CGT Panels

CGT: Tests list

Select your test and find the gene, mutations and diseases related to them.

CGT Exome
CGT Plus
CGT Bank
Other CGT

CGT 600
CGT 250
CGT Basic
CGT Essential

CGT Exome V5.4.5
Historic Versions

Chromosome	Gene symbol	OMIM (gene)	Disease name (phenotype)	Inheritance
12	AAAS	605378	Triple-A syndrome (achalasia-addisonianism-alacrimia)	Autosomal recessive
16	AARS1	601065	Epileptic encephalopathy, early infantile, type 29	Autosomal recessive
6	AARS2	612035	Combined oxidative phosphorylation deficiency 8; Leukoencephalopathy, progressive, with ovarian failure	Autosomal recessive
7	AASS	605113	Hyperlysinemia, type 1 and type 2	Autosomal recessive
16	ABAT	137150	GABA-transaminase deficiency	Autosomal recessive
9	ABCA1	600046	Tangier disease	Autosomal recessive
2	ABCA12	607800	Ichthyosis, congenital, autosomal recessive, type 4A; ICAR, type 4B (harlequin)	Autosomal recessive
16	ABCA3	601615	Surfactant metabolism dysfunction, pulmonary, type 3	Autosomal recessive
1	ABCA4	601691	Stargardt disease 1; Retinitis pigmentosa 19; Cone-rod dystrophy 3	Autosomal recessive
2	ABCB11	603201	Cholestasis, benign recurrent intrahepatic, type 2; Cholestasis, progressive familial intrahepatic, type 2	Autosomal recessive
7	ABCB4	171060	Cholestasis, progressive familial intrahepatic, type 3	Autosomal recessive
10	ABCC2	601107	Dubin-Johnson syndrome	Autosomal recessive
16	ABCC6	603234	Pseudoxanthoma elasticum; Generalized arterial calcification of infancy, type 2	Autosomal recessive
11	ABCC8	600509	Hyperinsulinemic hypoglycemia, type 1 (congenital hyperinsulinism); Permanent neonatal diabetes mellitus (PNDM)	Autosomal recessive*
X	ABCD1	300371	Adrenoleukodystrophy	X-linked
14	ABCD4	603214	Methylmalonic aciduria and homocystinuria, cblJ type	Autosomal recessive
2	ABCG5	605459	Sitosterolemia 2	Autosomal recessive
2	ABCG8	605460	Sitosterolemia 1	Autosomal recessive
20	ABHD12	613599	PHARC syndrome (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa and cataract)	Autosomal recessive
3	ABHD5	604780	Chanarin-Dorfman syndrome	Autosomal recessive
11	ACAD8	604773	Isobutyryl-CoA dehydrogenase deficiency	Autosomal recessive
3	ACAD9	611103	Acyl-CoA dehydrogenase 9 deficiency (mitochondrial complex I deficiency, nuclear, type 20)	Autosomal recessive
1	ACADM	607008	Medium-chain acyl-CoA dehydrogenase deficiency	Autosomal recessive
12	ACADS	606885	Short-chain acyl-CoA dehydrogenase deficiency	Autosomal recessive
10	ACADSB	600301	Short/branched-chain acyl-CoA dehydrogenase deficiency	Autosomal recessive
17	ACADVL	609575	Very long-chain acyl-CoA dehydrogenase (VLCAD) deficiency	Autosomal recessive
11	ACAT1	607809	Alpha-methylacetoacetic aciduria (3-ketothiolase deficiency)	Autosomal recessive
17	ACE	106180	Renal tubular dysgenesis	Autosomal recessive
22	ACO2	100850	Infantile cerebellar-retinal degeneration	Autosomal recessive
17	ACOX1	609751	Peroxisomal acyl-CoA oxidase deficiency	Autosomal recessive
3	ACOX2	601641	Bile acid synthesis defect, congenital, type 6	Autosomal recessive
19	ACP5	171640	Spondyloenchondrodysplasia with immune dysregulation	Autosomal recessive
16	ACSF3	614245	Combined malonic and methylmalonic aciduria	Autosomal recessive
1	ACTA1	102610	Nemaline myopathy 3; Congenital fiber-type disproportion myopathy 1	Autosomal recessive*
3	ACY1	104620	Aminoacylase 1 deficiency	Autosomal recessive
20	ADA	608958	Severe combined immunodeficiency due to adenosine deaminase deficiency (ADA)	Autosomal recessive
22	ADA2	607575	Vasculitis, autoinflammation, immunodeficiency, and hematologic defects syndrome; Sneddon syndrome	Autosomal recessive
8	ADAM9	602713	Cone-rod dystrophy 9	Autosomal recessive
19	ADAMTS10	608990	Weill-Marchesani syndrome, type 1, recessive	Autosomal recessive
9	ADAMTS13	604134	Thrombotic thrombocytopenic purpura, familial (Schulman-Upshaw syndrome)	Autosomal recessive
15	ADAMTS17	607511	Weill-Marchesani syndrome, type 4, recessive	Autosomal recessive
16	ADAMTS18	607512	Microcornea, myopic chorioretinal atrophy, and telecanthus	Autosomal recessive
5	ADAMTS2	604539	Ehlers-Danlos syndrome, dermatosparaxis type	Autosomal recessive
9	ADAMTSL2	612277	Geleophysic dysplasia type 1	Autosomal recessive
1	ADAMTSL4	610113	Ectopia lentis et pupillae; Ectopia lentis, isolated, type 2	Autosomal recessive
1	ADAR	146920	Aicardi-Goutieres syndrome, type 6	Autosomal recessive
19	ADAT3	615302	Mental retardation, autosomal recessive 36	Autosomal recessive
16	ADGRG1	604110	Polymicrogyria, bilateral frontoparietal	Autosomal recessive
6	ADGRG6	612243	Lethal congenital contracture syndrome 9	Autosomal recessive
5	ADGRV1	602851	Usher syndrome, type 2C	Autosomal recessive; Digenic inheritance (PDZD7 gene)
10	ADK	102750	Hypermethioninemia due to adenosine kinase deficiency	Autosomal recessive
22	ADSL	608222	Adenylosuccinase deficiency	Autosomal recessive
14	ADSS1	612498	Myopathy, distal, 5	Autosomal recessive
18	AFG3L2	604581	Spastic ataxia, type 5, autosomal recessive	Autosomal recessive
4	AFP	104150	Alpha-fetoprotein deficiency	Autosomal recessive
4	AGA	613228	Aspartylglucosaminuria (glycosylasparaginase deficiency)	Autosomal recessive
2	AGBL5	615900	Retinitis pigmentosa 75	Autosomal recessive
7	AGK	610345	Cataract 38; Sengers syndrome	Autosomal recessive
1	AGL	610860	Glycogen storage disease, type 3	Autosomal recessive
9	AGPAT2	603100	Congenital generalized lipodystrophy (Berardinelli-Seip syndrome)	Autosomal recessive
2	AGPS	603051	Rhizomelic chondrodysplasia punctata, type 3	Autosomal recessive
1	AGRN	103320	Myasthenic syndrome, congenital, type 8	Autosomal recessive
1	AGT	106150	Renal tubular dysgenesis	Autosomal recessive
3	AGTR1	106165	Renal tubular dysgenesis	Autosomal recessive
2	AGXT	604285	Hyperoxaluria, primary, type 1	Autosomal recessive
20	AHCY	180960	Hypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase	Autosomal recessive
6	AHI1	608894	Joubert syndrome, type 3	Autosomal recessive
12	AICDA	605257	Immunodeficiency with hyper-IgM, type 2	Autosomal recessive
4	AIMP1	603605	Leukodystrophy, hypomyelinating, type 3	Autosomal recessive
7	AIMP2	600859	Leukodystrophy, hypomyelinating, type 17	Autosomal recessive
17	AIPL1	604392	Leber congenital amaurosis, type 4	Autosomal recessive
21	AIRE	607358	Autoimmune polyendocrinopathy syndrome, type 1	Autosomal recessive*
9	AK1	103000	Hemolytic anemia due to adenylate kinase deficiency	Autosomal recessive
1	AK2	103020	Reticular dysgenesis	Autosomal recessive
10	AKR1C2	600450	46,XY disorder of sex development due to testicular 17,20-desmolase deficiency	Autosomal recessive
7	AKR1D1	604741	Bile acid synthesis defect, congenital, type 2	Autosomal recessive
9	ALAD	125270	Porphyria, acute hepatic	Autosomal recessive
4	ALB	103600	Analbuminemia	Autosomal recessive
10	ALDH18A1	138250	Spastic paraplegia, type 9B, autosomal recessive; Cutis laxa, type 3A (De Barsy syndrome)	Autosomal recessive
15	ALDH1A3	600463	Microphthalmia, isolated 8	Autosomal recessive
17	ALDH3A2	609523	Sjogren-Larsson syndrome	Autosomal recessive
1	ALDH4A1	606811	Hyperprolinemia, type 2	Autosomal recessive
6	ALDH5A1	610045	Succinic semialdehyde dehydrogenase deficiency	Autosomal recessive
14	ALDH6A1	603178	Methylmalonate semialdehyde dehydrogenase deficiency	Autosomal recessive
5	ALDH7A1	107323	Epilepsy, pyridoxine-dependent	Autosomal recessive
16	ALDOA	103850	Glycogen storage disease type 12	Autosomal recessive
9	ALDOB	612724	Fructose intolerance, hereditary	Autosomal recessive
16	ALG1	605907	Congenital disorder of glycosylation, type 1K	Autosomal recessive
13	ALG11	613666	Congenital disorder of glycosylation, type 1P	Autosomal recessive
22	ALG12	607144	Congenital disorder of glycosylation, type 1G	Autosomal recessive
9	ALG2	607905	Myasthenic syndrome, congenital, type 14, with tubular aggregates	Autosomal recessive
3	ALG3	608750	Congenital disorder of glycosylation, type 1D	Autosomal recessive
1	ALG6	604566	Congenital disorder of glycosylation, type 1C	Autosomal recessive
11	ALG8	608103	Congenital disorder of glycosylation, type 1H	Autosomal recessive
11	ALG9	606941	Congenital disorder of glycosylation, type 1L; Gillessen-Kaesbach-Nishimura syndrome	Autosomal recessive
2	ALMS1	606844	Alström syndrome	Autosomal recessive
17	ALOX12B	603741	Ichthyosis, congenital, autosomal recessive, type 2	Autosomal recessive
17	ALOXE3	607206	Ichthyosis, congenital, autosomal recessive, type 3	Autosomal recessive
15	ALPK3	617608	Cardiomyopathy, familial hypertrophic, type 27	Autosomal recessive
1	ALPL	171760	ALPL-related conditions	Autosomal recessive
2	ALS2	606352	Amyotrophic lateral sclerosis, type 2, juvenile; Primary lateral sclerosis, juvenile; Spastic paralysis, infantile onset ascending	Autosomal recessive
12	ALX1	601527	Frontonasal dysplasia, type 3	Autosomal recessive
1	ALX3	606014	Frontonasal dysplasia, type 1	Autosomal recessive
11	ALX4	605420	Frontonasal dysplasia, type 2	Autosomal recessive
5	AMACR	604489	Bile acid synthesis defect, congenital, type 4; Alpha-methylacyl-CoA racemase deficiency	Autosomal recessive
4	AMBN	601259	Amelogenesis imperfecta, type IF	Autosomal recessive
19	AMH	600957	Persistent Mullerian duct syndrome, type 1	Autosomal recessive
12	AMHR2	600956	Persistent Mullerian duct syndrome, type II	Autosomal recessive
14	AMN	605799	Megaloblastic anemia 1 (Imerslund-Grasbeck syndrome)	Autosomal recessive
1	AMPD1	102770	Myopathy due to myoadenylate deaminase deficiency	Autosomal recessive
1	AMPD2	102771	Pontocerebellar hypoplasia, type 9	Autosomal recessive
3	AMT	238310	Glycine encephalopathy	Autosomal recessive
1	ANGPTL3	604774	Hypobetalipoproteinemia, familial, type 2	Autosomal recessive
9	ANKS6	615370	Nephronophthisis 16	Autosomal recessive
3	ANO10	613726	Spinocerebellar ataxia, autosomal recessive, type 10	Autosomal recessive
11	ANO5	608662	Limb-girdle muscular dystrophy, type 12 (LGMD R12)	Autosomal recessive
2	ANTXR1	606410	GAPO syndrome	Autosomal recessive
4	ANTXR2	608041	Hyaline fibromatosis syndrome	Autosomal recessive
7	AP1S1	603531	MEDNIK syndrome	Autosomal recessive
X	AP1S2	300629	Mental retardation, X-linked, syndromic, type 5 (Pettigrew syndrome)	X-linked
5	AP3B1	603401	Hermansky-Pudlak syndrome, type 2	Autosomal recessive
15	AP3B2	602166	Epileptic encephalopathy, early infantile, type 48	Autosomal recessive
19	AP3D1	607246	Hermansky-Pudlak syndrome, type 10	Autosomal recessive
