T, NM_006343.2:c.2211_2214delCTGT, NM_006343.2:c.2323C>T, NM_006343.2:c.2785_2786dupTA	Retinitis pigmentosa type 38 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MERTK gene located on chromosomal region 2q13. The age of onset is infantile. This disease is characterized by. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness.	600,25
MFRP	Microphthalmia, isolated type 5	NM_031433.3	NM_031433.3:c.1149dupC, NM_031433.3:c.1124+1G>T, NM_031433.3:c.545T>C, NM_031433.3:c.523C>T, NM_031433.3:c.498delC	Microphthalmia, isolated type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFRP gene located on chromosomal region 11q23.3. The age of onset is infantile. This disease is characterized by posterior microphthalmos, retinitis pigmentosa, foveoschisis, and optic disk drusen.	600,25
MFSD8	Ceroid lipofuscinosis, neuronal, type 7	NM_152778.2	NM_152778.2:c.1525_1526delCT, NM_152778.2:c.1286G>A, NM_152778.2:c.1235C>T, NM_152778.2:c.1090delA, NM_152778.2:c.999-2A>G, NM_152778.2:c.929G>A, NM_152778.2:c.894T>G, NM_152778.2:c.881C>A, NM_152778.2:c.362A>G	Neuronal ceroid lipofuscinosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFSD8 gene located on chromosomal region 4q28.2. The age of onset is late infantile. This disease is characterized by decline of mental and motor capacities, epilepsy, and vision loss through retinal degeneration. The prevalence is 0.56:100,000-3.9:100,000.	600
MGAT2	Congenital disorder of glycosylation, type 2a	NM_002408.3	NM_002408.3:c.785A>G, NM_002408.3:c.869C>T, NM_002408.3:c.1017T>A	Congenital disorder of glycosylation type 2a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MGAT2 gene located on chromosomal region 14q21.3. The age of onset is infantile. This disease is characterized by severe psychomotor delay, postnatal growth retardation, facial dysmorphology and bleeding tendency. It has been described in four children.	600
MKKS	Bardet-Biedl syndrome type 6	NM_018848.3	NM_018848.3:c.1436C>G, NM_018848.3:c.1225_1226delGG, NM_018848.3:c.830T>C, NM_018848.3:c.353delG	Bardet-Biedl syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.	600,25
MKS1	Bardet-Biedl syndrome type 13	NM_001321269.1	NM_001321269.1:c.1024+1G>A, NM_001321269.1:c.508C>T	Bardet-Biedl syndrome type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.	600,25
MLC1	Megalencephalic leukoencephalopathy with subcortical cysts	NM_015166.3	NM_015166.3:c.424-2A>C, NM_015166.3:c.423C>A, NM_015166.3:c.422A>G, NM_015166.3:c.278C>T, NM_015166.3:c.274C>T, NM_015166.3:c.206C>T, NM_015166.3:c.135dupC, NM_015166.3:c.33dupC	Megalencephalic leukoencephalopathy with subcortical cysts follows an autosomal recessive patternof inheritance and is caused by pathogenic variants in the MLC1 gene located on chromosomal region 22q13.33. The age of onset is infantile. This disease is characterized by ataxia followed by progressive signs of pyramidal tract involvement and mental deterioration.	600
MLYCD	Malonyl-CoA decarboxylase deficiency	NM_012213.2	NM_012213.2:c.560C>G, NM_012213.2:c.680_685dupTGAAGC, NM_012213.2:c.758delT	Malonyl-CoA decarboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MLYCD gene located on chromosomal region 16q23.3. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000.	600
MMAA	Methylmalonic aciduria, vitamin B12-responsive	NM_172250.2	NM_172250.2:c.283C>T, NM_172250.2:c.387C>A, NM_172250.2:c.450dupG, NM_172250.2:c.455delC, NM_172250.2:c.503delC, NM_172250.2:c.586C>T, NM_172250.2:c.620A>G, NM_172250.2:c.811G>T, NM_172250.2:c.1034delT	Vitamin B12-responsive methylmalonic acidemia type cblA follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAA gene located on chromosomal region 4q31.21. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000.	600
MMAB	Methylmalonic aciduria, vitamin B12-responsive, type cblB	NM_052845.3	NM_052845.3:c.700C>T, NM_052845.3:c.569G>A, NM_052845.3:c.568C>T, NM_052845.3:c.556C>T, NM_052845.3:c.220G>T, NM_052845.3:c.197-1G>T, NM_052845.3:c.197-1G>A	Vitamin B12-responsive methylmalonic acidemia type cbl B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAB gene located on chromosomal region 12q24.31. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000.	600
MMACHC	Methylmalonic aciduria and homocystinuria, cblC type	NM_015506.2	NM_015506.2:c.271dupA, NM_015506.2:c.331C>T, NM_015506.2:c.347T>C, NM_015506.2:c.388_390delTAC, NM_015506.2:c.394C>T, NM_015506.2:c.440G>C, NM_015506.2:c.481C>T, NM_015506.2:c.482G>A, NM_015506.2:c.547_548delGT, NM_015506.2:c.608G>A, NM_015506.2:c.609G>A, NM_015506.2:c.615C>A, NM_015506.2:c.615C>G, NM_015506.2:c.619dupG, NM_015506.2:c.616C>T, NM_015506.2:c.658_660delAAG, NM_015506.2:c.688C>T	Vitamin B12-responsive methylmalonic acidemia type cbl B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAB gene located on chromosomal region 12q24.31. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000.	600,25
MMADHC	Homocystinuria, cblD type, variant 1	NM_015702.2	NM_015702.2:c.795dupT, NM_015702.2:c.776T>C, NM_015702.2:c.748C>T, NM_015702.2:c.746A>G, NM_015702.2:c.545C>A, NM_015702.2:c.478+1G>T, NM_015702.2:c.419dupA, NM_015702.2:c.57_64delCTCTTTAG	Homocystinuria, cblD type, variant 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMADHC gene located on chromosomal region 2q23.2. The age of onset is variable (infantile to adult). This disease is characterized by developmental delay, severe learning difficulties, seizures, movement and gait abnormalities, behavioral problems and signs of megaloblastic anemia (pallor, fatigue, anorexia). The prevalence is 1:50,000-1:80,000.	600
MOCS1	Molybdenum cofactor deficiency A	NM_001075098.3	NM_001075098.3:c.1027C>T, NM_001075098.3:c.956G>A, NM_001075098.3:c.397_406delCCGGACGTGG, NM_001075098.3:c.217C>T	Molybdenum cofactor deficiency type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS1 gene located on chromosomal region 6p21.2. The age of onset is infantile. This disease is characterized by severe neurological abnormalities, dislocated ocular early death.	600
MOCS2	Molybdenum cofactor deficiency B	NM_004531.4	NM_004531.4:c.567A>C, NM_004531.4:c.539_540delAA, NM_004531.4:c.502G>A, NM_004531.4:c.377+1G>A, NM_004531.4:c.106_107delAT, NM_004531.4:c.58delT, NM_004531.4:c.3G>A	Molybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death.	600,25
MOCS2	Molybdenum cofactor deficiency B	NM_176806.3	NM_176806.3:c.16C>T	Molybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death.	600,25
MPI	Congenital disorder of glycosylation, type 1b	NM_002435.2	NM_002435.2:c.305C>T, NM_002435.2:c.413T>C, NM_002435.2:c.656G>A, NM_002435.2:c.884G>A, NM_002435.2:c.1016_1019delACCC	Congenital disorder of glycosylation type 1b follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MPI gene located on chromosomal region 15q24.1. The age of onset is infantile. This disease is characterized by hepatic-intestinal manifestations (diarrhoea, vomiting, and hepatomegaly associated with hepatic fibrosis).	600
MPV17	Mitochondrial DNA depletion syndrome type 6 (hepatocerebral)	NM_002437.4	NM_002437.4:c.498C>A, NM_002437.4:c.462-2A>C, NM_002437.4:c.359G>A, NM_002437.4:c.284dupG, NM_002437.4:c.263_265delAGA, NM_002437.4:c.149G>A, NM_002437.4:c.148C>T, NM_002437.4:c.70G>T	Mitochondrial DNA depletion syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MPV17 gene located on chromosomal region 2p23.3. The age of onset is infantile. It is a disease due to mitochondrial dysfunction. It is characterized by infantile onset of progressive liver failure, often leading to death in the first year of life, peripheral neuropathy, corneal scarring, acral ulceration and osteomyelitis leading to autoamputation, cerebral leukoencephalopathy, failure to thrive, and recurrent metabolic acidosis with intercurrent infections.	600
MRPS16	Combined oxidative phosphorylation deficiency 2	NM_016065.3	NM_016065.3:c.331C>T, NM_016065.3:c.2T>C	Combined oxidative phosphorylation defect type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MRPS16 gene located on chromosomal region 10q22.2. The age of onset is infantile. This disease is characterized by agenesis of corpus callosum, dismorphism and fatal lactic acidosis.	600
MRPS22	Combined oxidative phosphorylation deficiency type 5	NM_020191.2	NM_020191.2:c.40_41insA, NM_020191.2:c.509G>A, NM_020191.2:c.644T>C	Combined oxidative phosphorylation defect type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MRPS22 gene located on chromosomal region 3q23. The age of onset is infantile. This disease is characterized by evere hypotonia, lactic academia and congenital hyperammonaemia.	600
MTM1	Myotubular myopathy, X-linked	NM_000252.2	NM_000252.2:c.70C>T, NM_000252.2:c.420C>G, NM_000252.2:c.461T>G, NM_000252.2:c.595_599delCCTGC, NM_000252.2:c.670C>T, NM_000252.2:c.721C>T, NM_000252.2:c.780T>A, NM_000252.2:c.969dupA, NM_000252.2:c.969delA, NM_000252.2:c.1261-10A>G, NM_000252.2:c.1306_1310dupCCTAT, NM_000252.2:c.1357_1358delCC, NM_000252.2:c.1415_1416delGT	X-linked centronuclear myopathy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the MTM1 gene located on chromosomal region Xq28. The age of onset is infantile, etc/. This disease is characterized by severe phenotype in males presenting at birth with marked weakness, hypotonia and respiratory failure. The incidence is 1/50,000 newborn man.	600
MTMR2	Charcot-Marie-Tooth disease, type 4B1	NM_016156.5	NM_016156.5:c.1276C>T, NM_016156.5:c.304C>T	Charcot-Marie-Tooth disease type 4B1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTMR2 gene located on chromosomal region 11q21. The age of onset is early infantile. This disease is characterized by distal and proximal muscular weakness starting in the lower extremities, sensory loss and cranial nerve involvement, foot deformities and diaphragmatic and facial involvement.	600
MTTP	Abetalipoproteinemia	NM_001300785.1	NM_001300785.1:c.789_790delCA, NM_001300785.1:c.1700G>A, NM_001300785.1:c.1850G>T, NM_001300785.1:c.1948+1G>A, NM_001300785.1:c.2112delC, NM_001300785.1:c.2674G>T	Abetalipoproteinemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTTP gene located on chromosomal region 4q23. The age of onset is infantile. This disease is characterized by growth delay, malabsorption, hepatomegaly, and neurological and neuromuscular manifestations. The prevalence is <1:1,000,000.	600,25
MUT	Methylmalonic aciduria, mut(0) type	NM_000255.3	NM_000255.3:c.2150G>T, NM_000255.3:c.2080C>T, NM_000255.3:c.1924G>C, NM_000255.3:c.1871A>G, NM_000255.3:c.1867G>A, NM_000255.3:c.1741C>T, NM_000255.3:c.1658delT, NM_000255.3:c.1445-2A>G, NM_000255.3:c.1420C>T, NM_000255.3:c.1399C>T, NM_000255.3:c.1280G>A, NM_000255.3:c.1207C>T, NM_000255.3:c.1181T>A, NM_000255.3:c.1106G>A, NM_000255.3:c.914T>C, NM_000255.3:c.682C>T, NM_000255.3:c.671_678dupAATTTATG, NM_000255.3:c.655A>T, NM_000255.3:c.643G>A, NM_000255.3:c.607G>A, NM_000255.3:c.572C>A, NM_000255.3:c.313T>C, NM_000255.3:c.280G>A, NM_000255.3:c.278G>A, NM_000255.3:c.91C>T	Methylmalonic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MUT gene located on chromosomal region 6p12.3. The age of onset is very early infantile. This disease is characterized by recurrent ketoacidotic comas or transient vomiting, dehydration, hypotonia and intellectual deficit, which does not respond to administration of vitamin B12.	600,25
MVK	Mevalonic aciduria	NM_000431.3	NM_000431.3:c.59A>C, NM_000431.3:c.185G>A, NM_000431.3:c.494C>T, NM_000431.3:c.803T>C, NM_000431.3:c.902A>C, NM_000431.3:c.928G>A, NM_000431.3:c.1000G>A, NM_000431.3:c.1129G>A	Mevalonic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by psychomotor retardation, failure to thrive, progressive cerebellar ataxia, dysmorphic features, progressive visual impairment and recurrent febrile crises. The prevalence is <1:1,000,000.	600,25
MYO15A	Deafness, autosomal recessive type 3	NM_016239.3	NM_016239.3:c.625G>T, NM_016239.3:c.755dupA, NM_016239.3:c.3313G>T, NM_016239.3:c.3336delG, NM_016239.3:c.3385C>T, NM_016239.3:c.3693-2A>G, NM_016239.3:c.3756+1G>T, NM_016239.3:c.4751_4752dupTC, NM_016239.3:c.5326C>T, NM_016239.3:c.5492G>T, NM_016239.3:c.6004delG, NM_016239.3:c.6864_6874delGGACCTGGAGC, NM_016239.3:c.8148G>T, NM_016239.3:c.8410A>T, NM_016239.3:c.8548C>T, NM_016239.3:c.9958_9961delGACT, NM_016239.3:c.10573delA	Deafness autosomal recessive type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO15A gene located on chromosomal region 17p11.2. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600,25
MYO3A	Deafness, autosomal recessive type 30	NM_017433.4	NM_017433.4:c.1A>G, NM_017433.4:c.732-2A>G, NM_017433.4:c.770C>G, NM_017433.4:c.1086T>G, NM_017433.4:c.1193C>A, NM_017433.4:c.1777-12G>A, NM_017433.4:c.1953delC, NM_017433.4:c.2243delA, NM_017433.4:c.2506-1G>A, NM_017433.4:c.2793+2T>A, NM_017433.4:c.3112-2A>G, NM_017433.4:c.3154C>T, NM_017433.4:c.4586+2T>G, NM_017433.4:c.4730+1G>A	Deafness autosomal recessive type 30 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO3A gene located on chromosomal region 10p12.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600,25
MYO5A	Griscelli syndrome, type 1	NM_000259.3	NM_000259.3:c.2332C>T, NM_000259.3:c.1145delC	Griscelli disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO5A gene located on chromosomal region 15q21.2. The age of onset is infantile. This disease is characterized by is characterised by silvery gray sheen of the hair and hypopigmentation of the skin which can be associated to neurological impairment. The prevalence is <1:1,000,000.	600
MYO6	Deafness, autosomal recessive type 37	NM_004999.3	NM_004999.3:c.1452dupT, NM_004999.3:c.2907_2909delAGA, NM_004999.3:c.3496C>T, NM_004999.3:c.3808C>T	Deafness autosomal recessive type 37 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO6 gene located on chromosomal region 6q14.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600,25
MYO7A	Usher syndrome, type 1B	NM_000260.3	NM_000260.3:c.3G>A, NM_000260.3:c.133-2A>G, NM_000260.3:c.448C>T, NM_000260.3:c.494C>T, NM_000260.3:c.634C>T, NM_000260.3:c.635G>A, NM_000260.3:c.640G>A, NM_000260.3:c.731G>C, NM_000260.3:c.1184G>A, NM_000260.3:c.1344-1G>A, NM_000260.3:c.1797G>A, NM_000260.3:c.1884C>A, NM_000260.3:c.1996C>T, NM_000260.3:c.2476G>A, NM_000260.3:c.3504-1G>C, NM_000260.3:c.3508G>A, NM_000260.3:c.3596dupT, NM_000260.3:c.3719G>A, NM_000260.3:c.3764delA, NM_000260.3:c.4024delT, NM_000260.3:c.5392C>T, NM_000260.3:c.5618G>A, NM_000260.3:c.5824G>T, NM_000260.3:c.5886_5889delCTTT, NM_000260.3:c.5967C>G, NM_000260.3:c.6025delG	Usher syndrome type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 1:100,000-9:100,000.	600,25
NAGA	Schindler disease, type I	NM_000262.2	NM_000262.2:c.986G>A, NM_000262.2:c.985C>T, NM_000262.2:c.973G>A, NM_000262.2:c.577G>T	Schindler disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGA gene located on chromosomal region 22q13.2. The age of onset is infantile. This disease is characterized by early-onset neuroaxonal dystrophy and neurological signs (convulsion during fever, epilepsy, psychomotor retardation and hypotonia). NAGA deficiency is typically classified in three main phenotypes: NAGA deficiency type I (Schindler disease or Schindler disease type I) with severe manifestations; NAGA deficiency type II (Kanzazi disease or Schindler disease type II) which is mild; NAGA deficiency type III (Schindler disease type III) characterized by mild-to-moderate neurologic manifestations. NAGA deficiency results in the increased urinary excretion of glycopeptides and oligosaccharides containing alpha-N-acetylgalactosaminyl moieties.	600,25
NAGS	N-acetylglutamate synthase deficiency	NM_153006.2	NM_153006.2:c.916-2A>T, NM_153006.2:c.971G>A, NM_153006.2:c.1025delG, NM_153006.2:c.1289T>C, NM_153006.2:c.1299G>C, NM_153006.2:c.1307dupT	N-acetylglutamate synthetase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGS gene located on chromosomal region 17q21.31. The age of onset is infantile, etc/. This disease is characterized by hyperammonemia, vomiting, hyperactivity or lethargy, diarrhoea, poor feeding, seizures, hypotonia, delayed psychomotor development and respiratory distress. The prevalence is <1:1,000,000.	600
NDRG1	Charcot-Marie-Tooth disease, type 4D	NM_001135242.1	NM_001135242.1:c.928C>T, NM_001135242.1:c.538-1G>A, NM_001135242.1:c.442C>T, NM_001135242.1:c.16C>T	Charcot-Marie-Tooth disease type 4D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NDRG1 gene located on chromosomal region 8q24.22. The age of onset is infantile, etc/. This disease is characterized by demyelination and hearing loss.	600
NEB	Nemaline myopathy type 2, autosomal recessive	NM_001271208.1	NM_001271208.1:c.12238_12239delAT, NM_001271208.1:c.8031_8041delAAATAAACGAG, NM_001271208.1:c.6105dupT, NM_001271208.1:c.2173G>T, NM_001271208.1:c.843T>G	Nemaline myopathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEB gene located on chromosomal region 2q23.3. The age of onset is infantile or adult. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:100,000-9:100,000 and the incidence is 1/50.000 newborn.	600,25
NEFL	Charcot-Marie-Tooth disease, type 1F	NM_006158.4	NM_006158.4:c.628G>T, NM_006158.4:c.418G>T, NM_006158.4:c.361G>T	Charcot-Marie-Tooth disease type 1F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEFL gene located on chromosomal region 8p21.2. The age of onset is infantile. This disease is characterized by a progressive peripheral motor and sensory neuropathy with variable clinical, distal weakness and wasting of the muscles of the lower limbs. The prevalence is 15:100,000-20:100,000.	600
NEUROG3	Diarrhea type 4, malabsorptive, congenital	NM_020999.3	NM_020999.3:c.319C>A, NM_020999.3:c.278G>T	Congenital malabsorptive diarrhea type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEUROG3 gene located on chromosomal region 10q22.1. The age of onset is early infantile. This disease is characterized by severe, life-threatening watery diarrhea associated with generalized malabsorption and a paucity of enteroendocrine cells. The prevalence is <1:1,000,000.	600
NHP2	Dyskeratosis congenita, autosomal recessive type 2	NM_017838.3	NM_017838.3:c.460T>A, NM_017838.3:c.415T>C, NM_017838.3:c.289_290delAT	Dyskeratosis congenita type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NHP2 gene located on chromosomal region 5q35.3. The age of onset is variable from infancy to adult. It is a multisystem disorder caused by defective telomere maintenance. Clinical manifestations include mucocutaneous abnormalities, bone marrow failure, and an increased predisposition to cancer, among other variable features.	600
NMNAT1	Leber congenital amaurosis type 9	NM_001297778.1	NM_001297778.1:c.25G>A, NM_001297778.1:c.451G>T, NM_001297778.1:c.457C>G, NM_001297778.1:c.507G>A, NM_001297778.1:c.619C>T, NM_001297778.1:c.710G>T, NM_001297778.1:c.769G>A	Leber congenital amaurosis type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NMNAT1 gene located on chromosomal region 1p36.22. The age of onset is early infantile. This disease is characterized by blindness, nystagmus, roving eye movement, leading to severe visual impairment.	600,25
NOP10	Dyskeratosis congenita, autosomal recessive type 1	NM_018648.3	NM_018648.3:c.100C>T	Dyskeratosis congenita autosomal recessive type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NOP10 gene located on chromosomal region 15q14. The age of onset is infantile. This disease is characterized by the mucocutaneous triad of abnormal skin pigmentation, nail dystrophy and mucosal leucoplakia. The prevalence is 1:1,000,000.	600
NPC1	Niemann-Pick disease, type C1	NM_000271.4	NM_000271.4:c.3662delT, NM_000271.4:c.3611_3614delTTAC, NM_000271.4:c.3467A>G, NM_000271.4:c.3425T>C, NM_000271.4:c.3182T>C, NM_000271.4:c.3175C>T, NM_000271.4:c.3107C>T, NM_000271.4:c.3104C>T, NM_000271.4:c.3019C>G, NM_000271.4:c.2974G>T, NM_000271.4:c.2974G>A, NM_000271.4:c.2972_2973delAG, NM_000271.4:c.2932C>T, NM_000271.4:c.2873G>A, NM_000271.4:c.2861C>T, NM_000271.4:c.2848G>A, NM_000271.4:c.2842G>A, NM_000271.4:c.2761C>T, NM_000271.4:c.2324A>C, NM_000271.4:c.2072C>T, NM_000271.4:c.1628C>T, NM_000271.4:c.1211G>A, NM_000271.4:c.1042C>T, NM_000271.4:c.813_815delCAT, NM_000271.4:c.530G>A, NM_000271.4:c.352_353delAG, NM_000271.4:c.337T>C	Niemann-Pick disease type C1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC1 gene located on chromosomal region 18q11.2. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000.	600,25
NPC2	Niemann-pick disease, type C2	NM_006432.3	NM_006432.3:c.436C>T, NM_006432.3:c.358C>T, NM_006432.3:c.352G>T, NM_006432.3:c.295T>C, NM_006432.3:c.190+5G>A, NM_006432.3:c.115G>A, NM_006432.3:c.58G>T, NM_006432.3:c.27delG	Niemann-Pick disease type C2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC2 gene located on chromosomal region 14q24.3. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000.	600,25
NPHP1	Joubert syndrome type 4	NM_000272.3	NM_000272.3:c.1884+1G>T, NM_000272.3:c.1184dupC, NM_000272.3:c.829C>T, NM_000272.3:c.555dupA, NM_000272.3:c.455C>G, NM_000272.3:c.80T>A, NM_000272.3:c.1delA	Joubert syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP1 gene located on chromosomal region 2q13. This is a disorder presenting with cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Additional variable features include retinal dystrophy and renal disease. Joubert syndrome type 4 is a phenotypically mild form.	600
NPHP3	Meckel syndrome type 7	NM_153240.4	NM_153240.4:c.3406C>T, NM_153240.4:c.3373C>T, NM_153240.4:c.3156dupA, NM_153240.4:c.2694-2_2694-1delAG, NM_153240.4:c.2694-2A>G, NM_153240.4:c.2570+1G>T, NM_153240.4:c.2541delG, NM_153240.4:c.2369T>C, NM_153240.4:c.1985+5G>A, NM_153240.4:c.1817G>A, NM_153240.4:c.1729C>T, NM_153240.4:c.1381G>T, NM_153240.4:c.1119-2A>G, NM_153240.4:c.434_437delAAAG	Meckel syndrome type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP3 gene located on chromosomal region 3q22.1. The age of onset is infantile. This is a disorder characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically encephalocele), hepatic ductal dysplasia and cysts, and polydactyly.	600,25
NPHP4	Nephronophthisis type 4	NM_015102.4	NM_015102.4:c.3767_3768insAA, NM_015102.4:c.3231+1G>C, NM_015102.4:c.2940_2944dupGCTCC, NM_015102.4:c.2335C>T, NM_015102.4:c.1972C>T, NM_015102.4:c.1120-1G>C, NM_015102.4:c.556_557insT, NM_015102.4:c.517C>T	Nephronophthisis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP4 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease results in end-stage renal disease at age ranging between 6 and 35 years. It is a progressive tubulo-interstitial kidney disorder characterized by polydipsia, polyuria, anemia and growth retardation. The prevalence is 1:1,000,000-9:1,000,000.	600,25
NPHS1	Nephrotic syndrome, type 1	NM_004646.3	NM_004646.3:c.3478C>T, NM_004646.3:c.3325C>T, NM_004646.3:c.3250dupG, NM_004646.3:c.3250delG, NM_004646.3:c.3109+1G>A, NM_004646.3:c.2928G>T, NM_004646.3:c.2491C>T, NM_004646.3:c.1715G>A, NM_004646.3:c.1481delC, NM_004646.3:c.1307_1308dupAC, NM_004646.3:c.121_122delCT	Nephrotic syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHS1 gene located on chromosomal region 19q13.12. The age of onset is fetal- infantile. This disease is characterized by fetal proteinuria and nephritic infantile syndrome. The prevalence is 1 in 8 200 births.	600,25
NR0B1	Adrenal hypoplasia, congenital	NM_000475.4	NM_000475.4:c.1319A>T, NM_000475.4:c.1316T>G, NM_000475.4:c.1107G>A, NM_000475.4:c.890T>C, NM_000475.4:c.873G>C, NM_000475.4:c.847C>T, NM_000475.4:c.813C>G, NM_000475.4:c.800G>C, NM_000475.4:c.788T>A, NM_000475.4:c.704G>A, NM_000475.4:c.591C>A, NM_000475.4:c.513G>A, NM_000475.4:c.388_389delTA, NM_000475.4:c.273C>A	Congenital adrenal hypoplasia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the NR0B1 gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by adrenal insufficiency with vomiting, feeding difficulty, dehydration, and shock caused by a salt-wasting episode and hypoglycemia.	600
NR2E3	Enhanced S-cone syndrome	NM_014249.3	NM_014249.3:c.119-2A>C, NM_014249.3:c.226C>T, NM_014249.3:c.298_299delTG, NM_014249.3:c.932G>A, NM_014249.3:c.1034_1038delTGCAG	Enhaced S-Cone Syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NR2E3 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by night blindness, reduced bilateral visual acuity, and typical fundus findings (progressive pigmentary degenerative changes, macular edema, retinoschisis).	600,25
NTRK1	Insensitivity to pain, congenital, with anhidrosis	NM_002529.3	NM_002529.3:c.1076A>G, NM_002529.3:c.1727delT, NM_002529.3:c.1729G>C, NM_002529.3:c.1759A>G, NM_002529.3:c.1926_1927insT, NM_002529.3:c.2084C>T, NM_002529.3:c.2339G>C	Insensitivity to pain, congenital, with anhidrosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NTRK1 gene located on chromosomal region 1q23.1. The age of onset is infantile. This disease is characterized by anhidrosis, insensitivity to pain, self-mutilating behavior and episodes of fever.	600
NUP62	Striatonigral degeneration, infantile	NM_001193357.1	NM_001193357.1:c.1172A>C	Infantile striatal degeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NUP62 gene located on chromosomal region 19q13.33. The age of onset is infantile. This disease is characterized by choreoathetosis, dystonia, rigidity, spasticity, dysphagia, optic atrophy, intellectual deficit, developmental regression of motor and verbal skills, failure to thrive, myoclonus, quadriparesis, cerebellar ataxia and nystagmus. The prevalence is <1:1,000,000.	600
NYX	Night blindness, congenital stationary (complete), type 1A, X-linked	NM_022567.2	NM_022567.2:c.1049G>A	Congenital stationary night blindness follows an X-linked pattern of inheritance and is caused by pathogenic variants in the NYX gene located on chromosomal region Xp11.4. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity.	600
OAT	Gyrate atrophy of choroid and retina	NM_000274.3	NM_000274.3:c.1276C>T, NM_000274.3:c.1250C>T, NM_000274.3:c.1205T>C, NM_000274.3:c.994G>A, NM_000274.3:c.955C>T, NM_000274.3:c.952delG, NM_000274.3:c.952G>A, NM_000274.3:c.901-2A>G, NM_000274.3:c.824G>A, NM_000274.3:c.812G>A, NM_000274.3:c.677C>T, NM_000274.3:c.627T>A, NM_000274.3:c.596C>A, NM_000274.3:c.539G>C, NM_000274.3:c.533G>A, NM_000274.3:c.278G>T, NM_000274.3:c.268C>G, NM_000274.3:c.159delC	Gyrate atrophy of choroid and retina follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OAT gene located on chromosomal region 10q26.13. The age of onset is infantile. This disease is characterized by gyrate atrophy of the choroid and retina that begins during childhood with myopia and night blindness, followed by concentric shrinking of the visual field (tunnel vision) and a peculiar aspect of retinopathy on the funduscopy. Patients can also present with ornithinemia.	600
OCA2	Oculocutaneous albinism type 2	NM_000275.2	NM_000275.2:c.2228C>T, NM_000275.2:c.1960delG, NM_000275.2:c.1842+1G>T, NM_000275.2:c.1465A>G, NM_000275.2:c.1364+1G>T, NM_000275.2:c.1327G>A, NM_000275.2:c.1182+2T>C, NM_000275.2:c.1182G>A, NM_000275.2:c.1025A>G, NM_000275.2:c.819_822delCTGGinsGGTC, NM_000275.2:c.157delA, NM_000275.2:c.79G>A	Oculocutaneous albinism type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OCA2 gene located on chromosomal region 15q12-q13. The age of onset is infantile. This disease is characterized by variable hypopigmentation of the skin and hair, numerous characteristic ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1/38,000-1/40,000	600,25
OCRL	Lowe Syndrome; Dent disease type 2	NM_001318784.1	NM_001318784.1:c.912_913delAG, NM_001318784.1:c.1502G>A, NM_001318784.1:c.2302C>T, NM_001318784.1:c.2406dupA, NM_001318784.1:c.2533C>T, NM_001318784.1:c.2538delA	Dent disease type 2 and Lowe syndrome follow an X-linked pattern of inheritance and are caused by pathogenic variants in the OCRL gene located on chromosomal region Xq25-q26. Dent disease type 2 is a type of Dent disease in which patients have the manifestations of Dent disease type 1 associated with extra-renal features: hypercalciuria and low-molecular-weight (LMW) proteinuria. In addition, these patients may also have nephrocalcinosis, nephrolithiasis, hematuria, hypophosphatemia and/or renal insufficiency. The features of Lowe syndrome are hydrophthalmia, cataract, mental retardation, vitamin D-resistant rickets, amino aciduria, and reduced ammonia production by the kidney.	600
OFD1	Joubert syndrome type 10; Orofaciodigital syndrome type 1	NM_003611.2	NM_003611.2:c.43_44delAG, NM_003611.2:c.52G>T, NM_003611.2:c.65dupA, NM_003611.2:c.62_63insT, NM_003611.2:c.221C>T, NM_003611.2:c.224A>C, NM_003611.2:c.235G>A, NM_003611.2:c.241C>G, NM_003611.2:c.243C>G, NM_003611.2:c.247C>T, NM_003611.2:c.260A>G, NM_003611.2:c.275_276delCT, NM_003611.2:c.274T>C, NM_003611.2:c.277G>T, NM_003611.2:c.290A>G, NM_003611.2:c.312+1delG, NM_003611.2:c.312+2_312+7delTAAAGT, NM_003611.2:c.413-10T>G, NM_003611.2:c.454C>T, NM_003611.2:c.518-1G>A, NM_003611.2:c.541dupG, NM_003611.2:c.594_598delAAAGC, NM_003611.2:c.602delA, NM_003611.2:c.607_610delTATA, NM_003611.2:c.616_617delGA, NM_003611.2:c.614_617delGAGA, NM_003611.2:c.619_624delATAGAA, NM_003611.2:c.628C>T, NM_003611.2:c.653delA, NM_003611.2:c.654+2_654+3delTA, NM_003611.2:c.1268_1272delAAAAC, NM_003611.2:c.1303A>C, NM_003611.2:c.1318delC, NM_003611.2:c.1319delT, NM_003611.2:c.1322_1326delAAGAA, NM_003611.2:c.1323_1326delAGAA, NM_003611.2:c.1360_1363delCTTA, NM_003611.2:c.1358T>A, NM_003611.2:c.1365_1368delACAA, NM_003611.2:c.1612C>T, NM_003611.2:c.1757delG, NM_003611.2:c.1821delG, NM_003611.2:c.1840delG, NM_003611.2:c.1859_1860delCCinsG, NM_003611.2:c.2261-1G>T, NM_003611.2:c.2321_2322insT, NM_003611.2:c.2349delC, NM_003611.2:c.2387+1G>C, NM_003611.2:c.2582dupT	Joubert syndrome type 10 and Orofaciodigital syndrome type 1 follow an X-linked pattern of inheritance and are caused by pathogenic variants in the OFD1 gene located on chromosomal region Xp22.2. Joubert syndrome type 10 is a disorder presenting with cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy and renal disease. Orofaciodigital syndrome type 1 is characterized by malformations of the face, oral cavity, and digits and is transmitted as an X-linked dominant condition with lethality in males. The central nervous system may also be involved in as many as 40% of cases.	600
OPA3	3-methylglutaconic aciduria, type 3	NM_001017989.2	NM_001017989.2:c.221delG	3-methylglutaconic aciduria type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OPA3 gene located on chromosomal region 19q13.32. The age of onset is infantile. This disease is characterized by the association of optic atrophy and choreoathetosis with 3-methylglutaconic aciduria. The prevalence is 1:10,000-5:10,000.	600
OSTM1	Osteopetrosis, autosomal recessive type 5	NM_014028.3	NM_014028.3:c.415_416delAG	Osteopetrosis, autosomal recessive type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OSTM1 gene located on chromosomal region 6p21. The age of onset is infantile. This disease is characterized by osteopetrosis, agenesis del cuerpo calloso, atrofia cerebral e hipocampo peque�o.	600
OTC	Ornithine transcarbamylase deficiency	NM_000531.5	NM_000531.5:c.77G>A, NM_000531.5:c.118C>T, NM_000531.5:c.119G>A, NM_000531.5:c.134T>C, NM_000531.5:c.148G>T, NM_000531.5:c.238A>G, NM_000531.5:c.245T>G, NM_000531.5:c.259G>A, NM_000531.5:c.275G>A, NM_000531.5:c.332T>C, NM_000531.5:c.421C>T, NM_000531.5:c.460G>T, NM_000531.5:c.563G>T, NM_000531.5:c.589G>T, NM_000531.5:c.617T>G, NM_000531.5:c.646C>G, NM_000531.5:c.674C>T, NM_000531.5:c.717+2T>C, NM_000531.5:c.829C>T	Ornithine transcarbamylase deficiency follows an X-linked pattern of inheritance and is caused by pathogenic variants in the OTC gene located on chromosomal region Xp11.4. The age of onset is infantile. This disease is characterized by severe neonatal hyperammonemic coma that generally proves to be fatal, in males. Females may be also affected by symptoms with various degrees of intensity, ranging from dislike for proteins to chronic vomiting, growth retardation, hypotonia, psychomotor retardation, hyperammonemic coma, or psychiatric disorders. The prevalence is 1:80,000.	600
OTOA	Deafness, autosomal recessive type 22	NM_144672.3	NM_144672.3:c.121-1G>A, NM_144672.3:c.828delT, NM_144672.3:c.1725_1726delCA	Deafness, autosomal recessive type 22 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOA gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems.	600,25
OTOF	Auditory neuropathy, autosomal recessive, type 1	NM_001287489.1	NM_001287489.1:c.5474_5475delCC, NM_001287489.1:c.5473C>G, NM_001287489.1:c.5103+2T>A, NM_001287489.1:c.4559G>A, NM_001287489.1:c.4491T>A, NM_001287489.1:c.3032T>C, NM_001287489.1:c.2485C>T, NM_001287489.1:c.2348delG, NM_001287489.1:c.1778delT, NM_001287489.1:c.1544T>C, NM_001287489.1:c.1498C>T, NM_001287489.1:c.766-2A>G, NM_001287489.1:c.584-1G>C, NM_001287489.1:c.227+2T>C, NM_001287489.1:c.149G>A	Auditory neuropathy, autosomal recessive type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. Patients can have varying degrees of hearing loss with poor speech reception out of proportion to the degree of hearing loss.	600,25
OTOF	Auditory neuropathy, autosomal recessive, type 1	NM_004802.3	NM_004802.3:c.3515G>A	Auditory neuropathy, autosomal recessive type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. Patients can have varying degrees of hearing loss with poor speech reception out of proportion to the degree of hearing loss.	600,25
P3H1	Osteogenesis imperfecta, type 8	NM_001243246.1	NM_001243246.1:c.1656C>A, NM_001243246.1:c.1473+1G>T, NM_001243246.1:c.1365_1366delAGinsC, NM_001243246.1:c.1102C>T, NM_001243246.1:c.747delC	Osteogenesis imperfecta type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the P3H1 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by bone fragility, low bone mass and susceptibility to bone fractures. The prevalence is 6:100,000-7:100,000.	600
PAH	Phenylketonuria	NM_000277.1	NM_000277.1:c.1315+1G>A, NM_000277.1:c.1243G>A, NM_000277.1:c.1241A>G, NM_000277.1:c.1238G>C, NM_000277.1:c.1222C>T, NM_000277.1:c.1217T>C, NM_000277.1:c.1208C>T, NM_000277.1:c.1199+17G>A, NM_000277.1:c.1199+1G>A, NM_000277.1:c.1197A>T, NM_000277.1:c.1184C>A, NM_000277.1:c.1169A>G, NM_000277.1:c.1166delC, NM_000277.1:c.1162G>A, NM_000277.1:c.1139C>T, NM_000277.1:c.1068C>A, NM_000277.1:c.1066-3C>T, NM_000277.1:c.1066-11G>A, NM_000277.1:c.1045T>C, NM_000277.1:c.1042C>G, NM_000277.1:c.1033G>T, NM_000277.1:c.1030G>A, NM_000277.1:c.955G>T, NM_000277.1:c.926C>T, NM_000277.1:c.926C>A, NM_000277.1:c.912+1G>A, NM_000277.1:c.898G>T, NM_000277.1:c.896T>G, NM_000277.1:c.842+5G>A, NM_000277.1:c.838G>A, NM_000277.1:c.829T>G, NM_000277.1:c.823C>T, NM_000277.1:c.818C>T, NM_000277.1:c.814G>T, NM_000277.1:c.809G>A, NM_000277.1:c.806delT, NM_000277.1:c.782G>A, NM_000277.1:c.764T>C, NM_000277.1:c.755G>A, NM_000277.1:c.754C>T, NM_000277.1:c.745C>T, NM_000277.1:c.737C>A, NM_000277.1:c.734T>C, NM_000277.1:c.733G>C, NM_000277.1:c.728G>A, NM_000277.1:c.727C>T, NM_000277.1:c.722delG, NM_000277.1:c.722G>A, NM_000277.1:c.721C>T, NM_000277.1:c.688G>A, NM_000277.1:c.673C>G, NM_000277.1:c.665A>G, NM_000277.1:c.638T>C, NM_000277.1:c.611A>G, NM_000277.1:c.569T>C, NM_000277.1:c.533A>G, NM_000277.1:c.529G>A, NM_000277.1:c.527G>T, NM_000277.1:c.509+1G>A, NM_000277.1:c.508C>G, NM_000277.1:c.503delA, NM_000277.1:c.490A>G, NM_000277.1:c.482T>C, NM_000277.1:c.473G>A, NM_000277.1:c.472C>T, NM_000277.1:c.450dupA, NM_000277.1:c.442-1G>A, NM_000277.1:c.442-5C>G, NM_000277.1:c.441+5G>T, NM_000277.1:c.441+1G>A, NM_000277.1:c.357delC, NM_000277.1:c.331C>T, NM_000277.1:c.320A>G, NM_000277.1:c.311C>A, NM_000277.1:c.284_286delTCA, NM_000277.1:c.261C>A, NM_000277.1:c.250G>T, NM_000277.1:c.204A>T, NM_000277.1:c.194T>C, NM_000277.1:c.165T>G, NM_000277.1:c.143T>C, NM_000277.1:c.136G>A, NM_000277.1:c.117C>G, NM_000277.1:c.47_48delCT	Phenylketonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAH gene located on chromosomal region 12q23.2. The age of onset is neonatal. This disease is characterized by gradual developmental delay, stunted growth, microcephaly, seizures, tremors, eczema, vomiting, and musty odor. Untreated patients subsequently develop intellectual disability, behavioral disorders (hyperactivity) and motor disorders. The prevalence is 1:2,600-1:200,000.	600,25
PANK2	Neurodegeneration with brain iron accumulation type 1	NM_153638.3	NM_153638.3:c.790C>T, NM_153638.3:c.823_824delCT, NM_153638.3:c.1561G>A, NM_153638.3:c.1583C>T	Neurodegeneration with brain iron accumulation type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PANK2 gene located on chromosomal region 20p13. The age of onset is infantile. This disease is characterized by progressive extrapyramidal dysfunction (dystonia, rigidity, choreoathetosis), iron accumulation on the brain and axonal spheroids in the central nervous system. The prevalence is 1-2/1,000,000.	600,25
PC	Pyruvate carboxylase deficiency	NM_000920.3	NM_000920.3:c.1748G>T, NM_000920.3:c.434T>C	Pyruvate carboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PC gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by metabolic acidosis, failure to thrive, developmental delay, and recurrent seizures. The prevalence is 1:250,000.	600,25
PCCA	Propionic acidemia	NM_000282.3	NM_000282.3:c.229C>T, NM_000282.3:c.261dupT, NM_000282.3:c.412G>A, NM_000282.3:c.600+1G>A, NM_000282.3:c.862A>T, NM_000282.3:c.1023dupT, NM_000282.3:c.1118T>A, NM_000282.3:c.1226_1227delTT, NM_000282.3:c.1284+1G>A, NM_000282.3:c.1598_1601delTTGT, NM_000282.3:c.1891G>C, NM_000282.3:c.1899+4_1899+7delAGTA	Propionic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCA gene located on chromosomal region 13q32.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000.	600,25
PCCB	Propionic acidemia	NM_001178014.1	NM_001178014.1:c.331C>T, NM_001178014.1:c.337C>T, NM_001178014.1:c.562G>A, NM_001178014.1:c.622G>A, NM_001178014.1:c.743C>T, NM_001178014.1:c.1050dupT, NM_001178014.1:c.1233dupT, NM_001178014.1:c.1278_1291delGGGCATCATCCGGCinsTAGAGCACAGGA, NM_001178014.1:c.1279_1284delGGCATCinsAA, NM_001178014.1:c.1283_1286delTCAT, NM_001178014.1:c.1288C>T, NM_001178014.1:c.1289_1290insT, NM_001178014.1:c.1343C>T, NM_001178014.1:c.1364A>G, NM_001178014.1:c.1594C>T, NM_001178014.1:c.1598_1600dupCCC, NM_001178014.1:c.1666A>G	Propionic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCB gene located on chromosomal region 3q22.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000.	600,25
PCDH15	Deafness, autosomal recessive type 23	NM_001142763.1	NM_001142763.1:c.5680A>T, NM_001142763.1:c.4982_4983insTGAT, NM_001142763.1:c.4958_4961dupTGAT, NM_001142763.1:c.4885delA, NM_001142763.1:c.4569_4572dupATCT, NM_001142763.1:c.3733-2A>G, NM_001142763.1:c.2660_2661delAT, NM_001142763.1:c.1955C>G, NM_001142763.1:c.1752C>G, NM_001142763.1:c.1598T>A, NM_001142763.1:c.1103delT, NM_001142763.1:c.1021C>T, NM_001142763.1:c.800G>A, NM_001142763.1:c.415C>T, NM_001142763.1:c.415C>G, NM_001142763.1:c.7C>T	Deafness, autosomal recessive 23 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCDH15 gene located on chromosomal region 10q21.1. This is a form of non-syndromic sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.	600,25
PDE6A	Retinitis pigmentosa type 43	NM_000440.2	NM_000440.2:c.2053G>A, NM_000440.2:c.1749C>G, NM_000440.2:c.1683G>A, NM_000440.2:c.1560dupA, NM_000440.2:c.1113+1G>T, NM_000440.2:c.1113+1G>A	Retinitis pigmentosa type 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	600,25
PDE6B	Retinitis pigmentosa type 40	NM_000283.3	NM_000283.3:c.892C>T, NM_000283.3:c.1540delC, NM_000283.3:c.1572delC, NM_000283.3:c.1580T>C, NM_000283.3:c.1669C>T, NM_000283.3:c.1920+2T>C	Retinitis pigmentosa 40 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6B gene located on chromosomal region 4p16.3. The age of onset is variable. Retinitis pigmentosa 40 is a retinal dystrophy belonging to the group of pigmentary retinopathies.This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness.	600,25
PDE6C	Cone dystrophy type 4	NM_006204.3	NM_006204.3:c.85C>T, NM_006204.3:c.180_186delCCTGTGC, NM_006204.3:c.256_257insAG, NM_006204.3:c.481-12T>A, NM_006204.3:c.633G>C, NM_006204.3:c.826C>T, NM_006204.3:c.881G>A, NM_006204.3:c.1066G>T, NM_006204.3:c.1363A>G, NM_006204.3:c.1682dupA, NM_006204.3:c.1805A>T, NM_006204.3:c.2036+1G>T, NM_006204.3:c.2283+1G>C, NM_006204.3:c.2457T>A	Cone dystrophy type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6C gene located on chromosomal region 10q23.33. The age of onset is infantile. This disease is characterized by reduced visual acuity, achromatopsia, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, eccentric fixation, and reduced or complete loss of color discrimination.	600
PDE6G	Retinitis pigmentosa type 57	NM_002602.3	NM_002602.3:c.187+1G>T	Retinitis pigmentosa type 57 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6G gene located on chromosomal region 17q25.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife.	600
PDHA1	Pyruvate dehydrogenase E1-alpha deficiency	NM_001173454.1	NM_001173454.1:c.887A>C, NM_001173454.1:c.901C>G	Pyruvate dehydrogenase E1-alpha deficiency follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PDHA1 gene located on chromosomal region Xp22.12. The age of onset is variable. This disease is characterized by primary lactic acidosis in children. It is associated with a broad clinical spectrum ranging from fatal lactic acidosis in the newborn to chronic neurologic dysfunction with structural abnormalities in the central nervous system without systemic acidosis.The prevalence is >1:40,000 newborn.	600
PDP1	Pyruvate dehydrogenase phosphatase deficiency	NM_001161779.1	NM_001161779.1:c.352G>T, NM_001161779.1:c.672_676delCTTTA, NM_001161779.1:c.878delC, NM_001161779.1:c.926_928delTTC, NM_001161779.1:c.1681C>T	Pyruvate dehydrogenase phosphatase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDP1 gene located on chromosomal region 8q22.1. The age of onset is neonatal. This disease is characterized by lactic acidosis and hypotonia.	600
PDSS1	Coenzyme Q10 deficiency, primary, type 2	NM_014317.4	NM_014317.4:c.319dupT, NM_014317.4:c.924T>G	Coenzyme Q10 deficiency, primary, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDSS1 gene located on chromosome 10p12.1. The age of onset is neonatal/infantile. This disease is characterized by multisystem disorder with early-onset deafness, optic atrophy, mild mental retardation, peripheral neuropathy, obesity and cardiac valvulopathy.	600
PDSS2	Coenzyme Q10 deficiency, primary, type 3	NM_020381.3	NM_020381.3:c.1145C>T, NM_020381.3:c.964C>T, NM_020381.3:c.129dupC	Coenzyme Q10 deficiency, primary, type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDSS2 gene located on chromosomal region 6q21. The age of onset is infantile. This disease is characterized by onset of symptoms typically between age three and 12 months, often following a viral infection. Neurologic features include hypotonia, spasticity, movement disorders, cerebellar ataxia, and peripheral neuropathy.	600
PDX1	Pancreatic agenesis type 1	NM_000209.3	NM_000209.3:c.492G>T, NM_000209.3:c.532G>A, NM_000209.3:c.533A>G	Pancreatic agenesis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDX1 gene located on chromosomal region 13q12.1. The age of onset is infantile. This disease is characterized by isolated hypoplasia or agenesis of the pancreas, pancreatic beta-cell failure resulting in neonatal insulin-dependent diabetes mellitus, and exocrine pancreatic insufficiency.	600
PDZD7	Usher syndrome, type 2C, GPR98/PDZD7 digenic	NM_001195263.1	NM_001195263.1:c.2107delA, NM_001195263.1:c.1543C>T, NM_001195263.1:c.166dupC, NM_001195263.1:c.144dupA	Usher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR98 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32, respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000.	600
PEX1	Heimler syndrome type 1	NM_000466.2	NM_000466.2:c.3505_3517delCAGTTGTTTTCAC, NM_000466.2:c.2916delA, NM_000466.2:c.2528G>A, NM_000466.2:c.2097dupT, NM_000466.2:c.1991T>C, NM_000466.2:c.1952_1960dupCAGTGTGGA, NM_000466.2:c.1842delA, NM_000466.2:c.1239+1G>T, NM_000466.2:c.877C>T	Heimler syndrome 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. This disease is characterized by sensorineural hearing loss, enamel hyoplasia of the secondary dentition, and nail abnormalities.	600,25
PEX12	Peroxisome biogenesis disorder type 3A (Zellweger)	NM_000286.2	NM_000286.2:c.959C>T, NM_000286.2:c.894delC, NM_000286.2:c.888_889delCT, NM_000286.2:c.771delC, NM_000286.2:c.538C>T, NM_000286.2:c.455_459dupGGAAA	Peroxisome biogenesis disorder 3A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX12 gene located on chromosomal region 17q12. The peroxisomal biogenesis disorder (PBD) Zellweger syndrome (ZS) is an autosomal recessive multiple congenital anomaly syndrome resulting from disordered peroxisome biogenesis. Affected children present in the newborn period with profound hypotonia, seizures, and inability to feed. Characteristic craniofacial anomalies, eye abnormalities, neuronal migration defects, hepatomegaly, and chondrodysplasia punctata are present. Children with this condition do not show any significant development and usually die in the first year of lifeﾠ	600
PEX2	Peroxisome biogenesis disorder type 5A (Zellweger)	NM_000318.2	NM_000318.2:c.789_790delCT, NM_000318.2:c.163G>A	Peroxisome biogenesis disorder 5A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX2 gene located on chromosomal region 8q21.13. The peroxisomal biogenesis disorder (PBD) Zellweger syndrome (ZS) is an autosomal recessive multiple congenital anomaly syndrome resulting from disordered peroxisome biogenesis. Affected children present in the newborn period with profound hypotonia, seizures, and inability to feed. Characteristic craniofacial anomalies, eye abnormalities, neuronal migration defects, hepatomegaly, and chondrodysplasia punctata are present. Children with this condition do not show any significant development and usually die in the first year of lifeﾠ	600
PEX26	Peroxisome biogenesis disorder type 7A (Zellweger)	NM_001127649.2	NM_001127649.2:c.254dupT, NM_001127649.2:c.265G>A, NM_001127649.2:c.292C>T	Peroxisome biogenesis disorder 7A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX26 gene located on chromosomal region 22q11.21. The peroxisomal biogenesis disorder (PBD) Zellweger syndrome (ZS) is an autosomal recessive multiple congenital anomaly syndrome resulting from disordered peroxisome biogenesis. Affected children present in the newborn period with profound hypotonia, seizures, and inability to feed. Characteristic craniofacial anomalies, eye abnormalities, neuronal migration defects, hepatomegaly, and chondrodysplasia punctata are present. Children with this condition do not show any significant development and usually die in the first year of lifeﾠ	600
PEX5	Peroxisome biogenesis disorder type 2A (Zellweger)	NM_001300789.1	NM_001300789.1:c.1342C>T, NM_001300789.1:c.1641T>G	Peroxisome biogenesis disorder 2A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX5 gene located on chromosomal region 12p13.31. The peroxisomal biogenesis disorder (PBD) Zellweger syndrome (ZS) is an autosomal recessive multiple congenital anomaly syndrome resulting from disordered peroxisome biogenesis. Affected children present in the newborn period with profound hypotonia, seizures, and inability to feed. Characteristic craniofacial anomalies, eye abnormalities, neuronal migration defects, hepatomegaly, and chondrodysplasia punctata are present. Children with this condition do not show any significant development and usually die in the first year of lifeﾠ	600
PEX7	Rhizomelic chondrodysplasia punctata, type 1	NM_000288.3	NM_000288.3:c.532C>T, NM_000288.3:c.618G>A, NM_000288.3:c.649G>A, NM_000288.3:c.653C>T, NM_000288.3:c.694C>T, NM_000288.3:c.854A>G, NM_000288.3:c.875T>A, NM_000288.3:c.903+1G>C	Rhizomelic chondrodysplasia punctata type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX7 gene located on chromosomal region 6q23.3. The age of onset is early. This disease is characterized by proximal shortening of the humerus and to a lesser degree the femur (rhizomelia), punctate calcifications in cartilage with epiphyseal and metaphyseal abnormalities (chondrodysplasia punctata), coronal clefts of the vertebral bodies, cataracts, postnatal growth deficiency is profound, intellectual disability is severe, seizures. The prevalence is <1:100,000.	600,25
PGM1	Congenital disorder of glycosylation, type 1t	NM_001172818.1	NM_001172818.1:c.397A>G, NM_001172818.1:c.415G>C, NM_001172818.1:c.841G>T, NM_001172818.1:c.1561C>T	Congenital disorder of glycosylation, type 1T follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PGM1 gene located on chromosomal region 1p31.3. The age of onset is infantile. It is a multisystem disorder caused by a defect in glycoprotein biosynthesis and characterized by under-glycosylated serum glycoproteins. Congenital disorders of glycosylation result in a wide variety of clinical features, such as defects in the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. The prevalence is <1:1,000,000.	600
PHKG2	Glycogen storage disease type 9c	NM_000294.2	NM_000294.2:c.130C>T, NM_000294.2:c.393-2A>G, NM_000294.2:c.553C>T, NM_000294.2:c.958C>T	Glycogen storage disease type 9C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHKG2 gene located on chromosomal region 16p12.1-p11.2. The age of onset is infantile. This disease is characterized by hepatomegaly, growth retardation, and mild delay in motor development during childhood. The incidence is <1:100.000 births.	600
PHYH	Refsum disease	NM_001323082.1	NM_001323082.1:c.830G>A, NM_001323082.1:c.829C>T, NM_001323082.1:c.811A>C, NM_001323082.1:c.684+5G>T, NM_001323082.1:c.684+2T>G, NM_001323082.1:c.503-2A>G, NM_001323082.1:c.164delT, NM_001323082.1:c.135-1G>C, NM_001323082.1:c.135-2A>G	Refsum disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHYH gene located on chromosomal region 10p13. The age of onset is variable. This disease is characterized by hemeralopia (loss of vision in the dark), followed by episods of chronic distal motor polyneuropathy. Other associated signs include perceptive deafness, anosmia, cerebellous ataxia and sometimes, severe intellectual deficiency. Over the course of time cutaneous signs appear (ichtyosis), along with polyepiphyseal dysplasia, myocardiopathy, elevated protein in cerebrospinal fluid, and pigmentary retinitis that may result in blindness. The prevalence is 1:1.000,000-9:1.000,000.	600,25
PJVK	Deafness, autosomal recessive type 59	NM_001042702.3	NM_001042702.3:c.113dupT, NM_001042702.3:c.122delA, NM_001042702.3:c.161C>T, NM_001042702.3:c.420delT, NM_001042702.3:c.726delT, NM_001042702.3:c.823dupT, NM_001042702.3:c.988delG	Autosomal recessive nonsyndromic sensorineural deafness type 59 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PJVK gene located on chromosomal region 2q31.2. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	600
PKHD1	Polycystic kidney disease type 4	NM_138694.3	NM_138694.3:c.12027C>G, NM_138694.3:c.11363_11372delCTTCCCTGGA, NM_138694.3:c.10452dupT, NM_138694.3:c.10412T>G, NM_138694.3:c.10219C>T, NM_138694.3:c.9719G>A, NM_138694.3:c.9689delA, NM_138694.3:c.9530T>C, NM_138694.3:c.9370C>T, NM_138694.3:c.8870T>C, NM_138694.3:c.8824C>T, NM_138694.3:c.8408G>A, NM_138694.3:c.8407T>C, NM_138694.3:c.8317G>T, NM_138694.3:c.6499C>T, NM_138694.3:c.5895dupA, NM_138694.3:c.5325_5326delAG, NM_138694.3:c.4870C>T, NM_138694.3:c.3940delA, NM_138694.3:c.3766delC, NM_138694.3:c.3761_3762delCCinsG, NM_138694.3:c.3367G>A, NM_138694.3:c.3229-2A>C, NM_138694.3:c.2854G>A, NM_138694.3:c.2827_2828delGA, NM_138694.3:c.2452C>T, NM_138694.3:c.2414C>T, NM_138694.3:c.2341C>T, NM_138694.3:c.1486C>T, NM_138694.3:c.982C>T, NM_138694.3:c.930delC, NM_138694.3:c.682A>G, NM_138694.3:c.664A>G, NM_138694.3:c.370C>T, NM_138694.3:c.353delG, NM_138694.3:c.107C>T, NM_138694.3:c.85G>T	Polycystic kidney disease type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKHD1 gene located on chromosomal region 6p12.3-p12.2. The age of onset is early. This disease is a severe form of polycystic kidney disease affecting the kidneys and, in some cases, the hepatic biliary tract. Up to 50% of the affected neonates die shortly after birth, as a result of severe pulmonary hypoplasia and secondary respiratory insufficiency. In the subset that survives the perinatal period, morbidity and mortality are mainly related to severe systemic hypertension, renal insufficiency, and portal hypertension due to portal-tract fibrosis.	600,25
PKLR	Pyruvate kinase deficiency	NM_000298.5	NM_000298.5:c.1675C>T, NM_000298.5:c.1529G>A, NM_000298.5:c.1528C>T, NM_000298.5:c.1456C>T, NM_000298.5:c.1436G>A, NM_000298.5:c.1261C>A, NM_000298.5:c.1151C>T, NM_000298.5:c.721G>T	Pyruvate kinase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKLR gene located on chromosomal region 1q22. The age of onset is early. This disease is characterized by highly variable degree of chronic hemolysis, with severe neonatal jaundice and fatal anemia at birth, severe transfusion-dependent chronic hemolysis, and moderate hemolysis with exacerbation during infection. The prevalence is 1:20,000.	600,25
PLA2G6	Infantile neuroaxonal dystrophy type 1	NM_003560.2	NM_003560.2:c.2370T>G, NM_003560.2:c.2239C>T, NM_003560.2:c.1903C>T, NM_003560.2:c.1894C>T, NM_003560.2:c.1634A>C, NM_003560.2:c.1612C>T, NM_003560.2:c.929T>A, NM_003560.2:c.109C>T	Infantile neuroaxonal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLA2G6 gene located on chromosomal region 22q13.1. The age of onset is infantile. This disease is a type of neurodegeneration with brain iron accumulation characterized by psychomotor delay and regression, increasing neurological involvement with symmetrical pyramidal tract signs and spastic tetraplegia. INAD may be classic or atypical and patients present with symptoms anywhere along a continuum between the two.	600
PLCE1	Nephrotic syndrome, type 3	NM_016341.3	NM_016341.3:c.961C>T, NM_016341.3:c.3346C>T, NM_016341.3:c.3736C>T, NM_016341.3:c.3846delG, NM_016341.3:c.4451C>T, NM_016341.3:c.4809delA, NM_016341.3:c.5560C>T	Nephrotic syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLCE1 gene located on chromosomal region 10q23.33. The age of onset is variable. This disease is characterized by low blood protein levels, high cholesterol levels, high triglyceride levels, and presence of protein in the urine. The prevalence is 2:100,000-7:100,000 Children; 3:100,000 adults.	600,25
PLEC	Epidermolysis bullosa simplex with muscular dystrophy	NM_201380.3	NM_201380.3:c.12373dupG, NM_201380.3:c.11776G>T, NM_201380.3:c.11301_11302delGA, NM_201380.3:c.9580_9581delCT, NM_201380.3:c.9415C>T, NM_201380.3:c.7285C>T, NM_201380.3:c.1243C>T, NM_201380.3:c.1236+1G>A	Epidermolysis bullosa simplex with muscular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLEC gene located on chromosomal region 8q24. The age of onset is early. This disease is characterized by generalized blistering associated with muscular dystrophy, dystrophic nails, and focal keratoderma of the palms and soles. The prevalence is 1:30,000-1:50,000.	600
PLEKHG5	Charcot-Marie-Tooth disease, recessive intermediate C	NM_001265592.1	NM_001265592.1:c.3172C>T, NM_001265592.1:c.2177T>C	Charcot-Marie-Tooth disease, intermediate type C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLEKHG5 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease is a disorder of the peripheral nervous system, characterized by progressive weakness and atrophy, initially of the peroneal muscles and later of the distal muscles of the arms. Recessive intermediate forms of Charcot-Marie-Tooth disease are characterized by clinical and pathologic features intermediate between demyelinating and axonal peripheral neuropathies, and motor median nerve conduction velocities ranging from 25 to 45 m/sec.	600
PLG	Plasminogen deficiency, type I	NM_000301.3	NM_000301.3:c.112A>G, NM_000301.3:c.693_695delGAA, NM_000301.3:c.704G>A, NM_000301.3:c.1120G>T, NM_000301.3:c.1435G>T, NM_000301.3:c.1848G>A	Plasminogen deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLG gene located on chromosomal region 6q26. The age of onset is infantile.This disease is characterized by markedly impaired extracellular fibrinolysis leading to the formation of ligneous (fibrin-rich) pseudomembranes on mucosae during wound healing. The prevalence is 1:1,000,000-9:1,000,000.	600,25
PLOD1	Ehlers-Danlos syndrome, kyphoscoliotic type, 1	NM_001316320.1	NM_001316320.1:c.607+1G>A, NM_001316320.1:c.1096C>T, NM_001316320.1:c.1674C>G, NM_001316320.1:c.1977G>C, NM_001316320.1:c.2149C>T, NM_001316320.1:c.2173G>A	Ehlers-Danlos syndrome kyphoscoliotic type, 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLOD1 gene located on chromosomal region 1p36. The age of onset is early. This disease is characterized by progressive scoliosis from birth, severe muscle hypotonia, hyperextensible joints and fragile eyeballs. The weakness can lead to ocular retinal hemorrhage, glaucoma, coloring of the sclera or even to rupture of the globe. The prevalence is <1:5,000.	600
PLP1	Pelizaeus-Merzbacher disease	NM_000533.4	NM_000533.4:c.3G>A, NM_000533.4:c.128C>T, NM_000533.4:c.231_232insC, NM_000533.4:c.487T>C, NM_000533.4:c.593delG, NM_000533.4:c.725C>T, NM_000533.4:c.737G>C	Pelizaeus-Merzbacher disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PLP1 gene located on chromosomal region Xq22.2. The age of onset is infantile. It is a hypomyelinative leukodystrophy in which myelin is not formed properly in the central nervous system. It is characterized clinically by nystagmus, spastic quadriplegia, ataxia, and developmental delay.	600
PLP1	Pelizaeus-Merzbacher disease	NM_001305004.1	NM_001305004.1:c.5-1G>T	Pelizaeus-Merzbacher disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PLP1 gene located on chromosomal region Xq22.2. The age of onset is infantile. It is a hypomyelinative leukodystrophy in which myelin is not formed properly in the central nervous system. It is characterized clinically by nystagmus, spastic quadriplegia, ataxia, and developmental delay.	600
PMM2	Congenital disorder of glycosylation, type 1a	NM_000303.2	NM_000303.2:c.26G>A, NM_000303.2:c.53C>G, NM_000303.2:c.95T>G, NM_000303.2:c.95_96delTAinsGC, NM_000303.2:c.97C>T, NM_000303.2:c.109C>T, NM_000303.2:c.131T>C, NM_000303.2:c.190delT, NM_000303.2:c.193G>T, NM_000303.2:c.255+2T>C, NM_000303.2:c.256-1G>C, NM_000303.2:c.323C>T, NM_000303.2:c.338C>T, NM_000303.2:c.349G>C, NM_000303.2:c.357C>A, NM_000303.2:c.368G>A, NM_000303.2:c.385G>A, NM_000303.2:c.395T>C, NM_000303.2:c.415G>A, NM_000303.2:c.422G>A, NM_000303.2:c.442G>A, NM_000303.2:c.470T>C, NM_000303.2:c.484C>T, NM_000303.2:c.563A>G, NM_000303.2:c.620T>C, NM_000303.2:c.623G>C, NM_000303.2:c.647A>T, NM_000303.2:c.652C>G, NM_000303.2:c.669C>G, NM_000303.2:c.677C>G, NM_000303.2:c.691G>A, NM_000303.2:c.710C>G, NM_000303.2:c.710C>T	Congenital disorder of glycosylation type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PMM2 gene located on chromosomal region 16p13.2. The age of onset is infantile. This disease is characterized by highly variable clinical manifestations that may include feeding problems, vomiting, and diarrhea with failure to thrive in infants, and severe encephalopathy with axial hypotonia, abnormal eye movement, marked psychomotor retardation, peripheral neuropathy, cerebellar hypoplasia, stroke-like episodes, and retinitis pigmentosa in late infancy, childhood or adulthood.	600,25
PNPO	Pyridoxamine 5'-phosphate oxidase deficiency	NM_018129.3	NM_018129.3:c.674G>A, NM_018129.3:c.685C>T	Pyridoxamine 5'-phosphate oxidase (PNPO) deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PNPO gene located on chromosomal region 17q21.32. The age of onset is early. This disease is characterized by onset of severe seizures within hours of birth that are not responsive to anticonvulsants.	600
POLG	Mitochondrial DNA depletion syndrome 4A (Alpers type)	NM_001126131.1	NM_001126131.1:c.3644-1G>A, NM_001126131.1:c.3630dupC, NM_001126131.1:c.3286C>T, NM_001126131.1:c.3218C>T, NM_001126131.1:c.3151G>C, NM_001126131.1:c.2794C>T, NM_001126131.1:c.2617G>T, NM_001126131.1:c.2605C>T, NM_001126131.1:c.2591A>G, NM_001126131.1:c.2557C>T, NM_001126131.1:c.2542G>A, NM_001126131.1:c.2243G>C, NM_001126131.1:c.2209G>C, NM_001126131.1:c.1879C>T, NM_001126131.1:c.1760C>T, NM_001126131.1:c.1754G>A, NM_001126131.1:c.1437C>G, NM_001126131.1:c.1399G>A, NM_001126131.1:c.1120C>T, NM_001126131.1:c.911T>G, NM_001126131.1:c.752C>T	Mitochondrial DNA depletion syndrome, Alpers type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by the clinical triad of psychomotor regression, seizures, and liver disease. The prevalence is 1:1,600 newborn.	600,25
POMGNT1	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3	NM_001243766.1	NM_001243766.1:c.1864delC, NM_001243766.1:c.1814G>C, NM_001243766.1:c.1545delC, NM_001243766.1:c.1539+1G>T, NM_001243766.1:c.1539+1G>A, NM_001243766.1:c.1469G>A, NM_001243766.1:c.1425G>A, NM_001243766.1:c.1411A>T, NM_001243766.1:c.1274G>C, NM_001243766.1:c.932G>A, NM_001243766.1:c.931C>T, NM_001243766.1:c.880-1G>A, NM_001243766.1:c.652+1G>A, NM_001243766.1:c.636C>T, NM_001243766.1:c.187C>T, NM_001243766.1:c.92dupA	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3 which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMGNT1 gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent psychomotor development, eye involvement and seizures. The prevalence is 1-9:100,000.	600,25
POMT1	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1	NM_007171.3	NM_007171.3:c.193G>A, NM_007171.3:c.226G>A, NM_007171.3:c.598G>C, NM_007171.3:c.793C>T, NM_007171.3:c.831C>G, NM_007171.3:c.907C>T, NM_007171.3:c.1153C>T, NM_007171.3:c.1242-2A>G, NM_007171.3:c.1261dupC, NM_007171.3:c.1280_1281delAGinsTC, NM_007171.3:c.1540C>T, NM_007171.3:c.1545C>G, NM_007171.3:c.1746G>C, NM_007171.3:c.1770G>C, NM_007171.3:c.2005G>A, NM_007171.3:c.2163C>A, NM_007171.3:c.2167dupG	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 gene located on chromosomal region 9q34.13. Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies (type A), which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), is a genetically heterogeneous disorder with characteristic brain and eye malformations, profound mental retardation, congenital muscular dystrophy, and early death. The phenotype commonly includes cobblestone (type II) lissencephaly, cerebellar malformations, and retinal malformations.	600,25
POMT2	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2	NM_013382.5	NM_013382.5:c.2243G>C, NM_013382.5:c.2177G>A, NM_013382.5:c.1997A>G, NM_013382.5:c.1941G>A, NM_013382.5:c.1912C>T, NM_013382.5:c.1726-2A>G, NM_013382.5:c.1608_1609delCA, NM_013382.5:c.1445G>T, NM_013382.5:c.1417C>T, NM_013382.5:c.1057G>A, NM_013382.5:c.1045_1052delCGGATGGCinsG, NM_013382.5:c.551C>T	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT2 gene located on chromosomal region 14q24.3. Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies (type A), which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), is a genetically heterogeneous disorder with characteristic brain and eye malformations, profound mental retardation, congenital muscular dystrophy, and early death. The phenotype commonly includes cobblestone (type II) lissencephaly, cerebellar malformations, and retinal malformations.	600,25
POU1F1	Pituitary hormone deficiency, combined, type 1	NM_001122757.2	NM_001122757.2:c.826G>T, NM_001122757.2:c.793C>T, NM_001122757.2:c.766G>A, NM_001122757.2:c.655T>C, NM_001122757.2:c.593G>A, NM_001122757.2:c.592C>T, NM_001122757.2:c.550G>C, NM_001122757.2:c.511A>T, NM_001122757.2:c.506G>A, NM_001122757.2:c.482T>G, NM_001122757.2:c.469G>T, NM_001122757.2:c.71C>T	Pituitary hormone deficiency, combined, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POU1F1 gene located on chromosomal region 3p11.2. The age of onset is early. This disease is characterized by short stature, cognitive alterations or delayed puberty. The prevalence is 1:8,000.	600
POU3F4	Deafness, X-linked type 2 (DFNX2)	NM_000307.4	NM_000307.4:c.499C>T, NM_000307.4:c.604A>T	X-linked deafness type 2 (DFNX2, also known as DFN3) follows an X-linked pattern of inheritance and is caused by pathogenic variants in the POU3F4 gene located on chromosomal region Xq21.1. The age of onset is infantile. This disease is characterized by progressive conductive and sensorineural hearing loss and a pathognomonic temporal bone deformity that includes dilatation of the inner auditory canal and a fistulous connection between the internal auditory canal and the cochlear basal turn, resulting in a perilymphatic fluid 'gusher' during stapes surgery (summary by de Kok et al., 1995 and Song et al., 2010). Note: Choroideremia, deafness, and mental retardation (OMIM 303110), is caused by a contiguous gene deletion syndrome involving the POU3F4 and CHM genes on Xq21. This deletion is not detected by this CGT test.	600
PPT1	Ceroid lipofuscinosis, neuronal, type 1	NM_000310.3	NM_000310.3:c.840dupA, NM_000310.3:c.627+1G>T, NM_000310.3:c.541G>T, NM_000310.3:c.451C>T, NM_000310.3:c.223A>C, NM_000310.3:c.169dupA, NM_000310.3:c.29T>A	Neuronal ceroid lipofuscinoses, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PPT1 gene located on chromosomal region 1p32. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 1.5:1,000,000-9:1,000,000.	600,25
PRCD	Retinitis pigmentosa, type 36	NM_001077620.2	NM_001077620.2:c.52C>T, NM_001077620.2:c.64C>T	Retinitis pigmentosa, type 36 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRCD gene located on chromosomal region 17q25.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife.	600
PRKRA	Dystonia, type 16	NM_003690.4	NM_003690.4:c.665C>T	Dystonia, type 16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRKRA gene located on chromosomal region 2q31.2. The age of onset is early. This disease is characterized by progressive limb dystonia, laryngeal and oromandibular dystonia and parkinsonism.	600
PROM1	Retinitis pigmentosa, type 41	NM_006017.2	NM_006017.2:c.2490-2A>G, NM_006017.2:c.1841delG, NM_006017.2:c.1726C>T, NM_006017.2:c.1354dupT, NM_006017.2:c.1177_1178delAT, NM_006017.2:c.199C>T	Retinitis pigmentosa, type 41 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROM1 gene located on chromosomal region 4p15.32. The age of onset is early. This disease is characterized by night blindness often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 19:100,000-27:100,000.	600,25
PROP1	Pituitary hormone deficiency, combined, type 2	NM_006261.4	NM_006261.4:c.469dupT, NM_006261.4:c.358C>T, NM_006261.4:c.349T>A, NM_006261.4:c.310delC, NM_006261.4:c.301_302delAG, NM_006261.4:c.295C>T, NM_006261.4:c.263T>C, NM_006261.4:c.247C>T, NM_006261.4:c.218G>A, NM_006261.4:c.217C>T, NM_006261.4:c.157delA, NM_006261.4:c.150delA, NM_006261.4:c.112_124delTCGAGTGCTCCAC, NM_006261.4:c.4delG, NM_006261.4:c.2T>C	Pituitary hormone deficiency, combined, type 2, genetic forms follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROP1 gene located on chromosomal region 5q35.3. The age of onset is early. This disease is characterized by short stature, cognitive alterations or delayed puberty.	600
PRPS1	Deafness, X-linked 1 (DFNX1); Arts syndrome; PRPS1-related disorders	NM_002764.3	NM_002764.3:c.193G>A, NM_002764.3:c.344T>C, NM_002764.3:c.398A>C, NM_002764.3:c.869T>C, NM_002764.3:c.916G>A	The DFNX1 locus (PRPS1 gene) is associated with phenotypically heterogeneous non-syndromic hearing loss. In general, hearing impairment in male patients with PRPS1 mutations is bilateral, moderate to profound, and can be pre- or post-lingual, progressive or non-progressive. Female carriers may also be affected by unilateral or bilateral hearing impairment. Mutations in PRPS1 might also result in a spectrum of syndromic conditions, including PRS-I superactivity (OMIM #300661), Charcot-Marie Tooth neuropathy type X-5 (CMTX5 or Rosenberg-Chutorian syndrome, OMIM #311070) and Arts syndrome. Arts syndrome is an X-linked disorder characterized by mental retardation, early-onset hypotonia, ataxia, delayed motor development, hearing impairment, and optic atrophy (de Brouwer et al., 2007). In the Arts syndrome, susceptibility to infections, especially of the upper respiratory tract, can result in early death.	600
PRX	Charcot-Marie-Tooth disease, type 4F	NM_181882.2	NM_181882.2:c.3208C>T, NM_181882.2:c.2857C>T, NM_181882.2:c.2553_2556delTCTC, NM_181882.2:c.2145T>A, NM_181882.2:c.2098delG, NM_181882.2:c.1362delA, NM_181882.2:c.1102C>T, NM_181882.2:c.247delC	Charcot-Marie-Tooth disease, type 4F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRX gene located on chromosomal region 19q13.2. The age of onset is infantile. This disease is characterized by delayed motor milestones, and proximal and distal muscle weakness. The prevalence is <1:1,000,000.	600
PSAP	Combined SAP deficiency	NM_001042465.2	NM_001042465.2:c.1297C>T, NM_001042465.2:c.1055T>C, NM_001042465.2:c.643A>C, NM_001042465.2:c.607C>T	Combined saposin (SAP) deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PSAP gene located on chromosomal region 10q22.1. The age of onset is neonatal/infancy. This disease is characterized by hypotonia, massive myoclonic bursts, abnormal ocular movements and dystonia. Grand mal seizures and seizures triggered by tactile stimuli have been described. Patients also develop hepatosplenomegaly. Death between 1 and 4 months usually occurs from respiratory failure following repeated pulmonary infections. The prevalence is below 1/1,000,000.	600
PSAP	Combined SAP deficiency	NM_002778.3	NM_002778.3:c.1A>T	Combined saposin (SAP) deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PSAP gene located on chromosomal region 10q22.1. The age of onset is neonatal/infancy. This disease is characterized by hypotonia, massive myoclonic bursts, abnormal ocular movements and dystonia. Grand mal seizures and seizures triggered by tactile stimuli have been described. Patients also develop hepatosplenomegaly. Death between 1 and 4 months usually occurs from respiratory failure following repeated pulmonary infections. The prevalence is below 1/1,000,000.	600
PSAT1	Neu-Laxova syndrome, type 2	NM_058179.3	NM_058179.3:c.299A>C, NM_058179.3:c.1033_1034delCT	Neu-Laxova syndrome, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PSAT1 gene located on chromosomal region 9q21.2. The age of onset is prenatal. This disease is characterized by severe congenital malformations leading to prenatal or early postnatal lethality. Affected patients have abnormal craniofacial features, microcephaly, intrauterine growth retardation, ichthyosis, flexion deformities, limb malformations, and edema of the hands and feet. Some patients have malformations of the central nervous system. The prevalence is below 1/1,000,000.	600
PYGM	McArdle disease	NM_005609.3	NM_005609.3:c.2392T>C, NM_005609.3:c.2262delA, NM_005609.3:c.2128_2130delTTC, NM_005609.3:c.1963G>A, NM_005609.3:c.1827G>A, NM_005609.3:c.1768+1G>A, NM_005609.3:c.1726C>T, NM_005609.3:c.1722T>G, NM_005609.3:c.1628A>C, NM_005609.3:c.1621G>T, NM_005609.3:c.1466C>G, NM_005609.3:c.613G>A, NM_005609.3:c.501dupT, NM_005609.3:c.393delG, NM_005609.3:c.280C>T, NM_005609.3:c.255C>A, NM_005609.3:c.148C>T, NM_005609.3:c.13_14delCT, NM_005609.3:c.1A>G	McArdle disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PYGM gene located on chromosomal region 11q13.1. The age of onset is infantile. This disease is characterized by muscular exercise intolerance with myalgia, cramps, fatigue, and muscle weakness.	600,25
RAB23	Carpenter syndrome	NM_001278666.1	NM_001278666.1:c.434T>A, NM_001278666.1:c.407dupC	Carpenter syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB23 gene located on chromosomal region 6p11.2. The age of onset is early. This disease is characterized by acrocephaly, peculiar facies, brachydactyly and syndactyly in the hands, and preaxial polydactyly and syndactyly of the toes. The prevalence is <1:1,000,000.	600
RAB27A	Griscelli syndrome, type 2	NM_004580.4	NM_004580.4:c.454G>C, NM_004580.4:c.389T>C, NM_004580.4:c.382dupA, NM_004580.4:c.352C>T, NM_004580.4:c.259G>C, NM_004580.4:c.217T>G	Griscelli disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB27A gene located on chromosome 15q15-q21.1. The age of onset is infantile. This disease is characterized by immune system abnormalities in addition to having hypopigmented skin and hair. Affected individuals are prone to recurrent infections. They also develop an immune condition called hemophagocytic lymphohistiocytosis, in which the immune system produces too many activated immune cells called T-lymphocytes and macrophages (histiocytes).	600
RAB3GAP1	Warburg micro syndrome, type 1	NM_001172435.1	NM_001172435.1:c.497_498delTT, NM_001172435.1:c.748+1G>A, NM_001172435.1:c.899+1G>A, NM_001172435.1:c.937dupA, NM_001172435.1:c.1395_1398delTATG, NM_001172435.1:c.1410C>A, NM_001172435.1:c.1734G>A, NM_001172435.1:c.2011C>T	Warburg micro syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB3GAP1 gene located on chromosomal region 2q21.3. The age of onset is infantile. This disease is characterized by microcephaly, microphthalmia, microcornia, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. The prevalence is <1:1,000,000.	600
RAB3GAP2	Martsolf syndrome	NM_012414.3	NM_012414.3:c.1648C>T, NM_012414.3:c.1485C>A, NM_012414.3:c.1276C>T, NM_012414.3:c.325_328delAAAG	Warburg micro syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB3GAP2 gene located on chromosomal region 1q41. The age of onset is early. This disease is characterized by microcephaly, microphthalmia, microcornia, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. The prevalence is <1:1,000,000.	600
RAG1	Omenn syndrome; Severe combined immunodeficiency, B cell-negative	NM_000448.2	NM_000448.2:c.256_257delAA, NM_000448.2:c.940C>T, NM_000448.2:c.983G>A, NM_000448.2:c.1681C>T, NM_000448.2:c.1682G>A, NM_000448.2:c.2164G>A, NM_000448.2:c.2320G>T, NM_000448.2:c.2326C>T, NM_000448.2:c.2333G>A, NM_000448.2:c.2814T>G, NM_000448.2:c.2923C>T	Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. Severe combined immunodeficiency, autosomal recessive, T cell-negative (T-), B cell negative (B-), NK cell positive (NK+) is also caused by mutation in the RAG1 and RAG2 genes. This disease is characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development. Without treatment, patients usually die within the first year of life.	600,25
RAG2	Omenn syndrome; Severe combined immunodeficiency, B cell-negative	NM_000536.3	NM_000536.3:c.1352G>C, NM_000536.3:c.601C>T, NM_000536.3:c.283G>A, NM_000536.3:c.230C>A, NM_000536.3:c.115A>G	Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. Severe combined immunodeficiency, autosomal recessive, T cell-negative (T-), B cell negative (B-), NK cell positive (NK+) is also caused by mutation in the RAG1 and RAG2 genes. This disease is characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development. Without treatment, patients usually die within the first year of life.	600
RAPSN	Fetal akinesia deformation sequence	NM_005055.4	NM_005055.4:c.848T>C, NM_005055.4:c.807C>A, NM_005055.4:c.566C>T, NM_005055.4:c.490C>T, NM_005055.4:c.484G>A, NM_005055.4:c.416T>C, NM_005055.4:c.264C>A	Fetal akinesia deformation sequence follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by multiple joint contractures, facial anomalies and pulmonary hypoplasia. The prevalence is 1:3,000.	600,25
RAX	Isolated microphthalmia, type 3	NM_013435.2	NM_013435.2:c.909C>G, NM_013435.2:c.439C>T, NM_013435.2:c.383_384delAG, NM_013435.2:c.18C>A	Isolated microphthalmia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAX gene located on chromosomal region 18q21.32. Microphthalmia designates a heterogeneous group of ocular malformations with a more or less evident reduction in the size of the eyeball. Additional features include high hypermetropia and a short axial length.	600,25
RDH12	Leber congenital amaurosis, type 13	NM_152443.2	NM_152443.2:c.146C>T, NM_152443.2:c.152T>A, NM_152443.2:c.184C>T, NM_152443.2:c.210dupC, NM_152443.2:c.295C>A, NM_152443.2:c.377C>T, NM_152443.2:c.379G>T, NM_152443.2:c.451C>A, NM_152443.2:c.451C>G, NM_152443.2:c.464C>T, NM_152443.2:c.523T>C, NM_152443.2:c.565C>T, NM_152443.2:c.677A>G, NM_152443.2:c.806_810delCCCTG	Leber congenital amaurosis type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDH12 gene located on chromosomal region 14q24.1. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.	600,25
RDX	Deafness, autosomal recessive, type 24	NM_001260492.1	NM_001260492.1:c.1405dupG, NM_001260492.1:c.342_346delGATAT	Autosomal recessive nonsyndromic sensorineural deafness type DFNB24 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDX gene located on chromosomal region 11q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	600
RELN	Lissencephaly 2 (Norman-Roberts type)	NM_005045.3	NM_005045.3:c.6646C>T, NM_005045.3:c.5615-1G>A	Lissencephaly syndrome 2, Norman-Roberts type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RELN gene located on chromosomal region 7q22. The age of onset is early. This disease is characterized by craniofacial anomalies (severe microcephaly, a low sloping forehead, a broad and prominent nasal bridge and widely set eyes) and postnatal growth retardation, severe intellectual deficit, spasticity and epilepsy. The prevalence is 1:1,000,000-9:1,000,000.	600
REN	Renal tubular dysgenesis	NM_000537.3	NM_000537.3:c.404C>A, NM_000537.3:c.145C>T, NM_000537.3:c.127C>T	Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in REN gene located on chromosomal region 1q32.1. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.	600
RGR	Retinitis pigmentosa, type 44	NM_002921.3	NM_002921.3:c.262_269dupGGCTCGGA, NM_002921.3:c.273_274insGGCTCGGA, NM_002921.3:c.877C>T	Retinitis pigmentosa type 44 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RGR gene located on chromosomal region 10q23.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	600,25
RHO	Retinitis pigmentosa, type 4, autosomal recessive	NM_000539.3	NM_000539.3:c.173C>T, NM_000539.3:c.448G>A, NM_000539.3:c.620T>G, NM_000539.3:c.745G>T	Retinitis pigmentosa type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RHO gene located on chromosomal region 3q22.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	600,25
RLBP1	Bothnia retinal dystrophy	NM_000326.4	NM_000326.4:c.700C>T, NM_000326.4:c.452G>A, NM_000326.4:c.333T>G	Bothnia retinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RLBP1 gene located on chromosomal region 15q26.1. This disease is characterized by night blindness from early childhood with features consistent with retinitis punctata albescens and macular degeneration. The prevalence is unknown.	600,25
RP2	Retinitis pigmentosa, type 2, X-linked	NM_006915.2	NM_006915.2:c.235delG, NM_006915.2:c.305dupT, NM_006915.2:c.352delC, NM_006915.2:c.353G>A, NM_006915.2:c.353G>T, NM_006915.2:c.358C>T, NM_006915.2:c.453delC, NM_006915.2:c.453C>G, NM_006915.2:c.631delC	Retinitis pigmentosa type 2 (RP2) follows an X-linked (XLRP) pattern of inheritance and is caused by pathogenic variants in the RP2 gene located on chromosomal region Xp11.23. The age of onset is variable. This condition primarily affects males, causing night blindness in early childhood followed by progressive daytime vision loss. RP2 gene mutations account for 10 to 15 percent of all cases of X-linked retinitis pigmentosa. A gradual loss of photoreceptors underlies the progressive vision loss characteristic of retinitis pigmentosa (RP). The prevalence of RP2 is 1:3,500.	600
RPE65	Leber congenital amaurosis, type 2	NM_000329.2	NM_000329.2:c.1543C>T, NM_000329.2:c.1355T>G, NM_000329.2:c.1292A>G, NM_000329.2:c.1102T>C, NM_000329.2:c.1087C>A, NM_000329.2:c.1067delA, NM_000329.2:c.1022T>C, NM_000329.2:c.907A>T, NM_000329.2:c.514_515delGT, NM_000329.2:c.271C>T	Leber congenital amaurosis 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus.	600,25
RPGR	Retinitis pigmentosa, type 3, X-linked	NM_001034853.1	NM_001034853.1:c.846_847delAA, NM_001034853.1:c.823G>A, NM_001034853.1:c.806G>A, NM_001034853.1:c.703C>T, NM_001034853.1:c.674_675delCC, NM_001034853.1:c.654_655delGA, NM_001034853.1:c.642_656delTGGAGAACCTGAGAAinsC, NM_001034853.1:c.517G>C, NM_001034853.1:c.505G>T, NM_001034853.1:c.389T>G, NM_001034853.1:c.296C>A, NM_001034853.1:c.179G>T, NM_001034853.1:c.173_174insA, NM_001034853.1:c.155-2A>G	Retinitis pigmentosa type 3 (RP3) follows an X-linked (XLRP) pattern of inheritance and is caused by pathogenic variants in the RPGR gene located on chromosomal region Xp11.4. XLRP are severe forms of inherited retinal degeneration that primarily affects the rod photoreceptors (Demirci et al., 2002). It typically causes an early-onset night blindness and loss of peripheral vision, often causing patients to become legally blind by the age of 30 to 40 years. Mutation in the RPGR gene is believed to account for approximately 70% of XLRP (RP3)(Vervoort et al., 2000). In RP3, affected males have a severe phenotype, and carrier females show a wide spectrum of clinical features ranging from completely asymptomatic to severe RP (Jin et al., 2007). Mutations in the RPGR gene can also cause X-linked cone-rod dystrophy (CORDX1; 304020) and a syndromic form of retinitis pigmentosa (RP) with deafness and sinorespiratory infections (300455). Cone-rod dystrophy is a group of related [to RP] eye disorders that causes vision loss, which becomes more severe over time. These disorders affect the retina, which is the layer of light-sensitive tissue at the back of the eye. In people with cone-rod dystrophy, vision loss occurs as the light-sensing cells of the retina gradually deteriorate. X-linked cone-rod dystrophy is a rare, progressive visual disorder primarily affecting cone photoreceptors (Demirci et al., 2002). Affected individuals, essentially all of whom are males, present with decreased visual acuity, myopia, photophobia, abnormal color vision, full peripheral visual fields, decreased photopic electroretinographic responses, and granularity of the macular retinal pigment epithelium. The degree of rod photoreceptor involvement is variable, with increasing degeneration. Although penetrance appears to be nearly 100%, there is variable expressivity with respect to age at onset, severity of symptoms, and findings (Hong et al., 1994).	600
RPGRIP1L	Joubert syndrome, type 7; Meckel syndrome, type 5; COACH syndrome	NM_015272.4	NM_015272.4:c.3634_3637delGAAA, NM_015272.4:c.2794_2795delTT, NM_015272.4:c.2614C>T, NM_015272.4:c.2413C>T, NM_015272.4:c.2050C>T, NM_015272.4:c.1975T>C, NM_015272.4:c.1843A>C, NM_015272.4:c.1329dupA, NM_015272.4:c.1326_1329delAAAA, NM_015272.4:c.776+1G>A, NM_015272.4:c.757C>T, NM_015272.4:c.697A>T, NM_015272.4:c.394A>T	Joubert syndrome (JBTS) type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. JBTS is characterized by congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (less common in JBTS7) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. RPGRIP1L gene is also associated with Meckel syndrome type 5, a rare, autosomal recessive lethal condition characterized by central nervous system malformations, postaxial, polydactyly, multicystic kidney dysplasia, and ductal proliferation in the portal area of the liver. Other phenotype associated is COACH syndrome, an autosomal recessive disorder characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable. COACH syndrome is considered by some to be a subtype of Joubert syndrome with congenital hepatic fibrosis.	600,25
RYR1	Minicore myopathy with external ophthalmoplegia	NM_000540.2	NM_000540.2:c.325C>T, NM_000540.2:c.487C>T, NM_000540.2:c.631+2T>C, NM_000540.2:c.738T>G, NM_000540.2:c.1021G>A, NM_000540.2:c.1186G>T, NM_000540.2:c.1205T>C, NM_000540.2:c.1739_1742dupATCA, NM_000540.2:c.1841G>T, NM_000540.2:c.4076delG, NM_000540.2:c.4405C>T, NM_000540.2:c.5333C>A, NM_000540.2:c.5726_5727delAG, NM_000540.2:c.6082C>T, NM_000540.2:c.6104A>T, NM_000540.2:c.6721C>T, NM_000540.2:c.7268T>A, NM_000540.2:c.7300G>A, NM_000540.2:c.7360C>T, NM_000540.2:c.7373G>A, NM_000540.2:c.7463_7475delCAAAGATGTCAGC, NM_000540.2:c.7781C>A, NM_000540.2:c.7836-1G>A, NM_000540.2:c.9000+1G>T, NM_000540.2:c.9905dupC, NM_000540.2:c.10343C>T, NM_000540.2:c.10579C>T, NM_000540.2:c.13480G>T, NM_000540.2:c.14126C>T, NM_000540.2:c.14365-2A>T, NM_000540.2:c.14545G>A	Multiminicore disease (MMD) is an inherited neuromuscular disorder defined pathologically by the presence of multiple areas of reduced mitochondrial oxidative activity running along a limited extent of the longitudinal axis of the muscle fiber, so-called 'minicores.' These regions show sarcomere disorganization and mitochondria depletion. Typically, no dystrophic signs, such as muscle fiber necrosis or regeneration or significant endomysial fibrosis, are present. MMD is a pathologic diagnosis and shows clinical and genetic heterogeneity. Affected individuals have clinical features of a congenital myopathy, including neonatal hypotonia, delayed motor development, and generalized muscle weakness and amyotrophy, which may progress slowly or remain stable (Ferreiro and Fardeau, 2002).Patients with recessive mutations in the RYR1 gene typically show severe congenital muscular dystrophy with ophthalmoplegia, although there is phenotypic variability. Some patients may present in utero with fetal akinesia, arthrogryposis, and lung hypoplasia resulting in fetal or perinatal death (McKie et al., 2014). Skeletal muscle biopsy of patients with recessive RYR1 mutations show variable features, including central cores (Jungbluth et al., 2007), congenital fiber-type disproportion (CFTD) (Monnier et al., 2009), and centronuclear myopathy (Wilmshurst et al., 2010).	600,25
SACS	Spastic ataxia, Charlevoix-Saguenay, type	NM_014363.5	NM_014363.5:c.13237C>T, NM_014363.5:c.12160C>T, NM_014363.5:c.8844delT, NM_014363.5:c.7504C>T, NM_014363.5:c.6563T>A, NM_014363.5:c.6355C>T, NM_014363.5:c.5618_5619delAT, NM_014363.5:c.4933C>T, NM_014363.5:c.3198T>A, NM_014363.5:c.994A>T, NM_014363.5:c.517C>T	Spastic ataxia, Charlevoix-Saguenay type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SACS gene located on chromosomal region 13q11. The age of onset is early. This disease is characterized by early-onset cerebellar ataxia with spasticity, a pyramidal syndrome and peripheral neuropathy. The prevalence is 1:1,500-1:2,000.	600,25
SAG	Oguchi disease, type 1	NM_000541.4	NM_000541.4:c.298dupG, NM_000541.4:c.523C>T, NM_000541.4:c.577C>T, NM_000541.4:c.874C>T, NM_000541.4:c.916G>T, NM_000541.4:c.926delA, NM_000541.4:c.993C>G	Oguchi disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SAG gene located on chromosomal region 2q37. The age of onset is infantile. This disease is characterized by congenital stationary night blindness and the Mizuo-Nakamura phenomenon which is a unique morphological and functional abnormality of the retina that presents with a typical golden-yellow or silver-gray discoloration of the fundus in the presence of light that disappears after dark-adaptation and appears again after the onset of light.	600,25
SBDS	Shwachman-Diamond syndrome	NM_016038.2	NM_016038.2:c.377G>C, NM_016038.2:c.258+2T>C, NM_016038.2:c.184A>T, NM_016038.2:c.183_184delTAinsCT, NM_016038.2:c.120delG	Shwachman-Diamond syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBDS gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by chronic and usually mild neutropenia, pancreatic exocrine insufficiency associated with steatorrhea and growth failure, skeletal dysplasia with short stature, and an increased risk of bone marrow aplasia or leukemic transformation, cutaneous (eczema or ichthyosis) and dental anomalies, and psychomotor retardation. The prevalence is 1:76,000 newborn.	600,25
SBF2	Charcot-Marie-Tooth disease, type 4B2	NM_030962.3	NM_030962.3:c.5536_5539dupATCT, NM_030962.3:c.3586C>T, NM_030962.3:c.3154A>T, NM_030962.3:c.2875C>T, NM_030962.3:c.1459C>T	Charcot-Marie-Tooth disease, type 4B2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBF2 gene located on chromosomal region 11p15.4. The age of onset is infantile. This disease is characterized by muscle weakness, sensory loss, reduced nerve conduction velocities, characteristic myelin outfoldings and a severe disease course.	600
SC5D	Lathosterolosis	NM_001024956.2	NM_001024956.2:c.86G>A	Lathosterolosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SC5D gene located on chromosomal region 11q23.3. The age of onset is early. This disease is characterized by malformations, intellectual deficit and liver disease. The prevalence is <1:1,000,000.	600
SCNN1A	Pseudohypoaldosteronism, type 1	NM_001159576.1	NM_001159576.1:c.1942C>T, NM_001159576.1:c.1699C>T, NM_001159576.1:c.1659delC, NM_001159576.1:c.1482delC, NM_001159576.1:c.517G>A, NM_001159576.1:c.380_381delTC	Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.	600
SCNN1B	Pseudohypoaldosteronism, type 1	NM_000336.2	NM_000336.2:c.109G>A	Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.	600,25
SCNN1G	Pseudohypoaldosteronism, type 1	NM_001039.3	NM_001039.3:c.600dupA, NM_001039.3:c.1373+2T>C, NM_001039.3:c.1570-1G>A, NM_001039.3:c.1627delG	Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.	600,25
SELENON	Muscular dystrophy, rigid spine, type 1	NM_020451.2	NM_020451.2:c.713dupA, NM_020451.2:c.818G>A, NM_020451.2:c.943G>A, NM_020451.2:c.1315C>T, NM_020451.2:c.1384T>G	Rigid spine syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SELENON gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is characterized by contractures of the spinal extensor muscles associated with abnormal posture (limitation of neck and trunk flexure), progressive scoliosis of the spine, early marked cervico-axial muscle weakness with relatively preserved strength and function of the extremities and progressive respiratory insufficiency. The prevalence is 3.5:100,000ﾖ5:100,000.	600
SEMA4A	Cone-rod dystrophy, type 10; Retinitis pigmentosa, type 35	NM_001193300.1	NM_001193300.1:c.1033G>C, NM_001193300.1:c.1049T>G	Cone-rod dystrophy, type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SEMA4A gene located on chromosomal region 1q22. The age of onset is childhood/adolescent. This disease is characterized by retinal pigment deposits visible on fundus examination, predominantly in the macular region, and initial loss of cone photoreceptors followed by rod degeneration. This leads to decreased visual acuity and sensitivity in the central visual field, followed by loss of peripheral vision. Severe loss of vision occurs earlier than in retinitis pigmentosa, due to cone photoreceptors degenerating at a higher rate than rod photoreceptors. The prevalence is 1-9/100,000. Retinitis pigmentosa-35 (RP35) can be caused by compound heterozygous mutation in the SEMA4A gene. RP35 is characterized by retinal pigment deposits and primary loss of rod photoreceptor cells followed by secondary loss of cone photoreceptors. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well.	600
SETX	Spinocerebellar ataxia, autosomal recessive, type 1	NM_015046.5	NM_015046.5:c.6848_6851delCAGA, NM_015046.5:c.6834_6839delAACAAA, NM_015046.5:c.5927T>G, NM_015046.5:c.5630delG, NM_015046.5:c.5549-1G>T, NM_015046.5:c.5308_5311delGAGA, NM_015046.5:c.4087C>T, NM_015046.5:c.2602C>T, NM_015046.5:c.1166T>C, NM_015046.5:c.1027G>T, NM_015046.5:c.994C>T	Spinocerebellar ataxia with axonal neuropathy type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SETX gene located on chromosomal region 9q34.13. The age of onset is infantile. This disease is characterized by progressive cerebellar ataxia, axonal sensorimotor neuropathy with oculomotor apraxia, fixation instability, extrapyramidal features and an elevated serum alpha-fetoprotein level. The prevalence is 4:100,000-8:100,000.	600,25
SGCA	Muscular dystrophy, limb-girdle, type 2D	NM_000023.3	NM_000023.3:c.101G>A, NM_000023.3:c.229C>T, NM_000023.3:c.371T>C, NM_000023.3:c.518T>C, NM_000023.3:c.574C>T, NM_000023.3:c.739G>A, NM_000023.3:c.850C>T, NM_000023.3:c.903_904dupCC	Autosomal recessive limb-girdle muscular dystrophy type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCA gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness and calf pseudohypertrophy. The prevalence is 1:1,000,000-9:1,000,000.	600,25
SGCB	Muscular dystrophy, limb-girdle, type 2E	NM_000232.4	NM_000232.4:c.552T>G, NM_000232.4:c.452C>G, NM_000232.4:c.341C>T, NM_000232.4:c.323T>G, NM_000232.4:c.299T>A, NM_000232.4:c.272G>T, NM_000232.4:c.272G>C	Autosomal recessive limb-girdle muscular dystrophy type 2E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCB gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness, particularly of the pelvic girdle muscles.	600
SGCG	Muscular dystrophy, limb-girdle, type 2C	NM_000231.2	NM_000231.2:c.89delG, NM_000231.2:c.195+4_195+7delAGTA, NM_000231.2:c.505+1G>A, NM_000231.2:c.525delT, NM_000231.2:c.787G>A, NM_000231.2:c.848G>A	Autosomal recessive limb-girdle muscular dystrophy type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCG gene located on chromosomal region 13q12.12. The age of onset is variable. This disease is characterized by limb-girdle weakness, calf hypertrophy, diaphragmatic weakness, and variable cardiac abnormalities.	600,25
SGSH	Mucopolysaccharidosis, type 3A (Sanfilippo A)	NM_000199.3	NM_000199.3:c.1380delT, NM_000199.3:c.1339G>A, NM_000199.3:c.1298G>A, NM_000199.3:c.1167C>A, NM_000199.3:c.892T>C, NM_000199.3:c.877C>T, NM_000199.3:c.757delG, NM_000199.3:c.617G>C, NM_000199.3:c.466A>T, NM_000199.3:c.449G>A, NM_000199.3:c.383C>T, NM_000199.3:c.364G>A, NM_000199.3:c.337_345delCAAGCTGGTinsGCACAGGTGAG, NM_000199.3:c.320delT, NM_000199.3:c.235A>C, NM_000199.3:c.220C>T, NM_000199.3:c.197C>G, NM_000199.3:c.130G>A	Mucopolysaccharidosis type 3A (Sanfilippo syndrome type A) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGSH gene located on chromosomal region 17q25.3. The age of onset is infantile. This disease is characterized by behavioural disorders (hyperkinesia, aggressiveness) and intellectual deterioration, sleep disorders and very mild dysmorphism. The prevalence is >1:70,000 newborn.	600,25
SH2D1A	Lymphoproliferative syndrome, X-linked, type 1	NM_002351.4	NM_002351.4:c.3G>T, NM_002351.4:c.95G>C, NM_002351.4:c.163C>T, NM_002351.4:c.164G>T, NM_002351.4:c.172C>T, NM_002351.4:c.203C>T, NM_002351.4:c.302C>T	X-linked lymphoproliferative disease type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the SH2D1A gene located on chromosomal region Xq25. The age of onset is infantile. This disease is characterized by an inadequate immune response to infection with the Epstein-Barr virus: fulminant infectious mononucleosis, macrophage-activation syndrome or hemophagocytic lymphohistiocytosis (HLH) (see these terms), and/or progressive hypogammaglobulinemia and/or lymphomas. The prevalence is 1:1, 000,000 men.	600
SH3TC2	Charcot-Marie-Tooth disease, type 4C	NM_024577.3	NM_024577.3:c.3676-1G>A, NM_024577.3:c.3601C>T, NM_024577.3:c.3341delC, NM_024577.3:c.3326G>C, NM_024577.3:c.3325C>T, NM_024577.3:c.2993_2994insC, NM_024577.3:c.2860C>T, NM_024577.3:c.2829T>G, NM_024577.3:c.2710C>T, NM_024577.3:c.2491_2492delAG, NM_024577.3:c.2191delG, NM_024577.3:c.1982T>C, NM_024577.3:c.1972C>T, NM_024577.3:c.1969G>A, NM_024577.3:c.1747_1748delAG, NM_024577.3:c.1724T>A, NM_024577.3:c.1586G>A, NM_024577.3:c.920G>A, NM_024577.3:c.735G>A, NM_024577.3:c.530-2A>G, NM_024577.3:c.217_227delGCTGCTCGGAGinsCCAGTAA, NM_024577.3:c.53-1G>C, NM_024577.3:c.52+1delG, NM_024577.3:c.28delG	Charcot-Marie-Tooth disease, type 4C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SH3TC2 gene located on chromosomal region 5q32. The age of onset is infantile. This disease is characterized by scoliosis or kyphoscoliosis, neuropathy, foot deformities, respiratory insufficiency, hypoacousis and deafness.	600,25
SIL1	Marinesco-Sjogren syndrome	NM_001037633.1	NM_001037633.1:c.1312C>T, NM_001037633.1:c.331C>T	Marinesco-Sj�gren syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SIL1 gene located on chromosomal region 5q31.2. The age of onset is infantile. This disease is characterized by dysarthria, nystagmus, muscle weakness and hypotonia. The prevalence is <1:1,000,000.	600
SIX6	Optic disc anomalies with retinal and/or macular dystrophy	NM_007374.2	NM_007374.2:c.532_536delAACCG	Optic disc anomalies with retinal and/or macular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SIX6 gene located on chromosomal region 14q23.1. The age of onset is neonatal. This disease is characterized by optic nerve dysplasia, optic disk anomalies, chorioretinal dystrophy and macular atrophy. Some patients have microphthalmia. The prevalence is <1/1,000,000.	600
SLC12A1	Bartter syndrome, type 1	NM_000338.2	NM_000338.2:c.223C>T, NM_000338.2:c.628+2T>C, NM_000338.2:c.814G>T, NM_000338.2:c.1875G>A, NM_000338.2:c.1942G>A, NM_000338.2:c.2805dupA, NM_000338.2:c.2952_2955delCAAA	Bartter syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A1 gene located on chromosomal region 15q15-21. The age of onset is infantile. This disease is characterized by polyhydramnios, premature delivery, polyuria, dehydration, hypercalciuria and nephrocalcinosis. The prevalence is 1:1,000,000.	600,25
SLC12A6	Agenesis of the corpus callosum with peripheral neuropathy	NM_133647.1	NM_133647.1:c.3031C>T, NM_133647.1:c.2023C>T, NM_133647.1:c.1584_1585delCTinsG, NM_133647.1:c.619C>T, NM_133647.1:c.366T>G, NM_133647.1:c.316+1G>A	Corpus callosum agenesis with neuronopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A6 gene located on chromosomal region 15q13-q14. The age of onset is early. This disease is characterized by a delay in developmental milestones, a severe sensory-motor polyneuropathy with areflexia, a variable degree of agenesis of the corpus callosum, amyotrophy, hypotonia, and cognitive impairment. The prevalence is 1:2,117.	600
SLC17A5	Salla disease	NM_012434.4	NM_012434.4:c.1259+1G>A, NM_012434.4:c.406A>G, NM_012434.4:c.115C>T, NM_012434.4:c.43G>T	Salla disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC17A5 gene located on chromosomal region 6q13. The age of onset is from infantile to adult forms. The main symptoms are hypotonia, cerebellar ataxia, and mental retardation; visceromegaly and coarse features are also present in the infantile cases.	600,25
SLC25A13	Citrullinemia, adult-onset, type 2	NM_001160210.1	NM_001160210.1:c.1816C>T, NM_001160210.1:c.1804G>T, NM_001160210.1:c.1804G>A, NM_001160210.1:c.1802dupA, NM_001160210.1:c.1595G>A, NM_001160210.1:c.1414_1415delCT, NM_001160210.1:c.1314+1G>A, NM_001160210.1:c.1234-1G>A, NM_001160210.1:c.1180+1G>A, NM_001160210.1:c.1081C>T, NM_001160210.1:c.852_855delTATG, NM_001160210.1:c.674C>A, NM_001160210.1:c.615+5G>A, NM_001160210.1:c.615+1G>C	Citrullinemia, adult-onset, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A13 gene located on chromosomal region 7q21.3. This disease is characterized by hyperammonemia and associated neuropsychiatric symptoms such as nocturnal delirium, confusion, restlessness, disorientation, drowsiness, memory loss, abnormal behavior (aggression, irritability, and hyperactivity), seizures, and coma. The prevalence is 1:17,000-1:230,000.	600
SLC25A15	Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome	NM_014252.3	NM_014252.3:c.110T>G, NM_014252.3:c.212T>A, NM_014252.3:c.535C>T, NM_014252.3:c.538G>A, NM_014252.3:c.562_564delTTC, NM_014252.3:c.569G>A, NM_014252.3:c.658G>A, NM_014252.3:c.815C>T, NM_014252.3:c.824G>A	Hyperornithinemia-hyperammonemia-homocitrullinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A15 gene located on chromosomal region 13q14.11. The age of onset is early. This disease is characterized by coma due to hyperammonemia, convulsions, and hypotonia. The prevalence is 1:5,500.	600
SLC25A22	Epileptic encephalopathy, early infantile, type 3	NM_001191060.1	NM_001191060.1:c.706G>T, NM_001191060.1:c.617C>T	Early infantile epileptic encephalopathy, type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A22 gene located on chromosomal region 11p15.5. The age of onset is early. This disease is characterized by the onset of tonic spasms within the first 3 months of life leading to psychomotor impairment and death. The prevalence is <1:1,000,000.	600
SLC26A2	Achondrogenesis, type 1B (diastrophic dysplasia)	NM_000112.3	NM_000112.3:c.496G>A, NM_000112.3:c.532C>T, NM_000112.3:c.833delC, NM_000112.3:c.835C>T, NM_000112.3:c.1020_1022delTGT, NM_000112.3:c.1273A>G, NM_000112.3:c.1361A>C, NM_000112.3:c.1535C>A, NM_000112.3:c.1724delA, NM_000112.3:c.1878delG, NM_000112.3:c.1957T>A, NM_000112.3:c.2033G>T	Achondrogenesis type 1B (diastrophic dysplasia) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by severe micromelia with very short fingers and toes, a flat face, a short neck, thickened soft tissue around the neck, hypoplasia of the thorax, protuberant abdomen, a hydropic fetal appearance and distinctive histological features of the cartilage. The prevalence is 1:20,000.	600,25
SLC26A4	Deafness, autosomal recessive, type 4	NM_000441.1	NM_000441.1:c.269C>T, NM_000441.1:c.281C>T, NM_000441.1:c.412G>T, NM_000441.1:c.554G>C, NM_000441.1:c.563T>C, NM_000441.1:c.626G>T, NM_000441.1:c.707T>C, NM_000441.1:c.916dupG, NM_000441.1:c.918+2T>C, NM_000441.1:c.919-2A>G, NM_000441.1:c.961A>T, NM_000441.1:c.1001G>T, NM_000441.1:c.1001+1G>T, NM_000441.1:c.1003T>C, NM_000441.1:c.1034T>A, NM_000441.1:c.1151A>G, NM_000441.1:c.1174A>T, NM_000441.1:c.1198delT, NM_000441.1:c.1226G>A, NM_000441.1:c.1229C>T, NM_000441.1:c.1246A>C, NM_000441.1:c.1263+1G>A, NM_000441.1:c.1334T>G, NM_000441.1:c.1489G>A, NM_000441.1:c.1707+5G>A, NM_000441.1:c.1975G>C, NM_000441.1:c.2048T>C, NM_000441.1:c.2162C>T, NM_000441.1:c.2168A>G	Autosomal recessive nonsyndromic sensorineural deafness type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	600,25
SLC35A1	Congenital disorder of glycosylation, type 2f	NM_006416.4	NM_006416.4:c.277_280delGTGCinsTG	Congenital disorder of glycosylation type 2F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35A1 gene located on chromosomal region 6q15. The age of onset is early. This disease is characterized by repeated hemorrhagic incidents, including severe pulmonary hemorrhage.	600
SLC35C1	Congenital disorder of glycosylation, type 2c	NM_018389.4	NM_018389.4:c.91G>T, NM_018389.4:c.290dupG, NM_018389.4:c.439C>T, NM_018389.4:c.503_505delTCT, NM_018389.4:c.923C>G	Congenital disorder of glycosylation type 2c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35C1 gene located on chromosomal region 11p11.2. The age of onset is infantile. This disease is characterized by recurrent bacterial infections, severe growth delay and severe intellectual deficit.	600
SLC35D1	Schneckenbecken dysplasia	NM_015139.2	NM_015139.2:c.932G>A, NM_015139.2:c.319C>T	Schneckenbecken dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35D1 gene located on chromosomal region 1p31.3. The age of onset is fetal. This disease is characterized by nail-like configuration of the hypoplastic iliac bone, flattened hypoplastic vertebral bodies, short ribs, short and wide fibulae, short and broad long bones with a dumbbell-like appearance, and precocious ossification of the tarsus.	600
SLC37A4	Glycogen storage disease, type 1b	NM_001164278.1	NM_001164278.1:c.1309C>T, NM_001164278.1:c.1190-2_1190-1delAG, NM_001164278.1:c.1129G>T, NM_001164278.1:c.1108_1109delCT, NM_001164278.1:c.1082G>A, NM_001164278.1:c.1081G>T, NM_001164278.1:c.706_708delGTG, NM_001164278.1:c.352T>C, NM_001164278.1:c.287G>A, NM_001164278.1:c.83G>A	Glycogen storage disease due to glucose-6-phosphatase deficiency type 1b follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC37A4 gene located on chromosomal region 11q23. The age of onset is early. This disease is characterized by impairment of terminal steps of glycogenolysis and gluconeogenesis. Patients manifest a wide range of clinical symptoms and biochemical abnormalities, including hypoglycemia, severe hepatomegaly due to excessive accumulation of glycogen, kidney enlargement, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. Glycogen storage disease type 1B patients also present a tendency towards infections associated with neutropenia, relapsing aphthous gingivostomatitis, and inflammatory bowel disease. The incidence is 1:100,000.	600,25
SLC45A2	Albinism, oculocutaneous, type 4	NM_016180.4	NM_016180.4:c.1121delT, NM_016180.4:c.986delC, NM_016180.4:c.469G>A	Oculocutaneous albinism type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC45A2 gene located on chromosomal region 5p13.2. The age of onset is early. This disease is characterized by skin and hair hypopigmentation, numerous ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1:100.000.	600
SLC4A11	Corneal endothelial dystrophy, autosomal recessive	NM_001174090.1	NM_001174090.1:c.2687G>A, NM_001174090.1:c.2686C>T, NM_001174090.1:c.2647A>G, NM_001174090.1:c.2609T>C, NM_001174090.1:c.2345G>A, NM_001174090.1:c.2314_2321dupTATGACAC, NM_001174090.1:c.2305G>A, NM_001174090.1:c.1894C>T, NM_001174090.1:c.1547C>T, NM_001174090.1:c.1544G>A, NM_001174090.1:c.1472G>A, NM_001174090.1:c.1119_1120insA, NM_001174090.1:c.718T>C, NM_001174090.1:c.554_561delGCTTCGCC	Congenital hereditary endothelial dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by a diffuse ground-glass appearance of the corneas and marked corneal thickening from birth with nystagmus, and blurred vision.	600,25
SLC6A8	Cerebral creatine deficiency syndrome, type 1	NM_005629.3	NM_005629.3:c.321_323delCTT, NM_005629.3:c.395G>T, NM_005629.3:c.1011C>G, NM_005629.3:c.1141G>C, NM_005629.3:c.1222_1224delTTC, NM_005629.3:c.1540C>T	Cerebral creatine deficiency syndrome type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the SLC6A8 gene located on chromosomal region Xq28. The age of onset is infantile. People with this disorder have intellectual disability, which can range from mild to severe, and delayed speech development. Some affected individuals develop behavioral disorders such as attention deficit hyperactivity disorder or autistic behaviors that affect communication and social interaction. They may also experience seizures. The disorder has been estimated to account for between 1 and 2 percent of males with intellectual disability. Carrier females may show mild neuropsychologic impairment (summary by van de Kamp et al., 2011). The prevalence is 11:1,000.	600
SMN1	Spinal muscular atrophy	-0	del ex7, del ex7-8	Spinal muscular atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMN1 gene located on chromosomal region 5q13.2. The age of onset is variable. This disease comprise a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. Autosomal recessive forms are classified according to the age of onset, the maximum muscular activity achieved, and survivorship. The severity of the disease is mainly determined by the copy number of SMN2, a copy gene which predominantly produces exon 7-skipped transcripts and only low amount of full-length transcripts that encode for a protein identical to SMN1. Only about 4% of patients bear one SMN1 copy with an intragenic mutation. Type 1 is a severe form, with onset before 6 months of age. Patients never achieve the ability to sit. Type 2 has intermediate severity, with onset between 6 and 18 months. Patients do not reach the motor milestone of standing, and survive into adulthood. Type 3 onset is after 18 months. Patients develop ability to stand and walk and survive into adulthood. Type 4 onset is in adulthood, disease progression is slow, and patients can stand and walk. The incidence is 1:10,000 and the prevalence is 1:80,000.	600,25
SMPD1	Niemann-Pick disease, type A and type B	NM_000543.4	NM_000543.4:c.96G>A, NM_000543.4:c.103_107delCTGGT, NM_000543.4:c.106delG, NM_000543.4:c.354delC, NM_000543.4:c.475T>C, NM_000543.4:c.557C>T, NM_000543.4:c.564delC, NM_000543.4:c.564dupC, NM_000543.4:c.573delT, NM_000543.4:c.688C>T, NM_000543.4:c.730G>A, NM_000543.4:c.740delG, NM_000543.4:c.739G>A, NM_000543.4:c.742G>A, NM_000543.4:c.757G>C, NM_000543.4:c.788T>A, NM_000543.4:c.842_849dupTCCCCGCA, NM_000543.4:c.911T>C, NM_000543.4:c.996delC, NM_000543.4:c.1092-1G>C, NM_000543.4:c.1117C>T, NM_000543.4:c.1152G>A, NM_000543.4:c.1264-1G>T, NM_000543.4:c.1267C>T, NM_000543.4:c.1299T>G, NM_000543.4:c.1327C>T, NM_000543.4:c.1420_1421delCT, NM_000543.4:c.1426C>T, NM_000543.4:c.1624C>T, NM_000543.4:c.1630delA, NM_000543.4:c.1805G>A, NM_000543.4:c.1829_1831delGCC	Niemann-Pick disease, type A and type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMPD1 gene located on chromosomal region 11p15.4. The clinical phenotype ranges from a severe infantile form with neurologic degeneration resulting in death usually by 3 years of age (type A) to a later-onset nonneurologic form (type B) that is compatible with survival into adulthood. Since intermediate cases also have been reported, the disease is best regarded a single entity with a clinical spectrum.	600,25
SNAP29	Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome	NM_004782.3	NM_004782.3:c.487dupA	Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SNAP29 gene located on chromosomal region 22q11.2. The age of onset is early. This disease is characterized by severe developmental abnormalities of the nervous system and aberrant differentiation of the epidermis. The prevalence is <1:1,000,000.	600
SPART	Spactic paraplegia, type 20, autosomal recessive	NM_001142294.1	NM_001142294.1:c.1110delA, NM_001142294.1:c.364_365delAT	Spactic paraplegia, type 20 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPART gene located on chromosomal region 13q13.3. The age of onset is infancy. This disease is characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. SPG20 is characterized by dysarthria, distal amyotrophy, mild developmental delay and short stature. The prevalence is <1/1,000,000.	600
SPG11	Amyotrophic lateral sclerosis, type 5, juvenile	NM_025137.3	NM_025137.3:c.7152-1G>C, NM_025137.3:c.6847_6848dupTC, NM_025137.3:c.6805_6806delCT, NM_025137.3:c.6100C>T, NM_025137.3:c.5623C>T, NM_025137.3:c.1736-1G>C, NM_025137.3:c.1339_1342dupGGCT, NM_025137.3:c.733_734delAT, NM_025137.3:c.529_533delATATT, NM_025137.3:c.342delT, NM_025137.3:c.118C>T	Amyotrophic lateral sclerosis, type 5, juvenile follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG11 gene located on chromosomal region 15q21.1. The age of onset is infancy/childhood. This disease is characterized by progressive upper and lower motor neuron degeneration causing facial spasticity, dysarthria, and gait disorders with onset before 25 years of age. The prevalence is <1/1,000,000.	600,25
SPG7	Spastic paraplegia, type 7, autosomal recessive	NM_003119.3	NM_003119.3:c.233T>A, NM_003119.3:c.286+1G>T, NM_003119.3:c.679C>T, NM_003119.3:c.758+2T>C, NM_003119.3:c.773_774delTG, NM_003119.3:c.1045G>A, NM_003119.3:c.1124delG, NM_003119.3:c.1529C>T, NM_003119.3:c.1676delA, NM_003119.3:c.1749G>C, NM_003119.3:c.2075G>C	Spastic paraplegia type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG7 gene located on chromosomal region 16q24.3. The age of onset is adult. This disease is characterized by by progressive muscle stiffness (spasticity) and the development of paralysis of the lower limbs (paraplegia) due to degeneration of corticospinal axons. The prevalence is 1:100,000-9:100,000.	600,25
STAR	Lipoid adrenal hyperplasia	NM_000349.2	NM_000349.2:c.772C>T, NM_000349.2:c.749G>A, NM_000349.2:c.577C>T, NM_000349.2:c.562C>T, NM_000349.2:c.559G>A, NM_000349.2:c.545G>T, NM_000349.2:c.545G>A	Lipoid adrenal hyperplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STAR gene located on chromosomal region 8p11.23. The age of onset is neonatal/infancy. This disease is characterized by a defect in the conversion of cholesterol to pregnenolone, the first step in adrenal and gonadal steroidogenesis. All affected individuals are phenotypic females with a severe salt-losing syndrome that is fatal if not treated in early infancy. The prevalence is unknown.	600
STIL	Microcephaly, type 7, primary, autosomal recessive	NM_001048166.1	NM_001048166.1:c.3846_3849delACAG, NM_001048166.1:c.3718C>T, NM_001048166.1:c.3658delG, NM_001048166.1:c.2829+1G>A	Microcephaly, type 7, primary, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STIL gene located on chromosomal region 1p33. The age of onset is prenatal/neonatal. This disease is characterized by a head circumference more than 3 standard deviations below the age-related mean. Brain weight is markedly reduced and the cerebral cortex is disproportionately small. Despite this marked reduction in size, the gyral pattern is relatively well preserved, with no major abnormality in cortical architecture. Affected individuals are mentally retarded. Primary microcephaly is further defined by the absence of other syndromic features or significant neurological deficits due to degenerative brain disorder. The prevalence is unknown.	600
STRA6	Microphthalmia, isolated, with coloboma, type 8	NM_001199042.1	NM_001199042.1:c.2081G>A, NM_001199042.1:c.2080C>T, NM_001199042.1:c.2048C>T, NM_001199042.1:c.1816C>T, NM_001199042.1:c.1795G>C, NM_001199042.1:c.1638-1G>A, NM_001199042.1:c.1027_1028delGGinsAA, NM_001199042.1:c.995C>T, NM_001199042.1:c.644dupG, NM_001199042.1:c.394_395insCC, NM_001199042.1:c.264delC, NM_001199042.1:c.186G>A, NM_001199042.1:c.169_170delTAinsC	Microphthalmia, isolated, with coloboma, type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRA6 gene located on chromosomal region 15q24.1. This disease is characterized by bilateral clinical anophthalmia, pulmonary hypoplasia/aplasia, cardiac malformations, and diaphragmatic defects. The phenotype is variable, ranging from isolated clinical anophthalmia or microphthalmia to complex presentations involving the cardiac, pulmonary, diaphragmatic, and renal systems. At its most severe, infants are born without pulmonary structures and die soon after birth.	600
STRC	Deafness, autosomal recessive, type 16	NM_153700.2	NM_153700.2:c.5188C>T, NM_153700.2:c.5185C>T, NM_153700.2:c.5168_5171delTTCT, NM_153700.2:c.4560dupC, NM_153700.2:c.4545+1G>C, NM_153700.2:c.3556C>T	Autosomal recessive nonsyndromic sensorineural deafness type DFNB16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRC gene located on chromosomal region 15q15.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	600,25
SUCLG1	Mitochondrial DNA depletion syndrome, type 9 (encephalomyopathic, type with methylmalonic aciduria)	NM_003849.3	NM_003849.3:c.152_153delAT	Mitochondrial DNA depletion syndrome, type 9 (encephalomyopathic, type with methylmalonic aciduria) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SUCLG1 gene located on chromosomal region 2p11.2. The age of onset is early. This disease is characterized by polypnea, severe hypotonia, lethargy, and vomiting, after a silent period during which the children were considered as normal. Facial dysmorphism and cerebral malformations may be noted, as well as diverse organ involvement such as hypertrophic myocardiopathy, tubulopathy, or liver insufficiency.	600
SUOX	Sulfite oxidase deficiency	NM_000456.2	NM_000456.2:c.37C>T, NM_000456.2:c.650G>A, NM_000456.2:c.794C>A, NM_000456.2:c.894_895delCT	Sulfocysteinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SUOX gene located on chromosome 12q13.13. The age of onset is early. This disease is characterized by seizures, reduced muscle tone, psychomotor retardation, lens dislocation.	600
TAT	Tyrosinemia, type 2	NM_000353.2	NM_000353.2:c.1297C>T, NM_000353.2:c.1249C>T, NM_000353.2:c.668C>G, NM_000353.2:c.236-5A>G, NM_000353.2:c.169C>T	Tyrosinemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TAT gene located on chromosomal region 16q22.1. The age of onset is early. This disease is characterized by hypertyrosinemia with oculocutaneous manifestations and, in some cases, intellectual deficit. The prevalence is 1:100,000-1:120,000 newborn.	600
TCAP	Muscular dystrophy, limb-girdle, type 2G	NM_003673.3	NM_003673.3:c.157C>T	Autosomal recessive limb-girdle muscular dystrophy type 2G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by muscle weakness in the four limbs, mild scapular winging, severe atrophy of the quadriceps and anterior tibialis muscles, calf hypertrophy, and lack of respiratory and cardiac involvement.	600,25
TCIRG1	Osteopetrosis, autosomal recessive, type 1	NM_006019.3	NM_006019.3:c.115_116delGA, NM_006019.3:c.1213G>A, NM_006019.3:c.1331G>T, NM_006019.3:c.1674-1G>A, NM_006019.3:c.2236+1G>A	Autosomal recessive osteopetrosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCIRG1 gene located on chromosomal region 11q13.2. The age of onset is early. This disease is characterized by bone marrow failure, fractures and visual impairment. The incidence is 1:200.000 live births and the prevalence is 1:250,000.	600,25
TECTA	Deafness, autosomal recessive, type 21	NM_005422.2	NM_005422.2:c.651dupC, NM_005422.2:c.2428C>T, NM_005422.2:c.2941+1G>A, NM_005422.2:c.4371_4384dupTCAGTGCGACCCGC, NM_005422.2:c.4601G>A	Autosomal recessive nonsyndromic sensorineural deafness type DFNB21 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TECTA gene located on chromosomal region 11q23.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	600
TERT	Dyskeratosis congenita, autosomal recessive, type 4	NM_198253.2	NM_198253.2:c.2701C>T, NM_198253.2:c.2431C>T	Dyskeratosis congenita, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TERT gene located on chromosomal region 5p15.33. The age of onset is early. This disease has a wide phenotypic spectrum and age onset. It usually manifests during childhood with the triad of dysplastic nails, lacy reticular pigmentation and atrophy of the skin at the level of the neck and upper chest, and oral leukoplakia. Patients show an increased risk for progressive bone marrow failure and may develop myelodysplastic syndrome or acute myelogenous leukemia at any age (the risk increasing with age). There is also an increased risk for solid tumors, typically squamous cell carcinoma of head and neck (see this term) or anogenital cancer. Various additional clinical findings have been reported and may include: developmental delay, short stature, microcephaly, blepharitis, epiphora, periodontal disease, taurodontism, decreased teeth/root ratio, esophageal stenosis, liver disease, urethral stenosis, osteoporosis, avascular necrosis of femur and/or humerus, premature hair greying/alopecia, or abnormal eyelashes. Individuals with DC are at high risk of pulmonary fibrosis. The prevalence is 1:1,000,000.	600,25
TFR2	Hemochromatosis, type 3	NM_001206855.1	NM_001206855.1:c.2T>A	Hemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000.	600,25
TFR2	Hemochromatosis, type 3	NM_003227.3	NM_003227.3:c.2374G>A, NM_003227.3:c.2343G>A, NM_003227.3:c.2014C>T, NM_003227.3:c.1861_1872delGCCGTGGCCCAG, NM_003227.3:c.1665delC, NM_003227.3:c.1632_1633delGA, NM_003227.3:c.1473+1G>A, NM_003227.3:c.1469T>G, NM_003227.3:c.1330G>A, NM_003227.3:c.1235_1237delACA, NM_003227.3:c.1186C>T, NM_003227.3:c.949C>T, NM_003227.3:c.750C>G, NM_003227.3:c.313C>T	Hemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000.	600,25
TH	Segawa syndrome, recessive	NM_199292.2	NM_199292.2:c.1481C>T, NM_199292.2:c.1234C>A, NM_199292.2:c.826A>C, NM_199292.2:c.707T>C, NM_199292.2:c.698G>A	Segawa syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TH gene located on chromosomal region 11p15.5. This disease is characterized by dystonia presenting in infancy or early childhood. Dystonia is defined by the presence of sustained involuntary muscle contractions, often leading to abnormal postures. Some cases present with parkinsonian symptoms in infancy. Unlike all other forms of dystonia, it is an eminently treatable condition, due to a favorable response to L-DOPA. The prevalence is 1:1,000,000-9:1,000,000.	600
TIMM8A	Mohr-Tranebjaerg syndrome	NM_004085.3	NM_004085.3:c.238C>T, NM_004085.3:c.198C>G, NM_004085.3:c.112C>T	Mohr-Tranebjaerg syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the TIMM8A gene located on chromosomal region Xq22. The age of onset is infantile. This disease is characterized by hearing loss, followed by adolescent onset progressive dystonia or ataxia, visual impairment from early adulthood onwards and dementia from the 4th decade onwards. The prevalence is <1:1,000,000.	600
TK2	Mitochondrial DNA depletion syndrome , type 2 (myopathic type)	NM_004614.4	NM_004614.4:c.635T>A, NM_004614.4:c.604_606delAAG, NM_004614.4:c.500G>A, NM_004614.4:c.373C>T, NM_004614.4:c.361C>A, NM_004614.4:c.323C>T, NM_004614.4:c.268C>T, NM_004614.4:c.159C>G	Mitochondrial DNA depletion syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TK2 gene located on chromosomal region 16q21. The age of onset is infantile. This disease is characterized by generalized hypotonia, proximal muscle weakness, loss of previously acquired motor skills, poor feeding, and respiratory difficulties leading to respiratory failure and death within a few years after diagnosis. The prevalence is 1.2:100,000.	600,25
TMC1	Deafness, autosomal recessive, type 7	NM_138691.2	NM_138691.2:c.100C>T, NM_138691.2:c.425G>A, NM_138691.2:c.454-1G>C, NM_138691.2:c.1165C>T, NM_138691.2:c.1763+3A>G, NM_138691.2:c.1842G>A, NM_138691.2:c.1960A>G	Autosomal recessive nonsyndromic sensorineural deafness type DFNB7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMC1 gene located on chromosomal region 9q21.13. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	600
TMEM216	Joubert syndrome, type 2; Meckel syndrome, type 2	NM_001173991.2	NM_001173991.2:c.79_82delAACG, NM_001173991.2:c.218G>A, NM_001173991.2:c.218G>T, NM_001173991.2:c.230G>C, NM_001173991.2:c.253C>T, NM_001173991.2:c.341T>G	Joubert syndrome (JBTS) type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM216 gene located on chromosomal region 11q12.2. The age of onset is early. JBTS is characterized by congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. The TMEM216 gene is also associated with other ciliopathies, as Meckel syndrome type 2, a rare, autosomal recessive lethal condition characterized by central nervous system malformations, postaxial, polydactyly, multicystic kidney dysplasia, and ductal proliferation in the portal area of the liver.	600
TMEM67	Joubert syndrome, type 6; Meckel syndrome, type 3; COACH syndrome	NM_153704.5	NM_153704.5:c.130C>T, NM_153704.5:c.148_149insTAAT, NM_153704.5:c.622A>T, NM_153704.5:c.755T>C, NM_153704.5:c.1046T>C, NM_153704.5:c.1538A>G, NM_153704.5:c.1769T>C, NM_153704.5:c.2498T>C	Joubert syndrome (JBTS) type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22.1. The age of onset is early. JBTS is characterized by congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. The TMEM67 gene is also associated with Meckel syndrome type 3, a rare, autosomal recessive lethal condition characterized by central nervous system malformations, postaxial, polydactyly, multicystic kidney dysplasia, and ductal proliferation in the portal area of the liver. Other phenotype associated with mutations in the TMEM67 gene is COACH syndrome, an autosomal recessive disorder characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable. COACH syndrome is considered by some to be a subtype of Joubert syndrome with congenital hepatic fibrosis.	600,25
TMIE	Deafness, autosomal recessive, type 6	NM_147196.2	NM_147196.2:c.170G>A, NM_147196.2:c.241C>T, NM_147196.2:c.250C>T	Autosomal recessive nonsyndromic sensorineural deafness type DFNB6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMIE gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness.	600
TMPRSS3	Deafness, autosomal recessive, type 8/10	NM_024022.2	NM_024022.2:c.1276G>A, NM_024022.2:c.1211C>T, NM_024022.2:c.753G>C, NM_024022.2:c.647G>T, NM_024022.2:c.446+1G>T, NM_024022.2:c.413C>A, NM_024022.2:c.242C>G, NM_024022.2:c.208delC	Autosomal recessive nonsyndromic sensorineural deafness type DFNB10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMPRSS3 gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness.	600,25
TNNT1	Nemaline myopathy , type 5, Amish type	NM_003283.5	NM_003283.5:c.538G>T	Nemaline myopathy 5, Amish type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TNNT1 gene located on chromosomal region 19q13.4. The age of onset is from birth to adulthood. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:50,000 newborn.	600
TPP1	Ceroid lipofuscinosis, neuronal, type 2	NM_000391.3	NM_000391.3:c.1340G>A, NM_000391.3:c.1093T>C, NM_000391.3:c.851G>T, NM_000391.3:c.827A>T, NM_000391.3:c.622C>T, NM_000391.3:c.616C>T, NM_000391.3:c.509-1G>C, NM_000391.3:c.141_144delGAGT	Neuronal ceroid lipofuscinosis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPP1 gene located on chromosomal region 11p15.4. Age of onset is infantile. This disease is characterized by epilepsy, followed by regression of developmental milestones, myoclonic ataxia, and pyramidal signs. Visual impairment typically appears at age four to six years and rapidly progresses to light/dark awareness only. Life expectancy ranges from age six years to early teenage. The prevalence is 1.5:1,000,000-9:1,000,000.	600,25
TPRN	Deafness, autosomal recessive, type 79	NM_001128228.2	NM_001128228.2:c.1427delC, NM_001128228.2:c.1239G>A	Autosomal recessive nonsyndromic sensorineural deafness type DFNB79 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPRN gene located on chromosomal region 9q34.3. The age of onset is early. This disease is characterized by hearing loss and deafness.	600
TREX1	Aicardi-Goutieres syndrome, type 1	NM_016381.5	NM_016381.5:c.309dupC, NM_016381.5:c.506G>A, NM_016381.5:c.655C>T	Aicardi-Gouti�res syndrome 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TREX1 gene located on chromosomal region 3p21.31. The age of onset is early. This disease is characterized by subacute encephalopathy (feeding problems, irritability and psychomotor regression or delay) associated with epilepsy (53% of cases), chilblain skin lesions on the extremities (43% of cases) and episodes of aseptic febrile illness (40% of cases). The prevalence is <1:1,000,000.	600
TRIM32	Muscular dystrophy, limb-girdle, type 2H	NM_001099679.1	NM_001099679.1:c.1459G>A, NM_001099679.1:c.1560delC	Autosomal recessive limb-girdle muscular dystrophy type 2H follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIM32 gene located on chromosomal region 9q31-q33. The age of onset is variable. This disease is characterized by proximal muscle weakness and facial muscle wasting.	600
TRIM37	Mulibrey nanism	NM_001005207.3	NM_001005207.3:c.2212delG, NM_001005207.3:c.2056C>T, NM_001005207.3:c.1668-1G>C, NM_001005207.3:c.1478_1479delAG, NM_001005207.3:c.1411C>T, NM_001005207.3:c.1346dupA, NM_001005207.3:c.1037_1040dupAGAT, NM_001005207.3:c.965G>T, NM_001005207.3:c.745C>T, NM_001005207.3:c.496_500delAGGAA, NM_001005207.3:c.326G>C, NM_001005207.3:c.227T>C	Mulibrey nanism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIM37 gene located on chromosomal region 17q22. The age of onset is prenatal. This disease is characterized by pre- and postnatal growth restriction, characteristic craniofacial features with scaphocephaly, triangular face, high and broad forehead, low nasal bridge and yellowish dots in retinal mid peripheral region. The prevalence is <1:1,000,000.	600
TRIOBP	Deafness, autosomal recessive, type 28	NM_001039141.2	NM_001039141.2:c.1039C>T, NM_001039141.2:c.1741C>T, NM_001039141.2:c.2362C>T, NM_001039141.2:c.2639_2640insTCAC, NM_001039141.2:c.3195delT, NM_001039141.2:c.3202C>T, NM_001039141.2:c.4436dupG, NM_001039141.2:c.4577C>G, NM_001039141.2:c.5316G>A	Deafness autosomal recessive type 28 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIOBP gene located on chromosomal region 22q13.1. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	600,25
TSEN54	Pontocerebellar hypoplasia, type 2A	NM_207346.2	NM_207346.2:c.670_671delAA, NM_207346.2:c.736C>T, NM_207346.2:c.887G>A, NM_207346.2:c.919G>T, NM_207346.2:c.1027C>T, NM_207346.2:c.1039A>T	Pontocerebellar hypoplasia type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSEN54 gene located on chromosomal region 17q25.1. Pontocerebellar hypoplasia (PCH) refers to a group of severe neurodegenerative disorders affecting growth and function of the brainstem and cerebellum, resulting in little or no development. Different types were classified based on the clinical picture and the spectrum of pathologic changes.ﾠ	600,25
TSFM	Combined oxidative phosphorylation deficiency, type 3	NM_001172696.1	NM_001172696.1:c.1_2delAT, NM_001172696.1:c.24_25delCG, NM_001172696.1:c.581delC, NM_001172696.1:c.919C>T	Combined oxidative phosphorylation deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSFM gene located on chromosomal region 12q14.1. The age of onset is early. This disease is characterized by hypotonia, lactic acidosis, and hepatic insufficiency, with progressive encephalomyopathy or hypertrophic cardiomyopathy.	600,25
TSHB	Hypothyroidism, congenital, nongoitrous, type 4	NM_000549.4	NM_000549.4:c.94G>T, NM_000549.4:c.145G>A, NM_000549.4:c.205C>T	Hypothyroidism, congenital, nongoitrous 4, also known as isolated thyroid-stimulating hormone (TSH) deficiency is a type of central congenital hypothyroidism, a permanent thyroid deficiency that is present from birth, characterized by low levels of thyroid hormones due to a deficiency in TSH synthesis.	600
TSHR	Hypothyroidism, congenital, nongoitrous, type 1	NM_000369.2	NM_000369.2:c.122G>C, NM_000369.2:c.202C>T, NM_000369.2:c.326G>A, NM_000369.2:c.484C>G, NM_000369.2:c.500T>A, NM_000369.2:c.1170T>G, NM_000369.2:c.1742dupC	Hypothyroidism, congenital, nongoitrous, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSHR gene located on chromosomal region 14q31.1. This disease is characterized by increased levels of plasma TSH and low levels of thyroid hormone. Only a subset of patients develop frank hypothyroidism; the remainder are euthyroid and asymptomatic.	600,25
TTN	Limb-girdle muscular dystrophy type 10 (LGMDR10; formerly LGMD2J); Early-onset myopathy with fatal cardiomyopathy	NM_001267550.2	NM_001267550.2:c.107889delA, NM_001267550.2:c.106070_106071delAT, NM_001267550.2:c.104092delC, NM_001267550.2:c.104092C>T, NM_001267550.2:c.98818_98821delTCCA, NM_001267550.2:c.92373_92379delTGAATTC, NM_001267550.2:c.69344C>G, NM_001267550.2:c.60681dupT, NM_001267550.2:c.56648-1G>A, NM_001267550.2:c.52372delG, NM_001267550.2:c.48253delA, NM_001267550.2:c.47915dupT, NM_001267550.2:c.32471-1G>A, NM_001267550.2:c.28300_28303delAGCA, NM_001267550.2:c.16881C>A, NM_001267550.2:c.15796C>T, NM_001267550.2:c.3165-1G>T	LGMDR10 is a severe recessive form of LGMD phenotype with onset in the first to third decades involving weakness of all proximal muscles. Severe disability with loss of ambulation may occur within 20 years (third to sixth decades). Most of the cases are without facial muscle involvement or cardiomyopathy. Some patients later developed distal muscle involvement. Early-onset myopathy with fatal cardiomyopathy (EOMFC), known as Salih myopathy, also follows an autosomal recessive pattern of inheritance. This disease is characterized by skeletal muscle weakness and a form of heart disease called dilated cardiomyopathy. Affected individuals have delayed development of motor skills, such as sitting, standing, and walking. The age of onset is neonatal/infancy. LGMDR10 and EOMFC are caused by pathogenic variants in the TTN gene located on chromosomal region 2q31.2.	600,25
TTPA	Ataxia with isolated vitamin E deficiency	NM_000370.3	NM_000370.3:c.744delA, NM_000370.3:c.661C>T, NM_000370.3:c.575G>A	Ataxia with vitamin E deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTPA gene located on chromosomal region 8q13. The age of onset is variable. This disease is characterized by progressive spino-cerebellar ataxia, loss of proprioception, areflexia, and is associated with a marked deficiency in vitamin E. The prevalence is 0.56:1,000,000-3.5:1,000,000.	600,25
TULP1	Leber congenital amaurosis, type 15	NM_003322.4	NM_003322.4:c.1511_1521delTGCAGTTCGGC, NM_003322.4:c.1471T>C, NM_003322.4:c.1444C>T, NM_003322.4:c.1376T>A, NM_003322.4:c.1318C>T, NM_003322.4:c.1259G>C, NM_003322.4:c.1204G>T, NM_003322.4:c.1198C>T	Leber congenital amaurosis 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TULP1 gene located on chromosomal region 6p21.31. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.	600
TWNK	Mitochondrial DNA depletion syndrome, type 7 (hepatocerebral type); Perrault syndrome type 5	NM_021830.4	NM_021830.4:c.526dupG, NM_021830.4:c.952G>A, NM_021830.4:c.955A>G, NM_021830.4:c.1287C>T, NM_021830.4:c.1370C>T, NM_021830.4:c.1523A>G	Mitochondrial DNA depletion syndrome, hepatocerebrorenal form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TWNK gene located on chromosomal region 10q24. The age of onset is neonatal/infantile. It is a severe disease associated with mitochondrial dysfunction. Some patients are affected by progressive atrophy of the cerebellum, brain stem, the spinal cord, and sensory axonal neuropathy. Clinical features include hypotonia, athetosis, ataxia, ophthalmoplegia, sensorineural hearing deficit, sensory axonal neuropathy, epileptic encephalopathy and female hypogonadism. In some individuals liver dysfunction and multi-organ failure is present. On the other hand, Perrault syndrome is a rare condition that causes different patterns of signs and symptoms in affected males and females. A key feature of this condition is hearing loss, which occurs in both males and females. Affected females also have abnormalities of the ovaries. Neurological problems occur in some affected males and females.	600
TYR	Albinism, oculocutaneous, type 1A	NM_000372.4	NM_000372.4:c.1A>G, NM_000372.4:c.140G>A, NM_000372.4:c.164G>A, NM_000372.4:c.230G>A, NM_000372.4:c.242C>T, NM_000372.4:c.265T>C, NM_000372.4:c.272G>A, NM_000372.4:c.286dupA, NM_000372.4:c.325G>A, NM_000372.4:c.533G>A, NM_000372.4:c.572delG, NM_000372.4:c.616G>A, NM_000372.4:c.646T>A, NM_000372.4:c.650G>A, NM_000372.4:c.823G>T, NM_000372.4:c.896G>A, NM_000372.4:c.1012_1013insC, NM_000372.4:c.1111A>G, NM_000372.4:c.1118C>A, NM_000372.4:c.1146C>A, NM_000372.4:c.1147G>A, NM_000372.4:c.1164delT, NM_000372.4:c.1177delG, NM_000372.4:c.1209G>T, NM_000372.4:c.1217C>T, NM_000372.4:c.1255G>A, NM_000372.4:c.1265G>A, NM_000372.4:c.1336G>A, NM_000372.4:c.1342G>A, NM_000372.4:c.1467dupT, NM_000372.4:c.1501dupC	Oculocutaneous albinism type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYR gene located on chromosomal region 11q14.2. The age of onset is early. This disease is characterized by white hair and skin, blue, fully translucent irises, nystagmus and misrouting of the optic nerves.	600,25
TYRP1	Albinism, oculocutaneous, type 3	NM_000550.2	NM_000550.2:c.107delT, NM_000550.2:c.176C>G, NM_000550.2:c.497C>G, NM_000550.2:c.1057_1060delAACA, NM_000550.2:c.1067G>A, NM_000550.2:c.1103delA, NM_000550.2:c.1120C>T, NM_000550.2:c.1372_1375dupGACA	Type 3 oculocutaneous albinism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYRP1 gene located on chromosomal region 9p23. The age of onset is early. This disease is characterized by rufous or brown albinism and occurring mainly in the African population. The prevalence is of 1/8,500 individuals in Africa.	600,25
UBR1	Johanson-Blizzard syndrome	NM_174916.2	NM_174916.2:c.4254G>A, NM_174916.2:c.1537C>T, NM_174916.2:c.1281+1G>T, NM_174916.2:c.869C>G	Johanson-Blizzard syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UBR1 gene located on chromosomal region 15q15.2. The age of onset is early. This disease is characterized by congenital exocrine pancreatic insufficiency and aplasia/hypoplasia of alae nasi, together with a variety of other abnormalities including aplasia cutis, anorectal anomalies and failure to thrive. The prevalence is <1:1,000,000.	600
UGT1A1	Crigler-Najjar syndrome, type 2	NM_000463.2	NM_000463.2:c.44T>G, NM_000463.2:c.1021C>T, NM_000463.2:c.1070A>G, NM_000463.2:c.1456T>G	Crigler-Najjar syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by unconjugated hyperbilirubinemia due to reduced and inducible activity of hepatic bilirubin glucuronosyltransferase with pigmented bile that contains bilirubin glucuronides, and generally do not present neurologic or intellectual impairment. Bilirubin encephalopathy may develop in later life when patients experience a superimposed infection or stress.	600,25
UQCRQ	Mitochondrial complex III deficiency, nuclear, type 4	NM_014402.4	NM_014402.4:c.134C>T	Mitochondrial complex III deficiency, nuclear type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UQCRQ gene located on chromosomal region 5q31.1. The age of onset is infantile. This disease is characterized by severe psychomotor retardation and extrapyramidal signs. Neurologic features included dystonia, athetoid movements, ataxia, mild axial hypotonia, increased tone, hyperreflexia, and inability to walk unsupported.	600
USH1C	Usher syndrome, type 1C; Deafness, autosomal recessive, type 18A	NM_153676.3	NM_153676.3:c.2688_2695dupAATTCACC, NM_153676.3:c.2622_2623delCA, NM_153676.3:c.2547-1G>T, NM_153676.3:c.238dupC, NM_153676.3:c.238delC, NM_153676.3:c.216G>A	Usher syndrome type 1C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1C gene located on chromosomal region 11p15.1. This disease is characterized by the association of sensorineural deafness (usually congenital, severe and stable), progressive vision loss caused by retinitis pigmentosa apparent in childhood and balance problems. The prevalence is 4.4:100,000. The USH1C gene is also associated with autosomal recessive nonsyndromic sensorineural deafness type 18A. This phenotype is characterized by profound, prelingual, nonsyndromic sensorineural deafness with normal vestibular and visual function.	600,25
USH1G	Usher syndrome, type 1G	NM_173477.4	NM_173477.4:c.805C>T, NM_173477.4:c.649C>T, NM_173477.4:c.394dupG, NM_173477.4:c.186_187delCA	Usher syndrome type 1G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1G gene located on chromosomal region 17q25.1. This disease is characterized by the association of sensorineural deafness (usually congenital, severe and stable), progressive vision loss caused by retinitis pigmentosa apparent in childhood and balance problems. The prevalence is 4.4:100,000.	600
USH2A	Usher syndrome, type 2A	NM_206933.2	NM_206933.2:c.15520-1G>A, NM_206933.2:c.15371delT, NM_206933.2:c.15089C>A, NM_206933.2:c.14803C>T, NM_206933.2:c.14442C>A, NM_206933.2:c.13709delG, NM_206933.2:c.12574C>T, NM_206933.2:c.12234_12235delGA, NM_206933.2:c.11864G>A, NM_206933.2:c.10636G>A, NM_206933.2:c.10561T>C, NM_206933.2:c.10073G>A, NM_206933.2:c.9799T>C, NM_206933.2:c.8981G>A, NM_206933.2:c.7364G>A, NM_206933.2:c.6862G>T, NM_206933.2:c.5743_5744delAG, NM_206933.2:c.5573-2A>G, NM_206933.2:c.4338_4339delCT, NM_206933.2:c.3491_3492delCT, NM_206933.2:c.2898delG, NM_206933.2:c.2299delG, NM_206933.2:c.2276G>T, NM_206933.2:c.2167+5G>A, NM_206933.2:c.2135delC, NM_206933.2:c.920_923dupGCCA, NM_206933.2:c.820C>T, NM_206933.2:c.779T>G	Usher syndrome type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. This disease is characterized by the association of sensorineural deafness (usually congenital, moderate/severe and stable) and progressive vision loss that begins in adolescence or adulthood caused by retinitis pigmentosa. Unlike the other forms of Usher syndrome, type 2 is not associated with vestibular abnormalities that cause difficulties with balance. USH2A accounts for more than half of all cases of Usher syndrome type 2. The estimated prevalence is 3:100,000-4:100,000.	600,25
VDR	Rickets, vitamin D-resistant, type 2A	NM_001017536.1	NM_001017536.1:c.1135G>A, NM_001017536.1:c.1065C>G, NM_001017536.1:c.1035C>A, NM_001017536.1:c.971G>T, NM_001017536.1:c.389G>A, NM_001017536.1:c.299G>A, NM_001017536.1:c.287G>A, NM_001017536.1:c.238C>T	Vitamin D-dependent rickets type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VDR gene located on chromosomal region 12q13.11. The age of onset is early. This disease is characterized by hypocalcemia, severe rickets and in many cases alopecia. The prevalence is 1:10,000-5:10,000.	600
VLDLR	Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion, type 1	NM_003383.4	NM_003383.4:c.769C>T, NM_003383.4:c.844C>T, NM_003383.4:c.2302_2303delGA, NM_003383.4:c.2339delT	Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VLDLR gene located on chromosomal region 9p24.2. The age of onset is early. This disease is characterized by non-progressive congenital ataxia that is predominantly truncal and results in delayed ambulation, moderate-to-profound intellectual disability, dysarthria, strabismus, and seizures. The prevalence is 1:100,000-9:100,000.	600
VPS13A	Choreoacanthocytosis	NM_033305.2	NM_033305.2:c.622C>T, NM_033305.2:c.2898T>G, NM_033305.2:c.3091delG, NM_033305.2:c.9109C>T, NM_033305.2:c.9275+1G>T	Chorea-acanthocytosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VPS13A gene located on chromosomal region 9q21. The age of onset is adult. This disease is characterized by progressive neurological symptoms including movement disorders, psychiatric manifestations and cognitive disturbances.	600
VPS33B	Arthrogryposis, renal dysfunction and cholestasis, type 1	NM_018668.4	NM_018668.4:c.1594C>T, NM_018668.4:c.1480-1G>T, NM_018668.4:c.1312C>T, NM_018668.4:c.1246C>T, NM_018668.4:c.603+2T>A, NM_018668.4:c.440_449delCTCTTGATGT	Arthrogryposis, renal dysfunction and cholestasis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VPS33B gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by neurogenic arthrogryposis multiplex congenita, renal tubular dysfunction and neonatal cholestasis. The prevalence is <1:1,000,000.	600
WAS	Wiskott-Aldrich syndrome; Thrombocytopenia, X-linked	NM_000377.2	NM_000377.2:c.134C>T, NM_000377.2:c.167C>T, NM_000377.2:c.173C>G, NM_000377.2:c.809T>C, NM_000377.2:c.814T>C, NM_000377.2:c.881T>C, NM_000377.2:c.1442T>A	Wiskott-Aldrich syndrome (WAS) is an X-linked recessive primary immunodeficiency disease characterized by microthrombocytopenia, eczema, recurrent infections and an increased risk for autoinmmune manifestations and malignancies. WAS usually manifests in infancy but onset may also occur during the neonatal period. The incidence of WAS has been estimated at less than 1 in 100,000 live births. Thrombocytopaenia is defined by a decrease in the number of platelets in circulating blood, resulting in the potential for increased bleeding and decreased ability for clotting. Both conditions follow an X-linked pattern of inheritance and are caused by pathogenic variants in the WAS gene located on chromosomal region Xp11.23.	600
WDR62	Microcephaly, type 2, primary, autosomal recessive, with or without cortical malformations	NM_001083961.1	NM_001083961.1:c.193G>A, NM_001083961.1:c.557G>A, NM_001083961.1:c.671G>C, NM_001083961.1:c.702dupG, NM_001083961.1:c.1313G>A, NM_001083961.1:c.1408C>T, NM_001083961.1:c.3514+1delG, NM_001083961.1:c.3574delA	Autosomal recessive primary microcephalyc type 2 with or without cortical malformations follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WDR62 gene located on chromosomal region 19q13.12. The age of onset is early. This disease is characterized by reduced head circumference at birth without gross anomalies of brain architecture and variable degrees of intellectual impairment. The incidence is 1:1,000,000.	600
WFS1	Wolfram syndrome, type 1	NM_001145853.1	NM_001145853.1:c.616C>T, NM_001145853.1:c.676C>T, NM_001145853.1:c.1060_1062delTTC, NM_001145853.1:c.1230_1233delCTCT, NM_001145853.1:c.1234_1237delGTCT, NM_001145853.1:c.1511C>T, NM_001145853.1:c.1943G>A, NM_001145853.1:c.1944G>A, NM_001145853.1:c.2084G>T, NM_001145853.1:c.2643_2644delCT	Wolfram syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WFS1 gene located on chromosomal region 4p16.1. The age of onset is infantile. This disease is characterized by diabetes mellitus type I, diabetes insipidus, optical atrophy and neurological signs. The prevalence is 1:1,000,000-9:1,000,000.	600,25
WHRN	Usher syndrome, type 2D; Deafness, autosomal recessive, type 31	NM_015404.3	NM_015404.3:c.817C>T	Usher syndrome type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WHRN gene located on chromosomal region 9q32. This disease is characterized by the association of sensorineural deafness (usually congenital, moderate/severe and stable) and progressive vision loss that begins in adolescence or adulthood caused by retinitis pigmentosa. Unlike the other forms of Usher syndrome, type 2 is not associated with vestibular abnormalities that cause difficulties with balance. The WHRN gene is also associated with autosomal recessive nonsyndromic sensorineural deafness type 31. This phenotype is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.ﾠ	600,25
WNT10A	Odontoonychodermal dysplasia	NM_025216.2	NM_025216.2:c.321C>A, NM_025216.2:c.383G>A, NM_025216.2:c.697G>T	Odonto-onycho-dermal dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by hyperkeratosis and hyperhidrosis of the palms and soles, atrophic malar patches, hypodontia, conical teeth, onychodysplasia, and dry and sparse hair. The prevalence is <1:1,000,000.	600,25
WNT7A	Fuhrmann syndrome	NM_004625.3	NM_004625.3:c.874C>T, NM_004625.3:c.325G>A	Fuhrmann syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT7A gene located on chromosomal region 3p25.1. The age of onset is neonatal/infancy. This disease is characterized by bowing of the femora, aplasia or hypoplasia of the fibulae and poly-, oligo-, and syndactyly. Most of the patients also have a hypoplastic pelvis and hypoplasia of the fingers and fingernails. Some had congenital dislocation of the hip, absence or fusion of tarsal bones, absence of various metatarsals, and hypoplasia and aplasia of the toes. The prevalence is <1:1,000,000.	600
XPA	Xeroderma pigmentosum, group A	NM_000380.3	NM_000380.3:c.727C>T, NM_000380.3:c.619C>T, NM_000380.3:c.501delG, NM_000380.3:c.348T>A	Xeroderma pigmentosum complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the gene XPA located on chromosomal region 9q22.33. The age of onset is variable. This disease is characterized by photosensitivity of skin with burning, freckling, and skin cancers. It is associated with a spectrum of mild to severe neurological anomalies (e.g. cognitive deterioration, dysarthria, balance disturbance, areflexia) and sometimes delay of growth and sexual development. The prevalence is 1:1,000,000.	600
ZFYVE26	Spastic paraplegia, type 15, autosomal recessive	NM_015346.3	NM_015346.3:c.5485-1G>A, NM_015346.3:c.5422C>T, NM_015346.3:c.4936C>T, NM_015346.3:c.4312C>T, NM_015346.3:c.3642_3643insCCACACTTAG, NM_015346.3:c.3206G>A, NM_015346.3:c.3182delT, NM_015346.3:c.2114dupC, NM_015346.3:c.1477C>T	Spastic paraplegia type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZFYVE26 gene located on chromosomal region 14q24.1. The age of onset is infancy. This disease is characterized by progressive spasticity primarily affecting the lower limbs. It is a complex form of spastic paraplegia, associated with other neurologic dysfunction, including variable mental retardation, hearing and visual defects, and thin corpus callosum. The prevalence is <1 / 1,000,000.	600,25
ZMPSTE24	Mandibuloacral dysplasia with, type B lipodystrophy	NM_005857.4	NM_005857.4:c.54dupT, NM_005857.4:c.121C>T, NM_005857.4:c.955-1G>A, NM_005857.4:c.1018T>C, NM_005857.4:c.1085dupT, NM_005857.4:c.1263dupT, NM_005857.4:c.1349G>A	Mandibuloacral dysplasia with type B lipodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZMPSTE24 gene located on chromosomal region 1p34.2. The age of onset is early. This disease is characterized by postnatal growth retardation, craniofacial anomalies and skeletal malformations, such as mandibular and clavicular hypoplasia; mottled cutaneous pigmentation and generalized lipoatrophy.	600
ZNF469	Brittle cornea syndrome, type 1	NM_001127464.2	NM_001127464.2:c.4174G>T	Brittle cornea syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZNF469 gene located on chromosomal region 16q24.2. The age of onset is infantile. This disease is characterized by severe ocular manifestations due to extreme corneal thinning and fragility with rupture in the absence of significant trauma. BCS generally progresses to blindness. The prevalence is <1:1,000,000.	600