1	AP4B1	607245	Spastic paraplegia, type 47, autosomal recessive	Autosomal recessive
15	AP4E1	607244	Spastic paraplegia, type 51, autosomal recessive	Autosomal recessive
7	AP4M1	602296	Spastic paraplegia, type 50, autosomal recessive	Autosomal recessive
14	AP4S1	607243	Spastic paraplegia, type 52, autosomal recessive	Autosomal recessive
7	AP5Z1	613653	Spastic paraplegia, type 48, autosomal recessive	Autosomal recessive
19	APOC2	608083	Hyperlipoproteinemia, type 1B	Autosomal recessive
19	APOE	107741	Sea-blue histiocyte disease	Autosomal recessive
16	APRT	102600	Adenine phosphoribosyltransferase deficiency	Autosomal recessive
9	APTX	606350	Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia	Autosomal recessive
12	AQP2	107777	Diabetes insipidus, nephrogenic, type 2	Autosomal recessive*
X	AR	313700	Androgen insensitivity syndrome	X-linked
20	ARFGEF2	605371	Periventricular heterotopia with microcephaly	Autosomal recessive
6	ARG1	608313	Argininemia (arginase deficiency)	Autosomal recessive
17	ARHGDIA	601925	Nephrotic syndrome, type 8	Autosomal recessive
19	ARHGEF18	616432	Retinitis pigmentosa 78	Autosomal recessive
3	ARL13B	608922	Joubert syndrome type 8	Autosomal recessive
16	ARL2BP	615407	Retinitis pigmentosa with or without situs inversus	Autosomal recessive
3	ARL6	608845	Bardet-Biedl syndrome, type 3	Autosomal recessive
2	ARMC9	617612	Joubert syndrome 30	Autosomal recessive
7	ARPC1B	604223	Immunodeficiency, type 71, with inflammatory disease and congenital thrombocytopenia	Autosomal recessive
22	ARSA	607574	Metachromatic leukodystrophy	Autosomal recessive
5	ARSB	611542	Mucopolysaccharidosis, type 6 (Maroteaux-Lamy syndrome)	Autosomal recessive
X	ARSL	300180	Chondrodysplasia punctata, brachytelephalangic	X-linked
1	ARV1	611647	Epileptic encephalopathy, early infantile, 38	Autosomal recessive
X	ARX	300382	Epileptic encephalopathy, early infantile, type 1; ARX-related developmental disorders	X-linked
8	ASAH1	613468	Farber lipogranulomatosis; Spinal muscular atrophy with progressive myoclonic epilepsy	Autosomal recessive
7	ASL	608310	Argininosuccinic aciduria	Autosomal recessive
7	ASNS	108370	Asparagine synthetase deficiency	Autosomal recessive
17	ASPA	608034	Canavan disease	Autosomal recessive
8	ASPH	600582	Traboulsi syndrome	Autosomal recessive
1	ASPM	605481	Primary microcephaly type 5, autosomal recessive	Autosomal recessive
9	ASS1	603470	Citrullinemia, type 1	Autosomal recessive
10	ATAD1	614452	Hyperekplexia 4	Autosomal recessive
1	ATF6	605537	Achromatopsia, type 7	Autosomal recessive
2	ATIC	601731	AICA-ribosiduria due to ATIC deficiency	Autosomal recessive
11	ATM	607585	ATM-related conditions	Autosomal recessive
10	ATOH7	609875	Persistent hyperplastic primary vitreous, autosomal recessive	Autosomal recessive
1	ATP13A2	610513	Kufor-Rakeb syndrome; Spastic paraplegia, type 78, autosomal recessive	Autosomal recessive
16	ATP2A1	108730	Brody myopathy	Autosomal recessive
12	ATP6V0A2	611716	Cutis laxa, autosomal recessive, type 2A; Wrinkly skin syndrome	Autosomal recessive
7	ATP6V0A4	605239	Renal tubular acidosis, distal, autosomal recessive	Autosomal recessive
3	ATP6V1A	607027	Cutis laxa, autosomal recessive, type 2D	Autosomal recessive
2	ATP6V1B1	192132	Renal tubular acidosis with deafness	Autosomal recessive
22	ATP6V1E1	108746	Cutis laxa, autosomal recessive, type 2C	Autosomal recessive
X	ATP7A	300011	Menkes disease; Occipital horn syndrome	X-linked
13	ATP7B	606882	Wilson disease	Autosomal recessive
18	ATP8B1	602397	Cholestasis, progressive familial intrahepatic, type 1; Cholestasis, benign recurrent intrahepatic, type 1	Autosomal recessive
3	ATR	601215	Seckel syndrome, type 1	Autosomal recessive
X	ATRX	300032	Mental retardation-hypotonic facies syndrome, X-linked; Alpha-thalassemia/mental retardation syndrome	X-linked
9	AUH	600529	3-methylglutaconic aciduria, type 1	Autosomal recessive
19	AURKC	603495	Spermatogenic failure, type 5	Autosomal recessive
12	AVIL	613397	Nephrotic syndrome, type 21	Autosomal recessive
15	B2M	109700	Immunodeficiency, type 43	Autosomal recessive
1	B3GALNT2	610194	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11	Autosomal recessive
1	B3GALT6	615291	Ehlers-Danlos syndrome, spondylodysplastic type, 2	Autosomal recessive
11	B3GAT3	606374	Multiple joint dislocations, short stature, craniofacial dysmorphism, with or without congenital heart defects	Autosomal recessive
13	B3GLCT	610308	Peters-plus syndrome	Autosomal recessive
12	B4GALNT1	601873	Spastic paraplegia, type 26, autosomal recessive	Autosomal recessive
9	B4GALT1	137060	Congenital disorder of glycosylation, type 2D	Autosomal recessive
5	B4GALT7	604327	Ehlers-Danlos syndrome, spondylodysplastic, type 1	Autosomal recessive
11	B4GAT1	605517	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 13	Autosomal recessive
17	B9D1	614144	Joubert syndrome, type 27; ?Meckel syndrome 9	Autosomal recessive
19	B9D2	611951	Joubert syndrome, type 34; ?Meckel syndrome, type 10	Autosomal recessive
11	BBS1	209901	Bardet-Biedl syndrome, type 1	Autosomal recessive
12	BBS10	610148	Bardet-Biedl syndrome, type 10	Autosomal recessive
4	BBS12	610683	Bardet-Biedl syndrome, type 12	Autosomal recessive
16	BBS2	606151	Bardet-Biedl syndrome, type 2	Autosomal recessive
15	BBS4	600374	Bardet-Biedl syndrome, type 4	Autosomal recessive
2	BBS5	603650	Bardet-Biedl syndrome, type 5	Autosomal recessive
4	BBS7	607590	Bardet-Biedl syndrome, type 7	Autosomal recessive
7	BBS9	607968	Bardet-Biedl syndrome, type 9	Autosomal recessive
19	BCAT2	113530	?Hypervalinemia or hyperleucine-isoleucinemia	Autosomal recessive
3	BCHE	177400	Butyrylcholinesterase deficiency	Autosomal recessive
19	BCKDHA	608348	Maple syrup urine disease, type 1A	Autosomal recessive
6	BCKDHB	248611	Maple syrup urine disease, type 1B	Autosomal recessive
16	BCKDK	614901	Branched-chain ketoacid dehydrogenase kinase deficiency	Autosomal recessive
1	BCL10	603517	?Immunodeficiency, type 37	Autosomal recessive
2	BCS1L	603647	Mitochondrial complex III deficiency nuclear type 1; GRACILE syndrome; Bjornstad syndrome	Autosomal recessive
11	BEST1	607854	Bestrophinopathy, AR	Autosomal recessive
20	BFSP1	603307	Cataract 33, multiple types	Autosomal recessive*
17	BHLHA9	615416	Syndactyly, mesoaxial synostotic, with phalangeal reduction	Autosomal recessive
2	BIN1	601248	Centronuclear myopathy, type 2	Autosomal recessive
15	BLM	604610	Bloom syndrome	Autosomal recessive
10	BLNK	604515	?Agammaglobulinemia 4	Autosomal recessive
19	BLOC1S3	609762	Hermansky-Pudlak syndrome, type 8	Autosomal recessive
15	BLOC1S6	604310	?Hermansky-Pudlak syndrome, type 9	Autosomal recessive
4	BLTP1	611565	Alkuraya-Kucinskas syndrome	Autosomal recessive
7	BLVRA	109750	Hyperbiliverdinemia	Autosomal recessive*
8	BMP1	112264	Osteogenesis imperfecta, type 13	Autosomal recessive
7	BMPER	608699	Diaphanospondylodysostosis	Autosomal recessive
4	BMPR1B	603248	Acromesomelic dysplasia, Demirhan type	Autosomal recessive
2	BOLA3	613183	Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia	Autosomal recessive
7	BPGM	613896	Erythrocytosis due to bisphosphoglycerate mutase deficiency	Autosomal recessive
8	BPNT2	614010	Chondrodysplasia with joint dislocations, GPAPP type	Autosomal recessive
7	BRAT1	614506	Rigidity and multifocal seizure syndrome, lethal neonatal; Neurodevelopmental disorder with cerebellar atrophy and with or without seizures	Autosomal recessive
14	BRF1	604902	Cerebellofaciodental syndrome	Autosomal recessive
17	BRIP1	605882	Fanconi anemia, complementation group J	Autosomal recessive
X	BRWD3	300553	Mental retardation, X-linked, type 93	X-linked
11	BSCL2	606158	Congenital generalized lipodystrophy, type 2; Encephalopathy, progressive, with or without lipodystrophy	Autosomal recessive
1	BSND	606412	Bartter syndrome, type 4A	Autosomal recessive
3	BTD	609019	Biotinidase deficiency	Autosomal recessive
X	BTK	300300	Agammaglobulinemia X-linked, type 1	X-linked
15	BUB1B	602860	Mosaic variegated aneuploidy syndrome 1	Autosomal recessive
12	C12orf57	615140	Temtamy syndrome	Autosomal recessive
19	C19orf12	614297	Neurodegeneration with brain iron accumulation, type 4	Autosomal recessive*
1	C1QA	120550	C1q deficiency	Autosomal recessive
1	C1QB	120570	C1q deficiency	Autosomal recessive
17	C1QBP	601269	Combined oxidative phosphorylation deficiency 33	Autosomal recessive
1	C1QC	120575	C1q deficiency	Autosomal recessive
12	C1S	120580	C1s deficiency	Autosomal recessive
6	C2	613927	C2 deficiency	Autosomal recessive
11	C2CD3	615944	Orofaciodigital syndrome, type 14	Autosomal recessive
19	C3	120700	Complement component 3 deficiency	Autosomal recessive
9	C5	120900	Complement component 5 deficiency	Autosomal recessive
5	C6	217050	Complement component 6 deficiency	Autosomal recessive
5	C7	217070	Complement component 7 deficiency	Autosomal recessive
1	C8B	120960	Complement component 8 deficiency, type 2	Autosomal recessive
15	CA12	603263	Hyperchlorhidrosis, isolated	Autosomal recessive
8	CA2	611492	Osteopetrosis with renal tubular acidosis (osteopetrosis, autosomal recessive, type 3)	Autosomal recessive
16	CA5A	114761	Hyperammonemia due to carbonic anhydrase VA deficiency	Autosomal recessive
8	CA8	114815	Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3	Autosomal recessive
11	CABP2	607314	Deafness, autosomal recessive, type 93	Autosomal recessive
11	CABP4	608965	Congenital stationary night blindness, type 2B	Autosomal recessive
3	CACNA1D	114206	Sinoatrial node dysfunction and deafness	Autosomal recessive
12	CACNA2D4	608171	Retinal cone dystrophy 4	Autosomal recessive
2	CAD	114010	Epileptic encephalopathy, early infantile, 50	Autosomal recessive
2	CALCRL	114190	?Lymphatic malformation 8	Autosomal recessive
17	CANT1	613165	Desbuquois dysplasia, type 1; Epiphyseal dysplasia, multiple, type 7	Autosomal recessive
11	CAPN1	114220	Spastic paraplegia, type 76, autosomal recessive	Autosomal recessive
15	CAPN3	114240	Limb-girdle muscular dystrophy, type 1 (LGMD R1)	Autosomal recessive
7	CARD11	607210	Immunodeficiency, type 11A	Autosomal recessive
9	CARD9	607212	Candidiasis, familial, type 2, autosomal recessive	Autosomal recessive
13	CARS2	612800	Combined oxidative phosphorylation deficiency 27	Autosomal recessive
1	CASQ2	114251	Ventricular tachycardia, catecholaminergic polymorphic, type 2	Autosomal recessive