CGT 250 v1
CGT 250 v2

Gene	Disease	Transcript	Mutations	Disease.description	products
ABCA4	Cone-rod dystrophy type 3	NM_000350.2	NM_000350.2:c.3540_3555delGTCTAAGGGTTTCTCC, NM_000350.2:c.2616_2617delCT, NM_000350.2:c.4793C>A, NM_000350.2:c.6179T>G, NM_000350.2:c.1222C>T, NM_000350.2:c.763C>T	Cone rod dystrophy type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness. The prevalence is 1:100,000-9100,000.	250,600
ABCA4	Retinitis pigmentosa type 19	NM_000350.2	NM_000350.2:c.1848delA	Retinitis pigmentosa type 19 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	250,600
ABCA4	Stargardt disease type 1	NM_000350.2	NM_000350.2:c.1018T>G, NM_000350.2:c.4457C>T, NM_000350.2:c.1225delA, NM_000350.2:c.1622T>C, NM_000350.2:c.1715G>A, NM_000350.2:c.1755delA, NM_000350.2:c.1771delT, NM_000350.2:c.1804C>T, NM_000350.2:c.6449G>A, NM_000350.2:c.1938-1G>A, NM_000350.2:c.1964T>G, NM_000350.2:c.2160+1G>T, NM_000350.2:c.2588G>C, NM_000350.2:c.4469G>A, NM_000350.2:c.2690C>T, NM_000350.2:c.2791G>A, NM_000350.2:c.286A>G, NM_000350.2:c.2971G>C, NM_000350.2:c.3083C>T, NM_000350.2:c.3106G>A, NM_000350.2:c.3210_3211dupGT, NM_000350.2:c.3364G>A, NM_000350.2:c.6320G>A, NM_000350.2:c.3970delG, NM_000350.2:c.4139C>T, NM_000350.2:c.4429C>T, NM_000350.2:c.2300T>A, NM_000350.2:c.3322C>T, NM_000350.2:c.52C>T, NM_000350.2:c.5512delC, NM_000350.2:c.5819T>C, NM_000350.2:c.5881G>A, NM_000350.2:c.5882G>A, NM_000350.2:c.5912T>G, NM_000350.2:c.634C>T, NM_000350.2:c.5714+5G>A, NM_000350.2:c.6394G>T, NM_000350.2:c.67-2A>G, NM_000350.2:c.5461-10T>C, NM_000350.2:c.6089G>A, NM_000350.2:c.6118C>T, NM_000350.2:c.6148G>C, NM_000350.2:c.661G>A, NM_000350.2:c.5338C>G	Stargardt disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by progressive central vision loss, mild loss of color vision, delayed dark adaptation and macular atrophy with or without paramacular flecks and degeneration of the underlying retinal pigment ephitelium. The prevalence is 1:10,000- 5:10,000.	250,600
ACAD9	Acyl-CoA dehydrogenase type 9 deficiency	NM_014049.4	NM_014049.4:c.1240C>T, NM_014049.4:c.1249C>T, NM_014049.4:c.130T>A, NM_014049.4:c.1594C>T, NM_014049.4:c.23delT, NM_014049.4:c.358delT, NM_014049.4:c.797G>A, NM_014049.4:c.976G>C, NM_014049.4:c.453+1G>A	Acyl-CoA dehydrogenase type 9 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAD9 gene located on chromosomal region 3q21.3. The age of onset is neonatal/infantile. This disease is characterized by failure to thrive, hypertrophic cardiomyopathy, exercise intolerance and mild to severe neurological dysfunction.	250,600
ACADM	Acyl-CoA dehydrogenase deficiency, medium-chain	NM_000016.5	NM_000016.5:c.1102_1105delTTAG, NM_000016.5:c.1232_1233delAA, NM_000016.5:c.287-2A>G, NM_000016.5:c.362C>T, NM_000016.5:c.447G>A, NM_000016.5:c.447G>T, NM_000016.5:c.449_452delCTGA, NM_000016.5:c.616C>T, NM_000016.5:c.617G>A, NM_000016.5:c.683C>A, NM_000016.5:c.797A>G, NM_000016.5:c.799G>A, NM_000016.5:c.815_827delTTGCAATGGGAGC, NM_000016.5:c.890A>G, NM_000016.5:c.984delG, NM_000016.5:c.985A>G, NM_000016.5:c.127G>A, NM_000016.5:c.734C>T, NM_000016.5:c.250C>T	Medium chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADM gene located on chromosomal region 1p31. The age of onset is neonatal/infantile. This disease is characterized by a rapidly progressive metabolic crisis, often presenting as hypoketotic hypoglycemia, lethargy, vomiting, seizures and coma. The prevalence is 1:4,900-1:27,000 in Caucasian populations and 1:14,600 in worldwide populations.	250,600
ACADS	Acyl-CoA dehydrogenase deficiency, short-chain	NM_000017.2	NM_000017.2:c.1095G>T, NM_000017.2:c.1108A>G, NM_000017.2:c.1147C>T, NM_000017.2:c.136C>T, NM_000017.2:c.319C>T, NM_000017.2:c.417G>C, NM_000017.2:c.529T>C, NM_000017.2:c.561_568delCAATGCCT, NM_000017.2:c.826G>A, NM_000017.2:c.314T>A	Short chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADS gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by seizures, developmental delay, failure to grow with poor feeding, and usually muscle weakness and hypotonia. The prevalence is <1:50,000.	250,600
ACADSB	2-Methylbutyryl-CoA dehydrogenase deficiency	NM_001609.3	NM_001609.3:c.1159G>A, NM_001609.3:c.443C>T, NM_001609.3:c.763C>T, NM_001609.3:c.621G>A, NM_001609.3:c.303+1G>A	2-Methylbutyryl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADSB gene located on chromosomal region 10q26.3. The age of onset is neonatal/infantile. This disease is characterized by muscle hypotonia, cerebral palsy, developmental delay, lethargy, hypoglycemia, and metabolic acidosis. The prevalence is <1:1,000,000.	250,600
ACADVL	Very long chain acyl-CoA dehydrogenase deficiency	NM_000018.3	NM_000018.3:c.1096C>T, NM_000018.3:c.1097G>A, NM_000018.3:c.1106T>C, NM_000018.3:c.1141_1143delGAG, NM_000018.3:c.1182+1G>A, NM_000018.3:c.1357C>T, NM_000018.3:c.1360G>A, NM_000018.3:c.1375dupC, NM_000018.3:c.1389dupG, NM_000018.3:c.1406G>A, NM_000018.3:c.1468G>C, NM_000018.3:c.1532+1G>A, NM_000018.3:c.1837C>T, NM_000018.3:c.1843C>T, NM_000018.3:c.1882delC, NM_000018.3:c.278-1G>A, NM_000018.3:c.298_299delCA, NM_000018.3:c.343delG, NM_000018.3:c.400C>T, NM_000018.3:c.477+1G>C, NM_000018.3:c.520G>A, NM_000018.3:c.685C>T, NM_000018.3:c.739A>C, NM_000018.3:c.753-2A>C, NM_000018.3:c.896_898delAGA, NM_000018.3:c.917T>C, NM_000018.3:c.1844G>A, NM_000018.3:c.848T>C	Very long chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADVL gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by cardiomyopathy, hypoketotic hypoglycemia, liver disease, exercise intolerance and rhabdomyolysis. The prevalence is 1:100,000-9:100,000.	250,600
ACE	Renal tubular dysgenesis	NM_000789.3	NM_000789.3:c.1319_1322delTGGA, NM_000789.3:c.1510delC, NM_000789.3:c.3381-4C>T, NM_000789.3:c.798C>G, NM_000789.3:c.1486C>T, NM_000789.3:c.2371C>T, NM_000789.3:c.1587-2A>G	Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.	250,600
ADA	Adenosine deaminase deficiency	NM_000022.2	NM_000022.2:c.226C>T, NM_000022.2:c.632G>A, NM_000022.2:c.890C>A, NM_000022.2:c.247G>A, NM_000022.2:c.320T>C, NM_000022.2:c.872C>T, NM_000022.2:c.956_960delAAGAG, NM_000022.2:c.986C>T	Adenosine deaminase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADA gene located on chromosomal region 20q13.12. The age of onset is neonatal/infantile. This disease is characterized by profound lymphopenia and very low immunoglobulin levels of all isotypes resulting in severe and recurrent opportunistic infections. The annual incidence is 1:200,000-1:1,000,000. The prevalence is 1:100,000-9:100,000.	250,600
ADCK3	Primary coenzyme Q10 deficiency type 4	NM_020247.4	NM_020247.4:c.911C>T, NM_020247.4:c.815G>T, NM_020247.4:c.993C>T, NM_020247.4:c.1541A>G, NM_020247.4:c.1645G>A, NM_020247.4:c.1651G>A, NM_020247.4:c.1750_1752delACC, NM_020247.4:c.1813_1814insG, NM_020247.4:c.589-3C>G, NM_020247.4:c.637C>T, NM_020247.4:c.815G>A	Primary coenzyme Q10 deficiency type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADCK3 gene located on chromosomal region 1q42.13. The age of onset is infantile. This disease is characterized by progressive ataxia, cerebellar atrophy, and often exercise intolerance with elevated lactate levels and mild intellectual deficit.	250,600
AGL	Glycogen storage disease type 3	NM_000642.2	NM_000642.2:c.1783C>T, NM_000642.2:c.18_19delGA, NM_000642.2:c.112A>G, NM_000642.2:c.1222C>T, NM_000642.2:c.1481G>A, NM_000642.2:c.1485delT, NM_000642.2:c.16C>T, NM_000642.2:c.4260-1G>T, NM_000642.2:c.3214_3215delGA, NM_000642.2:c.1999delC, NM_000642.2:c.2039G>A, NM_000642.2:c.2590C>T, NM_000642.2:c.4456delT, NM_000642.2:c.3216_3217delGA, NM_000642.2:c.3980G>A, NM_000642.2:c.4342G>C, NM_000642.2:c.4529dupA, NM_000642.2:c.294-2A>T, NM_000642.2:c.4260-12A>G	Glycogen storage disease type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGL gene located on chromosomal region 1p21.2. The age of onset is infantile. This disease is characterized by hepatomegaly, growth retardation and occasional seizures related to hypoglycemia and frequently muscular hypotonia and hypertrophic cardiomyopathy.	250,600
AGXT	Primary hyperoxaluria type 1	NM_000030.2	NM_000030.2:c.166-2A>G, NM_000030.2:c.121G>A, NM_000030.2:c.32C>A, NM_000030.2:c.245G>A, NM_000030.2:c.25_26insC, NM_000030.2:c.322T>C, NM_000030.2:c.508G>A, NM_000030.2:c.560C>T, NM_000030.2:c.590G>A, NM_000030.2:c.613T>C, NM_000030.2:c.697C>T, NM_000030.2:c.698G>A, NM_000030.2:c.731T>C, NM_000030.2:c.738G>A, NM_000030.2:c.836T>C, NM_000030.2:c.860G>A, NM_000030.2:c.33_34insC, NM_000030.2:c.454T>A, NM_000030.2:c.466G>A, NM_000030.2:c.248A>G	Primary hyperoxaluria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGXT gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by variable clinical presentation, ranging from occasional symptomatic nephrolithiasis to nephrocalcinosis and end-stage renal disease with systemic involvement. The prevalence is 1:1,000,000-9:1,000,000.	250,600
AHI1	Joubert syndrome type 3	NM_017651.4	NM_017651.4:c.1303C>T, NM_017651.4:c.1484G>A, NM_017651.4:c.2295_2296insA, NM_017651.4:c.2295dupA, NM_017651.4:c.3257A>G, NM_017651.4:c.2168G>A, NM_017651.4:c.985C>T, NM_017651.4:c.989A>G, NM_017651.4:c.3263_3264delGG, NM_017651.4:c.1051C>T, NM_017651.4:c.1052G>T	El síndrome de Joubert tipo 3 sigue un patrón de herencia autosómico recesivo y está causado por variantes patogénicas en el gen AHI1 localizado en la región cromosómica 6q23.3. La edad de aparición es neonatal/infantil con síntomas como los rasgos neurológicos del síndrome de Joubert (hipotonía neonatal, retraso del desarrollo, discapacidad intelectural de leve a grave, ataxia, movimiento ocular anormal incluyendo apraxia oculomotora y nistagmo en posición primaria) asociados a una distrofia retiniana.	250,600
AIPL1	Cone-rod dystrophy	NM_014336.4	NM_014336.4:c.1053_1064delTGCAGAGCCACC	La distrofia de conos y bastones causada por variantes patogénicas en el gen AIPL1 localizado en la región cromosómica 17p13.2 sigue un patrón de herencia autosómico recesivo. La edad de aparición es temprana. Se caracteriza por una agudeza visual disminuida, defectos en la visión de los colores, fotoaversión y disminución de la sensibilidad en el centro del campo visual, seguido por una pérdida de la visión periférica y ceguera nocturna.	250,600
AIPL1	Leber congenital amaurosis type 4	NM_014336.4	NM_014336.4:c.905G>T, NM_014336.4:c.834G>A, NM_014336.4:c.589G>C, NM_014336.4:c.715T>C	Leber congenital amaurosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AIPL1gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. The prevalence is 1:100,000-9:100,000.	250,600
ALDOB	Hereditary fructose intolerance	NM_000035.3	NM_000035.3:c.1005C>G, NM_000035.3:c.178C>T, NM_000035.3:c.1027T>C, NM_000035.3:c.10C>T, NM_000035.3:c.136A>T, NM_000035.3:c.448G>C, NM_000035.3:c.2T>C, NM_000035.3:c.360_363delCAAA, NM_000035.3:c.442T>C, NM_000035.3:c.1013C>T, NM_000035.3:c.113-1_115delGGTA, NM_000035.3:c.1067C>A, NM_000035.3:c.612T>A, NM_000035.3:c.720C>A, NM_000035.3:c.524C>A	Hereditary fructose intolerance follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOB gene located on chromosomal region 9q21.3-q22.2. The age of onset is neonatal/infantile. This disease is characterized by severe abdominal pain, vomiting, and hypoglycemia following ingestion of fructose or other sugars metabolised through fructose-1-phosphate. The prevalence is 1:100,000-9:100,000.	250,600
ALG6	Congenital disorders of glycosylation type Ic	NM_013339.3	NM_013339.3:c.897_899delAAT, NM_013339.3:c.998C>T, NM_013339.3:c.495-3C>G, NM_013339.3:c.53G>A, NM_013339.3:c.316C>T, NM_013339.3:c.482A>G, NM_013339.3:c.1432T>C	Congenital disorder of glycosylation type 1c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG6 gene located on chromosomal region 1p31.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay and muscular hypotonia, and possible coagulation anomalies, hormonal abnormalities and seizures. The prevalence is <1:1,000,000.	250,600
ALMS1	Alström syndrome	NM_015120.4	NM_015120.4:c.11443C>T, NM_015120.4:c.10775delC, NM_015120.4:c.11316_11319delAGAG, NM_015120.4:c.2323C>T, NM_015120.4:c.11449C>T, NM_015120.4:c.11452_11453insA, NM_015120.4:c.1574_1576delCTCinsT, NM_015120.4:c.8383C>T, NM_015120.4:c.9612_9616delAACAG, NM_015120.4:c.10579_10580delAT, NM_015120.4:c.11610_11611delCT, NM_015120.4:c.12439C>T, NM_015120.4:c.12445C>T, NM_015120.4:c.891_907delTCAGCACCCGCTTATAG, NM_015120.4:c.9911-1G>A, NM_015120.4:c.11618_11619delCT, NM_015120.4:c.4245delC, NM_015120.4:c.5584C>T, NM_015120.4:c.8164C>T	Alström syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALMS1 gene located on chromosomal region 2p13.1. The age of onset is neonatal/infantile. This disease is characterized by cone-rod dystrophy, hearing loss, obesity, insulin resistance and hyperinsulinemia, type 2 diabetes mellitus, dilated cardiomyopathy and progressive hepatic and renal dysfunction. The prevalence is 1:10,000-1:1,000,000.	250,600
ANO5	Limb-girdle muscular dystrophy type 2L, autosomal recessive	NM_213599.2	NM_213599.2:c.155A>G, NM_213599.2:c.1622_1623insA, NM_213599.2:c.1407+5G>A, NM_213599.2:c.1887delA, NM_213599.2:c.1733T>C, NM_213599.2:c.692G>T, NM_213599.2:c.1627_1628insA, NM_213599.2:c.172C>T, NM_213599.2:c.206_207delAT, NM_213599.2:c.1210C>T, NM_213599.2:c.1295C>G, NM_213599.2:c.1914G>A, NM_213599.2:c.184_185insA, NM_213599.2:c.1898+1G>A, NM_213599.2:c.191_192insA	Autosomal recessive limb-girdle muscular dystrophy type 2L follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ANO5 gene located on chromosomal region 11p14.3. The age of onset is adult. This disease is characterized by weakness and wasting restricted to the limb musculature, proximal greater than distal, and muscle degeneration/regeneration on muscle biopsy. The prevalence is <1:1,000,000.	250,600
APTX	Ataxia with oculomotor apraxia type 1	NM_175073.2	NM_175073.2:c.167delT, NM_175073.2:c.788T>G, NM_175073.2:c.320delC, NM_175073.2:c.617C>T, NM_175073.2:c.659C>T, NM_175073.2:c.134-2A>G, NM_175073.2:c.166C>T, NM_175073.2:c.124C>T, NM_175073.2:c.875-1G>A, NM_175073.2:c.837G>A, NM_175073.2:c.596G>A	Ataxia with oculomotor apraxia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the APTX gene located on chromosomal region 9p13.1. The age of onset is infantile. This disease is characterized by a progressive cerebellar ataxia associated with oculomotor apraxia, choeroathetosis and severe peripheral neuropathy. The prevalence is 0,4:100.000 in Portugal.	250,600
AR	Androgen insensitivity syndrome	NM_000044.3	NM_000044.3:c.2650A>T, NM_000044.3:c.340C>T, NM_000044.3:c.1937C>A, NM_000044.3:c.2323C>T, NM_000044.3:c.2391G>A, NM_000044.3:c.2567G>A, NM_000044.3:c.1769-11T>A, NM_000044.3:c.1771A>T, NM_000044.3:c.2395C>G	Androgen insensitivity syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the AR gene located on chromosomal region Xq12. The age of onset is variable. This disease is characterized by the presence of female external genitalia in a 46,XY individual with normal testis development but undescended testes and unresponsiveness to age-appropriate levels of androgens. The prevalence is 2:100,000-5:100,000.	250,600
ARSA	Metachromatic leukodystrophy	NM_000487.5	NM_000487.5:c.1241delC, NM_000487.5:c.1283C>T, NM_000487.5:c.346C>T, NM_000487.5:c.34delG, NM_000487.5:c.1210+1G>A, NM_000487.5:c.1232C>T, NM_000487.5:c.582delC, NM_000487.5:c.583delT, NM_000487.5:c.542dupT, NM_000487.5:c.542T>G, NM_000487.5:c.1408_1418delGCAGCTGTGAC, NM_000487.5:c.195delC, NM_000487.5:c.641C>T, NM_000487.5:c.1401_1411delGTTAGACGCAG, NM_000487.5:c.869G>A, NM_000487.5:c.869G>T, NM_000487.5:c.883G>A, NM_000487.5:c.899T>C, NM_000487.5:c.931G>A, NM_000487.5:c.937C>T, NM_000487.5:c.938G>A, NM_000487.5:c.979G>A, NM_000487.5:c.737G>A, NM_000487.5:c.739G>A, NM_000487.5:c.763G>A, NM_000487.5:c.827C>T, NM_000487.5:c.854+1G>A, NM_000487.5:c.1108-2A>G, NM_000487.5:c.1125_1126delCT, NM_000487.5:c.1150G>A, NM_000487.5:c.1174C>T, NM_000487.5:c.1175G>A, NM_000487.5:c.986C>T, NM_000487.5:c.991G>T, NM_000487.5:c.465+1G>A, NM_000487.5:c.257G>A, NM_000487.5:c.293C>T, NM_000487.5:c.302G>A	Metachromatic leukodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSA gene located on chromosomal region 22q13.33. The age of onset is variable. This disease is characterized by hypotonia, walking difficulties, optic atrophy and motor regression preceding mental impairment in the late infantile form, arrested intellectual development, followed by motor regression, epileptic seizures and ataxia in the juvenile form, and motor or psychiatric disorders, but with slow progression in the adult form. The incidence is 0.5:5,000-1:50,000 and the prevalence is 1:10,000 -5/10,000.	250,600
ARSB	Mucopolysaccharidosis type 6	NM_000046.3	NM_000046.3:c.410G>T, NM_000046.3:c.427delG, NM_000046.3:c.349T>C, NM_000046.3:c.389C>T, NM_000046.3:c.937C>G, NM_000046.3:c.944G>A, NM_000046.3:c.971G>T, NM_000046.3:c.979C>T, NM_000046.3:c.1562G>A, NM_000046.3:c.629A>G, NM_000046.3:c.1143-1G>C, NM_000046.3:c.571C>T, NM_000046.3:c.589C>T, NM_000046.3:c.1178A>C, NM_000046.3:c.1214G>A, NM_000046.3:c.1143-8T>G, NM_000046.3:c.1161dupC, NM_000046.3:c.707T>C, NM_000046.3:c.753C>G, NM_000046.3:c.1366C>T, NM_000046.3:c.1438_1439insG, NM_000046.3:c.921delA	Mucopolysaccharidosis type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSB gene located on chromosomal region 5q14.1. The age of onset is infantile. This disease is characterized by educed pulmonary function, hepatosplenomegaly, hearing loss, sleep apnea, corneal clouding, carpal tunnel disease and occasionally central nervous system findings may include cervical cord compression caused by cervical spinal instability, meningeal thickening and/or bony stenosis, communicating hydrocephalus, optic nerve atrophy and blindness. The prevalence is 1:250,000-1:600,000 newborns.	250,600
ARSE	Chondrodysplasia punctata type 1, X-linked	NM_000047.2	NM_000047.2:c.119T>G, NM_000047.2:c.1429delG, NM_000047.2:c.1442C>T, NM_000047.2:c.1732C>T, NM_000047.2:c.1743G>A, NM_000047.2:c.24-1G>A, NM_000047.2:c.410G>C, NM_000047.2:c.410G>T	X-linked chondrodysplasia punctata type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARSE gene located on chromosomal region Xp22.33. The age of onset is neonatal. This disease is characterized by chondrodysplasia punctata (stippled epiphyses), brachytelephalangy (shortening of the distal phalanges), and nasomaxillary hypoplasia. The prevalence is 1:500,000.	250,600
ASL	Argininosuccinic aciduria	NM_000048.3	NM_000048.3:c.1135C>T, NM_000048.3:c.1060C>T, NM_000048.3:c.1255_1256delCT, NM_000048.3:c.1366C>T, NM_000048.3:c.1045_1057delGTCATCTCTACGC, NM_000048.3:c.578G>A, NM_000048.3:c.539T>G, NM_000048.3:c.544C>T, NM_000048.3:c.557G>A, NM_000048.3:c.1144-2A>G, NM_000048.3:c.602+1G>A, NM_000048.3:c.857A>G, NM_000048.3:c.925G>A, NM_000048.3:c.446+1G>A, NM_000048.3:c.505T>C, NM_000048.3:c.525-2A>T, NM_000048.3:c.532G>A, NM_000048.3:c.337C>T, NM_000048.3:c.346C>T, NM_000048.3:c.35G>A, NM_000048.3:c.1369dupG, NM_000048.3:c.437G>A, NM_000048.3:c.392C>T, NM_000048.3:c.1153C>T	Argininosuccinic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASL gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by severe hyperammonemic coma, hypotonia, growth failure, anorexia and chronic vomiting or behavioral disorders during childhood, and hyperammonemic coma or behavioral disorders that simulate psychiatric disorders later in life. The prevalence is 1:70,000 newborns.	250,600
ASPA	Canavan disease	NM_000049.2	NM_000049.2:c.838C>T, NM_000049.2:c.693C>A, NM_000049.2:c.654C>A, NM_000049.2:c.433-2A>G, NM_000049.2:c.854A>C, NM_000049.2:c.914C>A, NM_000049.2:c.212G>A, NM_000049.2:c.863A>G	Canavan disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPA gene located on chromosomal region 17p13.3. The age of onset is neonatal/infantile. This disease is characterized by a variable spectrum between severe forms with leukodystrophy, macrocephaly and severe developmental delay, and a very rare mild/juvenile form characterized by mild developmental delay. The prevalence is 1:6,400- 1:13,500 in Askenazis Jewis.	250,600
ASPM	Microcephaly primary, type 5, autosomal recessive	NM_018136.4	NM_018136.4:c.1002delA, NM_018136.4:c.3055C>T, NM_018136.4:c.2389C>T, NM_018136.4:c.2967G>A, NM_018136.4:c.1260_1266delTCAAGTC, NM_018136.4:c.10059C>A, NM_018136.4:c.1154_1155delAG, NM_018136.4:c.1179delT, NM_018136.4:c.1729_1730delAG, NM_018136.4:c.1959_1962delCAAA, NM_018136.4:c.1990C>T, NM_018136.4:c.3979C>T, NM_018136.4:c.4195dupA, NM_018136.4:c.4583delA, NM_018136.4:c.4795C>T, NM_018136.4:c.4858_4859delAT, NM_018136.4:c.5136C>A, NM_018136.4:c.5149delA, NM_018136.4:c.1366G>T, NM_018136.4:c.1406_1413delATCCTAAA, NM_018136.4:c.1590delA, NM_018136.4:c.6189T>G, NM_018136.4:c.6232C>T, NM_018136.4:c.6337_6338delAT, NM_018136.4:c.6732delA, NM_018136.4:c.719_720delCT, NM_018136.4:c.7491_7495delTATTA, NM_018136.4:c.7565T>G, NM_018136.4:c.7761T>G, NM_018136.4:c.7782_7783delGA, NM_018136.4:c.7860_7861delGA, NM_018136.4:c.7894C>T, NM_018136.4:c.8131_8132delAA, NM_018136.4:c.8230_8231insA, NM_018136.4:c.8378delT, NM_018136.4:c.8508_8509delGA, NM_018136.4:c.8668C>T, NM_018136.4:c.8844delC, NM_018136.4:c.9115_9118dupCATT, NM_018136.4:c.9159delA, NM_018136.4:c.9178C>T, NM_018136.4:c.3082G>A, NM_018136.4:c.3188T>G, NM_018136.4:c.3477_3481delCGCTA, NM_018136.4:c.349C>T, NM_018136.4:c.3527C>G, NM_018136.4:c.3663delG, NM_018136.4:c.3710C>G, NM_018136.4:c.3796G>T, NM_018136.4:c.3811C>T, NM_018136.4:c.3978G>A, NM_018136.4:c.9747_9748delCT, NM_018136.4:c.9754delA, NM_018136.4:c.9789T>A, NM_018136.4:c.8711_8712delAA, NM_018136.4:c.9190C>T, NM_018136.4:c.9238A>T, NM_018136.4:c.9319C>T, NM_018136.4:c.5439_5440delAG, NM_018136.4:c.577C>T, NM_018136.4:c.6073delG, NM_018136.4:c.9677dupG, NM_018136.4:c.9685delA, NM_018136.4:c.9697C>T, NM_018136.4:c.9730C>T, NM_018136.4:c.9557C>G, NM_018136.4:c.9492T>G, NM_018136.4:c.9539A>C	Primary autosomal recessive microcephaly type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPM gene located on chromosomal region 1q31. The age of onset is neonatal/infantile. This disease is characterized by a reduction in head circumference at birth, mild to moderate non-progressive intellectual impairment and delay in early motor milestones, speech delay and hyperactive behavior are common. The annual incidence is 1:1,000,000.	250,600
ASS1	Citrullinemia type 1	NM_000050.4	NM_000050.4:c.421-2A>G, NM_000050.4:c.40G>A, NM_000050.4:c.1088G>A, NM_000050.4:c.470G>A, NM_000050.4:c.1085G>T, NM_000050.4:c.1087C>T, NM_000050.4:c.257G>A, NM_000050.4:c.323G>T, NM_000050.4:c.349G>A, NM_000050.4:c.380G>A, NM_000050.4:c.836G>A, NM_000050.4:c.910C>T, NM_000050.4:c.928A>C, NM_000050.4:c.496-2A>G, NM_000050.4:c.535T>C, NM_000050.4:c.539G>A, NM_000050.4:c.53C>T, NM_000050.4:c.571G>A, NM_000050.4:c.787G>A, NM_000050.4:c.793C>T, NM_000050.4:c.794G>A, NM_000050.4:c.805G>A, NM_000050.4:c.835C>T, NM_000050.4:c.919C>T, NM_000050.4:c.970G>A, NM_000050.4:c.814C>T, NM_000050.4:c.970+5G>A, NM_000050.4:c.1168G>A, NM_000050.4:c.1194-1G>C, NM_000050.4:c.256C>T	Citrullinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASS1 gene located on chromosomal region 9q34.1. The age of onset is variable. This disease is characterized by hyperammonemia, progressive lethargy, poor feeding and vomiting in the neonatal form and by variable hyperammonemia in the later-onset form. The prevalence is 1:100,000-9:100,000.	250,600
ATIC	AICA-ribosiduria	NM_004044.6	NM_004044.6:c.223+1G>A, NM_004044.6:c.1277A>G, NM_004044.6:c.625delG	AICA-ribosiduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATIC gene located on chromosomal region 2q35. The age of onset is neonatal/infantile. This disease is characterized by profound intellectual deficit, epilepsy, dysmorphic features of the knees, elbows, and shoulders and congenital blindness. The prevalence is <1:1,000,000.	250,600
ATP7B	Wilson disease	NM_000053.3	NM_000053.3:c.2532delA, NM_000053.3:c.2356-2A>G, NM_000053.3:c.1285+5G>T, NM_000053.3:c.2305A>G, NM_000053.3:c.1145_1151delCCCAACT, NM_000053.3:c.1934T>G, NM_000053.3:c.2071G>A, NM_000053.3:c.2297C>G, NM_000053.3:c.2972C>T, NM_000053.3:c.2975C>T, NM_000053.3:c.3083delA, NM_000053.3:c.2605G>A, NM_000053.3:c.2621C>T, NM_000053.3:c.2755C>G, NM_000053.3:c.2755C>T, NM_000053.3:c.2762G>A, NM_000053.3:c.2795C>A, NM_000053.3:c.2804C>T, NM_000053.3:c.2807T>A, NM_000053.3:c.2906G>A, NM_000053.3:c.2930C>T, NM_000053.3:c.4301C>T, NM_000053.3:c.915T>A, NM_000053.3:c.98T>C, NM_000053.3:c.1745_1746delTA, NM_000053.3:c.2123T>C, NM_000053.3:c.2267C>T, NM_000053.3:c.4088C>T, NM_000053.3:c.4135C>T, NM_000053.3:c.1512_1513insT, NM_000053.3:c.19_20delCA, NM_000053.3:c.1922T>C, NM_000053.3:c.3955C>T, NM_000053.3:c.3990_3993delTTAT, NM_000053.3:c.4058G>A, NM_000053.3:c.3207C>A, NM_000053.3:c.3359T>A, NM_000053.3:c.3688A>G, NM_000053.3:c.3101A>G, NM_000053.3:c.3796G>A, NM_000053.3:c.3809A>G, NM_000053.3:c.562C>T, NM_000053.3:c.3694A>C, NM_000053.3:c.1846C>T	Wilson disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATP7B gene located on chromosomal region 13q14.3. The age of onset is infantile. This disease is characterized by the toxic accumulation of copper, mainly in the liver and central nervous system, and symptomatic patients may present with hepatic, neurologic or psychiatric forms. The birth incidence is 1:30,000-1:100,000 in France and The prevalence is 1:10,000-1:30,000.	250,600
ATR	Seckel syndrome type 1	NM_001184.3	NM_001184.3:c.2341+1G>A, NM_001184.3:c.5645delA, NM_001184.3:c.6037_6038insA, NM_001184.3:c.6488delT, NM_001184.3:c.975_976delCT, NM_001184.3:c.5635G>T	Seckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATR gene located on chromosomal region 3q23. The age of onset is neonatal/infantile. This disease is characterized by a proportionate dwarfism of prenatal onset, a severe microcephaly with a bird-headed like appearance and mental retardation. The prevalence is <1:1,000,000.	250,600
BCKDHA	Maple syrup urine disease type 1A	NM_000709.3	NM_000709.3:c.1037G>A, NM_000709.3:c.1036C>T, NM_000709.3:c.1234G>A, NM_000709.3:c.14delT, NM_000709.3:c.761C>A, NM_000709.3:c.929C>G, NM_000709.3:c.964C>T, NM_000709.3:c.979G>A, NM_000709.3:c.905A>C, NM_000709.3:c.632C>T, NM_000709.3:c.659C>T, NM_000709.3:c.740_741insT, NM_000709.3:c.868G>A, NM_000709.3:c.909_910delGT, NM_000709.3:c.917delT, NM_000709.3:c.853G>C, NM_000709.3:c.796delA	Maple syrup urine disease type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHA gene located on chromosomal region 19q13.1-13.2. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:1,000,000-9:1,000,000.	250,600
BCS1L	Björnstad syndrome	NM_004328.4	NM_004328.4:c.548G>A	Björnstadt syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal/infantile. This disease is characterized by congenital sensorineural hearing loss and pili torti. The prevalence is <1:1,000,000.	250,600
BCS1L	GRACILE syndrome	NM_004328.4	NM_004328.4:c.232A>G	GRACILE syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal/infantile. This disease is characterized by fetal growth restriction (GR), aminoaciduria (A), cholestasis (C), iron overload (I), lactacidosis (L) and early death (E). The birth incidence is 1:50,000 in Finland and the prevalence is <1:1,000,000.	250,600
BCS1L	Mitochondrial comlpex III deficiency, nuclear type 1	NM_004328.4	NM_004328.4:c.1057G>A, NM_004328.4:c.830G>A, NM_004328.4:c.133C>T, NM_004328.4:c.103G>C, NM_004328.4:c.696delT, NM_004328.4:c.148A>G, NM_004328.4:c.166C>T, NM_004328.4:c.550C>T, NM_004328.4:c.547C>T	Mitochondrial comlpex III deficiency, nuclear type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal and it is characterized by lactic acidosis, hypotonia, hypoglycemia, failure to thrive, encephalopathy, and delayed psychomotor development.	250,600
BEST1	Bestrophinopathy	NM_004183.3	NM_004183.3:c.934G>A, NM_004183.3:c.598C>T, NM_004183.3:c.752G>A, NM_004183.3:c.949G>A, NM_004183.3:c.521_522delTG	Bestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram.	250,600
BEST1	Retinitis pigmentosa type 50	NM_004183.3	NM_004183.3:c.1383_1384insGCCTTGATGGA, NM_004183.3:c.1444delG, NM_004183.3:c.1491_1497dupCAAAGAC, NM_004183.3:c.1566_1576dupCTTGATGGAGC, NM_004183.3:c.341_342delTG, NM_004183.3:c.1308_1309insACCAAAG, NM_004183.3:c.1264delG, NM_004183.3:c.418C>G, NM_004183.3:c.614T>C, NM_004183.3:c.682G>A, NM_004183.3:c.344delG, NM_004183.3:c.524delG	Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 50 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q12.3. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.	250,600
BEST1	Vitelliform macular dystrophy type 2	NM_004183.3	NM_004183.3:c.122T>C, NM_004183.3:c.422G>A	Vitelliform macular dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q12.3. The age of onset is infancy or adolescence. This disease is characterized by normal vision at birth, then progresses through distinct stages that include an asymptomatic previtelliform phase (stage 1) followed by the formation of a yellow, egg yolk-like (vitelliform) lesion in the macula (stage 2). The contents become less homogenous and develop a "scrambled-egg" appearance (stage 2a). The lesion eventually develops a fluid, yellow-colored vitelline substance (pseudohypopyon or stage 3) and finally breaks down, leaving a scar that causes central visual acuity deterioration (20/200). This may be complicated by a subfoveal choroidal neovascular (CNV) membrane (rare in children). Anomalous color discrimination (mainly the protan axis) and metamorphopsia may be observed but patients retain normal peripheral vision and dark adaptation. Some affected individuals remain asymptomatic. The prevalence is 1/5,000 to 1/67,000.	250,600
BRCA2	Fanconi anemia, complementation group D1	NM_000059.3	NM_000059.3:c.1514T>C, NM_000059.3:c.4648G>T, NM_000059.3:c.8415A>T, NM_000059.3:c.7544C>T, NM_000059.3:c.7994A>G, NM_000059.3:c.5574_5577delAATT, NM_000059.3:c.4889C>G, NM_000059.3:c.4936_4939delGAAA, NM_000059.3:c.5066_5067insA, NM_000059.3:c.6024dupG, NM_000059.3:c.6860delG, NM_000059.3:c.7235C>A, NM_000059.3:c.9382C>T, NM_000059.3:c.9900dupA, NM_000059.3:c.3847_3848delGT, NM_000059.3:c.5718_5719delCT, NM_000059.3:c.5837_5838delCAinsAG, NM_000059.3:c.6023_6024insG, NM_000059.3:c.8503T>C, NM_000059.3:c.6486_6489delACAA, NM_000059.3:c.657_658delTG, NM_000059.3:c.6997_6998insT	Fanconi anemia, complementation group D1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BRCA2 gene located on chromosomal region 13q12.3. The age of onset is infantile. This disease is characterized by physical abnormalities, bone marrow failure, and increased risk of malignancy. The prevalence is 1:1,000,000-9:1,000,000.	250,600
BRIP1	Fanconi anemia, complementation group J	NM_032043.2	NM_032043.2:c.2990_2993delCAAA, NM_032043.2:c.1045G>C, NM_032043.2:c.2237_2240delTCAA, NM_032043.2:c.3209C>A, NM_032043.2:c.502C>T, NM_032043.2:c.139C>G, NM_032043.2:c.1702_1703delAA, NM_032043.2:c.2392C>T	Fanconi anemia, complementation group J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BRIP1 gene located on chromosomal region 17q22.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:1,000,000- 9:1,000,000.	250,600
BSND	Bartter syndrome type 4A	NM_057176.2	NM_057176.2:c.1A>T, NM_057176.2:c.22C>T, NM_057176.2:c.3G>A, NM_057176.2:c.10G>T, NM_057176.2:c.23G>T, NM_057176.2:c.35T>C, NM_057176.2:c.23G>A, NM_057176.2:c.139G>A	Bartter syndrome type 4A with deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSND gene located on chromosomal region 1p32.3. The age of onset is neonatal/infantile. This disease is characterized by maternal polyhydramnios, premature delivery, polyuria, sensorineural deafness and is associated with hypokalemic alkalosis, increased levels of plasma renin and aldosterone, low blood pressure, and vascular resistance to angiotensin II.	250,600
BTD	Biotinidase deficiency	NM_000060.3	NM_000060.3:c.1531C>G, NM_000060.3:c.1508_1512delGGATG, NM_000060.3:c.1339C>T, NM_000060.3:c.1352G>A, NM_000060.3:c.1489C>T, NM_000060.3:c.643C>T, NM_000060.3:c.664G>A, NM_000060.3:c.755A>G, NM_000060.3:c.1368A>C, NM_000060.3:c.933delT, NM_000060.3:c.1595C>T, NM_000060.3:c.1612C>T, NM_000060.3:c.757C>T, NM_000060.3:c.1106C>T, NM_000060.3:c.1321delG, NM_000060.3:c.794A>T, NM_000060.3:c.595G>A, NM_000060.3:c.629A>G, NM_000060.3:c.631C>T, NM_000060.3:c.235C>T, NM_000060.3:c.334G>C, NM_000060.3:c.511G>A, NM_000060.3:c.184G>A, NM_000060.3:c.557G>A, NM_000060.3:c.583A>G, NM_000060.3:c.968A>G, NM_000060.3:c.528G>T, NM_000060.3:c.443G>A	Biotinidase deficiency an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BTD gene located on chromosomal region 3p25. The age of onset is neonatal/infantile. This disease is characterized by seizures, breathing difficulties, hypotonia, skin rash, alopecia, hearing loss and delayed development.	250,600
CAPN3	Limb-girdle muscular dystrophy type 2A	NM_000070.2	NM_000070.2:c.1838delA, NM_000070.2:c.2120A>G, NM_000070.2:c.1795_1796insA, NM_000070.2:c.1469G>A, NM_000070.2:c.1599_1602delGAGC, NM_000070.2:c.1715G>A, NM_000070.2:c.1743_1745+1delTGAG, NM_000070.2:c.257C>T, NM_000070.2:c.328C>T, NM_000070.2:c.549delA, NM_000070.2:c.2212C>T, NM_000070.2:c.223dupT, NM_000070.2:c.2243G>A, NM_000070.2:c.2251_2254dupGTCA, NM_000070.2:c.2257G>A, NM_000070.2:c.2306G>A, NM_000070.2:c.2361_2363delAGinsTCATCT, NM_000070.2:c.2361_2364delAGinsTCATCT, NM_000070.2:c.2362_2363delAGinsTCATCT, NM_000070.2:c.246G>A, NM_000070.2:c.676G>A, NM_000070.2:c.551C>T, NM_000070.2:c.580delT, NM_000070.2:c.133G>A, NM_000070.2:c.550delA, NM_000070.2:c.1468C>T, NM_000070.2:c.956C>T, NM_000070.2:c.1322delG, NM_000070.2:c.1466G>A, NM_000070.2:c.662G>T, NM_000070.2:c.855_864dupGTTGATTGCA, NM_000070.2:c.1610A>G, NM_000070.2:c.598_612delTTCTGGAGTGCTCTG	Limb-girdle muscular dystrophy type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CAPN3 gene located on chromosomal region 15q15.1. The age of onset is variable. This disease is characterized by symmetrical and selective atrophy and weakness of proximal limb and girdle muscles. The prevalence is 1:100,000- 9:100,000.	250,600
CBS	Homocystinuria	NM_000071.2	NM_000071.2:c.1150A>G, NM_000071.2:c.1058C>T, NM_000071.2:c.1136G>A, NM_000071.2:c.341C>T, NM_000071.2:c.1006C>T, NM_000071.2:c.325T>C, NM_000071.2:c.1316G>A, NM_000071.2:c.374G>A, NM_000071.2:c.1265C>T, NM_000071.2:c.1280C>T, NM_000071.2:c.146C>T, NM_000071.2:c.1471C>T, NM_000071.2:c.1616T>C, NM_000071.2:c.162G>A, NM_000071.2:c.833T>C, NM_000071.2:c.904G>A, NM_000071.2:c.919G>A, NM_000071.2:c.393G>C, NM_000071.2:c.415G>A, NM_000071.2:c.430G>A, NM_000071.2:c.434C>T, NM_000071.2:c.502G>A, NM_000071.2:c.526G>T, NM_000071.2:c.572C>T, NM_000071.2:c.676G>A, NM_000071.2:c.689delT, NM_000071.2:c.797G>A, NM_000071.2:c.959T>C, NM_000071.2:c.969G>A, NM_000071.2:c.992C>A, NM_000071.2:c.1330G>A, NM_000071.2:c.1379C>T, NM_000071.2:c.1397C>T, NM_000071.2:c.304A>C	Homocystinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CBS gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by the multiple involvement of the eye, skeleton, central nervous system and vascular system. The prevalence is 1:200,000-1:335,000.	250,600
CC2D2A	Joubert syndrome type 9	NM_001080522.2	NM_001080522.2:c.4179delG, NM_001080522.2:c.3594+1G>A, NM_001080522.2:c.3289delG, NM_001080522.2:c.4582C>T, NM_001080522.2:c.4667A>T, NM_001080522.2:c.2848C>T, NM_001080522.2:c.3364C>T, NM_001080522.2:c.4333C>T, NM_001080522.2:c.4181delG	Joubert syndrome type 9 defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized neonatal hypotonia, developmental delay, intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia, primary position nystagmus and congenital hepatic fibrosis.	250,600
CC2D2A	Meckel syndrome type 6	NM_001080522.2	NM_001080522.2:c.3145C>T, NM_001080522.2:c.2486+1G>C	Meckel syndrome type 6 with hepatic defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized by a combination of renal cysts, developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and polydactyly.	250,600
CDH23	Deafness type 12, autosomal recessive	NM_022124.5	NM_022124.5:c.6442G>A, NM_022124.5:c.5663T>C, NM_022124.5:c.9565C>T, NM_022124.5:c.7823G>A, NM_022124.5:c.902G>A	Non-syndromic autosomal recessive deafness type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	250,600
CDH23	Usher syndrome type 1D	NM_022124.5	NM_022124.5:c.288+1G>A, NM_022124.5:c.193delC, NM_022124.5:c.6050-9G>A, NM_022124.5:c.3141C>A, NM_022124.5:c.146-2A>G, NM_022124.5:c.4504C>T, NM_022124.5:c.3516_3519delATCC, NM_022124.5:c.3579+2T>C, NM_022124.5:c.3293A>G, NM_022124.5:c.9319+1_9319+4delGTAA, NM_022124.5:c.5237G>A, NM_022124.5:c.1858+2T>G, NM_022124.5:c.6392delC, NM_022124.5:c.7660G>A	Usher syndrome type 1D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by sensorineural deafness, retinitis pigmentosa and progressive vision loss.	250,600
CDHR1	Retinitis pigmentosa type 65	NM_033100.3	NM_033100.3:c.1485+2T>C, NM_033100.3:c.1463delG, NM_033100.3:c.1110delC, NM_033100.3:c.338delG, NM_033100.3:c.524dupA, NM_033100.3:c.1485+2T>G, NM_033100.3:c.1112delC, NM_033100.3:c.640delG	Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 65 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDHR1 gene located on chromosomal region 10q23.1. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.	250,600
CENPJ	Microcephaly primary, type 6, autosomal recessive	NM_018451.4	NM_018451.4:c.3243_3246delTCAG, NM_018451.4:c.2614delT, NM_018451.4:c.3415G>T, NM_018451.4:c.3653C>T, NM_018451.4:c.2462C>T, NM_018451.4:c.3699_3702dupAATA, NM_018451.4:c.3568_3571dupGTCA, NM_018451.4:c.3843_3844insTA, NM_018451.4:c.757_760delGTCT, NM_018451.4:c.1952_1953insAGTG, NM_018451.4:c.3704A>T, NM_018451.4:c.232_236delCAGAA, NM_018451.4:c.2460_2463delGACG, NM_018451.4:c.2968_2972delAAAAA, NM_018451.4:c.40C>T, NM_018451.4:c.289dupA	Primary autosomal recessive microcephaly type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CENPJ gene located on chromosomal region 13q12.12. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.	250,600
CEP290	Joubert syndrome, Senior-Loken type	NM_025114.3	NM_025114.3:c.5611_5614delCAAA, NM_025114.3:c.164_167delCTCA	Joubert syndrome, Senior-Loken type syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infantile. This disease is characterized by symptoms of nephronophthisis such as polyuria, polydipsia, secondary eneuresis and anemia. The progression of the disease can lead to acute or chronic renal insufficiency and finally to end-stage kidney disease. Ocular features include congenital or early-onset severe visual loss, due to retinal dystrophy. In rare occasions, other additional clinical signs may be observed like liver fibrosis, obesity and neurologic disorders.. The prevalence is <1:1,000,000.	250,600
CEP290	Joubert syndrome type 5	NM_025114.3	NM_025114.3:c.4656delA, NM_025114.3:c.21G>T, NM_025114.3:c.5668G>T	Joubert syndrome with oculorenal defect 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infantile. This disease is characterized by neonatal hypotonia, developmental delay, intellectrual disability, ataxia, abnormal eye movements including oculomotor apraxia, primary position nystagmus and renal and ocular disease.	250,600
CEP290	Leber congenital amaurosis type 10	NM_025114.3	NM_025114.3:c.7341_7342insA, NM_025114.3:c.4705-1G>T, NM_025114.3:c.4723A>T, NM_025114.3:c.4962_4963delAA, NM_025114.3:c.4916C>A, NM_025114.3:c.6624delG, NM_025114.3:c.6645+1G>A, NM_025114.3:c.7324G>T, NM_025114.3:c.6798G>A, NM_025114.3:c.7394_7395delAG, NM_025114.3:c.1681C>T, NM_025114.3:c.7341delA, NM_025114.3:c.6448_6455delCAGTTGAA, NM_025114.3:c.1665_1666delAA, NM_025114.3:c.384_387delTAGA, NM_025114.3:c.2249T>G, NM_025114.3:c.3185delT, NM_025114.3:c.4393C>T, NM_025114.3:c.1501G>T	Leber congenital amaurosis type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infancy/neonatal. This disease is characterized by retinal dystrophy defined by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.	250,600
CEP290	Meckel syndrome type 4	NM_025114.3	NM_025114.3:c.613C>T	Meckel syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is neonatal. This disease is characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically occipital encephalocele), hepatic ductal dysplasia and cysts, and postaxial polydactyly. The prevalence is <1 / 1,000,000.	250,600
CERKL	Retinitis pigmentosa tipo 26	NM_201548.4	NM_201548.4:c.1012C>T, NM_201548.4:c.1090C>T, NM_201548.4:c.312delA, NM_201548.4:c.715C>T, NM_201548.4:c.769C>T, NM_201548.4:c.780delT, NM_201548.4:c.847C>T, NM_201548.4:c.1553_1569dupTTATCAGTCTTTATGGA	Retinitis pigmentosa 26 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CERKL gene located on chromosomal region 2q31.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	250,600
CFH	Complement factor H deficiency	NM_000186.3	NM_000186.3:c.3628C>T, NM_000186.3:c.2876G>A, NM_000186.3:c.380G>T, NM_000186.3:c.481G>T, NM_000186.3:c.1606T>C	Immunodeficiency with factor H anomaly follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFH gene located on chromosomal region 1q32. This disease is characterized by recurrent bacterial infections and renal failure.	250,600
CFTR	Cystic fibrosis	NM_000492.3	NM_000492.3:c.1327_1330dupGATA, NM_000492.3:c.1210-7_1210-6delTT, NM_000492.3:c.125C>T, NM_000492.3:c.1301_1307delCACTTCT, NM_000492.3:c.1397C>A, NM_000492.3:c.1340delA, NM_000492.3:c.1364C>A, NM_000492.3:c.1393-1G>A, NM_000492.3:c.1438G>T, NM_000492.3:c.1466C>A, NM_000492.3:c.1475C>T, NM_000492.3:c.1477C>T, NM_000492.3:c.1516A>G, NM_000492.3:c.1519_1521delATC, NM_000492.3:c.1521_1523delCTT, NM_000492.3:c.1545_1546delTA, NM_000492.3:c.1624G>T, NM_000492.3:c.1692delA, NM_000492.3:c.1706A>G, NM_000492.3:c.1721C>A, NM_000492.3:c.178G>T, NM_000492.3:c.1970delG, NM_000492.3:c.200C>T, NM_000492.3:c.2012delT, NM_000492.3:c.2051_2052delAAinsG, NM_000492.3:c.2052_2053insA, NM_000492.3:c.2052delA, NM_000492.3:c.1000C>T, NM_000492.3:c.1007T>A, NM_000492.3:c.1013C>T, NM_000492.3:c.1021T>C, NM_000492.3:c.1022_1023insTC, NM_000492.3:c.1040G>A, NM_000492.3:c.1040G>C, NM_000492.3:c.1055G>A, NM_000492.3:c.1081delT, NM_000492.3:c.115C>T, NM_000492.3:c.2538G>A, NM_000492.3:c.254G>A, NM_000492.3:c.2551C>T, NM_000492.3:c.2583delT, NM_000492.3:c.262_263delTT, NM_000492.3:c.2657+5G>A, NM_000492.3:c.2668C>T, NM_000492.3:c.273+1G>A, NM_000492.3:c.2737_2738insG, NM_000492.3:c.2739T>A, NM_000492.3:c.274-1G>A, NM_000492.3:c.274G>A, NM_000492.3:c.274G>T, NM_000492.3:c.2780T>C, NM_000492.3:c.2834C>T, NM_000492.3:c.2855T>C, NM_000492.3:c.2869_2870insG, NM_000492.3:c.2875delG, NM_000492.3:c.2908G>C, NM_000492.3:c.292C>T, NM_000492.3:c.2939T>A, NM_000492.3:c.2989-1G>A, NM_000492.3:c.3067_3072delATAGTG, NM_000492.3:c.3140-26A>G, NM_000492.3:c.3194T>C, NM_000492.3:c.3196C>T, NM_000492.3:c.3197G>A, NM_000492.3:c.3230T>C, NM_000492.3:c.325_327delTATinsG, NM_000492.3:c.3266G>A, NM_000492.3:c.3276C>A, NM_000492.3:c.3276C>G, NM_000492.3:c.328G>C, NM_000492.3:c.328G>T, NM_000492.3:c.3302T>A, NM_000492.3:c.3310G>T, NM_000492.3:c.349C>T, NM_000492.3:c.350G>T, NM_000492.3:c.3528delC, NM_000492.3:c.3533_3536delCAAC, NM_000492.3:c.3587C>G, NM_000492.3:c.358G>A, NM_000492.3:c.3611G>A, NM_000492.3:c.3612G>A, NM_000492.3:c.3659delC, NM_000492.3:c.366T>A, NM_000492.3:c.3731G>A, NM_000492.3:c.3744delA, NM_000492.3:c.3752G>A, NM_000492.3:c.3761T>G, NM_000492.3:c.3764C>A, NM_000492.3:c.3773_3774insT, NM_000492.3:c.3846G>A, NM_000492.3:c.3909C>G, NM_000492.3:c.3937C>T, NM_000492.3:c.4056G>T, NM_000492.3:c.4077_4080delinsAA, NM_000492.3:c.4077_4080delTGTTinsAA, NM_000492.3:c.4251delA, NM_000492.3:c.4333G>A, NM_000492.3:c.4426C>T, NM_000492.3:c.442delA, NM_000492.3:c.445G>A, NM_000492.3:c.445G>T, NM_000492.3:c.446G>T, NM_000492.3:c.531delT, NM_000492.3:c.532G>A, NM_000492.3:c.571T>G, NM_000492.3:c.577G>T, NM_000492.3:c.579+1G>T, NM_000492.3:c.579+3A>G, NM_000492.3:c.579+5G>A, NM_000492.3:c.592G>A, NM_000492.3:c.595C>T, NM_000492.3:c.613C>T, NM_000492.3:c.617T>G, NM_000492.3:c.650A>G, NM_000492.3:c.658C>T, NM_000492.3:c.708delT, NM_000492.3:c.722_743delGGAGAATGATGATGAAGTACAG, NM_000492.3:c.803delA, NM_000492.3:c.935_937delTCT, NM_000492.3:c.988G>T, NM_000492.3:c.1046C>T, NM_000492.3:c.14C>T, NM_000492.3:c.1558G>A, NM_000492.3:c.1585-1G>A, NM_000492.3:c.1684G>C, NM_000492.3:c.1766+1G>A, NM_000492.3:c.1397C>G, NM_000492.3:c.1399C>T, NM_000492.3:c.1400T>C, NM_000492.3:c.3380G>A, NM_000492.3:c.3409A>G, NM_000492.3:c.3868C>A, NM_000492.3:c.489+1G>T, NM_000492.3:c.2537G>A, NM_000492.3:c.2125C>T, NM_000492.3:c.2128A>T, NM_000492.3:c.2175_2176insA, NM_000492.3:c.2052dupA, NM_000492.3:c.2195T>G, NM_000492.3:c.2215delG, NM_000492.3:c.223C>T, NM_000492.3:c.2175dupA, NM_000492.3:c.221G>A, NM_000492.3:c.2930C>T, NM_000492.3:c.3205G>A, NM_000492.3:c.2249C>T	Cystic fibrosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFTR gene located on chromosomal region 7q31.2. The age of onset of severe form is neonatal or infantile but there are also variants associated with moderate clinical or late onset. This disease is characterized by the production of sweat with a high salt content, mucus secretions with an abnormal viscosity, chronic bronchitis, pancreatic insufficiency, adolescent diabetes and, more rarely, stercoral obstruction and cirrhosis. Male sterility is a constant feature. Late-onset forms, which are usually only mild or monosymptomatic. The prevalence is 1:10,000-9:10,000.	250,600
CHST6	Macular corneal dystrophy	NM_021615.4	NM_021615.4:c.820G>T, NM_021615.4:c.853delC, NM_021615.4:c.993G>T, NM_021615.4:c.327_328delCT, NM_021615.4:c.392C>A	Macular corneal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CHST6 gene located on chromosomal region 16q22. The age of onset is variable. This disease is characterized by bilateral ill-defined cloudy regions within a hazy stroma, and eventually severe visual impairment. The prevalence is 1:100,000-9:100,000.	250,600
CLCN1	Myotonia congenita, autosomal recessive	NM_000083.2	NM_000083.2:c.1453A>G, NM_000083.2:c.409T>G, NM_000083.2:c.568G>A, NM_000083.2:c.899G>A, NM_000083.2:c.1169G>A, NM_000083.2:c.1238T>G, NM_000083.2:c.871G>A, NM_000083.2:c.180+3A>T, NM_000083.2:c.225dupC, NM_000083.2:c.501C>G, NM_000083.2:c.2680C>T	Myotonia congenita (Becker disease) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN1 gene located on chromosomal region 7q35. The age of onset is neonatal/infantile. This disease is characterized by slow muscle relaxation, that it is relieved with exercise, associated with hyperexcitation of the muscle fibres. The prevalence is 1:100,000.	250,600
CLDN19	Hypomagnesemia type 5, renal failure with severe ocular abnormalities	NM_148960.2	NM_148960.2:c.269T>C, NM_148960.2:c.425_437delCCCTGGTGACCCA, NM_148960.2:c.59G>A, NM_148960.2:c.169C>G, NM_148960.2:c.599G>A	Hypomagnesemia type 5, renal failure with severe ocular abnormalities follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN19 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by excessive magnesium and calcium renal wasting, bilateral nephrocalcinosis, progressive renal failure and severe ocular abnormalities. The prevalence is <1:1,000,000.	250,600
CLRN1	Retinitis pigmentosa type 61	NM_174878.2	NM_174878.2:c.92C>T	Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 61 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1gene located on chromosomal region 3q25.1. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.	250,600
CLRN1	Usher syndrome type 3A	NM_174878.2	NM_174878.2:c.591_592insT, NM_174878.2:c.630_631insT, NM_174878.2:c.118T>G, NM_174878.2:c.433+1061A>T, NM_174878.2:c.189C>A, NM_174878.2:c.144T>G	Usher syndrome type 3A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1 gene located on chromosomal region 3q25.1. The age of onset is neonatal/infantile. This disease is characterized by the association of sensorineural deafness with retinitis pigmentosa and progressive vision loss. The prevalence is 1:1.000.000- 9/1.000.000.	250,600
CNGA1	Retinitis pigmentosa type 49	NM_000087.3	NM_000087.3:c.1747C>T, NM_000087.3:c.1540C>T, NM_000087.3:c.2071T>C, NM_000087.3:c.1927C>T, NM_000087.3:c.1271G>A, NM_000087.3:c.1001G>A, NM_000087.3:c.959C>T, NM_000087.3:c.97_98insA, NM_000087.3:c.449+2T>C, NM_000087.3:c.1972delA, NM_000087.3:c.238G>T, NM_000087.3:c.794G>A, NM_000087.3:c.238G>A	Retinitis pigmentosa 49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGA1 gene located on chromosomal region 4p12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	250,600
CNGB1	Retinitis pigmentosa tipo 45	NM_001297.4	NM_001297.4:c.3150delG, NM_001297.4:c.2762_2765delACGA, NM_001297.4:c.2957A>T, NM_001297.4:c.413-1G>A, NM_001297.4:c.218-2A>G, NM_001297.4:c.2492+2T>G, NM_001297.4:c.3462+1G>A, NM_001297.4:c.2653delG, NM_001297.4:c.3425delT, NM_001297.4:c.1122-2A>T, NM_001297.4:c.1958-1G>A, NM_001297.4:c.952C>T	Retinitis pigmentosa 45 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB1 gene located on chromosomal region 16q13. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000 to 5:10,000.	250,600
CNGB3	Achromatopsia type 3	NM_019098.4	NM_019098.4:c.2011G>T, NM_019098.4:c.1063C>T, NM_019098.4:c.1208G>A, NM_019098.4:c.1672G>T, NM_019098.4:c.819_826delCAGACTCC, NM_019098.4:c.1148delC, NM_019098.4:c.886_890delACTTC, NM_019098.4:c.2048_2049delCA, NM_019098.4:c.446_447insT, NM_019098.4:c.893_897delCAAAA, NM_019098.4:c.887_896delCTTCTACAAA	Achromatopsia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is neonatal/Infantile. This disease is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, and reduced or complete loss of color discrimination. Most individuals have complete form, with total lack of function in all three types of cones. Rarely, individuals have incomplete form, with similar, but generally less severe symptoms. The prevalence is 1/30,000-1/50,000.	250,600
CNGB3	Macular degeneration, juvenile	NM_019098.4	NM_019098.4:c.1405T>G	Juvenile macular degeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is infancy or adolescence. This disease is characterized by blurred or distorted central vision with dark areas. Normally, side vision is not affected, but the perception of color can vary during the later stages of the disease.	250,600
COL17A1	Epidermolysis bullosa, junctional, non-Herlitz type	NM_000494.3	NM_000494.3:c.1898G>A, NM_000494.3:c.3827_3828insC, NM_000494.3:c.2228-3_2235delCAGGTCCTGCTinsTTG, NM_000494.3:c.1706delC, NM_000494.3:c.2336-2A>G, NM_000494.3:c.3897_3900delATCT, NM_000494.3:c.3908G>A, NM_000494.3:c.2336-1G>T, NM_000494.3:c.2965delA, NM_000494.3:c.3043C>T, NM_000494.3:c.3067C>T, NM_000494.3:c.3277+1G>A, NM_000494.3:c.3676C>T, NM_000494.3:c.4319_4320insC, NM_000494.3:c.433C>T, NM_000494.3:c.520_521delAG, NM_000494.3:c.4003_4004delGG, NM_000494.3:c.2551+1G>T, NM_000494.3:c.3800delC, NM_000494.3:c.2564T>G, NM_000494.3:c.2430_2431insCCGA, NM_000494.3:c.2383C>T, NM_000494.3:c.2944_2947+1delGAAGG	Epidermolysis bullosa, junctional, non-Herlitz type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL17A1 gene located on chromosomal region 10q24.3. The age of onset is neonatal/infantile. This disease is characterized by a generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.	250,600
COL18A1	Knobloch syndrome type 1	NM_030582.3	NM_030582.3:c.3367_3379delCCCCCAGGCCCAC, NM_030582.3:c.3493_3501delGGCCCCCCA, NM_030582.3:c.2797C>T, NM_030582.3:c.995_996insGACGTGAAAGAGGGG, NM_030582.3:c.3502_3511delGGCCCCCCAG, NM_030582.3:c.3618_3618+1delGG, NM_030582.3:c.994_995insGGACGTGAAAGAGGG, NM_030582.3:c.3517_3518delCC, NM_030582.3:c.1535_1536insGACGTGAAAGAGGGG, NM_030582.3:c.2589_2590delAG, NM_030582.3:c.4054_4055delCT, NM_030582.3:c.4463_4464insG	Knobloch syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL18A1 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by vitreoretinal and macular degeneration, and occipital encephalocele. The prevalence is <1:1,000,000.	250,600
COL4A3	Alport syndrome, autosomal recessive	NM_000091.4	NM_000091.4:c.345delG, NM_000091.4:c.346C>A, NM_000091.4:c.898G>A, NM_000091.4:c.4421T>C, NM_000091.4:c.2110delC, NM_000091.4:c.343delG, NM_000091.4:c.4420_4424delCTTTT, NM_000091.4:c.5002_*6delAAAAGACACTGAAGCTAA, NM_000091.4:c.2083G>A, NM_000091.4:c.2954G>T, NM_000091.4:c.4484A>G, NM_000091.4:c.4571C>G, NM_000091.4:c.4441C>T	Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.	250,600
COL4A4	Alport syndrome, autosomal recessive	NM_000092.4	NM_000092.4:c.3713C>A, NM_000092.4:c.4129C>T, NM_000092.4:c.4923C>A, NM_000092.4:c.3601G>A, NM_000092.4:c.2312delG, NM_000092.4:c.71+1G>A	Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.	250,600
COL7A1	Epidermolysis bullosa dystrophica, Hallopeau-Siemens type	NM_000094.3	NM_000094.3:c.4039G>C, NM_000094.3:c.425A>G, NM_000094.3:c.336C>G, NM_000094.3:c.3809C>T, NM_000094.3:c.4119+1G>T, NM_000094.3:c.6205C>T, NM_000094.3:c.6527_6528insC, NM_000094.3:c.6573+1G>T, NM_000094.3:c.6187C>T, NM_000094.3:c.6752G>A, NM_000094.3:c.6859G>A, NM_000094.3:c.6946G>A, NM_000094.3:c.6670G>T, NM_000094.3:c.1907G>T, NM_000094.3:c.2471_2472insG, NM_000094.3:c.7440+4delC, NM_000094.3:c.7912G>T, NM_000094.3:c.7930-1G>C, NM_000094.3:c.7957G>A, NM_000094.3:c.8245G>A, NM_000094.3:c.8371C>T, NM_000094.3:c.8393T>A, NM_000094.3:c.8440C>T, NM_000094.3:c.8479C>T, NM_000094.3:c.8524_8527+10delGAAGGTGAGGACAG, NM_000094.3:c.887delG, NM_000094.3:c.933C>A, NM_000094.3:c.238G>T, NM_000094.3:c.3831+1G>T, NM_000094.3:c.4373C>T, NM_000094.3:c.6091G>A, NM_000094.3:c.4888C>T, NM_000094.3:c.5052+1G>A, NM_000094.3:c.5096C>T, NM_000094.3:c.4783G>C, NM_000094.3:c.5443G>C, NM_000094.3:c.5532+1G>A, NM_000094.3:c.5821-1G>A, NM_000094.3:c.5287C>T, NM_000094.3:c.706C>T, NM_000094.3:c.7345-1G>A, NM_000094.3:c.592G>A, NM_000094.3:c.7411C>T	Epidermolysis bullosa dystrophica, Hallopeau-Siemens type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL7A1 gene located on chromosomal region 3p21.1. The age of onset is neonatal/infantile. This disease is characterized by generalized cutaneous and mucosal blistering and scarring associated with severe deformities and major extracutaneous involvement. The prevalence is <1:1,000,000.	250,600
COQ2	Primary coenzyme Q10 deficiency type 1	NM_015697.7	NM_015697.7:c.683A>G, NM_015697.7:c.1197delT, NM_015697.7:c.590G>A, NM_015697.7:c.723delT, NM_015697.7:c.890A>G	Coenzyme Q10 deficiency, primary follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ2 gene located on chromosomal region 4q21.23. The age of onset is neonatal/infantile. The phenotypes include an encephalomyopathic form with seizures and ataxia; a multisystem infantile form with encephalopathy, cardiomyopathy and renal failure; a predominantly cerebellar form with ataxia and cerebellar atrophy; Leigh syndrome with growth retardation; and an isolated myopathic form.	250,600
CPT2	Carnitine palmitoyltransferase deficiency, type 2	NM_000098.2	NM_000098.2:c.1239_1240delGA, NM_000098.2:c.1369A>T, NM_000098.2:c.1237C>T, NM_000098.2:c.680C>T, NM_000098.2:c.1437C>G, NM_000098.2:c.149C>A, NM_000098.2:c.1784delC, NM_000098.2:c.886C>T, NM_000098.2:c.1763C>G, NM_000098.2:c.359A>G, NM_000098.2:c.370C>T, NM_000098.2:c.1883A>C, NM_000098.2:c.1891C>T, NM_000098.2:c.1148T>A, NM_000098.2:c.638A>G, NM_000098.2:c.725_726delAC, NM_000098.2:c.452G>A, NM_000098.2:c.338C>T, NM_000098.2:c.481C>T, NM_000098.2:c.464dupT, NM_000098.2:c.520G>A	Carnitine palmitoyl transferase type 2 deficiency, infantile form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT2 gene located on chromosomal region 1p32. The age of onset is neonatal/infantile. This disease is characterized by a severe fasting intolerance leading to metabolic derangements of hypoketotic hypoglycemia, resulting in coma and seizures, and hepatic encephalopathy leading to liver failure. The prevalence is <1:1,000,000.	250,600
CRB1	Leber congenital amaurosis type 8	NM_201253.2	NM_201253.2:c.3299T>G, NM_201253.2:c.3383delT, NM_201253.2:c.3419T>A, NM_201253.2:c.3094G>A, NM_201253.2:c.936T>G, NM_201253.2:c.493_501delGATGGAATT, NM_201253.2:c.3997G>T, NM_201253.2:c.498_506delAATTGATGG, NM_201253.2:c.2688T>A, NM_201253.2:c.613_619delATAGGAA, NM_201253.2:c.2401A>T, NM_201253.2:c.610_616delGAAATAG	Leber congenital amaurosis follows an autosomal recessive pattern of inheritance. Type 8 is caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. The age of onset is neonatal/infancy. This disease comprises a group of early-onset childhood retinal dystrophies characterized by vision loss, nystagmus, and severe retinal dysfunction. Patients usually present at birth with profound vision loss and pendular nystagmus. Electroretinogram responses are usually nonrecordable. Other clinical findings may include high hypermetropia, photodysphoria, oculodigital sign, keratoconus, cataracts, and a variable appearance to the fundus.	250,600
CRB1	Pigmented paravenous chorioretinal atrophy	NM_201253.2	NM_201253.2:c.484G>A	Pigmented paravenous chorioretinal atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRB1 gene located on chromosomal region 19p12. The age of onset is variable. This disease is characterized by an unusual retinal degeneration characterized by accumulation of pigmentation along retinal veins.	250,600
CRB1	Retinitis pigmentosa type 12	NM_201253.2	NM_201253.2:c.3053_3054insTTATA, NM_201253.2:c.3122T>C, NM_201253.2:c.2416G>T, NM_201253.2:c.2843G>A, NM_201253.2:c.3299T>C, NM_201253.2:c.2983G>T, NM_201253.2:c.2290C>T	Retinitis pigmentosa 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	250,600
CRX	Leber congenital amaurosis type 7	NM_000554.4	NM_000554.4:c.425A>G, NM_000554.4:c.196G>A, NM_000554.4:c.898T>C	Leber congenital amaurosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRX gene located on chromosomal region 19q13.3. The age of onset is neonatal/infantile. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. The prevalence is 2:100,000-3:100,000 newborn.	250,600
CTNS	Cystinosis, ocular nonnephropathic	NM_004937.2	NM_004937.2:c.589G>A, NM_004937.2:c.853-3C>G	Ocular non nephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. It presents typical ocular findings of nephropathic cystinosis. However, systemic manifestations are absent and kidney disease does not occur. The prevalence is 1:100,000-1:200,000.	250,600
CTNS	Nephropathic cystinosis	NM_004937.2	NM_004937.2:c.416C>T, NM_004937.2:c.414G>A, NM_004937.2:c.124G>A, NM_004937.2:c.357_360delCAGC, NM_004937.2:c.397_398delAT, NM_004937.2:c.1015G>A, NM_004937.2:c.646dupA, NM_004937.2:c.283G>T, NM_004937.2:c.329G>T, NM_004937.2:c.506G>A	Nephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. This disease is characterized by hypothyroidism, insulin-dependent diabetes, hepatosplenomegaly with portal hypertension, and muscle, cerebral and ocular involvement, caused by cystine deposits in various organs. The prevalence is 1:100,000-1:200,000.	250,600
CTSK	Pycnodysostosis	NM_000396.3	NM_000396.3:c.236G>A, NM_000396.3:c.154A>T, NM_000396.3:c.436G>C, NM_000396.3:c.926T>C, NM_000396.3:c.721C>T	Pycnodysostosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSK gene located on chromosomal region 1q21. The age of onset is variable. This disease is characterized by osteosclerosis, short stature or dwarfism, acroosteolysis of the distal phalanges, fragile bones associated with spontaneous fractures and dysplasia of the clavicles. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
CYP4V2	Bietti crystalline corneoretinal dystrophy	NM_207352.3	NM_207352.3:c.1523G>A, NM_207352.3:c.130T>A, NM_207352.3:c.327+1G>A, NM_207352.3:c.332T>C	Bietti crystalline corneoretinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP4V2 gene located on chromosomal region 4q35.2. The age of onset is adult. This disease is characterized by nightblindness, decreased vision, paracentral scotoma, and, in the end stages of the disease, legal blindness.	250,600
CYP7B1	Congenital bile acid synthesis defect type 3	NM_004820.3	NM_004820.3:c.1162C>T	Congenital bile acid synthesis defect type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by severe neonatal cholestatic liver disease. The prevalence is below 1,000,000.	250,600
CYP7B1	Spastic paraplegia type 5A, autosomal recessive	NM_004820.3	NM_004820.3:c.1460_1461insT, NM_004820.3:c.321_324delACAA, NM_004820.3:c.825T>A, NM_004820.3:c.889A>G, NM_004820.3:c.1456C>T, NM_004820.3:c.187C>T	Autosomal recessive spastic paraplegia type 5A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. The prevalence is below 1,000,000.	250,600
D2HGDH	D-2-Hydroxyglutaric aciduria	NM_152783.4	NM_152783.4:c.1315A>G, NM_152783.4:c.1276G>A, NM_152783.4:c.440T>G, NM_152783.4:c.1333_1334delAC, NM_152783.4:c.1123G>T, NM_152783.4:c.1331T>C	D-2-Hydroxyglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the D2HGDH gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by extremely variable clinical manifestations, with severe cases characterized by neonatal or early infantile-onset epileptic encephalopathy, and marked hypotonia, and cerebral visual failure, developmental delay, seizures, involuntary movements, and cardiomyopathy are also common in these cases. The prevalence is below 1,000,000.	250,600
DBT	Maple syrup urine disease type 2	NM_001918.3	NM_001918.3:c.670G>T, NM_001918.3:c.827T>G, NM_001918.3:c.294C>G, NM_001918.3:c.581C>G, NM_001918.3:c.772+1G>A, NM_001918.3:c.272_275delCAGT, NM_001918.3:c.1281+1G>A, NM_001918.3:c.871C>T, NM_001918.3:c.901C>T, NM_001918.3:c.939G>C, NM_001918.3:c.126T>G	Maple syrup urine disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DBT gene located on chromosomal region 1p31. The age of onset is neonatal/infantile. This disease is characterized by a maple syrup odor in the cerumen at birth, poor feeding, lethargy and focal dystonia, followed by progressive encephalopathy and central respiratory failure if untreated. The prevalence is 1/10,000 to 5/10,000.	250,600
DCLRE1C	Omenn syndrome	NM_001033855.2	NM_001033855.2:c.2T>C	Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency.	250,600
DCLRE1C	Severe combined immunodeficiency due to DCLRE1C deficiency	NM_001033855.2	NM_001033855.2:c.1558_1559insA, NM_001033855.2:c.597C>A, NM_001033855.2:c.780+1delG, NM_001033855.2:c.1639G>T, NM_001033855.2:c.1903_1904insA, NM_001033855.2:c.457G>A, NM_001033855.2:c.1559_1560insA	Severe combined immunodeficiency due to DCLRE1C deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DCLRE1C gene located on chromosomal region 10p13. The age of onset is neonatal/infantile. This disease is characterized by severe and recurrent infections, diarrhea, failure to thrive, and cell sensitivity to ionizing radiation. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
DFNB31	Deafness type 31, autosomal recessive	NM_015404.3	NM_015404.3:c.1135C>T, NM_015404.3:c.817C>T	Deafness, autosomal recessive type 31 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DFNB31 gene located on chromosomal region 9q32. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	250,600
DGUOK	Mitochondrial DNA depletion syndrome type 3	NM_080916.2	NM_080916.2:c.137A>G, NM_080916.2:c.707+2T>G, NM_080916.2:c.763G>T, NM_080916.2:c.425G>A, NM_080916.2:c.313C>T, NM_080916.2:c.494A>T	Mitochondrial DNA depletion syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DGUOK gene located on chromosomal region 2p13. The age of onset is neonatal/infantile. This disease is characterized by progressive liver failure, hypoglycemia and neurologic abnormalities including hypotonia, encephalopathy and peripheral neuropathy	250,600
DHCR7	Smith-Lemli-Opitz syndrome	NM_001360.2	NM_001360.2:c.1055G>A, NM_001360.2:c.1210C>T, NM_001360.2:c.1054C>T, NM_001360.2:c.461C>G, NM_001360.2:c.151C>T, NM_001360.2:c.1031G>A, NM_001360.2:c.453G>A, NM_001360.2:c.506C>T, NM_001360.2:c.356A>T, NM_001360.2:c.1228G>A, NM_001360.2:c.1A>G, NM_001360.2:c.976G>T, NM_001360.2:c.964-1G>C, NM_001360.2:c.682C>T, NM_001360.2:c.452G>A, NM_001360.2:c.1337G>A, NM_001360.2:c.1342G>A, NM_001360.2:c.730G>A, NM_001360.2:c.292C>T, NM_001360.2:c.904T>C, NM_001360.2:c.907G>A, NM_001360.2:c.841G>A, NM_001360.2:c.744G>T, NM_001360.2:c.724C>T, NM_001360.2:c.725G>A, NM_001360.2:c.866C>T, NM_001360.2:c.278C>T, NM_001360.2:c.839A>G, NM_001360.2:c.832-1G>C	Smith-Lemli-Opitz syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHCR7 gene located on chromosomal region 11q13.4. The age of onset is neonatal/infantile. This disease is characterized by multiple congenital anomalies, intellectual deficit, and behavioral problems. The prevalence is 1/20,000 to 1/40,000 newborn.	250,600
DPYD	Dihydropyrimidine dehydrogenase deficiency	NM_000110.3	NM_000110.3:c.775A>G, NM_000110.3:c.1679T>G, NM_000110.3:c.299_302delTCAT, NM_000110.3:c.703C>T, NM_000110.3:c.1109_1110delTA, NM_000110.3:c.1905+1G>A, NM_000110.3:c.257C>T	Dihydropyrimidine dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPYD gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterised by mental and motor retardation and convulsions.	250,600
DSP	Cardiomyopathy, arrhythmogenic	NM_004415.2	NM_004415.2:c.7000C>T, NM_004415.2:c.88G>A, NM_004415.2:c.6370_6371delCT, NM_004415.2:c.7180_7181delAG, NM_004415.2:c.643G>A, NM_004415.2:c.3098delA, NM_004415.2:c.8188C>T	Cardiomyopathy, arrhythmogenic follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is a heart condition in which the heart muscle fibers are gradually replaced by fibrous or fibro-fatty tissue, causing abnormal heart electrical rhythms and heart failure. Consequently pumping blood to the body is weakened and sometimes leads to sudden cardiac death. The prevalence is below 1,000,000.	250,600
DSP	Cardiomyopathy, dilated, with woolly hair and keratoderma	NM_004415.2	NM_004415.2:c.5513G>A	Cardiomyopathy, dilated, with woolly hair and keratoderma follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterized by a generalized striate keratoderma particularly affecting the palmoplantar epidermis, woolly hair, and dilated left ventricular cardiomyopathy. The prevalence is below 1,000,000.	250,600
DSP	Lethal acantholytic epidermolysis bullosa	NM_004415.2	NM_004415.2:c.5800C>T	Lethal acantholytic epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterised by generalized oozing erosions, usually in the absence of blisters. The prevalence is below 1,000,000.	250,600
DYSF	Dysferlinopathy	NM_003494.3	NM_003494.3:c.1398-2A>G, NM_003494.3:c.1392dupA, NM_003494.3:c.1398-1G>A, NM_003494.3:c.5266C>T, NM_003494.3:c.1620delA, NM_003494.3:c.1481-1G>A, NM_003494.3:c.3041A>G, NM_003494.3:c.3985C>G, NM_003494.3:c.4090C>T, NM_003494.3:c.5713C>T, NM_003494.3:c.1053+1G>A, NM_003494.3:c.200_201delTGinsAT, NM_003494.3:c.2869C>T, NM_003494.3:c.2870_2874delAGACC, NM_003494.3:c.458-390C>T, NM_003494.3:c.757C>T, NM_003494.3:c.3065G>A, NM_003494.3:c.393_394delCC, NM_003494.3:c.3859A>T, NM_003494.3:c.5429G>A, NM_003494.3:c.3130C>T, NM_003494.3:c.3444_3445delTGinsAA, NM_003494.3:c.1638+2T>A, NM_003494.3:c.4108_4109delGT, NM_003494.3:c.3641delC, NM_003494.3:c.1368C>A, NM_003494.3:c.4872_4876delGCCCGinsCCCC, NM_003494.3:c.5341-2A>C, NM_003494.3:c.509C>A, NM_003494.3:c.5836_5839delCAGC, NM_003494.3:c.5644C>T, NM_003494.3:c.1861G>C, NM_003494.3:c.5429+1G>T, NM_003494.3:c.3957delC, NM_003494.3:c.5998C>T, NM_003494.3:c.3724C>T, NM_003494.3:c.5525+1G>A, NM_003494.3:c.3477C>A, NM_003494.3:c.3708delA, NM_003494.3:c.5992G>T, NM_003494.3:c.3113G>C, NM_003494.3:c.1216T>C, NM_003494.3:c.3903delG	Dysferlinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. Dysferlinopathy includes a spectrum of muscle disease characterized by two main phenotypes: Miyoshi myopathy with primarily distal weakness and limb-girdle muscular dystrophy type 2B (LGMD2B) with primarily proximal weakness. Miyoshi myopathy (median age of onset 19 years) is characterized by muscle weakness and atrophy, most marked in the distal parts of the legs, especially the gastrocnemius and soleus muscles. Over a period of years, the weakness and atrophy spread to the thighs and gluteal muscles. The forearms may become mildly atrophic with decrease in grip strength; the small muscles of the hands are spared. LGMD2B is characterized by early weakness and atrophy of the pelvic and shoulder girdle muscles in adolescence or young adulthood, with slow progression. Other phenotypes are scapuloperoneal syndrome, distal myopathy with anterior tibial onset, elevated serum CK concentration only, and congenital muscular dystrophy. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
DYSF	Miyoshi myopathy	NM_003494.3	NM_003494.3:c.1555G>A, NM_003494.3:c.5509G>A, NM_003494.3:c.5077C>T, NM_003494.3:c.5698_5699delAG, NM_003494.3:c.3892A>G, NM_003494.3:c.286A>C, NM_003494.3:c.1120G>C, NM_003494.3:c.1284+2T>C, NM_003494.3:c.5497G>T, NM_003494.3:c.3478C>T, NM_003494.3:c.2997G>T, NM_003494.3:c.3121C>T, NM_003494.3:c.1813C>T, NM_003494.3:c.3181_3182insAGGCGG, NM_003494.3:c.937+1G>A, NM_003494.3:c.3158T>G, NM_003494.3:c.1276G>A, NM_003494.3:c.701G>A, NM_003494.3:c.610C>T, NM_003494.3:c.5594delG, NM_003494.3:c.3112C>T, NM_003494.3:c.4199C>A, NM_003494.3:c.5999G>A, NM_003494.3:c.4756C>T, NM_003494.3:c.6124C>T, NM_003494.3:c.2966C>T, NM_003494.3:c.663+1G>C, NM_003494.3:c.3175-2A>T, NM_003494.3:c.895G>T, NM_003494.3:c.4985C>T, NM_003494.3:c.6203C>T	Miyoshi myopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. This disease is characterised by weakness in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
DYSF	Muscular dystrophy, limb girdle type 2B	NM_003494.3	NM_003494.3:c.5979dupA, NM_003494.3:c.565C>G, NM_003494.3:c.1663C>T, NM_003494.3:c.1873G>T, NM_003494.3:c.1834C>T, NM_003494.3:c.5201A>G, NM_003494.3:c.895G>A, NM_003494.3:c.3805G>T, NM_003494.3:c.4003G>A, NM_003494.3:c.4253G>A	Muscular dystrophy, limb girdle type 2B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. This disease is characterised by limb-girdle weakness and atrophy mostly in the shoulder pelvic girdle. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
EDA	Hypohidrotic ectodermal dysplasia, X-linked	NM_001399.4	NM_001399.4:c.206G>T, NM_001399.4:c.463C>T, NM_001399.4:c.187G>A, NM_001399.4:c.573_574insT, NM_001399.4:c.466C>T, NM_001399.4:c.826C>T, NM_001399.4:c.183C>G, NM_001399.4:c.181T>C, NM_001399.4:c.467G>A, NM_001399.4:c.671G>C, NM_001399.4:c.1045G>A	Hypohidrotic ectodermal dysplasia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EDA gene located on chromosomal region Xq12-q13.1. The age of onset is neonatal/infantile. This disease is characterized by malformation of ectodermal structures such as skin, hair, teeth and sweat glands. The prevalence is 1/5,000 to 1/10,000 newborns.	250,600
ENO3	Glycogen storage disease type 13	NM_053013.3	NM_053013.3:c.667+1G>T, NM_053013.3:c.1121G>A, NM_053013.3:c.953delA, NM_053013.3:c.692_707dupTCCAGGCGGCTGGTTA, NM_053013.3:c.467G>A, NM_053013.3:c.1303T>C	Glycogen storage disease type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENO3 gene located on chromosomal region 17p13.2. The age of onset is adult. This disease is characterised by exercise intolerance and myalgia due to severe enolase deficiency in muscle. The prevalence is below 1/1,000,000.	250,600
ERCC2	Trichothiodystrophy	NM_000400.3	NM_000400.3:c.1972C>T	Trichothiodystrophy is a heterogeneous group of disorders that follows an autosomal recessive pattern of inheritance. It is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.32. The age of onset is neonatal or infantile. This disease is characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. The abnormalities are usually obvious at birth, with variable clinical expression.	250,600
ERCC2	Xeroderma pigmentosum complementation group D	NM_000400.3	NM_000400.3:c.1308-1G>A, NM_000400.3:c.1454T>C, NM_000400.3:c.1621A>C, NM_000400.3:c.1703_1704delTT, NM_000400.3:c.1381C>G, NM_000400.3:c.719-1G>A, NM_000400.3:c.2230_2233dupCTAG, NM_000400.3:c.183+2T>A, NM_000400.3:c.567G>A, NM_000400.3:c.1354C>T, NM_000400.3:c.2047C>T, NM_000400.3:c.1304T>G, NM_000400.3:c.2176C>T, NM_000400.3:c.950-2A>G, NM_000400.3:c.949+1G>A	Xeroderma pigmentosum complementation group D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.3. The age of onset is variable. This disease is characterised by typical xeroderma pigmentosum manifestations (photosensitivity of skin with burning, freckling, and dryness of skin, skin cancers) associated with a spectrum of neurological anomalies (from no abnormality to severe neurological disease).	250,600
ERCC4	Xeroderma pigmentosum complementation group F	NM_005236.2	NM_005236.2:c.49G>T, NM_005236.2:c.1467_1468insA, NM_005236.2:c.2281_2284delTTTG, NM_005236.2:c.2T>C, NM_005236.2:c.538_539delAG, NM_005236.2:c.706T>C, NM_005236.2:c.2395C>T	Xeroderma pigmentosum complementation group F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC4 gene located on chromosomal region 16p13.12. The age of onset is variable. This disease is characterised very mild skin symptoms and no ocular or neurological disease. The prevalence is 1/1,000,000.	250,600
ERCC5	Xeroderma pigmentosum complementation group G	NM_000123.3	NM_000123.3:c.2620G>A, NM_000123.3:c.463_464insA, NM_000123.3:c.526C>T, NM_000123.3:c.88+2T>C, NM_000123.3:c.2144dupA, NM_000123.3:c.2375C>T, NM_000123.3:c.381-2A>G, NM_000123.3:c.2573T>C, NM_000123.3:c.406C>T, NM_000123.3:c.215C>A, NM_000123.3:c.787C>T, NM_000123.3:c.2751delA	Xeroderma pigmentosum complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC5 gene located on chromosomal region 13q33. The age of onset is variable. This disease is characterised by variable clinical manifestations, as some patients present with a mild xeroderma pigmentosum phenotype (UV sensitivity, hyper- or hypo-pigmented skin lesions and increased incidence of skin cancer) and others combine symptoms of xeroderma pigmentosum with systemic and neurological manifestations of Cockayne syndrome. The prevalence is 1/1,000,000.	250,600
ERCC6	Cerebrooculofacioskeletal syndrome tipo 1	NM_000124.3	NM_000124.3:c.2047C>T	Cerebrooculofacioskeletal syndrome tipo 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterised by congenital microcephaly, congenital cataract and/or microphthalmia, arthrogryposis, severe psychomotor developmental delay, height-weight growth delay (principally postnatal) and facial dysmorphism (prominent metopic suture, micrognathism). The prevalence is below 1,000,000.	250,600
ERCC6	Cockayne syndrome type B	NM_000124.3	NM_000124.3:c.207_208insG, NM_000124.3:c.2203C>T, NM_000124.3:c.1357C>T, NM_000124.3:c.48_49delCT, NM_000124.3:c.3592_3593insGA, NM_000124.3:c.422+1G>A, NM_000124.3:c.1550G>A, NM_000124.3:c.3284C>G, NM_000124.3:c.2587C>T, NM_000124.3:c.3862C>T	Cockayne syndrome type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterised by growth failure at birth, with little or no postnatal neurologic development.	250,600
EYS	Retinitis pigmentosa type 25	NM_001142800.1	NM_001142800.1:c.5044G>T, NM_001142800.1:c.9036delT, NM_001142800.1:c.490C>T, NM_001142800.1:c.5928-2A>G, NM_001142800.1:c.571dupA, NM_001142800.1:c.4597_4613delTCAAGCAACCAGAGACT, NM_001142800.1:c.7822C>T, NM_001142800.1:c.5857G>T, NM_001142800.1:c.6170delA, NM_001142800.1:c.8569G>T, NM_001142800.1:c.232delT, NM_001142800.1:c.6102_6103insT, NM_001142800.1:c.8834G>A, NM_001142800.1:c.1211_1212insA, NM_001142800.1:c.4350_4356delTATAGCT, NM_001142800.1:c.4469_4470insAGCCCCTC, NM_001142800.1:c.8648_8655delCATGCAGA, NM_001142800.1:c.4120C>T, NM_001142800.1:c.863-4_863-3insT, NM_001142800.1:c.8629_8632dupACAG, NM_001142800.1:c.9299_9302delCTCA, NM_001142800.1:c.103C>T, NM_001142800.1:c.2826_2827delAT, NM_001142800.1:c.4045C>T, NM_001142800.1:c.5757_5758insT, NM_001142800.1:c.8408dupA, NM_001142800.1:c.7095T>G, NM_001142800.1:c.3329C>G, NM_001142800.1:c.9405T>A	Retinitis pigmentosa 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EYS gene located on chromosomal region 6q12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000.	250,600
F11	Factor 11 deficiency	NM_000128.3	NM_000128.3:c.1613C>T, NM_000128.3:c.166T>C, NM_000128.3:c.403G>T, NM_000128.3:c.731A>G, NM_000128.3:c.809A>T, NM_000128.3:c.1693G>A, NM_000128.3:c.1211C>A, NM_000128.3:c.901T>C, NM_000128.3:c.595+3A>G, NM_000128.3:c.438C>A	Factor 11 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F11 gene located on chromosomal region 4q35. The age of onset is variable. This disease is characterized by reduced levels and activity of factor XI resulting in moderate bleeding symptoms, usually occurring after trauma or surgery. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
F5	Factor 5 deficiency	NM_000130.4	NM_000130.4:c.4876delA, NM_000130.4:c.439G>T, NM_000130.4:c.6419G>A, NM_000130.4:c.2401C>T, NM_000130.4:c.5521G>A, NM_000130.4:c.1083G>A, NM_000130.4:c.5189A>G, NM_000130.4:c.3799delC, NM_000130.4:c.6304C>T	Factor 5 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F5 gene located on chromosomal region 1q23. The age of onset is variable. This disease is characterized by mild to severe bleeding symptoms usually occurring after trauma or surgery. In severe forms of the disease, there can be a risk of intracranial, pulmonary or gastrointestinal bleedings. The severity of the bleeding manifestations correlates with the FV levels. The prevalence is 1/5,000.	250,600
F5	Thrombosis	NM_000130.4	NM_000130.4:c.1000A>G	Deep venous thrombosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F5 gene located on chromosomal region 1q23. The age of onset is variable. This disease is characterized by a poor anticoagulant response to activated Protein C and an increased risk for venous thromboembolism. Deep venous thrombosis and pulmonary embolism are the most common manifestations, but thrombosis in unusual locations also occurs. The prevalence is 1/5,000.	250,600
F9	Hemophilia B	NM_000133.3	NM_000133.3:c.1150C>T, NM_000133.3:c.52T>C, NM_000133.3:c.1031T>C, NM_000133.3:c.82T>C, NM_000133.3:c.1136G>A, NM_000133.3:c.79G>A, NM_000133.3:c.19A>T, NM_000133.3:c.80A>T	Hemophilia B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F9 gene located on chromosomal region Xq27.1-q27.2. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor IX deficiency. The prevalence is 1/100,000 to 9/100,000.	250,600
FAH	Tyrosinemia type 1	NM_000137.2	NM_000137.2:c.1141A>G, NM_000137.2:c.1069G>T, NM_000137.2:c.1090G>T, NM_000137.2:c.401C>A, NM_000137.2:c.456G>A, NM_000137.2:c.192G>T, NM_000137.2:c.607-6T>G, NM_000137.2:c.707-1G>A, NM_000137.2:c.939delC, NM_000137.2:c.103G>A, NM_000137.2:c.982C>T, NM_000137.2:c.837+1G>A, NM_000137.2:c.1009G>A, NM_000137.2:c.47A>T, NM_000137.2:c.554-1G>T, NM_000137.2:c.1027G>T, NM_000137.2:c.1062+5G>A, NM_000137.2:c.786G>A, NM_000137.2:c.1021C>T, NM_000137.2:c.782C>T	Tyrosinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAH gene located on chromosomal region 15q25.1. The age of onset is variable. This disease is characterized by progressive liver disease, renal tubular dysfunction, porphyria-like crises and a dramatic improvement in prognosis following treatment with nitisinone. The birth incidence is 1/100,000, notably in Québec, Canada, and the prevalence is 1/100,000 to 1/120,000 newborns.	250,600
FANCA	Fanconi anemia, complementation group A	NM_000135.2	NM_000135.2:c.3788_3790delTCT, NM_000135.2:c.2303T>C, NM_000135.2:c.3558_3559insG, NM_000135.2:c.4130C>G, NM_000135.2:c.233_236delTTGA, NM_000135.2:c.3763G>T, NM_000135.2:c.1115_1118delTTGG, NM_000135.2:c.131_132insA	Fanconi anemia complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCA gene located on chromosomal region 16q24.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCC	Fanconi anemia, complementation group C	NM_000136.2	NM_000136.2:c.1642C>T, NM_000136.2:c.37C>T, NM_000136.2:c.996+1G>T, NM_000136.2:c.67delG, NM_000136.2:c.416G>A, NM_000136.2:c.1015delA, NM_000136.2:c.1487T>G, NM_000136.2:c.1103_1104delTG	Fanconi anemia complementation group C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCC gene located on chromosomal region 9q22.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCD2	Fanconi anemia, complementation group D2	NM_033084.3	NM_033084.3:c.1278+1delG, NM_033084.3:c.2152C>T, NM_033084.3:c.2494+2T>C, NM_033084.3:c.958C>T, NM_033084.3:c.2444G>A, NM_033084.3:c.782A>T, NM_033084.3:c.904C>T	Fanconi anemia complementation group D2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCD2 gene located on chromosomal region 3p26. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCG	Fanconi anemia, complementation group G	NM_004629.1	NM_004629.1:c.1795_1804delTGGATCCGTC, NM_004629.1:c.313G>T, NM_004629.1:c.637_643delTACCGCC, NM_004629.1:c.1480+1G>C, NM_004629.1:c.1852_1853delAA, NM_004629.1:c.510+1G>A, NM_004629.1:c.1077-2A>G, NM_004629.1:c.908_909insCT	Fanconi anemia complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCG gene located on chromosomal region 9p13. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCI	Fanconi anemia, complementation group I	NM_001113378.1	NM_001113378.1:c.3816+1G>A, NM_001113378.1:c.52C>T, NM_001113378.1:c.989_991delTAA, NM_001113378.1:c.2097C>G, NM_001113378.1:c.3466G>C, NM_001113378.1:c.2292-1G>A, NM_001113378.1:c.3492delG, NM_001113378.1:c.3853C>T, NM_001113378.1:c.3626_3627delGT, NM_001113378.1:c.3854G>A	Fanconi anemia complementation group I follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCI gene located on chromosomal region 15q26.1. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCL	Fanconi anemia, complementation group L	NM_018062.3	NM_018062.3:c.1051_1052delAG, NM_018062.3:c.1066_1067delAG, NM_018062.3:c.1096_1099dupATTA, NM_018062.3:c.1099_1100insATTA	Fanconi anemia complementation group L follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCL gene located on chromosomal region 2p16.1. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCM	Fanconi anemia, complementation group M	NM_020937.2	NM_020937.2:c.2171C>A, NM_020937.2:c.5766_5769delGACT, NM_020937.2:c.5101C>T, NM_020937.2:c.1072G>T, NM_020937.2:c.2996_2997insC, NM_020937.2:c.2586_2589delAAAA, NM_020937.2:c.5791C>T, NM_020937.2:c.624_625delAA, NM_020937.2:c.5569G>A, NM_020937.2:c.5764_5767delCTGA	Fanconi anemia complementation group M follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCM gene located on chromosomal region 14q21.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FGB	Congenital afibrinogenemia	NM_005141.4	NM_005141.4:c.1289G>A, NM_005141.4:c.1148T>G, NM_005141.4:c.794C>T	Congenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGB gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FIG4	Charcot-Marie-Tooth disease type 4J	NM_014845.5	NM_014845.5:c.592C>T, NM_014845.5:c.831_838delTAAATTTG, NM_014845.5:c.547C>T, NM_014845.5:c.501C>G, NM_014845.5:c.737G>A, NM_014845.5:c.122T>C, NM_014845.5:c.2296_2297insG	Charcot-Marie-Tooth disease type 4J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by rapidly progressive, asymmetric motor neuron degeneration with slow nerve conduction velocities, weakness and paralysis, without sensory loss. The prevalence is 4/100,000 to 8/100,000.	250,600
FIG4	Yunis-Varon syndrome	NM_014845.5	NM_014845.5:c.311G>A	Yunis-Varon syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by skeletal defects, including cleidocranial dysplasia and digital anomalies, and severe neurologic involvement with neuronal loss. Enlarged cytoplasmic vacuoles are found in neurons, muscle, and cartilage. The disorder is usually lethal in infancy. The prevalence is 4/100,000 to 8/100,000.	250,600
FKRP	Congenital muscular dystrophy type 5B	NM_024301.4	NM_024301.4:c.235G>A, NM_024301.4:c.1343C>T, NM_024301.4:c.1387A>G, NM_024301.4:c.1154C>A	Congenital muscular dystrophy type 5B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is neonatal/infantile. This disease is characterized by hypotonia, muscle wasting, weakness or delayed motor milestones. The prevalence is 1/14,500 to 1/123,000.	250,600
FKRP	Limb-girdle muscular dystrophy type 2I, autosomal recessive	NM_024301.4	NM_024301.4:c.160C>T	Autosomal recessive limb-girdle muscular dystrophy type 2I follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is infantile. This disease is characterized by proximal limb girdle weakness predominant in the legs, together with bilateral moderate scapulae winging, abdominal muscle weakness, waddling gait, calf hypertrophy, cardiomyopathy and respiratory insufficiency. The prevalence is 1/14,500 to 1/123,000.	250,600
FMR1	Fragile X syndrome	-	(CGG)n pre-mutated allele (Detection by PCR and TP-PCR)	Fragile X syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FMR1 gene located on chromosomal region Xq27.3. The symptoms are variable depending on the range of CGG triplet expansion. In complete mutation the onset is infantile in men and is characterized by intellectual disability, characteristic appearance (large head, long face, prominent forehead and chin, protruding ears) joint laxity and large testes after puberty. In carrier female, the symptoms are milder and include primary ovarian insufficiency. The prevalence is 1/2,500 (full mutation allele) to 1/4,000 (prevalence of symptomatic cases) for both genders.	250,600
FRAS1	Fraser syndrome	NM_025074.6	NM_025074.6:c.7813C>T, NM_025074.6:c.832_835delTGTG, NM_025074.6:c.11159_11166delAGCTGGAG, NM_025074.6:c.776T>G, NM_025074.6:c.6991_6992insGG, NM_025074.6:c.6433C>T, NM_025074.6:c.3799C>T, NM_025074.6:c.1071+1_1071+4delGTGA, NM_025074.6:c.4969+1_4969+2insTAGC, NM_025074.6:c.5605_5606insT	Fraser syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the genes FRAS1 (located on chromosomal region 4q21.21) and FREM2 (located on chromosomal region 13q13.3). The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000.	250,600
G6PC	Glycogen storage disease type 1a	NM_000151.3	NM_000151.3:c.508C>T, NM_000151.3:c.551G>A, NM_000151.3:c.447-1G>A, NM_000151.3:c.1039C>T, NM_000151.3:c.562G>C, NM_000151.3:c.380_381insTA, NM_000151.3:c.497T>G, NM_000151.3:c.247C>T, NM_000151.3:c.113A>T, NM_000151.3:c.229T>C, NM_000151.3:c.230+1G>C, NM_000151.3:c.47C>G, NM_000151.3:c.883C>T, NM_000151.3:c.370G>A, NM_000151.3:c.626A>G, NM_000151.3:c.248G>A	Glycogen storage disease type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000.	250,600
GAA	Glycogen storage disease type 2	NM_000152.3	NM_000152.3:c.118C>T, NM_000152.3:c.1316T>A, NM_000152.3:c.1799G>A, NM_000152.3:c.1827_1828insA, NM_000152.3:c.1846_1847insA, NM_000152.3:c.1115A>T, NM_000152.3:c.1552-3C>G, NM_000152.3:c.1445C>T, NM_000152.3:c.2238G>C, NM_000152.3:c.1327-2A>G, NM_000152.3:c.1650dupG, NM_000152.3:c.2238G>A, NM_000152.3:c.307T>G, NM_000152.3:c.230_240delCAGTGCCCACA, NM_000152.3:c.2512C>T, NM_000152.3:c.1431delT, NM_000152.3:c.1561G>A, NM_000152.3:c.1465G>A, NM_000152.3:c.1548G>A, NM_000152.3:c.546G>A, NM_000152.3:c.1064T>C, NM_000152.3:c.877G>A, NM_000152.3:c.925G>A, NM_000152.3:c.768_769insT, NM_000152.3:c.2560C>T, NM_000152.3:c.655G>A, NM_000152.3:c.1408_1410delAAC, NM_000152.3:c.953T>C, NM_000152.3:c.1933G>T, NM_000152.3:c.1935C>A, NM_000152.3:c.1585_1586delTCinsGT, NM_000152.3:c.1927G>A, NM_000152.3:c.2041-1G>A, NM_000152.3:c.2066_2070dupAGCCG, NM_000152.3:c.2105G>T, NM_000152.3:c.2237G>A, NM_000152.3:c.525delT, NM_000152.3:c.546+1_546+4delGTGG, NM_000152.3:c.2544delC, NM_000152.3:c.1912G>T, NM_000152.3:c.1634C>T, NM_000152.3:c.710C>T, NM_000152.3:c.2015G>A, NM_000152.3:c.546G>C, NM_000152.3:c.2012T>G, NM_000152.3:c.853C>T, NM_000152.3:c.697delA	Glycogen storage disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAA gene located on chromosomal region 17q25.3. There are two forms: adult and infantile.The age of onset in this last form is before the age of three months. This disease is characterized by severe hypotonia, hypertrophic cardiomyopathy and progressive hepatomegaly. The incidence is 1/57,000 for the adult form and 1/138,000 for infantile form.	250,600
GALC	Krabbe disease	NM_000153.3	NM_000153.3:c.1591C>T, NM_000153.3:c.1161+2T>G, NM_000153.3:c.1586C>T, NM_000153.3:c.1592G>A, NM_000153.3:c.1489+1_1489+2delGT, NM_000153.3:c.582+1G>A, NM_000153.3:c.388G>A, NM_000153.3:c.430delA, NM_000153.3:c.1695delT, NM_000153.3:c.1472delA, NM_000153.3:c.1004A>G, NM_000153.3:c.1153G>T, NM_000153.3:c.658C>T, NM_000153.3:c.1543G>A, NM_000153.3:c.332G>A, NM_000153.3:c.334A>G, NM_000153.3:c.205C>T, NM_000153.3:c.1796T>G, NM_000153.3:c.1814dupA, NM_000153.3:c.1700A>C, NM_000153.3:c.1723_1724insT, NM_000153.3:c.1964delC, NM_000153.3:c.236G>A, NM_000153.3:c.1488_1489+2delTGGT, NM_000153.3:c.453G>A, NM_000153.3:c.1488_1489delTG, NM_000153.3:c.628A>T, NM_000153.3:c.655C>T, NM_000153.3:c.953C>G, NM_000153.3:c.2056T>C	Krabbe disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALC gene located on chromosomal region 14q31.3. There are two forms of the disease: infantile form (2-6 months onset) more severe and adult form less severe. It is a degenerative disorder that affects the nervous system characterized by a muscle stiffness, blindness, deafness, and eventually death. The incidence is 1/100,000-1/250,000 and the prevalence is 1/100,000.	250,600
GALT	Galactosemia	NM_000155.3	NM_000155.3:c.130G>A, NM_000155.3:c.132delG, NM_000155.3:c.118G>T, NM_000155.3:c.265T>G, NM_000155.3:c.289_291delAAC, NM_000155.3:c.1138T>C, NM_000155.3:c.113A>C, NM_000155.3:c.152G>A, NM_000155.3:c.1048delA, NM_000155.3:c.290A>G, NM_000155.3:c.221T>C, NM_000155.3:c.253-2A>G, NM_000155.3:c.425T>A, NM_000155.3:c.428C>T, NM_000155.3:c.442C>T, NM_000155.3:c.143G>C, NM_000155.3:c.443G>A, NM_000155.3:c.158G>A, NM_000155.3:c.18delC, NM_000155.3:c.199C>T, NM_000155.3:c.200G>A, NM_000155.3:c.203A>C, NM_000155.3:c.218_219delCT, NM_000155.3:c.512T>C, NM_000155.3:c.547C>A, NM_000155.3:c.552C>A, NM_000155.3:c.563A>G, NM_000155.3:c.565_578delGTATGGGCCAGCAG, NM_000155.3:c.568T>C, NM_000155.3:c.580T>C, NM_000155.3:c.584T>C, NM_000155.3:c.598delC, NM_000155.3:c.601C>T, NM_000155.3:c.602G>A, NM_000155.3:c.1030C>A, NM_000155.3:c.510C>A, NM_000155.3:c.617A>G, NM_000155.3:c.619C>T, NM_000155.3:c.626A>G, NM_000155.3:c.634C>T, NM_000155.3:c.688-2A>C, NM_000155.3:c.692G>A, NM_000155.3:c.292G>A, NM_000155.3:c.329-2A>C, NM_000155.3:c.367C>T, NM_000155.3:c.377+7A>C, NM_000155.3:c.386T>C, NM_000155.3:c.607G>A, NM_000155.3:c.610C>T, NM_000155.3:c.413C>T, NM_000155.3:c.416T>G, NM_000155.3:c.41delinsTT, NM_000155.3:c.904+1G>T, NM_000155.3:c.905-2A>G, NM_000155.3:c.907G>A, NM_000155.3:c.442G>A, NM_000155.3:c.947G>A, NM_000155.3:c.443G>C, NM_000155.3:c.445dupG, NM_000155.3:c.997C>G, NM_000155.3:c.997C>T, NM_000155.3:c.998G>A, NM_000155.3:c.793C>G, NM_000155.3:c.820+13A>G, NM_000155.3:c.1052delC, NM_000155.3:c.844C>G, NM_000155.3:c.855G>T, NM_000155.3:c.719_728delTAGTACTGGT, NM_000155.3:c.772C>T, NM_000155.3:c.939G>A, NM_000155.3:c.71_72insA, NM_000155.3:c.404C>T, NM_000155.3:c.508-1G>C, NM_000155.3:c.775C>T, NM_000155.3:c.400delT, NM_000155.3:c.502_504delGTG, NM_000155.3:c.957C>A, NM_000155.3:c.823C>G, NM_000155.3:c.505C>A, NM_000155.3:c.1006A>T, NM_000155.3:c.985T>C, NM_000155.3:c.790delC, NM_000155.3:c.790_792delinsTAG	Galactosemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALT gene located on chromosomal region 9p13.3. The age of onset is neonatal. This disease is characterized by feeding difficulties, lethargy, and severe liver disease. Long-term complications appear including cognitive impairments, motor deficits, and ovarian dysfunction with reduced fertility in women and diminished bone density. The prevalence is 1/40,000-1/60,000.	250,600
GAN	Giant axonal neuropathy	NM_022041.3	NM_022041.3:c.1447C>T, NM_022041.3:c.1456G>A, NM_022041.3:c.1684C>G, NM_022041.3:c.1429C>T, NM_022041.3:c.601C>T, NM_022041.3:c.413G>A, NM_022041.3:c.505G>A, NM_022041.3:c.1268T>C	Giant axonal neuropathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAN gene located on chromosomal region 16q23.2. The age of onset is infantile. This disease is characterized by a progressive motor and sensitive peripheral and central nervous system neuropathy. Twenty families have been reported with this disease but the frequency is likely to be under-estimated.	250,600
GBA	Gaucher disease	NM_001005741.2	NM_001005741.2:c.1093G>A, NM_001005741.2:c.1090G>A, NM_001005741.2:c.1043C>T, NM_001005741.2:c.1274dupA, NM_001005741.2:c.1098dupA, NM_001005741.2:c.1085C>T, NM_001005741.2:c.1102C>T, NM_001005741.2:c.1049A>G, NM_001005741.2:c.1240G>T, NM_001005741.2:c.1246G>A, NM_001005741.2:c.1301G>C, NM_001005741.2:c.1088T>C, NM_001005741.2:c.1348T>A, NM_001005741.2:c.1361C>G, NM_001005741.2:c.1342G>C, NM_001005741.2:c.1448T>C, NM_001005741.2:c.1448T>G, NM_001005741.2:c.1504C>T, NM_001005741.2:c.1447_1466delCTGGACGCAGTGGCACTGATinsTG, NM_001005741.2:c.254G>A, NM_001005741.2:c.259C>T, NM_001005741.2:c.1053G>T, NM_001005741.2:c.160G>T, NM_001005741.2:c.431T>G, NM_001005741.2:c.475C>T, NM_001005741.2:c.476G>A, NM_001005741.2:c.481C>T, NM_001005741.2:c.487delG, NM_001005741.2:c.497A>T, NM_001005741.2:c.508C>T, NM_001005741.2:c.1141T>G, NM_001005741.2:c.115+1G>A, NM_001005741.2:c.1171G>C, NM_001005741.2:c.1174C>G, NM_001005741.2:c.354G>C, NM_001005741.2:c.1060G>C, NM_001005741.2:c.1208G>C, NM_001005741.2:c.1228C>G, NM_001005741.2:c.123A>G, NM_001005741.2:c.1240G>C, NM_001005741.2:c.914delC, NM_001005741.2:c.517A>C, NM_001005741.2:c.1295G>T, NM_001005741.2:c.1307T>C, NM_001005741.2:c.1265_1319del, NM_001005741.2:c.1319C>T, NM_001005741.2:c.1309G>T, NM_001005741.2:c.1226A>G, NM_001005741.2:c.407C>A, NM_001005741.2:c.1343A>T, NM_001005741.2:c.84_85insG, NM_001005741.2:c.518C>T, NM_001005741.2:c.1391A>C, NM_001005741.2:c.509G>T, NM_001005741.2:c.1604G>A, NM_001005741.2:c.84dupG, NM_001005741.2:c.535G>C, NM_001005741.2:c.586A>C, NM_001005741.2:c.1297G>T, NM_001005741.2:c.1184C>T, NM_001005741.2:c.1192C>T	Gaucher disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBA gene located on chromosomal region 1q22. Gaucher disease encompasses a continuum of clinical findings from a perinatal lethal disorder to an asymptomatic type. There are three major clinical types (1, 2, and 3) and two other subtypes (perinatal-lethal and cardiovascular). Type 1 is characterized by the presence of clinical or radiographic evidence of bone disease, hepatosplenomegaly, anemia and thrombocytopenia, lung disease, and the absence of primary central nervous system disease. GD types 2 and 3 are characterized by the presence of primary neurologic disease. Type 2 has an onset before age two years, limited psychomotor development, and a rapidly progressive course with death by age two to four years. Type 3 may have onset before age two years, but often have a more slowly progressive course, with survival into the third or fourth decade. The perinatal-lethal form is associated with ichthyosiform or collodion skin abnormalities or with nonimmune hydrops fetalis. The cardiovascular form is characterized by calcification of the aortic and mitral valves, mild splenomegaly, corneal opacities, and supranuclear ophthalmoplegia. Cardiopulmonary complications have been described with all the clinical subtypes, although varying in frequency and severity. The incidence is 1/60,000 and the prevalence is approximately 1/100,000.	250,600
GBE1	Glycogen storage disease type 4	NM_000158.3	NM_000158.3:c.1571G>A, NM_000158.3:c.1570C>T, NM_000158.3:c.1774G>T, NM_000158.3:c.771T>A, NM_000158.3:c.1543C>T, NM_000158.3:c.1883A>G, NM_000158.3:c.2052+1G>A, NM_000158.3:c.986A>C, NM_000158.3:c.466_470delCGTAT, NM_000158.3:c.1604A>G	Glycogen storage disease type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is infantile. This disease is characterized by failure to thrive; hepatomegaly, liver dysfunction, and progressive liver cirrhosis; hypotonia; cardiomyopathy and, finally, death.	250,600
GBE1	Polyglucosan body disease, adult	NM_000158.3	NM_000158.3:c.986A>G	Polyglucosan body disease, adult form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is late-onset, slowly progressive disorder affecting the central and peripheral nervous systems. This disease is characterized by a variable combination of cognitive impairment, pyramidal tetraparesis, peripheral neuropathy, and neurogenic bladder. Other manifestations include cerebellar dysfunction and extrapyramidal signs.	250,600
GCDH	Glutaric acidemia type 1	NM_000159.3	NM_000159.3:c.1093G>A, NM_000159.3:c.1060G>C, NM_000159.3:c.542A>G, NM_000159.3:c.442G>A, NM_000159.3:c.1199dupT, NM_000159.3:c.572T>C, NM_000159.3:c.1060G>A, NM_000159.3:c.1247C>T, NM_000159.3:c.74C>A, NM_000159.3:c.947C>A, NM_000159.3:c.1168G>C, NM_000159.3:c.416C>T, NM_000159.3:c.1198G>A, NM_000159.3:c.636-1G>A, NM_000159.3:c.1204C>T, NM_000159.3:c.1244-2A>C, NM_000159.3:c.751C>T, NM_000159.3:c.1262C>T, NM_000159.3:c.1148G>A, NM_000159.3:c.680G>C, NM_000159.3:c.883T>C, NM_000159.3:c.1015A>G, NM_000159.3:c.764C>T, NM_000159.3:c.271+1G>A, NM_000159.3:c.743C>T, NM_000159.3:c.877G>A, NM_000159.3:c.914C>T, NM_000159.3:c.1002_1003delGA, NM_000159.3:c.383G>A, NM_000159.3:c.769C>T	Glutaric acidemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCDH gene located on chromosomal region 19p13.2. The age of onset is infantile or neonatal. This disease is characterized by encephalopathic crises resulting in striatal injury and a severe dystonic dyskinetic movement disorder. The prevalence is 1 in 100,000 births.	250,600
GJB2	Deafness type 1A, autosomal recessive	NM_004004.5	NM_004004.5:c.176_191delGCTGCAAGAACGTGTG, NM_004004.5:c.169C>T, NM_004004.5:c.270dupA, NM_004004.5:c.239A>C, NM_004004.5:c.269T>C, NM_004004.5:c.427C>T, NM_004004.5:c.299_300delAT, NM_004004.5:c.250G>T, NM_004004.5:c.230G>A, NM_004004.5:c.516G>A, NM_004004.5:c.439G>A, NM_004004.5:c.465T>A, NM_004004.5:c.229T>C, NM_004004.5:c.241C>G, NM_004004.5:c.235delC, NM_004004.5:c.238C>T, NM_004004.5:c.557C>T, NM_004004.5:c.269_270insT, NM_004004.5:c.617A>G, NM_004004.5:c.231G>A, NM_004004.5:c.310_323delAGGAAGTTCATCAA, NM_004004.5:c.313_326delAAGTTCATCAAGGG, NM_004004.5:c.358_360delGAG, NM_004004.5:c.35delG, NM_004004.5:c.249C>G, NM_004004.5:c.334_335delAA, NM_004004.5:c.402delG, NM_004004.5:c.413G>A, NM_004004.5:c.416G>A, NM_004004.5:c.299A>T, NM_004004.5:c.250G>C, NM_004004.5:c.550C>T, NM_004004.5:c.551G>C, NM_004004.5:c.503A>G, NM_004004.5:c.227T>C, NM_004004.5:c.380G>A, NM_004004.5:c.132G>A, NM_004004.5:c.365A>T, NM_004004.5:c.139G>T	Deafness, autosomal recessive type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 and GJB3 genes located on chromosomal regions 13q12.11 and 1p34.3 respectively. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.	250,600
GJB3	Deafness type 1A, autosomal recessive	NM_024009.2	NM_024009.2:c.529T>G, NM_024009.2:c.580G>A, NM_024009.2:c.94C>T	Deafness, autosomal recessive type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 and GJB3 genes located on chromosomal regions 13q12.11 and 1p34.3 respectively. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.	250,600
GJB6	Deafness type 1B, autosomal recessive	NM_006783.4	NM_006783.4:c.261dupA, NM_006783.4:c.169C>T, NM_006783.4:c.485dupA, NM_006783.4:c.689dupA, NM_006783.4:c.14C>T, NM_006783.4:c.443delC, NM_006783.4:c.383_384delTA, NM_006783.4:c.689_690insA	Nonsyndromic sensorineural deafness, autosomal recessive type DFNB1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB6 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.	250,600
GLB1	GM1 Gangliosidosis	NM_000404.2	NM_000404.2:c.1369C>T, NM_000404.2:c.1370G>A, NM_000404.2:c.1452C>G, NM_000404.2:c.176G>A, NM_000404.2:c.276G>A, NM_000404.2:c.1733A>G, NM_000404.2:c.1355dupA, NM_000404.2:c.442C>A, NM_000404.2:c.202C>T, NM_000404.2:c.591_592insT, NM_000404.2:c.622C>T, NM_000404.2:c.1549G>T, NM_000404.2:c.442C>T, NM_000404.2:c.457+2T>C, NM_000404.2:c.947A>G, NM_000404.2:c.438_440delTCT, NM_000404.2:c.601C>T, NM_000404.2:c.602G>A, NM_000404.2:c.1068+1G>T, NM_000404.2:c.1174_1175delCT, NM_000404.2:c.1004C>T, NM_000404.2:c.1051C>T, NM_000404.2:c.171C>G, NM_000404.2:c.1321G>A, NM_000404.2:c.1325G>A, NM_000404.2:c.818G>T, NM_000404.2:c.152T>C, NM_000404.2:c.1456_1466dupGGTGCATATAT, NM_000404.2:c.145C>T, NM_000404.2:c.175C>T, NM_000404.2:c.901G>A, NM_000404.2:c.1646C>T, NM_000404.2:c.1577dupG, NM_000404.2:c.1310A>T	Gangliosidosis GM1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. Although the three types differ in severity, their features can overlap significantly. The age of onset in type 1 is infantile, in type 2 is late-infantile or juvenile and adult in type3. This disease is characterized by arrest/regression of neurological development, hypotonia, visceromegaly, macular cherry-red spots, dysostosis and coarse facial features. The prevalence is 1:100,000 a 200,000 newborn.	250,600
GLB1	Mucopolysaccharidosis type 4B	NM_000404.2	NM_000404.2:c.1444C>T, NM_000404.2:c.1313G>A, NM_000404.2:c.817T>C, NM_000404.2:c.1445G>A, NM_000404.2:c.1223A>C	Mucopolysaccharidosis type 4B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. The age of onset is variable infantile/juvenile. In addition to skeletal involvement, significant morbidity can result from respiratory compromise, obstructive sleep apnea, valvular heart disease, hearing impairment, corneal clouding, and spinal cord compression. The prevalence is 1:200,000-1:300,000.	250,600
GLDC	Glycine encephalopathy	NM_000170.2	NM_000170.2:c.322G>T, NM_000170.2:c.1229G>A, NM_000170.2:c.1545G>C, NM_000170.2:c.1691G>T, NM_000170.2:c.1166C>T, NM_000170.2:c.2113G>A, NM_000170.2:c.2284G>A, NM_000170.2:c.1705G>A, NM_000170.2:c.2216G>A, NM_000170.2:c.2405C>T	Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMT and GLDC genes located on chromosomal regions 3p21.31 and 9p24.1 respectively. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000.	250,600
GLE1	Lethal arthrogryposis with anterior horn cell disease	NM_001003722.1	NM_001003722.1:c.2051T>C, NM_001003722.1:c.1412_1413delAG, NM_001003722.1:c.898-2A>G, NM_001003722.1:c.2069_2072delTTCT, NM_001003722.1:c.1807C>T	Lethal arthrogryposis with anterior horn cell disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLE1 gene located on chromosomal region 9q34.11. The age of onset is fetal. This disease is characterized by fetal akinesia, arthrogryposis and motor neuron loss. The fetus often survives delivery, but dies early as a result of respiratory failure. Neuropathological findings resemble those of lethal congenital contracture syndrome type 1, but are less severe.	250,600
GNE	Distal myopathy Nonaka type	NM_005476.5	NM_005476.5:c.2116T>C, NM_005476.5:c.2135T>C, NM_005476.5:c.2086G>A, NM_005476.5:c.478C>T, NM_005476.5:c.1844C>G, NM_005476.5:c.737G>A, NM_005476.5:c.385C>T, NM_005476.5:c.1714G>T, NM_005476.5:c.1798G>A, NM_005476.5:c.2086G>T, NM_005476.5:c.787C>T, NM_005476.5:c.2023T>C, NM_005476.5:c.1993G>A, NM_005476.5:c.673G>A, NM_005476.5:c.909T>A, NM_005476.5:c.1727G>A	Distal myopathy, Nonaka type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNE gene located on chromosomal region 9p13.3. The age of onset is adult. This disease is characterized by progressive muscle weakness and joint deformity. The prevalence is 1:500-1:1,000.	250,600
GNPTAB	Mucolipidosis type 2/type 3	NM_024312.4	NM_024312.4:c.1931C>T, NM_024312.4:c.1799delC, NM_024312.4:c.3503_3504delTC, NM_024312.4:c.3173C>G, NM_024312.4:c.25C>T, NM_024312.4:c.3663delG, NM_024312.4:c.1906dupA, NM_024312.4:c.2383delG, NM_024312.4:c.732_733delAA, NM_024312.4:c.749dupA, NM_024312.4:c.2896delA, NM_024312.4:c.648_651delAGAA, NM_024312.4:c.3326dupA, NM_024312.4:c.3410T>A, NM_024312.4:c.10A>C, NM_024312.4:c.1000C>T, NM_024312.4:c.1196C>T, NM_024312.4:c.1759C>T, NM_024312.4:c.3565C>T, NM_024312.4:c.616_619delACAG, NM_024312.4:c.99delC, NM_024312.4:c.3598G>A, NM_024312.4:c.3560_3561delAG	Mucolipidosis type 2/type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNPTAB gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by growth retardation, skeletal abnormalities, facial dysmorphism, stiff skin, developmental delay and cardiomegaly and that is lethal in childhood. The prevalence is 1:123,500-1:625,500.	250,600
GPR179	Night blindness, congenital stationary type 1E	NM_001004334.3	NM_001004334.3:c.1784+1G>A, NM_001004334.3:c.1368delT, NM_001004334.3:c.3656_3657delCT, NM_001004334.3:c.6847_6848delCT, NM_001004334.3:c.984delC, NM_001004334.3:c.1807C>T, NM_001004334.3:c.278_279insC, NM_001004334.3:c.5693_5694insT, NM_001004334.3:c.278delC, NM_001004334.3:c.1236G>A, NM_001004334.3:c.376G>C, NM_001004334.3:c.3233_3234delCT, NM_001004334.3:c.5763_5764delGA, NM_001004334.3:c.839_842delATCA, NM_001004334.3:c.4699_4700delAG	Congenital stationary night blindness type 1E follow an autosomal recessive, dominant or X-linked pattern of inheritance and is caused by pathogenic variants in the GPR179 gene located on chromosomal region 17q12. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity.	250,600
GPR98	Usher syndrome type 2C	NM_032119.3	NM_032119.3:c.11377G>T, NM_032119.3:c.8713_8716dupAACA, NM_032119.3:c.2864C>A, NM_032119.3:c.18131A>G, NM_032119.3:c.2258_2270delAAGTGCTGAAATC, NM_032119.3:c.6275-1G>A, NM_032119.3:c.2636C>T, NM_032119.3:c.14973-1G>C, NM_032119.3:c.17668_17669delAT, NM_032119.3:c.5357_5358delAA, NM_032119.3:c.5747C>T, NM_032119.3:c.15196_15199dupCAAA, NM_032119.3:c.3151G>T, NM_032119.3:c.6901C>T, NM_032119.3:c.8790delC, NM_032119.3:c.5830G>A, NM_032119.3:c.6311_6312insT	Usher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR98 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32 respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000.	250,600
GRM6	Night blindness, congenital stationary type 1B	NM_000843.3	NM_000843.3:c.2341G>A, NM_000843.3:c.727_728insG, NM_000843.3:c.2213_2219delCCAGAGG, NM_000843.3:c.1861C>T, NM_000843.3:c.2560C>T, NM_000843.3:c.712C>T, NM_000843.3:c.2122C>T, NM_000843.3:c.719_720insG, NM_000843.3:c.1214T>C, NM_000843.3:c.1336C>T, NM_000843.3:c.1258C>T, NM_000843.3:c.1565G>A	Congenital stationary night blindness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRM6 gene located on chromosomal region 5q35.3. The age of onset is early infancy. This disease is characterized by hemeralopia with a moderate loss of visual acuity.	250,600
GUSB	Mucopolysaccharidosis type 7	NM_000181.3	NM_000181.3:c.1065+1G>T, NM_000181.3:c.1084G>A, NM_000181.3:c.1144C>T, NM_000181.3:c.1337G>A, NM_000181.3:c.1222C>T, NM_000181.3:c.1730G>T, NM_000181.3:c.1831C>T, NM_000181.3:c.1856C>T, NM_000181.3:c.1881G>T, NM_000181.3:c.442C>T, NM_000181.3:c.499C>T, NM_000181.3:c.526C>T, NM_000181.3:c.646C>T, NM_000181.3:c.820_821delAC, NM_000181.3:c.1061C>T, NM_000181.3:c.1050G>C, NM_000181.3:c.1534G>A, NM_000181.3:c.1244C>T, NM_000181.3:c.1219_1220insC, NM_000181.3:c.866G>A, NM_000181.3:c.1244+1G>A, NM_000181.3:c.1521G>A, NM_000181.3:c.1429C>T, NM_000181.3:c.1618G>T, NM_000181.3:c.1338G>A	Mucopolysaccharidosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUSB gene located on chromosomal region 7q11.21. The age of onset is variable. There are prenatal forms with non-immune hydrops fetalis, and severe neonatal forms with dysmorphism, hernias, hepatosplenomegaly, club feet, dysostosis, severe hypotonia and neurological disorders that ultimately lead to profound intellectual deficit and small stature in patients that survive. Finally, there are also very mild cases that are discovered during adolescence or adulthood following presentation with thoracic kyphosis. The prevalence is 1:250,000 in newborn.	250,600
HADHA	Trifunctional protein deficiency	NM_000182.4	NM_000182.4:c.1918C>T, NM_000182.4:c.274_278delTCATC, NM_000182.4:c.2131C>A, NM_000182.4:c.1793_1794delAT, NM_000182.4:c.1620+2_1620+6delTAAGG, NM_000182.4:c.2027G>A, NM_000182.4:c.1678C>T, NM_000182.4:c.2132_2133insC, NM_000182.4:c.2146+1G>A, NM_000182.4:c.919-2A>G, NM_000182.4:c.1644delC, NM_000182.4:c.1132C>T, NM_000182.4:c.1528G>C, NM_000182.4:c.499delA, NM_000182.4:c.845T>A, NM_000182.4:c.1422dupT	Mitochondrial trifunctional protein deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA and HADHB genes located on chromosomal region 2p23.3. The age of onset is neonatal/infancy. It is characterized by a wide clinical spectrum ranging from severe neonatal manifestations including cardiomyopathy, hypoglycemia, metabolic acidosis, skeletal myopathy and neuropathy, liver disease and death to a mild phenotype with peripheral polyneuropathy, episodic rhabdomyolysis and pigmentary retinopathy. The prevalence is <1 / 1,000,000.	250,600
HBB	Beta-thalassemia	NM_000518.4	NM_000518.4:c.135delC, NM_000518.4:c.118C>T, NM_000518.4:c.217dupA, NM_000518.4:c.92+5G>C, NM_000518.4:c.208G>A, NM_000518.4:c.85_86insC, NM_000518.4:c.92+5G>A, NM_000518.4:c.27dupG, NM_000518.4:c.126_129delCTTT, NM_000518.4:c.93-23T>C, NM_000518.4:c.92+1G>A, NM_000518.4:c.-50-u32C>T, NM_000518.4:c.82G>T, NM_000518.4:c.315+1G>A, NM_000518.4:c.52A>T, NM_000518.4:c.380T>A, NM_000518.4:c.93-21G>A, NM_000518.4:c.79G>A, NM_000518.4:c.112delT, NM_000518.4:c.92+6T>C, NM_000518.4:c.59A>G, NM_000518.4:c.364G>A	Beta-thalassemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBB gene located on chromosomal region 11p15.4. The age of onset is infantile. Three main types of BT have been described, thalassemia minor is usually asymptomatic, thalassemia major is associated with splenomegaly and microcytic and hypochromic anemia and thalassemia intermedia, in which the anemia is less severe. The incidence is 1/100,000.	250,600
HBB	Sickle cell anaemia	NM_000518.4	NM_000518.4:c.19G>A, NM_000518.4:c.20A>T	Sickle cell anemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBB gene located on chromosomal region 11p15.4. The age of onset is infantile. This disease is characterized by chronic severe anemia, bacterial infections, and ischemic vaso-occlusive accidents. This results in tissue ischemia leading to acute and chronic pain as well as organ damage that can affect any organ in the body, including the bones, lungs, liver, kidneys, brain, eyes, and joints. The highest frequency of sickle cell disease is found in tropical regions, particularly sub-Saharan Africa, India and the Middle-East.	250,600
HESX1	Combined pituitary hormone deficiencies, genetic forms	NM_003865.2	NM_003865.2:c.374A>G, NM_003865.2:c.77T>C, NM_003865.2:c.445G>A, NM_003865.2:c.450_451delCA, NM_003865.2:c.18G>C	Combined pituitary hormone deficiencies, genetic forms follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the HESX1 gene located on chromosomal region 3p14.3. The age of onset is infantile. These diseases are characterized by short stature, cognitive alterations or delayed puberty. The incidence is 1:3,000 and 1:4,000 births.	250,600
HEXA	Tay-Sachs disease	NM_000520.4	NM_000520.4:c.1176G>A, NM_000520.4:c.1495C>T, NM_000520.4:c.1177C>T, NM_000520.4:c.116T>G, NM_000520.4:c.1510delC, NM_000520.4:c.1496G>A, NM_000520.4:c.1260G>C, NM_000520.4:c.1351C>G, NM_000520.4:c.1511G>A, NM_000520.4:c.1499delT, NM_000520.4:c.1510C>T, NM_000520.4:c.380T>G, NM_000520.4:c.459+5G>A, NM_000520.4:c.508C>T, NM_000520.4:c.509G>A, NM_000520.4:c.532C>T, NM_000520.4:c.533G>A, NM_000520.4:c.533G>T, NM_000520.4:c.1528C>T, NM_000520.4:c.173G>A, NM_000520.4:c.1A>G, NM_000520.4:c.1A>T, NM_000520.4:c.1444G>A, NM_000520.4:c.1453T>C, NM_000520.4:c.739C>T, NM_000520.4:c.745C>T, NM_000520.4:c.749G>A, NM_000520.4:c.759_774dupGCTTGCAGAGTTTGAC, NM_000520.4:c.772G>C, NM_000520.4:c.1214_1215delinsG, NM_000520.4:c.78G>A, NM_000520.4:c.538T>C, NM_000520.4:c.540C>G, NM_000520.4:c.805G>A, NM_000520.4:c.915_917delCTT, NM_000520.4:c.254-1G>C, NM_000520.4:c.2T>C, NM_000520.4:c.1537C>T, NM_000520.4:c.1490A>G, NM_000520.4:c.77G>A, NM_000520.4:c.1422G>C, NM_000520.4:c.805+1G>A, NM_000520.4:c.805+1G>C, NM_000520.4:c.672+1G>A, NM_000520.4:c.629C>T, NM_000520.4:c.987G>A, NM_000520.4:c.632T>C, NM_000520.4:c.1278_1279insTATC, NM_000520.4:c.1274_1277dupTATC, NM_000520.4:c.986+3A>G, NM_000520.4:c.611A>G, NM_000520.4:c.1277_1278insTAT	Tay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births.	250,600
HEXB	Sandhoff disease	NM_000521.3	NM_000521.3:c.1310_1311delCA, NM_000521.3:c.1380G>A, NM_000521.3:c.1367A>C, NM_000521.3:c.1238_1242delCAAAG, NM_000521.3:c.298delC, NM_000521.3:c.1345delT, NM_000521.3:c.797A>G, NM_000521.3:c.1539_1540delCT, NM_000521.3:c.1375G>T, NM_000521.3:c.508C>T, NM_000521.3:c.1517_1529dupCAAGTGCTGTTGG, NM_000521.3:c.841C>T, NM_000521.3:c.202_203insGG, NM_000521.3:c.1250C>T, NM_000521.3:c.1619_1620insTTCATGTTATCTACAGACGTG, NM_000521.3:c.1537_1538delCT, NM_000521.3:c.170delG, NM_000521.3:c.115delG, NM_000521.3:c.171delG, NM_000521.3:c.850C>T	Sandhoff disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXB gene located on chromosomal region 5q13.3. The age of onset is adult or infantile. This disease is characterized by central nervous system degeneration, with startle reactions, early blindness, progressive motor and mental deterioration, macrocephaly and cherry-red spots on the macula. The prevalence is 1/130.000.	250,600
HFE	Haemochromatosis	NM_000410.3	NM_000410.3:c.18G>C, NM_000410.3:c.252G>A, NM_000410.3:c.989G>T, NM_000410.3:c.314T>C, NM_000410.3:c.193A>T, NM_000410.3:c.829G>A, NM_000410.3:c.277G>C	Hemochromatosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HFE gene located on chromosomal region 6p22.2. The age of onset is adult. This disease is characterized by chronic fatigue, bronzed skin pigmentation and tissue damage in the liver, pancreas, joints, bone, endocrine glands, heart. The prevalence is 1/200 - 1/1.000.	250,600
HGD	Alkaptonuria	NM_000187.3	NM_000187.3:c.140C>T, NM_000187.3:c.16-1G>A, NM_000187.3:c.342+1G>A, NM_000187.3:c.1111_1112insC, NM_000187.3:c.899T>G, NM_000187.3:c.1189-2A>G, NM_000187.3:c.674G>A, NM_000187.3:c.175delA, NM_000187.3:c.283-5delT, NM_000187.3:c.172A>T, NM_000187.3:c.873C>A, NM_000187.3:c.283-4C>T, NM_000187.3:c.808G>A, NM_000187.3:c.1102A>G, NM_000187.3:c.469+2T>C, NM_000187.3:c.688C>T, NM_000187.3:c.481G>A	Alkaptonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGD gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by darkening of the urine when it is left exposed to air, grey-blue colouration of the eye sclerae and the ear helix (ochronosis), and a disabling joint disease involving both the axial and peripheral joints (ochronotic arthropathy). The prevalence is 1:250,000-1:1.000.000 newborn.	250,600
HGSNAT	Mucopolysaccharidosis type 3C	NM_152419.2	NM_152419.2:c.1378-1G>A, NM_152419.2:c.1843G>A, NM_152419.2:c.607C>T, NM_152419.2:c.1250+1G>A, NM_152419.2:c.848C>T, NM_152419.2:c.1464+1G>A, NM_152419.2:c.1501delA, NM_152419.2:c.1030C>T, NM_152419.2:c.1503delA, NM_152419.2:c.1553C>T, NM_152419.2:c.1622C>T, NM_152419.2:c.493+1G>A	Mucopolysaccharidosis type 3C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGSNAT gene located on chromosomal region 8p11.21. The age of onset is infantile. This disease is characterized by defective or missing enzymes to break down mucopolysaccharides are missing or are defective. The prevalence is <1:70.000 newborn.	250,600
HPD	Tyrosinemia type 3	NM_002150.2	NM_002150.2:c.600C>G, NM_002150.2:c.774T>G, NM_002150.2:c.1005C>G, NM_002150.2:c.987delA	Tyrosinemia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPD gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by intellectual deficit and ataxia. The prevalence is 1:100,000-1:120,000 newborn.	250,600
IGHMBP2	Spinal muscular atrophy, distal, type 1, autosomal recessive	NM_002180.2	NM_002180.2:c.1488C>A, NM_002180.2:c.2611+1G>T, NM_002180.2:c.1540G>A, NM_002180.2:c.1738G>A, NM_002180.2:c.661delA, NM_002180.2:c.121C>T, NM_002180.2:c.1101_1116delCTACTTCGACGTGGTG, NM_002180.2:c.2922T>G, NM_002180.2:c.1107C>G, NM_002180.2:c.2362C>T, NM_002180.2:c.638A>G	Autosomal recessive distal spinal muscular atrophy type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGHMBP2 gene located on chromosomal region 11q13.3. The age of onset is infantile. This disease is characterized by neuromuscular disorder characterized by progressive weakness and atrophy of the diaphragm and skeletal muscles, leading to death in childhood. The prevalence is 4:100,000-10:100,000.	250,600
IMPDH1	Retinitis pigmentosa type 10	NM_000883.3	NM_000883.3:c.1057G>A, NM_000883.3:c.1390delC, NM_000883.3:c.931G>A	Retinitis pigmentosa type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IMPDH1 gene located on chromosomal region 7q32.1. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades. The prevalence is 1/4,000.	250,600
INPP5E	Joubert syndrome type 1	NM_019892.4	NM_019892.4:c.1132C>T, NM_019892.4:c.855_856insCG, NM_019892.4:c.1688G>A, NM_019892.4:c.1543C>T, NM_019892.4:c.1304G>A	Joubert syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized by congenital malformation of the brainstem and agenesis or hypoplasia of the cerebellar vermis leading to an abnormal respiratory pattern, nystagmus, hypotonia, ataxia, and delay in achieving motor milestones.. The prevalence is 1/100.000.	250,600
INPP5E	MORM syndrome	NM_019892.4	NM_019892.4:c.1879C>T	MORM syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized by the association of intellectual deficit, truncal obesity, retinal dystrophy and micropenis. The prevalence is 1/100.000.	250,600
INSR	Diabetes mellitus, insulin-resistant	NM_000208.2	NM_000208.2:c.3079C>T, NM_000208.2:c.3680G>C, NM_000208.2:c.3034G>A, NM_000208.2:c.1114C>T, NM_000208.2:c.1378A>G	Diabetes mellitus, insulin-resistant follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by the triad of hyperinsulinemia, acanthosis nigricans (skin lesions associated with insulin resistance), and signs of hyperandrogenism in females without lipodystrophy and who are not overweight. It is generally diagnosed in young women with marked signs of hyperandrogenism, but insulin resistance and acanthosis nigricans may be observed in men and in childhood. Acromegaloid facies or muscular cramps are sometimes associated. Hyperinsulinemia, a biological marker for insulin resistance, is often associated with glucose tolerance defects over the course of the disease, and diabetes progressively sets in. Hyperandrogenism (associated with polycystic ovarian syndrome (see this term) or ovarian hyperthecoses) leads to fertility problems. The prevalence is <1:1,000,000.	250,600
INSR	Leprechaunism	NM_000208.2	NM_000208.2:c.2668C>T, NM_000208.2:c.172G>A	Leprechaunism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by intrauterine and mainly postnatal severe growth retardation, extreme insulin resistance. The prevalence is <1:1,000,000.	250,600
ITGB4	Epidermolysis bullosa, junctional with pyloric atresia	NM_001005731.1	NM_001005731.1:c.112T>C, NM_001005731.1:c.1684T>C, NM_001005731.1:c.1150delG, NM_001005731.1:c.1544G>A, NM_001005731.1:c.3977-19T>A, NM_001005731.1:c.4410delG, NM_001005731.1:c.4433G>A, NM_001005731.1:c.5119+2T>C, NM_001005731.1:c.3321_3331delACTGGACCGGA, NM_001005731.1:c.4618C>T, NM_001005731.1:c.182G>A, NM_001005731.1:c.2607delC, NM_001005731.1:c.3801_3802insT, NM_001005731.1:c.3841C>T, NM_001005731.1:c.2608delC, NM_001005731.1:c.3793+1G>A, NM_001005731.1:c.1660C>T, NM_001005731.1:c.3674G>A	Junctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGA6 and ITGB4 genes located on chromosomal regions 2q31.1 and 17q25.1 respectively. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract.	250,600
ITGB4	Epidermolysis bullosa, without pyloric atresia	NM_001005731.1	NM_001005731.1:c.2792G>A	Junctional epidermolysis bullosa with piloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGB4 gene located on chromosomal region 17q25.1. The age of onset is neonatal. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. More than 100 cases have been reported around the world.	250,600
IVD	Isovaleric acidemia	NM_002225.3	NM_002225.3:c.158G>C, NM_002225.3:c.1208A>G, NM_002225.3:c.157C>T, NM_002225.3:c.1141T>C, NM_002225.3:c.243+1G>A, NM_002225.3:c.1147+1_1147+4delGTGA, NM_002225.3:c.367G>A, NM_002225.3:c.605G>T, NM_002225.3:c.1145_1147+4delTTGGTGA, NM_002225.3:c.559+1G>A, NM_002225.3:c.134T>C, NM_002225.3:c.941C>T, NM_002225.3:c.627delT, NM_002225.3:c.793+1G>A, NM_002225.3:c.2T>G, NM_002225.3:c.1183C>T, NM_002225.3:c.390delT, NM_002225.3:c.406_407delTG, NM_002225.3:c.158G>A, NM_002225.3:c.593G>A, NM_002225.3:c.507delG, NM_002225.3:c.1188delT, NM_002225.3:c.465+2T>C, NM_002225.3:c.434_437dupATGA, NM_002225.3:c.860G>A, NM_002225.3:c.994_995delAT, NM_002225.3:c.1192C>T, NM_002225.3:c.478_479insGT	Isovaleric academia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IVD gene located on chromosomal region 15q15.1. The age of onset is neonatal. This disease is characterized by vomiting, dehydration, coma and abnormal movements. The prevalence is 1/100,000.	250,600
JAK3	Severe combined immunodeficiency T-B+NK-	NM_000215.3	NM_000215.3:c.452C>G, NM_000215.3:c.1765G>A, NM_000215.3:c.1333C>T, NM_000215.3:c.1172_1173insG, NM_000215.3:c.1837C>T, NM_000215.3:c.299A>G, NM_000215.3:c.1695C>A	Severe combined immunodeficiency T-B+NK- follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the JAK3 gene located on chromosomal region 19p13.11. The age of onset is infantile. This disease is characterized by chronic diarrhea, failure to thrive, recurrent respiratory infections and/or generalized infections due to opportunistic pathogens. The incidence is 1/100,000 and 1/1,000,000.	250,600
KCNJ1	Bartter syndrome type 2	NM_000220.4	NM_000220.4:c.1012C>T, NM_000220.4:c.1070T>C, NM_000220.4:c.592G>A, NM_000220.4:c.322G>C, NM_000220.4:c.372T>A, NM_000220.4:c.500G>A, NM_000220.4:c.237C>G, NM_000220.4:c.1014delA, NM_000220.4:c.641C>T, NM_000220.4:c.657C>G, NM_000220.4:c.996_999delAAAG, NM_000220.4:c.942T>G	Bartter syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ1 gene located on chromosomal region 11q24.3. The age of onset is antenatal. This disease is characterized by severe polyhydramnios in mother leading to premature delivery, postnatally newborns suffer from recurrent episodes of severe dehydration and electrolyte imbalance which can lead to fatal outcome.	250,600
KCNV2	Retinal cone dystrophy type 3B	NM_133497.3	NM_133497.3:c.1016_1024delACCTGGTGG, NM_133497.3:c.1376G>A, NM_133497.3:c.427G>T, NM_133497.3:c.226C>T, NM_133497.3:c.325C>T, NM_133497.3:c.357_358insC, NM_133497.3:c.1480A>C, NM_133497.3:c.1132_1133insT, NM_133497.3:c.854T>G, NM_133497.3:c.491T>C, NM_133497.3:c.767C>G, NM_133497.3:c.916G>T, NM_133497.3:c.778A>T, NM_133497.3:c.442G>T	Retinal cone dystrophy type 3B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNV2 gene located on 9p24.2. The age of onset is in the first or second decade of life. This disease is characterized by is characterized by onset in the first or second decade of life of very marked photophobia, myopia, reduced color vision along the red-green axis with relatively preserved tritan discrimination, and central scotomata with peripheral widespread sensitivity loss predominating in the superior visual field. Nyctalopia is a later feature of the disorder. There is often retinal pigment epithelium disturbance at the macula with a normal retinal periphery.	250,600
LAMA2	Congenital muscular dystrophy type 1A	NM_000426.3	NM_000426.3:c.184G>T, NM_000426.3:c.1612C>T, NM_000426.3:c.3718C>T, NM_000426.3:c.2750-1G>C, NM_000426.3:c.2049_2050delAG, NM_000426.3:c.5050G>T, NM_000426.3:c.1634T>A, NM_000426.3:c.2045_2046delAG, NM_000426.3:c.4645C>T, NM_000426.3:c.2962C>T, NM_000426.3:c.2098_2099delTT, NM_000426.3:c.4437-5T>A, NM_000426.3:c.2901C>A, NM_000426.3:c.112+1G>A, NM_000426.3:c.7732C>T, NM_000426.3:c.6038delT, NM_000426.3:c.7888C>T, NM_000426.3:c.825delC, NM_000426.3:c.8314delA, NM_000426.3:c.3976C>T, NM_000426.3:c.9101_9104dupAACA, NM_000426.3:c.9253C>T, NM_000426.3:c.2323-2A>T, NM_000426.3:c.8748delA, NM_000426.3:c.6334A>T, NM_000426.3:c.1050delT, NM_000426.3:c.7536delC, NM_000426.3:c.8705delT, NM_000426.3:c.9221delA, NM_000426.3:c.5227G>T, NM_000426.3:c.6429+1G>A, NM_000426.3:c.6617delT, NM_000426.3:c.2451-2A>G, NM_000426.3:c.6011delA, NM_000426.3:c.7810C>T, NM_000426.3:c.8684C>G, NM_000426.3:c.3630delT, NM_000426.3:c.3215delG, NM_000426.3:c.3623_3645delAGGGCATTGTTTTTCAACATCCA, NM_000426.3:c.6955C>T, NM_000426.3:c.7279_7280delCT, NM_000426.3:c.725G>A, NM_000426.3:c.7147C>T, NM_000426.3:c.3237C>A	Congenital muscular dystrophy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMA2 gene located on chromosomal region 6q22.33. The age of onset is early infancy. This disease is characterized by hypotonia, muscle weakness and muscle wasting and motor development delayed. The prevalence is 1/30,000.	250,600
LAMB3	Epidermolysis bullosa, junctional	NM_000228.2	NM_000228.2:c.1587_1588delAG, NM_000228.2:c.124C>T, NM_000228.2:c.1438_1442delCCGTG, NM_000228.2:c.1830G>A, NM_000228.2:c.565-2A>G, NM_000228.2:c.2806C>T, NM_000228.2:c.904delT, NM_000228.2:c.1357delT, NM_000228.2:c.3228+1G>T, NM_000228.2:c.628+1delG, NM_000228.2:c.496C>T, NM_000228.2:c.1903C>T, NM_000228.2:c.628G>A, NM_000228.2:c.3228+1G>A, NM_000228.2:c.727C>T	Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 and LAMC2 genes located on chromosomal regions 1q32.2 and 1q25.3 respectively. The age of onset is infantile. It is a lethal form of junctional epidermolysis bullosa, a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement. In the Herlitz type, death occurs usually within the first six months of life. Occasionally, children survive to teens. It is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic.	250,600
LMNA	Cardiomyopathy, dilated type 1A	NM_170707.3	NM_170707.3:c.1366A>C, NM_170707.3:c.1930C>T, NM_170707.3:c.1567G>A, NM_170707.3:c.1786G>A	Dilated cardiomyopathy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death.	250,600
LMNA	Hutchinson-Gilford progeria syndrome	NM_170707.3	NM_170707.3:c.1579C>T, NM_170707.3:c.1411C>T, NM_170707.3:c.1824C>T, NM_170707.3:c.1626G>C	Hutchinson-Gilford progeria syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/infancy. It is characterized by growth reduction, failure to thrive, a typical facial appearance (prominent forehead, protuberant eyes, thin nose with a beaked tip, thin lips, micrognathia and protruding ears) and distinct dermatologic features (generalized alopecia, aged-looking skin, sclerotic and dimpled skin over the abdomen and extremities, prominent cutaneous vasculature, dyspigmentation, nail hypoplasia and loss of subcutaneous fat).	250,600
LMNA	Lipodystrophy, familial partial, type 2	NM_170707.3	NM_170707.3:c.1318G>A	Lipodystrophy, familial partial, type2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by the loss of subcutaneous adipose tissue in the lower parts of the body (limbs, buttocks, trunk). It is accompanied by an accumulation of adipose tissue in the face and neck causing a double chin, fat neck, or cushingoid appearance. Adipose tissue may also accumulate in the axillae, back, labia majora, and intraabdominal region. Affected patients are insulin-resistant and may develop glucose intolerance and diabetes mellitus after age 20 years,hypertriglyceridemia, and low levels of high density lipoprotein cholesterol.	250,600
LMNA	Mandibuloacral dysplasia	NM_170707.3	NM_170707.3:c.1586C>T, NM_170707.3:c.1580G>A, NM_170707.3:c.1585G>A, NM_170707.3:c.1228C>T	Mandibuloacral dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/. This disease is characterized by postnatal growth retardation, craniofacial anomalies, skeletal malformations, and mottled cutaneous pigmentation. The prevalence is 1:2,700-1:5,000.	250,600
LMNA	Muscular dystrophy, Emery-Dreifuss type 3	NM_170707.3	NM_170707.3:c.1072G>A, NM_170707.3:c.419T>C, NM_170707.3:c.1488+1G>A, NM_170707.3:c.1583C>A	Emery-Dreifuss muscular dystrophy type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by weakness and atrophy of muscle without involvement of the nervous system, early contractures of the elbows, Achilles tendons and spine, and cardiomyopathy associated with cardiac conduction defects.	250,600
LRP5	Exudative vitreoretinopathy type 4	NM_002335.3	NM_002335.3:c.2254C>G, NM_002335.3:c.518C>T, NM_002335.3:c.1709G>A, NM_002335.3:c.804_813delGGGGAAGAGG, NM_002335.3:c.4099G>A	Exudative vitreoretinopathy type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile or juvenile. This disease is characterized by abnormal or incomplete vascularization of the peripheral retina leading to variable clinical manifestations ranging from no effects to minor anomalies, or even retinal detachment with blindness.	250,600
LRP5	Isolated polycystic liver disease	NM_002335.3	NM_002335.3:c.4651G>A	Isolated polycystic liver disease due to LRP5 gene located on chromosomal region 11q13.2 follows an autosomal recessive pattern of inheritance. The age of onset is variable. This disease is characterized by the appearance of numerous cysts spread throughout the liver.	250,600
LRP5	Osteoporosis-pseudoglioma syndrome	NM_002335.3	NM_002335.3:c.1481G>A, NM_002335.3:c.1453G>T, NM_002335.3:c.1468delG, NM_002335.3:c.2305delG, NM_002335.3:c.2202G>A, NM_002335.3:c.1708C>T, NM_002335.3:c.3107G>A, NM_002335.3:c.2557C>T	Osteoporosis-pseudoglioma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by congenital or infancy-onset blindness and severe juvenile-onset osteoporosis and spontaneous fractures. The prevalence is 1:2,000,000.	250,600
MAN2B1	Alpha-mannosidosis	NM_000528.3	NM_000528.3:c.215A>T, NM_000528.3:c.2401G>T, NM_000528.3:c.2278C>T, NM_000528.3:c.2368C>T, NM_000528.3:c.2119C>T, NM_000528.3:c.2013delT, NM_000528.3:c.1A>G, NM_000528.3:c.1067C>G, NM_000528.3:c.384G>A, NM_000528.3:c.2398G>A, NM_000528.3:c.1915C>T, NM_000528.3:c.2426T>C, NM_000528.3:c.2436+2T>C, NM_000528.3:c.1259G>T, NM_000528.3:c.1780C>T, NM_000528.3:c.1929G>A, NM_000528.3:c.2686_2687delCTinsG, NM_000528.3:c.1830+1G>C	Alpha-mannosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAN2B1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by immunodeficiency, facial and skeletal abnormalities, hearing impairment and intellectual disability. The prevalence is 1:1,000,000-9:1,000,000.	250,600
MCCC2	3-Methylcrotonyl-CoA carboxylase 2 deficiency, type 2	NM_022132.4	NM_022132.4:c.295G>C, NM_022132.4:c.380C>G, NM_022132.4:c.1309A>G, NM_022132.4:c.515_516insT, NM_022132.4:c.1015G>A, NM_022132.4:c.464G>A, NM_022132.4:c.641delG, NM_022132.4:c.1576_1577insT, NM_022132.4:c.735_736insC, NM_022132.4:c.517_518insT, NM_022132.4:c.838G>T, NM_022132.4:c.499T>C, NM_022132.4:c.1367C>T, NM_022132.4:c.929C>G, NM_022132.4:c.1065A>T, NM_022132.4:c.1580G>A, NM_022132.4:c.994C>T, NM_022132.4:c.1072+1G>A	3-methylcrotonyl-CoA carboxylase deficiency type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC2 gene located on chromosomal region 5q13.2. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn.	250,600
MED25	Charcot-Marie-Tooth disease type 2B2	NM_030973.3	NM_030973.3:c.316delG, NM_030973.3:c.1366C>T, NM_030973.3:c.1004C>T	Charcot-Marie-Tooth disease type 2B2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MED25 gene located on chromosomal region 19q13.33. The age of onset is adult. This disease is characterized by symmetric moderate to severe weakness of the distal muscles, predominantly affecting the lower extremities. Marked sensory deficits were also reported.	250,600
MEFV	Familial mediterranean fever	NM_000243.2	NM_000243.2:c.163_164insA, NM_000243.2:c.1437C>G, NM_000243.2:c.2282G>A, NM_000243.2:c.163dupA, NM_000243.2:c.2076_2078delAAT, NM_000243.2:c.1958G>A, NM_000243.2:c.443A>T, NM_000243.2:c.656_657insG, NM_000243.2:c.688G>A, NM_000243.2:c.800C>T, NM_000243.2:c.1223G>A, NM_000243.2:c.501G>C, NM_000243.2:c.2040G>A, NM_000243.2:c.2040G>C, NM_000243.2:c.2084A>G, NM_000243.2:c.1141C>T, NM_000243.2:c.1016C>T, NM_000243.2:c.2177T>C, NM_000243.2:c.1772T>C, NM_000243.2:c.2080A>G, NM_000243.2:c.2082G>A, NM_000243.2:c.2230G>T	Familial Mediterranean fever follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MEFV gene located on chromosomal region 16p13.3. The age of onset is infantile or adult (before the age of 30). This disease is characterized by recurrent short episodes of fever and serositis resulting in pain in the abdomen, chest, joints and muscles. The prevalence is 1:10,000-5:10,000.	250,600
MERTK	Retinitis pigmentosa type 38	NM_006343.2	NM_006343.2:c.2189+1G>T, NM_006343.2:c.1605-2A>G, NM_006343.2:c.2070_2074delAGGAC, NM_006343.2:c.2784_2785insTA, NM_006343.2:c.2785_2786dupTA, NM_006343.2:c.2323C>T, NM_006343.2:c.2207_2210delCTGT	Retinitis pigmentosa type 38 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MERTK gene located on chromosomal region 2q13. The age of onset is infantile. This disease is characterized by. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness.	250,600
MFRP	Microphthalmia - Retinitis pigmentosa - foveoschisis - optic disc drusen	NM_031433.3	NM_031433.3:c.498delC, NM_031433.3:c.523C>T, NM_031433.3:c.629G>T, NM_031433.3:c.1150_1151insC, NM_031433.3:c.545T>C, NM_031433.3:c.1124+1G>T	Microphthalmia - Retinitis pigmentosa - foveoschisis - optic disc drusen follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFRP gene located on chromosomal region 11q23.3. The age of onset is infantile. This disease is characterized by posterior microphthalmos, retinitis pigmentosa, foveoschisis, and optic disk drusen.	250,600
MKKS	Bardet-Biedl/McKusick-Kaufman syndrome	NM_018848.3	NM_018848.3:c.353delG	Bardet-Biedl syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. McKusick-Kaufman syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is fetal. This disease is characterized by hydrometrocolpos, post-axial polydactyly, and to a lesser extent cardiac defects.	250,600
MKKS	Bardet-Biedl syndrome type 6	NM_018848.3	NM_018848.3:c.830T>C, NM_018848.3:c.1436C>G	Bardet-Biedl syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.	250,600
MKKS	McKusick-Kaufman syndrome	NM_018848.3	NM_018848.3:c.250C>T, NM_018848.3:c.1225_1226delGG, NM_018848.3:c.724G>T	McKusick-Kaufman syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is fetal. This disease is characterized by hydrometrocolpos, post-axial polydactyly, and to a lesser extent cardiac defects.	250,600
MKS1	Bardet-Biedl syndrome type 13	NM_017777.3	NM_017777.3:c.1349T>C	Bardet-Biedl syndrome type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.	250,600
MKS1	Meckel type 1/Bardet-Biedl syndrome	NM_017777.3	NM_017777.3:c.1024+1G>A, NM_017777.3:c.857A>G, NM_017777.3:c.1319T>C, NM_017777.3:c.814G>C, NM_017777.3:c.508C>T, NM_017777.3:c.1319G>C	Meckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is infantile, etc/. This disease is characterized by a combination of renal cysts and variably associated features, including developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and cysts, and polydactyly.. The prevalence is 1:1,000,000-9:1,000,000. Bardet-Biedl syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.	250,600
MMACHC	Methylmalonic aciduria cblC type, with homocystinuria	NM_015506.2	NM_015506.2:c.389A>G, NM_015506.2:c.388T>C, NM_015506.2:c.482G>A, NM_015506.2:c.609G>A, NM_015506.2:c.688C>T, NM_015506.2:c.394C>T, NM_015506.2:c.440G>C, NM_015506.2:c.608G>A, NM_015506.2:c.481C>T, NM_015506.2:c.619_620insG, NM_015506.2:c.547_548delGT, NM_015506.2:c.347T>C, NM_015506.2:c.658_660delAAG, NM_015506.2:c.388_390delTAC, NM_015506.2:c.615C>A, NM_015506.2:c.331C>T, NM_015506.2:c.616C>T, NM_015506.2:c.270_271insA, NM_015506.2:c.271dupA, NM_015506.2:c.615C>G	Methylmalonic acidemia with homocystinuria, type cblC follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMACHC gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by failure to thrive, acute neurological deterioration, intellectual deficit, lethargy, seizures, microcephaly, a salt-and-pepper retinopathy, and signs of megaloblastic anemia. The prevalence is <1:1,000,000.	250,600
MOCS2	Molybdenum cofactor deficiency type B	NM_176806.3	NM_176806.3:c.106_107delAT, NM_176806.3:c.297+1G>A, NM_176806.3:c.58delT, NM_176806.3:c.245delT, NM_176806.3:c.190G>A, NM_176806.3:c.16C>T, NM_176806.3:c.487A>C, NM_176806.3:c.422G>A, NM_176806.3:c.26_27delAT, NM_176806.3:c.539_540delAA, NM_176806.3:c.459_*460delAA	Molybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death.	250,600
MTTP	Abetalipoproteinemia	NM_000253.3	NM_000253.3:c.1769G>T, NM_000253.3:c.2030delC, NM_000253.3:c.1619G>A, NM_000253.3:c.2593G>T, NM_000253.3:c.708_709delCA, NM_000253.3:c.1867+1G>A, NM_000253.3:c.703_704delAC	Abetalipoproteinemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTP gene located on chromosomal region 4q23. The age of onset is infantile. This disease is characterized by growth delay, malabsorption, hepatomegaly, and neurological and neuromuscular manifestations. The prevalence is <1:1,000,000.	250,600
MUT	Methylmalonic acidemia	NM_000255.3	NM_000255.3:c.1420C>T, NM_000255.3:c.1445-2A>G, NM_000255.3:c.2080C>T, NM_000255.3:c.1867G>A, NM_000255.3:c.607G>A, NM_000255.3:c.1658delT, NM_000255.3:c.1280G>A, NM_000255.3:c.1399C>T, NM_000255.3:c.914T>C, NM_000255.3:c.643G>A, NM_000255.3:c.655A>T, NM_000255.3:c.1741C>T, NM_000255.3:c.1106G>A, NM_000255.3:c.1871A>G, NM_000255.3:c.1924G>C, NM_000255.3:c.682C>T, NM_000255.3:c.572C>A, NM_000255.3:c.313T>C, NM_000255.3:c.1181T>A, NM_000255.3:c.278G>A, NM_000255.3:c.678_679insAATTTATG, NM_000255.3:c.794dupT, NM_000255.3:c.671_678dupAATTTATG, NM_000255.3:c.2150G>T, NM_000255.3:c.280G>A, NM_000255.3:c.91C>T, NM_000255.3:c.1207C>T	Methylmalonic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MUT gene located on chromosomal region 6p12.3. The age of onset is very early infantile. This disease is characterized by recurrent ketoacidotic comas or transient vomiting, dehydration, hypotonia and intellectual deficit, which does not respond to administration of vitamin B12.	250,600
MVK	Hyper-IgD syndrome	NM_000431.3	NM_000431.3:c.829C>T, NM_000431.3:c.803T>C, NM_000431.3:c.185G>A, NM_000431.3:c.494C>T, NM_000431.3:c.59A>C, NM_000431.3:c.1129G>A	Hyper IgD syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by periodic attacks of fever and a systemic inflammatory reaction (cervical lymphadenopathy, abdominal pain, vomiting, diarrhea, arthralgias and skin signs).	250,600
MVK	Mevalonic aciduria	NM_000431.3	NM_000431.3:c.1000G>A, NM_000431.3:c.902A>C, NM_000431.3:c.928G>A	Mevalonic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by psychomotor retardation, failure to thrive, progressive cerebellar ataxia, dysmorphic features, progressive visual impairment and recurrent febrile crises. The prevalence is <1:1,000,000.	250,600
MYO15A	Deafness type 3, autosomal recessive	NM_016239.3	NM_016239.3:c.3385C>T, NM_016239.3:c.6003delG, NM_016239.3:c.6004delG, NM_016239.3:c.10573delA, NM_016239.3:c.3313G>T, NM_016239.3:c.3336delG, NM_016239.3:c.755dupA, NM_016239.3:c.5492G>T, NM_016239.3:c.4351G>A, NM_016239.3:c.6864_6874delGGACCTGGAGC, NM_016239.3:c.4751_4752dupTC, NM_016239.3:c.625G>T, NM_016239.3:c.3693-2A>G, NM_016239.3:c.6614C>T, NM_016239.3:c.6743C>T, NM_016239.3:c.6046+2T>G, NM_016239.3:c.5326C>T, NM_016239.3:c.3756+1G>T, NM_016239.3:c.8410A>T, NM_016239.3:c.8429_8447delGCGGGCAGCTGCGGGTCCT, NM_016239.3:c.8148G>T, NM_016239.3:c.9958_9961delGACT, NM_016239.3:c.4750_4751insTC, NM_016239.3:c.8548C>T	Deafness autosomal recessive type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO15A gene located on chromosomal region 17p11.2. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	250,600
MYO3A	Deafness type 30, autosomal recessive	NM_017433.4	NM_017433.4:c.1086T>G, NM_017433.4:c.2793+2T>A, NM_017433.4:c.4586+2T>G, NM_017433.4:c.4730+1G>A, NM_017433.4:c.1A>G, NM_017433.4:c.2506-1G>A, NM_017433.4:c.1777-12G>A, NM_017433.4:c.1952delC, NM_017433.4:c.1193C>A, NM_017433.4:c.770C>G, NM_017433.4:c.3154C>T, NM_017433.4:c.585+5G>C, NM_017433.4:c.2243delA, NM_017433.4:c.3112-2A>G, NM_017433.4:c.732-2A>G	Deafness autosomal recessive type 30 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO3A gene located on chromosomal region 10p12.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	250,600
MYO6	Deafness type 37, autosomal recessive	NM_004999.3	NM_004999.3:c.2897_2899delAAG, NM_004999.3:c.2840G>A, NM_004999.3:c.647A>T, NM_004999.3:c.3496C>T, NM_004999.3:c.3808C>T, NM_004999.3:c.1446_1447insT	Deafness autosomal recessive type 37 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO6 gene located on chromosomal region 6q14.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	250,600
MYO7A	Deafness type 2, autosomal recessive	NM_000260.3	NM_000260.3:c.1797G>A, NM_000260.3:c.2023C>T, NM_000260.3:c.731G>C, NM_000260.3:c.3596dupT, NM_000260.3:c.1184G>A, NM_000260.3:c.133-2A>G	Deafness autosomal recessive type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	250,600
MYO7A	Usher syndrome type 1B	NM_000260.3	NM_000260.3:c.1996C>T, NM_000260.3:c.1884C>A, NM_000260.3:c.448C>T, NM_000260.3:c.2476G>A, NM_000260.3:c.4024delT, NM_000260.3:c.2617C>T, NM_000260.3:c.5227C>T, NM_000260.3:c.1344-1G>A, NM_000260.3:c.5507T>G, NM_000260.3:c.5886_5889delCTTT, NM_000260.3:c.3504-1G>C, NM_000260.3:c.3508G>A, NM_000260.3:c.4018G>A, NM_000260.3:c.5392C>T, NM_000260.3:c.640G>A, NM_000260.3:c.3134T>C, NM_000260.3:c.5824G>T, NM_000260.3:c.3G>A, NM_000260.3:c.494C>T, NM_000260.3:c.5618G>A, NM_000260.3:c.5884_5887delTTCT, NM_000260.3:c.634C>T, NM_000260.3:c.3719G>A, NM_000260.3:c.5967C>G, NM_000260.3:c.3763delA, NM_000260.3:c.635G>A, NM_000260.3:c.6025delG	Usher syndrome type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 1:100,000-9:100,000.	250,600
NAGA	Schindler disease	NM_000262.2	NM_000262.2:c.973G>A, NM_000262.2:c.985C>T, NM_000262.2:c.986G>A, NM_000262.2:c.577G>T	Schindler disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGA gene located on chromosomal region 22q13.2. The age of onset is infantile. This disease is characterized by early-onset neuroaxonal dystrophy and neurological signs (convulsion during fever, epilepsy, psychomotor retardation and hypotonia). NAGA deficiency is typically classified in three main phenotypes: NAGA deficiency type I (Schindler disease or Schindler disease type I) with severe manifestations; NAGA deficiency type II (Kanzazi disease or Schindler disease type II) which is mild; NAGA deficiency type III (Schindler disease type III) characterized by mild-to-moderate neurologic manifestations. NAGA deficiency results in the increased urinary excretion of glycopeptides and oligosaccharides containing alpha-N-acetylgalactosaminyl moieties.	250,600
NEB	Nemaline myopathy type 2	NM_004543.4	NM_004543.4:c.11474_11475delTG, NM_004543.4:c.19119_19120delGA, NM_004543.4:c.19306-1G>A, NM_004543.4:c.19606G>T, NM_004543.4:c.6105dupT, NM_004543.4:c.3191A>G, NM_004543.4:c.18318_18319delAG, NM_004543.4:c.11473_11474delAT, NM_004543.4:c.2173G>T, NM_004543.4:c.19097_19098delTT, NM_004543.4:c.19836+1_19836+2insATGGA, NM_004543.4:c.18825+1370C>T, NM_004543.4:c.5567G>A, NM_004543.4:c.6105_6106insT, NM_004543.4:c.16842+1G>A, NM_004543.4:c.843T>G, NM_004543.4:c.8031_8041delAAATAAACGAG, NM_004543.4:c.14182_14183delGCinsAA, NM_004543.4:c.15973C>T	Nemaline myopathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEB gene located on chromosomal region 2q23.3. The age of onset is infantile or adult. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:100,000-9:100,000 and the incidence is 1/50.000 newborn.	250,600
NMNAT1	Leber congenital amaurosis type 9	NM_022787.3	NM_022787.3:c.451G>T, NM_022787.3:c.25G>A, NM_022787.3:c.457C>G, NM_022787.3:c.507G>A, NM_022787.3:c.710G>T, NM_022787.3:c.619C>T, NM_022787.3:c.769G>A	Leber congenital amaurosis type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NMNAT1 gene located on chromosomal region 1p36.22. The age of onset is early infantile. This disease is characterized by blindness, nystagmus, roving eye movement, leading to severe visual impairment.	250,600
NPC1	Niemann-Pick disease type C1	NM_000271.4	NM_000271.4:c.1042C>T, NM_000271.4:c.2842G>A, NM_000271.4:c.1628C>T, NM_000271.4:c.2974G>T, NM_000271.4:c.3019C>G, NM_000271.4:c.1211G>A, NM_000271.4:c.2072C>T, NM_000271.4:c.2324A>C, NM_000271.4:c.337T>C, NM_000271.4:c.3107C>T, NM_000271.4:c.530G>A, NM_000271.4:c.743G>T, NM_000271.4:c.3611_3614delTTAC, NM_000271.4:c.813_815delCAT, NM_000271.4:c.2932C>T, NM_000271.4:c.3425T>C, NM_000271.4:c.2761C>T, NM_000271.4:c.3104C>T, NM_000271.4:c.3662delT, NM_000271.4:c.2972_2973delAG, NM_000271.4:c.2974G>A, NM_000271.4:c.2873G>A, NM_000271.4:c.352_353delAG, NM_000271.4:c.3182T>C, NM_000271.4:c.3467A>G, NM_000271.4:c.3175C>T, NM_000271.4:c.2861C>T, NM_000271.4:c.2848G>A	Niemann-Pick disease type C1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC1 gene located on chromosomal region 18q11.2. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000.	250,600