3	CASR	601199	Hyperparathyroidism, neonatal	Autosomal recessive*
5	CAST	114090	Peeling skin with leukonychia, acral punctate keratoses, cheilitis, and knuckle pads	Autosomal recessive
11	CAT	115500	Acatalasemia	Autosomal recessive
11	CATSPER1	606389	Spermatogenic failure, type 7	Autosomal recessive
17	CAVIN1	603198	Lipodystrophy, congenital generalized, type 4	Autosomal recessive
11	CBLIF	609342	Intrinsic factor deficiency	Autosomal recessive
21	CBS	613381	Homocystinuria due to cystathionine beta-synthase	Autosomal recessive
19	CC2D1A	610055	Mental retardation, autosomal recessive, type 3	Autosomal recessive
4	CC2D2A	612013	Joubert syndrome, type 9; Meckel syndrome, type 6; COACH syndrome, 2	Autosomal recessive
18	CCBE1	612753	Hennekam lymphangiectasia-lymphedema syndrome, type 1	Autosomal recessive
17	CCDC103	614677	Ciliary dyskinesia, primary, type 17	Autosomal recessive
2	CCDC115	613734	Congenital disorder of glycosylation, type IIo	Autosomal recessive
3	CCDC174	616735	Hypotonia, infantile, with psychomotor retardation	Autosomal recessive
3	CCDC39	613798	Ciliary dyskinesia, primary, type 14	Autosomal recessive
17	CCDC40	613799	Ciliary dyskinesia, primary, type 15	Autosomal recessive
12	CCDC65	611088	Ciliary dyskinesia, primary, type 27	Autosomal recessive
19	CCDC8	614145	3M syndrome 3	Autosomal recessive
14	CCDC88C	611204	Hydrocephalus, congenital, type 1	Autosomal recessive
6	CCN6	603400	Progressive pseudorheumatoid dysplasia	Autosomal recessive
5	CCNO	607752	Ciliary dyskinesia, primary, type 29	Autosomal recessive
16	CD19	107265	Immunodeficiency, common variable, type 3	Autosomal recessive
1	CD247	186780	?Immunodeficiency, type 25	Autosomal recessive
12	CD27	186711	Lymphoproliferative syndrome 2	Autosomal recessive
6	CD2AP	604241	Glomerulosclerosis, focal segmental, type 3, susceptibility to	Autosomal recessive*
19	CD320	606475	Methylmalonic aciduria, transient, due to transcobalamin receptor defect	Autosomal recessive
7	CD36	173510	Platelet glycoprotein 4 deficiency	Autosomal recessive
11	CD3D	186790	Immunodeficiency, type 19	Autosomal recessive
11	CD3E	186830	Immunodeficiency, type 18	Autosomal recessive
11	CD3G	186740	Immunodeficiency, type 17, CD3 gamma deficient	Autosomal recessive
20	CD40	109535	Immunodeficiency with hyper-IgM, type 3	Autosomal recessive
X	CD40LG	300386	Hyper-IgM syndrome, type 1 (immunodeficiency, X-linked, with hyper-IgM, type 1)	X-linked
1	CD55	125240	Complement hyperactivation, angiopathic thrombosis, and protein-losing enteropathy (CHAPLE)	Autosomal recessive
11	CD59	107271	CD59 deficiency	Autosomal recessive
19	CD79A	112205	Agammaglobulinemia 3	Autosomal recessive
17	CD79B	147245	Agammaglobulinemia 6	Autosomal recessive
11	CD81	186845	Immunodeficiency, common variable, type 6	Autosomal recessive
2	CD8A	186910	CD8 deficiency, familial	Autosomal recessive
15	CDAN1	607465	Dyserythropoietic anemia, congenital, type 1A	Autosomal recessive
1	CDC14A	603504	Deafness, autosomal recessive, type 105	Autosomal recessive
22	CDC45	603465	Meier-Gorlin syndrome 7	Autosomal recessive
2	CDCA7	609937	Immunodeficiency-centromeric instability-facial anomalies syndrome 3	Autosomal recessive
16	CDH11	600023	Elsahy-Waters syndrome	Autosomal recessive
10	CDH23	605516	Deafness, autosomal recessive, type 12; Usher syndrome, type 1D	Autosomal recessive
16	CDH3	114021	Ectodermal dysplasia, ectrodactyly, and macular dystrophy; Hypotrichosis, congenital, with juvenile macular dystrophy	Autosomal recessive
10	CDHR1	609502	Cone-rod dystrophy, type 15	Autosomal recessive
15	CDIN1	615626	Dyserythropoietic anemia, congenital, type Ib	Autosomal recessive
16	CDK10	603464	Al Kaissi syndrome	Autosomal recessive
9	CDK5RAP2	608201	Primary microcephaly type 3, autosomal recessive	Autosomal recessive
6	CDSN	602593	Peeling skin syndrome 1	Autosomal recessive
16	CDT1	605525	Meier-Gorlin syndrome, type 4	Autosomal recessive
14	CEBPE	600749	Specific granule deficiency	Autosomal recessive
1	CENPF	600236	Stromme syndrome	Autosomal recessive
13	CENPJ	609279	Primary microcephaly type 6, autosomal recessive	Autosomal recessive
1	CEP104	616690	Joubert syndrome 25	Autosomal recessive
5	CEP120	613446	Short-rib thoracic dysplasia 13 with or without polydactyly	Autosomal recessive
4	CEP135	611423	Microcephaly 8, primary, autosomal recessive	Autosomal recessive
15	CEP152	613529	Primary microcephaly type 9, autosomal recessive	Autosomal recessive
11	CEP164	614848	Nephronophthisis 15	Autosomal recessive
3	CEP19	615586	Morbid obesity and spermatogenic failure	Autosomal recessive
12	CEP290	610142	Meckel syndrome, type 4; Joubert syndrome, type 5; Leber congenital amaurosis, type 10	Autosomal recessive
7	CEP41	610523	Joubert syndrome, type 15	Autosomal recessive
10	CEP55	610000	Multinucleated neurons, anhydramnios, renal dysplasia, cerebellar hypoplasia, and hydranencephaly	Autosomal recessive
11	CEP57	607951	Mosaic variegated aneuploidy syndrome 2	Autosomal recessive
9	CEP78	617110	Cone-rod dystrophy and hearing loss	Autosomal recessive
12	CEP83	615847	Nephronophthisis 18	Autosomal recessive
2	CERKL	608381	Retinitis pigmentosa, type 26	Autosomal recessive
15	CERS3	615276	Ichthyosis, congenital, autosomal recessive 9	Autosomal recessive
8	CFAP418	614477	Bardet-Biedl syndrome, type 21; Cone-rod dystrophy 16 and Retintis pigmentosa 64; Ciliary dyskinesia, primary, 26	Autosomal recessive
10	CFAP43	617558	Spermatogenic failure, type 19	Autosomal recessive
18	CFAP53	614759	Heterotaxy, visceral, 6, autosomal recessive	Autosomal recessive
19	CFD	134350	Complement factor D deficiency	Autosomal recessive
1	CFH	134370	Complement factor H deficiency	Autosomal recessive
4	CFI	217030	Complement factor I deficiency	Autosomal recessive
14	CFL2	601443	Nemaline myopathy, type 7, autosomal recessive	Autosomal recessive
7	CFTR	602421	Cystic fibrosis	Autosomal recessive
10	CHAT	118490	Myasthenic syndrome, congenital, type 6, presynaptic	Autosomal recessive
22	CHKB	612395	Muscular dystrophy, congenital, megaconial type	Autosomal recessive
X	CHM	300390	Choroideremia	X-linked
16	CHMP1A	164010	Pontocerebellar hypoplasia, type 8	Autosomal recessive
2	CHRNA1	100690	Multiple pterygium syndrome, lethal type	Autosomal recessive
17	CHRNB1	100710	?Myasthenic syndrome, congenital, 2C, associated with acetylcholine receptor deficiency	Autosomal recessive
2	CHRND	100720	Myasthenic syndrome, congenital, type 3B, fast-channel; Multiple pterygium syndrome, lethal type	Autosomal recessive
17	CHRNE	100725	Myasthenic syndrome, congenital, type 4B, fast-channel; Myasthenic syndrome, congenital, type 4C, associated with acetylcholine receptor deficiency	Autosomal recessive
2	CHRNG	100730	Multiple pterygium syndrome (MPS), Escobar type; MPS, lethal type	Autosomal recessive
15	CHST14	608429	Ehlers-Danlos syndrome, musculocontractural, type 1	Autosomal recessive
10	CHST3	603799	Spondyloepiphyseal dysplasia with congenital joint dislocations	Autosomal recessive
16	CHST6	605294	Macular corneal dystrophy	Autosomal recessive
15	CHSY1	608183	Temtamy preaxial brachydactyly syndrome	Autosomal recessive
10	CHUK	600664	Cocoon syndrome	Autosomal recessive
15	CIB2	605564	Deafness, autosomal recessive, type 48; Usher syndrome, type 1J	Autosomal recessive
16	CIITA	600005	Bare lymphocyte syndrome, type 2, complementation group A	Autosomal recessive
6	CILK1	612325	Endocrine-cerebroosteodysplasia	Autosomal recessive
4	CISD2	611507	Wolfram syndrome 2	Autosomal recessive
12	CIT	605629	Microcephaly 17, primary, autosomal recessive	Autosomal recessive
2	CKAP2L	616174	Filippi syndrome	Autosomal recessive
11	CLCF1	607672	Cold-induced sweating syndrome 2	Autosomal recessive
7	CLCN1	118425	Myotonia congenita, recessive	Autosomal recessive
3	CLCN2	600570	Leukoencephalopathy with ataxia	Autosomal recessive
16	CLCN7	602727	Osteopetrosis, autosomal recessive type 4	Autosomal recessive
1	CLCNKA	602024	Bartter syndrome, type 4B, digenic	Digenic inheritance (CLCNKB gene)
1	CLCNKB	602023	Bartter syndrome, type 3; Bartter syndrome, type 4B, digenic	Autosomal recessive; Digenic inheritance (CLCNKA gene)
3	CLDN1	603718	Ichthyosis, leukocyte vacuoles, alopecia, and sclerosing cholangitis	Autosomal recessive
13	CLDN10	617579	HELIX syndrome	Autosomal recessive
21	CLDN14	605608	Deafness type 29, autosomal recessive	Autosomal recessive
3	CLDN16	603959	Hypomagnesemia, type 3, renal	Autosomal recessive
1	CLDN19	610036	Rena hypomagnesemia type 5, with ocular involvement	Autosomal recessive
11	CLMP	611693	Congenital short bowel syndrome	Autosomal recessive
16	CLN3	607042	Ceroid lipofuscinosis, neuronal, type 3	Autosomal recessive
13	CLN5	608102	Ceroid lipofuscinosis, neuronal, type 5	Autosomal recessive
15	CLN6	606725	Ceroid lipofuscinosis, neuronal, type 6	Autosomal recessive
8	CLN8	607837	Ceroid lipofuscinosis, neuronal, type 8	Autosomal recessive
11	CLP1	608757	Pontocerebellar hypoplasia, type 10	Autosomal recessive
11	CLPB	616254	3-methylglutaconic aciduria, type 7, with cataracts, neurologic involvement and neutropenia	Autosomal recessive
19	CLPP	601119	Perrault syndrome 3	Autosomal recessive
3	CLRN1	606397	Usher syndrome, type 3A	Autosomal recessive
4	CNGA1	123825	Retinitis pigmentosa type 49	Autosomal recessive
2	CNGA3	600053	Achromatopsia, type 2	Autosomal recessive
16	CNGB1	600724	Retinitis pigmentosa type 45	Autosomal recessive
8	CNGB3	605080	Achromatopsia, type 3	Autosomal recessive
10	CNNM2	607803	Hypomagnesemia, seizures, and mental retardation	Autosomal recessive*
2	CNNM4	607805	Jalili syndrome	Autosomal recessive
6	CNPY3	610774	Epileptic encephalopathy, early infantile, type 60	Autosomal recessive
17	CNTNAP1	602346	Lethal congenital contracture syndrome 7	Autosomal recessive
7	CNTNAP2	604569	Pitt-Hopkins like syndrome 1	Autosomal recessive
1	COA6	614772	Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 4	Autosomal recessive
14	COA8	616003	Mitochondrial complex IV deficiency, nuclear type 17	Autosomal recessive
17	COASY	609855	Neurodegeneration with brain iron accumulation 6	Autosomal recessive
17	COG1	606973	Congenital disorder of glycosylation, type IIg	Autosomal recessive
16	COG4	606976	Congenital disorder of glycosylation, type 2J	Autosomal recessive
7	COG5	606821	Congenital disorder of glycosylation, type 2I	Autosomal recessive
13	COG6	606977	Congenital disorder of glycosylation, type 2L; Shaheen syndrome	Autosomal recessive
16	COG7	606978	Congenital disorder of glycosylation, type 2E	Autosomal recessive
16	COG8	606979	Congenital disorder of glycosylation, type 2H	Autosomal recessive
1	COL11A1	120280	Fibrochondrogenesis type 1	Autosomal recessive
6	COL11A2	120290	Otospondylomegaepiphyseal dysplasia, autosomal recessive	Autosomal recessive
10	COL13A1	120350	Myasthenic syndrome, congenital, 19	Autosomal recessive
10	COL17A1	113811	Epidermolysis bullosa, junctional, non-Herlitz type	Autosomal recessive
21	COL18A1	120328	Knobloch syndrome, type 1	Autosomal recessive
7	COL1A2	120160	Ehlers-Danlos syndrome, cardiac valvular type	Autosomal recessive
4	COL25A1	610004	Fibrosis of extraocular muscles, congenital, type 5	Autosomal recessive
9	COL27A1	608461	Steel syndrome	Autosomal recessive
2	COL4A3	120070	Alport syndrome, autosomal recessive, type 2	Autosomal recessive; Autosomal dominant
2	COL4A4	120131	Alport syndrome, autosomal recessive, type 2	Autosomal recessive; Autosomal dominant
X	COL4A5	303630	Alport syndrome, X-linked	X-linked
21	COL6A1	120220	Ullrich congenital muscular dystrophy, type 1 (Limb-girdle muscular dystrophy, type 22 [LGMD R22])	Autosomal recessive*
21	COL6A2	120240	Ullrich congenital muscular dystrophy 1; Bethlem myopathy-1; Myosclerosis	Autosomal recessive
2	COL6A3	120250	Bethlem myopathy 1; Ullrich congenital muscular dystrophy 1; Dystonia 27	Autosomal recessive;Autosomal recessive;Autosomal recessive
3	COL7A1	120120	Dystrophic epidermolysis bullosa (DEB), Hallopeau-Siemens (HS) type and non-HS type; DEB pruriginosa; DEB pretibial	Autosomal recessive; Autosomal recessive; Autosomal recessive
6	COL9A1	120210	Stickler syndrome, type 4	Autosomal recessive
1	COL9A2	120260	?Stickler syndrome, type V	Autosomal recessive
8	COLEC10	607620	3MC syndrome 3	Autosomal recessive
2	COLEC11	612502	3MC syndrome 2	Autosomal recessive
3	COLQ	603033	Myasthenic syndrome, congenital, type 5	Autosomal recessive
4	COQ2	609825	Primary coenzyme Q10 deficiency, type 1	Autosomal recessive
9	COQ4	612898	Coenzyme Q10 deficiency, primary, type 7	Autosomal recessive
14	COQ6	614647	Coenzyme Q10 deficiency, primary, type 6	Autosomal recessive
1	COQ8A	606980	Primary coenzyme Q10 deficiency, type 4	Autosomal recessive
19	COQ8B	615567	Nephrotic syndrome, type 9	Autosomal recessive
16	COQ9	612837	Coenzyme Q10 deficiency, primary, type 5	Autosomal recessive
16	CORO1A	605000	Immunodeficiency, type 8	Autosomal recessive
17	COX10	602125	Mitochondrial complex IV deficiency, nuclear type 3	Autosomal recessive
10	COX15	603646	Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, type 2; Leigh syndrome due to cytochrome c oxidase deficiency	Autosomal recessive
1	COX20	614698	Mitochondrial complex IV deficiency, nuclear type 11	Autosomal recessive
19	COX6B1	124089	Mitochondrial complex IV deficiency, nuclear type 7	Autosomal recessive
3	CP	117700	Aceruloplasminemia	Autosomal recessive
8	CPA6	609562	Febrile seizures, familial, type 11	Autosomal recessive
19	CPAMD8	608841	Anterior segment dysgenesis, type 8	Autosomal recessive
5	CPLANE1	614571	Joubert syndrome 17	Autosomal recessive
4	CPLX1	605032	Epileptic encephalopathy, early infantile, 63	Autosomal recessive
2	CPS1	608307	Carbamoylphosphate synthetase 1 deficiency	Autosomal recessive
11	CPT1A	600528	Carnitine palmitoyltransferase type 1A deficiency, hepatic	Autosomal recessive
1	CPT2	600650	Carnitine palmitoyltransferase type 2 deficiency, lethal neonatal; Carnitine palmitoyltransferase type 2 deficiency, infantile	Autosomal recessive
1	CR2	120650	Immunodeficiency, common variable, type 7	Autosomal recessive
12	CRADD	603454	Mental retardation, autosomal recessive, type 34, with variant lissencephaly	Autosomal recessive
1	CRB1	604210	Retinitis pigmentosa, type 12; Leber congenital amaurosis, type 8	Autosomal recessive
9	CRB2	609720	Ventriculomegaly with cystic kidney disease	Autosomal recessive
3	CRBN	609262	Mental retardation, autosomal recessive, type 2	Autosomal recessive
2	CRIPT	604594	Short stature with microcephaly and distinctive facies	Autosomal recessive
19	CRLF1	604237	Cold-induced sweating syndrome type 1	Autosomal recessive
7	CRPPA	614631	Muscular dystrophy-dystroglycanopathy, type A7; Muscular dystrophy-dystroglycanopathy, type C7	Autosomal recessive
3	CRTAP	605497	Osteogenesis imperfecta, type 7	Autosomal recessive
21	CRYAA	123580	Cataract 9, multiple types	Autosomal recessive*
11	CRYAB	123590	Myopathy, myofibrillar, fatal infantile hypertonic, alpha-B crystallin-related; Cataract 16, multiple types	Autosomal recessive; Autosomal recessive*
22	CRYBB1	600929	Cataract 17	Autosomal recessive*
22	CRYBB3	123630	Cataract 22	Autosomal recessive
22	CSF2RB	138981	Surfactant metabolism dysfunction, pulmonary, type 5	Autosomal recessive
1	CSF3R	138971	Neutropenia, severe congenital, type 7, autosomal recessive	Autosomal recessive
8	CSPP1	611654	Joubert syndrome 21	Autosomal recessive
3	CSTA	184600	Peeling skin syndrome, type 4	Autosomal recessive
21	CSTB	601145	Epilepsy, progressive myoclonic type 1A (Unverricht and Lundborg)	Autosomal recessive
17	CTC1	613129	Cerebroretinal microangiopathy with calcifications and cysts	Autosomal recessive
1	CTH	607657	Cystathioninuria	Autosomal recessive
17	CTNS	606272	Nephropathic cystinosis	Autosomal recessive
1	CTPS1	123860	Immunodeficiency, type 24	Autosomal recessive
20	CTSA	613111	Galactosialidosis	Autosomal recessive
11	CTSC	602365	Haim-Munk syndrome; Papillon-Lefevre syndrome	Autosomal recessive
11	CTSD	116840	Ceroid lipofuscinosis, neuronal, type 10	Autosomal recessive
11	CTSF	603539	Ceroid lipofuscinosis, neuronal, type 13 (Kufs type)	Autosomal recessive
1	CTSK	601105	Pycnodysostosis	Autosomal recessive
10	CUBN	602997	Megaloblastic anemia 1 (Imerslund-Grasbeck syndrome)	Autosomal recessive
X	CUL4B	300304	Mental retardation, X-linked, syndromic, type 15 (Cabezas type)	X-linked
6	CUL7	609577	3M syndrome 1	Autosomal recessive
5	CWC27	617170	Retinitis pigmentosa with or without skeletal anomalies	Autosomal recessive
10	CWF19L1	616120	Spinocerebellar ataxia, autosomal recessive, type 17	Autosomal recessive
18	CYB5A	613218	46,XY disorder of sex development due to isolated 17,20-lyase deficiency	Autosomal recessive
22	CYB5R3	613213	Methemoglobinemia, type 1; Methemoglobinemia, type 2	Autosomal recessive
16	CYBA	608508	Chronic granulomatous disease, type 4	Autosomal recessive
X	CYBB	300481	Chronic granulomatous disease, X-linked	X-linked
8	CYC1	123980	Mitochondrial complex III deficiency, nuclear type 6	Autosomal recessive
15	CYP11A1	118485	46,XY disorder of sex development-adrenal insufficiency due to CYP11A1 deficiency	Autosomal recessive
8	CYP11B1	610613	Adrenal hyperplasia, congenital, due to 11-beta-hydroxylase deficiency	Autosomal recessive
8	CYP11B2	124080	Hypoaldosteronism, congenital, due to CMO I deficiency	Autosomal recessive
10	CYP17A1	609300	17 alpha(?)-hydroxylase/17,20-lyase deficiency	Autosomal recessive
15	CYP19A1	107910	Aromatase deficiency	Autosomal recessive
2	CYP1B1	601771	Glaucoma, primary congenital, type 3A	Autosomal recessive
6	CYP21A2	613815	Congenital adrenal hyperplasia due to 21-hydroxylase deficiency	Autosomal recessive
20	CYP24A1	126065	Hypercalcemia, infantile, type 1	Autosomal recessive
2	CYP26B1	605207	Craniosynostosis with radiohumeral fusions and other skeletal and craniofacial anomalies	Autosomal recessive
10	CYP26C1	608428	Focal facial dermal dysplasia 4	digenic inheritance (CLCNKB gene)
2	CYP27A1	606530	Cerebrotendinous xanthomatosis	Autosomal recessive
12	CYP27B1	609506	Vitamin D-dependent rickets, type 1	Autosomal recessive
11	CYP2R1	608713	Rickets due to defect in vitamin D 25-hydroxylation	Autosomal recessive
4	CYP2U1	610670	Spastic paraplegia, type 56, autosomal recessive	Autosomal recessive
19	CYP4F22	611495	Ichthyosis, congenital, autosomal recessive, type 5	Autosomal recessive
4	CYP4V2	608614	Bietti crystalline corneoretinal dystrophy	Autosomal recessive
8	CYP7B1	603711	Spastic paraplegia, type 5A, autosomal recessive	Autosomal recessive
2	D2HGDH	609186	D-2-hydroxyglutaric aciduria	Autosomal recessive
3	DAG1	128239	Muscular dystrophy-dystroglycanopathy type A9; Muscular dystrophy-dystroglycanopathy type C9	Autosomal recessive
2	DARS1	603084	Hypomyelination with brainstem and spinal cord involvement and leg spasticity	Autosomal recessive
1	DARS2	610956	Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation	Autosomal recessive
9	DBH	609312	Dopamine beta-hydroxylase deficiency	Autosomal recessive
1	DBT	248610	Maple syrup urine disease, type 2	Autosomal recessive
2	DCAF17	612515	Woodhouse-Sakati syndrome	Autosomal recessive
18	DCC	120470	Gaze palsy, familial horizontal, with progressive scoliosis, type 2	Autosomal recessive
6	DCDC2	605755	Sclerosing cholangitis, neonatal; Nephronophthisis 19	Autosomal recessive
11	DCHS1	603057	Van Maldergem syndrome 1	Autosomal recessive
10	DCLRE1C	605988	Omenn syndrome; Severe combined immunodeficiency, Athabascan type	Autosomal recessive
11	DCPS	610534	Al-Raqad syndrome	Autosomal recessive
X	DCX	300121	Lissencephaly, X-linked, type 1	X-linked
11	DDB2	600811	Xeroderma pigmentosum, complementation group E	Autosomal recessive
7	DDC	107930	Aromatic L-amino acid decarboxylase deficiency	Autosomal recessive
14	DDHD1	614603	Spastic paraplegia, type 28, autosomal recessive	Autosomal recessive
8	DDHD2	615003	Spastic paraplegia, type 54, autosomal recessive	Autosomal recessive
1	DDR2	191311	Spondylometaepiphyseal dysplasia, short limb-hand type	Autosomal recessive
20	DDRGK1	616177	Spondyloepimetaphyseal dysplasia, Shohat type	Autosomal recessive
12	DDX11	601150	Warsaw breakage syndrome	Autosomal recessive
1	DDX59	615464	Orofaciodigital syndrome V	Autosomal recessive
11	DENND5A	617278	Epileptic encephalopathy, early infantile, 49	Autosomal recessive
2	DES	125660	Myopathy, myofibrillar, type 1	Autosomal recessive*; Autosomal dominant
8	DGAT1	604900	?Diarrhea 7, protein-losing enteropathy type	Autosomal recessive
17	DGKE	601440	Nephrotic syndrome, type 7	Autosomal recessive
2	DGUOK	601465	DGUOK-related mitochondrial DNA depletion syndrome	Autosomal recessive
1	DHCR24	606418	Desmosterolosis	Autosomal recessive
11	DHCR7	602858	Smith-Lemli-Opitz syndrome	Autosomal recessive