NPC2	Niemann-Pick disease type C2	NM_006432.3	NM_006432.3:c.115G>A, NM_006432.3:c.190+5G>A, NM_006432.3:c.27delG, NM_006432.3:c.352G>T, NM_006432.3:c.58G>T, NM_006432.3:c.358C>T, NM_006432.3:c.295T>C, NM_006432.3:c.441+1G>A, NM_006432.3:c.436C>T	Niemann-Pick disease type C2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC2 gene located on chromosomal region 14q24.3. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000.	250,600
NPHP3	Nephronophthisis type 3	NM_153240.4	NM_153240.4:c.1817G>A, NM_153240.4:c.434_437delAAAG, NM_153240.4:c.1119-2A>G, NM_153240.4:c.1729C>T, NM_153240.4:c.2694-2A>G, NM_153240.4:c.1985+5G>A, NM_153240.4:c.3406C>T, NM_153240.4:c.3373C>T, NM_153240.4:c.1381G>T, NM_153240.4:c.2694-2_2694-1delAG, NM_153240.4:c.1157A>G, NM_153240.4:c.2369T>C, NM_153240.4:c.3550G>A, NM_153240.4:c.2541delG, NM_153240.4:c.2570+1G>T, NM_153240.4:c.3156_3157insA, NM_153240.4:c.3662C>T	Nephronophthisis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP3 gene located on chromosomal region 3q22.1. The age of onset is adult. This disease is characterized by polyuria, polydipsia, anemia. Onset of terminal renal failure occur significantly later (median age, 19 years) than in juvenile nephronophthisis. Renal pathology is characterized by alterations of tubular basement membranes, tubular atrophy and dilation, sclerosing tubulointerstitial nephropathy, and renal cyst development predominantly at the corticomedullary junction. The prevalence is <1:1,000,000.	250,600
NPHP4	Nephronophthisis type 4	NM_015102.4	NM_015102.4:c.4179T>A, NM_015102.4:c.3767_3768insAA, NM_015102.4:c.3674C>T, NM_015102.4:c.556_557insT, NM_015102.4:c.2940_2944dupGCTCC, NM_015102.4:c.3231+1G>C, NM_015102.4:c.517C>T, NM_015102.4:c.2335C>T, NM_015102.4:c.2219G>A, NM_015102.4:c.7G>T, NM_015102.4:c.1972C>T, NM_015102.4:c.1120-1G>C	Nephronophthisis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP4 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease results in end-stage renal disease at age ranging between 6 and 35 years. It is a progressive tubulo-interstitial kidney disorder characterized by polydipsia, polyuria, anemia and growth retardation. The prevalence is 1:1,000,000-9:1,000,000.	250,600
NPHS1	Nephrotic syndrome type 1	NM_004646.3	NM_004646.3:c.59-5C>G, NM_004646.3:c.3109+1G>A, NM_004646.3:c.3478C>T, NM_004646.3:c.121_122delCT, NM_004646.3:c.1481delC, NM_004646.3:c.2456A>T, NM_004646.3:c.2491C>T, NM_004646.3:c.2464G>A, NM_004646.3:c.1307_1308dupAC, NM_004646.3:c.3250delG, NM_004646.3:c.3325C>T, NM_004646.3:c.2928G>T, NM_004646.3:c.3250_3251insG, NM_004646.3:c.2746G>T, NM_004646.3:c.1715G>A	Nephrotic syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHS1 gene located on chromosomal region 19q13.12. The age of onset is fetal- infantile. This disease is characterized by fetal proteinuria and nephritic infantile syndrome. The prevalence is 1 in 8 200 births.	250,600
NR2E3	Enhaced S-Cone Syndrome	NM_014249.3	NM_014249.3:c.119-2A>C, NM_014249.3:c.297_298delGT, NM_014249.3:c.932G>A, NM_014249.3:c.226C>T, NM_014249.3:c.361G>A, NM_014249.3:c.227G>A, NM_014249.3:c.1034_1038delTGCAG	Enhaced S-Cone Syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NR2E3 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by night blindness, reduced bilateral visual acuity, and typical fundus findings (progressive pigmentary degenerative changes, macular edema, retinoschisis).	250,600
OCA2	Oculocutaneous albinism type 2	NM_000275.2	NM_000275.2:c.1610A>G, NM_000275.2:c.1960delG, NM_000275.2:c.2359G>A, NM_000275.2:c.819_822delCTGGinsGGTC, NM_000275.2:c.2228C>T, NM_000275.2:c.1025A>G, NM_000275.2:c.1842+1G>T, NM_000275.2:c.157delA, NM_000275.2:c.1182G>A, NM_000275.2:c.1182+2T>C, NM_000275.2:c.1441G>A, NM_000275.2:c.79G>A, NM_000275.2:c.1465A>G, NM_000275.2:c.1327G>A, NM_000275.2:c.1364+1G>T	Oculocutaneous albinism type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OCA2 gene located on chromosomal region 15q12-q13. The age of onset is infantile. This disease is characterized by variable hypopigmentation of the skin and hair, numerous characteristic ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1/38,000-1/40,000	250,600
OTOA	Deafness type 22, autosomal recessive	NM_144672.3	NM_144672.3:c.2301+1G>T, NM_144672.3:c.2359G>T, NM_144672.3:c.121-1G>A, NM_144672.3:c.827delT, NM_144672.3:c.1725_1726delCA	Deafness, autosomal recessive type 22 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOA gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems.	250,600
OTOF	Deaffness type 9, autosomal recessive	NM_194248.2	NM_194248.2:c.149G>A, NM_194248.2:c.1867G>A, NM_194248.2:c.1669G>A, NM_194248.2:c.2381G>A, NM_194248.2:c.1498C>T, NM_194248.2:c.1544T>C, NM_194248.2:c.5473C>G, NM_194248.2:c.1150G>A, NM_194248.2:c.1778delT, NM_194248.2:c.5103+2T>A, NM_194248.2:c.227+2T>C, NM_194248.2:c.5474_5475delCC, NM_194248.2:c.5332G>A, NM_194248.2:c.584-1G>C, NM_194248.2:c.98G>A, NM_194248.2:c.2348delG, NM_194248.2:c.3032T>C, NM_194248.2:c.4559G>A, NM_194248.2:c.4491T>A, NM_194248.2:c.5816G>A, NM_194248.2:c.766-2A>G, NM_194248.2:c.2485C>T, NM_194248.2:c.2401G>T	Deaffness, autosomal recessive type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems.	250,600
PAH	Phenylketonuria	NM_000277.1	NM_000277.1:c.1139C>T, NM_000277.1:c.1066-3C>T, NM_000277.1:c.117C>G, NM_000277.1:c.1166delC, NM_000277.1:c.1068C>A, NM_000277.1:c.1315+1G>A, NM_000277.1:c.1162G>A, NM_000277.1:c.143T>C, NM_000277.1:c.1243G>A, NM_000277.1:c.1169A>G, NM_000277.1:c.136G>A, NM_000277.1:c.1184C>A, NM_000277.1:c.194T>C, NM_000277.1:c.1199+17G>A, NM_000277.1:c.232G>A, NM_000277.1:c.1045T>C, NM_000277.1:c.1197A>T, NM_000277.1:c.441+1G>A, NM_000277.1:c.442-1G>A, NM_000277.1:c.442-5C>G, NM_000277.1:c.450_451insA, NM_000277.1:c.472C>T, NM_000277.1:c.204A>T, NM_000277.1:c.482T>C, NM_000277.1:c.250G>T, NM_000277.1:c.261C>A, NM_000277.1:c.1030G>A, NM_000277.1:c.1199+1G>A, NM_000277.1:c.1238G>C, NM_000277.1:c.1241A>G, NM_000277.1:c.673C>G, NM_000277.1:c.688G>A, NM_000277.1:c.721C>T, NM_000277.1:c.722delG, NM_000277.1:c.722G>A, NM_000277.1:c.727C>T, NM_000277.1:c.728G>A, NM_000277.1:c.733G>C, NM_000277.1:c.734T>C, NM_000277.1:c.737C>A, NM_000277.1:c.745C>T, NM_000277.1:c.1042C>G, NM_000277.1:c.638T>C, NM_000277.1:c.764T>C, NM_000277.1:c.782G>A, NM_000277.1:c.806delT, NM_000277.1:c.809G>A, NM_000277.1:c.814G>T, NM_000277.1:c.818C>T, NM_000277.1:c.823C>T, NM_000277.1:c.829T>G, NM_000277.1:c.898G>T, NM_000277.1:c.912+1G>A, NM_000277.1:c.284_286delTCA, NM_000277.1:c.754C>T, NM_000277.1:c.755G>A, NM_000277.1:c.357delC, NM_000277.1:c.1217T>C, NM_000277.1:c.1222C>T, NM_000277.1:c.157C>T, NM_000277.1:c.158G>A, NM_000277.1:c.165T>G, NM_000277.1:c.473G>A, NM_000277.1:c.490A>G, NM_000277.1:c.503delA, NM_000277.1:c.508C>G, NM_000277.1:c.533A>G, NM_000277.1:c.665A>G, NM_000277.1:c.838G>A, NM_000277.1:c.842+5G>A, NM_000277.1:c.896T>G, NM_000277.1:c.320A>G, NM_000277.1:c.441+5G>T, NM_000277.1:c.311C>A, NM_000277.1:c.527G>T, NM_000277.1:c.529G>A, NM_000277.1:c.47_48delCT, NM_000277.1:c.1208C>T, NM_000277.1:c.331C>T, NM_000277.1:c.926C>T, NM_000277.1:c.955G>T, NM_000277.1:c.926C>A, NM_000277.1:c.509+1G>A, NM_000277.1:c.1033G>T, NM_000277.1:c.611A>G, NM_000277.1:c.1066-11G>A, NM_000277.1:c.569T>C	Phenylketonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAH gene located on chromosomal region 12q23.2. The age of onset is neonatal. This disease is characterized by gradual developmental delay, stunted growth, microcephaly, seizures, tremors, eczema, vomiting, and musty odor. Untreated patients subsequently develop intellectual disability, behavioral disorders (hyperactivity) and motor disorders. The prevalence is 1:2,600-1:200,000.	250,600
PALB2	Fanconi anemia, complementation group N	NM_024675.3	NM_024675.3:c.1882_1890delAAGTCCTGC, NM_024675.3:c.2962C>T, NM_024675.3:c.50T>G, NM_024675.3:c.3116delA, NM_024675.3:c.3287A>G, NM_024675.3:c.3549C>G, NM_024675.3:c.3113G>A, NM_024675.3:c.2816T>G, NM_024675.3:c.1240C>T, NM_024675.3:c.557_558insA	Fanconi anemia, complementation group N follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PALB2 gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:1,000,000-9:1,000,000.	250,600
PANK2	Pantothenate kinase-associated neurodegeneration	NM_153638.2	NM_153638.2:c.1561G>A, NM_153638.2:c.688G>A, NM_153638.2:c.790C>T, NM_153638.2:c.821_822delCT, NM_153638.2:c.1583C>T, NM_153638.2:c.1211A>T	Pantothenate kinase-associated neurodegeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PANK2 gene located on chromosomal region 20p13. The age of onset is infantile. This disease is characterized by progressive extrapyramidal dysfunction (dystonia, rigidity, choreoathetosis), iron accumulation on the brain and axonal spheroids in the central nervous system. The prevalence is 1-2/1,000,000.	250,600
PC	Pyruvate carboxylase deficiency	NM_000920.3	NM_000920.3:c.434T>C, NM_000920.3:c.1748G>T, NM_000920.3:c.496G>A	Pyruvate carboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PC gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by metabolic acidosis, failure to thrive, developmental delay, and recurrent seizures. The prevalence is 1:250,000.	250,600
PCCA	Propionic acidemia type 1	NM_000282.3	NM_000282.3:c.1598_1601delTTGT, NM_000282.3:c.412G>A, NM_000282.3:c.1226_1227delTT, NM_000282.3:c.1891G>C, NM_000282.3:c.1899+1_1899+4delGTAA, NM_000282.3:c.1284+1G>A, NM_000282.3:c.229C>T, NM_000282.3:c.1023dupT, NM_000282.3:c.600+1G>A, NM_000282.3:c.261_262insT, NM_000282.3:c.1118T>A, NM_000282.3:c.862A>T	Propionic acidemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCA gene located on chromosomal region 13q32.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000.	250,600
PCCB	Propionic acidemia type 2	NM_000532.4	NM_000532.4:c.1279_1291delGTTCCCinsAA, NM_000532.4:c.1283C>T, NM_000532.4:c.337C>T, NM_000532.4:c.1538_1540dupCCC, NM_000532.4:c.990dupT, NM_000532.4:c.1304A>G, NM_000532.4:c.1228C>T, NM_000532.4:c.1229_1230insT, NM_000532.4:c.1606A>G, NM_000532.4:c.1223_1226delTCAT, NM_000532.4:c.1490C>T, NM_000532.4:c.1534C>T, NM_000532.4:c.1173_1174insT, NM_000532.4:c.1540_1541insCCC, NM_000532.4:c.331C>T, NM_000532.4:c.683C>T, NM_000532.4:c.797G>T, NM_000532.4:c.737G>T, NM_000532.4:c.1218_1231delinsTAGAGCACAGGA, NM_000532.4:c.502G>A, NM_000532.4:c.562G>A, NM_000532.4:c.1219_1224delGGCATCinsAA	Propionic acidemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCB gene located on chromosomal region 3q22.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy.. The prevalence is 1:100,000.	250,600
PCDH15	Usher syndrome type 1F	NM_033056.3	NM_033056.3:c.1583T>A, NM_033056.3:c.4885delA, NM_033056.3:c.4961_4962insTGAT, NM_033056.3:c.5659A>T, NM_033056.3:c.4937_4940dupTGAT, NM_033056.3:c.785G>A, NM_033056.3:c.5622_5624delAAC, NM_033056.3:c.400C>T, NM_033056.3:c.5724_5755delACGCACAAATGTTTCAGAACTTCAAACTATGT, NM_033056.3:c.4864delA, NM_033056.3:c.1737C>G, NM_033056.3:c.1021C>T, NM_033056.3:c.1088delT, NM_033056.3:c.1006C>T, NM_033056.3:c.1940C>G, NM_033056.3:c.400C>G, NM_033056.3:c.3718-2A>G, NM_033056.3:c.4548_4551dupATCT, NM_033056.3:c.7C>T, NM_033056.3:c.2645_2646delAT	Usher syndrome type 1F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCDH15 gene located on chromosomal region 10q21.1. The age of onset is early. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 4.4:100,000.	250,600
PDE6A	Retinitis pigmentosa type 43	NM_000440.2	NM_000440.2:c.1683G>A, NM_000440.2:c.1113+1G>T, NM_000440.2:c.718-4_718-3insT, NM_000440.2:c.1749C>G, NM_000440.2:c.2053G>A, NM_000440.2:c.1560_1561insA, NM_000440.2:c.304C>A, NM_000440.2:c.1040C>T, NM_000440.2:c.1113+1G>A	Retinitis pigmentosa 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	250,600
PDE6B	Retinitis pigmentosa type 43	NM_000283.3	NM_000283.3:c.1580T>C, NM_000283.3:c.655T>C, NM_000283.3:c.1540delC, NM_000283.3:c.1572delC, NM_000283.3:c.1920+2T>C, NM_000283.3:c.1669C>T, NM_000283.3:c.892C>T	Retinitis pigmentosa 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	250,600
PEX1	Peroxisome biogenesis disorder type 1A	NM_000466.2	NM_000466.2:c.2097dupT, NM_000466.2:c.2916delA, NM_000466.2:c.1842delA, NM_000466.2:c.1991T>C, NM_000466.2:c.1239+1G>T	Peroxisome biogenesis disorder type 1A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. The age of onset is early. This disease is characterized by neuronal migration defects in the brain, dysmorphic craniofacial features, profound hypotonia, neonatal seizures, and liver dysfunction. The prevalence is 1:1,000,000.	250,600
PEX1	Peroxisome biogenesis disorder type 1B	NM_000466.2	NM_000466.2:c.2097_2098insT, NM_000466.2:c.1952_1960dupCAGTGTGGA, NM_000466.2:c.877C>T, NM_000466.2:c.3505_3517delCAGTTGTTTTCAC, NM_000466.2:c.2528G>A	Peroxisome biogenesis disorder type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. The age of onset is early. This disease includes neonatal adrenoleukodystrophy and infantile Refsum disease, two milder manifestations of the Zellweger disease spectrum. The clinical course of patients is variable and may include developmental delay, hypotonia, liver dysfunction, sensorineural hearing loss, retinal dystrophy and vision impairment.	250,600
PEX7	Rhizomelic chondrodysplasia punctata type 1	NM_000288.3	NM_000288.3:c.694C>T, NM_000288.3:c.649G>A, NM_000288.3:c.618G>A, NM_000288.3:c.722A>T, NM_000288.3:c.875T>A, NM_000288.3:c.653C>T, NM_000288.3:c.854A>G, NM_000288.3:c.532C>T, NM_000288.3:c.903+1G>C	Rhizomelic chondrodysplasia punctata type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX7 gene located on chromosomal region 6q23.3. The age of onset is early. This disease is characterized by proximal shortening of the humerus and to a lesser degree the femur (rhizomelia), punctate calcifications in cartilage with epiphyseal and metaphyseal abnormalities (chondrodysplasia punctata), coronal clefts of the vertebral bodies, cataracts, postnatal growth deficiency is profound, intellectual disability is severe, seizures. The prevalence is <1:100,000.	250,600
PHYH	Refsum disease	NM_006214.3	NM_006214.3:c.135-2A>G, NM_006214.3:c.497-2A>G, NM_006214.3:c.135-1G>C, NM_006214.3:c.805A>C, NM_006214.3:c.678+5G>T, NM_006214.3:c.823C>T, NM_006214.3:c.530A>G, NM_006214.3:c.164delT, NM_006214.3:c.678+2T>G, NM_006214.3:c.824G>A	Refsum disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHYH gene located on chromosomal region 10p13. The age of onset is variable. This disease is characterized by hemeralopia (loss of vision in the dark), followed by episods of chronic distal motor polyneuropathy. Other associated signs include perceptive deafness, anosmia, cerebellous ataxia and sometimes, severe intellectual deficiency. Over the course of time cutaneous signs appear (ichtyosis), along with polyepiphyseal dysplasia, myocardiopathy, elevated protein in cerebrospinal fluid, and pigmentary retinitis that may result in blindness. The prevalence is 1:1.000,000-9:1.000,000.	250,600
PKHD1	Polycystic kidney disease, autosomal recessive	NM_138694.3	NM_138694.3:c.10515C>A, NM_138694.3:c.11363_11372delCTTCCCTGGA, NM_138694.3:c.10585G>C, NM_138694.3:c.107C>T, NM_138694.3:c.10452dupT, NM_138694.3:c.2452C>T, NM_138694.3:c.2747A>C, NM_138694.3:c.12027C>G, NM_138694.3:c.11284C>A, NM_138694.3:c.3367G>A, NM_138694.3:c.353delG, NM_138694.3:c.2827_2828delGA, NM_138694.3:c.2854G>A, NM_138694.3:c.1342G>C, NM_138694.3:c.1409G>A, NM_138694.3:c.11611T>C, NM_138694.3:c.3761_3762delCCinsG, NM_138694.3:c.2414C>T, NM_138694.3:c.5895_5896insA, NM_138694.3:c.5895dupA, NM_138694.3:c.6499C>T, NM_138694.3:c.664A>G, NM_138694.3:c.682A>G, NM_138694.3:c.6854G>A, NM_138694.3:c.370C>T, NM_138694.3:c.8407T>C, NM_138694.3:c.3766delC, NM_138694.3:c.3940delA, NM_138694.3:c.1486C>T, NM_138694.3:c.2341C>T, NM_138694.3:c.10219C>T, NM_138694.3:c.9107T>G, NM_138694.3:c.930delC, NM_138694.3:c.9370C>T, NM_138694.3:c.9530T>C, NM_138694.3:c.9689delA, NM_138694.3:c.982C>T, NM_138694.3:c.9866G>T, NM_138694.3:c.10036T>C, NM_138694.3:c.3229-2A>C, NM_138694.3:c.4870C>T, NM_138694.3:c.4165C>A, NM_138694.3:c.9719G>A, NM_138694.3:c.5325_5326delAG, NM_138694.3:c.5498C>T, NM_138694.3:c.8824C>T, NM_138694.3:c.85G>T, NM_138694.3:c.10412T>G, NM_138694.3:c.8518C>T, NM_138694.3:c.8408G>A, NM_138694.3:c.8317G>T, NM_138694.3:c.8870T>C	Autosomal recessive polycystic kidney disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKHD1 gene located on chromosomal region 6p12.3-p12.2. The age of onset is early. This disease is characterized by the development of cysts affecting the collecting ducts. It is frequently associated with hepatic involvement. After birth, in addition to nephromegaly, arterial hypertension and urinary tract infections are common and often severe. The prevalence is 1:10,000-1:40,000.	250,600
PKLR	Hemolytic anemia due to red cell pyruvate kinase deficiency	NM_000298.5	NM_000298.5:c.1151C>T, NM_000298.5:c.1706G>A, NM_000298.5:c.1529G>A, NM_000298.5:c.1528C>T, NM_000298.5:c.1595G>A, NM_000298.5:c.721G>T, NM_000298.5:c.1076G>A, NM_000298.5:c.1675C>T, NM_000298.5:c.1261C>A, NM_000298.5:c.1436G>A, NM_000298.5:c.1456C>T	Hemolytic anemia due to red cell pyruvate kinase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKLR gene located on chromosomal region 1q22. The age of onset is early. This disease is characterized by highly variable degree of chronic hemolysis, with severe neonatal jaundice and fatal anemia at birth, severe transfusion-dependent chronic hemolysis, and moderate hemolysis with exacerbation during infection. The prevalence is 1:20,000.	250,600
PLCE1	Nephrotic syndrome type 3	NM_016341.3	NM_016341.3:c.3346C>T, NM_016341.3:c.4808delA, NM_016341.3:c.3846delG, NM_016341.3:c.3736C>T, NM_016341.3:c.5560C>T, NM_016341.3:c.4451C>T, NM_016341.3:c.5669C>T, NM_016341.3:c.961C>T	Nephrotic syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLCE1 gene located on chromosomal region 10q23.33. The age of onset is variable. This disease is characterized by low blood protein levels, high cholesterol levels, high triglyceride levels, and presence of protein in the urine. The prevalence is 2:100,000-7:100,000 Children; 3:100,000 adults.	250,600
PLG	Congenital plasminogen deficiency type 1	NM_000301.3	NM_000301.3:c.704G>A, NM_000301.3:c.1848G>A, NM_000301.3:c.1435G>T, NM_000301.3:c.693_695delGAA, NM_000301.3:c.1120G>T, NM_000301.3:c.112A>G	Plasminogen deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLG gene located on chromosomal region 6q26. The age of onset is infantile.This disease is characterized by markedly impaired extracellular fibrinolysis leading to the formation of ligneous (fibrin-rich) pseudomembranes on mucosae during wound healing. The prevalence is 1:1,000,000-9:1,000,000.	250,600
PMM2	Congenital disorders of glycosylation type 1a	NM_000303.2	NM_000303.2:c.349G>C, NM_000303.2:c.357C>A, NM_000303.2:c.255+2T>C, NM_000303.2:c.127G>C, NM_000303.2:c.395T>C, NM_000303.2:c.415G>A, NM_000303.2:c.368G>A, NM_000303.2:c.385G>A, NM_000303.2:c.470T>C, NM_000303.2:c.484C>T, NM_000303.2:c.422G>A, NM_000303.2:c.442G>A, NM_000303.2:c.623G>C, NM_000303.2:c.647A>T, NM_000303.2:c.652C>G, NM_000303.2:c.323C>T, NM_000303.2:c.677C>G, NM_000303.2:c.691G>A, NM_000303.2:c.710C>G, NM_000303.2:c.669C>G, NM_000303.2:c.95_96delTAinsGC, NM_000303.2:c.95T>G, NM_000303.2:c.53C>G, NM_000303.2:c.710C>T, NM_000303.2:c.620T>C, NM_000303.2:c.97C>T, NM_000303.2:c.193G>T, NM_000303.2:c.338C>T, NM_000303.2:c.563A>G, NM_000303.2:c.131T>C, NM_000303.2:c.26G>A, NM_000303.2:c.109C>T, NM_000303.2:c.317A>T, NM_000303.2:c.190delT, NM_000303.2:c.256-1G>C	Congenital disorder of glycosylation type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PMM2 gene located on chromosomal region 16p13.2. The age of onset is infantile. This disease is characterized by highly variable clinical manifestations that may include feeding problems, vomiting, and diarrhea with failure to thrive in infants, and severe encephalopathy with axial hypotonia, abnormal eye movement, marked psychomotor retardation, peripheral neuropathy, cerebellar hypoplasia, stroke-like episodes, and retinitis pigmentosa in late infancy, childhood or adulthood.	250,600
POLG	Mitochondrial DNA depletion syndrome, Alpers type	NM_002693.2	NM_002693.2:c.2617G>T, NM_002693.2:c.1120C>T, NM_002693.2:c.830A>T, NM_002693.2:c.3218C>T, NM_002693.2:c.3630dupC	Mitochondrial DNA depletion syndrome, Alpers type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by the clinical triad of psychomotor regression, seizures, and liver disease. The prevalence is 1:1,600 newborn.	250,600
POLG	Progressive external ophthalmoplegia	NM_002693.2	NM_002693.2:c.1437C>G, NM_002693.2:c.2591A>G, NM_002693.2:c.1754G>A, NM_002693.2:c.1399G>A, NM_002693.2:c.1491G>C, NM_002693.2:c.3151G>C, NM_002693.2:c.803G>C, NM_002693.2:c.3286C>T, NM_002693.2:c.2794C>T, NM_002693.2:c.752C>T, NM_002693.2:c.3644-1G>A, NM_002693.2:c.1879C>T, NM_002693.2:c.2605C>T, NM_002693.2:c.911T>G, NM_002693.2:c.1760C>T, NM_002693.2:c.2542G>A, NM_002693.2:c.1550G>T, NM_002693.2:c.2557C>T, NM_002693.2:c.2207A>G, NM_002693.2:c.2243G>C, NM_002693.2:c.2209G>C	Progressive external ophthalmoplegia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by ptosis, paralysis of the extraocular muscles, oropharyngeal weakness, and variably severe proximal limb weakness.	250,600
POMGNT1	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3	NM_017739.3	NM_017739.3:c.1425G>A, NM_017739.3:c.1545delC, NM_017739.3:c.1274G>C, NM_017739.3:c.1864delC, NM_017739.3:c.1411A>T, NM_017739.3:c.1469G>A, NM_017739.3:c.1539+1G>A, NM_017739.3:c.92dupA, NM_017739.3:c.1539+1G>T, NM_017739.3:c.932G>A, NM_017739.3:c.794G>A, NM_017739.3:c.880-1G>A, NM_017739.3:c.652+1G>A, NM_017739.3:c.931C>T, NM_017739.3:c.1666G>A, NM_017739.3:c.1814G>C, NM_017739.3:c.636C>T, NM_017739.3:c.187C>T	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3 which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMGNT1 gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent psychomotor development, eye involvement and seizures. The prevalence is 1-9:100,000.	250,600
POMT1	Congenital muscular dystrophy with intellectual disability type B1	NM_007171.3	NM_007171.3:c.598G>C, NM_007171.3:c.193G>A, NM_007171.3:c.1770G>C, NM_007171.3:c.2005G>A, NM_007171.3:c.2163C>A, NM_007171.3:c.1746G>C, NM_007171.3:c.793C>T	Congenital muscular dystrophy with intellectual disability type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 gene located on chromosomal region 9q34.13. The age of onset is early. This disease is associated with mental retardation and mild structural brain abnormalities.	250,600
POMT1	Walker-Warburg syndrome	NM_007171.3	NM_007171.3:c.1540C>T, NM_007171.3:c.226G>A, NM_007171.3:c.1611C>G, NM_007171.3:c.1242-2A>G, NM_007171.3:c.907C>T, NM_007171.3:c.2163_2164insG, NM_007171.3:c.2167dupG, NM_007171.3:c.1153C>T, NM_007171.3:c.1261_1262insC, NM_007171.3:c.831C>G, NM_007171.3:c.1545C>G, NM_007171.3:c.1280_1281delAGinsTC	Walker-Warburg syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 and POMT2 genes located on chromosomal regions 9q34.13 and 14q24.3 respectively. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent or very poor psychomotor development, eye involvement and seizures. The prevalence is 1:100,000-9:100,000.	250,600
POMT2	Congenital muscular dystrophy with intellectual disability type A2	NM_013382.5	NM_013382.5:c.2243G>C, NM_013382.5:c.1997A>G, NM_013382.5:c.2242T>C, NM_013382.5:c.1445G>T, NM_013382.5:c.2177G>A, NM_013382.5:c.1238G>C, NM_013382.5:c.1941G>A, NM_013382.5:c.1057G>A, NM_013382.5:c.551C>T	Congenital muscular dystrophy with intellectual disability type A2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT2 gene located on chromosomal region 14q24.3. The age of onset is early. This disorder characterized by congenital muscular dystrophy associated with cobblestone lissencephaly and other brain anomalies, eye malformations, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease.	250,600
POMT2	Walker-Warburg syndrome	NM_013382.5	NM_013382.5:c.1726-2A>G, NM_013382.5:c.1417C>T, NM_013382.5:c.1912C>T, NM_013382.5:c.1608_1609delCA, NM_013382.5:c.1045_1052delinsG	Walker-Warburg syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 and POMT2 genes located on chromosomal regions 9q34.13 and 14q24.3 respectively. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent or very poor psychomotor development, eye involvement and seizures. The prevalence is 1:100,000-9:100,000.	250,600
PPT1	Neuronal ceroid-lipofuscinoses type 1	NM_000310.3	NM_000310.3:c.29T>A, NM_000310.3:c.223A>C, NM_000310.3:c.627+1G>T, NM_000310.3:c.169_170insA, NM_000310.3:c.451C>T, NM_000310.3:c.541G>T, NM_000310.3:c.840_841insA	Neuronal ceroid lipofuscinoses, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PPT1 gene located on chromosomal region 1p32. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 1.5:1,000,000-9:1,000,000.	250,600
PRODH	Hyperprolinemia type 1	NM_016335.4	NM_016335.4:c.865T>A, NM_016335.4:c.1331G>A	Hyperprolinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRODH gene located on chromosomal region 22q11.2. The age of onset is variable. This disease is characterized by benign symptoms, but associations with renal abnormalities, epileptic seizures, and other neurological manifestations, as well as certain forms of schizophrenia have been reported.	250,600
PROM1	Retinitis pigmentosa type 41	NM_006017.2	NM_006017.2:c.1841delG, NM_006017.2:c.1354_1355insT, NM_006017.2:c.1726C>T, NM_006017.2:c.199C>T, NM_006017.2:c.2490-2A>G, NM_006017.2:c.1177_1178delAT	Retinitis pigmentosa 41 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROM1 gene located on chromosomal region 4p15.32. The age of onset is early. This disease is characterized by night blindness often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 19:100,000-27:100,000.	250,600
PYGM	McArdle disease	NM_005609.2	NM_005609.2:c.1628A>C, NM_005609.2:c.1466C>G, NM_005609.2:c.1094C>T, NM_005609.2:c.1827G>A, NM_005609.2:c.13_14delCT, NM_005609.2:c.1A>G, NM_005609.2:c.2009C>T, NM_005609.2:c.2128_2130delTTC, NM_005609.2:c.393delG, NM_005609.2:c.2392T>C, NM_005609.2:c.148C>T, NM_005609.2:c.1621G>T, NM_005609.2:c.613G>A, NM_005609.2:c.1963G>A, NM_005609.2:c.2262delA, NM_005609.2:c.1722T>G, NM_005609.2:c.255C>A, NM_005609.2:c.280C>T, NM_005609.2:c.1768+1G>A, NM_005609.2:c.501dupT, NM_005609.2:c.481C>T, NM_005609.2:c.1726C>T	McArdle disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PYGM gene located on chromosomal region 11q13.1. The age of onset is infantile. This disease is characterized by muscular exercise intolerance with myalgia, cramps, fatigue, and muscle weakness.	250,600
RAG1	Immunodeficiency severe combined B cell-negative	NM_000448.2	NM_000448.2:c.2333G>A, NM_000448.2:c.2320G>T, NM_000448.2:c.2164G>A, NM_000448.2:c.940C>T, NM_000448.2:c.2814T>G, NM_000448.2:c.2923C>T, NM_000448.2:c.2326C>T	Severe combined immunodeficiency, autosomal recessive, T cell-negative, B cell negative, NK cell positive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 gene located on chromosomal region 11p13. The age of onset is early. This disease is characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development.	250,600
RAG1	Omenn syndrome	NM_000448.2	NM_000448.2:c.983G>A, NM_000448.2:c.3016A>G, NM_000448.2:c.256_257delAA, NM_000448.2:c.1682G>A, NM_000448.2:c.1681C>T	Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency.	250,600
RAPSN	Congenital myasthenic syndrome	NM_005055.4	NM_005055.4:c.484G>A, NM_005055.4:c.264C>A, NM_005055.4:c.807C>A, NM_005055.4:c.848T>C, NM_005055.4:c.490C>T, NM_005055.4:c.603C>A	Congenital myasthenic syndromes follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by fatigable weakness of skeletal muscle (e.g., ocular, bulbar, limb muscles) with onset at or shortly after birth or in early childhood; rarely, symptoms may not manifest until later in childhood. Cardiac and smooth muscle are not involved. Severity and course of disease are highly variable, ranging from minor symptoms to progressive disabling weakness. The prevalence is 1:3,000.	250,600
RAPSN	Fetal akinesia deformation sequence	NM_005055.4	NM_005055.4:c.416T>C, NM_005055.4:c.566C>T	Fetal akinesia deformation sequence follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by multiple joint contractures, facial anomalies and pulmonary hypoplasia. The prevalence is 1:3,000.	250,600
RAX	Isolated microphthalmia type 3	NM_013435.2	NM_013435.2:c.909C>G, NM_013435.2:c.18C>A, NM_013435.2:c.197G>C, NM_013435.2:c.439C>T, NM_013435.2:c.383_384delAG	Isolated microphthalmia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAX gene located on chromosomal region 18q21.32. Microphthalmia designates a heterogeneous group of ocular malformations with a more or less evident reduction in the size of the eyeball. Additional features include high hypermetropia and a short axial length.	250,600
RDH12	Leber congenital amaurosis type 13	NM_152443.2	NM_152443.2:c.184C>T, NM_152443.2:c.146C>T, NM_152443.2:c.152T>A, NM_152443.2:c.451C>A, NM_152443.2:c.295C>A, NM_152443.2:c.377C>T, NM_152443.2:c.379G>T, NM_152443.2:c.565C>T, NM_152443.2:c.677A>G, NM_152443.2:c.805_809delGCCCT, NM_152443.2:c.164C>T, NM_152443.2:c.210dupC, NM_152443.2:c.448+1_448+4delGTAA, NM_152443.2:c.451C>G, NM_152443.2:c.464C>T, NM_152443.2:c.523T>C	Leber congenital amaurosis type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDH12 gene located on chromosomal region 14q24.1. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.	250,600
RGR	Retinitis pigmentosa type 44	NM_001012720.1	NM_001012720.1:c.196A>C, NM_001012720.1:c.249_250insGGCTCGGA, NM_001012720.1:c.261_262insGGCTCGGA, NM_001012720.1:c.454C>A, NM_001012720.1:c.865C>T, NM_001012720.1:c.877C>T	Retinitis pigmentosa type 44 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RGR gene located on chromosomal region 10q23.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	250,600
RHO	Retinitis pigmentosa type 4	NM_000539.3	NM_000539.3:c.152G>C, NM_000539.3:c.173C>T, NM_000539.3:c.448G>A, NM_000539.3:c.620T>G, NM_000539.3:c.670G>A, NM_000539.3:c.745G>T, NM_000539.3:c.659T>G	Retinitis pigmentosa type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RHO gene located on chromosomal region 3q22.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	250,600
RLBP1	Retinitis punctata albescens	NM_000326.4	NM_000326.4:c.333T>G, NM_000326.4:c.452G>A, NM_000326.4:c.700C>T, NM_000326.4:c.875C>T	Retinitis punctata albescens follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RLBP1 gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by night blindness from early childhood, delay in the regeneration of cone and rod photopigments in young adults, followed by macular degeneration and a decrease in visual acuity that led to legal blindness in early adulthood.	250,600
RPE65	Leber congenital amaurosis type 2	NM_000329.2	NM_000329.2:c.1067delA, NM_000329.2:c.1301C>T, NM_000329.2:c.1292A>G, NM_000329.2:c.272G>A, NM_000329.2:c.907A>T, NM_000329.2:c.514_515delGT	Leber congenital amaurosis 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus.	250,600
RPE65	Retinitis pigmentosa type 20	NM_000329.2	NM_000329.2:c.1022T>C, NM_000329.2:c.1087C>A, NM_000329.2:c.1102T>C, NM_000329.2:c.271C>T, NM_000329.2:c.1355T>G, NM_000329.2:c.1543C>T, NM_000329.2:c.394G>A, NM_000329.2:c.881A>C	Retinitis pigmentosa type 20 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	250,600
RPGRIP1L	Joubert syndrome type 7	NM_015272.2	NM_015272.2:c.1177G>A, NM_015272.2:c.1326_1329delAAAA, NM_015272.2:c.1329_1330insA, NM_015272.2:c.1843A>C, NM_015272.2:c.1975T>C, NM_015272.2:c.2030C>T, NM_015272.2:c.2050C>T, NM_015272.2:c.2413C>T, NM_015272.2:c.757C>T, NM_015272.2:c.3548C>G, NM_015272.2:c.697A>T, NM_015272.2:c.3634_3637delGAAA, NM_015272.2:c.776+1G>A, NM_015272.2:c.2794_2795delTT	Joubert syndrome type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. This disease is characterized by cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy and renal disease.	250,600
RPGRIP1L	Meckel syndrome type 5	NM_015272.2	NM_015272.2:c.394A>T, NM_015272.2:c.3706C>T, NM_015272.2:c.2614C>T	Meckel syndrome, type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. This disease is characterized by a combination of renal cysts and variably associated features, including developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and cysts, and polydactyly. The prevalence is <1:1,000,000.	250,600
RYR1	Central core disease	NM_000540.2	NM_000540.2:c.1021G>A, NM_000540.2:c.10343C>T, NM_000540.2:c.10579C>T, NM_000540.2:c.10616G>A, NM_000540.2:c.11798A>G, NM_000540.2:c.1205T>C, NM_000540.2:c.13480G>T, NM_000540.2:c.13513G>C, NM_000540.2:c.14365-2A>T, NM_000540.2:c.14511+1_14511+2delGT, NM_000540.2:c.14545G>A, NM_000540.2:c.1739_1742dupATCA, NM_000540.2:c.1841G>T, NM_000540.2:c.325C>T, NM_000540.2:c.4076delG, NM_000540.2:c.4178A>G, NM_000540.2:c.4405C>T, NM_000540.2:c.487C>T, NM_000540.2:c.5036G>A, NM_000540.2:c.5333C>A, NM_000540.2:c.5726_5727delAG, NM_000540.2:c.6082C>T, NM_000540.2:c.6104A>T, NM_000540.2:c.631+2T>C, NM_000540.2:c.6961A>G, NM_000540.2:c.7025A>G, NM_000540.2:c.7268T>A, NM_000540.2:c.7300G>A, NM_000540.2:c.7360C>T, NM_000540.2:c.7373G>A, NM_000540.2:c.738T>G, NM_000540.2:c.7463_7475delCAAAGATGTCAGC, NM_000540.2:c.9000+1G>T, NM_000540.2:c.14126C>T, NM_000540.2:c.1655G>A, NM_000540.2:c.4729G>A, NM_000540.2:c.7781C>A, NM_000540.2:c.7836-1G>A, NM_000540.2:c.8360C>G, NM_000540.2:c.9868G>A, NM_000540.2:c.9905_9906insC, NM_000540.2:c.1186G>T, NM_000540.2:c.6721C>T	Central core disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RYR1 gene located on chromosomal region 19q13.2. Typical central core disease is a relatively mild congenital myopathy, usually characterized by motor developmental delay and signs of mild proximal weakness most pronounced in the hip girdle musculature. Orthopedic complications, particularly congenital dislocation of the hips and scoliosis, are common, and patients are at risk of having malignant hyperthermia. Onset is usually in childhood, although adult onset has also been reported.	250,600
SACS	Spastic ataxia, Charlevoix-Saguenay type	NM_014363.5	NM_014363.5:c.10907G>A, NM_014363.5:c.10954C>A, NM_014363.5:c.11624G>A, NM_014363.5:c.12160C>T, NM_014363.5:c.517C>T, NM_014363.5:c.6355C>T, NM_014363.5:c.6781C>A, NM_014363.5:c.7504C>T, NM_014363.5:c.8107C>T, NM_014363.5:c.8844delT, NM_014363.5:c.994A>T, NM_014363.5:c.13237C>T, NM_014363.5:c.3198T>A, NM_014363.5:c.4933C>T, NM_014363.5:c.5618_5619delAT, NM_014363.5:c.6563T>A	Spastic ataxia, Charlevoix-Saguenay type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SACS gene located on chromosomal region 13q11. The age of onset is early. This disease is characterized by early-onset cerebellar ataxia with spasticity, a pyramidal syndrome and peripheral neuropathy. The prevalence is 1:1,500-1:2,000.	250,600
SAG	Oguchi disease	NM_000541.4	NM_000541.4:c.293_294insG, NM_000541.4:c.523C>T, NM_000541.4:c.577C>T, NM_000541.4:c.874C>T, NM_000541.4:c.916G>T, NM_000541.4:c.926delA, NM_000541.4:c.993C>G	Oguchi disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SAG gene located on chromosomal region 2q37. The age of onset is infantile. This disease is characterized by congenital stationary night blindness and the Mizuo-Nakamura phenomenon which is a unique morphological and functional abnormality of the retina that presents with a typical golden-yellow or silver-gray discoloration of the fundus in the presence of light that disappears after dark-adaptation and appears again after the onset of light.	250,600
SBDS	Shwachman-Diamond syndrome	NM_016038.2	NM_016038.2:c.120delG, NM_016038.2:c.127G>T, NM_016038.2:c.183_184delTAinsCT, NM_016038.2:c.184A>T, NM_016038.2:c.377G>C, NM_016038.2:c.505C>T, NM_016038.2:c.652C>T, NM_016038.2:c.258+2T>C	Shwachman-Diamond syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBDS gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by chronic and usually mild neutropenia, pancreatic exocrine insufficiency associated with steatorrhea and growth failure, skeletal dysplasia with short stature, and an increased risk of bone marrow aplasia or leukemic transformation, cutaneous (eczema or ichthyosis) and dental anomalies, and psychomotor retardation. The prevalence is 1:76,000 newborn.	250,600
SCNN1B	Pseudohypoaldosteronism, type 1	NM_000336.2	NM_000336.2:c.109G>A	Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.	250,600
SCNN1G	Pseudohypoaldosteronism, type 1	NM_001039.3	NM_001039.3:c.1373+2T>C, NM_001039.3:c.1570-1G>A, NM_001039.3:c.1627delG, NM_001039.3:c.598_599insA	Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.	250,600
SERPINA1	Alpha1-antitrypsin deficiency	NM_000295.4	NM_000295.4:c.1177C>T, NM_000295.4:c.187C>T, NM_000295.4:c.194T>C, NM_000295.4:c.230C>T, NM_000295.4:c.250G>A, NM_000295.4:c.272G>A, NM_000295.4:c.347T>A, NM_000295.4:c.415G>A, NM_000295.4:c.514G>A, NM_000295.4:c.514G>T, NM_000295.4:c.739C>T, NM_000295.4:c.839A>T, NM_000295.4:c.1093G>A, NM_000295.4:c.848A>T	Alpha-1-antitrypsin deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SERPINA1 gene located on chromosomal region 14q32.13. The age of onset is variable. This disease is characterized by emphysema, which becomes evident by the third to fourth decade. A less common manifestation of the deficiency is liver disease, which occurs in children and adults, and may result in cirrhosis and liver failure. Environmental factors, particularly cigarette smoking, greatly increase the risk of emphysema at an earlier age. The prevalence is 1:1,500-1:3,500 in European.	250,600
SETX	Spinocerebellar ataxia with axonal neuropathy type 2	NM_015046.5	NM_015046.5:c.1027G>T, NM_015046.5:c.1166T>C, NM_015046.5:c.1807A>G, NM_015046.5:c.2602C>T, NM_015046.5:c.3880C>T, NM_015046.5:c.4087C>T, NM_015046.5:c.5630delG, NM_015046.5:c.5927T>G, NM_015046.5:c.6848_6851delCAGA, NM_015046.5:c.994C>T, NM_015046.5:c.5308_5311delGAGA, NM_015046.5:c.5549-1G>T, NM_015046.5:c.6834_6839delAACAAA	Spinocerebellar ataxia with axonal neuropathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SETX gene located on chromosomal region 9q34.13. The age of onset is infantile. This disease is characterized by progressive cerebellar ataxia, axonal sensorimotor neuropathy with oculomotor apraxia, fixation instability, extrapyramidal features and an elevated serum alpha-fetoprotein level. The prevalence is 4:100,000-8:100,000.	250,600
SGCA	Limb-girdle muscular dystrophy type 2D	NM_000023.2	NM_000023.2:c.101G>A, NM_000023.2:c.229C>T, NM_000023.2:c.371T>C, NM_000023.2:c.518T>C, NM_000023.2:c.574C>T, NM_000023.2:c.850C>T, NM_000023.2:c.662G>A, NM_000023.2:c.739G>A, NM_000023.2:c.904_905insCC	Autosomal recessive limb-girdle muscular dystrophy type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCA gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness and calf pseudohypertrophy. The prevalence is 1:1,000,000-9:1,000,000.	250,600
SGCG	Limb-girdle muscular dystrophy type 2C	NM_000231.2	NM_000231.2:c.195+4_195+7delAGTA, NM_000231.2:c.505+1G>A, NM_000231.2:c.787G>A, NM_000231.2:c.848G>A, NM_000231.2:c.88delG, NM_000231.2:c.521delT	Autosomal recessive limb-girdle muscular dystrophy type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCG gene located on chromosomal region 13q12.12. The age of onset is variable. This disease is characterized by limb-girdle weakness, calf hypertrophy, diaphragmatic weakness, and variable cardiac abnormalities.	250,600
SGSH	Mucopolysaccharidosis type 3A (Sanfilippo disease type A)	NM_000199.3	NM_000199.3:c.1167C>A, NM_000199.3:c.1298G>A, NM_000199.3:c.130G>A, NM_000199.3:c.1339G>A, NM_000199.3:c.1380delT, NM_000199.3:c.197C>G, NM_000199.3:c.220C>T, NM_000199.3:c.235A>C, NM_000199.3:c.320delT, NM_000199.3:c.337_345delinsGCACAGGTGAG, NM_000199.3:c.364G>A, NM_000199.3:c.383C>T, NM_000199.3:c.416C>T, NM_000199.3:c.449G>A, NM_000199.3:c.466A>T, NM_000199.3:c.617G>C, NM_000199.3:c.752G>C, NM_000199.3:c.757delG, NM_000199.3:c.877C>T, NM_000199.3:c.892T>C	Mucopolysaccharidosis type 3A (Sanfilippo syndrome type A) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGSH gene located on chromosomal region 17q25.3. The age of onset is infantile. This disease is characterized by behavioural disorders (hyperkinesia, aggressiveness) and intellectual deterioration, sleep disorders and very mild dysmorphism. The prevalence is >1:70,000 newborn.	250,600
SH3TC2	Charcot-Marie-Tooth disease type 4C	NM_024577.3	NM_024577.3:c.1586G>A, NM_024577.3:c.1747_1748delAG, NM_024577.3:c.1969G>A, NM_024577.3:c.1972C>T, NM_024577.3:c.1982T>C, NM_024577.3:c.217_227delGCTGCTCGGAGinsCCAGTAA, NM_024577.3:c.2191delG, NM_024577.3:c.2491_2492delAG, NM_024577.3:c.2710C>T, NM_024577.3:c.2829T>G, NM_024577.3:c.2860C>T, NM_024577.3:c.28delG, NM_024577.3:c.2993_2994insC, NM_024577.3:c.3325C>T, NM_024577.3:c.3326G>C, NM_024577.3:c.3341delC, NM_024577.3:c.3601C>T, NM_024577.3:c.3686A>T, NM_024577.3:c.505T>C, NM_024577.3:c.52+1delG, NM_024577.3:c.530-2A>G, NM_024577.3:c.735G>A, NM_024577.3:c.920G>A, NM_024577.3:c.3676-1G>A, NM_024577.3:c.1724T>A, NM_024577.3:c.53-1G>C	Charcot-Marie-Tooth disease, type 4C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SH3TC2 gene located on chromosomal region 5q32. The age of onset is infantile. This disease is characterized by scoliosis or kyphoscoliosis, neuropathy, foot deformities, respiratory insufficiency, hypoacousis and deafness.	250,600
SLC12A1	Bartter syndrome type 1	NM_000338.2	NM_000338.2:c.1875G>A, NM_000338.2:c.1942G>A, NM_000338.2:c.2805_2806insA, NM_000338.2:c.347G>A, NM_000338.2:c.611T>C, NM_000338.2:c.628+2T>C, NM_000338.2:c.814G>T, NM_000338.2:c.223C>T, NM_000338.2:c.2952_2955delCAAA	Bartter syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A1 gene located on chromosomal region 15q15-21. The age of onset is infantile. This disease is characterized by polyhydramnios, premature delivery, polyuria, dehydration, hypercalciuria and nephrocalcinosis. The prevalence is 1:1,000,000.	250,600
SLC17A5	Sialic acid storage disease	NM_012434.4	NM_012434.4:c.115C>T, NM_012434.4:c.406A>G, NM_012434.4:c.43G>T, NM_012434.4:c.918T>G, NM_012434.4:c.1259+1G>A, NM_012434.4:c.500T>C	Sialic acid storage diseases, follow an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC17A5 gene located on chromosomal region 6q13. The age of onset is from infantile to adult forms. The main symptoms are hypotonia, cerebellar ataxia, and mental retardation; visceromegaly and coarse features are also present in the infantile cases.	250,600
SLC24A1	Night blindness, congenital stationary type 1D	NM_004727.2	NM_004727.2:c.1963C>T	Night blindness, congenital stationary type 1D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC24A1 gene located on chromosomal region 15q22.31. The age of onset is early. This disease is characterized by hemeralopia with a moderate loss of visual acuity.	250,600
SLC26A2	Achondrogenesis type 1B	NM_000112.3	NM_000112.3:c.1020_1022delTGT, NM_000112.3:c.1273A>G, NM_000112.3:c.532C>T, NM_000112.3:c.2033G>T	Achondrogenesis type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by severe micromelia with very short fingers and toes, a flat face, a short neck, thickened soft tissue around the neck, hypoplasia of the thorax, protuberant abdomen, a hydropic fetal appearance and distinctive histological features of the cartilage. The prevalence is 1:20,000.	250,600
SLC26A2	Atelosteogenesis type 2	NM_000112.3	NM_000112.3:c.1535C>A, NM_000112.3:c.835C>T	Atelosteogenesis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by limb shortening, normal sized skull with cleft palate, hitchhiker thumbs, distinctive facial dysmorphism and radiographic skeletal features. The prevalence is 1:20,000.	250,600
SLC26A2	Diastrophic dysplasia	NM_000112.3	NM_000112.3:c.1724delA, NM_000112.3:c.1878delG, NM_000112.3:c.1361A>C, NM_000112.3:c.767T>C, NM_000112.3:c.833delC, NM_000112.3:c.496G>A, NM_000112.3:c.1957T>A	Diastrophic dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by short stature with short extremities (final adult height is 120cm), and joint malformations leading to multiple joint contractures (principally involving the shoulders, elbows, interphalangeal joints and hips). The prevalence is 1:20,000.	250,600
SLC26A4	Deafness type 4, autosomal recessive	NM_000441.1	NM_000441.1:c.1001G>T, NM_000441.1:c.1034T>A, NM_000441.1:c.2162C>T, NM_000441.1:c.1975G>C, NM_000441.1:c.1174A>T, NM_000441.1:c.2131G>A, NM_000441.1:c.1454C>T, NM_000441.1:c.1468A>C, NM_000441.1:c.2211G>C, NM_000441.1:c.269C>T, NM_000441.1:c.916dupG, NM_000441.1:c.281C>T, NM_000441.1:c.1634T>G, NM_000441.1:c.1707+5G>A, NM_000441.1:c.1489G>A, NM_000441.1:c.961A>T, NM_000441.1:c.2048T>C, NM_000441.1:c.898A>C, NM_000441.1:c.918+2T>C, NM_000441.1:c.1001+1G>T, NM_000441.1:c.970A>T, NM_000441.1:c.563T>C	Autosomal recessive nonsyndromic sensorineural deafness type DFNB4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	250,600
SLC26A4	Pendred syndrome	NM_000441.1	NM_000441.1:c.1246A>C, NM_000441.1:c.1826T>G, NM_000441.1:c.1229C>T, NM_000441.1:c.1263+1G>A, NM_000441.1:c.1061T>C, NM_000441.1:c.1790T>C, NM_000441.1:c.2168A>G, NM_000441.1:c.1151A>G, NM_000441.1:c.1226G>A, NM_000441.1:c.1003T>C, NM_000441.1:c.919-2A>G, NM_000441.1:c.554G>C, NM_000441.1:c.626G>T, NM_000441.1:c.1334T>G, NM_000441.1:c.1198delT, NM_000441.1:c.412G>T, NM_000441.1:c.707T>C	Pendred syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. The main presenting clinical sign is prelingual sensorineural deafness, although occasionally the hearing loss develops later in childhood. The degree of hearing loss is variable: it can be mild-to-moderate and progressive in some patients, and severe-to-profound in others. Fluctuations in hearing are also common and may be associated with or preceded by vertigo. The onset and presentation of euthyroid goiter (75%) is highly variable within and between families, with thyroid enlargement usually developing in late childhood or early adulthood. The thyromegaly reflects a defect in iodide transport from the thyrocyte to the colloid, although organification itself is not impaired. Hypothyroidism may develop if nutritional iodide intake is low.	250,600
SLC37A4	Glycogen storage disease types 1b, 1c and 1d	NM_001164278.1	NM_001164278.1:c.1042_1043delCT, NM_001164278.1:c.1081G>T, NM_001164278.1:c.1082G>A, NM_001164278.1:c.1108_1109delCT, NM_001164278.1:c.1129G>T, NM_001164278.1:c.1190-2_1190-1delAG, NM_001164278.1:c.1309C>T, NM_001164278.1:c.287G>A, NM_001164278.1:c.352T>C, NM_001164278.1:c.593A>T, NM_001164278.1:c.706_708delGTG, NM_001164278.1:c.83G>A, NM_001164278.1:c.899G>A	Glycogen storage disease due to glucose-6-phosphatase deficiency types 1b, 1c and 1d follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC37A4 gene located on chromosomal region 11q23. The age of onset is early. This disease is characterized by impairment of terminal steps of glycogenolysis and gluconeogenesis. Patients manifest a wide range of clinical symptoms and biochemical abnormalities, including hypoglycemia, severe hepatomegaly due to excessive accumulation of glycogen, kidney enlargement, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. Glycogen storage disease type 1B patients also present a tendency towards infections associated with neutropenia, relapsing aphthous gingivostomatitis, and inflammatory bowel disease. The incidence is 1:100,000.	250,600
SLC4A11	Congenital hereditary endothelial dystrophy type 2	NM_032034.3	NM_032034.3:c.1038_1039insA, NM_032034.3:c.1391G>A, NM_032034.3:c.2318C>T, NM_032034.3:c.1466C>T, NM_032034.3:c.1813C>T, NM_032034.3:c.2264G>A, NM_032034.3:c.2605C>T, NM_032034.3:c.2399C>T, NM_032034.3:c.554_561delGCTTCGCC, NM_032034.3:c.2606G>A	Congenital hereditary endothelial dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by a diffuse ground-glass appearance of the corneas and marked corneal thickening from birth with nystagmus, and blurred vision.	250,600
SLC4A11	Corneal dystrophy and perceptive deafness	NM_032034.3	NM_032034.3:c.2528T>C, NM_032034.3:c.1463G>A, NM_032034.3:c.473_480delGCTTCGCC, NM_032034.3:c.2566A>G, NM_032034.3:c.637T>C, NM_032034.3:c.625C>T, NM_032034.3:c.2224G>A, NM_032034.3:c.2240_2240+1insTATGACAC	Corneal dystrophy - perceptive deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by the association of congenital hereditary endothelial dystrophy with progressive, postlingual sensorineural hearing loss.	250,600
SLX4	Fanconi anemia, complementation group P	NM_032444.2	NM_032444.2:c.1093delC, NM_032444.2:c.286delA, NM_032444.2:c.4921_4922insG, NM_032444.2:c.5097_5098delTC, NM_032444.2:c.5408_5409insAC, NM_032444.2:c.4739+1G>T, NM_032444.2:c.2808_2809delAG	Fanconi anemia complementation group P follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLX4 gene located on chromosomal region 16p13.3. The age of onset is early. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:160,000.	250,600
SMN1	Spinal muscular atrophy	-	del ex7, del ex7-8, del ex8 (Detection by MLPA)	Spinal muscular atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMN1 gene located on chromosomal region 5q13.2. The age of onset is variable. This disease comprise a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. Autosomal recessive forms are classified according to the age of onset, the maximum muscular activity achieved, and survivorship. The severity of the disease is mainly determined by the copy number of SMN2, a copy gene which predominantly produces exon 7-skipped transcripts and only low amount of full-length transcripts that encode for a protein identical to SMN1. Only about 4% of patients bear one SMN1 copy with an intragenic mutation. Type 1 is a severe form, with onset before 6 months of age. Patients never achieve the ability to sit. Type 2 has intermediate severity, with onset between 6 and 18 months. Patients do not reach the motor milestone of standing, and survive into adulthood. Type 3 onset is after 18 months. Patients develop ability to stand and walk and survive into adulthood. Type 4 onset is in adulthood, disease progression is slow, and patients can stand and walk. The incidence is 1:10,000 and the prevalence is 1:80,000.	250,600
SMPD1	Niemann-Pick disease	NM_000543.4	NM_000543.4:c.103_118delCTGGTGCTGGCGCTGG, NM_000543.4:c.103_119delCTGGTGCTGGCGCTGGC, NM_000543.4:c.103_107delCTGGT, NM_000543.4:c.103_113delCTGGTGCTGGCGinsCTGGTG, NM_000543.4:c.1092-1G>C, NM_000543.4:c.1117C>T, NM_000543.4:c.106delG, NM_000543.4:c.108_124delGCTGGCGCTGGCGCTGGC, NM_000543.4:c.1267C>T, NM_000543.4:c.1299T>G, NM_000543.4:c.1327C>T, NM_000543.4:c.1420_1421delCT, NM_000543.4:c.1426C>T, NM_000543.4:c.1624C>T, NM_000543.4:c.1630delA, NM_000543.4:c.1805G>A, NM_000543.4:c.354delC, NM_000543.4:c.475T>C, NM_000543.4:c.551C>T, NM_000543.4:c.557C>T, NM_000543.4:c.558_559insC, NM_000543.4:c.558_574delGCCCCCCAAACCCCCTA, NM_000543.4:c.564delC, NM_000543.4:c.573delT, NM_000543.4:c.689G>A, NM_000543.4:c.730G>A, NM_000543.4:c.739G>A, NM_000543.4:c.740delG, NM_000543.4:c.742G>A, NM_000543.4:c.757G>C, NM_000543.4:c.785_807delTGTTGAGTGGGCTGGGCCCAGCC, NM_000543.4:c.788T>A, NM_000543.4:c.842_849dupTCCCCGCA, NM_000543.4:c.911T>C, NM_000543.4:c.940G>A, NM_000543.4:c.96G>A, NM_000543.4:c.996delC, NM_000543.4:c.688C>T, NM_000543.4:c.995C>G, NM_000543.4:c.1829_1831delGCC, NM_000543.4:c.1264-1G>T, NM_000543.4:c.1152G>A	Niemann-Pick disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMPD1 gene located on chromosomal region 11p15.4. The clinical phenotype ranges from a severe infantile form with neurologic degeneration resulting in death usually by 3 years of age (type A) to a later-onset nonneurologic form (type B) that is compatible with survival into adulthood.	250,600
SPG11	Spastic paraplegia type 11	NM_025137.3	NM_025137.3:c.118C>T, NM_025137.3:c.529_533delATATT, NM_025137.3:c.5623C>T, NM_025137.3:c.1339_1342dupGGCT, NM_025137.3:c.342delT, NM_025137.3:c.7152-1G>C, NM_025137.3:c.733_734delAT, NM_025137.3:c.6805_6806delCT, NM_025137.3:c.1736-1G>C, NM_025137.3:c.6100C>T, NM_025137.3:c.6848_6849insTC	Spastic paraplegia type 11 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG11 gene located on chromosomal region 13q13.3. The age of onset is infantile. This disease is characterized by progressive spasticity and weakness of the lower limbs frequently associated with the following: mild intellectual disability with learning difficulties in childhood and/or progressive cognitive decline; peripheral neuropathy; pseudobulbar involvement; and increased reflexes in the upper limbs. The prevalence is 5:100.000.	250,600
SPG7	Spastic paraplegia type 7	NM_003119.3	NM_003119.3:c.1457G>A, NM_003119.3:c.1529C>T, NM_003119.3:c.2075G>C, NM_003119.3:c.233T>A, NM_003119.3:c.1676delA, NM_003119.3:c.1749G>C, NM_003119.3:c.773_774delTG, NM_003119.3:c.1045G>A, NM_003119.3:c.1124delG, NM_003119.3:c.679C>T, NM_003119.3:c.758+2T>C, NM_003119.3:c.286+1G>T	Spastic paraplegia type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG7 gene located on chromosomal region 16q24.3. The age of onset is adult. This disease is characterized by insidiously progressive bilateral lower limb weakness and spasticity. The prevalence is 1:100,000-9:100,000.	250,600
STRC	Deafness type 16, autosomal recessive	NM_153700.2	NM_153700.2:c.4561_4562insC, NM_153700.2:c.5188C>T, NM_153700.2:c.3556C>T, NM_153700.2:c.5168_5171delTTCT, NM_153700.2:c.5185C>T, NM_153700.2:c.4545+1G>C	Autosomal recessive nonsyndromic sensorineural deafness type DFNB16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRC gene located on chromosomal region 15q15.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	250,600
TCAP	Cardiomyopathy, hypertrophic, type 25	NM_003673.3	NM_003673.3:c.260G>A, NM_003673.3:c.316C>T	Cardiomyopathy, hypertrophic, type 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by dyspnea, syncope, collapse, palpitations, and chest pain. They can be readily provoked by exercise. The disorder has inter- and intrafamilial variability ranging from benign to malignant forms with high risk of cardiac failure and sudden cardiac death.	250,600
TCAP	Limb-girdle muscular dystrophy type 2G	NM_003673.3	NM_003673.3:c.157C>T	Autosomal recessive limb-girdle muscular dystrophy type 2G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by muscle weakness in the four limbs, mild scapular winging, severe atrophy of the quadriceps and anterior tibialis muscles, calf hypertrophy, and lack of respiratory and cardiac involvement.	250,600
TCIRG1	Osteopetrosis type 1, autosomal recessive	NM_006019.3	NM_006019.3:c.1331G>T, NM_006019.3:c.1674-1G>A, NM_006019.3:c.179A>G, NM_006019.3:c.2236+1G>A, NM_006019.3:c.2415-3C>G, NM_006019.3:c.112_113delAG, NM_006019.3:c.1213G>A	Autosomal recessive osteopetrosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCIRG1 gene located on chromosomal region 11q13.2. The age of onset is early. This disease is characterized by bone marrow failure, fractures and visual impairment. The incidence is 1:200.000 live births and the prevalence is 1:250,000.	250,600
TERT	Dyskeratosis congenita, autosomal recessive	NM_198253.2	NM_198253.2:c.1234C>T, NM_198253.2:c.835G>A, NM_198253.2:c.2701C>T, NM_198253.2:c.2431C>T	Dyskeratosis congenita, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TERT gene located on chromosomal region 5p15.33. The age of onset is early. This disease has a wide phenotypic spectrum and age onset. It usually manifests during childhood with the triad of dysplastic nails, lacy reticular pigmentation and atrophy of the skin at the level of the neck and upper chest, and oral leukoplakia. Patients show an increased risk for progressive bone marrow failure and may develop myelodysplastic syndrome or acute myelogenous leukemia at any age (the risk increasing with age). There is also an increased risk for solid tumors, typically squamous cell carcinoma of head and neck (see this term) or anogenital cancer. Various additional clinical findings have been reported and may include: developmental delay, short stature, microcephaly, blepharitis, epiphora, periodontal disease, taurodontism, decreased teeth/root ratio, esophageal stenosis, liver disease, urethral stenosis, osteoporosis, avascular necrosis of femur and/or humerus, premature hair greying/alopecia, or abnormal eyelashes. Individuals with DC are at high risk of pulmonary fibrosis. The prevalence is 1:1.000.000.	250,600
TFR2	Hemochromatosis, type 3	NM_003227.3	NM_003227.3:c.1330G>A, NM_003227.3:c.1403G>A, NM_003227.3:c.1469T>G, NM_003227.3:c.1235_1237delACA, NM_003227.3:c.1861_1872delGCCGTGGCCCAG, NM_003227.3:c.2343G>A, NM_003227.3:c.313C>T, NM_003227.3:c.1665delC, NM_003227.3:c.750C>G, NM_003227.3:c.840C>G, NM_003227.3:c.949C>T, NM_003227.3:c.515T>A, NM_003227.3:c.1632_1633delGA, NM_003227.3:c.2014C>T, NM_003227.3:c.2374G>A, NM_003227.3:c.1473+1G>A, NM_003227.3:c.1186C>T	Hemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000.	250,600
TK2	Mitochondrial DNA depletion syndrome type 2	NM_004614.4	NM_004614.4:c.323C>T, NM_004614.4:c.361C>A, NM_004614.4:c.373C>T, NM_004614.4:c.500G>A, NM_004614.4:c.604_606delAAG, NM_004614.4:c.635T>A, NM_004614.4:c.623A>G, NM_004614.4:c.159C>G, NM_004614.4:c.268C>T	Mitochondrial DNA depletion syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TK2 gene located on chromosomal region 16q21. The age of onset is infantile. This disease is characterized by generalized hypotonia, proximal muscle weakness, loss of previously acquired motor skills, poor feeding, and respiratory difficulties leading to respiratory failure and death within a few years after diagnosis. The prevalence is 1.2:100,000.	250,600
TMEM67	COACH syndrome	NM_153704.5	NM_153704.5:c.1769T>C, NM_153704.5:c.2498T>C	COACH syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is variable. This disease is characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable.	250,600
TMEM67	Joubert syndrome type 6	NM_153704.5	NM_153704.5:c.130C>T, NM_153704.5:c.148_149insTAAT, NM_153704.5:c.1538A>G	Joubert syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is infantile. This disease is characterized by an irregular breathing pattern (episodic tachypnea and/or apnea), and nystagmus. During infancy, hypotonia may appear. Cerebellar ataxia (staggering gait and imbalance) may develop later. Delayed acquisition of motor milestones is common. Cognitive abilities are variable, ranging from severe intellectual deficit to normal intelligence. Neuro-ophthalmologic examination may show oculomotor apraxia. In some cases, seizures occur. Careful examination of the face shows a characteristic appearance: large head, prominent forehead, high rounded eyebrows, epicanthal folds, ptosis (occasionally), an upturned nose with prominent nostrils, an open mouth (which tends to have an oval shape early on, a 'rhomboid' appearance later, and finally can appear triangular with downturned angles), tongue protrusion and rhythmic tongue motions, and occasionally low-set and tilted ears. Other features sometimes present in Joubert syndrome include retinal dystrophy, nephronophthisis, and polydactyly. The prevalence is 1:80,000-1:100,000.	250,600
TMEM67	Meckel syndrome type 3	NM_153704.5	NM_153704.5:c.1309C>G, NM_153704.5:c.755T>C, NM_153704.5:c.1046T>C, NM_153704.5:c.653G>C, NM_153704.5:c.406+1402_406+1403insTAAT, NM_153704.5:c.622A>T	Meckel syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is variable. This disease is characterized multiple congenital anomaly disorder characterized by the triad of brain malformation mainly occipital encephalocele (see this term), large polycystic kidneys, and polydactyly as well as associated abnormalities that may include cleft lip/palate (see these terms), cardiac and genital anomalies, central nervous system (CNS) malformations, liver fibrosis, and bone dysplasia.	250,600
TMPRSS3	Deafness types 8/10, autosomal recessive	NM_024022.2	NM_024022.2:c.1211C>T, NM_024022.2:c.1276G>A, NM_024022.2:c.1159G>A, NM_024022.2:c.413C>A, NM_024022.2:c.446+1G>T, NM_024022.2:c.647G>T, NM_024022.2:c.753G>C, NM_024022.2:c.646C>T, NM_024022.2:c.208delC, NM_024022.2:c.242C>G	Autosomal recessive nonsyndromic sensorineural deafness type DFNB10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMPRSS3 gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness.	250,600
TPP1	Neuronal ceroid-lipofuscinoses type 2	NM_000391.3	NM_000391.3:c.1093T>C, NM_000391.3:c.616C>T, NM_000391.3:c.622C>T, NM_000391.3:c.1340G>A, NM_000391.3:c.141_144delGAGT, NM_000391.3:c.827A>T, NM_000391.3:c.509-1G>C, NM_000391.3:c.851G>T	Neuronal ceroid lipofuscinosis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPP1 gene located on chromosomal region 11p15.4. Age of onset is infantile. This disease is characterized by epilepsy, followed by regression of developmental milestones, myoclonic ataxia, and pyramidal signs. Visual impairment typically appears at age four to six years and rapidly progresses to light/dark awareness only. Life expectancy ranges from age six years to early teenage. The prevalence is 1.5:1,000,000-9:1,000,000.	250,600
TRIOBP	Deafness type 28, autosomal recessive	NM_001039141.2	NM_001039141.2:c.2362C>T, NM_001039141.2:c.3194delT, NM_001039141.2:c.1039C>T, NM_001039141.2:c.1741C>T, NM_001039141.2:c.4577C>G, NM_001039141.2:c.2639_2640insTCAC, NM_001039141.2:c.5316G>A, NM_001039141.2:c.3202C>T, NM_001039141.2:c.4429_4430insG	Deafness autosomal recessive type 28 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIOBP gene located on chromosomal region 22q13.1. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	250,600
TSEN54	Pontocerebellar hypoplasia	NM_207346.2	NM_207346.2:c.670_671delAA, NM_207346.2:c.736C>T, NM_207346.2:c.1027C>T, NM_207346.2:c.1039A>T, NM_207346.2:c.887G>A, NM_207346.2:c.919G>T	Pontocerebellar hypoplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSEN54 gene located on chromosomal region 17q25.1. Pontocerebellar hypoplasia (PCH) refers to a group of severe neurodegenerative disorders affecting growth and function of the brainstem and cerebellum, resulting in little or no development. Different types were classified based on the clinical picture and the spectrum of pathologic changes.	250,600
TSFM	Combined oxidative phosphorylation deficiency type 3	NM_001172696.1	NM_001172696.1:c.1_2delAT, NM_001172696.1:c.580delC, NM_001172696.1:c.919C>T, NM_001172696.1:c.21_22delGC	Combined oxidative phosphorylation deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSFM gene located on chromosomal region 12q14.1. The age of onset is early. This disease is characterized by hypotonia, lactic acidosis, and hepatic insufficiency, with progressive encephalomyopathy or hypertrophic cardiomyopathy.	250,600
TSHR	Hypothyroidism	NM_000369.2	NM_000369.2:c.100G>A, NM_000369.2:c.1170T>G, NM_000369.2:c.484C>G, NM_000369.2:c.500T>A, NM_000369.2:c.122G>C, NM_000369.2:c.326G>A, NM_000369.2:c.1741_1742insC, NM_000369.2:c.202C>T	Hypothyroidism due to TSH receptor mutations follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSHR gene located on chromosomal region 14q31. The age of onset is early. This disease is characterized by decreased activity and increased sleep, feeding difficulty and constipation, prolonged jaundice, myxedematous facies, large fontanels (especially posterior), macroglossia, a distended abdomen with umbilical hernia, and hypotonia. Slow linear growth and developmental delay are usually apparent by 4-6 months of age. Without treatment CH results in severe intellectual deficit and short stature. The prevalence is 1:3,000-1:4,000 newborn.	250,600
TTN	Cardiomyopathy, dilated/Tibial muscular dystrophy	NM_133378.4	NM_133378.4:c.13149C>A, NM_133378.4:c.22246G>A, NM_133378.4:c.31780G>A, NM_133378.4:c.40211dupT, NM_133378.4:c.44668delG, NM_133378.4:c.52977dupT, NM_133378.4:c.61640C>G, NM_133378.4:c.84669_84675delTGAATTC, NM_133378.4:c.94567C>T, NM_133378.4:c.96388C>T, NM_133378.4:c.96388delC, NM_133378.4:c.98366_98367delAT, NM_133378.4:c.12064C>T, NM_133378.4:c.28739-1G>A, NM_133378.4:c.3165-1G>T, NM_133378.4:c.4724_4728delTGAAA, NM_133378.4:c.48944-1G>A, NM_133378.4:c.91114_91117delTCCA, NM_133378.4:c.100185delA, NM_133378.4:c.40549delA, NM_133378.4:c.24568_24571delAGCA	Cardiomyopathy, dilated/Tibial muscular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTN gene located on chromosomal region 2q31.2. The age of onset is variable. This disease is characterized by slowly progressive weakness and atrophy of the anterior tibial muscles with decreased dorsiflexion. Sometimes it could be companied by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death. The prevalence is >9:100,000.	250,600
TTPA	Ataxia with vitamin E deficiency	NM_000370.3	NM_000370.3:c.661C>T, NM_000370.3:c.744delA, NM_000370.3:c.575G>A	Ataxia with vitamin E deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTPA gene located on chromosomal region 8q13. The age of onset is variable. This disease is characterized by progressive spino-cerebellar ataxia, loss of proprioception, areflexia, and is associated with a marked deficiency in vitamin E. The prevalence is 0.56:1,000,000-3.5:1,000,000.	250,600
TYR	Oculocutaneous albinism type 1	NM_000372.4	NM_000372.4:c.1012_1013insC, NM_000372.4:c.1146C>A, NM_000372.4:c.1164delT, NM_000372.4:c.1177delG, NM_000372.4:c.1147G>A, NM_000372.4:c.115T>G, NM_000372.4:c.1255G>A, NM_000372.4:c.1265G>A, NM_000372.4:c.1209G>T, NM_000372.4:c.1217C>T, NM_000372.4:c.140G>A, NM_000372.4:c.1467dupT, NM_000372.4:c.1501dupC, NM_000372.4:c.164G>A, NM_000372.4:c.1A>G, NM_000372.4:c.230G>A, NM_000372.4:c.242C>T, NM_000372.4:c.265T>C, NM_000372.4:c.272G>A, NM_000372.4:c.286dupA, NM_000372.4:c.533G>A, NM_000372.4:c.1336G>A, NM_000372.4:c.1342G>A, NM_000372.4:c.646T>A, NM_000372.4:c.650G>A, NM_000372.4:c.823G>T, NM_000372.4:c.896G>A, NM_000372.4:c.1111A>G, NM_000372.4:c.1118C>A, NM_000372.4:c.325G>A, NM_000372.4:c.572delG, NM_000372.4:c.616G>A	Oculocutaneous albinism type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYR gene located on chromosomal region 11q14.2. The age of onset is early. This disease is characterized by white hair and skin, blue, fully translucent irises, nystagmus and misrouting of the optic nerves.	250,600
TYRP1	Oculocutaneous albinism type 3	NM_000550.2	NM_000550.2:c.107delT, NM_000550.2:c.1103delA, NM_000550.2:c.1057_1060delAACA, NM_000550.2:c.1067G>A, NM_000550.2:c.1557T>G, NM_000550.2:c.176C>G, NM_000550.2:c.497C>G, NM_000550.2:c.1120C>T, NM_000550.2:c.1369_1370insCAGA	Type 3 oculocutaneous albinism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYRP1 gene located on chromosomal region 9p23. The age of onset is early. This disease is characterized by rufous or brown albinism and occurring mainly in the African population. The prevalence is of 1/8,500 individuals in Africa.	250,600
UGT1A1	Crigler-Najjar syndrome type 1	NM_000463.2	NM_000463.2:c.1021C>T, NM_000463.2:c.1070A>G	Crigler-Najjar syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by severe neonatal unconjugated hyperbilirubinemia, persistent jaundice and bilirubin encephalopathy manifesting as hypotonia, deafness, oculomotor palsy and lethargy. Neurologic defects can occur, generally associated with intellectual and motor impairment.	250,600
UGT1A1	Crigler-Najjar syndrome type 2	NM_000463.2	NM_000463.2:c.1207C>T, NM_000463.2:c.674T>G, NM_000463.2:c.1130G>T, NM_000463.2:c.524T>A, NM_000463.2:c.44T>G	Crigler-Najjar syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by unconjugated hyperbilirubinemia due to reduced and inducible activity of hepatic bilirubin glucuronosyltransferase with pigmented bile that contains bilirubin glucuronides, and generally do not present neurologic or intellectual impairment. Bilirubin encephalopathy may develop in later life when patients experience a superimposed infection or stress.	250,600
UGT1A1	Gilbert syndrome	NM_000463.2	NM_000463.2:c.1211T>C, NM_000463.2:c.1456T>G	Gilbert syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by jaundice due to unconjugated hyperbilirubinemia, resulting a partial deficiency in hepatic bilirubin glucuronosyltransferase activity.	250,600
USH1C	Usher syndrome type 1C	NM_153676.3	NM_153676.3:c.216G>A, NM_153676.3:c.2362G>A, NM_153676.3:c.2622_2623delCA, NM_153676.3:c.2688_2695dupAATTCACC, NM_153676.3:c.238_239insC, NM_153676.3:c.238delC, NM_153676.3:c.2547-1G>T, NM_153676.3:c.2695_2696insAATTCACC, NM_153676.3:c.388G>A	Usher syndrome type 1C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1C gene located on chromosomal region 11p15.1. The age of onset is infantile. This disease is characterized by the association of sensorineural deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 3:100,000-4:100,000.	250,600
USH2A	Retinitis pigmentosa type 39	NM_206933.2	NM_206933.2:c.10073G>A, NM_206933.2:c.2296T>C, NM_206933.2:c.14519T>C, NM_206933.2:c.7364G>A, NM_206933.2:c.12574C>T, NM_206933.2:c.2276G>T	Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 39 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.	250,600
USH2A	Usher syndrome type 2A	NM_206933.2	NM_206933.2:c.10636G>A, NM_206933.2:c.10561T>C, NM_206933.2:c.15371delT, NM_206933.2:c.2167+5G>A, NM_206933.2:c.11864G>A, NM_206933.2:c.14803C>T, NM_206933.2:c.2898delG, NM_206933.2:c.3491_3492delCT, NM_206933.2:c.11549-5_11549-4insT, NM_206933.2:c.2299delG, NM_206933.2:c.5975A>G, NM_206933.2:c.6670G>T, NM_206933.2:c.6862G>T, NM_206933.2:c.5743_5744delAG, NM_206933.2:c.779T>G, NM_206933.2:c.820C>T, NM_206933.2:c.8981G>A, NM_206933.2:c.956G>A, NM_206933.2:c.9799T>C, NM_206933.2:c.15089C>A, NM_206933.2:c.2135delC, NM_206933.2:c.4338_4339delCT, NM_206933.2:c.5573-2A>G, NM_206933.2:c.920_923dupGCCA, NM_206933.2:c.13709delG, NM_206933.2:c.14926G>A, NM_206933.2:c.15520-1G>A, NM_206933.2:c.8431C>A, NM_206933.2:c.12234_12235delGA, NM_206933.2:c.14442C>A	Usher syndrome type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. The age of onset is infantile. This disease is characterized by the association of sensorineural deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 3:100,000-4:100,000.	250,600
WFS1	Wolfram syndrome	NM_006005.3	NM_006005.3:c.1234_1237delGTCT, NM_006005.3:c.1511C>T, NM_006005.3:c.2168T>C, NM_006005.3:c.2171C>T, NM_006005.3:c.1944G>A, NM_006005.3:c.2084G>T, NM_006005.3:c.577A>C, NM_006005.3:c.676C>T, NM_006005.3:c.2327A>T, NM_006005.3:c.407_408insGGGCCGTCGCGAGGCT, NM_006005.3:c.2576G>A, NM_006005.3:c.2643_2644delCT, NM_006005.3:c.616C>T, NM_006005.3:c.1060_1062delTTC, NM_006005.3:c.400G>A, NM_006005.3:c.1943G>A, NM_006005.3:c.1230_1233delCTCT	Wolfram syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WFS1 gene located on chromosomal region 4p16.1. The age of onset is infantile. This disease is characterized by diabetes mellitus type I, diabetes insipidus, optical atrophy and neurological signs. The prevalence is 1:1,000,000-9:1,000,000.	250,600
WNT10A	Hypohidrotic ectodermal dysplasia, autosomal recessive	NM_025216.2	NM_025216.2:c.347T>C, NM_025216.2:c.383G>A, NM_025216.2:c.321C>A	Hypohidrotic ectodermal displasia, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by sparse hair (atrichosis or hypotrichosis), abnormal or missing teeth and the inability to sweat due to the absence of sweat glands. The prevalence is <1:1,000,000.	250,600
WNT10A	Odontoonychodermal dysplasia	NM_025216.2	NM_025216.2:c.697G>T	Odonto-onycho-dermal dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by hyperkeratosis and hyperhidrosis of the palms and soles, atrophic malar patches, hypodontia, conical teeth, onychodysplasia, and dry and sparse hair. The prevalence is <1:1,000,000.	250,600
ZFYVE26	Spastic paraplegia type 15, autosomal recessive	NM_015346.3	NM_015346.3:c.3206G>A, NM_015346.3:c.3642_3643insCCACACTTAG, NM_015346.3:c.1477C>T, NM_015346.3:c.2887G>C, NM_015346.3:c.5422C>T, NM_015346.3:c.5485-1G>A, NM_015346.3:c.4312C>T, NM_015346.3:c.4936C>T, NM_015346.3:c.3182delT, NM_015346.3:c.2114_2115insC	Spastic paraplegia type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZFYVE26 gene located on chromosomal region 14q24.1. The age of onset is infancy. This disease is characterized by progressive spasticity primarily affecting the lower limbs. It is a complex form of spastic paraplegia, associated with other neurologic dysfunction, including variable mental retardation, hearing and visual defects, and thin corpus callosum. The prevalence is <1 / 1,000,000.	250,600

Gene	Disease	Transcript	Mutations	Disease.description	products
ABCA4	Stargardt disease type 1; Cone-rod dystrophy type 3	NM_000350.2	NM_000350.2:c.6449G>A, NM_000350.2:c.6394G>T, NM_000350.2:c.6320G>A, NM_000350.2:c.6118C>T, NM_000350.2:c.6089G>A, NM_000350.2:c.5912T>G, NM_000350.2:c.5882G>A, NM_000350.2:c.5881G>A, NM_000350.2:c.5819T>C, NM_000350.2:c.5714+5G>A, NM_000350.2:c.5512delC, NM_000350.2:c.5461-10T>C, NM_000350.2:c.5338C>G, NM_000350.2:c.4793C>A, NM_000350.2:c.4469G>A, NM_000350.2:c.4457C>T, NM_000350.2:c.4429C>T, NM_000350.2:c.4139C>T, NM_000350.2:c.3970delG, NM_000350.2:c.3364G>A, NM_000350.2:c.3322C>T, NM_000350.2:c.3210_3211dupGT, NM_000350.2:c.3106G>A, NM_000350.2:c.3083C>T, NM_000350.2:c.2791G>A, NM_000350.2:c.2616_2617delCT, NM_000350.2:c.2588G>C, NM_000350.2:c.2300T>A, NM_000350.2:c.2160+1G>T, NM_000350.2:c.1964T>G, NM_000350.2:c.1938-1G>A, NM_000350.2:c.1848delA, NM_000350.2:c.1804C>T, NM_000350.2:c.1771delT, NM_000350.2:c.1755delA, NM_000350.2:c.1622T>C, NM_000350.2:c.1225delA, NM_000350.2:c.1222C>T, NM_000350.2:c.1018T>G, NM_000350.2:c.763C>T, NM_000350.2:c.634C>T, NM_000350.2:c.286A>G, NM_000350.2:c.67-2A>G, NM_000350.2:c.52C>T	Stargardt disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by progressive central vision loss, mild loss of color vision, delayed dark adaptation and macular atrophy with or without paramacular flecks and degeneration of the underlying retinal pigment ephitelium. The estimated prevalence is 1:8,000-10,000. Mutations in the ABCA4 gene account also for 30 to 60 percent of cases of cone-rod dystrophy that are inherited in an autosomal recessive pattern. The problems associated with this condition include a loss of visual sharpness (acuity), an increased sensitivity to light (photophobia), and impaired color vision. These vision problems worsen over time.	600,25
ACAD9	Mitochondrial complex I deficiency due to ACAD9	NM_014049.4	NM_014049.4:c.23delT, NM_014049.4:c.130T>A, NM_014049.4:c.359delT, NM_014049.4:c.453+1G>A, NM_014049.4:c.797G>A, NM_014049.4:c.976G>C, NM_014049.4:c.1240C>T, NM_014049.4:c.1249C>T, NM_014049.4:c.1594C>T	Mitochondrial complex I deficiency due to ACAD9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAD9 gene located on chromosomal region 3q21.3. The age of onset is neonatal/infantile. This disease is a multisystem disorder characterized by infantile onset of acute metabolic acidosis, hypertrophic cardiomyopathy, and muscle weakness associated with a deficiency of mitochondrial complex I activity in muscle, liver, and fibroblasts (summary by Haack et al., 2010).	600,25
ACADM	Medium-chain acyl-CoA dehydrogenase deficiency	NM_001286043.1	NM_001286043.1:c.250C>T, NM_001286043.1:c.386-2A>G, NM_001286043.1:c.461C>T, NM_001286043.1:c.548_551delCTGA, NM_001286043.1:c.546G>A, NM_001286043.1:c.715C>T, NM_001286043.1:c.716G>A, NM_001286043.1:c.833C>T, NM_001286043.1:c.896A>G, NM_001286043.1:c.898G>A, NM_001286043.1:c.916_928delGCAATGGGAGCTT, NM_001286043.1:c.1083delG, NM_001286043.1:c.1084A>G, NM_001286043.1:c.1201_1204delTTAG	Medium-chain acyl-CoA dehydrogenase (MCAD) deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADM gene located on chromosomal region 1p31. Inherited deficiency of MCAD is a condition that prevents the body from converting certain fats to energy, particularly during periods without food (fasting). Signs and symptoms of MCAD deficiency typically appear during infancy or early childhood and can include vomiting, lack of energy (lethargy), and low blood sugar (hypoglycemia). Individuals with MCAD deficiency are at risk of serious complications such as seizures, breathing difficulties, liver problems, brain damage, coma, and sudden death. The estimated prevalence is 1:4,900-1:27,000 in Caucasian populations and 1:14,600 in worldwide populations.	600,25
ACADS	Short-chain acyl-CoA dehydrogenase deficiency	NM_000017.3	NM_000017.3:c.136C>T, NM_000017.3:c.319C>T, NM_000017.3:c.417G>C, NM_000017.3:c.529T>C, NM_000017.3:c.561_568delCAATGCCT, NM_000017.3:c.1095G>T, NM_000017.3:c.1147C>T	Short-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADS gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by seizures, developmental delay, failure to grow with poor feeding, and usually muscle weakness and hypotonia. The prevalence is <1:50,000.	600,25
ACADSB	Short/branched-chain acyl-CoA dehydrogenase deficiency	NM_001609.3	NM_001609.3:c.303+1G>A, NM_001609.3:c.443C>T, NM_001609.3:c.621G>A, NM_001609.3:c.763C>T	Short/branched-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADSB gene located on chromosomal region 10q26.3. The age of onset is neonatal/infantile. This disease is characterized by muscle hypotonia, cerebral palsy, developmental delay, lethargy, hypoglycemia, and metabolic acidosis. The prevalence is <1:1,000,000.	600,25
ACADVL	Very long-chain acyl-CoA dehydrogenase deficiency	NM_001270447.1	NM_001270447.1:c.347-1G>A, NM_001270447.1:c.367_368delCA, NM_001270447.1:c.412delG, NM_001270447.1:c.469C>T, NM_001270447.1:c.546+1G>C, NM_001270447.1:c.589G>A, NM_001270447.1:c.754C>T, NM_001270447.1:c.822-2A>C, NM_001270447.1:c.917T>C, NM_001270447.1:c.965_967delAGA, NM_001270447.1:c.1165C>T, NM_001270447.1:c.1166G>A, NM_001270447.1:c.1175T>C, NM_001270447.1:c.1210_1212delGAG, NM_001270447.1:c.1251+1G>A, NM_001270447.1:c.1426C>T, NM_001270447.1:c.1444dupC, NM_001270447.1:c.1458dupG, NM_001270447.1:c.1475G>A, NM_001270447.1:c.1537G>C, NM_001270447.1:c.1601+1G>A, NM_001270447.1:c.1906C>T, NM_001270447.1:c.1912C>T, NM_001270447.1:c.1951delC	Very long-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADVL gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by cardiomyopathy, hypoketotic hypoglycemia, liver disease, exercise intolerance and rhabdomyolysis. The prevalence is 1:100,000-9:100,000.	600,25
ACE	Renal tubular dysgenesis	NM_000789.3	NM_000789.3:c.798C>G, NM_000789.3:c.1319_1322delTGGA, NM_000789.3:c.1486C>T, NM_000789.3:c.1511delC, NM_000789.3:c.1587-2A>G, NM_000789.3:c.2371C>T	Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and the most common cause are pathogenic variants in the ACE (chromosomal region 17q23.3). The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.	600,25
ADA	Adenosine deaminase deficiency / Severe combined immunodeficiency due to ADA deficiency	NM_000022.3	NM_000022.3:c.986C>T, NM_000022.3:c.956_960delAAGAG, NM_000022.3:c.890C>A, NM_000022.3:c.872C>T, NM_000022.3:c.632G>A, NM_000022.3:c.320T>C	Adenosine deaminase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADA gene located on chromosomal region 20q13.12. The age of onset is neonatal/infantile. This disease is characterized by profound lymphopenia and very low immunoglobulin levels of all isotypes resulting in severe and recurrent opportunistic infections. The annual incidence is 1:200,000-1:1,000,000. The prevalence is 1:100,000-9:100,000.	600,25
ADGRV1	Usher syndrome, type 2C	NM_032119.3	NM_032119.3:c.2258_2270delAAGTGCTGAAATC, NM_032119.3:c.2864C>A, NM_032119.3:c.5357_5358delAA, NM_032119.3:c.6275-1G>A, NM_032119.3:c.6312dupT, NM_032119.3:c.6901C>T, NM_032119.3:c.8713_8716dupAACA, NM_032119.3:c.8790delC, NM_032119.3:c.11377G>T, NM_032119.3:c.14973-1G>C, NM_032119.3:c.15196_15199dupCAAA, NM_032119.3:c.17668_17669delAT, NM_032119.3:c.18131A>G	Usher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADGRV1 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32 respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000.	600,25
AGL	Glycogen storage disease type 3	NM_000028.2	NM_000028.2:c.16C>T, NM_000028.2:c.18_19delGA, NM_000028.2:c.294-2A>T, NM_000028.2:c.1222C>T, NM_000028.2:c.1485delT, NM_000028.2:c.1783C>T, NM_000028.2:c.1999delC, NM_000028.2:c.2039G>A, NM_000028.2:c.2590C>T, NM_000028.2:c.3216_3217delGA, NM_000028.2:c.3980G>A, NM_000028.2:c.4260-12A>G, NM_000028.2:c.4260-1G>T, NM_000028.2:c.4342G>C, NM_000028.2:c.4456delT, NM_000028.2:c.4529dupA	Glycogen storage disease (GSD) type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGL gene located on chromosomal region 1p21.2. The age of onset is infantile. This metabolic disorder is caused by deficiency of the glycogen debrancher enzyme and is associated with an accumulation of abnormal glycogen with short outer chains. Most patients are enzyme-deficient in both liver and muscle (IIIa), but about 15% are enzyme-deficient in liver only (IIIb) (Shen et al., 1996). These subtypes have been explained by differences in tissue expression of the deficient enzyme (Endo et al., 2006). In rare cases, selective loss of only 1 of the 2 debranching activities, glucosidase or transferase, results in type IIIc or IIId, respectively (Van Hoof and Hers, 1967; Ding et al., 1990). Clinically, patients with GSD type 3 present in infancy or early childhood with hepatomegaly, hypoglycemia, and growth retardation. Muscle weakness in those with IIIa is minimal in childhood but can become more severe in adults; some patients develop cardiomyopathy (Shen et al., 1996).	600,25
AGXT	Hyperoxaluria, primary, type 1	NM_000030.2	NM_000030.2:c.33dupC, NM_000030.2:c.121G>A, NM_000030.2:c.166-2A>G, NM_000030.2:c.245G>A, NM_000030.2:c.248A>G, NM_000030.2:c.322T>C, NM_000030.2:c.454T>A, NM_000030.2:c.466G>A, NM_000030.2:c.508G>A, NM_000030.2:c.560C>T, NM_000030.2:c.613T>C, NM_000030.2:c.697C>T, NM_000030.2:c.698G>A, NM_000030.2:c.731T>C, NM_000030.2:c.738G>A	Primary hyperoxaluria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGXT gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by variable clinical presentation, ranging from occasional symptomatic nephrolithiasis to nephrocalcinosis and end-stage renal disease with systemic involvement. The prevalence is 1:1,000,000-9:1,000,000.	600,25
AHI1	Joubert syndrome type 3	NM_001134830.1	NM_001134830.1:c.3263_3264delGG, NM_001134830.1:c.2295dupA, NM_001134830.1:c.2168G>A, NM_001134830.1:c.1484G>A, NM_001134830.1:c.1303C>T, NM_001134830.1:c.1052G>T, NM_001134830.1:c.1051C>T, NM_001134830.1:c.985C>T	Joubert syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AHI1 gene located on chromosomal region 6q23.3. The age of onset is variable. This disease is characterized by the neurological features of Joubert syndrome (neonatal hypotonia, developmental delay, mild to severe intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia and primary position nystagmus) associated with retinal dystrophy.	600,25
AIPL1	Leber congenital amaurosis type 4	NM_014336.4	NM_014336.4:c.1053_1064delTGCAGAGCCACC, NM_014336.4:c.834G>A, NM_014336.4:c.715T>C, NM_014336.4:c.589G>C	Leber congenital amaurosis type 4 (LCA4) is a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus. Mutations in the AIPL1 gene may cause approximately 20% of recessive LCA. Other conditions caused by pathogenic variants in the AIPL1 gene are cone rod dystrophy and the less agressive form, juvenile retinitis pigmentosa. Cone-rod dystropy is characterized by decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness.	600,25
ALDOB	Fructose intolerance, hereditary	NM_000035.3	NM_000035.3:c.1067C>A, NM_000035.3:c.1013C>T, NM_000035.3:c.1005C>G, NM_000035.3:c.720C>A, NM_000035.3:c.612T>A, NM_000035.3:c.524C>A, NM_000035.3:c.448G>C, NM_000035.3:c.442T>C, NM_000035.3:c.360_363delCAAA, NM_000035.3:c.178C>T, NM_000035.3:c.113-1_115delGGTA, NM_000035.3:c.10C>T, NM_000035.3:c.2T>C	Hereditary fructose intolerance follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOB gene located on chromosomal region 9q21.3-q22.2. The age of onset is neonatal/infantile. This disease is characterized by severe abdominal pain, vomiting, and hypoglycemia following ingestion of fructose or other sugars metabolised through fructose-1-phosphate. The prevalence is 1:100,000-9:100,000.	600,25
ALG6	Congenital disorder of glycosylation, type 1c	NM_013339.3	NM_013339.3:c.316C>T, NM_013339.3:c.897_899delAAT, NM_013339.3:c.998C>T, NM_013339.3:c.1432T>C	Congenital disorder of glycosylation type 1c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG6 gene located on chromosomal region 1p31.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay and muscular hypotonia, and possible coagulation anomalies, hormonal abnormalities and seizures. The prevalence is <1:1,000,000.	600,25
ALMS1	Alstr�m syndrome	NM_015120.4	NM_015120.4:c.2323C>T, NM_015120.4:c.4246delC, NM_015120.4:c.5584C>T, NM_015120.4:c.8383C>T, NM_015120.4:c.9614_9618delCAGAA, NM_015120.4:c.11443C>T, NM_015120.4:c.11453dupA, NM_015120.4:c.11612_11613delCT, NM_015120.4:c.12439C>T, NM_015120.4:c.12445C>T	Alstr�m syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALMS1 gene located on chromosomal region 2p13.1. The age of onset is neonatal/infantile. This disease is characterized by cone-rod dystrophy, hearing loss, obesity, insulin resistance and hyperinsulinemia, type 2 diabetes mellitus, dilated cardiomyopathy and progressive hepatic and renal dysfunction. The prevalence is 1:10,000-1:1,000,000.	600,25
ANO5	Limb-girdle muscular dystrophy type 12 (LGMDR12; formerly LGMD2L)	NM_213599.2	NM_213599.2:c.172C>T, NM_213599.2:c.191dupA, NM_213599.2:c.206_207delAT, NM_213599.2:c.692G>T, NM_213599.2:c.1210C>T, NM_213599.2:c.1295C>G, NM_213599.2:c.1407+5G>A, NM_213599.2:c.1627dupA, NM_213599.2:c.1733T>C, NM_213599.2:c.1887delA, NM_213599.2:c.1898+1G>A, NM_213599.2:c.1914G>A	Limb-girdle muscular dystrophy type 12 (LGMDR12, formerly LGMD2L) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ANO5 gene located on chromosomal region 11p14.3. This disease is characterized by weakness and wasting restricted to the limb musculature. Most often is characterized by an adult onset (but ranging from 11 to 51 years) of mainly proximal lower limb weakness, with difficulties standing on tiptoes being one of the initial signs. Proximal upper limb and distal lower limb weakness is also common, as well as atrophy of the quadriceps (most commonly), biceps brachii, and lower leg muscles. Calf hypertrophy has also been reported in some cases. LGMDR12 progresses slowly, with most patients remaining ambulatory until late adulthood. The estimated prevalence is <1:1,000,000.	600,25
APTX	Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia	NM_001195248.1	NM_001195248.1:c.917-1G>A, NM_001195248.1:c.879G>A, NM_001195248.1:c.830T>G, NM_001195248.1:c.659C>T, NM_001195248.1:c.362delC, NM_001195248.1:c.209delT, NM_001195248.1:c.176-2A>G, NM_001195248.1:c.166C>T	Ataxia, early-onset, with oculomotor apraxia and hipoalbuminemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the APTX gene located on chromosomal region 9p13.1. Ataxia-oculomotor apraxia syndrome is an early-onset autosomal recessive, progressive, cerebellar ataxia with peripheral axonal neuropathy, oculomotor apraxia (defined as the limitation of ocular movements on command), and hypoalbuminemia. The prevalence is unknown.	600,25
AR	Androgen insensitivity syndrome, complete	NM_000044.3	NM_000044.3:c.340C>T, NM_000044.3:c.1771A>T, NM_000044.3:c.2323C>T, NM_000044.3:c.2391G>A, NM_000044.3:c.2395C>G, NM_000044.3:c.2567G>A, NM_000044.3:c.2650A>T	The complete androgen insensitivity syndrome (CAIS) follows an X-linked pattern of inheritance and is caused by pathogenic variants in the AR gene located on chromosomal region Xq12. Affected males have female external genitalia, female breast development, blind vagina, absent uterus and female adnexa, and abdominal or inguinal testes, despite a normal male 46,XY karyotype. There is unresponsiveness to age-appropriate levels of androgens. There is also a partial androgen insensitivity syndrome (PAIS; OMIM 312300) caused by mutations in the AR gene, called Reifenstein syndrome, which results in hypospadias and micropenis with gynecomastia. Note: A specific type of mutation in the AR gene (a CAG repeat expansion) also cause a rare condition known as Spinal and bulbar muscular atrophy or Kennedy disease; this mutation is not tested by this carrier test.	600,25
ARSA	Metachromatic leukodystrophy	NM_000487.5	NM_000487.5:c.1408_1418delGCAGCTGTGAC, NM_000487.5:c.1401_1411delGTTAGACGCAG, NM_000487.5:c.1283C>T, NM_000487.5:c.1241delC, NM_000487.5:c.1232C>T, NM_000487.5:c.1210+1G>A, NM_000487.5:c.1175G>A, NM_000487.5:c.1174C>T, NM_000487.5:c.1150G>A, NM_000487.5:c.1125_1126delCT, NM_000487.5:c.1108-2A>G, NM_000487.5:c.991G>T, NM_000487.5:c.986C>T, NM_000487.5:c.979G>A, NM_000487.5:c.938G>A, NM_000487.5:c.937C>T, NM_000487.5:c.931G>A, NM_000487.5:c.899T>C, NM_000487.5:c.883G>A, NM_000487.5:c.869G>A, NM_000487.5:c.854+1G>A, NM_000487.5:c.827C>T, NM_000487.5:c.763G>A, NM_000487.5:c.739G>A, NM_000487.5:c.737G>A, NM_000487.5:c.641C>T, NM_000487.5:c.583delT, NM_000487.5:c.582delC, NM_000487.5:c.542dupT, NM_000487.5:c.542T>G, NM_000487.5:c.465+1G>A, NM_000487.5:c.346C>T, NM_000487.5:c.302G>A, NM_000487.5:c.293C>T, NM_000487.5:c.257G>A, NM_000487.5:c.195delC, NM_000487.5:c.34delG	Metachromatic leukodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSA gene located on chromosomal region 22q13.33. The age of onset is variable. This disease is characterized by hypotonia, walking difficulties, optic atrophy and motor regression preceding mental impairment in the late infantile form, arrested intellectual development, followed by motor regression, epileptic seizures and ataxia in the juvenile form, and motor or psychiatric disorders, but with slow progression in the adult form. The incidence is 0.5:5,000-1:50,000ﾠand the prevalence is 1:10,000 -5/10,000.	600,25
ARSB	Mucopolysaccharidosis type 6 (Maroteaux-Lamy)	NM_000046.3	NM_000046.3:c.1438dupG, NM_000046.3:c.1366C>T, NM_000046.3:c.1214G>A, NM_000046.3:c.1178A>C, NM_000046.3:c.1161dupC, NM_000046.3:c.1143-1G>C, NM_000046.3:c.1143-8T>G, NM_000046.3:c.979C>T, NM_000046.3:c.971G>T, NM_000046.3:c.944G>A, NM_000046.3:c.937C>G, NM_000046.3:c.921delA, NM_000046.3:c.753C>G, NM_000046.3:c.629A>G, NM_000046.3:c.589C>T, NM_000046.3:c.571C>T, NM_000046.3:c.427delG, NM_000046.3:c.349T>C	Mucopolysaccharidosis type 6 (Maroteaux-Lamy) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSB gene located on chromosomal region 5q14.1. The age of onset is infantile. This lysosomal storage disorder resulting from a deficiency of arylsulfatase B is characterized by educed pulmonary function, hepatosplenomegaly, hearing loss, sleep apnea, corneal clouding, carpal tunnel disease and occasionally central nervous system findings may include cervical cord compression caused by cervical spinal instability, meningeal thickening and/or bony stenosis, communicating hydrocephalus, optic nerve atrophy and blindness. The prevalence is 1:250,000-1:600,000 newborns.	600,25
ARSE	Chondrodysplasia punctata, X-linked recessive	NM_001282628.1	NM_001282628.1:c.1807C>T, NM_001282628.1:c.1517C>T, NM_001282628.1:c.1504delG, NM_001282628.1:c.485G>T, NM_001282628.1:c.194T>G, NM_001282628.1:c.99-1G>A	X-linked chondrodysplasia punctata follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARSE gene located on chromosomal region Xp22.33. The age of onset is neonatal. Thisﾠis a disorder of cartilage and bone development that occurs almost exclusively in males. Include short stature and unusually short fingertips and ends of the toes. This condition is also associated with distinctive facial features, particularly a flattened-appearing nose with crescent-shaped nostrils and a flat nasal bridge. People with X-linked chondrodysplasia punctata 1 typically have normal intelligence and a normal life expectancy. However, some affected individuals have had serious or life-threatening complications including abnormal thickening (stenosis) of the cartilage that makes up the airways, which restricts breathing. Also, abnormalities of spinal bones in the neck can lead to pinching (compression) of the spinal cord, which can cause pain, numbness, and weakness. Other, less common features of X-linked chondrodysplasia punctata 1 include delayed development, hearing loss, vision abnormalities, and heart defects. The prevalence is 1:500,000.	600,25
ASL	Argininosuccinic aciduria	NM_000048.3	NM_000048.3:c.35G>A, NM_000048.3:c.337C>T, NM_000048.3:c.346C>T, NM_000048.3:c.446+1G>A, NM_000048.3:c.525-2A>T, NM_000048.3:c.532G>A, NM_000048.3:c.539T>G, NM_000048.3:c.544C>T, NM_000048.3:c.578G>A, NM_000048.3:c.602+1G>A, NM_000048.3:c.857A>G, NM_000048.3:c.1045_1057delGTCATCTCTACGC, NM_000048.3:c.1060C>T, NM_000048.3:c.1135C>T, NM_000048.3:c.1144-2A>G, NM_000048.3:c.1153C>T, NM_000048.3:c.1255_1256delCT, NM_000048.3:c.1369dupG	Argininosuccinic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASL gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by severe hyperammonemic coma, hypotonia, growth failure, anorexia and chronic vomiting or behavioral disorders during childhood, and hyperammonemic coma or behavioral disorders that simulate psychiatric disorders later in life. The prevalence is 1:70,000 newborns.	600,25
ASPA	Canavan disease	NM_000049.2	NM_000049.2:c.212G>A, NM_000049.2:c.433-2A>G, NM_000049.2:c.654C>A, NM_000049.2:c.693C>A, NM_000049.2:c.854A>C, NM_000049.2:c.914C>A	Canavan disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPA gene located on chromosomal region 17p13.3. The age of onset is neonatal/infantile. This disease is characterized by a variable spectrum between severe forms with leukodystrophy, macrocephaly and severe developmental delay, and a very rare mild/juvenile form characterized by mild developmental delay. The prevalence is 1:6,400- 1:13,500 in Askenazis Jewis.	600,25
ASPM	Primary microcephaly type 5, autosomal recessive	NM_018136.4	NM_018136.4:c.10059C>A, NM_018136.4:c.9789T>A, NM_018136.4:c.9754delA, NM_018136.4:c.9747_9748delCT, NM_018136.4:c.9730C>T, NM_018136.4:c.9697C>T, NM_018136.4:c.9685delA, NM_018136.4:c.9677dupG, NM_018136.4:c.9557C>G, NM_018136.4:c.9492T>G, NM_018136.4:c.9319C>T, NM_018136.4:c.9238A>T, NM_018136.4:c.9190C>T, NM_018136.4:c.9178C>T, NM_018136.4:c.9159delA, NM_018136.4:c.9115_9118dupCATT, NM_018136.4:c.8844delC, NM_018136.4:c.8711_8712delAA, NM_018136.4:c.8668C>T, NM_018136.4:c.8508_8509delGA, NM_018136.4:c.8378delT, NM_018136.4:c.8230dupA, NM_018136.4:c.8131_8132delAA, NM_018136.4:c.7894C>T, NM_018136.4:c.7860_7861delGA, NM_018136.4:c.7782_7783delGA, NM_018136.4:c.7761T>G, NM_018136.4:c.7491_7495delTATTA, NM_018136.4:c.6732delA, NM_018136.4:c.6337_6338delAT, NM_018136.4:c.6232C>T, NM_018136.4:c.6189T>G, NM_018136.4:c.6073delG, NM_018136.4:c.5439_5440delAG, NM_018136.4:c.5149delA, NM_018136.4:c.5136C>A, NM_018136.4:c.4858_4859delAT, NM_018136.4:c.4795C>T, NM_018136.4:c.4583delA, NM_018136.4:c.4195dupA, NM_018136.4:c.3979C>T, NM_018136.4:c.3978G>A, NM_018136.4:c.3811C>T, NM_018136.4:c.3796G>T, NM_018136.4:c.3710C>G, NM_018136.4:c.3663delG, NM_018136.4:c.3527C>G, NM_018136.4:c.3477_3481delCGCTA, NM_018136.4:c.3188T>G, NM_018136.4:c.3082G>A, NM_018136.4:c.3055C>T, NM_018136.4:c.2967G>A, NM_018136.4:c.2389C>T, NM_018136.4:c.1990C>T, NM_018136.4:c.1959_1962delCAAA, NM_018136.4:c.1729_1730delAG, NM_018136.4:c.1590delA, NM_018136.4:c.1406_1413delATCCTAAA, NM_018136.4:c.1366G>T, NM_018136.4:c.1260_1266delTCAAGTC, NM_018136.4:c.1179delT, NM_018136.4:c.1154_1155delAG, NM_018136.4:c.1002delA, NM_018136.4:c.719_720delCT, NM_018136.4:c.577C>T, NM_018136.4:c.349C>T	Primary autosomal recessive microcephaly type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPM gene located on chromosomal region 1q31. The age of onset is neonatal/infantile. This disease is characterized by a reduction in head circumference at birth, mild to moderate non-progressive intellectual impairment and delay in early motor milestones, speech delay and hyperactive behavior are common.ﾠThe annual incidence is 1:1,000,000.	600,25
ASS1	Citrullinemia type 1	NM_000050.4	NM_000050.4:c.40G>A, NM_000050.4:c.256C>T, NM_000050.4:c.257G>A, NM_000050.4:c.349G>A, NM_000050.4:c.421-2A>G, NM_000050.4:c.470G>A, NM_000050.4:c.496-2A>G, NM_000050.4:c.535T>C, NM_000050.4:c.539G>A, NM_000050.4:c.571G>A, NM_000050.4:c.787G>A, NM_000050.4:c.793C>T, NM_000050.4:c.794G>A, NM_000050.4:c.805G>A, NM_000050.4:c.814C>T, NM_000050.4:c.835C>T, NM_000050.4:c.836G>A, NM_000050.4:c.910C>T, NM_000050.4:c.919C>T, NM_000050.4:c.970G>A, NM_000050.4:c.970+5G>A, NM_000050.4:c.1085G>T, NM_000050.4:c.1087C>T, NM_000050.4:c.1088G>A, NM_000050.4:c.1168G>A, NM_000050.4:c.1194-1G>C	Citrullinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASS1 gene located on chromosomal region 9q34.1. The age of onset is variable. This disease is characterized by hyperammonemia, progressive lethargy, poor feeding and vomiting in the neonatal form and by variable hyperammonemia in the later-onset form. The prevalence is 1:100,000-9:100,000.	600,25
ATIC	AICA-ribosiduria due to ATIC deficiency	NM_004044.6	NM_004044.6:c.1277A>G	AICA-ribosiduria due to ATIC deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATIC gene located on chromosomal region 2q35. The age of onset is neonatal/infantile. This disease is characterized by profound intellectual deficit, epilepsy, dysmorphic features of the knees, elbows, and shoulders and congenital blindness. The prevalence is <1:1,000,000.	600,25
ATP7B	Wilson disease	NM_000053.3	NM_000053.3:c.4088C>T, NM_000053.3:c.4058G>A, NM_000053.3:c.3990_3993delTTAT, NM_000053.3:c.3955C>T, NM_000053.3:c.3809A>G, NM_000053.3:c.3796G>A, NM_000053.3:c.3694A>C, NM_000053.3:c.3359T>A, NM_000053.3:c.3207C>A, NM_000053.3:c.3083delA, NM_000053.3:c.2975C>T, NM_000053.3:c.2972C>T, NM_000053.3:c.2930C>T, NM_000053.3:c.2906G>A, NM_000053.3:c.2807T>A, NM_000053.3:c.2804C>T, NM_000053.3:c.2795C>A, NM_000053.3:c.2755C>T, NM_000053.3:c.2755C>G, NM_000053.3:c.2621C>T, NM_000053.3:c.2605G>A, NM_000053.3:c.2532delA, NM_000053.3:c.2356-2A>G, NM_000053.3:c.2305A>G, NM_000053.3:c.2297C>G, NM_000053.3:c.2123T>C, NM_000053.3:c.2071G>A, NM_000053.3:c.1934T>G, NM_000053.3:c.1846C>T, NM_000053.3:c.1745_1746delTA, NM_000053.3:c.1512dupT, NM_000053.3:c.1145_1151delCCCAACT, NM_000053.3:c.915T>A, NM_000053.3:c.562C>T, NM_000053.3:c.19_20delCA	Wilson disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATP7B gene located on chromosomal region 13q14.3. The age of onset is infantile. This disease is characterized by the toxic accumulation of copper, mainly in the liver and central nervous system, and symptomatic patients may present with hepatic, neurologic or psychiatric forms. The birth incidence is 1:30,000-1:100,000 in France and The prevalence is 1:10,000-1:30,000.	600,25
ATR	Seckel syndrome type 1	NM_001184.3	NM_001184.3:c.6488delT, NM_001184.3:c.6037dupA, NM_001184.3:c.5645delA, NM_001184.3:c.5635G>T, NM_001184.3:c.2341+1G>A, NM_001184.3:c.975_976delCT	Seckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATR gene located on chromosomal region 3q23. The age of onset is neonatal/infantile. This disease is characterized by a proportionate dwarfism of prenatal onset, a severe microcephaly with a bird-headed like appearance and mental retardation.ﾠThe prevalence is <1:1,000,000.	600,25
BCKDHA	Maple syrup urine disease, type 1a	NM_000709.3	NM_000709.3:c.14delT, NM_000709.3:c.632C>T, NM_000709.3:c.659C>T, NM_000709.3:c.741dupT, NM_000709.3:c.797delA, NM_000709.3:c.853G>C, NM_000709.3:c.868G>A, NM_000709.3:c.905A>C, NM_000709.3:c.909_910delGT, NM_000709.3:c.917delT, NM_000709.3:c.929C>G, NM_000709.3:c.964C>T, NM_000709.3:c.979G>A, NM_000709.3:c.1036C>T, NM_000709.3:c.1037G>A, NM_000709.3:c.1234G>A	Maple syrup urine disease type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHA gene located on chromosomal region 19q13.1-13.2. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:1,000,000-9:1,000,000.	600,25
BCS1L	BCS1L-related disorders, including Leigh syndrome	NM_001079866.1	NM_001079866.1:c.103G>C, NM_001079866.1:c.133C>T, NM_001079866.1:c.148A>G, NM_001079866.1:c.166C>T, NM_001079866.1:c.232A>G, NM_001079866.1:c.547C>T, NM_001079866.1:c.548G>A, NM_001079866.1:c.550C>T, NM_001079866.1:c.696delT, NM_001079866.1:c.830G>A, NM_001079866.1:c.1057G>A	Leigh syndrome caused by mutations in the BCS1L gene -located on chromosomal region 2q35- follows an autosomal recessive pattern of inheritance. Leigh syndrome is a clinically and genetically heterogeneous disorder resulting from defective mitochondrial energy generation; It presents extensive genetic heterogeneity (more than 75 different genes) with mutations identified in both nuclear- and mitochondrial-encoded genes involved in energy metabolism, including mitochondrial respiratory chain complexes I, II, III, IV, and V. It most commonly presents as a progressive and severe neurodegenerative disorder with onset within the first months or years of life, and may result in early death. Affected individuals usually show global developmental delay or developmental regression, hypotonia, ataxia, dystonia, and ophthalmologic abnormalities, such as nystagmus or optic atrophy. The BCS1L protein is critical for the formation of mitochondrial complex III. This syndrome affects at least 1 in 40,000 newborns.	600,25
BEST1	Bestrophinopathy, AR	NM_001139443.1	NM_001139443.1:c.242G>A, NM_001139443.1:c.341_342delTG, NM_001139443.1:c.344delG, NM_001139443.1:c.418C>T, NM_001139443.1:c.434T>C, NM_001139443.1:c.502G>A, NM_001139443.1:c.754G>A, NM_001139443.1:c.769G>A, NM_001139443.1:c.1129_1130insCCAAAGA, NM_001139443.1:c.1203_1204insGCCTTGATGGA, NM_001139443.1:c.1311_1317dupCAAAGAC	Bestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram. Genetic heterogeneity: Mutations in this gene may cause dominant phenotypes like Macular dystrophy, vitelliform, 2 ( OMIM 153700) and Vitreoretinochoroidopathy (193220).	600,25
BEST1	Bestrophinopathy, AR	NM_004183.3	NM_004183.3:c.122T>C	Bestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram. Genetic heterogeneity: Mutations in this gene may cause dominant phenotypes like Macular dystrophy, vitelliform, 2 ( OMIM 153700) and Vitreoretinochoroidopathy (193220).	600,25
BSND	Bartter syndrome, type 4a	NM_057176.2	NM_057176.2:c.1A>T, NM_057176.2:c.3G>A, NM_057176.2:c.10G>T, NM_057176.2:c.22C>T, NM_057176.2:c.23G>T, NM_057176.2:c.35T>C, NM_057176.2:c.139G>A	Bartter syndrome type 4A with deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSND gene located on chromosomal region 1p32.3. The age of onset is neonatal/infantile. This disease is characterized by maternal polyhydramnios, premature delivery, polyuria, sensorineural deafness and is associated with hypokalemic alkalosis, increased levels of plasma renin and aldosterone, low blood pressure, and vascular resistance to angiotensin II.	600,25
BTD	Biotinidase deficiency	NM_001281723.2	NM_001281723.2:c.190G>A, NM_001281723.2:c.241C>T, NM_001281723.2:c.340G>C, NM_001281723.2:c.449G>A, NM_001281723.2:c.517G>A, NM_001281723.2:c.534G>T, NM_001281723.2:c.563G>A, NM_001281723.2:c.589A>G, NM_001281723.2:c.601G>A, NM_001281723.2:c.635A>G, NM_001281723.2:c.637C>T, NM_001281723.2:c.649C>T, NM_001281723.2:c.670G>A, NM_001281723.2:c.761A>G, NM_001281723.2:c.800A>T, NM_001281723.2:c.939delT, NM_001281723.2:c.1330delG, NM_001281723.2:c.1345C>T, NM_001281723.2:c.1358G>A, NM_001281723.2:c.1374A>C, NM_001281723.2:c.1495C>T, NM_001281723.2:c.1514_1518delGGATG, NM_001281723.2:c.1601C>T, NM_001281723.2:c.1618C>T	Biotinidase deficiency an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BTD gene located on chromosomal region 3p25. The age of onset is neonatal/infantile. This disease is characterized by seizures, breathing difficulties, hypotonia, skin rash, alopecia, hearing loss and delayed development.	600,25
CAPN3	Limb-girdle muscular dystrophy type 1 (LGMDR1; formerly LGMD2A)	NM_000070.2	NM_000070.2:c.133G>A, NM_000070.2:c.223dupT, NM_000070.2:c.257C>T, NM_000070.2:c.328C>T, NM_000070.2:c.550delA, NM_000070.2:c.580delT, NM_000070.2:c.598_612delTTCTGGAGTGCTCTG, NM_000070.2:c.855_864dupGTTGATTGCA, NM_000070.2:c.956C>T, NM_000070.2:c.1322delG, NM_000070.2:c.1466G>A, NM_000070.2:c.1468C>T, NM_000070.2:c.1469G>A, NM_000070.2:c.1599_1602delGAGC, NM_000070.2:c.1715G>A, NM_000070.2:c.1795dupA, NM_000070.2:c.1838delA, NM_000070.2:c.2120A>G, NM_000070.2:c.2212C>T, NM_000070.2:c.2243G>A, NM_000070.2:c.2251_2254dupGTCA, NM_000070.2:c.2306G>A, NM_000070.2:c.2362_2363delAGinsTCATCT	Limb-girdle muscular dystrophy type 1 (LGMDR1; formerly LGMD2A) follows an autosomal recessive pattern of inheritance and is caused by biallelic pathogenic variants in the CAPN3 gene located on chromosomal region 15q15.1. The age of onset is variable. This disease is characterized by a variable age of onset of progressive, typically symmetrical and selective weakness and atrophy of proximal shoulder- and pelvic-girdle muscles (gluteus maximus, thigh adductors, and muscles of the posterior compartment of the limbs are most commonly affected) without cardiac or facial involvement. Clinical manifestations include exercise intolerance, a waddling gait, scapular winging and calf pseudo-hypertrophy.The prevalence is 1:100,000- 9:100,000. Genetic heterogeneity: Heterozygous mutation in the CAPN3 gene can cause autosomal dominant limb-girdle muscular dystrophy-4 (LGMDD4; OMIM 618129), which has a later onset and milder features.	600,25
CBS	Homocystinuria, B6-responsive and nonresponsive types	NM_000071.2	NM_000071.2:c.1330G>A, NM_000071.2:c.1280C>T, NM_000071.2:c.1150A>G, NM_000071.2:c.1136G>A, NM_000071.2:c.1058C>T, NM_000071.2:c.1006C>T, NM_000071.2:c.992C>A, NM_000071.2:c.969G>A, NM_000071.2:c.959T>C, NM_000071.2:c.919G>A, NM_000071.2:c.833T>C, NM_000071.2:c.797G>A, NM_000071.2:c.689delT, NM_000071.2:c.676G>A, NM_000071.2:c.572C>T, NM_000071.2:c.526G>T, NM_000071.2:c.502G>A, NM_000071.2:c.434C>T, NM_000071.2:c.430G>A, NM_000071.2:c.415G>A, NM_000071.2:c.393G>C, NM_000071.2:c.374G>A, NM_000071.2:c.341C>T, NM_000071.2:c.325T>C, NM_000071.2:c.162G>A, NM_000071.2:c.146C>T	Homocystinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CBS gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by the multiple involvement of the eye, skeleton, central nervous system and vascular system. The prevalence is 1:200,000-1:335,000.	600,25
CC2D2A	Joubert syndrome type 9; Meckel syndrome type 6	NM_001080522.2	NM_001080522.2:c.2486+1G>C, NM_001080522.2:c.2848C>T, NM_001080522.2:c.3145C>T, NM_001080522.2:c.3289delG, NM_001080522.2:c.3364C>T, NM_001080522.2:c.3594+1G>A, NM_001080522.2:c.4179+1delG, NM_001080522.2:c.4181delG, NM_001080522.2:c.4333C>T, NM_001080522.2:c.4582C>T, NM_001080522.2:c.4667A>T	Joubert syndrome type 9 defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized neonatal hypotonia, developmental delay, intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia, primary position nystagmus and congenital hepatic fibrosis.	600,25
CDH23	Usher syndrome, type 1D	NM_022124.5	NM_022124.5:c.146-2A>G, NM_022124.5:c.193delC, NM_022124.5:c.288+1G>A, NM_022124.5:c.1858+2T>G, NM_022124.5:c.3141C>A, NM_022124.5:c.3516_3519delATCC, NM_022124.5:c.3579+2T>C, NM_022124.5:c.4504C>T, NM_022124.5:c.5237G>A, NM_022124.5:c.5663T>C, NM_022124.5:c.6050-9G>A, NM_022124.5:c.6393delC, NM_022124.5:c.6442G>A	Non-syndromic autosomal recessive deafness type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	600,25
CDHR1	Cone-rod dystrophy, type 15	NM_033100.3	NM_033100.3:c.338delG, NM_033100.3:c.524dupA, NM_033100.3:c.640delG, NM_033100.3:c.1112delC, NM_033100.3:c.1463delG, NM_033100.3:c.1485+2T>C, NM_033100.3:c.1485+2T>G	Cone-rod dystrophy, type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDHR1 gene located on chromosomal region 10q23.1. This disease is characterized by decreased visual acuity and sensitivity in the central visual field, followed by loss of peripheral vision. The overall prevalence of all types of cone-rod dystrophy is 1-9:100,000.	600,25
CENPJ	Primary microcephaly type 6, autosomal recessive	NM_018451.4	NM_018451.4:c.3842_3843dupTA, NM_018451.4:c.3704A>T, NM_018451.4:c.3699_3702dupAATA, NM_018451.4:c.3568_3571dupGTCA, NM_018451.4:c.3415G>T, NM_018451.4:c.3243_3246delTCAG, NM_018451.4:c.2968_2972delAAAAA, NM_018451.4:c.2614delT, NM_018451.4:c.2460_2463delGACG, NM_018451.4:c.1949_1952dupAGTG, NM_018451.4:c.757_760delGTCT, NM_018451.4:c.289dupA, NM_018451.4:c.232_236delCAGAA, NM_018451.4:c.40C>T	Primary autosomal recessive microcephaly type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CENPJ gene located on chromosomal region 13q12.12.ﾠThe age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.	600,25
CEP290	Meckel syndrome type 4; Joubert syndrome type 5	NM_025114.3	NM_025114.3:c.7341dupA, NM_025114.3:c.7341delA, NM_025114.3:c.7324G>T, NM_025114.3:c.6798G>A, NM_025114.3:c.6645+1G>A, NM_025114.3:c.6624delG, NM_025114.3:c.6448_6455delCAGTTGAA, NM_025114.3:c.5668G>T, NM_025114.3:c.5611_5614delCAAA, NM_025114.3:c.4962_4963delAA, NM_025114.3:c.4916C>A, NM_025114.3:c.4723A>T, NM_025114.3:c.4705-1G>T, NM_025114.3:c.4656delA, NM_025114.3:c.4393C>T, NM_025114.3:c.3185delT, NM_025114.3:c.2249T>G, NM_025114.3:c.1681C>T, NM_025114.3:c.1665_1666delAA, NM_025114.3:c.1501G>T, NM_025114.3:c.613C>T, NM_025114.3:c.384_387delTAGA, NM_025114.3:c.164_167delCTCA, NM_025114.3:c.21G>T	Meckel syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is neonatal. This disease is characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically occipital encephalocele), hepatic ductal dysplasia and cysts, and postaxial polydactyly. The prevalence is <1/1,000,000.	600,25
CERKL	Retinitis pigmentosa type 26	NM_001030311.2	NM_001030311.2:c.1090C>T, NM_001030311.2:c.858delT, NM_001030311.2:c.847C>T, NM_001030311.2:c.312delA	Retinitis pigmentosa 26 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CERKL gene located on chromosomal region 2q31.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	600,25
CFH	Complement factor H deficiency	NM_000186.3	NM_000186.3:c.380G>T, NM_000186.3:c.1606T>C, NM_000186.3:c.2876G>A	Complement factor H deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFH gene located on chromosomal region 1q32. This disease is characterized by increased susceptibility to recurrent, usually severe, infections (particularly by Neisseria meningitidis, Escherichia coli, and Haemophilus influenzae), renal impairment and/or autoimmune diseases.	600,25
CFTR	Cystic fibrosis	NM_000492.3	NM_000492.3:c.1A>G, NM_000492.3:c.4C>T, NM_000492.3:c.11C>A, NM_000492.3:c.50delT, NM_000492.3:c.44T>C, NM_000492.3:c.53+1G>T, NM_000492.3:c.57G>A, NM_000492.3:c.79G>T, NM_000492.3:c.88C>T, NM_000492.3:c.115C>T, NM_000492.3:c.137C>A, NM_000492.3:c.164+1G>A, NM_000492.3:c.164+1G>T, NM_000492.3:c.164+2T>C, NM_000492.3:c.164+4dupT, NM_000492.3:c.165-3C>T, NM_000492.3:c.165-1G>A, NM_000492.3:c.166G>A, NM_000492.3:c.169T>G, NM_000492.3:c.170G>A, NM_000492.3:c.171G>A, NM_000492.3:c.174_177delTAGA, NM_000492.3:c.175dupA, NM_000492.3:c.178G>A, NM_000492.3:c.178G>T, NM_000492.3:c.200C>T, NM_000492.3:c.223C>T, NM_000492.3:c.233dupT, NM_000492.3:c.254G>A, NM_000492.3:c.262_263delTT, NM_000492.3:c.263T>A, NM_000492.3:c.263T>G, NM_000492.3:c.271G>A, NM_000492.3:c.273+1G>A, NM_000492.3:c.273+3A>C, NM_000492.3:c.274-2A>G, NM_000492.3:c.274-1G>A, NM_000492.3:c.274G>A, NM_000492.3:c.274G>T, NM_000492.3:c.292C>T, NM_000492.3:c.305T>G, NM_000492.3:c.310delA, NM_000492.3:c.313delA, NM_000492.3:c.325_327delTATinsG, NM_000492.3:c.328G>C, NM_000492.3:c.328G>T, NM_000492.3:c.349C>T, NM_000492.3:c.350G>A, NM_000492.3:c.350G>T, NM_000492.3:c.366T>A, NM_000492.3:c.409delC, NM_000492.3:c.413_415dupTAC, NM_000492.3:c.416A>G, NM_000492.3:c.442delA, NM_000492.3:c.445G>A, NM_000492.3:c.445G>T, NM_000492.3:c.446G>T, NM_000492.3:c.489+1G>T, NM_000492.3:c.531delT, NM_000492.3:c.532G>A, NM_000492.3:c.543_546delTAGT, NM_000492.3:c.571T>G, NM_000492.3:c.577G>T, NM_000492.3:c.579+1G>T, NM_000492.3:c.579+3A>G, NM_000492.3:c.579+5G>A, NM_000492.3:c.580-1G>T, NM_000492.3:c.595C>T, NM_000492.3:c.613C>T, NM_000492.3:c.617T>G, NM_000492.3:c.647G>A, NM_000492.3:c.658C>T, NM_000492.3:c.680T>G, NM_000492.3:c.695T>A, NM_000492.3:c.708delT, NM_000492.3:c.717delG, NM_000492.3:c.803delA, NM_000492.3:c.825C>G, NM_000492.3:c.828C>A, NM_000492.3:c.850dupA, NM_000492.3:c.861_865delCTTAA, NM_000492.3:c.935_937delTCT, NM_000492.3:c.933C>G, NM_000492.3:c.948delT, NM_000492.3:c.987delA, NM_000492.3:c.988G>T, NM_000492.3:c.1000C>T, NM_000492.3:c.1001G>T, NM_000492.3:c.1006_1007insG, NM_000492.3:c.1007T>A, NM_000492.3:c.1013C>T, NM_000492.3:c.1021_1022dupTC, NM_000492.3:c.1021T>C, NM_000492.3:c.1029delC, NM_000492.3:c.1037T>C, NM_000492.3:c.1040G>A, NM_000492.3:c.1040G>C, NM_000492.3:c.1055G>A, NM_000492.3:c.1075C>A, NM_000492.3:c.1079C>A, NM_000492.3:c.1081delT, NM_000492.3:c.1116+1G>A, NM_000492.3:c.1117-1G>A, NM_000492.3:c.1130dupA, NM_000492.3:c.1155_1156dupTA, NM_000492.3:c.1202G>A, NM_000492.3:c.1203G>A, NM_000492.3:c.1209+1G>A, NM_000492.3:c.1211delG, NM_000492.3:c.1240C>T, NM_000492.3:c.1301_1307delCACTTCT, NM_000492.3:c.1327_1330dupGATA, NM_000492.3:c.1340delA, NM_000492.3:c.1364C>A, NM_000492.3:c.1365_1366delGG, NM_000492.3:c.1393-2A>G, NM_000492.3:c.1393-1G>A, NM_000492.3:c.1397C>A, NM_000492.3:c.1397C>G, NM_000492.3:c.1400T>C, NM_000492.3:c.1418delG, NM_000492.3:c.1420G>A, NM_000492.3:c.1438G>T, NM_000492.3:c.1466C>A, NM_000492.3:c.1475C>T, NM_000492.3:c.1477_1478delCA, NM_000492.3:c.1477C>T, NM_000492.3:c.1487G>A, NM_000492.3:c.1505T>C, NM_000492.3:c.1519_1521delATC, NM_000492.3:c.1516A>G, NM_000492.3:c.1519A>G, NM_000492.3:c.1521_1523delCTT, NM_000492.3:c.1523T>G, NM_000492.3:c.1538A>G, NM_000492.3:c.1545_1546delTA, NM_000492.3:c.1558G>T, NM_000492.3:c.1572C>A, NM_000492.3:c.1573C>T, NM_000492.3:c.1584+1G>A, NM_000492.3:c.1585-8G>A, NM_000492.3:c.1585-1G>A, NM_000492.3:c.1624G>T, NM_000492.3:c.1645A>C, NM_000492.3:c.1646G>A, NM_000492.3:c.1647T>G, NM_000492.3:c.1648G>T, NM_000492.3:c.1650delA, NM_000492.3:c.1651G>A, NM_000492.3:c.1652G>A, NM_000492.3:c.1654C>T, NM_000492.3:c.1657C>T, NM_000492.3:c.1670delC, NM_000492.3:c.1673T>C, NM_000492.3:c.1675G>A, NM_000492.3:c.1679G>A, NM_000492.3:c.1679G>C, NM_000492.3:c.1679+1G>A, NM_000492.3:c.1679+1G>C, NM_000492.3:c.1680-886A>G, NM_000492.3:c.1680-1G>A, NM_000492.3:c.1682C>A, NM_000492.3:c.1692delA, NM_000492.3:c.1703delT, NM_000492.3:c.1705T>G, NM_000492.3:c.1721C>A, NM_000492.3:c.1753G>T, NM_000492.3:c.1766+1G>A, NM_000492.3:c.1766+1G>C, NM_000492.3:c.1766+1G>T, NM_000492.3:c.1766+3A>G, NM_000492.3:c.1766+5G>T, NM_000492.3:c.1792_1798delAAAACTA, NM_000492.3:c.1826A>G, NM_000492.3:c.1882G>C, NM_000492.3:c.1923_1931delCTCAAAACTinsA, NM_000492.3:c.1973_1985delGAAATTCAATCCTinsAGAAA, NM_000492.3:c.1986_1989delAACT, NM_000492.3:c.2012delT, NM_000492.3:c.2017G>T, NM_000492.3:c.2052dupA, NM_000492.3:c.2052delA, NM_000492.3:c.2051_2052delAAinsG, NM_000492.3:c.2053dupC, NM_000492.3:c.2053C>T, NM_000492.3:c.2125C>T, NM_000492.3:c.2128A>T, NM_000492.3:c.2143C>T, NM_000492.3:c.2158C>T, NM_000492.3:c.2175dupA, NM_000492.3:c.2195T>G, NM_000492.3:c.2215delG, NM_000492.3:c.2241_2248delGATACTGC, NM_000492.3:c.2290C>T, NM_000492.3:c.2353C>T, NM_000492.3:c.2374C>T, NM_000492.3:c.2423_2424dupAT, NM_000492.3:c.2453delT, NM_000492.3:c.2463_2464delTG, NM_000492.3:c.2464G>T, NM_000492.3:c.2490+1G>A, NM_000492.3:c.2491G>T, NM_000492.3:c.2537G>A, NM_000492.3:c.2538G>A, NM_000492.3:c.2547C>A, NM_000492.3:c.2551C>T, NM_000492.3:c.2583delT, NM_000492.3:c.2589_2599delAATTTGGTGCT, NM_000492.3:c.2601dupA, NM_000492.3:c.2645G>A, NM_000492.3:c.2657+5G>A, NM_000492.3:c.2658-1G>C, NM_000492.3:c.2668C>T, NM_000492.3:c.2735C>A, NM_000492.3:c.2737_2738insG, NM_000492.3:c.2739T>A, NM_000492.3:c.2763_2764dupAG, NM_000492.3:c.2780T>C, NM_000492.3:c.2810dupT, NM_000492.3:c.2825delT, NM_000492.3:c.2834C>T, NM_000492.3:c.2869_2870insG, NM_000492.3:c.2875delG, NM_000492.3:c.2896delA, NM_000492.3:c.2908G>C, NM_000492.3:c.2930C>T, NM_000492.3:c.2936A>T, NM_000492.3:c.2988G>A, NM_000492.3:c.2988+1G>A, NM_000492.3:c.2989-2A>G, NM_000492.3:c.2989-1G>A, NM_000492.3:c.3002_3003delTG, NM_000492.3:c.3011_3019delCTATAGCAG, NM_000492.3:c.3017C>A, NM_000492.3:c.3039dupC, NM_000492.3:c.3039delC, NM_000492.3:c.3067_3072delATAGTG, NM_000492.3:c.3080T>C, NM_000492.3:c.3107C>A, NM_000492.3:c.3124C>T, NM_000492.3:c.3139_3139+1delGG, NM_000492.3:c.3140-26A>G, NM_000492.3:c.3160C>G, NM_000492.3:c.3181G>C, NM_000492.3:c.3194T>C, NM_000492.3:c.3196C>T, NM_000492.3:c.3197G>A, NM_000492.3:c.3205G>A, NM_000492.3:c.3209G>A, NM_000492.3:c.3230T>C, NM_000492.3:c.3266G>A, NM_000492.3:c.3276C>A, NM_000492.3:c.3276C>G, NM_000492.3:c.3292T>C, NM_000492.3:c.3293G>A, NM_000492.3:c.3294G>A, NM_000492.3:c.3294G>C, NM_000492.3:c.3294G>T, NM_000492.3:c.3302T>A, NM_000492.3:c.3302T>G, NM_000492.3:c.3304A>T, NM_000492.3:c.3310G>T, NM_000492.3:c.3353C>T, NM_000492.3:c.3368-2A>G, NM_000492.3:c.3435G>A, NM_000492.3:c.3454G>C, NM_000492.3:c.3468G>A, NM_000492.3:c.3468+5G>A, NM_000492.3:c.3472C>T, NM_000492.3:c.3484C>T, NM_000492.3:c.3528delC, NM_000492.3:c.3532_3535dupTCAA, NM_000492.3:c.3536_3539delCCAA, NM_000492.3:c.3587C>G, NM_000492.3:c.3605delA, NM_000492.3:c.3611G>A, NM_000492.3:c.3612G>A, NM_000492.3:c.3659delC, NM_000492.3:c.3691delT, NM_000492.3:c.3700A>G, NM_000492.3:c.3717+4A>G, NM_000492.3:c.3717+5G>A, NM_000492.3:c.3717+40A>G, NM_000492.3:c.3718-2477C>T, NM_000492.3:c.3718-3T>G, NM_000492.3:c.3718-1G>A, NM_000492.3:c.3719T>G, NM_000492.3:c.3731G>A, NM_000492.3:c.3744delA, NM_000492.3:c.3747delG, NM_000492.3:c.3752G>A, NM_000492.3:c.3761T>G, NM_000492.3:c.3763T>C, NM_000492.3:c.3764C>A, NM_000492.3:c.3773dupT, NM_000492.3:c.3846G>A, NM_000492.3:c.3848G>T, NM_000492.3:c.3873+1G>A, NM_000492.3:c.3873+2T>C, NM_000492.3:c.3883_3886delATTT, NM_000492.3:c.3883delA, NM_000492.3:c.3889dupT, NM_000492.3:c.3891dupT, NM_000492.3:c.3908delA, NM_000492.3:c.3909C>G, NM_000492.3:c.3937C>T, NM_000492.3:c.3971T>C, NM_000492.3:c.4036_4042delCTAAGCC, NM_000492.3:c.4046G>A, NM_000492.3:c.4077_4080delTGTTinsAA, NM_000492.3:c.4086dupT, NM_000492.3:c.4111G>T, NM_000492.3:c.4127_4131delTGGAT, NM_000492.3:c.4144C>T, NM_000492.3:c.4147dupA, NM_000492.3:c.4197_4198delCT, NM_000492.3:c.4231C>T, NM_000492.3:c.4234C>T, NM_000492.3:c.4242+1G>A, NM_000492.3:c.4242+1G>T, NM_000492.3:c.4251delA, NM_000492.3:c.4300_4301dupAG, NM_000492.3:c.4426C>T	Cystic fibrosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFTR gene located on chromosomal region 7q31.2. The age of onset of severe form is neonatal or infantile but there are also variants associated with moderate clinical or late onset. This disease is characterized by the production of sweat with a high salt content, mucus secretions with an abnormal viscosity, chronic bronchitis, pancreatic insufficiency, adolescent diabetes and, more rarely, stercoral obstruction and cirrhosis. Male sterility is a constant feature. Late-onset forms, which are usually only mild or monosymptomatic. The prevalence is 1:10,000-9:10,000.	600,25
CHST6	Macular corneal dystrophy	NM_021615.4	NM_021615.4:c.853delC, NM_021615.4:c.820G>T, NM_021615.4:c.392C>A, NM_021615.4:c.327_328delCT	Macular corneal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CHST6 gene located on chromosomal region 16q22. The age of onset is variable. This disease is characterized by bilateral ill-defined cloudy regions within a hazy stroma, and eventually severe visual impairment. The prevalence is 1:100,000-9:100,000.	600,25
CLCN1	Myotonia congenita, recessive	NM_000083.2	NM_000083.2:c.180+3A>T, NM_000083.2:c.225dupC, NM_000083.2:c.409T>G, NM_000083.2:c.871G>A, NM_000083.2:c.1238T>G, NM_000083.2:c.1453A>G, NM_000083.2:c.2680C>T	Myotonia congenita follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN1 gene located on chromosomal region 7q35. The age of onset is neonatal/infantile. This is a nondystrophic skeletal muscle disorder characterized by muscle stiffness and an inability of the muscle to relax after voluntary contraction. Most patients have symptom onset in the legs, which later progresses to the arms, neck, and facial muscles. Many patients show marked hypertrophy of the lower limb muscles. The prevalence is 1:100,000.	600,25
CLDN19	Rena hypomagnesemia type 5, with ocular involvement	NM_148960.2	NM_148960.2:c.425_437delCCCTGGTGACCCA, NM_148960.2:c.269T>C, NM_148960.2:c.169C>G, NM_148960.2:c.59G>A	Renal hypomagnesemia type 5, with ocular involvement follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN19 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by excessive magnesium and calcium renal wasting, bilateral nephrocalcinosis, progressive renal failure and severe ocular abnormalities. The prevalence is <1:1,000,000.	600,25
CLRN1	Usher syndrome, type 3A	NM_001195794.1	NM_001195794.1:c.669_670insT, NM_001195794.1:c.630dupT, NM_001195794.1:c.189C>A, NM_001195794.1:c.144T>G, NM_001195794.1:c.118T>G, NM_001195794.1:c.92C>T	Usher syndrome type 3A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1 gene located on chromosomal region 3q25.1. The age of onset is neonatal/infantile. This disease is characterized by the association of sensorineural deafness with retinitis pigmentosa and progressive vision loss. The prevalence is 1:1.000.000- 9/1.000.000.	600,25
CNGA1	Retinitis pigmentosa type 49	NM_001142564.1	NM_001142564.1:c.2179delA, NM_001142564.1:c.2134C>T, NM_001142564.1:c.1747C>T, NM_001142564.1:c.1166C>T, NM_001142564.1:c.1001G>A, NM_001142564.1:c.656+2T>C, NM_001142564.1:c.445G>T, NM_001142564.1:c.304dupA	Retinitis pigmentosa 49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGA1 gene located on chromosomal region 4p12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	600,25
CNGB1	Retinitis pigmentosa type 45	NM_001297.4	NM_001297.4:c.3462+1G>A, NM_001297.4:c.3425delT, NM_001297.4:c.3150delG, NM_001297.4:c.2762_2765delACGA, NM_001297.4:c.2653delG, NM_001297.4:c.2492+2T>G, NM_001297.4:c.1958-1G>A, NM_001297.4:c.1122-2A>T, NM_001297.4:c.952C>T, NM_001297.4:c.413-1G>A, NM_001297.4:c.218-2A>G	Retinitis pigmentosa 45 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB1 gene located on chromosomal region 16q13. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000 to 5:10,000.	600,25
CNGB3	Achromatopsia type 3	NM_019098.4	NM_019098.4:c.2048_2049delCA, NM_019098.4:c.2011G>T, NM_019098.4:c.1148delC, NM_019098.4:c.1063C>T, NM_019098.4:c.893_897delCAAAA, NM_019098.4:c.887_896delCTTCTACAAA, NM_019098.4:c.886_890delACTTC, NM_019098.4:c.819_826delCAGACTCC, NM_019098.4:c.446_447insT	Achromatopsia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is neonatal/Infantile. This disease is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, and reduced or complete loss of color discrimination. Most individuals have complete form, with total lack of function in all three types of cones. Rarely, individuals have incomplete form, with similar, but generally less severe symptoms. The prevalence is 1/30,000-1/50,000.	600,25
COL17A1	Epidermolysis bullosa, junctional, non-Herlitz type	NM_000494.3	NM_000494.3:c.4319dupC, NM_000494.3:c.4003_4004delGG, NM_000494.3:c.3908G>A, NM_000494.3:c.3897_3900delATCT, NM_000494.3:c.3827dupC, NM_000494.3:c.3795delC, NM_000494.3:c.3676C>T, NM_000494.3:c.3277+1G>A, NM_000494.3:c.3067C>T, NM_000494.3:c.3043C>T, NM_000494.3:c.2965delA, NM_000494.3:c.2944_2947+1delGAAGG, NM_000494.3:c.2564T>G, NM_000494.3:c.2551+1G>T, NM_000494.3:c.2430_2431insCCGA, NM_000494.3:c.2383C>T, NM_000494.3:c.2336-1G>T, NM_000494.3:c.2336-2A>G, NM_000494.3:c.2228-3_2235delCAGGTCCTGCTinsTTG, NM_000494.3:c.1898G>A, NM_000494.3:c.1706delC, NM_000494.3:c.520_521delAG, NM_000494.3:c.433C>T	Epidermolysis bullosa, junctional, non-Herlitz type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL17A1 gene located on chromosomal region 10q24.3. The age of onset is neonatal/infantile. This disease is characterized by a generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.	600,25
COL18A1	Knobloch syndrome, type 1	NM_130444.2	NM_130444.2:c.1700_1701insGACGTGAAAGAGGGG, NM_130444.2:c.2240_2241insGACGTGAAAGAGGGG, NM_130444.2:c.3294_3295delAG, NM_130444.2:c.3502C>T, NM_130444.2:c.4072_4084delCCCCCAGGCCCAC, NM_130444.2:c.4214_4223delCAGGGCCCCC, NM_130444.2:c.4222_4223delCC, NM_130444.2:c.4323_4323+1delGG, NM_130444.2:c.4759_4760delCT, NM_130444.2:c.5168dupG	Knobloch syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL18A1 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by vitreoretinal and macular degeneration, and occipital encephalocele.ﾠThe prevalence is <1:1,000,000.	600,25
COL4A3	Alport syndrome, autosomal recessive	NM_000091.4	NM_000091.4:c.345delG, NM_000091.4:c.898G>A, NM_000091.4:c.2083G>A, NM_000091.4:c.2111delC, NM_000091.4:c.2954G>T, NM_000091.4:c.4420_4424delCTTTT, NM_000091.4:c.4441C>T, NM_000091.4:c.4571C>G	Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.	600,25
COL4A4	Alport syndrome, autosomal recessive	NM_000092.4	NM_000092.4:c.4923C>A, NM_000092.4:c.4129C>T, NM_000092.4:c.3713C>A, NM_000092.4:c.3601G>A, NM_000092.4:c.2312delG, NM_000092.4:c.71+1G>A	Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.	600,25
COL7A1	Epidermolysis bullosa dystrophica, AR	NM_000094.3	NM_000094.3:c.8524_8527+10delGAAGGTGAGGACAG, NM_000094.3:c.8479C>T, NM_000094.3:c.8440C>T, NM_000094.3:c.8393T>A, NM_000094.3:c.8245G>A, NM_000094.3:c.7957G>A, NM_000094.3:c.7930-1G>C, NM_000094.3:c.7912G>T, NM_000094.3:c.7411C>T, NM_000094.3:c.7345-1G>A, NM_000094.3:c.6946G>A, NM_000094.3:c.6859G>A, NM_000094.3:c.6752G>A, NM_000094.3:c.6670G>T, NM_000094.3:c.6573+1G>T, NM_000094.3:c.6527dupC, NM_000094.3:c.6205C>T, NM_000094.3:c.6187C>T, NM_000094.3:c.6091G>A, NM_000094.3:c.5821-1G>A, NM_000094.3:c.5532+1G>A, NM_000094.3:c.5287C>T, NM_000094.3:c.5096C>T, NM_000094.3:c.5052+1G>A, NM_000094.3:c.4888C>T, NM_000094.3:c.4783G>C, NM_000094.3:c.4373C>T, NM_000094.3:c.4119+1G>T, NM_000094.3:c.4039G>C, NM_000094.3:c.3831+1G>T, NM_000094.3:c.2471dupG, NM_000094.3:c.933C>A, NM_000094.3:c.887delG, NM_000094.3:c.706C>T, NM_000094.3:c.425A>G, NM_000094.3:c.336C>G	Epidermolysis bullosa dystrophica follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL7A1 gene located on chromosomal region 3p21.1. The age of onset is neonatal/infantile. This disease is characterized by generalized cutaneous and mucosal blistering and scarring associated with severe deformities and major extracutaneous involvement. The prevalence is <1:1,000,000.	600,25
COQ2	Primary coenzyme Q10 deficiency, type 1	NM_015697.7	NM_015697.7:c.1197delT, NM_015697.7:c.890A>G, NM_015697.7:c.723delT, NM_015697.7:c.683A>G, NM_015697.7:c.590G>A	Primary coenzyme Q10 deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ2 gene located on chromosomal region 4q21.23. The age of onset is neonatal/infantile. The phenotypes include an encephalomyopathic form with seizures and ataxia; a multisystem infantile form with encephalopathy, cardiomyopathy and renal failure; a predominantly cerebellar form with ataxia and cerebellar atrophy; Leigh syndrome with growth retardation; and an isolated myopathic form.	600,25
COQ8A	Primary coenzyme Q10 deficiency, type 4	NM_020247.4	NM_020247.4:c.589-3C>G, NM_020247.4:c.637C>T, NM_020247.4:c.815G>A, NM_020247.4:c.815G>T, NM_020247.4:c.911C>T, NM_020247.4:c.1541A>G, NM_020247.4:c.1645G>A, NM_020247.4:c.1651G>A, NM_020247.4:c.1750_1752delACC, NM_020247.4:c.1813dupG	Primary coenzyme Q10 deficiency type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ8A gene located on chromosomal region 1q42.13. The age of onset is infantile. This disease is characterized by progressive ataxia, cerebellar atrophy, and often exercise intolerance with elevated lactate levels and mild intellectual deficit.	600,25
CPT2	Carnitine palmitoyltransferase type 2 deficiency, lethal neonatal	NM_000098.2	NM_000098.2:c.149C>A, NM_000098.2:c.338C>T, NM_000098.2:c.359A>G, NM_000098.2:c.370C>T, NM_000098.2:c.452G>A, NM_000098.2:c.464dupT, NM_000098.2:c.520G>A, NM_000098.2:c.638A>G, NM_000098.2:c.680C>T, NM_000098.2:c.725_726delAC, NM_000098.2:c.886C>T, NM_000098.2:c.1148T>A, NM_000098.2:c.1237C>T, NM_000098.2:c.1239_1240delGA, NM_000098.2:c.1369A>T, NM_000098.2:c.1437C>G, NM_000098.2:c.1784delC, NM_000098.2:c.1883A>C, NM_000098.2:c.1891C>T	Carnitine palmitoyltransferase deficiency, type 2, lethal neonatal form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT2 gene located on chromosomal region 1p32. The age of onset is neonatal/infantile. This disease is characterized by a severe fasting intolerance leading to metabolic derangements of hypoketotic hypoglycemia, resulting in coma and seizures, and hepatic encephalopathy leading to liver failure.ﾠThe prevalence is <1:1,000,000.	600,25
CRB1	Retinitis pigmentosa type 12, AR; Leber congenital amaurosis type 8	NM_201253.2	NM_201253.2:c.498_506delAATTGATGG, NM_201253.2:c.613_619delATAGGAA, NM_201253.2:c.2290C>T, NM_201253.2:c.2401A>T, NM_201253.2:c.2416G>T, NM_201253.2:c.2688T>A, NM_201253.2:c.2983G>T, NM_201253.2:c.3055_3059dupTATAT, NM_201253.2:c.3122T>C, NM_201253.2:c.3299T>C, NM_201253.2:c.3299T>G, NM_201253.2:c.3383delT, NM_201253.2:c.3419T>A, NM_201253.2:c.3997G>T	Retinitis pigmentosa type 12 and leber congenital amaurosis type 8 follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. Retinitis pigmentosa type 12 is characterized by night blindness, peripheral visual field impairment and over time loss of central visionm, and its prevalence is 1-5:10,000. Leber congenital amaurosis, with a neonatal/infantile age of onset, comprises a group of early-onset childhood retinal dystrophies characterized by vision loss, nystagmus, and severe retinal dysfunction. Patients usually present at birth with profound vision loss and pendular nystagmus. Other clinical findings of this disease may include high hypermetropia, photodysphoria, oculodigital sign, keratoconus, cataracts, and a variable appearance to the fundus.	600,25
CTNS	Cystinosis (atypical/juvenile/ocular) nephropathic	NM_001031681.2	NM_001031681.2:c.283G>T, NM_001031681.2:c.329G>T, NM_001031681.2:c.357_360delCAGC, NM_001031681.2:c.397_398delAT, NM_001031681.2:c.414G>A, NM_001031681.2:c.416C>T, NM_001031681.2:c.506G>A, NM_001031681.2:c.589G>A, NM_001031681.2:c.646dupA, NM_001031681.2:c.853-3C>G, NM_001031681.2:c.1015G>A	Nephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. This disease is characterized by hypothyroidism, insulin-dependent diabetes, hepatosplenomegaly with portal hypertension, and muscle, cerebral and ocular involvement, caused by cystine deposits in various organs. The prevalence is 1:100,000-1:200,000.	600,25
CTSK	Pycnodysostosis	NM_000396.3	NM_000396.3:c.926T>C, NM_000396.3:c.721C>T, NM_000396.3:c.436G>C, NM_000396.3:c.236G>A, NM_000396.3:c.154A>T	Pycnodysostosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSK gene located on chromosomal region 1q21. The age of onset is variable. This disease is characterized by osteosclerosis, short stature or dwarfism, acroosteolysis of the distal phalanges, fragile bones associated with spontaneous fractures and dysplasia of the clavicles. The prevalence is 1/1,000,000 to 9/1,000,000.	600,25
CYP4V2	Bietti crystalline corneoretinal dystrophy	NM_207352.3	NM_207352.3:c.130T>A, NM_207352.3:c.327+1G>A, NM_207352.3:c.332T>C, NM_207352.3:c.1523G>A	Bietti crystalline corneoretinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP4V2 gene located on chromosomal region 4q35.2. The age of onset is adult. This disease is characterized by nightblindness, decreased vision, paracentral scotoma, and, in the end stages of the disease, legal blindness.	600,25
CYP7B1	Spastic paraplegia type 5A, autosomal recessive	NM_004820.4	NM_004820.4:c.1460dupT, NM_004820.4:c.1456C>T, NM_004820.4:c.1162C>T, NM_004820.4:c.889A>G, NM_004820.4:c.825T>A, NM_004820.4:c.321_324delACAA, NM_004820.4:c.187C>T	Spastic paraplegia type 5A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. The prevalence is below 1,000,000.	600,25
D2HGDH	D-2-hydroxyglutaric aciduria	NM_152783.4	NM_152783.4:c.440T>G, NM_152783.4:c.1123G>T, NM_152783.4:c.1315A>G, NM_152783.4:c.1331T>C, NM_152783.4:c.1333_1334delAC	D-2-Hydroxyglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the D2HGDH gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by extremely variable clinical manifestations, with severe cases characterized by neonatal or early infantile-onset epileptic encephalopathy, and marked hypotonia, and cerebral visual failure, developmental delay, seizures, involuntary movements, and cardiomyopathy are also common in these cases. The prevalence is below 1,000,000.	600,25
DBT	Maple syrup urine disease, type 2	NM_001918.3	NM_001918.3:c.1281+1G>A, NM_001918.3:c.939G>C, NM_001918.3:c.901C>T, NM_001918.3:c.871C>T, NM_001918.3:c.827T>G, NM_001918.3:c.772+1G>A, NM_001918.3:c.670G>T, NM_001918.3:c.581C>G, NM_001918.3:c.294C>G, NM_001918.3:c.272_275delCAGT, NM_001918.3:c.126T>G	Maple syrup urine disease, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DBT gene located on chromosomal region 1p21.2. The age of onset in neonatal/infantil. This disease is characterized by a maple syrup odor to the urine, deficient diet, lethargy and focal dystonia, followed by progressive encephalopathy and central respiratory failure if not treated. The prevalence is 1-5/10,000.	600,25
DCLRE1C	Omenn syndrome; Severe combined immunodeficiency, Athabascan type	NM_001033855.2	NM_001033855.2:c.1639G>T, NM_001033855.2:c.1558dupA, NM_001033855.2:c.780+1delG, NM_001033855.2:c.597C>A, NM_001033855.2:c.2T>C	Omenn syndrome and Athabascan type severe combined immunodeficiency follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the DCLRE1C gene located on chromosomal region 10p13. Omenn syndrome has an early age of onset and it is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. The age of onset of Athabascan type severe combined immunodeficiency is neonatal/infantile and it is characterized by severe and recurrent infections, diarrhea, failure to thrive, and cell sensitivity to ionizing radiation. The prevalence is 1-9/1,000,000.	600,25
DGUOK	DGUOK-related mitochondrial DNA depletion syndrome	NM_080916.2	NM_080916.2:c.137A>G, NM_080916.2:c.313C>T, NM_080916.2:c.425G>A, NM_080916.2:c.494A>T, NM_080916.2:c.707+2T>G, NM_080916.2:c.763G>T	Mitochondrial DNA depletion syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DGUOK gene located on chromosomal region 2p13. The age of onset is neonatal/infantile. This disease is characterized by progressive liver failure, hypoglycemia and neurologic abnormalities including hypotonia, encephalopathy and peripheral neuropathy	600,25
DHCR7	Smith-Lemli-Opitz syndrome	NM_001163817.1	NM_001163817.1:c.1342G>A, NM_001163817.1:c.1337G>A, NM_001163817.1:c.1228G>A, NM_001163817.1:c.1210C>T, NM_001163817.1:c.1055G>A, NM_001163817.1:c.1054C>T, NM_001163817.1:c.976G>T, NM_001163817.1:c.964-1G>C, NM_001163817.1:c.907G>A, NM_001163817.1:c.866C>T, NM_001163817.1:c.841G>A, NM_001163817.1:c.839A>G, NM_001163817.1:c.832-1G>C, NM_001163817.1:c.744G>T, NM_001163817.1:c.730G>A, NM_001163817.1:c.725G>A, NM_001163817.1:c.724C>T, NM_001163817.1:c.506C>T, NM_001163817.1:c.461C>G, NM_001163817.1:c.453G>A, NM_001163817.1:c.452G>A, NM_001163817.1:c.356A>T, NM_001163817.1:c.292C>T, NM_001163817.1:c.278C>T, NM_001163817.1:c.151C>T, NM_001163817.1:c.1A>G	Smith-Lemli-Opitz syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHCR7 gene located on chromosomal region 11q13.4. The age of onset is neonatal/infantile. This disease is characterized by multiple congenital anomalies, intellectual deficit, and behavioral problems.ﾠThe prevalence is 1/20,000 to 1/40,000 newborn.	600,25
DPYD	Dihydropyrimidine dehydrogenase deficiency	NM_000110.3	NM_000110.3:c.1905+1G>A, NM_000110.3:c.1679T>G, NM_000110.3:c.1109_1110delTA, NM_000110.3:c.299_302delTCAT	Dihydropyrimidine dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPYD gene located on chromosomal region 1p22. This disease shows large phenotypic variability, ranging from no symptoms to a convulsive disorder with motor and mental retardation in homozygous patients. In people with severe dihydropyrimidine dehydrogenase deficiency, the disorder becomes apparent in infancy. These affected individuals have recurrent seizures (epilepsy), intellectual disability, a small head size (microcephaly), increased muscle tone (hypertonia), delayed development of motor skills such as walking, and autistic behaviors that affect communication and social interaction. The prevalence is unknow. In addition, homozygous and heterozygous mutation carriers can develop severe toxicity after the administration of the antineoplastic drug 5-fluorouracil (5FU).	600,25
DSP	Cardiomyopathy, dilated, with woolly hair and keratoderma; Epidermolysis bullosa, lethal acantholytic	NM_004415.3	NM_004415.3:c.3098delA, NM_004415.3:c.5800C>T, NM_004415.3:c.6370_6371delCT, NM_004415.3:c.7000C>T, NM_004415.3:c.7180_7181delAG, NM_004415.3:c.8188C>T	Dilated cardiomyopathy with woolly hair and keratoderma, known as Carvajal syndrome, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterized by woolly hair is present at birth and the palmoplantar keratoderma appears during the first year of life. The cardiac anomaly presents during childhood and is marked by dilation of the left ventricle accompanied by alterations in muscle contractility. The dilated cardiomyopathy may lead to life-threatening congestive heart failure and death. The prevalence is below 1,000,000. Furthermore, mutations in the DSP gene have been identified in people with an autosomal recessive disorder called lethal acantholytic epidermolysis bullosa. Features of this condition include very fragile skin that blisters and detaches easily, a complete absence of hair (alopecia), abnormal or missing fingernails, teeth that are present from birth (neonatal teeth), and abnormalities of the heart muscle (cardiomyopathy). The skin abnormalities lead to a severe loss of fluids and death in early infancy.	600,25
DYSF	Miyoshi muscular dystrophy, type 1; Muscular dystrophy, limb-girdle, autosomal recessive, type 2	NM_001130978.1	NM_001130978.1:c.1481-1G>A	Miyoshi muscular dystrophy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is young adulthood. This disease is characterized by weakness and atrophy in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000. Mutations in the DYSF gene can also cause muscular dystrophy, limb-girdle, autosomal recessive, type 2. This disease is characterized by an onset in late adolescence or early adulthood of slowly progressive, proximal weakness and atrophy of shoulder and pelvic girdle muscles. Cardiac and respiratory muscles are not involved. Hypertrophy of the calf muscles and highly elevated serum creatine kinase levels are frequently observed.	600,25
DYSF	Miyoshi muscular dystrophy, type 1; Muscular dystrophy, limb-girdle, autosomal recessive, type 2	NM_001130987.1	NM_001130987.1:c.203_204delTGinsAT, NM_001130987.1:c.396_397delCC, NM_001130987.1:c.706C>T, NM_001130987.1:c.759+1G>C, NM_001130987.1:c.797G>A, NM_001130987.1:c.853C>T, NM_001130987.1:c.991G>A, NM_001130987.1:c.991G>T, NM_001130987.1:c.1033+1G>A, NM_001130987.1:c.1149+1G>A, NM_001130987.1:c.1372G>A, NM_001130987.1:c.1380+2T>C, NM_001130987.1:c.1464C>A, NM_001130987.1:c.1488dupA, NM_001130987.1:c.1494-2A>G, NM_001130987.1:c.1494-1G>A, NM_001130987.1:c.1609G>A, NM_001130987.1:c.1674delA, NM_001130987.1:c.1692+2T>A, NM_001130987.1:c.1717C>T, NM_001130987.1:c.1867C>T, NM_001130987.1:c.1888C>T, NM_001130987.1:c.1927G>T, NM_001130987.1:c.2924_2928delAGACC, NM_001130987.1:c.2923C>T, NM_001130987.1:c.3051G>T, NM_001130987.1:c.3095A>G, NM_001130987.1:c.3166C>T, NM_001130987.1:c.3229-2A>T, NM_001130987.1:c.3498_3499delTGinsAA, NM_001130987.1:c.3531C>A, NM_001130987.1:c.3532C>T, NM_001130987.1:c.3695delC, NM_001130987.1:c.3762delA, NM_001130987.1:c.3859G>T, NM_001130987.1:c.3957+1delG, NM_001130987.1:c.4011delC, NM_001130987.1:c.4144C>T, NM_001130987.1:c.4162_4163delGT, NM_001130987.1:c.4307G>A, NM_001130987.1:c.4873C>T, NM_001130987.1:c.4989_4993delGCCCGinsCCCC, NM_001130987.1:c.5194C>T, NM_001130987.1:c.5318A>G, NM_001130987.1:c.5383C>T, NM_001130987.1:c.5458-2A>C, NM_001130987.1:c.5546G>A, NM_001130987.1:c.5546+1G>T, NM_001130987.1:c.5614G>T, NM_001130987.1:c.5626G>A, NM_001130987.1:c.5642+1G>A, NM_001130987.1:c.5711delG, NM_001130987.1:c.5761C>T, NM_001130987.1:c.5815_5816delAG, NM_001130987.1:c.5830C>T, NM_001130987.1:c.5953_5956delCAGC, NM_001130987.1:c.6096dupA, NM_001130987.1:c.6109G>T, NM_001130987.1:c.6241C>T	Miyoshi muscular dystrophy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is young adulthood. This disease is characterized by weakness and atrophy in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000. Mutations in the DYSF gene can also cause muscular dystrophy, limb-girdle, autosomal recessive, type 2. This disease is characterized by an onset in late adolescence or early adulthood of slowly progressive, proximal weakness and atrophy of shoulder and pelvic girdle muscles. Cardiac and respiratory muscles are not involved. Hypertrophy of the calf muscles and highly elevated serum creatine kinase levels are frequently observed.	600,25
EDA	Ectodermal dysplasia, type 1, hypohidrotic, X-linked	NM_001399.4	NM_001399.4:c.181T>C, NM_001399.4:c.183C>G, NM_001399.4:c.187G>A, NM_001399.4:c.463C>T, NM_001399.4:c.466C>T, NM_001399.4:c.467G>A, NM_001399.4:c.573_574insT, NM_001399.4:c.671G>C, NM_001399.4:c.826C>T, NM_001399.4:c.1045G>A	Hypohidrotic ectodermal dysplasia, type 1, hypohidrotic, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EDA gene located on chromosomal region Xq12-q13.1. The age of onset is neonatal/infantile. This disease is characterized by malformation of ectodermal structures such as skin, hair, teeth and sweat glands. The prevalence is 1/5,000 to 1/10,000 newborns.	600,25
ERCC2	Trichothiodystrophy, type 1	NM_000400.3	NM_000400.3:c.2230_2233dupCTAG, NM_000400.3:c.2176C>T, NM_000400.3:c.2047C>T, NM_000400.3:c.1972C>T, NM_000400.3:c.1703_1704delTT, NM_000400.3:c.1621A>C, NM_000400.3:c.1454T>C, NM_000400.3:c.1381C>G, NM_000400.3:c.1354C>T, NM_000400.3:c.1308-1G>A, NM_000400.3:c.950-2A>G, NM_000400.3:c.949+1G>A, NM_000400.3:c.719-1G>A, NM_000400.3:c.567G>A, NM_000400.3:c.183+2T>A	Trichothiodystrophy (TTD), type 1 is a heterogeneous group of disorders that follows an autosomal recessive pattern of inheritance. It is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.32. The age of onset is neonatal or infantile. This disease, with variable clinical expression, is characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. About half of the patients with TTD exhibit marked photosensitivity.	600,25
ERCC5	Cerebrooculofacioskeletal syndrome, type 3	NM_000123.3	NM_000123.3:c.88+2T>C, NM_000123.3:c.215C>A, NM_000123.3:c.381-2A>G, NM_000123.3:c.406C>T, NM_000123.3:c.464dupA, NM_000123.3:c.526C>T, NM_000123.3:c.787C>T, NM_000123.3:c.2144dupA, NM_000123.3:c.2375C>T, NM_000123.3:c.2573T>C, NM_000123.3:c.2751delA	Cerebrooculofacioskeletal syndrome type 3, also known as COFS syndrome, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC5 gene located on chromosomal region 13q33.1. COFS syndrome is characterized by prenatal onset of arthrogryposis, microcephaly and growth failure. Postnatal features include severe developmental delay, congenital cataracts (in some), and marked UV sensitivity of the skin. Survival beyond 6 years of age is rare. The prevalence is below 1/1,000,000.	600,25
ERCC6	Cockayne syndrome, type B; Cerebrooculofacioskeletal syndrome, type 1	NM_000124.3	NM_000124.3:c.3862C>T, NM_000124.3:c.3591_3592dupGA, NM_000124.3:c.2587C>T, NM_000124.3:c.2203C>T, NM_000124.3:c.2047C>T, NM_000124.3:c.1550G>A, NM_000124.3:c.1357C>T, NM_000124.3:c.422+1G>A, NM_000124.3:c.207dupG, NM_000124.3:c.48_49delCT	Cockayne syndrome (CS), type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterized by short stature, a characteristic facial appearance, premature aging, photosensitivity, progressive neurological dysfunction, and intellectual deficit. Mutations in the ERRC6 gene have been also found in patients with COFS syndrome type 1, an extreme prenatal form of the CS clinical spectrum. This autosomal recessive progressive neurodegenerative disorder is characterized by microcephaly, congenital cataracts, severe mental retardation, facial dysmorphism, and arthrogryposis.	600,25
EYS	Retinitis pigmentosa, type 25	NM_001292009.1	NM_001292009.1:c.9468T>A, NM_001292009.1:c.9362_9365delCTCA, NM_001292009.1:c.9099delT, NM_001292009.1:c.8711_8718delCATGCAGA, NM_001292009.1:c.8692_8695dupACAG, NM_001292009.1:c.8632G>T, NM_001292009.1:c.8471dupA, NM_001292009.1:c.7822C>T, NM_001292009.1:c.7095T>G, NM_001292009.1:c.6170delA, NM_001292009.1:c.6102dupT, NM_001292009.1:c.5928-2A>G, NM_001292009.1:c.5857G>T, NM_001292009.1:c.5757dupT, NM_001292009.1:c.4462_4469dupAGCCCCTC, NM_001292009.1:c.4350_4356delTATAGCT, NM_001292009.1:c.4120C>T, NM_001292009.1:c.4045C>T, NM_001292009.1:c.2826_2827delAT, NM_001292009.1:c.1211dupA, NM_001292009.1:c.571dupA, NM_001292009.1:c.490C>T, NM_001292009.1:c.232delT, NM_001292009.1:c.103C>T	Retinitis pigmentosa, type 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EYS gene located on chromosomal region 6q12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000.	600,25
F11	Factor XI deficiency, autosomal recessive	NM_000128.3	NM_000128.3:c.166T>C, NM_000128.3:c.403G>T, NM_000128.3:c.438C>A, NM_000128.3:c.595+3A>G, NM_000128.3:c.901T>C, NM_000128.3:c.1211C>A, NM_000128.3:c.1613C>T, NM_000128.3:c.1693G>A	Factor XI deficiency, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F11 gene located on chromosomal region 4q35. The age of onset is variable. This disease is characterized by reduced levels and activity of factor XI resulting in moderate bleeding symptoms, usually occurring after trauma or surgery. The prevalence is 1/1,000,000 to 9/1,000,000.	600,25
F9	Hemophilia B	NM_000133.3	NM_000133.3:c.82T>C, NM_000133.3:c.1031T>C, NM_000133.3:c.1136G>A, NM_000133.3:c.1150C>T	Hemophilia B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F9 gene located on chromosomal region Xq27.1-q27.2. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor IX deficiency. The prevalence is 1/100,000 to 9/100,000.	600,25
FAH	Tyrosinemia, type 1	NM_000137.2	NM_000137.2:c.47A>T, NM_000137.2:c.192G>T, NM_000137.2:c.401C>A, NM_000137.2:c.456G>A, NM_000137.2:c.554-1G>T, NM_000137.2:c.707-1G>A, NM_000137.2:c.782C>T, NM_000137.2:c.786G>A, NM_000137.2:c.837+1G>A, NM_000137.2:c.939delC, NM_000137.2:c.982C>T, NM_000137.2:c.1009G>A, NM_000137.2:c.1027G>T, NM_000137.2:c.1062+5G>A, NM_000137.2:c.1069G>T, NM_000137.2:c.1090G>T, NM_000137.2:c.1141A>G	Tyrosinemia, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAH gene located on chromosomal region 15q25.1. The age of onset is variable. This disease is characterized by progressive liver disease, renal tubular dysfunction, porphyria-like crises and a dramatic improvement in prognosis following treatment with nitisinone. The birth incidence is 1/100,000, notably in Qu�bec, Canada, and the prevalence is 1/100,000 to 1/120,000 newborns.	600,25
FANCA	Fanconi anemia, complementation group A	NM_000135.2	NM_000135.2:c.4130C>G, NM_000135.2:c.3788_3790delTCT, NM_000135.2:c.3763G>T, NM_000135.2:c.3558dupG, NM_000135.2:c.2303T>C, NM_000135.2:c.1115_1118delTTGG, NM_000135.2:c.233_236delTTGA, NM_000135.2:c.131dupA	Fanconi anemia, complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCA gene located on chromosomal region 16q24.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	600,25
FANCC	Fanconi anemia, complementation group C	NM_000136.2	NM_000136.2:c.1642C>T, NM_000136.2:c.1487T>G, NM_000136.2:c.1103_1104delTG, NM_000136.2:c.1015delA, NM_000136.2:c.996+1G>T, NM_000136.2:c.67delG, NM_000136.2:c.37C>T	Fanconi anemia, complementation group C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCC gene located on chromosomal region 9q22.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	600,25
FANCG	Fanconi anemia, complementation group G	NM_004629.1	NM_004629.1:c.1852_1853delAA, NM_004629.1:c.1795_1804delTGGATCCGTC, NM_004629.1:c.1480+1G>C, NM_004629.1:c.1077-2A>G, NM_004629.1:c.907_908dupCT, NM_004629.1:c.637_643delTACCGCC, NM_004629.1:c.510+1G>A, NM_004629.1:c.313G>T	Fanconi anemia, complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCG gene located on chromosomal region 9p13. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	600,25
FGB	Congenital afibrinogenemia	NM_005141.4	NM_005141.4:c.1148T>G, NM_005141.4:c.1289G>A	Congenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGB gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000.	600,25
FIG4	Charcot-Marie-Tooth disease, type 4J; Yunis-Varon syndrome	NM_014845.5	NM_014845.5:c.122T>C, NM_014845.5:c.311G>A, NM_014845.5:c.501C>G, NM_014845.5:c.547C>T, NM_014845.5:c.592C>T, NM_014845.5:c.737G>A, NM_014845.5:c.831_838delTAAATTTG, NM_014845.5:c.2299dupG	Charcot-Marie-Tooth disease, type 4J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by rapidly progressive, asymmetric motor neuron degeneration with slow nerve conduction velocities, weakness and paralysis, without sensory loss. The prevalence is 4/100,000 to 8/100,000. Mutations in the FIG4 gene have been also found in patient with Yunis-Varon syndrome. This disease is a severe autosomal recessive disorder characterized by skeletal defects, including cleidocranial dysplasia and digital anomalies, and severe neurologic involvement with neuronal loss. Enlarged cytoplasmic vacuoles are found in neurons, muscle, and cartilage. The disorder is usually lethal in infancy.	600,25
FKRP	Muscular dystrophy-dystroglycanopathy, type 5A, 5B and 5C	NM_001039885.2	NM_001039885.2:c.160C>T, NM_001039885.2:c.1154C>A, NM_001039885.2:c.1343C>T, NM_001039885.2:c.1387A>G	Muscular dystrophy-dystroglycanopathy type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is neonatal or early infancy. There are three subtypes of dystroglycanopathies related to FKRP gene: subtype 5A, 5B and 5C. Subtype 5A is the most severe phenotype and is associated with congenital brain and eye anomalies, cobblestone lissencephaly, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Subtype 5B represents an intermediate phenotype with or without congenital mental retardation, white matter changes and structural brain abnormalities. Finally, subtype 5C is the less severe phenotype characterized by limb-girdle muscular dystrophy, variable age at onset, normal cognition, and no structural brain changes.	600,25
FMR1	Fragile X syndrome	-0	(CGG)n pre-mutated allele	Fragile X syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FMR1 gene located on chromosomal region Xq27.3. The symptoms are variable depending on the range of CGG triplet expansion. In complete mutation the onset is infantile in men and is characterized by intellectual disability, characteristic appearance (large head, long face, prominent forehead and chin, protruding ears) joint laxity and large testes after puberty. In carrier female, the symptoms are milder and include primary ovarian insufficiency. The prevalence is 1/2,500 (full mutation allele) to 1/4,000 (prevalence of symptomatic cases) for both genders.	600,25
FRAS1	Fraser syndrome, type 1	NM_025074.6	NM_025074.6:c.835_838delGTGT, NM_025074.6:c.3799C>T, NM_025074.6:c.5605_5606insT, NM_025074.6:c.6433C>T, NM_025074.6:c.6991_6992insGG, NM_025074.6:c.7813C>T, NM_025074.6:c.11160_11167delGCTGGAGA	Fraser syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the gene FRAS1 located on chromosomal region 4q21.21. The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000.	600,25
G6PC	Glycogen storage disease, type 1A	NM_000151.3	NM_000151.3:c.113A>T, NM_000151.3:c.229T>C, NM_000151.3:c.230+1G>C, NM_000151.3:c.247C>T, NM_000151.3:c.248G>A, NM_000151.3:c.370G>A, NM_000151.3:c.379_380dupTA, NM_000151.3:c.447-1G>A, NM_000151.3:c.497T>G, NM_000151.3:c.508C>T, NM_000151.3:c.562G>C, NM_000151.3:c.883C>T, NM_000151.3:c.1039C>T	Glycogen storage disease, type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000.	600,25
G6PC	Glycogen storage disease, type 1A	NM_001270397.1	NM_001270397.1:c.474G>A	Glycogen storage disease, type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000.	600,25
GALC	Krabbe disease	NM_000153.3	NM_000153.3:c.2056T>C, NM_000153.3:c.1964delC, NM_000153.3:c.1814dupA, NM_000153.3:c.1796T>G, NM_000153.3:c.1723_1724insT, NM_000153.3:c.1700A>C, NM_000153.3:c.1695delT, NM_000153.3:c.1592G>A, NM_000153.3:c.1591C>T, NM_000153.3:c.1586C>T, NM_000153.3:c.1543G>A, NM_000153.3:c.1489+1_1489+2delGT, NM_000153.3:c.1488_1489+2delTGGT, NM_000153.3:c.1488_1489delTG, NM_000153.3:c.1472delA, NM_000153.3:c.1161+2T>G, NM_000153.3:c.1153G>T, NM_000153.3:c.953C>G, NM_000153.3:c.658C>T, NM_000153.3:c.655C>T, NM_000153.3:c.628A>T, NM_000153.3:c.582+1G>A, NM_000153.3:c.453G>A, NM_000153.3:c.430delA, NM_000153.3:c.388G>A, NM_000153.3:c.205C>T	Krabbe disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALC gene located on chromosomal region 14q31.3. There are two forms of the disease: infantile form (2-6 months onset) more severe and adult form less severe. It is a degenerative disorder that affects the nervous system characterized by a muscle stiffness, blindness, deafness, and eventually death. The incidence is 1/100,000-1/250,000 and the prevalence is 1/100,000.	600,25
GALT	Galactosemia	NM_000155.3	NM_000155.3:c.18delC, NM_000155.3:c.41delCinsTT, NM_000155.3:c.71_72insA, NM_000155.3:c.113A>C, NM_000155.3:c.118G>T, NM_000155.3:c.130G>A, NM_000155.3:c.132delG, NM_000155.3:c.152G>A, NM_000155.3:c.158G>A, NM_000155.3:c.199C>T, NM_000155.3:c.203A>C, NM_000155.3:c.220_221delCT, NM_000155.3:c.221T>C, NM_000155.3:c.253-2A>G, NM_000155.3:c.265T>G, NM_000155.3:c.289_291delAAC, NM_000155.3:c.290A>G, NM_000155.3:c.292G>A, NM_000155.3:c.329-2A>C, NM_000155.3:c.367C>T, NM_000155.3:c.386T>C, NM_000155.3:c.400delT, NM_000155.3:c.404C>T, NM_000155.3:c.413C>T, NM_000155.3:c.425T>A, NM_000155.3:c.428C>T, NM_000155.3:c.445dupG, NM_000155.3:c.442C>T, NM_000155.3:c.443G>A, NM_000155.3:c.502_504delGTG, NM_000155.3:c.505C>A, NM_000155.3:c.508-1G>C, NM_000155.3:c.512T>C, NM_000155.3:c.547C>A, NM_000155.3:c.552C>A, NM_000155.3:c.563A>G, NM_000155.3:c.565_578delGTATGGGCCAGCAG, NM_000155.3:c.568T>C, NM_000155.3:c.580T>C, NM_000155.3:c.584T>C, NM_000155.3:c.598delC, NM_000155.3:c.601C>T, NM_000155.3:c.602G>A, NM_000155.3:c.607G>A, NM_000155.3:c.610C>T, NM_000155.3:c.619C>T, NM_000155.3:c.626A>G, NM_000155.3:c.634C>T, NM_000155.3:c.688-2A>C, NM_000155.3:c.692G>A, NM_000155.3:c.719_728delTAGTACTGGT, NM_000155.3:c.772C>T, NM_000155.3:c.775C>T, NM_000155.3:c.790delC, NM_000155.3:c.790_792delCTAinsTAG, NM_000155.3:c.820+13A>G, NM_000155.3:c.844C>G, NM_000155.3:c.855G>T, NM_000155.3:c.904+1G>T, NM_000155.3:c.905-2A>G, NM_000155.3:c.939G>A, NM_000155.3:c.947G>A, NM_000155.3:c.957C>A, NM_000155.3:c.985T>C, NM_000155.3:c.997C>G, NM_000155.3:c.997C>T, NM_000155.3:c.998G>A, NM_000155.3:c.1006A>T, NM_000155.3:c.1030C>A, NM_000155.3:c.1048delA, NM_000155.3:c.1052delC, NM_000155.3:c.1138T>C	Galactosemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALT gene located on chromosomal region 9p13.3. The age of onset is neonatal. This disease is characterized by feeding difficulties, lethargy, and severe liver disease. Long-term complications appear including cognitive impairments, motor deficits, and ovarian dysfunction with reduced fertility in women and diminished bone density. The prevalence is 1/40,000-1/60,000.	600,25
GAN	Giant axonal neuropathy, type 1	NM_022041.3	NM_022041.3:c.413G>A, NM_022041.3:c.505G>A, NM_022041.3:c.601C>T, NM_022041.3:c.1268T>C, NM_022041.3:c.1429C>T, NM_022041.3:c.1447C>T, NM_022041.3:c.1456G>A	Giant axonal neuropathy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAN gene located on chromosomal region 16q23.2. The age of onset is infantile. This disease is characterized by a progressive motor and sensitive peripheral and central nervous system neuropathy. Twenty families have been reported with this disease but the frequency is likely to be under-estimated.	600,25
GBA	Gaucher disease	NM_000157.3	NM_000157.3:c.1604G>A, NM_000157.3:c.1504C>T, NM_000157.3:c.1448T>G, NM_000157.3:c.1448T>C, NM_000157.3:c.1361C>G, NM_000157.3:c.1348T>A, NM_000157.3:c.1343A>T, NM_000157.3:c.1342G>C, NM_000157.3:c.1319C>T, NM_000157.3:c.1309G>T, NM_000157.3:c.1307T>C, NM_000157.3:c.1301G>C, NM_000157.3:c.1297G>T, NM_000157.3:c.1295G>T, NM_000157.3:c.1274dupA, NM_000157.3:c.1246G>A, NM_000157.3:c.1240G>T, NM_000157.3:c.1240G>C, NM_000157.3:c.1228C>G, NM_000157.3:c.1226A>G, NM_000157.3:c.1208G>C, NM_000157.3:c.1192C>T, NM_000157.3:c.1184C>T, NM_000157.3:c.1174C>G, NM_000157.3:c.1171G>C, NM_000157.3:c.1141T>G, NM_000157.3:c.1098dupA, NM_000157.3:c.1090G>A, NM_000157.3:c.1085C>T, NM_000157.3:c.1060G>C, NM_000157.3:c.1053G>T, NM_000157.3:c.1049A>G, NM_000157.3:c.1043C>T, NM_000157.3:c.914delC, NM_000157.3:c.586A>C, NM_000157.3:c.509G>T, NM_000157.3:c.508C>T, NM_000157.3:c.487delG, NM_000157.3:c.481C>T, NM_000157.3:c.476G>A, NM_000157.3:c.475C>T, NM_000157.3:c.431T>G, NM_000157.3:c.407C>A, NM_000157.3:c.354G>C, NM_000157.3:c.259C>T, NM_000157.3:c.254G>A, NM_000157.3:c.160G>T, NM_000157.3:c.115+1G>A, NM_000157.3:c.84dupG	Gaucher disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBA gene located on chromosomal region 1q22. Gaucher disease encompasses a continuum of clinical findings from a perinatal lethal disorder to an asymptomatic type. There are three major clinical types (1, 2, and 3) and two other subtypes (perinatal-lethal and cardiovascular). Type 1 is characterized by the presence of clinical or radiographic evidence of bone disease, hepatosplenomegaly, anemia and thrombocytopenia, lung disease, and the absence of primary central nervous system disease. GD types 2 and 3 are characterized by the presence of primary neurologic disease. Type 2 has an onset before age two years, limited psychomotor development, and a rapidly progressive course with death by age two to four years. Type 3 may have onset before age two years, but often have a more slowly progressive course, with survival into the third or fourth decade. The perinatal-lethal form is associated with ichthyosiform or collodion skin abnormalities or with nonimmune hydrops fetalis. The cardiovascular form is characterized by calcification of the aortic and mitral valves, mild splenomegaly, corneal opacities, and supranuclear ophthalmoplegia. Cardiopulmonary complications have been described with all the clinical subtypes, although varying in frequency and severity. The incidence is 1/60,000 and the prevalence is approximately 1/100,000.	600,25
GBE1	Glycogen storage disease, type 4	NM_000158.3	NM_000158.3:c.2052+1G>A, NM_000158.3:c.1883A>G, NM_000158.3:c.1774G>T, NM_000158.3:c.1604A>G, NM_000158.3:c.1571G>A, NM_000158.3:c.1570C>T, NM_000158.3:c.1543C>T, NM_000158.3:c.986A>C, NM_000158.3:c.771T>A, NM_000158.3:c.466_470delCGTAT	Glycogen storage disease, type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is infantile. This disease is characterized by failure to thrive; hepatomegaly, liver dysfunction, and progressive liver cirrhosis; hypotonia; cardiomyopathy and, finally, death.	600,25
GCDH	Glutaricaciduria, type 1	NM_000159.3	NM_000159.3:c.74C>A, NM_000159.3:c.271+1G>A, NM_000159.3:c.383G>A, NM_000159.3:c.416C>T, NM_000159.3:c.542A>G, NM_000159.3:c.572T>C, NM_000159.3:c.636-1G>A, NM_000159.3:c.680G>C, NM_000159.3:c.743C>T, NM_000159.3:c.751C>T, NM_000159.3:c.764C>T, NM_000159.3:c.769C>T, NM_000159.3:c.877G>A, NM_000159.3:c.883T>C, NM_000159.3:c.914C>T, NM_000159.3:c.1002_1003delGA, NM_000159.3:c.1060G>A, NM_000159.3:c.1093G>A, NM_000159.3:c.1168G>C, NM_000159.3:c.1198G>A, NM_000159.3:c.1199dupT, NM_000159.3:c.1204C>T, NM_000159.3:c.1244-2A>C, NM_000159.3:c.1247C>T, NM_000159.3:c.1262C>T	Glutaricaciduria, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCDH gene located on chromosomal region 19p13.2. The age of onset is infantile or neonatal. This disease is characterized by encephalopathic crises resulting in striatal injury and a severe dystonic dyskinetic movement disorder. The prevalence is 1 in 100,000 births.	600,25
GJB2	Deafness, autosomal recessive, type 1A	NM_004004.5	NM_004004.5:c.617A>G, NM_004004.5:c.551G>C, NM_004004.5:c.550C>T, NM_004004.5:c.516G>A, NM_004004.5:c.465T>A, NM_004004.5:c.439G>A, NM_004004.5:c.427C>T, NM_004004.5:c.416G>A, NM_004004.5:c.402delG, NM_004004.5:c.365A>T, NM_004004.5:c.358_360delGAG, NM_004004.5:c.334_335delAA, NM_004004.5:c.313_326delAAGTTCATCAAGGG, NM_004004.5:c.310_323delAGGAAGTTCATCAA, NM_004004.5:c.299_300delAT, NM_004004.5:c.299A>T, NM_004004.5:c.270dupA, NM_004004.5:c.269dupT, NM_004004.5:c.269T>C, NM_004004.5:c.250G>T, NM_004004.5:c.250G>C, NM_004004.5:c.239A>C, NM_004004.5:c.238C>T, NM_004004.5:c.235delC, NM_004004.5:c.231G>A, NM_004004.5:c.230G>A, NM_004004.5:c.229T>C, NM_004004.5:c.169C>T, NM_004004.5:c.139G>T, NM_004004.5:c.132G>A, NM_004004.5:c.35delG	Autosomal recessive nonsyndromic sensorineural deafness type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.	600,25
GJB6	Deafness, autosomal recessive, type 1B	NM_001110219.2	NM_001110219.2:c.485dupA, NM_001110219.2:c.443delC, NM_001110219.2:c.383_384delTA, NM_001110219.2:c.261dupA, NM_001110219.2:c.169C>T, NM_001110219.2:c.14C>T	Autosomal recessive nonsyndromic sensorineural deafness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB6 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.	600,25
GLB1	GM1-gangliosidosis, type 1	NM_001317040.1	NM_001317040.1:c.1877A>G, NM_001317040.1:c.1790C>T, NM_001317040.1:c.1721dupG, NM_001317040.1:c.1693G>T, NM_001317040.1:c.1600_1610dupGGTGCATATAT, NM_001317040.1:c.1589G>A, NM_001317040.1:c.1514G>A, NM_001317040.1:c.1513C>T, NM_001317040.1:c.1499dupA, NM_001317040.1:c.1469G>A, NM_001317040.1:c.1465G>A, NM_001317040.1:c.1457G>A, NM_001317040.1:c.1318_1319delCT, NM_001317040.1:c.1212+1G>T, NM_001317040.1:c.1195C>T, NM_001317040.1:c.1148C>T, NM_001317040.1:c.1091A>G, NM_001317040.1:c.1045G>A, NM_001317040.1:c.962G>T, NM_001317040.1:c.766C>T, NM_001317040.1:c.746G>A, NM_001317040.1:c.745C>T, NM_001317040.1:c.735dupT, NM_001317040.1:c.601+2T>C, NM_001317040.1:c.586C>T, NM_001317040.1:c.586C>A, NM_001317040.1:c.582_584delTCT, NM_001317040.1:c.420G>A, NM_001317040.1:c.346C>T, NM_001317040.1:c.320G>A, NM_001317040.1:c.319C>T, NM_001317040.1:c.315C>G, NM_001317040.1:c.296T>C, NM_001317040.1:c.289C>T	Gangliosidosis GM1, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. Although the three types differ in severity, their features can overlap significantly. The age of onset in type 1 is infantile, in type 2 is late-infantile or juvenile and adult in type3. This disease is characterized by arrest/regression of neurological development, hypotonia, visceromegaly, macular cherry-red spots, dysostosis and coarse facial features. The prevalence is 1:100,000 a 200,000 newborn.	600,25
GLDC	Glycine encephalopathy	NM_000170.2	NM_000170.2:c.2405C>T, NM_000170.2:c.2284G>A, NM_000170.2:c.2216G>A, NM_000170.2:c.1691G>T, NM_000170.2:c.1545G>C, NM_000170.2:c.1166C>T, NM_000170.2:c.322G>T	Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in GLDC gene located on chromosomal region 9p24.1. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000.	600,25
GLE1	Lethal congenital contracture syndrome, type 1	NM_001003722.1	NM_001003722.1:c.898-2A>G, NM_001003722.1:c.1412_1413delAG, NM_001003722.1:c.2051T>C, NM_001003722.1:c.2069_2072delTTCT	Lethal congenital contracture syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLE1 gene located on chromosomal region 9q34.11. The age of onset is neonatal. This disease is characterized by total fetal akinesia (detectable since the 13th week of gestation) accompanied by hydrops, micrognathia, pulmonary hypoplasia, pterygia and multiple joint contractures (usually flexion contractures in the elbows and extension in the knees), leading invariably to death before the 32nd week of gestation. Lack of anterior horn motoneurons, severe atrophy of the ventral spinal cord and severe skeletal muscle hypoplasia are characteristic neuropathological findings, with no evidence of other organ structural anomalies.	600,25
GNE	Inclusion body myopathy, type 2 (Nonaka myopathy)	NM_001128227.2	NM_001128227.2:c.2228T>C, NM_001128227.2:c.2179G>A, NM_001128227.2:c.1937C>G, NM_001128227.2:c.1891G>A, NM_001128227.2:c.1820G>A, NM_001128227.2:c.1002T>A, NM_001128227.2:c.880C>T, NM_001128227.2:c.830G>A, NM_001128227.2:c.478C>T	Inclusion body myopathy, type 2 (Nonaka myopathy) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNE gene located on chromosomal region 9p13.3. The age of onset is adult. This disease is characterized by progressive muscle weakness and joint deformity. The prevalence is 1:500-1:1,000.	600,25
GNPTAB	Mucolipidosis 2 alpha/beta	NM_024312.4	NM_024312.4:c.3663delG, NM_024312.4:c.3565C>T, NM_024312.4:c.3560_3561delAG, NM_024312.4:c.3503_3504delTC, NM_024312.4:c.3410T>A, NM_024312.4:c.3326dupA, NM_024312.4:c.3173C>G, NM_024312.4:c.2896delA, NM_024312.4:c.2383delG, NM_024312.4:c.1906dupA, NM_024312.4:c.1759C>T, NM_024312.4:c.1196C>T, NM_024312.4:c.1000C>T, NM_024312.4:c.749dupA, NM_024312.4:c.732_733delAA, NM_024312.4:c.648_651delAGAA, NM_024312.4:c.616_619delACAG, NM_024312.4:c.99delC, NM_024312.4:c.25C>T, NM_024312.4:c.10A>C	Mucolipidosis type 2 alpha/beta follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNPTAB gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by growth retardation, short stature, skeletal abnormalities, facial dysmorphism, stiff skin, developmental delay and cardiomegaly and that is lethal in childhood. The prevalence is 1:123,500-1:625,500.	600,25
GPR179	Night blindness, congenital stationary (complete), type 1E, autosomal recessive	NM_001004334.3	NM_001004334.3:c.6847_6848delCT, NM_001004334.3:c.5763_5764delGA, NM_001004334.3:c.5693dupT, NM_001004334.3:c.4699_4700delAG, NM_001004334.3:c.3233_3234delCT, NM_001004334.3:c.1807C>T, NM_001004334.3:c.1784+1G>A, NM_001004334.3:c.1368delT, NM_001004334.3:c.1236G>A, NM_001004334.3:c.984delC, NM_001004334.3:c.839_842delATCA, NM_001004334.3:c.278dupC, NM_001004334.3:c.278delC	Congenital stationary night blindness type 1E follow an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR179 gene located on chromosomal region 17q12. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity.	600,25
GRM6	Night blindness, congenital stationary (complete), type 1B, autosomal recessive	NM_000843.3	NM_000843.3:c.2560C>T, NM_000843.3:c.2341G>A, NM_000843.3:c.2213_2219delCCAGAGG, NM_000843.3:c.2122C>T, NM_000843.3:c.1861C>T, NM_000843.3:c.1565G>A, NM_000843.3:c.1336C>T, NM_000843.3:c.1258C>T, NM_000843.3:c.1214T>C, NM_000843.3:c.727dupG, NM_000843.3:c.719_720insG, NM_000843.3:c.712C>T	Congenital stationary night blindness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRM6 gene located on chromosomal region 5q35.3. The age of onset is early infancy. This disease is characterized by hemeralopia with a moderate loss of visual acuity.	600,25
GUSB	Mucopolysaccharidosis, type 7	NM_000181.3	NM_000181.3:c.1881G>T, NM_000181.3:c.1856C>T, NM_000181.3:c.1831C>T, NM_000181.3:c.1730G>T, NM_000181.3:c.1618G>T, NM_000181.3:c.1534G>A, NM_000181.3:c.1521G>A, NM_000181.3:c.1429C>T, NM_000181.3:c.1338G>A, NM_000181.3:c.1337G>A, NM_000181.3:c.1244+1G>A, NM_000181.3:c.1219_1220insC, NM_000181.3:c.1144C>T, NM_000181.3:c.1084G>A, NM_000181.3:c.1065+1G>T, NM_000181.3:c.1061C>T, NM_000181.3:c.1050G>C, NM_000181.3:c.866G>A, NM_000181.3:c.820_821delAC, NM_000181.3:c.646C>T, NM_000181.3:c.526C>T, NM_000181.3:c.499C>T, NM_000181.3:c.442C>T	Mucopolysaccharidosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUSB gene located on chromosomal region 7q11.21. The age of onset is variable. There are prenatal forms with non-immune hydrops fetalis, and severe neonatal forms with dysmorphism, hernias, hepatosplenomegaly, club feet, dysostosis, severe hypotonia and neurological disorders that ultimately lead to profound intellectual deficit and small stature in patients that survive. Finally, there are also very mild cases that are discovered during adolescence or adulthood following presentation with thoracic kyphosis. The prevalence is 1:250,000 in newborn.	600,25
HADHA	LCHAD deficiency	NM_000182.4	NM_000182.4:c.2146+1G>A, NM_000182.4:c.2132dupC, NM_000182.4:c.1918C>T, NM_000182.4:c.1793_1794delAT, NM_000182.4:c.1678C>T, NM_000182.4:c.1644delC, NM_000182.4:c.1620+2_1620+6delTAAGG, NM_000182.4:c.1528G>C, NM_000182.4:c.1422dupT, NM_000182.4:c.1132C>T, NM_000182.4:c.919-2A>G, NM_000182.4:c.845T>A, NM_000182.4:c.499delA, NM_000182.4:c.274_278delTCATC	Isolated deficiency of long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD deficiency) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA gene located on chromosomal region 2p23.3. This disease is characterized in infancy/early childhood of hypoketotic hypoglycemia, metabolic acidosis, liver disease, hypotonia and, frequently, cardiac involvement with arrhythmias and/or cardiomyopathy. The prevalence is 1/250,000.	600,25