1	DHDDS	608172	Retinitis pigmentosa, type 59	Autosomal recessive
5	DHFR	126060	Megaloblastic anemia due to dihydrofolate reductase deficiency	Autosomal recessive
12	DHH	605423	46,XY complete gonadal dysgenesis	Autosomal recessive
16	DHODH	126064	Miller syndrome	Autosomal recessive
19	DHPS	600944	Neurodevelopmental disorder with seizures and speech and walking impairment	Autosomal recessive
10	DHTKD1	614984	2-aminoadipic 2-oxoadipic aciduria	Autosomal recessive
5	DIAPH1	602121	Seizures, cortical blindness, microcephaly syndrome	Autosomal recessive
2	DIS3L2	614184	Perlman syndrome	Autosomal recessive
X	DKC1	300126	Dyskeratosis congenita, X-linked	X-linked
11	DLAT	608770	Pyruvate dehydrogenase E2 deficiency	Autosomal recessive
7	DLD	238331	Dihydrolipoamide dehydrogenase deficiency	Autosomal recessive
X	DLG3	300189	Mental retardation, X-linked, type 90	X-linked
19	DLL3	602768	Spondylocostal dysostosis type 1	Autosomal recessive
X	DMD	300377	DMD-related conditions	X-linked
5	DMGDH	605849	Dimethylglycine dehydrogenase deficiency	Autosomal recessive
4	DMP1	600980	Hypophosphatemic rickets, autosomal recessive	Autosomal recessive
15	DMXL2	612186	Developmental and epileptic encephalopathy, type 81	Autosomal recessive
16	DNAAF1	613190	Ciliary dyskinesia, primary, type 13	Autosomal recessive
8	DNAAF11	614930	Ciliary dyskinesia, primary, type 19	Autosomal recessive
14	DNAAF2	612517	Ciliary dyskinesia, primary, type 10	Autosomal recessive
19	DNAAF3	614566	Ciliary dyskinesia, primary, type 2	Autosomal recessive
15	DNAAF4	608706	Ciliary dyskinesia, primary, type 25	Autosomal recessive
7	DNAAF5	614864	Ciliary dyskinesia, primary, type 18	Autosomal recessive
3	DNAH1	603332	Spermatogenic failure, type 18	Autosomal recessive
7	DNAH11	603339	Ciliary dyskinesia, primary, type 7, with or without situs inversus	Autosomal recessive
5	DNAH5	603335	Ciliary dyskinesia, primary, type 3, with or without situs inversus	Autosomal recessive
17	DNAH9	603330	Ciliary dyskinesia, primary, type 40	Autosomal recessive
9	DNAI1	604366	Ciliary dyskinesia, primary, type 1, with or without situs inversus	Autosomal recessive
17	DNAI2	605483	Ciliary dyskinesia, primary, type 9, with or without situs inversus	Autosomal recessive
11	DNAJB13	610263	Ciliary dyskinesia, primary, type 34	Autosomal recessive
2	DNAJB2	604139	Spinal muscular atrophy, distal, autosomal recessive, type 5	Autosomal recessive
10	DNAJC12	606060	Hyperphenylalaninemia, mild, non-BH4-deficient	Autosomal recessive
3	DNAJC19	608977	3-methylglutaconic aciduria, type 5	Autosomal recessive
5	DNAJC21	617048	Bone marrow failure syndrome, type 3	Autosomal recessive
1	DNAJC6	608375	Parkinson disease, type 19A, juvenile-onset; Parkinson disease, type 19B, early-onset	Autosomal recessive
14	DNAL1	610062	Ciliary dyskinesia, primary, type 16	Autosomal recessive
3	DNASE1L3	602244	Systemic lupus erythematosus 16	Autosomal recessive
12	DNM1L	603850	Encephalopathy due to defective mitochondrial and peroxisomal fission, type 1	Autosomal recessive*
19	DNM2	602378	Lethal congenital contracture syndrome, type 5	Autosomal recessive
20	DNMT3B	602900	Immunodeficiency-centromeric instability-facial anomalies syndrome, type 1	Autosomal recessive
5	DOCK2	603122	Immunodeficiency, type 40	Autosomal recessive
19	DOCK6	614194	Adams-Oliver syndrome 2	Autosomal recessive
1	DOCK7	615730	Epileptic encephalopathy, early infantile, 23	Autosomal recessive
9	DOCK8	611432	Hyper-IgE recurrent infection syndrome, autosomal recessive	Autosomal recessive
4	DOK7	610285	Fetal akinesia deformation sequence, type 3; Myasthenic syndrome, congenital, type 10	Autosomal recessive
9	DOLK	610746	Congenital disorder of glycosylation, type 1M	Autosomal recessive
21	DONSON	611428	Microcephaly, short stature, and limb abnormalities	Autosomal recessive
11	DPAGT1	191350	Congenital disorder of glycosylation, type 1J; Myasthenic syndrome, congenital, type 13	Autosomal recessive
17	DPH1	603527	Developmental delay with short stature, dysmorphic features, and sparse hair	Autosomal recessive
20	DPM1	603503	Congenital disorder of glycosylation, type 1E	Autosomal recessive
9	DPM2	603564	Congenital disorder of glycosylation, type Iu	Autosomal recessive
1	DPM3	605951	Congenital disorder of glycosylation, type Io	Autosomal recessive
12	DPY19L2	613893	Spermatogenic failure, type 9	Autosomal recessive
1	DPYD	612779	Dihydropyrimidine dehydrogenase deficiency	Autosomal recessive
8	DPYS	613326	Dihydropyrimidinuria	Autosomal recessive
1	DRAM2	613360	Cone-rod dystrophy 21	Autosomal recessive
2	DRC1	615288	Ciliary dyskinesia, primary, type 21	Autosomal recessive
18	DSG1	125670	Erythroderma, congenital, with palmoplantar keratoderma, hypotrichosis, and hyper IgE	Autosomal recessive
18	DSG4	607892	Hypotrichosis, type 6	Autosomal recessive
6	DSP	125647	Cardiomyopathy, dilated, with woolly hair and keratoderma; Epidermolysis bullosa, lethal acantholytic	Autosomal recessive
6	DST	113810	Neuropathy, hereditary sensory and autonomic, type VI;Epidermolysis bullosa simplex 3, localized or generalized intermediate, with bp230 deficiency	Autosomal recessive
1	DSTYK	612666	Spastic paraplegia, type 23, autosomal recessive	Autosomal recessive
6	DTNBP1	607145	Hermansky-Pudlak syndrome, type 7	Autosomal recessive
15	DUOX2	606759	Thyroid dyshormonogenesis, type 6	Autosomal recessive
15	DUOXA2	612772	Thyroid dyshormonogenesis, type 5	Autosomal recessive
18	DYM	607461	Smith-McCort dysplasia; Dyggve-Melchior-Clausen disease	Autosomal recessive
11	DYNC2H1	603297	Short-rib thoracic dysplasia, type 3, with or without polydactyly	Autosomal recessive
7	DYNC2I1	615462	Short-rib thoracic dysplasia 8 with or without polydactyly	Autosomal recessive
9	DYNC2I2	613363	Short-rib thoracic dysplasia 11 with or without polydactyly	Autosomal recessive
2	DYNC2LI1	617083	Short-rib thoracic dysplasia 15 with polydactyly	Autosomal recessive
3	DYNLT2B	617353	Short-rib thoracic dysplasia 17 with or without polydactyly	Autosomal recessive
2	DYSF	603009	Miyoshi muscular dystrophy, type 1; Limb-girdle muscular dystrophy, type 2 (LGMD R2)	Autosomal recessive
3	DZIP1L	617570	Polycystic kidney disease 5	Autosomal recessive
16	EARS2	612799	Combined oxidative phosphorylation deficiency 12	Autosomal recessive
2	ECEL1	605896	Arthrogryposis, distal, type 5D	Autosomal recessive
10	ECHS1	602292	Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency	Autosomal recessive
1	ECM1	602201	Urbach-Wiethe disease	Autosomal recessive
X	EDA	300451	Ectodermal dysplasia, type 1, hypohidrotic, X-linked	X-linked
2	EDAR	604095	Ectodermal dysplasia 10B, hypohidrotic/hair/tooth type	Autosomal recessive
1	EDARADD	606603	Ectodermal dysplasia 11B, hypohidrotic/hair/tooth type	Autosomal recessive
6	EDN1	131240	Auriculocondylar syndrome, type 3	Autosomal recessive
20	EDN3	131242	Waardenburg syndrome, type 4B	Autosomal recessive
13	EDNRB	131244	ABCD syndrome	Autosomal recessive
11	EFEMP2	604633	Cutis laxa, autosomal recessive, type 1B	Autosomal recessive
15	EFL1	617538	Shwachman-Diamond syndrome 2	Autosomal recessive
7	EGFR	131550	?Inflammatory skin and bowel disease, neonatal, 2	Autosomal recessive
10	EGR2	129010	Dejerine-Sottas disease	Autosomal recessive*
2	EIF2AK3	604032	Wolcott-Rallison syndrome	Autosomal recessive
15	EIF2AK4	609280	Pulmonary venoocclusive disease 2	Autosomal recessive
12	EIF2B1	606686	Leukoencephalopathy with vanishing white matter (VWM)	Autosomal recessive
14	EIF2B2	606454	Leukoencephalopathy with vanishing white matter (VWM)	Autosomal recessive
1	EIF2B3	606273	Leukoencephalopathy with vanishing white matter (VWM)	Autosomal recessive
2	EIF2B4	606687	Leukoencephalopathy with vanishing white matter (VWM)	Autosomal recessive
3	EIF2B5	603945	Leukoencephalopathy with vanishing white matter (VWM)	Autosomal recessive
17	EIF4A3	608546	Robin sequence with cleft mandible and limb anomalies	Autosomal recessive
17	ELAC2	605367	Combined oxidative phosphorylation deficiency 17	Autosomal recessive
20	ELMO2	606421	Vascular malformation, primary intraosseous	Autosomal recessive
6	ELOVL4	605512	Ichthyosis, spastic quadriplegia, and mental retardation	Autosomal recessive
9	ELP1	603722	Familial dysautonomia	Autosomal recessive
18	ELP2	616054	Mental retardation, autosomal recessive, type 58	Autosomal recessive
1	EMC1	616846	Cerebellar atrophy, visual impairment, and psychomotor retardation	Autosomal recessive
X	EMD	300384	Emery-Dreifuss muscular dystrophy, type 1, X-linked	X-linked
14	EML1	602033	Band heterotopia	Autosomal recessive
16	EMP2	602334	Nephrotic syndrome, type 10	Autosomal recessive
4	ENAM	606585	Amelogenesis imperfecta, type 1C	Autosomal recessive
17	ENO3	131370	?Glycogen storage disease XIII	Autosomal recessive
6	ENPP1	173335	Arterial calcification, generalized, of infancy, type 1	Autosomal recessive
10	ENTPD1	601752	Spastic paraplegia, type 64, autosomal recessive	Autosomal recessive
3	EOGT	614789	Adams-Oliver syndrome 4	Autosomal recessive
1	EPB41	130500	Elliptocytosis, type 1	Autosomal recessive*
15	EPB42	177070	Spherocytosis, type 5	Autosomal recessive
2	EPCAM	185535	EPCAM-related conditions	Autosomal recessive
18	EPG5	615068	Vici syndrome	Autosomal recessive
6	EPM2A	607566	Epilepsy, progressive myoclonic, type 2A (Lafora)	Autosomal recessive
1	EPRS1	138295	Leukodystrophy, hypomyelinating, type 15	Autosomal recessive
11	EPS8L2	614988	Deafness autosomal recessive, type 106	Autosomal recessive
17	ERAL1	607435	Perrault syndrome 6	Autosomal recessive
12	ERBB3	190151	Lethal congenital contractural syndrome, type 2	Autosomal recessive
19	ERCC1	126380	Cerebrooculofacioskeletal syndrome, type 4	Autosomal recessive
19	ERCC2	126340	Trichothiodystrophy, type 1; Xeroderma pigmentosum, group D	Autosomal recessive
2	ERCC3	133510	Trichothiodystrophy, type 2	Autosomal recessive
16	ERCC4	133520	Fanconi anemia, complementation group Q	Autosomal recessive
13	ERCC5	133530	Cerebrooculofacioskeletal syndrome 3; Xeroderma pigmentosum, group G;Xeroderma pigmentosum, group G/Cockayne syndrome	Autosomal recessive
10	ERCC6	609413	Cockayne syndrome, type B; Cerebrooculofacioskeletal syndrome, type 1	Autosomal recessive
9	ERCC6L2	615667	Bone marrow failure syndrome, type 2	Autosomal recessive
5	ERCC8	609412	Cockayne syndrome, type A	Autosomal recessive
10	ERLIN1	611604	Spastic paraplegia, type 62, autosomal recessive	Autosomal recessive
8	ERLIN2	611605	Spastic paraplegia, type 18, autosomal recessive	Autosomal recessive
8	ESCO2	609353	Roberts syndrome	Autosomal recessive
1	ESPN	606351	Deafness, autosomal recessive, type 36	Autosomal recessive
6	ESR1	133430	Estrogen resistance	Autosomal recessive
14	ESRRB	602167	Deafness, autosomal recessive, type 35	Autosomal recessive
15	ETFA	608053	Glutaric acidemia, type 2A	Autosomal recessive
19	ETFB	130410	Glutaric acidemia, type 2B	Autosomal recessive
4	ETFDH	231675	Glutaric acidemia, type 2C	Autosomal recessive
19	ETHE1	608451	Ethylmalonic encephalopathy	Autosomal recessive
4	EVC	604831	Ellis-van Creveld syndrome	Autosomal recessive
4	EVC2	607261	Ellis-van Creveld syndrome	Autosomal recessive
9	EXOSC3	606489	Pontocerebellar hypoplasia, type 1B	Autosomal recessive
11	EXPH5	612878	Epidermolysis bullosa, nonspecific, autosomal recessive	Autosomal recessive
8	EXTL3	605744	Immunoskeletal dysplasia with neurodevelopmental abnormalities	Autosomal recessive
6	EYS	612424	Retinitis pigmentosa, type 25	Autosomal recessive
13	F10	613872	Factor X deficiency	Autosomal recessive
4	F11	264900	Factor XI deficiency	Autosomal recessive*
6	F13A1	134570	Factor XIIIA deficiency	Autosomal recessive
1	F13B	134580	Factor XIIIB deficiency	Autosomal recessive
11	F2	176930	Prothrombin deficiency	Autosomal recessive
1	F5	612309	Factor V deficiency	Autosomal recessive
13	F7	613878	Factor VII deficiency	Autosomal recessive
X	F8	300841	Hemophilia A	X-linked
X	F9	300746	Hemophilia B	X-linked
16	FA2H	611026	Spastic paraplegia, type 35, autosomal recessive	Autosomal recessive
11	FADD	602457	Infections, recurrent, with encephalopathy, hepatic dysfunction, and cardiovascular malformations	Autosomal recessive
15	FAH	613871	Tyrosinemia, type 1	Autosomal recessive
2	FAM161A	613596	Retinitis pigmentosa, type 28	Autosomal recessive
17	FAM20A	611062	Amelogenesis imperfecta, type 1G (Enamel-renal syndrome)	Autosomal recessive
7	FAM20C	611061	Raine syndrome	Autosomal recessive
15	FAN1	613534	Interstitial nephritis, karyomegalic	Autosomal recessive
16	FANCA	607139	Fanconi anemia, complementation group A	Autosomal recessive
9	FANCC	613899	Fanconi anemia, complementation group C	Autosomal recessive
3	FANCD2	613984	Fanconi anemia, complementation group D2	Autosomal recessive
6	FANCE	613976	Fanconi anemia, complementation group E	Autosomal recessive
11	FANCF	613897	Fanconi anemia, complementation group F	Autosomal recessive
9	FANCG	602956	Fanconi anemia, complementation group G	Autosomal recessive
15	FANCI	611360	Fanconi anemia, complementation group I	Autosomal recessive
2	FANCL	608111	Fanconi anemia, complementation group L	Autosomal recessive
14	FANCM	609644	Spermatogenic failure, type 28; ?Premature ovarian failure 15	Autosomal recessive
11	FAR1	616107	Peroxisomal fatty acyl-CoA reductase 1 disorder	Autosomal recessive
6	FARS2	611592	Combined oxidative phosphorylation deficiency 14; Spastic paraplegia, type 77, autosomal recessive	Autosomal recessive
2	FASTKD2	612322	Combined oxidative phosphorylation deficiency 44	Autosomal recessive
4	FAT4	612411	Hennekam lymphangiectasia-lymphedema syndrome 2	Autosomal recessive
14	FBLN5	604580	Cutis laxa, autosomal recessive, type 1A	Autosomal recessive
9	FBP1	611570	Fructose-1,6-bisphosphatase deficiency	Autosomal recessive
6	FBXL4	605654	Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type)	Autosomal recessive
22	FBXO7	605648	Parkinson disease, type 15, autosomal recessive	Autosomal recessive
17	FDXR	103270	Auditory neuropathy and optic atrophy	Autosomal recessive
18	FECH	612386	Protoporphyria, erythropoietic, autosomal recessive	Autosomal recessive
20	FERMT1	607900	Kindler syndrome	Autosomal recessive
11	FERMT3	607901	Leukocyte adhesion deficiency, type 3	Autosomal recessive
7	FEZF1	613301	Hypogonadotropic hypogonadism type 22, with or without anosmia	Autosomal recessive
4	FGA	134820	Afibrinogenemia, congenital	Autosomal recessive
4	FGB	134830	Congenital afibrinogenemia	Autosomal recessive
X	FGD1	300546	Aarskog-Scott syndrome; Mental retardation, X-linked syndromic, type 16	X-linked
12	FGD4	611104	Charcot-Marie-Tooth disease, type 4H	Autosomal recessive
12	FGF23	605380	Tumoral calcinosis, hyperphosphatemic, familial, type 2	Autosomal recessive
11	FGF3	164950	Deafness, congenital with inner ear agenesis, microtia, and microdontia	Autosomal recessive
4	FGG	134850	Afibrinogenemia, congenital; Hypofibrinogenemia, congenital	Autosomal recessive
1	FH	136850	Fumarase deficiency	Autosomal recessive
11	FIBP	608296	Thauvin-Robinet-Faivre syndrome	Autosomal recessive
6	FIG4	609390	Charcot-Marie-Tooth disease, type 4J; Yunis-Varon syndrome	Autosomal recessive
17	FKBP10	607063	Bruck syndrome 1	Autosomal recessive
7	FKBP14	614505	Ehlers-Danlos syndrome, kyphoscoliotic type, 2	Autosomal recessive
19	FKRP	606596	Muscular dystrophy-dystroglycanopathy, type 5A (Walker-Warburg syndrome); Type 5B; Type 5C (limb-girdle muscular dystrophy, type 9 [LGMDR9])	Autosomal recessive
9	FKTN	607440	Muscular dystrophy-dystroglycanopathy, type 4A (Walker-Warburg syndrome); Type 4B; Type 4C (limb-girdle muscular dystrophy, type 13 [LGMD R13])	Autosomal recessive
1	FLAD1	610595	Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency	Autosomal recessive
1	FLG	135940	Ichthyosis vulgaris	Autosomal recessive*
11	FLI1	193067	Bleeding disorder, platelet-type, type 21	Autosomal recessive*
3	FLNB	603381	Spondylocarpotarsal synostosis syndrome	Autosomal recessive
1	FLVCR1	609144	Posterior column ataxia-retinitis pigmentosa syndrome	Autosomal recessive
14	FLVCR2	610865	Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome	Autosomal recessive
1	FMN2	606373	Mental retardation, autosomal recessive, type 47	Autosomal recessive
1	FMO3	136132	Trimethylaminuria	Autosomal recessive
X	FMR1	309550	FMR1-related conditions	X-linked
11	FOLR1	136430	Neurodegeneration due to cerebral folate transport deficiency	Autosomal recessive
9	FOXE1	602617	Bamforth-Lazarus syndrome	Autosomal recessive
1	FOXE3	601094	Anterior segment dysgenesis, type 2, multiple subtypes	Autosomal recessive
17	FOXN1	600838	T-cell immunodeficiency, congenital alopecia and nail dystrophy	Autosomal recessive
11	FOXRED1	613622	Mitochondrial complex I deficiency, nuclear type 19	Autosomal recessive
4	FRAS1	607830	Fraser syndrome, type 1	Autosomal recessive
9	FREM1	608944	Manitoba oculotrichoanal syndrome	Autosomal recessive
13	FREM2	608945	Fraser syndrome, type 2	Autosomal recessive
9	FRRS1L	604574	Epileptic encephalopathy, early infantile, 37	Autosomal recessive
11	FSHB	136530	Hypogonadotropic hypogonadism, type 24, without anosmia	Autosomal recessive
2	FSHR	136435	Ovarian dysgenesis 1;Ovarian hyperstimulation syndrome;Ovarian response to FSH stimulation	Autosomal recessive; Autosomal dominant; Autosomal recessive
21	FTCD	606806	Glutamate formiminotransferase deficiency	Autosomal recessive
19	FTL	134790	L-ferritin deficiency	Autosomal recessive*
16	FTO	610966	Growth retardation, developmental delay, facial dysmorphism	Autosomal recessive
X	FTSJ1	300499	Mental retardation, X-linked 44	X-linked
1	FUCA1	612280	Fucosidosis	Autosomal recessive
14	FUT8	602589	Congenital disorder of glycosylation with defective fucosylation, type 1	Autosomal recessive
9	FXN	606829	Friedreich ataxia	Autosomal recessive
3	FYCO1	607182	Cataract 18	Autosomal recessive
8	FZD6	603409	Nail disorder, nonsyndromic congenital, type 10 (claw-shaped nails)	Autosomal recessive
17	G6PC1	613742	Glycogen storage disease, type 1A	Autosomal recessive
17	G6PC3	611045	Dursun syndrome	Autosomal recessive
X	G6PD	305900	G6PD deficiency	X-linked
17	GAA	606800	Glycogen storage disease, type 2	Autosomal recessive
14	GALC	606890	Krabbe disease	Autosomal recessive
1	GALE	606953	Galactose epimerase deficiency	Autosomal recessive
17	GALK1	604313	Galactokinase deficiency with cataracts	Autosomal recessive
16	GALNS	612222	Mucopolysaccharidosis, type 4A	Autosomal recessive
2	GALNT3	601756	Tumoral calcinosis, hyperphosphatemic, familial, type 1	Autosomal recessive
9	GALT	606999	Galactosemia	Autosomal recessive
19	GAMT	601240	Cerebral creatine deficiency syndrome, type 2	Autosomal recessive
16	GAN	605379	Giant axonal neuropathy, type 1	Autosomal recessive
16	GAS8	605178	Ciliary dyskinesia, primary, type 33	Autosomal recessive
15	GATM	602360	Cerebral creatine deficiency syndrome, type 3	Autosomal recessive
1	GBA1	606463	Gaucher disease	Autosomal recessive
9	GBA2	609471	Spastic paraplegia, type 46, autosomal recessive	Autosomal recessive
3	GBE1	607839	Glycogen storage disease, type 4	Autosomal recessive
19	GCDH	608801	Glutaricaciduria, type 1	Autosomal recessive
14	GCH1	600225	Hyperphenylalaninemia, BH4-deficient, type B	Autosomal recessive
7	GCK	138079	Permanent neonatal diabetes mellitus (PNDM)	Autosomal recessive*
6	GCM2	603716	Hypoparathyroidism, familial isolated (FIH) 2	Autosomal recessive
6	GCNT2	600429	Cataract 13, with adult i phenotype	Autosomal recessive
16	GCSH	238330	Multiple mitochondrial dysfunctions syndrome 7	Autosomal recessive
8	GDAP1	606598	Charcot-Marie-Tooth disease, recessive intermediate, type A	Autosomal recessive
19	GDF1	602880	Right atrial isomerism (Ivemark syndrome)	Autosomal recessive
20	GDF5	601146	Chondrodysplasia, Grebe type	Autosomal recessive
8	GDF6	601147	Leber congenital amaurosis, type 17	Autosomal recessive
16	GFER	600924	Myopathy, mitochondrial progressive, with congenital cataract, hearing loss, and developmental delay	Autosomal recessive
3	GFM1	606639	Combined oxidative phosphorylation deficiency, type 1	Autosomal recessive
2	GFPT1	138292	Myasthenia, congenital, type 12, with tubular aggregates	Autosomal recessive
2	GGCX	137167	Vitamin K-dependent clotting factors, combined deficiency of, type 1	Autosomal recessive
17	GH1	139250	Growth hormone deficiency, isolated, type 1A; Kowarski syndrome	Autosomal recessive
5	GHR	600946	Laron dwarfism	Autosomal recessive
7	GHRHR	139191	Growth hormone deficiency, isolated, type 1B	Autosomal recessive
3	GHSR	601898	Growth hormone deficiency, isolated partial	Autosomal recessive
20	GINS1	610608	Immunodeficiency, type 55	Autosomal recessive
19	GIPC3	608792	Deafness, autosomal recessive, type 15	Autosomal recessive
6	GJA1	121014	Craniometaphyseal dysplasia, autosomal recessive	Autosomal recessive