HBB	HBB-related hemoglobinopathy	NM_000518.4	NM_000518.4:c.*110T>C, NM_000518.4:c.440_441dupAC, NM_000518.4:c.440A>T, NM_000518.4:c.440A>C, NM_000518.4:c.439C>G, NM_000518.4:c.438T>A, NM_000518.4:c.437A>G, NM_000518.4:c.436T>C, NM_000518.4:c.435G>C, NM_000518.4:c.431A>C, NM_000518.4:c.428C>A, NM_000518.4:c.421G>A, NM_000518.4:c.383A>C, NM_000518.4:c.371_378delCCCCACCA, NM_000518.4:c.364G>T, NM_000518.4:c.364G>A, NM_000518.4:c.347C>A, NM_000518.4:c.344T>C, NM_000518.4:c.343_344delCTinsG, NM_000518.4:c.341T>A, NM_000518.4:c.332T>C, NM_000518.4:c.328delG, NM_000518.4:c.328G>A, NM_000518.4:c.323dupG, NM_000518.4:c.320T>G, NM_000518.4:c.316-1G>T, NM_000518.4:c.316-1G>A, NM_000518.4:c.316-2A>G, NM_000518.4:c.316-2A>C, NM_000518.4:c.316-3C>A, NM_000518.4:c.316-106C>G, NM_000518.4:c.316-146T>G, NM_000518.4:c.316-197C>T, NM_000518.4:c.315+2T>G, NM_000518.4:c.315+1G>C, NM_000518.4:c.315+1G>A, NM_000518.4:c.312C>G, NM_000518.4:c.306G>C, NM_000518.4:c.305A>G, NM_000518.4:c.304G>A, NM_000518.4:c.302C>T, NM_000518.4:c.299A>T, NM_000518.4:c.299A>G, NM_000518.4:c.299A>C, NM_000518.4:c.298G>T, NM_000518.4:c.298G>C, NM_000518.4:c.298G>A, NM_000518.4:c.295G>A, NM_000518.4:c.293A>T, NM_000518.4:c.287dupA, NM_000518.4:c.282_283dupTG, NM_000518.4:c.283G>C, NM_000518.4:c.277C>T, NM_000518.4:c.277C>A, NM_000518.4:c.275T>C, NM_000518.4:c.271G>T, NM_000518.4:c.269G>A, NM_000518.4:c.268A>C, NM_000518.4:c.257T>C, NM_000518.4:c.251delG, NM_000518.4:c.248A>T, NM_000518.4:c.248A>C, NM_000518.4:c.247A>G, NM_000518.4:c.230delC, NM_000518.4:c.226delC, NM_000518.4:c.217_221delAGTGAinsT, NM_000518.4:c.217dupA, NM_000518.4:c.216dupT, NM_000518.4:c.208G>A, NM_000518.4:c.206T>A, NM_000518.4:c.203_204delTG, NM_000518.4:c.201delA, NM_000518.4:c.199A>G, NM_000518.4:c.194delG, NM_000518.4:c.190C>T, NM_000518.4:c.184A>T, NM_000518.4:c.182T>A, NM_000518.4:c.179A>C, NM_000518.4:c.176C>G, NM_000518.4:c.162delT, NM_000518.4:c.143_146dupATCT, NM_000518.4:c.143dupA, NM_000518.4:c.135delC, NM_000518.4:c.134C>G, NM_000518.4:c.130G>T, NM_000518.4:c.126_129delCTTT, NM_000518.4:c.128T>C, NM_000518.4:c.127T>G, NM_000518.4:c.127T>C, NM_000518.4:c.114_120delGACCCAG, NM_000518.4:c.117_118delCC, NM_000518.4:c.118C>T, NM_000518.4:c.114G>A, NM_000518.4:c.113G>A, NM_000518.4:c.112delT, NM_000518.4:c.110delC, NM_000518.4:c.108C>A, NM_000518.4:c.103G>T, NM_000518.4:c.93G>T, NM_000518.4:c.93-1G>C, NM_000518.4:c.93-1G>A, NM_000518.4:c.93-2A>C, NM_000518.4:c.93-21G>A, NM_000518.4:c.92+6T>C, NM_000518.4:c.92+5G>T, NM_000518.4:c.92+5G>C, NM_000518.4:c.92+5G>A, NM_000518.4:c.92+2T>C, NM_000518.4:c.92+2T>A, NM_000518.4:c.92+1G>T, NM_000518.4:c.92+1G>A, NM_000518.4:c.92G>C, NM_000518.4:c.92G>A, NM_000518.4:c.91A>C, NM_000518.4:c.90C>T, NM_000518.4:c.86T>A, NM_000518.4:c.85dupC, NM_000518.4:c.82G>T, NM_000518.4:c.80A>G, NM_000518.4:c.79_80insT, NM_000518.4:c.79G>T, NM_000518.4:c.79G>A, NM_000518.4:c.75T>A, NM_000518.4:c.68_74delAAGTTGG, NM_000518.4:c.64dupG, NM_000518.4:c.59A>G, NM_000518.4:c.52A>T, NM_000518.4:c.51delC, NM_000518.4:c.48G>A, NM_000518.4:c.47G>A, NM_000518.4:c.46delT, NM_000518.4:c.45dupG, NM_000518.4:c.36delT, NM_000518.4:c.27dupG, NM_000518.4:c.25_26delAA, NM_000518.4:c.20delA, NM_000518.4:c.20A>T, NM_000518.4:c.19G>A, NM_000518.4:c.17_18delCT, NM_000518.4:c.8A>C, NM_000518.4:c.4delG, NM_000518.4:c.4G>T, NM_000518.4:c.3G>A, NM_000518.4:c.2T>G, NM_000518.4:c.2T>C, NM_000518.4:c.2T>A, NM_000518.4:c.1A>G, NM_000518.4:c.-50A>C, NM_000518.4:c.-75G>C, NM_000518.4:c.-78A>G, NM_000518.4:c.-78A>C, NM_000518.4:c.-79A>G, NM_000518.4:c.-80T>A, NM_000518.4:c.-137C>G, NM_000518.4:c.-137C>A, NM_000518.4:c.-138C>T, NM_000518.4:c.-151C>T	DNA variations in the HBB gene result in the production of different versions of beta-globin. Some of these variations may affect a person's health while other variations cause no noticeable signs or symptoms. Two of the most common HBB-related conditions are beta-thalassemia and sickle cell anemia (SCA). Beta thalassemia is caused by HBB gene mutations that prevent or decrease beta-globin production, subunits that make up hemoglobin. A lack of hemoglobin disrupts the normal development of red blood cells. A shortage of mature red blood cells can reduce the amount of oxygen that is delivered to tissues to below what is needed to satisfy the body's energy needs. A lack of oxygen in the body's tissues can lead to poor growth, organ damage, and other health problems associated with beta thalassemia. SCA is a multisystem disease associated with episodes of acute illness and progressive organ damage. SCA-associated mutations cause red blood cells assuming an abnormal, rigid, sickle shape promoting cell break down prematurely, which can lead to anemia. Anemia can cause shortness of breath, fatigue, and delayed growth and development in children.	600,25
HESX1	Growth hormone deficiency with pituitary anomalies	NM_003865.2	NM_003865.2:c.450_451delCA, NM_003865.2:c.445G>A, NM_003865.2:c.77T>C, NM_003865.2:c.18G>C	Growth hormone deficiency with pituitary anomalies follows an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the HESX1 gene located on chromosomal region 3p14.3. The age of onset is infantile. These diseases are characterized by short stature, cognitive alterations or delayed puberty. The incidence is 1:3,000 and 1:4,000 births.	600,25
HEXA	Tay-Sachs disease	NM_000520.5	NM_000520.5:c.254-1G>C	Tay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births.	600,25
HEXA	Tay-Sachs disease	NM_001318825.1	NM_001318825.1:c.1570C>T, NM_001318825.1:c.1561C>T, NM_001318825.1:c.1544G>A, NM_001318825.1:c.1543delC, NM_001318825.1:c.1543C>T, NM_001318825.1:c.1532delT, NM_001318825.1:c.1529G>A, NM_001318825.1:c.1528C>T, NM_001318825.1:c.1477G>A, NM_001318825.1:c.1455G>C, NM_001318825.1:c.1311_1312insTATC, NM_001318825.1:c.1307_1310dupTATC, NM_001318825.1:c.1293G>C, NM_001318825.1:c.1247_1248delAAinsG, NM_001318825.1:c.1210C>T, NM_001318825.1:c.1209G>A, NM_001318825.1:c.1020G>A, NM_001318825.1:c.1019+3A>G, NM_001318825.1:c.948_950delCTT, NM_001318825.1:c.838+1G>C, NM_001318825.1:c.838+1G>A, NM_001318825.1:c.838G>A, NM_001318825.1:c.805G>C, NM_001318825.1:c.782G>A, NM_001318825.1:c.705+1G>A, NM_001318825.1:c.665T>C, NM_001318825.1:c.662C>T, NM_001318825.1:c.573C>G, NM_001318825.1:c.571T>C, NM_001318825.1:c.566G>T, NM_001318825.1:c.566G>A, NM_001318825.1:c.565C>T, NM_001318825.1:c.542G>A, NM_001318825.1:c.541C>T, NM_001318825.1:c.492+5G>A, NM_001318825.1:c.413T>G, NM_001318825.1:c.173G>A, NM_001318825.1:c.116T>G, NM_001318825.1:c.78G>A, NM_001318825.1:c.77G>A, NM_001318825.1:c.2T>C, NM_001318825.1:c.1A>T, NM_001318825.1:c.1A>G	Tay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births.	600,25
HEXB	Sandhoff disease, infantile, juvenile, and adult forms	NM_000521.3	NM_000521.3:c.115delG, NM_000521.3:c.171delG, NM_000521.3:c.202_203insGG, NM_000521.3:c.298delC, NM_000521.3:c.508C>T, NM_000521.3:c.797A>G, NM_000521.3:c.841C>T, NM_000521.3:c.850C>T, NM_000521.3:c.1238_1242delCAAAG, NM_000521.3:c.1250C>T, NM_000521.3:c.1310_1311delCA, NM_000521.3:c.1345delT, NM_000521.3:c.1375G>T, NM_000521.3:c.1380G>A, NM_000521.3:c.1517_1529dupCAAGTGCTGTTGG, NM_000521.3:c.1539_1540delCT	Sandhoff disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXB gene located on chromosomal region 5q13.3. The age of onset is adult or infantile. This disease is characterized by central nervous system degeneration, with startle reactions, early blindness, progressive motor and mental deterioration, macrocephaly and cherry-red spots on the macula. The prevalence is 1/130.000.	600,25
HGD	Alkaptonuria	NM_000187.3	NM_000187.3:c.1189-2A>G, NM_000187.3:c.1111dupC, NM_000187.3:c.1102A>G, NM_000187.3:c.899T>G, NM_000187.3:c.808G>A, NM_000187.3:c.688C>T, NM_000187.3:c.674G>A, NM_000187.3:c.481G>A, NM_000187.3:c.469+2T>C, NM_000187.3:c.342+1G>A, NM_000187.3:c.175delA, NM_000187.3:c.172A>T, NM_000187.3:c.140C>T, NM_000187.3:c.16-1G>A	Alkaptonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGD gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by darkening of the urine when it is left exposed to air, grey-blue colouration of the eye sclerae and the ear helix (ochronosis), and a disabling joint disease involving both the axial and peripheral joints (ochronotic arthropathy). The prevalence is 1:250,000-1:1.000.000 newborn.	600,25
HGSNAT	Mucopolysaccharidosis type 3C (Sanfilippo C)	NM_152419.2	NM_152419.2:c.493+1G>A, NM_152419.2:c.607C>T, NM_152419.2:c.848C>T, NM_152419.2:c.1030C>T, NM_152419.2:c.1250+1G>A, NM_152419.2:c.1378-1G>A, NM_152419.2:c.1464+1G>A, NM_152419.2:c.1503delA, NM_152419.2:c.1553C>T, NM_152419.2:c.1622C>T	Mucopolysaccharidosis type 3C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGSNAT gene located on chromosomal region 8p11.21. The age of onset is infantile. This disease is characterized by defective or missing enzymes to break down mucopolysaccharides are missing or are defective. The prevalence is <1:70.000 newborn.	600,25
HPD	Tyrosinemia, type 3	NM_002150.2	NM_002150.2:c.987delA, NM_002150.2:c.774T>G, NM_002150.2:c.600C>G	Tyrosinemia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPD gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by intellectual deficit and ataxia. The prevalence is 1:100,000-1:120,000 newborn.	600,25
IGHMBP2	Charcot-Marie-Tooth disease, axonal, type 2S	NM_002180.2	NM_002180.2:c.121C>T, NM_002180.2:c.638A>G, NM_002180.2:c.661delA, NM_002180.2:c.1107C>G, NM_002180.2:c.1488C>A, NM_002180.2:c.1540G>A, NM_002180.2:c.1738G>A, NM_002180.2:c.2362C>T, NM_002180.2:c.2611+1G>T	Charcot-Marie-Tooth disease, axonal, type 2S follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGHMBP2 gene located on chromosomal region 11q13.3. The age of onset can be infancy, childhood, adult or adolescent. This disease is characterized by progressive distal muscle weakness and atrophy of both the lower and upper limbs, absent or reduced deep tendon reflexes, mild sensory loss, foot drop, and pes cavus leading eventually to wheelchair dependence. Some patients present with early hypotonia and delayed motor development. Scoliosis and variable autonomic disturbances may be associated. The prevalence is below 1/1,000,000.	600,25
INPP5E	Joubert syndrome, type 1	NM_019892.5	NM_019892.5:c.1879C>T, NM_019892.5:c.1688G>A, NM_019892.5:c.1543C>T, NM_019892.5:c.1304G>A, NM_019892.5:c.1132C>T, NM_019892.5:c.855_856insCG	Joubert syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:100,000.	600,25
INSR	Diabetes mellitus, insulin-resistant, with acanthosis nigricans, type A	NM_000208.3	NM_000208.3:c.3680G>C, NM_000208.3:c.3079C>T, NM_000208.3:c.2668C>T, NM_000208.3:c.1114C>T, NM_000208.3:c.172G>A	Diabetes mellitus, insulin-resistant, with acanthosis nigricans type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by the triad of hyperinsulinemia, acanthosis nigricans (skin lesions associated with insulin resistance), and signs of hyperandrogenism in females without lipodystrophy and who are not overweight. It is generally diagnosed in young women with marked signs of hyperandrogenism, but insulin resistance and acanthosis nigricans may be observed in men and in childhood. Acromegaloid facies or muscular cramps are sometimes associated. Hyperinsulinemia, a biological marker for insulin resistance, is often associated with glucose tolerance defects over the course of the disease, and diabetes progressively sets in. Hyperandrogenism (associated with polycystic ovarian syndrome (see this term) or ovarian hyperthecoses) leads to fertility problems. The prevalence is <1:1,000,000.	600,25
ITGB4	Epidermolysis bullosa, junctional, with pyloric atresia	NM_000213.4	NM_000213.4:c.112T>C, NM_000213.4:c.182G>A, NM_000213.4:c.1150delG, NM_000213.4:c.1660C>T, NM_000213.4:c.1684T>C, NM_000213.4:c.2608delC, NM_000213.4:c.2792G>A, NM_000213.4:c.3321_3331delACTGGACCGGA, NM_000213.4:c.3674G>A, NM_000213.4:c.3793+1G>A, NM_000213.4:c.3801dupT, NM_000213.4:c.3841C>T, NM_000213.4:c.4620delG, NM_000213.4:c.4643G>A, NM_000213.4:c.4828C>T, NM_000213.4:c.5329+2T>C	Junctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGB4 gene located on chromosomal region 17q25.1. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. More than 100 cases have been reported around the world.	600,25
IVD	Isovaleric acidemia	NM_002225.3	NM_002225.3:c.2T>G, NM_002225.3:c.134T>C, NM_002225.3:c.157C>T, NM_002225.3:c.158G>A, NM_002225.3:c.158G>C, NM_002225.3:c.243+1G>A, NM_002225.3:c.367G>A, NM_002225.3:c.390delT, NM_002225.3:c.406_407delTG, NM_002225.3:c.434_437dupATGA, NM_002225.3:c.465+2T>C, NM_002225.3:c.478_479insGT, NM_002225.3:c.507delG, NM_002225.3:c.559+1G>A, NM_002225.3:c.593G>A, NM_002225.3:c.605G>T, NM_002225.3:c.627delT, NM_002225.3:c.793+1G>A, NM_002225.3:c.941C>T, NM_002225.3:c.994_995delAT, NM_002225.3:c.1141T>C, NM_002225.3:c.1145_1147+4delTTGGTGA, NM_002225.3:c.1183C>T, NM_002225.3:c.1188delT, NM_002225.3:c.1192C>T, NM_002225.3:c.1208A>G	Isovaleric academia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IVD gene located on chromosomal region 15q15.1. The age of onset is neonatal. This disease is characterized by vomiting, dehydration, coma and abnormal movements. The prevalence is 1/100,000.	600,25
JAK3	Severe Combined Immunodeficiency, autosomal recessive, T-negative/B-positive type	NM_000215.3	NM_000215.3:c.1837C>T, NM_000215.3:c.1765G>A, NM_000215.3:c.1695C>A, NM_000215.3:c.1333C>T, NM_000215.3:c.1172_1173insG, NM_000215.3:c.299A>G	Severe combined immunodeficiency, T-B+ type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the JAK3 gene located on chromosomal region 19p13.11. The age of onset is infantile. This disease is characterized by chronic diarrhea, failure to thrive, recurrent respiratory infections and/or generalized infections due to opportunistic pathogens. The incidence is 1/100,000 and 1/1,000,000.	600,25
KCNJ1	Bartter syndrome, type 2	NM_000220.4	NM_000220.4:c.1014delA, NM_000220.4:c.1012C>T, NM_000220.4:c.996_999delAAAG, NM_000220.4:c.942T>G, NM_000220.4:c.657C>G, NM_000220.4:c.641C>T, NM_000220.4:c.592G>A, NM_000220.4:c.500G>A, NM_000220.4:c.372T>A, NM_000220.4:c.322G>C, NM_000220.4:c.237C>G	Bartter syndrome, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ1 gene located on chromosomal region 11q24.3. The age of onset is antenatal. This disease is characterized by severe polyhydramnios in mother leading to premature delivery, postnatally newborns suffer from recurrent episodes of severe dehydration and electrolyte imbalance which can lead to fatal outcome.	600,25
KCNV2	Retinal cone dystrophy, type 3B	NM_133497.3	NM_133497.3:c.226C>T, NM_133497.3:c.325C>T, NM_133497.3:c.357dupC, NM_133497.3:c.427G>T, NM_133497.3:c.442G>T, NM_133497.3:c.491T>C, NM_133497.3:c.767C>G, NM_133497.3:c.778A>T, NM_133497.3:c.916G>T, NM_133497.3:c.1016_1024delACCTGGTGG, NM_133497.3:c.1133dupT, NM_133497.3:c.1376G>A	Retinal cone dystrophy, type 3B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNV2 gene located on 9p24.2. The age of onset is in the first or second decade of life. This disease is characterized by is characterized by onset in the first or second decade of life of very marked photophobia, myopia, reduced color vision along the red-green axis with relatively preserved tritan discrimination, and central scotomata with peripheral widespread sensitivity loss predominating in the superior visual field. Nyctalopia is a later feature of the disorder. There is often retinal pigment epithelium disturbance at the macula with a normal retinal periphery.	600,25
LAMA2	LAMA2-related muscular dystrophy	NM_000426.3	NM_000426.3:c.112+1G>A, NM_000426.3:c.184G>T, NM_000426.3:c.825delC, NM_000426.3:c.1050delT, NM_000426.3:c.1612C>T, NM_000426.3:c.2049_2050delAG, NM_000426.3:c.2098_2099delTT, NM_000426.3:c.2323-2A>T, NM_000426.3:c.2451-2A>G, NM_000426.3:c.2750-1G>C, NM_000426.3:c.2901C>A, NM_000426.3:c.2962C>T, NM_000426.3:c.3215delG, NM_000426.3:c.3237C>A, NM_000426.3:c.3630delT, NM_000426.3:c.3718C>T, NM_000426.3:c.3976C>T, NM_000426.3:c.4645C>T, NM_000426.3:c.5050G>T, NM_000426.3:c.5227G>T, NM_000426.3:c.6011delA, NM_000426.3:c.6038delT, NM_000426.3:c.6334A>T, NM_000426.3:c.6429+1G>A, NM_000426.3:c.6617delT, NM_000426.3:c.6955C>T, NM_000426.3:c.7147C>T, NM_000426.3:c.7279_7280delCT, NM_000426.3:c.7536delC, NM_000426.3:c.7732C>T, NM_000426.3:c.7810C>T, NM_000426.3:c.7888C>T, NM_000426.3:c.8314delA, NM_000426.3:c.8705delT, NM_000426.3:c.8748delA, NM_000426.3:c.9101_9104dupAACA, NM_000426.3:c.9221delA, NM_000426.3:c.9253C>T	LAMA2-related muscular dystrophy 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMA2 gene located on chromosomal region 6q22.33. LAMA2-related muscular dystrophy is a disorder that causes weakness and atrophy of skeletal muscles. This condition varies in severity, from a severe, early-onset type to a milder, late-onset form. Early-onset LAMA2-related muscular dystrophy is apparent at birth or within the first few months of life, called merosin-deficient congenital muscular dystrophy type 1A (607855). Patients show hypotonia, poor suck and cry, and delayed motor development; most never achieve independent ambulation. Most patients also have periventricular white matter abnormalities on brain imaging, but mental retardation and/or seizures occur only rarely. Symptoms of late-onset LAMA2-related muscular dystrophy become evident later in childhood or adulthood, and are similar to those of a group of muscle disorders classified as autosomal recessive limb-girdle muscular dystrophies, type 23. This group is characterized by slowly progressive proximal muscle weakness primarily affecting the lower limbs and resulting in gait difficulties. Additional features include white matter abnormalities on brain imaging, increased serum creatine kinase, and dystrophic features, with partial LAMA2 deficiency on muscle biopsy. Some patients may have additional neurologic features, including executive deficits, seizures, and peripheral neuropathy. Patients remain ambulatory well into adulthood. The prevalence is 1/30,000.	600,25
LAMB3	Junctional epidermolysis bullosa, Herlitz and non-Herlitz type	NM_000228.2	NM_000228.2:c.3228+1G>T, NM_000228.2:c.3228+1G>A, NM_000228.2:c.2806C>T, NM_000228.2:c.1903C>T, NM_000228.2:c.1830G>A, NM_000228.2:c.1587_1588delAG, NM_000228.2:c.1438_1442delCCGTG, NM_000228.2:c.1357delT, NM_000228.2:c.904delT, NM_000228.2:c.727C>T, NM_000228.2:c.628+1delG, NM_000228.2:c.628G>A, NM_000228.2:c.565-2A>G, NM_000228.2:c.496C>T, NM_000228.2:c.124C>T	Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 gene located on chromosomal region 1q32.2. The age of onset is neonatal/infancy. Junctional epidermolysis bullosa (JEB) is a group of genetic conditions that cause the skin to be very fragile and to blister easily. Blisters and skin erosions form in response to minor injury or friction, such as rubbing or scratching. Researchers classify junctional epidermolysis bullosa into two main types based on severity: Herlitz JEB and non-Herlitz JEB. Herlitz type is more severe phenotype characterized by blisters and erosions, localized to the skin and mucous membranes and often results in early death. More than 80 mutations in the LAMB3 gene have been identified in people with Herlitz JEB. Other LAMB3 gene mutations cause the milder form non-Herlitz JEB, disease characterized by generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.	600,25
LMNA	LMNA-related disorders, autosomal recessive	NM_001282626.1	NM_001282626.1:c.1818+6C>T	LMNA-related disorders, autosomal recessive, are caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22, and include Charcot-Marie-Tooth disease, type 2B1, Emery-Dreifuss muscular dystrophy type 3, mandibuloacral dysplasia, lethal restrictive dermopathy among others. Charcot-Marie-Tooth disease constitutes a clinically and genetically heterogeneous group of hereditary motor and sensory neuropathies. Emery-Dreifuss muscular dystrophy is characterized classically by the triad of weakness of the shoulder and pelvic girdle muscles, contractures of the elbows, neck, and Achilles tendon, and cardiac involvement, most commonly arrhythmias. Mandibuloacral dysplasia is characterized by growth retardation, craniofacial anomalies with mandibular hypoplasia, skeletal abnormalities with progressive osteolysis of the distal phalanges and clavicles, and pigmentary skin changes. Restrictive dermopathy is a rare, lethal genodermatosis characterized by thin, tightly adherent translucent skin with erosions at flexure sites, superficial vessels, typical facial dysmorphism, and generalized joint ankylosis.	600,25
LMNA	LMNA-related disorders, autosomal recessive	NM_170707.3	NM_170707.3:c.419T>C, NM_170707.3:c.1072G>A, NM_170707.3:c.1228C>T, NM_170707.3:c.1366A>C, NM_170707.3:c.1411C>T, NM_170707.3:c.1488+1G>A, NM_170707.3:c.1579C>T, NM_170707.3:c.1580G>A, NM_170707.3:c.1583C>A, NM_170707.3:c.1585G>A, NM_170707.3:c.1586C>T, NM_170707.3:c.1626G>C	LMNA-related disorders, autosomal recessive, are caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22, and include Charcot-Marie-Tooth disease, type 2B1, Emery-Dreifuss muscular dystrophy type 3, mandibuloacral dysplasia, lethal restrictive dermopathy among others. Charcot-Marie-Tooth disease constitutes a clinically and genetically heterogeneous group of hereditary motor and sensory neuropathies. Emery-Dreifuss muscular dystrophy is characterized classically by the triad of weakness of the shoulder and pelvic girdle muscles, contractures of the elbows, neck, and Achilles tendon, and cardiac involvement, most commonly arrhythmias. Mandibuloacral dysplasia is characterized by growth retardation, craniofacial anomalies with mandibular hypoplasia, skeletal abnormalities with progressive osteolysis of the distal phalanges and clavicles, and pigmentary skin changes. Restrictive dermopathy is a rare, lethal genodermatosis characterized by thin, tightly adherent translucent skin with erosions at flexure sites, superficial vessels, typical facial dysmorphism, and generalized joint ankylosis.	600,25
LRP5	Osteoporosis-pseudoglioma syndrome	NM_002335.3	NM_002335.3:c.804_813delGGGGAAGAGG, NM_002335.3:c.1453G>T, NM_002335.3:c.1468delG, NM_002335.3:c.1481G>A, NM_002335.3:c.1708C>T, NM_002335.3:c.1709G>A, NM_002335.3:c.2202G>A, NM_002335.3:c.2254C>G, NM_002335.3:c.2305delG, NM_002335.3:c.2557C>T, NM_002335.3:c.4099G>A, NM_002335.3:c.4651G>A	Osteoporosis-pseudoglioma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by congenital or infancy-onset blindness and severe juvenile-onset osteoporosis and spontaneous fractures. The prevalence is 1:2,000,000.	600,25
MAN2B1	Mannosidosis, alpha-, types I and II	NM_000528.3	NM_000528.3:c.2686_2687delCTinsG, NM_000528.3:c.2436+2T>C, NM_000528.3:c.2426T>C, NM_000528.3:c.2398G>A, NM_000528.3:c.2368C>T, NM_000528.3:c.2278C>T, NM_000528.3:c.2119C>T, NM_000528.3:c.2013delT, NM_000528.3:c.1929G>A, NM_000528.3:c.1915C>T, NM_000528.3:c.1830+1G>C, NM_000528.3:c.1780C>T, NM_000528.3:c.384G>A, NM_000528.3:c.1A>G	Alpha-mannosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAN2B1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by immunodeficiency, facial and skeletal abnormalities, hearing impairment and intellectual disability. The prevalence is 1:1,000,000-9:1,000,000.	600,25
MCCC2	3-Methylcrotonyl-CoA carboxylase type 2, deficiency	NM_022132.4	NM_022132.4:c.295G>C, NM_022132.4:c.380C>G, NM_022132.4:c.464G>A, NM_022132.4:c.499T>C, NM_022132.4:c.517dupT, NM_022132.4:c.641delG, NM_022132.4:c.735dupC, NM_022132.4:c.838G>T, NM_022132.4:c.929C>G, NM_022132.4:c.994C>T, NM_022132.4:c.1015G>A, NM_022132.4:c.1065A>T, NM_022132.4:c.1072+1G>A, NM_022132.4:c.1577dupT, NM_022132.4:c.1580G>A	3-methylcrotonyl-CoA carboxylase deficiency type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC2 gene located on chromosomal region 5q13.2. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn.	600,25
MED25	Basel-Vanagait-Smirin-Yosef syndrome	NM_030973.3	NM_030973.3:c.320delG, NM_030973.3:c.1366C>T	Basel-Vanagait-Smirin-Yosef syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MED25 gene located on chromosomal region 19q13.33. The age of onset neonatal/infantile. This syndrome is characterized by eye, brain, cardiac and palatal abnormalities as well as growth retardation, microcephaly and severe intellectual disability.	600,25
MEFV	Familial Mediterranean fever, AR	NM_000243.2	NM_000243.2:c.2282G>A, NM_000243.2:c.2230G>T, NM_000243.2:c.2177T>C, NM_000243.2:c.2084A>G, NM_000243.2:c.2082G>A, NM_000243.2:c.2080A>G, NM_000243.2:c.2076_2078delAAT, NM_000243.2:c.2040G>C, NM_000243.2:c.2040G>A, NM_000243.2:c.1958G>A, NM_000243.2:c.1437C>G, NM_000243.2:c.1141C>T, NM_000243.2:c.656dupG, NM_000243.2:c.501G>C, NM_000243.2:c.163dupA	Familial Mediterranean fever follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MEFV gene located on chromosomal region 16p13.3. The age of onset is infantile or adult (before the age of 30). This disease is characterized by recurrent short episodes of fever and serositis resulting in pain in the abdomen, chest, joints and muscles. The prevalence is 1:10,000-5:10,000.	600,25
MERTK	Retinitis pigmentosa type 38	NM_006343.2	NM_006343.2:c.1605-2A>G, NM_006343.2:c.2070_2074delAGGAC, NM_006343.2:c.2189+1G>T, NM_006343.2:c.2211_2214delCTGT, NM_006343.2:c.2323C>T, NM_006343.2:c.2785_2786dupTA	Retinitis pigmentosa type 38 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MERTK gene located on chromosomal region 2q13. The age of onset is infantile. This disease is characterized by. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness.	600,25
MFRP	Microphthalmia, isolated type 5	NM_031433.3	NM_031433.3:c.1149dupC, NM_031433.3:c.1124+1G>T, NM_031433.3:c.545T>C, NM_031433.3:c.523C>T, NM_031433.3:c.498delC	Microphthalmia, isolated type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFRP gene located on chromosomal region 11q23.3. The age of onset is infantile. This disease is characterized by posterior microphthalmos, retinitis pigmentosa, foveoschisis, and optic disk drusen.	600,25
MKKS	Bardet-Biedl syndrome type 6	NM_018848.3	NM_018848.3:c.1436C>G, NM_018848.3:c.1225_1226delGG, NM_018848.3:c.830T>C, NM_018848.3:c.353delG	Bardet-Biedl syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.	600,25
MKS1	Bardet-Biedl syndrome type 13	NM_001321269.1	NM_001321269.1:c.1024+1G>A, NM_001321269.1:c.508C>T	Bardet-Biedl syndrome type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.	600,25
MMACHC	Methylmalonic aciduria and homocystinuria, cblC type	NM_015506.2	NM_015506.2:c.271dupA, NM_015506.2:c.331C>T, NM_015506.2:c.347T>C, NM_015506.2:c.388_390delTAC, NM_015506.2:c.394C>T, NM_015506.2:c.440G>C, NM_015506.2:c.481C>T, NM_015506.2:c.482G>A, NM_015506.2:c.547_548delGT, NM_015506.2:c.608G>A, NM_015506.2:c.609G>A, NM_015506.2:c.615C>A, NM_015506.2:c.615C>G, NM_015506.2:c.619dupG, NM_015506.2:c.616C>T, NM_015506.2:c.658_660delAAG, NM_015506.2:c.688C>T	Vitamin B12-responsive methylmalonic acidemia type cbl B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAB gene located on chromosomal region 12q24.31. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000.	600,25
MOCS2	Molybdenum cofactor deficiency B	NM_004531.4	NM_004531.4:c.567A>C, NM_004531.4:c.539_540delAA, NM_004531.4:c.502G>A, NM_004531.4:c.377+1G>A, NM_004531.4:c.106_107delAT, NM_004531.4:c.58delT, NM_004531.4:c.3G>A	Molybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death.	600,25
MOCS2	Molybdenum cofactor deficiency B	NM_176806.3	NM_176806.3:c.16C>T	Molybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death.	600,25
MTTP	Abetalipoproteinemia	NM_001300785.1	NM_001300785.1:c.789_790delCA, NM_001300785.1:c.1700G>A, NM_001300785.1:c.1850G>T, NM_001300785.1:c.1948+1G>A, NM_001300785.1:c.2112delC, NM_001300785.1:c.2674G>T	Abetalipoproteinemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTTP gene located on chromosomal region 4q23. The age of onset is infantile. This disease is characterized by growth delay, malabsorption, hepatomegaly, and neurological and neuromuscular manifestations. The prevalence is <1:1,000,000.	600,25
MUT	Methylmalonic aciduria, mut(0) type	NM_000255.3	NM_000255.3:c.2150G>T, NM_000255.3:c.2080C>T, NM_000255.3:c.1924G>C, NM_000255.3:c.1871A>G, NM_000255.3:c.1867G>A, NM_000255.3:c.1741C>T, NM_000255.3:c.1658delT, NM_000255.3:c.1445-2A>G, NM_000255.3:c.1420C>T, NM_000255.3:c.1399C>T, NM_000255.3:c.1280G>A, NM_000255.3:c.1207C>T, NM_000255.3:c.1181T>A, NM_000255.3:c.1106G>A, NM_000255.3:c.914T>C, NM_000255.3:c.682C>T, NM_000255.3:c.671_678dupAATTTATG, NM_000255.3:c.655A>T, NM_000255.3:c.643G>A, NM_000255.3:c.607G>A, NM_000255.3:c.572C>A, NM_000255.3:c.313T>C, NM_000255.3:c.280G>A, NM_000255.3:c.278G>A, NM_000255.3:c.91C>T	Methylmalonic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MUT gene located on chromosomal region 6p12.3. The age of onset is very early infantile. This disease is characterized by recurrent ketoacidotic comas or transient vomiting, dehydration, hypotonia and intellectual deficit, which does not respond to administration of vitamin B12.	600,25
MVK	Mevalonic aciduria	NM_000431.3	NM_000431.3:c.59A>C, NM_000431.3:c.185G>A, NM_000431.3:c.494C>T, NM_000431.3:c.803T>C, NM_000431.3:c.902A>C, NM_000431.3:c.928G>A, NM_000431.3:c.1000G>A, NM_000431.3:c.1129G>A	Mevalonic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by psychomotor retardation, failure to thrive, progressive cerebellar ataxia, dysmorphic features, progressive visual impairment and recurrent febrile crises. The prevalence is <1:1,000,000.	600,25
MYO15A	Deafness, autosomal recessive type 3	NM_016239.3	NM_016239.3:c.625G>T, NM_016239.3:c.755dupA, NM_016239.3:c.3313G>T, NM_016239.3:c.3336delG, NM_016239.3:c.3385C>T, NM_016239.3:c.3693-2A>G, NM_016239.3:c.3756+1G>T, NM_016239.3:c.4751_4752dupTC, NM_016239.3:c.5326C>T, NM_016239.3:c.5492G>T, NM_016239.3:c.6004delG, NM_016239.3:c.6864_6874delGGACCTGGAGC, NM_016239.3:c.8148G>T, NM_016239.3:c.8410A>T, NM_016239.3:c.8548C>T, NM_016239.3:c.9958_9961delGACT, NM_016239.3:c.10573delA	Deafness autosomal recessive type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO15A gene located on chromosomal region 17p11.2. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600,25
MYO3A	Deafness, autosomal recessive type 30	NM_017433.4	NM_017433.4:c.1A>G, NM_017433.4:c.732-2A>G, NM_017433.4:c.770C>G, NM_017433.4:c.1086T>G, NM_017433.4:c.1193C>A, NM_017433.4:c.1777-12G>A, NM_017433.4:c.1953delC, NM_017433.4:c.2243delA, NM_017433.4:c.2506-1G>A, NM_017433.4:c.2793+2T>A, NM_017433.4:c.3112-2A>G, NM_017433.4:c.3154C>T, NM_017433.4:c.4586+2T>G, NM_017433.4:c.4730+1G>A	Deafness autosomal recessive type 30 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO3A gene located on chromosomal region 10p12.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600,25
MYO6	Deafness, autosomal recessive type 37	NM_004999.3	NM_004999.3:c.1452dupT, NM_004999.3:c.2907_2909delAGA, NM_004999.3:c.3496C>T, NM_004999.3:c.3808C>T	Deafness autosomal recessive type 37 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO6 gene located on chromosomal region 6q14.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600,25
MYO7A	Usher syndrome, type 1B	NM_000260.3	NM_000260.3:c.3G>A, NM_000260.3:c.133-2A>G, NM_000260.3:c.448C>T, NM_000260.3:c.494C>T, NM_000260.3:c.634C>T, NM_000260.3:c.635G>A, NM_000260.3:c.640G>A, NM_000260.3:c.731G>C, NM_000260.3:c.1184G>A, NM_000260.3:c.1344-1G>A, NM_000260.3:c.1797G>A, NM_000260.3:c.1884C>A, NM_000260.3:c.1996C>T, NM_000260.3:c.2476G>A, NM_000260.3:c.3504-1G>C, NM_000260.3:c.3508G>A, NM_000260.3:c.3596dupT, NM_000260.3:c.3719G>A, NM_000260.3:c.3764delA, NM_000260.3:c.4024delT, NM_000260.3:c.5392C>T, NM_000260.3:c.5618G>A, NM_000260.3:c.5824G>T, NM_000260.3:c.5886_5889delCTTT, NM_000260.3:c.5967C>G, NM_000260.3:c.6025delG	Usher syndrome type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 1:100,000-9:100,000.	600,25
NAGA	Schindler disease, type I	NM_000262.2	NM_000262.2:c.986G>A, NM_000262.2:c.985C>T, NM_000262.2:c.973G>A, NM_000262.2:c.577G>T	Schindler disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGA gene located on chromosomal region 22q13.2. The age of onset is infantile. This disease is characterized by early-onset neuroaxonal dystrophy and neurological signs (convulsion during fever, epilepsy, psychomotor retardation and hypotonia). NAGA deficiency is typically classified in three main phenotypes: NAGA deficiency type I (Schindler disease or Schindler disease type I) with severe manifestations; NAGA deficiency type II (Kanzazi disease or Schindler disease type II) which is mild; NAGA deficiency type III (Schindler disease type III) characterized by mild-to-moderate neurologic manifestations. NAGA deficiency results in the increased urinary excretion of glycopeptides and oligosaccharides containing alpha-N-acetylgalactosaminyl moieties.	600,25
NEB	Nemaline myopathy type 2, autosomal recessive	NM_001271208.1	NM_001271208.1:c.12238_12239delAT, NM_001271208.1:c.8031_8041delAAATAAACGAG, NM_001271208.1:c.6105dupT, NM_001271208.1:c.2173G>T, NM_001271208.1:c.843T>G	Nemaline myopathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEB gene located on chromosomal region 2q23.3. The age of onset is infantile or adult. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:100,000-9:100,000 and the incidence is 1/50.000 newborn.	600,25
NMNAT1	Leber congenital amaurosis type 9	NM_001297778.1	NM_001297778.1:c.25G>A, NM_001297778.1:c.451G>T, NM_001297778.1:c.457C>G, NM_001297778.1:c.507G>A, NM_001297778.1:c.619C>T, NM_001297778.1:c.710G>T, NM_001297778.1:c.769G>A	Leber congenital amaurosis type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NMNAT1 gene located on chromosomal region 1p36.22. The age of onset is early infantile. This disease is characterized by blindness, nystagmus, roving eye movement, leading to severe visual impairment.	600,25
NPC1	Niemann-Pick disease, type C1	NM_000271.4	NM_000271.4:c.3662delT, NM_000271.4:c.3611_3614delTTAC, NM_000271.4:c.3467A>G, NM_000271.4:c.3425T>C, NM_000271.4:c.3182T>C, NM_000271.4:c.3175C>T, NM_000271.4:c.3107C>T, NM_000271.4:c.3104C>T, NM_000271.4:c.3019C>G, NM_000271.4:c.2974G>T, NM_000271.4:c.2974G>A, NM_000271.4:c.2972_2973delAG, NM_000271.4:c.2932C>T, NM_000271.4:c.2873G>A, NM_000271.4:c.2861C>T, NM_000271.4:c.2848G>A, NM_000271.4:c.2842G>A, NM_000271.4:c.2761C>T, NM_000271.4:c.2324A>C, NM_000271.4:c.2072C>T, NM_000271.4:c.1628C>T, NM_000271.4:c.1211G>A, NM_000271.4:c.1042C>T, NM_000271.4:c.813_815delCAT, NM_000271.4:c.530G>A, NM_000271.4:c.352_353delAG, NM_000271.4:c.337T>C	Niemann-Pick disease type C1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC1 gene located on chromosomal region 18q11.2. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000.	600,25
NPC2	Niemann-pick disease, type C2	NM_006432.3	NM_006432.3:c.436C>T, NM_006432.3:c.358C>T, NM_006432.3:c.352G>T, NM_006432.3:c.295T>C, NM_006432.3:c.190+5G>A, NM_006432.3:c.115G>A, NM_006432.3:c.58G>T, NM_006432.3:c.27delG	Niemann-Pick disease type C2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC2 gene located on chromosomal region 14q24.3. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000.	600,25
NPHP3	Meckel syndrome type 7	NM_153240.4	NM_153240.4:c.3406C>T, NM_153240.4:c.3373C>T, NM_153240.4:c.3156dupA, NM_153240.4:c.2694-2_2694-1delAG, NM_153240.4:c.2694-2A>G, NM_153240.4:c.2570+1G>T, NM_153240.4:c.2541delG, NM_153240.4:c.2369T>C, NM_153240.4:c.1985+5G>A, NM_153240.4:c.1817G>A, NM_153240.4:c.1729C>T, NM_153240.4:c.1381G>T, NM_153240.4:c.1119-2A>G, NM_153240.4:c.434_437delAAAG	Meckel syndrome type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP3 gene located on chromosomal region 3q22.1. The age of onset is infantile. This is a disorder characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically encephalocele), hepatic ductal dysplasia and cysts, and polydactyly.	600,25
NPHP4	Nephronophthisis type 4	NM_015102.4	NM_015102.4:c.3767_3768insAA, NM_015102.4:c.3231+1G>C, NM_015102.4:c.2940_2944dupGCTCC, NM_015102.4:c.2335C>T, NM_015102.4:c.1972C>T, NM_015102.4:c.1120-1G>C, NM_015102.4:c.556_557insT, NM_015102.4:c.517C>T	Nephronophthisis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP4 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease results in end-stage renal disease at age ranging between 6 and 35 years. It is a progressive tubulo-interstitial kidney disorder characterized by polydipsia, polyuria, anemia and growth retardation. The prevalence is 1:1,000,000-9:1,000,000.	600,25
NPHS1	Nephrotic syndrome, type 1	NM_004646.3	NM_004646.3:c.3478C>T, NM_004646.3:c.3325C>T, NM_004646.3:c.3250dupG, NM_004646.3:c.3250delG, NM_004646.3:c.3109+1G>A, NM_004646.3:c.2928G>T, NM_004646.3:c.2491C>T, NM_004646.3:c.1715G>A, NM_004646.3:c.1481delC, NM_004646.3:c.1307_1308dupAC, NM_004646.3:c.121_122delCT	Nephrotic syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHS1 gene located on chromosomal region 19q13.12. The age of onset is fetal- infantile. This disease is characterized by fetal proteinuria and nephritic infantile syndrome. The prevalence is 1 in 8 200 births.	600,25
NR2E3	Enhanced S-cone syndrome	NM_014249.3	NM_014249.3:c.119-2A>C, NM_014249.3:c.226C>T, NM_014249.3:c.298_299delTG, NM_014249.3:c.932G>A, NM_014249.3:c.1034_1038delTGCAG	Enhaced S-Cone Syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NR2E3 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by night blindness, reduced bilateral visual acuity, and typical fundus findings (progressive pigmentary degenerative changes, macular edema, retinoschisis).	600,25
OCA2	Oculocutaneous albinism type 2	NM_000275.2	NM_000275.2:c.2228C>T, NM_000275.2:c.1960delG, NM_000275.2:c.1842+1G>T, NM_000275.2:c.1465A>G, NM_000275.2:c.1364+1G>T, NM_000275.2:c.1327G>A, NM_000275.2:c.1182+2T>C, NM_000275.2:c.1182G>A, NM_000275.2:c.1025A>G, NM_000275.2:c.819_822delCTGGinsGGTC, NM_000275.2:c.157delA, NM_000275.2:c.79G>A	Oculocutaneous albinism type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OCA2 gene located on chromosomal region 15q12-q13. The age of onset is infantile. This disease is characterized by variable hypopigmentation of the skin and hair, numerous characteristic ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1/38,000-1/40,000	600,25
OTOA	Deafness, autosomal recessive type 22	NM_144672.3	NM_144672.3:c.121-1G>A, NM_144672.3:c.828delT, NM_144672.3:c.1725_1726delCA	Deafness, autosomal recessive type 22 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOA gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems.	600,25
OTOF	Auditory neuropathy, autosomal recessive, type 1	NM_001287489.1	NM_001287489.1:c.5474_5475delCC, NM_001287489.1:c.5473C>G, NM_001287489.1:c.5103+2T>A, NM_001287489.1:c.4559G>A, NM_001287489.1:c.4491T>A, NM_001287489.1:c.3032T>C, NM_001287489.1:c.2485C>T, NM_001287489.1:c.2348delG, NM_001287489.1:c.1778delT, NM_001287489.1:c.1544T>C, NM_001287489.1:c.1498C>T, NM_001287489.1:c.766-2A>G, NM_001287489.1:c.584-1G>C, NM_001287489.1:c.227+2T>C, NM_001287489.1:c.149G>A	Auditory neuropathy, autosomal recessive type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. Patients can have varying degrees of hearing loss with poor speech reception out of proportion to the degree of hearing loss.	600,25
OTOF	Auditory neuropathy, autosomal recessive, type 1	NM_004802.3	NM_004802.3:c.3515G>A	Auditory neuropathy, autosomal recessive type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. Patients can have varying degrees of hearing loss with poor speech reception out of proportion to the degree of hearing loss.	600,25
PAH	Phenylketonuria	NM_000277.1	NM_000277.1:c.1315+1G>A, NM_000277.1:c.1243G>A, NM_000277.1:c.1241A>G, NM_000277.1:c.1238G>C, NM_000277.1:c.1222C>T, NM_000277.1:c.1217T>C, NM_000277.1:c.1208C>T, NM_000277.1:c.1199+17G>A, NM_000277.1:c.1199+1G>A, NM_000277.1:c.1197A>T, NM_000277.1:c.1184C>A, NM_000277.1:c.1169A>G, NM_000277.1:c.1166delC, NM_000277.1:c.1162G>A, NM_000277.1:c.1139C>T, NM_000277.1:c.1068C>A, NM_000277.1:c.1066-3C>T, NM_000277.1:c.1066-11G>A, NM_000277.1:c.1045T>C, NM_000277.1:c.1042C>G, NM_000277.1:c.1033G>T, NM_000277.1:c.1030G>A, NM_000277.1:c.955G>T, NM_000277.1:c.926C>T, NM_000277.1:c.926C>A, NM_000277.1:c.912+1G>A, NM_000277.1:c.898G>T, NM_000277.1:c.896T>G, NM_000277.1:c.842+5G>A, NM_000277.1:c.838G>A, NM_000277.1:c.829T>G, NM_000277.1:c.823C>T, NM_000277.1:c.818C>T, NM_000277.1:c.814G>T, NM_000277.1:c.809G>A, NM_000277.1:c.806delT, NM_000277.1:c.782G>A, NM_000277.1:c.764T>C, NM_000277.1:c.755G>A, NM_000277.1:c.754C>T, NM_000277.1:c.745C>T, NM_000277.1:c.737C>A, NM_000277.1:c.734T>C, NM_000277.1:c.733G>C, NM_000277.1:c.728G>A, NM_000277.1:c.727C>T, NM_000277.1:c.722delG, NM_000277.1:c.722G>A, NM_000277.1:c.721C>T, NM_000277.1:c.688G>A, NM_000277.1:c.673C>G, NM_000277.1:c.665A>G, NM_000277.1:c.638T>C, NM_000277.1:c.611A>G, NM_000277.1:c.569T>C, NM_000277.1:c.533A>G, NM_000277.1:c.529G>A, NM_000277.1:c.527G>T, NM_000277.1:c.509+1G>A, NM_000277.1:c.508C>G, NM_000277.1:c.503delA, NM_000277.1:c.490A>G, NM_000277.1:c.482T>C, NM_000277.1:c.473G>A, NM_000277.1:c.472C>T, NM_000277.1:c.450dupA, NM_000277.1:c.442-1G>A, NM_000277.1:c.442-5C>G, NM_000277.1:c.441+5G>T, NM_000277.1:c.441+1G>A, NM_000277.1:c.357delC, NM_000277.1:c.331C>T, NM_000277.1:c.320A>G, NM_000277.1:c.311C>A, NM_000277.1:c.284_286delTCA, NM_000277.1:c.261C>A, NM_000277.1:c.250G>T, NM_000277.1:c.204A>T, NM_000277.1:c.194T>C, NM_000277.1:c.165T>G, NM_000277.1:c.143T>C, NM_000277.1:c.136G>A, NM_000277.1:c.117C>G, NM_000277.1:c.47_48delCT	Phenylketonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAH gene located on chromosomal region 12q23.2. The age of onset is neonatal. This disease is characterized by gradual developmental delay, stunted growth, microcephaly, seizures, tremors, eczema, vomiting, and musty odor. Untreated patients subsequently develop intellectual disability, behavioral disorders (hyperactivity) and motor disorders. The prevalence is 1:2,600-1:200,000.	600,25
PANK2	Neurodegeneration with brain iron accumulation type 1	NM_153638.3	NM_153638.3:c.790C>T, NM_153638.3:c.823_824delCT, NM_153638.3:c.1561G>A, NM_153638.3:c.1583C>T	Neurodegeneration with brain iron accumulation type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PANK2 gene located on chromosomal region 20p13. The age of onset is infantile. This disease is characterized by progressive extrapyramidal dysfunction (dystonia, rigidity, choreoathetosis), iron accumulation on the brain and axonal spheroids in the central nervous system. The prevalence is 1-2/1,000,000.	600,25
PC	Pyruvate carboxylase deficiency	NM_000920.3	NM_000920.3:c.1748G>T, NM_000920.3:c.434T>C	Pyruvate carboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PC gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by metabolic acidosis, failure to thrive, developmental delay, and recurrent seizures. The prevalence is 1:250,000.	600,25
PCCA	Propionic acidemia	NM_000282.3	NM_000282.3:c.229C>T, NM_000282.3:c.261dupT, NM_000282.3:c.412G>A, NM_000282.3:c.600+1G>A, NM_000282.3:c.862A>T, NM_000282.3:c.1023dupT, NM_000282.3:c.1118T>A, NM_000282.3:c.1226_1227delTT, NM_000282.3:c.1284+1G>A, NM_000282.3:c.1598_1601delTTGT, NM_000282.3:c.1891G>C, NM_000282.3:c.1899+4_1899+7delAGTA	Propionic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCA gene located on chromosomal region 13q32.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000.	600,25
PCCB	Propionic acidemia	NM_001178014.1	NM_001178014.1:c.331C>T, NM_001178014.1:c.337C>T, NM_001178014.1:c.562G>A, NM_001178014.1:c.622G>A, NM_001178014.1:c.743C>T, NM_001178014.1:c.1050dupT, NM_001178014.1:c.1233dupT, NM_001178014.1:c.1278_1291delGGGCATCATCCGGCinsTAGAGCACAGGA, NM_001178014.1:c.1279_1284delGGCATCinsAA, NM_001178014.1:c.1283_1286delTCAT, NM_001178014.1:c.1288C>T, NM_001178014.1:c.1289_1290insT, NM_001178014.1:c.1343C>T, NM_001178014.1:c.1364A>G, NM_001178014.1:c.1594C>T, NM_001178014.1:c.1598_1600dupCCC, NM_001178014.1:c.1666A>G	Propionic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCB gene located on chromosomal region 3q22.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000.	600,25
PCDH15	Deafness, autosomal recessive type 23	NM_001142763.1	NM_001142763.1:c.5680A>T, NM_001142763.1:c.4982_4983insTGAT, NM_001142763.1:c.4958_4961dupTGAT, NM_001142763.1:c.4885delA, NM_001142763.1:c.4569_4572dupATCT, NM_001142763.1:c.3733-2A>G, NM_001142763.1:c.2660_2661delAT, NM_001142763.1:c.1955C>G, NM_001142763.1:c.1752C>G, NM_001142763.1:c.1598T>A, NM_001142763.1:c.1103delT, NM_001142763.1:c.1021C>T, NM_001142763.1:c.800G>A, NM_001142763.1:c.415C>T, NM_001142763.1:c.415C>G, NM_001142763.1:c.7C>T	Deafness, autosomal recessive 23 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCDH15 gene located on chromosomal region 10q21.1. This is a form of non-syndromic sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.	600,25
PDE6A	Retinitis pigmentosa type 43	NM_000440.2	NM_000440.2:c.2053G>A, NM_000440.2:c.1749C>G, NM_000440.2:c.1683G>A, NM_000440.2:c.1560dupA, NM_000440.2:c.1113+1G>T, NM_000440.2:c.1113+1G>A	Retinitis pigmentosa type 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	600,25
PDE6B	Retinitis pigmentosa type 40	NM_000283.3	NM_000283.3:c.892C>T, NM_000283.3:c.1540delC, NM_000283.3:c.1572delC, NM_000283.3:c.1580T>C, NM_000283.3:c.1669C>T, NM_000283.3:c.1920+2T>C	Retinitis pigmentosa 40 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6B gene located on chromosomal region 4p16.3. The age of onset is variable. Retinitis pigmentosa 40 is a retinal dystrophy belonging to the group of pigmentary retinopathies.This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness.	600,25
PEX1	Heimler syndrome type 1	NM_000466.2	NM_000466.2:c.3505_3517delCAGTTGTTTTCAC, NM_000466.2:c.2916delA, NM_000466.2:c.2528G>A, NM_000466.2:c.2097dupT, NM_000466.2:c.1991T>C, NM_000466.2:c.1952_1960dupCAGTGTGGA, NM_000466.2:c.1842delA, NM_000466.2:c.1239+1G>T, NM_000466.2:c.877C>T	Heimler syndrome 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. This disease is characterized by sensorineural hearing loss, enamel hyoplasia of the secondary dentition, and nail abnormalities.	600,25
PEX7	Rhizomelic chondrodysplasia punctata, type 1	NM_000288.3	NM_000288.3:c.532C>T, NM_000288.3:c.618G>A, NM_000288.3:c.649G>A, NM_000288.3:c.653C>T, NM_000288.3:c.694C>T, NM_000288.3:c.854A>G, NM_000288.3:c.875T>A, NM_000288.3:c.903+1G>C	Rhizomelic chondrodysplasia punctata type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX7 gene located on chromosomal region 6q23.3. The age of onset is early. This disease is characterized by proximal shortening of the humerus and to a lesser degree the femur (rhizomelia), punctate calcifications in cartilage with epiphyseal and metaphyseal abnormalities (chondrodysplasia punctata), coronal clefts of the vertebral bodies, cataracts, postnatal growth deficiency is profound, intellectual disability is severe, seizures. The prevalence is <1:100,000.	600,25
PHYH	Refsum disease	NM_001323082.1	NM_001323082.1:c.830G>A, NM_001323082.1:c.829C>T, NM_001323082.1:c.811A>C, NM_001323082.1:c.684+5G>T, NM_001323082.1:c.684+2T>G, NM_001323082.1:c.503-2A>G, NM_001323082.1:c.164delT, NM_001323082.1:c.135-1G>C, NM_001323082.1:c.135-2A>G	Refsum disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHYH gene located on chromosomal region 10p13. The age of onset is variable. This disease is characterized by hemeralopia (loss of vision in the dark), followed by episods of chronic distal motor polyneuropathy. Other associated signs include perceptive deafness, anosmia, cerebellous ataxia and sometimes, severe intellectual deficiency. Over the course of time cutaneous signs appear (ichtyosis), along with polyepiphyseal dysplasia, myocardiopathy, elevated protein in cerebrospinal fluid, and pigmentary retinitis that may result in blindness. The prevalence is 1:1.000,000-9:1.000,000.	600,25
PKHD1	Polycystic kidney disease type 4	NM_138694.3	NM_138694.3:c.12027C>G, NM_138694.3:c.11363_11372delCTTCCCTGGA, NM_138694.3:c.10452dupT, NM_138694.3:c.10412T>G, NM_138694.3:c.10219C>T, NM_138694.3:c.9719G>A, NM_138694.3:c.9689delA, NM_138694.3:c.9530T>C, NM_138694.3:c.9370C>T, NM_138694.3:c.8870T>C, NM_138694.3:c.8824C>T, NM_138694.3:c.8408G>A, NM_138694.3:c.8407T>C, NM_138694.3:c.8317G>T, NM_138694.3:c.6499C>T, NM_138694.3:c.5895dupA, NM_138694.3:c.5325_5326delAG, NM_138694.3:c.4870C>T, NM_138694.3:c.3940delA, NM_138694.3:c.3766delC, NM_138694.3:c.3761_3762delCCinsG, NM_138694.3:c.3367G>A, NM_138694.3:c.3229-2A>C, NM_138694.3:c.2854G>A, NM_138694.3:c.2827_2828delGA, NM_138694.3:c.2452C>T, NM_138694.3:c.2414C>T, NM_138694.3:c.2341C>T, NM_138694.3:c.1486C>T, NM_138694.3:c.982C>T, NM_138694.3:c.930delC, NM_138694.3:c.682A>G, NM_138694.3:c.664A>G, NM_138694.3:c.370C>T, NM_138694.3:c.353delG, NM_138694.3:c.107C>T, NM_138694.3:c.85G>T	Polycystic kidney disease type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKHD1 gene located on chromosomal region 6p12.3-p12.2. The age of onset is early. This disease is a severe form of polycystic kidney disease affecting the kidneys and, in some cases, the hepatic biliary tract. Up to 50% of the affected neonates die shortly after birth, as a result of severe pulmonary hypoplasia and secondary respiratory insufficiency. In the subset that survives the perinatal period, morbidity and mortality are mainly related to severe systemic hypertension, renal insufficiency, and portal hypertension due to portal-tract fibrosis.	600,25
PKLR	Pyruvate kinase deficiency	NM_000298.5	NM_000298.5:c.1675C>T, NM_000298.5:c.1529G>A, NM_000298.5:c.1528C>T, NM_000298.5:c.1456C>T, NM_000298.5:c.1436G>A, NM_000298.5:c.1261C>A, NM_000298.5:c.1151C>T, NM_000298.5:c.721G>T	Pyruvate kinase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKLR gene located on chromosomal region 1q22. The age of onset is early. This disease is characterized by highly variable degree of chronic hemolysis, with severe neonatal jaundice and fatal anemia at birth, severe transfusion-dependent chronic hemolysis, and moderate hemolysis with exacerbation during infection. The prevalence is 1:20,000.	600,25
PLCE1	Nephrotic syndrome, type 3	NM_016341.3	NM_016341.3:c.961C>T, NM_016341.3:c.3346C>T, NM_016341.3:c.3736C>T, NM_016341.3:c.3846delG, NM_016341.3:c.4451C>T, NM_016341.3:c.4809delA, NM_016341.3:c.5560C>T	Nephrotic syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLCE1 gene located on chromosomal region 10q23.33. The age of onset is variable. This disease is characterized by low blood protein levels, high cholesterol levels, high triglyceride levels, and presence of protein in the urine. The prevalence is 2:100,000-7:100,000 Children; 3:100,000 adults.	600,25
PLG	Plasminogen deficiency, type I	NM_000301.3	NM_000301.3:c.112A>G, NM_000301.3:c.693_695delGAA, NM_000301.3:c.704G>A, NM_000301.3:c.1120G>T, NM_000301.3:c.1435G>T, NM_000301.3:c.1848G>A	Plasminogen deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLG gene located on chromosomal region 6q26. The age of onset is infantile.This disease is characterized by markedly impaired extracellular fibrinolysis leading to the formation of ligneous (fibrin-rich) pseudomembranes on mucosae during wound healing. The prevalence is 1:1,000,000-9:1,000,000.	600,25
PMM2	Congenital disorder of glycosylation, type 1a	NM_000303.2	NM_000303.2:c.26G>A, NM_000303.2:c.53C>G, NM_000303.2:c.95T>G, NM_000303.2:c.95_96delTAinsGC, NM_000303.2:c.97C>T, NM_000303.2:c.109C>T, NM_000303.2:c.131T>C, NM_000303.2:c.190delT, NM_000303.2:c.193G>T, NM_000303.2:c.255+2T>C, NM_000303.2:c.256-1G>C, NM_000303.2:c.323C>T, NM_000303.2:c.338C>T, NM_000303.2:c.349G>C, NM_000303.2:c.357C>A, NM_000303.2:c.368G>A, NM_000303.2:c.385G>A, NM_000303.2:c.395T>C, NM_000303.2:c.415G>A, NM_000303.2:c.422G>A, NM_000303.2:c.442G>A, NM_000303.2:c.470T>C, NM_000303.2:c.484C>T, NM_000303.2:c.563A>G, NM_000303.2:c.620T>C, NM_000303.2:c.623G>C, NM_000303.2:c.647A>T, NM_000303.2:c.652C>G, NM_000303.2:c.669C>G, NM_000303.2:c.677C>G, NM_000303.2:c.691G>A, NM_000303.2:c.710C>G, NM_000303.2:c.710C>T	Congenital disorder of glycosylation type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PMM2 gene located on chromosomal region 16p13.2. The age of onset is infantile. This disease is characterized by highly variable clinical manifestations that may include feeding problems, vomiting, and diarrhea with failure to thrive in infants, and severe encephalopathy with axial hypotonia, abnormal eye movement, marked psychomotor retardation, peripheral neuropathy, cerebellar hypoplasia, stroke-like episodes, and retinitis pigmentosa in late infancy, childhood or adulthood.	600,25
POLG	Mitochondrial DNA depletion syndrome 4A (Alpers type)	NM_001126131.1	NM_001126131.1:c.3644-1G>A, NM_001126131.1:c.3630dupC, NM_001126131.1:c.3286C>T, NM_001126131.1:c.3218C>T, NM_001126131.1:c.3151G>C, NM_001126131.1:c.2794C>T, NM_001126131.1:c.2617G>T, NM_001126131.1:c.2605C>T, NM_001126131.1:c.2591A>G, NM_001126131.1:c.2557C>T, NM_001126131.1:c.2542G>A, NM_001126131.1:c.2243G>C, NM_001126131.1:c.2209G>C, NM_001126131.1:c.1879C>T, NM_001126131.1:c.1760C>T, NM_001126131.1:c.1754G>A, NM_001126131.1:c.1437C>G, NM_001126131.1:c.1399G>A, NM_001126131.1:c.1120C>T, NM_001126131.1:c.911T>G, NM_001126131.1:c.752C>T	Mitochondrial DNA depletion syndrome, Alpers type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by the clinical triad of psychomotor regression, seizures, and liver disease. The prevalence is 1:1,600 newborn.	600,25
POMGNT1	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3	NM_001243766.1	NM_001243766.1:c.1864delC, NM_001243766.1:c.1814G>C, NM_001243766.1:c.1545delC, NM_001243766.1:c.1539+1G>T, NM_001243766.1:c.1539+1G>A, NM_001243766.1:c.1469G>A, NM_001243766.1:c.1425G>A, NM_001243766.1:c.1411A>T, NM_001243766.1:c.1274G>C, NM_001243766.1:c.932G>A, NM_001243766.1:c.931C>T, NM_001243766.1:c.880-1G>A, NM_001243766.1:c.652+1G>A, NM_001243766.1:c.636C>T, NM_001243766.1:c.187C>T, NM_001243766.1:c.92dupA	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3 which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMGNT1 gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent psychomotor development, eye involvement and seizures. The prevalence is 1-9:100,000.	600,25
POMT1	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1	NM_007171.3	NM_007171.3:c.193G>A, NM_007171.3:c.226G>A, NM_007171.3:c.598G>C, NM_007171.3:c.793C>T, NM_007171.3:c.831C>G, NM_007171.3:c.907C>T, NM_007171.3:c.1153C>T, NM_007171.3:c.1242-2A>G, NM_007171.3:c.1261dupC, NM_007171.3:c.1280_1281delAGinsTC, NM_007171.3:c.1540C>T, NM_007171.3:c.1545C>G, NM_007171.3:c.1746G>C, NM_007171.3:c.1770G>C, NM_007171.3:c.2005G>A, NM_007171.3:c.2163C>A, NM_007171.3:c.2167dupG	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 gene located on chromosomal region 9q34.13. Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies (type A), which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), is a genetically heterogeneous disorder with characteristic brain and eye malformations, profound mental retardation, congenital muscular dystrophy, and early death. The phenotype commonly includes cobblestone (type II) lissencephaly, cerebellar malformations, and retinal malformations.	600,25
POMT2	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2	NM_013382.5	NM_013382.5:c.2243G>C, NM_013382.5:c.2177G>A, NM_013382.5:c.1997A>G, NM_013382.5:c.1941G>A, NM_013382.5:c.1912C>T, NM_013382.5:c.1726-2A>G, NM_013382.5:c.1608_1609delCA, NM_013382.5:c.1445G>T, NM_013382.5:c.1417C>T, NM_013382.5:c.1057G>A, NM_013382.5:c.1045_1052delCGGATGGCinsG, NM_013382.5:c.551C>T	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT2 gene located on chromosomal region 14q24.3. Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies (type A), which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), is a genetically heterogeneous disorder with characteristic brain and eye malformations, profound mental retardation, congenital muscular dystrophy, and early death. The phenotype commonly includes cobblestone (type II) lissencephaly, cerebellar malformations, and retinal malformations.	600,25
PPT1	Ceroid lipofuscinosis, neuronal, type 1	NM_000310.3	NM_000310.3:c.840dupA, NM_000310.3:c.627+1G>T, NM_000310.3:c.541G>T, NM_000310.3:c.451C>T, NM_000310.3:c.223A>C, NM_000310.3:c.169dupA, NM_000310.3:c.29T>A	Neuronal ceroid lipofuscinoses, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PPT1 gene located on chromosomal region 1p32. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 1.5:1,000,000-9:1,000,000.	600,25
PROM1	Retinitis pigmentosa, type 41	NM_006017.2	NM_006017.2:c.2490-2A>G, NM_006017.2:c.1841delG, NM_006017.2:c.1726C>T, NM_006017.2:c.1354dupT, NM_006017.2:c.1177_1178delAT, NM_006017.2:c.199C>T	Retinitis pigmentosa, type 41 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROM1 gene located on chromosomal region 4p15.32. The age of onset is early. This disease is characterized by night blindness often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 19:100,000-27:100,000.	600,25
PYGM	McArdle disease	NM_005609.3	NM_005609.3:c.2392T>C, NM_005609.3:c.2262delA, NM_005609.3:c.2128_2130delTTC, NM_005609.3:c.1963G>A, NM_005609.3:c.1827G>A, NM_005609.3:c.1768+1G>A, NM_005609.3:c.1726C>T, NM_005609.3:c.1722T>G, NM_005609.3:c.1628A>C, NM_005609.3:c.1621G>T, NM_005609.3:c.1466C>G, NM_005609.3:c.613G>A, NM_005609.3:c.501dupT, NM_005609.3:c.393delG, NM_005609.3:c.280C>T, NM_005609.3:c.255C>A, NM_005609.3:c.148C>T, NM_005609.3:c.13_14delCT, NM_005609.3:c.1A>G	McArdle disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PYGM gene located on chromosomal region 11q13.1. The age of onset is infantile. This disease is characterized by muscular exercise intolerance with myalgia, cramps, fatigue, and muscle weakness.	600,25
RAG1	Omenn syndrome; Severe combined immunodeficiency, B cell-negative	NM_000448.2	NM_000448.2:c.256_257delAA, NM_000448.2:c.940C>T, NM_000448.2:c.983G>A, NM_000448.2:c.1681C>T, NM_000448.2:c.1682G>A, NM_000448.2:c.2164G>A, NM_000448.2:c.2320G>T, NM_000448.2:c.2326C>T, NM_000448.2:c.2333G>A, NM_000448.2:c.2814T>G, NM_000448.2:c.2923C>T	Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. Severe combined immunodeficiency, autosomal recessive, T cell-negative (T-), B cell negative (B-), NK cell positive (NK+) is also caused by mutation in the RAG1 and RAG2 genes. This disease is characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development. Without treatment, patients usually die within the first year of life.	600,25
RAPSN	Fetal akinesia deformation sequence	NM_005055.4	NM_005055.4:c.848T>C, NM_005055.4:c.807C>A, NM_005055.4:c.566C>T, NM_005055.4:c.490C>T, NM_005055.4:c.484G>A, NM_005055.4:c.416T>C, NM_005055.4:c.264C>A	Fetal akinesia deformation sequence follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by multiple joint contractures, facial anomalies and pulmonary hypoplasia. The prevalence is 1:3,000.	600,25
RAX	Isolated microphthalmia, type 3	NM_013435.2	NM_013435.2:c.909C>G, NM_013435.2:c.439C>T, NM_013435.2:c.383_384delAG, NM_013435.2:c.18C>A	Isolated microphthalmia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAX gene located on chromosomal region 18q21.32. Microphthalmia designates a heterogeneous group of ocular malformations with a more or less evident reduction in the size of the eyeball. Additional features include high hypermetropia and a short axial length.	600,25
RDH12	Leber congenital amaurosis, type 13	NM_152443.2	NM_152443.2:c.146C>T, NM_152443.2:c.152T>A, NM_152443.2:c.184C>T, NM_152443.2:c.210dupC, NM_152443.2:c.295C>A, NM_152443.2:c.377C>T, NM_152443.2:c.379G>T, NM_152443.2:c.451C>A, NM_152443.2:c.451C>G, NM_152443.2:c.464C>T, NM_152443.2:c.523T>C, NM_152443.2:c.565C>T, NM_152443.2:c.677A>G, NM_152443.2:c.806_810delCCCTG	Leber congenital amaurosis type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDH12 gene located on chromosomal region 14q24.1. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.	600,25
RGR	Retinitis pigmentosa, type 44	NM_002921.3	NM_002921.3:c.262_269dupGGCTCGGA, NM_002921.3:c.273_274insGGCTCGGA, NM_002921.3:c.877C>T	Retinitis pigmentosa type 44 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RGR gene located on chromosomal region 10q23.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	600,25
RHO	Retinitis pigmentosa, type 4, autosomal recessive	NM_000539.3	NM_000539.3:c.173C>T, NM_000539.3:c.448G>A, NM_000539.3:c.620T>G, NM_000539.3:c.745G>T	Retinitis pigmentosa type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RHO gene located on chromosomal region 3q22.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.	600,25
RLBP1	Bothnia retinal dystrophy	NM_000326.4	NM_000326.4:c.700C>T, NM_000326.4:c.452G>A, NM_000326.4:c.333T>G	Bothnia retinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RLBP1 gene located on chromosomal region 15q26.1. This disease is characterized by night blindness from early childhood with features consistent with retinitis punctata albescens and macular degeneration. The prevalence is unknown.	600,25
RPE65	Leber congenital amaurosis, type 2	NM_000329.2	NM_000329.2:c.1543C>T, NM_000329.2:c.1355T>G, NM_000329.2:c.1292A>G, NM_000329.2:c.1102T>C, NM_000329.2:c.1087C>A, NM_000329.2:c.1067delA, NM_000329.2:c.1022T>C, NM_000329.2:c.907A>T, NM_000329.2:c.514_515delGT, NM_000329.2:c.271C>T	Leber congenital amaurosis 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus.	600,25
RPGRIP1L	Joubert syndrome, type 7; Meckel syndrome, type 5; COACH syndrome	NM_015272.4	NM_015272.4:c.3634_3637delGAAA, NM_015272.4:c.2794_2795delTT, NM_015272.4:c.2614C>T, NM_015272.4:c.2413C>T, NM_015272.4:c.2050C>T, NM_015272.4:c.1975T>C, NM_015272.4:c.1843A>C, NM_015272.4:c.1329dupA, NM_015272.4:c.1326_1329delAAAA, NM_015272.4:c.776+1G>A, NM_015272.4:c.757C>T, NM_015272.4:c.697A>T, NM_015272.4:c.394A>T	Joubert syndrome (JBTS) type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. JBTS is characterized by congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (less common in JBTS7) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. RPGRIP1L gene is also associated with Meckel syndrome type 5, a rare, autosomal recessive lethal condition characterized by central nervous system malformations, postaxial, polydactyly, multicystic kidney dysplasia, and ductal proliferation in the portal area of the liver. Other phenotype associated is COACH syndrome, an autosomal recessive disorder characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable. COACH syndrome is considered by some to be a subtype of Joubert syndrome with congenital hepatic fibrosis.	600,25
RYR1	Minicore myopathy with external ophthalmoplegia	NM_000540.2	NM_000540.2:c.325C>T, NM_000540.2:c.487C>T, NM_000540.2:c.631+2T>C, NM_000540.2:c.738T>G, NM_000540.2:c.1021G>A, NM_000540.2:c.1186G>T, NM_000540.2:c.1205T>C, NM_000540.2:c.1739_1742dupATCA, NM_000540.2:c.1841G>T, NM_000540.2:c.4076delG, NM_000540.2:c.4405C>T, NM_000540.2:c.5333C>A, NM_000540.2:c.5726_5727delAG, NM_000540.2:c.6082C>T, NM_000540.2:c.6104A>T, NM_000540.2:c.6721C>T, NM_000540.2:c.7268T>A, NM_000540.2:c.7300G>A, NM_000540.2:c.7360C>T, NM_000540.2:c.7373G>A, NM_000540.2:c.7463_7475delCAAAGATGTCAGC, NM_000540.2:c.7781C>A, NM_000540.2:c.7836-1G>A, NM_000540.2:c.9000+1G>T, NM_000540.2:c.9905dupC, NM_000540.2:c.10343C>T, NM_000540.2:c.10579C>T, NM_000540.2:c.13480G>T, NM_000540.2:c.14126C>T, NM_000540.2:c.14365-2A>T, NM_000540.2:c.14545G>A	Multiminicore disease (MMD) is an inherited neuromuscular disorder defined pathologically by the presence of multiple areas of reduced mitochondrial oxidative activity running along a limited extent of the longitudinal axis of the muscle fiber, so-called 'minicores.' These regions show sarcomere disorganization and mitochondria depletion. Typically, no dystrophic signs, such as muscle fiber necrosis or regeneration or significant endomysial fibrosis, are present. MMD is a pathologic diagnosis and shows clinical and genetic heterogeneity. Affected individuals have clinical features of a congenital myopathy, including neonatal hypotonia, delayed motor development, and generalized muscle weakness and amyotrophy, which may progress slowly or remain stable (Ferreiro and Fardeau, 2002).Patients with recessive mutations in the RYR1 gene typically show severe congenital muscular dystrophy with ophthalmoplegia, although there is phenotypic variability. Some patients may present in utero with fetal akinesia, arthrogryposis, and lung hypoplasia resulting in fetal or perinatal death (McKie et al., 2014). Skeletal muscle biopsy of patients with recessive RYR1 mutations show variable features, including central cores (Jungbluth et al., 2007), congenital fiber-type disproportion (CFTD) (Monnier et al., 2009), and centronuclear myopathy (Wilmshurst et al., 2010).	600,25
SACS	Spastic ataxia, Charlevoix-Saguenay, type	NM_014363.5	NM_014363.5:c.13237C>T, NM_014363.5:c.12160C>T, NM_014363.5:c.8844delT, NM_014363.5:c.7504C>T, NM_014363.5:c.6563T>A, NM_014363.5:c.6355C>T, NM_014363.5:c.5618_5619delAT, NM_014363.5:c.4933C>T, NM_014363.5:c.3198T>A, NM_014363.5:c.994A>T, NM_014363.5:c.517C>T	Spastic ataxia, Charlevoix-Saguenay type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SACS gene located on chromosomal region 13q11. The age of onset is early. This disease is characterized by early-onset cerebellar ataxia with spasticity, a pyramidal syndrome and peripheral neuropathy. The prevalence is 1:1,500-1:2,000.	600,25
SAG	Oguchi disease, type 1	NM_000541.4	NM_000541.4:c.298dupG, NM_000541.4:c.523C>T, NM_000541.4:c.577C>T, NM_000541.4:c.874C>T, NM_000541.4:c.916G>T, NM_000541.4:c.926delA, NM_000541.4:c.993C>G	Oguchi disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SAG gene located on chromosomal region 2q37. The age of onset is infantile. This disease is characterized by congenital stationary night blindness and the Mizuo-Nakamura phenomenon which is a unique morphological and functional abnormality of the retina that presents with a typical golden-yellow or silver-gray discoloration of the fundus in the presence of light that disappears after dark-adaptation and appears again after the onset of light.	600,25
SBDS	Shwachman-Diamond syndrome	NM_016038.2	NM_016038.2:c.377G>C, NM_016038.2:c.258+2T>C, NM_016038.2:c.184A>T, NM_016038.2:c.183_184delTAinsCT, NM_016038.2:c.120delG	Shwachman-Diamond syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBDS gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by chronic and usually mild neutropenia, pancreatic exocrine insufficiency associated with steatorrhea and growth failure, skeletal dysplasia with short stature, and an increased risk of bone marrow aplasia or leukemic transformation, cutaneous (eczema or ichthyosis) and dental anomalies, and psychomotor retardation. The prevalence is 1:76,000 newborn.	600,25
SCNN1B	Pseudohypoaldosteronism, type 1	NM_000336.2	NM_000336.2:c.109G>A	Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.	600,25
SCNN1G	Pseudohypoaldosteronism, type 1	NM_001039.3	NM_001039.3:c.600dupA, NM_001039.3:c.1373+2T>C, NM_001039.3:c.1570-1G>A, NM_001039.3:c.1627delG	Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.	600,25
SETX	Spinocerebellar ataxia, autosomal recessive, type 1	NM_015046.5	NM_015046.5:c.6848_6851delCAGA, NM_015046.5:c.6834_6839delAACAAA, NM_015046.5:c.5927T>G, NM_015046.5:c.5630delG, NM_015046.5:c.5549-1G>T, NM_015046.5:c.5308_5311delGAGA, NM_015046.5:c.4087C>T, NM_015046.5:c.2602C>T, NM_015046.5:c.1166T>C, NM_015046.5:c.1027G>T, NM_015046.5:c.994C>T	Spinocerebellar ataxia with axonal neuropathy type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SETX gene located on chromosomal region 9q34.13. The age of onset is infantile. This disease is characterized by progressive cerebellar ataxia, axonal sensorimotor neuropathy with oculomotor apraxia, fixation instability, extrapyramidal features and an elevated serum alpha-fetoprotein level. The prevalence is 4:100,000-8:100,000.	600,25
SGCA	Muscular dystrophy, limb-girdle, type 2D	NM_000023.3	NM_000023.3:c.101G>A, NM_000023.3:c.229C>T, NM_000023.3:c.371T>C, NM_000023.3:c.518T>C, NM_000023.3:c.574C>T, NM_000023.3:c.739G>A, NM_000023.3:c.850C>T, NM_000023.3:c.903_904dupCC	Autosomal recessive limb-girdle muscular dystrophy type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCA gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness and calf pseudohypertrophy. The prevalence is 1:1,000,000-9:1,000,000.	600,25
SGCG	Muscular dystrophy, limb-girdle, type 2C	NM_000231.2	NM_000231.2:c.89delG, NM_000231.2:c.195+4_195+7delAGTA, NM_000231.2:c.505+1G>A, NM_000231.2:c.525delT, NM_000231.2:c.787G>A, NM_000231.2:c.848G>A	Autosomal recessive limb-girdle muscular dystrophy type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCG gene located on chromosomal region 13q12.12. The age of onset is variable. This disease is characterized by limb-girdle weakness, calf hypertrophy, diaphragmatic weakness, and variable cardiac abnormalities.	600,25
SGSH	Mucopolysaccharidosis, type 3A (Sanfilippo A)	NM_000199.3	NM_000199.3:c.1380delT, NM_000199.3:c.1339G>A, NM_000199.3:c.1298G>A, NM_000199.3:c.1167C>A, NM_000199.3:c.892T>C, NM_000199.3:c.877C>T, NM_000199.3:c.757delG, NM_000199.3:c.617G>C, NM_000199.3:c.466A>T, NM_000199.3:c.449G>A, NM_000199.3:c.383C>T, NM_000199.3:c.364G>A, NM_000199.3:c.337_345delCAAGCTGGTinsGCACAGGTGAG, NM_000199.3:c.320delT, NM_000199.3:c.235A>C, NM_000199.3:c.220C>T, NM_000199.3:c.197C>G, NM_000199.3:c.130G>A	Mucopolysaccharidosis type 3A (Sanfilippo syndrome type A) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGSH gene located on chromosomal region 17q25.3. The age of onset is infantile. This disease is characterized by behavioural disorders (hyperkinesia, aggressiveness) and intellectual deterioration, sleep disorders and very mild dysmorphism. The prevalence is >1:70,000 newborn.	600,25
SH3TC2	Charcot-Marie-Tooth disease, type 4C	NM_024577.3	NM_024577.3:c.3676-1G>A, NM_024577.3:c.3601C>T, NM_024577.3:c.3341delC, NM_024577.3:c.3326G>C, NM_024577.3:c.3325C>T, NM_024577.3:c.2993_2994insC, NM_024577.3:c.2860C>T, NM_024577.3:c.2829T>G, NM_024577.3:c.2710C>T, NM_024577.3:c.2491_2492delAG, NM_024577.3:c.2191delG, NM_024577.3:c.1982T>C, NM_024577.3:c.1972C>T, NM_024577.3:c.1969G>A, NM_024577.3:c.1747_1748delAG, NM_024577.3:c.1724T>A, NM_024577.3:c.1586G>A, NM_024577.3:c.920G>A, NM_024577.3:c.735G>A, NM_024577.3:c.530-2A>G, NM_024577.3:c.217_227delGCTGCTCGGAGinsCCAGTAA, NM_024577.3:c.53-1G>C, NM_024577.3:c.52+1delG, NM_024577.3:c.28delG	Charcot-Marie-Tooth disease, type 4C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SH3TC2 gene located on chromosomal region 5q32. The age of onset is infantile. This disease is characterized by scoliosis or kyphoscoliosis, neuropathy, foot deformities, respiratory insufficiency, hypoacousis and deafness.	600,25
SLC12A1	Bartter syndrome, type 1	NM_000338.2	NM_000338.2:c.223C>T, NM_000338.2:c.628+2T>C, NM_000338.2:c.814G>T, NM_000338.2:c.1875G>A, NM_000338.2:c.1942G>A, NM_000338.2:c.2805dupA, NM_000338.2:c.2952_2955delCAAA	Bartter syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A1 gene located on chromosomal region 15q15-21. The age of onset is infantile. This disease is characterized by polyhydramnios, premature delivery, polyuria, dehydration, hypercalciuria and nephrocalcinosis. The prevalence is 1:1,000,000.	600,25
SLC17A5	Salla disease	NM_012434.4	NM_012434.4:c.1259+1G>A, NM_012434.4:c.406A>G, NM_012434.4:c.115C>T, NM_012434.4:c.43G>T	Salla disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC17A5 gene located on chromosomal region 6q13. The age of onset is from infantile to adult forms. The main symptoms are hypotonia, cerebellar ataxia, and mental retardation; visceromegaly and coarse features are also present in the infantile cases.	600,25
SLC26A2	Achondrogenesis, type 1B (diastrophic dysplasia)	NM_000112.3	NM_000112.3:c.496G>A, NM_000112.3:c.532C>T, NM_000112.3:c.833delC, NM_000112.3:c.835C>T, NM_000112.3:c.1020_1022delTGT, NM_000112.3:c.1273A>G, NM_000112.3:c.1361A>C, NM_000112.3:c.1535C>A, NM_000112.3:c.1724delA, NM_000112.3:c.1878delG, NM_000112.3:c.1957T>A, NM_000112.3:c.2033G>T	Achondrogenesis type 1B (diastrophic dysplasia) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by severe micromelia with very short fingers and toes, a flat face, a short neck, thickened soft tissue around the neck, hypoplasia of the thorax, protuberant abdomen, a hydropic fetal appearance and distinctive histological features of the cartilage. The prevalence is 1:20,000.	600,25
SLC26A4	Deafness, autosomal recessive, type 4	NM_000441.1	NM_000441.1:c.269C>T, NM_000441.1:c.281C>T, NM_000441.1:c.412G>T, NM_000441.1:c.554G>C, NM_000441.1:c.563T>C, NM_000441.1:c.626G>T, NM_000441.1:c.707T>C, NM_000441.1:c.916dupG, NM_000441.1:c.918+2T>C, NM_000441.1:c.919-2A>G, NM_000441.1:c.961A>T, NM_000441.1:c.1001G>T, NM_000441.1:c.1001+1G>T, NM_000441.1:c.1003T>C, NM_000441.1:c.1034T>A, NM_000441.1:c.1151A>G, NM_000441.1:c.1174A>T, NM_000441.1:c.1198delT, NM_000441.1:c.1226G>A, NM_000441.1:c.1229C>T, NM_000441.1:c.1246A>C, NM_000441.1:c.1263+1G>A, NM_000441.1:c.1334T>G, NM_000441.1:c.1489G>A, NM_000441.1:c.1707+5G>A, NM_000441.1:c.1975G>C, NM_000441.1:c.2048T>C, NM_000441.1:c.2162C>T, NM_000441.1:c.2168A>G	Autosomal recessive nonsyndromic sensorineural deafness type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	600,25
SLC37A4	Glycogen storage disease, type 1b	NM_001164278.1	NM_001164278.1:c.1309C>T, NM_001164278.1:c.1190-2_1190-1delAG, NM_001164278.1:c.1129G>T, NM_001164278.1:c.1108_1109delCT, NM_001164278.1:c.1082G>A, NM_001164278.1:c.1081G>T, NM_001164278.1:c.706_708delGTG, NM_001164278.1:c.352T>C, NM_001164278.1:c.287G>A, NM_001164278.1:c.83G>A	Glycogen storage disease due to glucose-6-phosphatase deficiency type 1b follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC37A4 gene located on chromosomal region 11q23. The age of onset is early. This disease is characterized by impairment of terminal steps of glycogenolysis and gluconeogenesis. Patients manifest a wide range of clinical symptoms and biochemical abnormalities, including hypoglycemia, severe hepatomegaly due to excessive accumulation of glycogen, kidney enlargement, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. Glycogen storage disease type 1B patients also present a tendency towards infections associated with neutropenia, relapsing aphthous gingivostomatitis, and inflammatory bowel disease. The incidence is 1:100,000.	600,25
SLC4A11	Corneal endothelial dystrophy, autosomal recessive	NM_001174090.1	NM_001174090.1:c.2687G>A, NM_001174090.1:c.2686C>T, NM_001174090.1:c.2647A>G, NM_001174090.1:c.2609T>C, NM_001174090.1:c.2345G>A, NM_001174090.1:c.2314_2321dupTATGACAC, NM_001174090.1:c.2305G>A, NM_001174090.1:c.1894C>T, NM_001174090.1:c.1547C>T, NM_001174090.1:c.1544G>A, NM_001174090.1:c.1472G>A, NM_001174090.1:c.1119_1120insA, NM_001174090.1:c.718T>C, NM_001174090.1:c.554_561delGCTTCGCC	Congenital hereditary endothelial dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by a diffuse ground-glass appearance of the corneas and marked corneal thickening from birth with nystagmus, and blurred vision.	600,25
SMN1	Spinal muscular atrophy	-0	del ex7, del ex7-8	Spinal muscular atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMN1 gene located on chromosomal region 5q13.2. The age of onset is variable. This disease comprise a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. Autosomal recessive forms are classified according to the age of onset, the maximum muscular activity achieved, and survivorship. The severity of the disease is mainly determined by the copy number of SMN2, a copy gene which predominantly produces exon 7-skipped transcripts and only low amount of full-length transcripts that encode for a protein identical to SMN1. Only about 4% of patients bear one SMN1 copy with an intragenic mutation. Type 1 is a severe form, with onset before 6 months of age. Patients never achieve the ability to sit. Type 2 has intermediate severity, with onset between 6 and 18 months. Patients do not reach the motor milestone of standing, and survive into adulthood. Type 3 onset is after 18 months. Patients develop ability to stand and walk and survive into adulthood. Type 4 onset is in adulthood, disease progression is slow, and patients can stand and walk. The incidence is 1:10,000 and the prevalence is 1:80,000.	600,25
SMPD1	Niemann-Pick disease, type A and type B	NM_000543.4	NM_000543.4:c.96G>A, NM_000543.4:c.103_107delCTGGT, NM_000543.4:c.106delG, NM_000543.4:c.354delC, NM_000543.4:c.475T>C, NM_000543.4:c.557C>T, NM_000543.4:c.564delC, NM_000543.4:c.564dupC, NM_000543.4:c.573delT, NM_000543.4:c.688C>T, NM_000543.4:c.730G>A, NM_000543.4:c.740delG, NM_000543.4:c.739G>A, NM_000543.4:c.742G>A, NM_000543.4:c.757G>C, NM_000543.4:c.788T>A, NM_000543.4:c.842_849dupTCCCCGCA, NM_000543.4:c.911T>C, NM_000543.4:c.996delC, NM_000543.4:c.1092-1G>C, NM_000543.4:c.1117C>T, NM_000543.4:c.1152G>A, NM_000543.4:c.1264-1G>T, NM_000543.4:c.1267C>T, NM_000543.4:c.1299T>G, NM_000543.4:c.1327C>T, NM_000543.4:c.1420_1421delCT, NM_000543.4:c.1426C>T, NM_000543.4:c.1624C>T, NM_000543.4:c.1630delA, NM_000543.4:c.1805G>A, NM_000543.4:c.1829_1831delGCC	Niemann-Pick disease, type A and type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMPD1 gene located on chromosomal region 11p15.4. The clinical phenotype ranges from a severe infantile form with neurologic degeneration resulting in death usually by 3 years of age (type A) to a later-onset nonneurologic form (type B) that is compatible with survival into adulthood. Since intermediate cases also have been reported, the disease is best regarded a single entity with a clinical spectrum.	600,25
SPG11	Amyotrophic lateral sclerosis, type 5, juvenile	NM_025137.3	NM_025137.3:c.7152-1G>C, NM_025137.3:c.6847_6848dupTC, NM_025137.3:c.6805_6806delCT, NM_025137.3:c.6100C>T, NM_025137.3:c.5623C>T, NM_025137.3:c.1736-1G>C, NM_025137.3:c.1339_1342dupGGCT, NM_025137.3:c.733_734delAT, NM_025137.3:c.529_533delATATT, NM_025137.3:c.342delT, NM_025137.3:c.118C>T	Amyotrophic lateral sclerosis, type 5, juvenile follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG11 gene located on chromosomal region 15q21.1. The age of onset is infancy/childhood. This disease is characterized by progressive upper and lower motor neuron degeneration causing facial spasticity, dysarthria, and gait disorders with onset before 25 years of age. The prevalence is <1/1,000,000.	600,25
SPG7	Spastic paraplegia, type 7, autosomal recessive	NM_003119.3	NM_003119.3:c.233T>A, NM_003119.3:c.286+1G>T, NM_003119.3:c.679C>T, NM_003119.3:c.758+2T>C, NM_003119.3:c.773_774delTG, NM_003119.3:c.1045G>A, NM_003119.3:c.1124delG, NM_003119.3:c.1529C>T, NM_003119.3:c.1676delA, NM_003119.3:c.1749G>C, NM_003119.3:c.2075G>C	Spastic paraplegia type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG7 gene located on chromosomal region 16q24.3. The age of onset is adult. This disease is characterized by by progressive muscle stiffness (spasticity) and the development of paralysis of the lower limbs (paraplegia) due to degeneration of corticospinal axons. The prevalence is 1:100,000-9:100,000.	600,25
STRC	Deafness, autosomal recessive, type 16	NM_153700.2	NM_153700.2:c.5188C>T, NM_153700.2:c.5185C>T, NM_153700.2:c.5168_5171delTTCT, NM_153700.2:c.4560dupC, NM_153700.2:c.4545+1G>C, NM_153700.2:c.3556C>T	Autosomal recessive nonsyndromic sensorineural deafness type DFNB16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRC gene located on chromosomal region 15q15.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	600,25
TCAP	Muscular dystrophy, limb-girdle, type 2G	NM_003673.3	NM_003673.3:c.157C>T	Autosomal recessive limb-girdle muscular dystrophy type 2G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by muscle weakness in the four limbs, mild scapular winging, severe atrophy of the quadriceps and anterior tibialis muscles, calf hypertrophy, and lack of respiratory and cardiac involvement.	600,25
TCIRG1	Osteopetrosis, autosomal recessive, type 1	NM_006019.3	NM_006019.3:c.115_116delGA, NM_006019.3:c.1213G>A, NM_006019.3:c.1331G>T, NM_006019.3:c.1674-1G>A, NM_006019.3:c.2236+1G>A	Autosomal recessive osteopetrosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCIRG1 gene located on chromosomal region 11q13.2. The age of onset is early. This disease is characterized by bone marrow failure, fractures and visual impairment. The incidence is 1:200.000 live births and the prevalence is 1:250,000.	600,25
TERT	Dyskeratosis congenita, autosomal recessive, type 4	NM_198253.2	NM_198253.2:c.2701C>T, NM_198253.2:c.2431C>T	Dyskeratosis congenita, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TERT gene located on chromosomal region 5p15.33. The age of onset is early. This disease has a wide phenotypic spectrum and age onset. It usually manifests during childhood with the triad of dysplastic nails, lacy reticular pigmentation and atrophy of the skin at the level of the neck and upper chest, and oral leukoplakia. Patients show an increased risk for progressive bone marrow failure and may develop myelodysplastic syndrome or acute myelogenous leukemia at any age (the risk increasing with age). There is also an increased risk for solid tumors, typically squamous cell carcinoma of head and neck (see this term) or anogenital cancer. Various additional clinical findings have been reported and may include: developmental delay, short stature, microcephaly, blepharitis, epiphora, periodontal disease, taurodontism, decreased teeth/root ratio, esophageal stenosis, liver disease, urethral stenosis, osteoporosis, avascular necrosis of femur and/or humerus, premature hair greying/alopecia, or abnormal eyelashes. Individuals with DC are at high risk of pulmonary fibrosis. The prevalence is 1:1,000,000.	600,25
TFR2	Hemochromatosis, type 3	NM_001206855.1	NM_001206855.1:c.2T>A	Hemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000.	600,25
TFR2	Hemochromatosis, type 3	NM_003227.3	NM_003227.3:c.2374G>A, NM_003227.3:c.2343G>A, NM_003227.3:c.2014C>T, NM_003227.3:c.1861_1872delGCCGTGGCCCAG, NM_003227.3:c.1665delC, NM_003227.3:c.1632_1633delGA, NM_003227.3:c.1473+1G>A, NM_003227.3:c.1469T>G, NM_003227.3:c.1330G>A, NM_003227.3:c.1235_1237delACA, NM_003227.3:c.1186C>T, NM_003227.3:c.949C>T, NM_003227.3:c.750C>G, NM_003227.3:c.313C>T	Hemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000.	600,25
TK2	Mitochondrial DNA depletion syndrome , type 2 (myopathic type)	NM_004614.4	NM_004614.4:c.635T>A, NM_004614.4:c.604_606delAAG, NM_004614.4:c.500G>A, NM_004614.4:c.373C>T, NM_004614.4:c.361C>A, NM_004614.4:c.323C>T, NM_004614.4:c.268C>T, NM_004614.4:c.159C>G	Mitochondrial DNA depletion syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TK2 gene located on chromosomal region 16q21. The age of onset is infantile. This disease is characterized by generalized hypotonia, proximal muscle weakness, loss of previously acquired motor skills, poor feeding, and respiratory difficulties leading to respiratory failure and death within a few years after diagnosis. The prevalence is 1.2:100,000.	600,25
TMEM67	Joubert syndrome, type 6; Meckel syndrome, type 3; COACH syndrome	NM_153704.5	NM_153704.5:c.130C>T, NM_153704.5:c.148_149insTAAT, NM_153704.5:c.622A>T, NM_153704.5:c.755T>C, NM_153704.5:c.1046T>C, NM_153704.5:c.1538A>G, NM_153704.5:c.1769T>C, NM_153704.5:c.2498T>C	Joubert syndrome (JBTS) type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22.1. The age of onset is early. JBTS is characterized by congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. The TMEM67 gene is also associated with Meckel syndrome type 3, a rare, autosomal recessive lethal condition characterized by central nervous system malformations, postaxial, polydactyly, multicystic kidney dysplasia, and ductal proliferation in the portal area of the liver. Other phenotype associated with mutations in the TMEM67 gene is COACH syndrome, an autosomal recessive disorder characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable. COACH syndrome is considered by some to be a subtype of Joubert syndrome with congenital hepatic fibrosis.	600,25
TMPRSS3	Deafness, autosomal recessive, type 8/10	NM_024022.2	NM_024022.2:c.1276G>A, NM_024022.2:c.1211C>T, NM_024022.2:c.753G>C, NM_024022.2:c.647G>T, NM_024022.2:c.446+1G>T, NM_024022.2:c.413C>A, NM_024022.2:c.242C>G, NM_024022.2:c.208delC	Autosomal recessive nonsyndromic sensorineural deafness type DFNB10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMPRSS3 gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness.	600,25
TPP1	Ceroid lipofuscinosis, neuronal, type 2	NM_000391.3	NM_000391.3:c.1340G>A, NM_000391.3:c.1093T>C, NM_000391.3:c.851G>T, NM_000391.3:c.827A>T, NM_000391.3:c.622C>T, NM_000391.3:c.616C>T, NM_000391.3:c.509-1G>C, NM_000391.3:c.141_144delGAGT	Neuronal ceroid lipofuscinosis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPP1 gene located on chromosomal region 11p15.4. Age of onset is infantile. This disease is characterized by epilepsy, followed by regression of developmental milestones, myoclonic ataxia, and pyramidal signs. Visual impairment typically appears at age four to six years and rapidly progresses to light/dark awareness only. Life expectancy ranges from age six years to early teenage. The prevalence is 1.5:1,000,000-9:1,000,000.	600,25
TRIOBP	Deafness, autosomal recessive, type 28	NM_001039141.2	NM_001039141.2:c.1039C>T, NM_001039141.2:c.1741C>T, NM_001039141.2:c.2362C>T, NM_001039141.2:c.2639_2640insTCAC, NM_001039141.2:c.3195delT, NM_001039141.2:c.3202C>T, NM_001039141.2:c.4436dupG, NM_001039141.2:c.4577C>G, NM_001039141.2:c.5316G>A	Deafness autosomal recessive type 28 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIOBP gene located on chromosomal region 22q13.1. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.	600,25
TSEN54	Pontocerebellar hypoplasia, type 2A	NM_207346.2	NM_207346.2:c.670_671delAA, NM_207346.2:c.736C>T, NM_207346.2:c.887G>A, NM_207346.2:c.919G>T, NM_207346.2:c.1027C>T, NM_207346.2:c.1039A>T	Pontocerebellar hypoplasia type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSEN54 gene located on chromosomal region 17q25.1. Pontocerebellar hypoplasia (PCH) refers to a group of severe neurodegenerative disorders affecting growth and function of the brainstem and cerebellum, resulting in little or no development. Different types were classified based on the clinical picture and the spectrum of pathologic changes.ﾠ	600,25
TSFM	Combined oxidative phosphorylation deficiency, type 3	NM_001172696.1	NM_001172696.1:c.1_2delAT, NM_001172696.1:c.24_25delCG, NM_001172696.1:c.581delC, NM_001172696.1:c.919C>T	Combined oxidative phosphorylation deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSFM gene located on chromosomal region 12q14.1. The age of onset is early. This disease is characterized by hypotonia, lactic acidosis, and hepatic insufficiency, with progressive encephalomyopathy or hypertrophic cardiomyopathy.	600,25
TSHR	Hypothyroidism, congenital, nongoitrous, type 1	NM_000369.2	NM_000369.2:c.122G>C, NM_000369.2:c.202C>T, NM_000369.2:c.326G>A, NM_000369.2:c.484C>G, NM_000369.2:c.500T>A, NM_000369.2:c.1170T>G, NM_000369.2:c.1742dupC	Hypothyroidism, congenital, nongoitrous, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSHR gene located on chromosomal region 14q31.1. This disease is characterized by increased levels of plasma TSH and low levels of thyroid hormone. Only a subset of patients develop frank hypothyroidism; the remainder are euthyroid and asymptomatic.	600,25
TTN	Limb-girdle muscular dystrophy type 10 (LGMDR10; formerly LGMD2J); Early-onset myopathy with fatal cardiomyopathy	NM_001267550.2	NM_001267550.2:c.107889delA, NM_001267550.2:c.106070_106071delAT, NM_001267550.2:c.104092delC, NM_001267550.2:c.104092C>T, NM_001267550.2:c.98818_98821delTCCA, NM_001267550.2:c.92373_92379delTGAATTC, NM_001267550.2:c.69344C>G, NM_001267550.2:c.60681dupT, NM_001267550.2:c.56648-1G>A, NM_001267550.2:c.52372delG, NM_001267550.2:c.48253delA, NM_001267550.2:c.47915dupT, NM_001267550.2:c.32471-1G>A, NM_001267550.2:c.28300_28303delAGCA, NM_001267550.2:c.16881C>A, NM_001267550.2:c.15796C>T, NM_001267550.2:c.3165-1G>T	LGMDR10 is a severe recessive form of LGMD phenotype with onset in the first to third decades involving weakness of all proximal muscles. Severe disability with loss of ambulation may occur within 20 years (third to sixth decades). Most of the cases are without facial muscle involvement or cardiomyopathy. Some patients later developed distal muscle involvement. Early-onset myopathy with fatal cardiomyopathy (EOMFC), known as Salih myopathy, also follows an autosomal recessive pattern of inheritance. This disease is characterized by skeletal muscle weakness and a form of heart disease called dilated cardiomyopathy. Affected individuals have delayed development of motor skills, such as sitting, standing, and walking. The age of onset is neonatal/infancy. LGMDR10 and EOMFC are caused by pathogenic variants in the TTN gene located on chromosomal region 2q31.2.	600,25
TTPA	Ataxia with isolated vitamin E deficiency	NM_000370.3	NM_000370.3:c.744delA, NM_000370.3:c.661C>T, NM_000370.3:c.575G>A	Ataxia with vitamin E deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTPA gene located on chromosomal region 8q13. The age of onset is variable. This disease is characterized by progressive spino-cerebellar ataxia, loss of proprioception, areflexia, and is associated with a marked deficiency in vitamin E. The prevalence is 0.56:1,000,000-3.5:1,000,000.	600,25
TYR	Albinism, oculocutaneous, type 1A	NM_000372.4	NM_000372.4:c.1A>G, NM_000372.4:c.140G>A, NM_000372.4:c.164G>A, NM_000372.4:c.230G>A, NM_000372.4:c.242C>T, NM_000372.4:c.265T>C, NM_000372.4:c.272G>A, NM_000372.4:c.286dupA, NM_000372.4:c.325G>A, NM_000372.4:c.533G>A, NM_000372.4:c.572delG, NM_000372.4:c.616G>A, NM_000372.4:c.646T>A, NM_000372.4:c.650G>A, NM_000372.4:c.823G>T, NM_000372.4:c.896G>A, NM_000372.4:c.1012_1013insC, NM_000372.4:c.1111A>G, NM_000372.4:c.1118C>A, NM_000372.4:c.1146C>A, NM_000372.4:c.1147G>A, NM_000372.4:c.1164delT, NM_000372.4:c.1177delG, NM_000372.4:c.1209G>T, NM_000372.4:c.1217C>T, NM_000372.4:c.1255G>A, NM_000372.4:c.1265G>A, NM_000372.4:c.1336G>A, NM_000372.4:c.1342G>A, NM_000372.4:c.1467dupT, NM_000372.4:c.1501dupC	Oculocutaneous albinism type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYR gene located on chromosomal region 11q14.2. The age of onset is early. This disease is characterized by white hair and skin, blue, fully translucent irises, nystagmus and misrouting of the optic nerves.	600,25
TYRP1	Albinism, oculocutaneous, type 3	NM_000550.2	NM_000550.2:c.107delT, NM_000550.2:c.176C>G, NM_000550.2:c.497C>G, NM_000550.2:c.1057_1060delAACA, NM_000550.2:c.1067G>A, NM_000550.2:c.1103delA, NM_000550.2:c.1120C>T, NM_000550.2:c.1372_1375dupGACA	Type 3 oculocutaneous albinism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYRP1 gene located on chromosomal region 9p23. The age of onset is early. This disease is characterized by rufous or brown albinism and occurring mainly in the African population. The prevalence is of 1/8,500 individuals in Africa.	600,25
UGT1A1	Crigler-Najjar syndrome, type 2	NM_000463.2	NM_000463.2:c.44T>G, NM_000463.2:c.1021C>T, NM_000463.2:c.1070A>G, NM_000463.2:c.1456T>G	Crigler-Najjar syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by unconjugated hyperbilirubinemia due to reduced and inducible activity of hepatic bilirubin glucuronosyltransferase with pigmented bile that contains bilirubin glucuronides, and generally do not present neurologic or intellectual impairment. Bilirubin encephalopathy may develop in later life when patients experience a superimposed infection or stress.	600,25
USH1C	Usher syndrome, type 1C; Deafness, autosomal recessive, type 18A	NM_153676.3	NM_153676.3:c.2688_2695dupAATTCACC, NM_153676.3:c.2622_2623delCA, NM_153676.3:c.2547-1G>T, NM_153676.3:c.238dupC, NM_153676.3:c.238delC, NM_153676.3:c.216G>A	Usher syndrome type 1C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1C gene located on chromosomal region 11p15.1. This disease is characterized by the association of sensorineural deafness (usually congenital, severe and stable), progressive vision loss caused by retinitis pigmentosa apparent in childhood and balance problems. The prevalence is 4.4:100,000. The USH1C gene is also associated with autosomal recessive nonsyndromic sensorineural deafness type 18A. This phenotype is characterized by profound, prelingual, nonsyndromic sensorineural deafness with normal vestibular and visual function.	600,25
USH2A	Usher syndrome, type 2A	NM_206933.2	NM_206933.2:c.15520-1G>A, NM_206933.2:c.15371delT, NM_206933.2:c.15089C>A, NM_206933.2:c.14803C>T, NM_206933.2:c.14442C>A, NM_206933.2:c.13709delG, NM_206933.2:c.12574C>T, NM_206933.2:c.12234_12235delGA, NM_206933.2:c.11864G>A, NM_206933.2:c.10636G>A, NM_206933.2:c.10561T>C, NM_206933.2:c.10073G>A, NM_206933.2:c.9799T>C, NM_206933.2:c.8981G>A, NM_206933.2:c.7364G>A, NM_206933.2:c.6862G>T, NM_206933.2:c.5743_5744delAG, NM_206933.2:c.5573-2A>G, NM_206933.2:c.4338_4339delCT, NM_206933.2:c.3491_3492delCT, NM_206933.2:c.2898delG, NM_206933.2:c.2299delG, NM_206933.2:c.2276G>T, NM_206933.2:c.2167+5G>A, NM_206933.2:c.2135delC, NM_206933.2:c.920_923dupGCCA, NM_206933.2:c.820C>T, NM_206933.2:c.779T>G	Usher syndrome type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. This disease is characterized by the association of sensorineural deafness (usually congenital, moderate/severe and stable) and progressive vision loss that begins in adolescence or adulthood caused by retinitis pigmentosa. Unlike the other forms of Usher syndrome, type 2 is not associated with vestibular abnormalities that cause difficulties with balance. USH2A accounts for more than half of all cases of Usher syndrome type 2. The estimated prevalence is 3:100,000-4:100,000.	600,25
WFS1	Wolfram syndrome, type 1	NM_001145853.1	NM_001145853.1:c.616C>T, NM_001145853.1:c.676C>T, NM_001145853.1:c.1060_1062delTTC, NM_001145853.1:c.1230_1233delCTCT, NM_001145853.1:c.1234_1237delGTCT, NM_001145853.1:c.1511C>T, NM_001145853.1:c.1943G>A, NM_001145853.1:c.1944G>A, NM_001145853.1:c.2084G>T, NM_001145853.1:c.2643_2644delCT	Wolfram syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WFS1 gene located on chromosomal region 4p16.1. The age of onset is infantile. This disease is characterized by diabetes mellitus type I, diabetes insipidus, optical atrophy and neurological signs. The prevalence is 1:1,000,000-9:1,000,000.	600,25
WHRN	Usher syndrome, type 2D; Deafness, autosomal recessive, type 31	NM_015404.3	NM_015404.3:c.817C>T	Usher syndrome type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WHRN gene located on chromosomal region 9q32. This disease is characterized by the association of sensorineural deafness (usually congenital, moderate/severe and stable) and progressive vision loss that begins in adolescence or adulthood caused by retinitis pigmentosa. Unlike the other forms of Usher syndrome, type 2 is not associated with vestibular abnormalities that cause difficulties with balance. The WHRN gene is also associated with autosomal recessive nonsyndromic sensorineural deafness type 31. This phenotype is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.ﾠ	600,25
WNT10A	Odontoonychodermal dysplasia	NM_025216.2	NM_025216.2:c.321C>A, NM_025216.2:c.383G>A, NM_025216.2:c.697G>T	Odonto-onycho-dermal dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by hyperkeratosis and hyperhidrosis of the palms and soles, atrophic malar patches, hypodontia, conical teeth, onychodysplasia, and dry and sparse hair. The prevalence is <1:1,000,000.	600,25
ZFYVE26	Spastic paraplegia, type 15, autosomal recessive	NM_015346.3	NM_015346.3:c.5485-1G>A, NM_015346.3:c.5422C>T, NM_015346.3:c.4936C>T, NM_015346.3:c.4312C>T, NM_015346.3:c.3642_3643insCCACACTTAG, NM_015346.3:c.3206G>A, NM_015346.3:c.3182delT, NM_015346.3:c.2114dupC, NM_015346.3:c.1477C>T	Spastic paraplegia type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZFYVE26 gene located on chromosomal region 14q24.1. The age of onset is infancy. This disease is characterized by progressive spasticity primarily affecting the lower limbs. It is a complex form of spastic paraplegia, associated with other neurologic dysfunction, including variable mental retardation, hearing and visual defects, and thin corpus callosum. The prevalence is <1 / 1,000,000.	600,25