X	GJB1	304040	Charcot-Marie-Tooth neuropathy, X-linked dominant, type 1	X-linked
13	GJB2	121011	Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6	Autosomal recessive; Digenic inheritance (GJB6 gene)
13	GJB6	604418	Deafness, autosomal recessive, type 1B; Deafness, digenic GJB2/GJB6	Autosomal recessive; Digenic inheritance (GJB2 gene)
1	GJC2	608803	Spastic paraplegia, type 44, autosomal recessive	Autosomal recessive
X	GLA	300644	Fabry disease	X-linked
3	GLB1	611458	GM1-gangliosidosis, types 1-3; Mucopolysaccharidosis, type 4B (Morquio)	Autosomal recessive
9	GLDC	238300	Glycine encephalopathy	Autosomal recessive
15	GLDN	608603	Lethal congenital contracture syndrome 11	Autosomal recessive
9	GLE1	603371	Lethal congenital contracture syndrome, type 1; Congenital arthrogryposis with anterior horn cell disease	Autosomal recessive
16	GLIS2	608539	Nephronophthisis, type 7	Autosomal recessive
9	GLIS3	610192	Diabetes mellitus, neonatal, with congenital hypothyroidism	Autosomal recessive
5	GLRA1	138491	Hyperekplexia, type 1	Autosomal recessive*
4	GLRB	138492	Hyperekplexia, type 2	Autosomal recessive
14	GLRX5	609588	Anemia, sideroblastic, type 3, pyridoxine-refractory; Spasticity, childhood-onset, with hyperglycinemia	Autosomal recessive
1	GLUL	138290	Glutamine deficiency, congenital	Autosomal recessive
3	GLYCTK	610516	D-glyceric aciduria	Autosomal recessive
5	GM2A	613109	GM2-gangliosidosis, AB variant	Autosomal recessive
2	GMPPA	615495	Alacrima, achalasia, and mental retardation syndrome	Autosomal recessive
3	GMPPB	615320	Muscular dystrophy-dystroglycanopathy 14	Autosomal recessive
3	GNAT1	139330	Night blindness, congenital stationary, type 1G	Autosomal recessive
1	GNAT2	139340	Achromatopsia, type 4	Autosomal recessive
15	GNB5	604447	Intellectual developmental disorder with cardiac arrhythmia; Language delay and ADHD/cognitive impairment with or without cardiac arrhythmia	Autosomal recessive
9	GNE	603824	Inclusion body myopathy, type 2 (Nonaka myopathy)	Autosomal recessive
6	GNMT	606628	Glycine N-methyltransferase deficiency	Autosomal recessive
1	GNPAT	602744	Rhizomelic chondrodysplasia punctata, type 2	Autosomal recessive
12	GNPTAB	607840	Mucolipidosis 2 alpha/beta; Mucolipidosis 3 alpha/beta	Autosomal recessive
16	GNPTG	607838	Mucolipidosis III gamma	Autosomal recessive
4	GNRHR	138850	Hypogonadotropic hypogonadism, type 7, without anosmia	Autosomal recessive
12	GNS	607664	Mucopolysaccharidosis, type 3D (Sanfilippo syndrome D)	Autosomal recessive
1	GORAB	607983	Geroderma osteodysplasticum	Autosomal recessive
17	GOSR2	604027	Epilepsy, progressive myoclonic, type 6	Autosomal recessive
16	GOT2	138150	Epileptic encephalopathy, early infantile, 82	Autosomal recessive
17	GP1BA	606672	Bernard-Soulier syndrome, type A1	Autosomal recessive
22	GP1BB	138720	Bernard-Soulier syndrome, type B	Autosomal recessive
19	GP6	605546	Bleeding disorder, platelet-type, type 11	Autosomal recessive
3	GP9	173515	Bernard-Soulier syndrome, type C	Autosomal recessive
8	GPAA1	603048	Glycosylphosphatidylinositol biosynthesis defect 15	Autosomal recessive
13	GPC6	604404	Omodysplasia, type 1	Autosomal recessive
12	GPD1	138420	Hypertriglyceridemia, transient infantile	Autosomal recessive
14	GPHN	603930	Molybdenum cofactor deficiency C	Autosomal recessive
19	GPI	172400	Hemolytic anemia, nonspherocytic, due to glucose phosphate isomerase deficiency	Autosomal recessive
8	GPIHBP1	612757	Hyperlipoproteinemia, type 1D	Autosomal recessive
X	GPR143	300808	Ocular albinism, type 1 (Nettleship-Falls type)	X-linked
17	GPR179	614515	Night blindness, congenital stationary (complete), type 1E, autosomal recessive	Autosomal recessive
14	GPR68	601404	Amelogenesis imperfecta, type 2A6 (hypomaturation type)	Autosomal recessive
1	GPSM2	609245	Chudley-McCullough syndrome	Autosomal recessive
16	GPT2	138210	Mental retardation, autosomal recessive 49	Autosomal recessive
19	GPX4	138322	Spondylometaphyseal dysplasia, Sedaghatian type	Autosomal recessive
8	GRHL2	608576	Ectodermal dysplasia/short stature syndrome	Autosomal recessive
9	GRHPR	604296	Hyperoxaluria, primary, type 2	Autosomal recessive
4	GRID2	602368	Spinocerebellar ataxia, autosomal recessive, type 18	Autosomal recessive
6	GRIK2	138244	Mental retardation, autosomal recessive, type, 6	Autosomal recessive
9	GRIN1	138249	Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive	Autosomal recessive
12	GRIP1	604597	Fraser syndrome 3	Autosomal recessive
13	GRK1	180381	Oguchi disease-2	Autosomal recessive
6	GRM1	604473	Spinocerebellar ataxia, autosomal recessive, type 13	Autosomal recessive
5	GRM6	604096	Night blindness, congenital stationary (complete), type 1B, autosomal recessive	Autosomal recessive
17	GRN	138945	Ceroid lipofuscinosis, neuronal, type 11	Autosomal recessive
4	GRXCR1	613283	Deafness, autosomal recessive, type 25	Autosomal recessive
14	GSC	138890	Short stature, auditory canal atresia, mandibular hypoplasia, skeletal abnormalities	Autosomal recessive
20	GSS	601002	Glutathione synthetase deficiency	Autosomal recessive
6	GTF2H5	608780	Trichothiodystrophy, type 3, photosensitive	Autosomal recessive
6	GTPBP2	607434	Jaberi-Elahi syndrome	Autosomal recessive
19	GTPBP3	608536	Combined oxidative phosphorylation deficiency 23	Autosomal recessive
12	GUCY2C	601330	Meconium ileus	Autosomal recessive
17	GUCY2D	600179	Leber congenital amaurosis, type 1	Autosomal recessive
4	GUF1	617064	?Epileptic encephalopathy, early infantile, 40	Autosomal recessive
7	GUSB	611499	Mucopolysaccharidosis, type 7	Autosomal recessive
3	GYG1	603942	Polyglucosan body myopathy, type 2	Autosomal recessive
19	GYS1	138570	Glycogen storage disease, type 0, muscle	Autosomal recessive
12	GYS2	138571	Glycogen storage disease, type 0, liver	Autosomal recessive
20	GZF1	613842	Joint laxity, short stature, and myopia	Autosomal recessive
1	H6PD	138090	Cortisone reductase deficiency 1	Autosomal recessive
2	HAAO	604521	Vertebral, cardiac, renal, and limb defects syndrome 1	Autosomal recessive
6	HACE1	610876	Spastic paraplegia and psychomotor retardation with or without seizures	Autosomal recessive
4	HADH	601609	3-hydroxyacyl-CoA dehydrogenase deficiency	Autosomal recessive
2	HADHA	600890	Long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD) deficiency; Mitochondrial trifunctional protein deficiency	Autosomal recessive
2	HADHB	143450	Mitochondrial trifunctional protein deficiency	Autosomal recessive
19	HAMP	606464	Hemochromatosis, type 2B	Autosomal recessive
5	HARS1	142810	Usher syndrome, type 3B	Autosomal recessive
1	HAX1	605998	Neutropenia, severe congenital, type 3, autosomal recessive	Autosomal recessive
16	HBA1	141800	Alpha thalassemia	Autosomal recessive
16	HBA2	141850	Alpha thalassemia	Autosomal recessive
11	HBB	141900	HBB-related hemoglobinopathies	Autosomal recessive
X	HCFC1	300019	Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type )	X-linked
10	HELLS	603946	Immunodeficiency-centromeric instability-facial anomalies syndrome 4	Autosomal recessive
11	HEPACAM	611642	Megalencephalic leukoencephalopathy with subcortical cysts 2A	Autosomal recessive
15	HERC1	605109	Macrocephaly, dysmorphic facies, and psychomotor retardation	Autosomal recessive
15	HERC2	605837	Mental retardation, autosomal recessive, type 38	Autosomal recessive
17	HES7	608059	Spondylocostal dysostosis, type 4, autosomal recessive	Autosomal recessive
3	HESX1	601802	Growth hormone deficiency with pituitary anomalies	Autosomal recessive
15	HEXA	606869	Tay-Sachs disease	Autosomal recessive
5	HEXB	606873	Sandhoff disease, infantile, juvenile, and adult forms	Autosomal recessive
6	HFE	613609	Hemochromatosis, type 1	Autosomal recessive
1	HFM1	615684	Premature ovarian failure 9	Autosomal recessive
3	HGD	607474	Alkaptonuria	Autosomal recessive
7	HGF	142409	Deafness, autosomal recessive, type 39	Autosomal recessive
8	HGSNAT	610453	Mucopolysaccharidosis type 3C (Sanfilippo syndrome C)	Autosomal recessive
2	HIBCH	610690	3-hydroxyisobutryl-CoA hydrolase deficiency	Autosomal recessive
11	HIKESHI	614908	Leukodystrophy, hypomyelinating, type 13	Autosomal recessive
5	HINT1	601314	Neuromyotonia and axonal neuropathy, autosomal recessive	Autosomal recessive
1	HJV	608374	Hemochromatosis, type 2A	Autosomal recessive
10	HK1	142600	Charcot-Marie-Tooth disease, type 4G	Autosomal recessive
21	HLCS	609018	Holocarboxylase synthetase deficiency	Autosomal recessive
1	HMGCL	613898	HMG-CoA lyase deficiency	Autosomal recessive
1	HMGCS2	600234	HMG-CoA synthase-2 deficiency	Autosomal recessive
22	HMOX1	141250	Heme oxygenase-1 deficiency	Autosomal recessive
4	HMX1	142992	Oculoauricular syndrome	Autosomal recessive
2	HNMT	605238	Mental retardation, autosomal recessive, type 51	Autosomal recessive
10	HOGA1	613597	Hyperoxaluria, primary, type 3	Autosomal recessive
7	HOXA1	142955	Athabaskan brainstem dysgenesis syndrome	Autosomal recessive
17	HOXB1	142968	Facial paresis, hereditary congenital, 3	Autosomal recessive
12	HOXC13	142976	Ectodermal dysplasia 9, hair/nail type	Autosomal recessive
1	HPCA	142622	Dystonia 2, torsion, autosomal recessive	Autosomal recessive
12	HPD	609695	Tyrosinemia, type 3	Autosomal recessive
4	HPGD	601688	Hypertrophic osteoarthropathy, primary, type 1 (pachydermoperiostosis)	Autosomal recessive
X	HPRT1	308000	Lesch-Nyhan syndrome	X-linked
10	HPS1	604982	Hermansky-Pudlak syndrome, type 1	Autosomal recessive
3	HPS3	606118	Hermansky-Pudlak syndrome, type 3	Autosomal recessive
22	HPS4	606682	Hermansky-Pudlak syndrome, type 4	Autosomal recessive
11	HPS5	607521	Hermansky-Pudlak syndrome, type 5	Autosomal recessive
10	HPS6	607522	Hermansky-Pudlak syndrome, type 6	Autosomal recessive
10	HPSE2	613469	Urofacial syndrome, type 1	Autosomal recessive
8	HR	602302	Alopecia universalis; Atrichia with papular lesions	Autosomal recessive
16	HSD11B2	614232	Apparent mineralocorticoid excess	Autosomal recessive
X	HSD17B10	300256	HSD10 mitochondrial disease	X-linked
9	HSD17B3	605573	46,XY disorder of sex development due to 17-beta-hydroxysteroid dehydrogenase 3 deficiency	Autosomal recessive
5	HSD17B4	601860	D-bifunctional protein deficiency	Autosomal recessive
1	HSD3B2	613890	Adrenal hyperplasia, congenital, due to 3-beta-hydroxysteroid dehydrogenase 2 deficiency	Autosomal recessive
16	HSD3B7	607764	Bile acid synthesis defect, congenital, type 1	Autosomal recessive