Current version
Historic versions

chrom	OMIM (gene)	gene	OMIM (phen)	disease name (phenotype)	inheritance
7	602421	CFTR	219700	Cystic fibrosis	Autosomal recessive
X	309550	FMR1	300624	Fragile X syndrome	X-linked
X	305900	G6PD	300908	Hemolytic anemia, G6PD deficient (favism)	X-linked
13	121011	GJB2	220290	Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6	Autosomal recessive; Digenic inheritance (GJB6 gene)
16	141800	HBA1	604131	Thalassemia, alpha-	Autosomal recessive
16	141850	HBA2	604131	Thalassemia, alpha-	Autosomal recessive
11	141900	HBB	603903	HBB-related hemoglobinopathy	Autosomal recessive
5	600354	SMN1	253300	Spinal muscular atrophy	Autosomal recessive

Download CGT Basic v1.0

Export DDownload CGT Basic v2.1

Export

CGT Essential
Historic versions

chrom	OMIM (gene)	Gene	OMIM (phen)	DISEASE	MOI
1	607008	ACADM	201450	Medium-chain acyl-CoA dehydrogenase deficiency	Autosomal recessive
2	604285	AGXT	259900	Hyperoxaluria, primary, type 1	Autosomal recessive
22	607574	ARSA	250100	Metachromatic leukodystrophy	Autosomal recessive
3	609019	BTD	253260	Biotinidase deficiency	Autosomal recessive
21	613381	CBS	236200	Homocystinuria due to cystathionine beta-synthase	Autosomal recessive
7	602421	CFTR	219700	Cystic fibrosis	Autosomal recessive
11	602858	DHCR7	270400	Smith-Lemli-Opitz syndrome	Autosomal recessive
X	300384	EMD	310300	Emery-Dreifuss muscular dystrophy, type 1, X-linked	X-linked
X	309550	FMR1	300624	Fragile X syndrome	X-linked
17	606800	GAA	232300	Glycogen storage disease, type 2	Autosomal recessive
9	606999	GALT	230400	Galactosemia	Autosomal recessive
X	300644	GLA	301500	Fabry disease	X-linked
2	600890	HADHA	609016; 609015	Long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD) deficiency; Mitochondrial trifunctional protein deficiency	Autosomal recessive
11	141900	HBB	603903	HBB-related hemoglobinopathy	Autosomal recessive
1	609831	MMACHC	277400	Methylmalonic aciduria and homocystinuria, cblC type	Autosomal recessive, digenic inheritance (PRDX1 gene)
12	612349	PAH	261600	Phenylketonuria	Autosomal recessive
16	601785	PMM2	212065	Congenital disorder of glycosylation, type 1A	Autosomal recessive
5	606718	SLC26A2	600972	Achondrogenesis, type 1B (diastrophic dysplasia)	Autosomal recessive
5	600354	SMN1	253300	Spinal muscular atrophy	Autosomal recessive

Download CGT Essential v1.0

Export Download CGT Essential v1.1

Export Download CGT Essential v1.2

Export Download CGT Essential web

Export