5	HSPA9	600548	Even-plus syndrome	Autosomal recessive
2	HSPD1	118190	Leukodystrophy, hypomyelinating, type 4	Autosomal recessive
1	HSPG2	142461	Schwartz-Jampel syndrome, type 1; Dyssegmental dysplasia, Silverman-Handmaker type	Autosomal recessive
10	HTRA1	602194	CARASIL syndrome	Autosomal recessive
2	HTRA2	606441	3-methylglutaconic aciduria, type 8	Autosomal recessive
3	HYAL1	607071	?Mucopolysaccharidosis, type 9	Autosomal recessive
7	HYC11	610531	Leukodystrophy, hypomyelinating, type 5	Autosomal recessive
16	HYDIN	610812	Ciliary dyskinesia, primary, type 5	Autosomal recessive
11	HYLS1	610693	Hydrolethalus syndrome	Autosomal recessive
9	IARS1	600709	Growth retardation, intellectual developmental disorder, hypotonia, and hepatopathy	Autosomal recessive
1	IBA57	615316	Multiple mitochondrial dysfunctions syndrome 3	Autosomal recessive
2	ICOS	604558	Immunodeficiency, common variable, 1	Autosomal recessive
20	IDH3B	604526	Retinitis pigmentosa, type 46	Autosomal recessive
X	IDS	300823	Mucopolysaccharidosis, type 2	X-linked
4	IDUA	252800	Mucopolysaccharidosis type 1	Autosomal recessive
18	IER3IP1	609382	Microcephaly, epilepsy, and diabetes syndrome	Autosomal recessive
6	IFNGR1	107470	Immunodeficiency, type 27A, mycobacteriosis	Autosomal recessive
21	IFNGR2	147569	Immunodeficiency, type 28, mycobacteriosis	Autosomal recessive
3	IFT122	606045	Cranioectodermal dysplasia 1	Autosomal recessive
16	IFT140	614620	Retinitis pigmentosa, type 80; Short-rib thoracic dysplasia 9 with or without polydactyly	Autosomal recessive
2	IFT172	607386	Short-rib thoracic dysplasia 10 with or without polydactyly	Autosomal recessive
14	IFT43	614068	Short-rib thoracic dysplasia 18 with polydactyly	Autosomal recessive
20	IFT52	617094	Short-rib thoracic dysplasia 16 with or without polydactyly	Autosomal recessive
3	IFT80	611177	Short-rib thoracic dysplasia, type 2, with or without polydactyly	Autosomal recessive
12	IFT81	605489	Short-rib thoracic dysplasia 19 with or without polydactyly	Autosomal recessive
12	IGF1	147440	Growth retardation with deafness and mental retardation due to IGF1 deficiency	Autosomal recessive
15	IGF1R	147370	Insulin-like growth factor I, resistance to	Autosomal recessive*
16	IGFALS	601489	Acid-labile subunit deficiency	Autosomal recessive
4	IGFBP7	602867	Retinal arterial macroaneurysm with supravalvular pulmonic stenosis	Autosomal recessive
11	IGHMBP2	600502	Charcot-Marie-Tooth disease, axonal, type 2S	Autosomal recessive
22	IGLL1	146770	Agammaglobulinemia 2	Autosomal recessive
2	IHH	600726	Acrocapitofemoral dysplasia	Autosomal recessive
8	IKBKB	603258	Immunodeficiency, type 15	Autosomal recessive
11	IL10RA	146933	Inflammatory bowel disease, type 28, early onset, autosomal recessive	Autosomal recessive
21	IL10RB	123889	Inflammatory bowel disease, type 25, early onset, autosomal recessive	Autosomal recessive
9	IL11RA	600939	Craniosynostosis and dental anomalies	Autosomal recessive
5	IL12B	161561	Immunodeficiency, type 29, mycobacteriosis	Autosomal recessive
19	IL12RB1	601604	Immunodeficiency, type 30	Autosomal recessive
22	IL17RA	605461	Immunodeficiency, type 51	Autosomal recessive
3	IL17RC	610925	Candidiasis, familial, 9	Autosomal recessive
X	IL1RAPL1	300206	Mental retardation, X-linked, type 21/34	X-linked
2	IL1RN	147679	Sterile multifocal osteomyelitis with periostitis and pustulosis	Autosomal recessive
16	IL21R	605383	Immunodeficiency, type 56	Autosomal recessive
10	IL2RA	147730	Immunodeficiency, type 41, with lymphoproliferation and autoimmunity	Autosomal recessive
X	IL2RG	308380	Severe combined immunodeficiency, X-linked	X-linked
2	IL36RN	605507	Psoriasis, type 14, pustular	Autosomal recessive
5	IL7R	146661	Severe combined immunodeficiency, T-cell negative, B-cell/natural killer cell-positive type	Autosomal recessive
3	ILDR1	609739	Deafness, autosomal recessive, type 42	Autosomal recessive
8	IMPA1	602064	Mental retardation, autosomal recessive 59	Autosomal recessive
3	IMPG2	607056	Retinitis pigmentosa, type 56	Autosomal recessive
9	INPP5E	613037	Joubert syndrome, type 1	Autosomal recessive
17	INPP5K	607875	Muscular dystrophy, congenital, with cataracts and intellectual disability	Autosomal recessive
11	INPPL1	600829	Opsismodysplasia	Autosomal recessive
11	INS	176730	Permanent neonatal diabetes mellitus (PNDM)	Autosomal recessive*
19	INSR	147670	Diabetes mellitus, insulin-resistant, with acanthosis nigricans, type A	Autosomal recessive
7	INTS1	611345	Neurodevelopmental disorder with cataracts, poor growth, and dysmorphic facies	Autosomal recessive
9	INVS	243305	Nephronophthisis, type 2, infantile	Autosomal recessive
3	IQCB1	609237	Senior-Loken syndrome, type 5	Autosomal recessive
7	IQCE	617631	Polydactyly, postaxial, type A7	Autosomal recessive
12	IRAK4	606883	Immunodeficiency, type 67 (IRAK4 deficiency)	Autosomal recessive
16	IRF8	601565	Immunodeficiency, type 32B, monocyte and dendritic cell deficiency	Autosomal recessive
16	IRX5	606195	Hamamy syndrome	Autosomal recessive
9	ISCA1	611006	Multiple mitochondrial dysfunctions syndrome 5	Autosomal recessive
14	ISCA2	615317	Multiple mitochondrial dysfunctions syndrome 4	Autosomal recessive
12	ISCU	611911	Myopathy with lactic acidosis, hereditary	Autosomal recessive
1	ISG15	147571	Immunodeficiency, type 38	Autosomal recessive
20	ITCH	606409	Autoimmune disease, multisystem, with facial dysmorphism	Autosomal recessive
17	ITGA2B	607759	Glanzmann thrombasthenia	Autosomal recessive
17	ITGA3	605025	Interstitial lung disease, nephrotic syndrome, and epidermolysis bullosa, congenital	Autosomal recessive
2	ITGA6	147556	Epidermolysis bullosa, junctional, with pyloric stenosis	Autosomal recessive
12	ITGA7	600536	Muscular dystrophy, congenital, due to ITGA7 deficiency	Autosomal recessive
10	ITGA8	604063	Renal hypodysplasia/aplasia 1	Autosomal recessive
21	ITGB2	600065	Leukocyte adhesion deficiency	Autosomal recessive
17	ITGB3	173470	Glanzmann thrombasthenia	Autosomal recessive
17	ITGB4	147557	Epidermolysis bullosa, junctional, with pyloric atresia	Autosomal recessive
2	ITGB6	147558	Amelogenesis imperfecta, type 1H	Autosomal recessive
5	ITK	186973	Lymphoproliferative syndrome 1	Autosomal recessive
20	ITPA	147520	Epileptic encephalopathy, early infantile, type 35	Autosomal recessive
3	ITPR1	147265	Gillespie syndrome	Autosomal recessive*
15	IVD	607036	Isovaleric acidemia	Autosomal recessive
6	IYD	612025	Thyroid dyshormonogenesis, type 4	Autosomal recessive
3	JAGN1	616012	Neutropenia, severe congenital, 6, autosomal recessive	Autosomal recessive
19	JAK3	600173	Severe Combined Immunodeficiency, autosomal recessive, T-negative/B-positive type	Autosomal recessive
11	JAM3	606871	Hemorrhagic destruction of the brain, subependymal calcification, and cataracts	Autosomal recessive
17	JUP	173325	Naxos disease	Autosomal recessive
19	KANK2	614610	Nephrotic syndrome, type 16	Autosomal recessive
16	KARS1	601421	Deafness, autosomal recessive, type 89	Autosomal recessive
16	KATNB1	602703	Lissencephaly 6, with microcephaly	Autosomal recessive
16	KATNIP	616650	Joubert syndrome 26	Autosomal recessive
21	KCNE1	176261	Jervell and Lange-Nielsen syndrome 2	Autosomal recessive
11	KCNJ1	600359	Bartter syndrome, type 2	Autosomal recessive
1	KCNJ10	602208	SESAME syndrome	Autosomal recessive
11	KCNJ11	600937	Hyperinsulinemic hypoglycemia, type 2 (congenital hyperinsulinism); Permanent neonatal diabetes mellitus (PNDM)	Autosomal recessive; Autosomal recessive*
2	KCNJ13	603208	Leber congenital amaurosis, type 16	Autosomal recessive
9	KCNV2	607604	Retinal cone dystrophy, type 3B	Autosomal recessive
7	KCTD7	611725	Epilepsy, progressive myoclonic, type 3, with or without intracellular inclusions	Autosomal recessive
X	KDM5C	314690	Mental retardation, X-linked, syndromic, Claes-Jensen type	X-linked
18	KDSR	136440	Erythrokeratodermia variabilis et progressiva 4	Autosomal recessive
12	KERA	603288	Cornea plana 2, autosomal recessive	Autosomal recessive
6	KHDC3L	611687	Hydatidiform mole, recurrent, type 2	Autosomal recessive
14	KIAA0586	610178	Short-rib thoracic dysplasia 14 with polydactyly	Autosomal recessive
17	KIAA0753	617112	?Orofaciodigital syndrome, type 15	Autosomal recessive
7	KIAA1549	613344	Retinitis pigmentosa, type 86	Autosomal recessive
1	KIF14	611279	Microcephaly 20, primary, autosomal recessive; ?Meckel syndrome 12	Autosomal recessive
2	KIF1A	601255	Neuropathy, hereditary sensory, type 2C; Spastic paraplegia, type 30, autosomal recessive	Autosomal recessive
17	KIF1C	603060	Spastic ataxia 2, autosomal recessive	Autosomal recessive
15	KIF7	611254	Acrocallosal syndrome; Joubert syndrome, type 12	Autosomal recessive
10	KIFBP	609367	Goldberg-Shprintzen megacolon syndrome	Autosomal recessive
19	KISS1R	604161	Hypogonadotropic hypogonadism, type 8, with or without anosmia	Autosomal recessive
20	KIZ	615757	Retinitis pigmentosa 69	Autosomal recessive
5	KLHL3	605775	Pseudohypoaldosteronism, type 2D	Autosomal recessive
3	KLHL40	615340	Nemaline myopathy 8, autosomal recessive	Autosomal recessive
2	KLHL41	607701	Nemaline myopathy 9	Autosomal recessive
7	KLHL7	611119	Cold-induced sweating syndrome 3	Autosomal recessive
19	KLK4	603767	Amelogenesis imperfecta, type 2A1 (hypomaturation type)	Autosomal recessive
4	KLKB1	229000	Fletcher factor (prekallikrein) deficiency	Autosomal recessive
15	KNL1	609173	Microcephaly 4, primary, autosomal recessive	Autosomal recessive
19	KPTN	615620	Mental retardation, autosomal recessive 41	Autosomal recessive
22	KREMEN1	609898	Ectodermal dysplasia 13, hair/tooth type	Autosomal recessive
17	KRT10	148080	Epidermolytic hyperkeratosis	Autosomal recessive*
17	KRT14	148066	Epidermolysis bullosa simplex, autosomal recessive, type 1	Autosomal recessive
17	KRT25	616646	Woolly hair, autosomal recessive 3	Autosomal recessive
12	KRT5	148040	Epidermolysis bullosa simplex, autosomal recessive, type 1	Autosomal recessive
12	KRT85	602767	Ectodermal dysplasia 4, hair/nail type	Autosomal recessive
3	KY	605739	Myopathy, myofibrillar, type 7	Autosomal recessive
2	KYNU	605197	Vertebral, cardiac, renal, and limb defects syndrome, type 2	Autosomal recessive
X	L1CAM	308840	L1 Syndrome	X-linked
14	L2HGDH	609584	L-2-hydroxyglutaric aciduria	Autosomal recessive
18	LAMA1	150320	Poretti-Boltshauser syndrome	Autosomal recessive
6	LAMA2	156225	LAMA2-related muscular dystrophy	Autosomal recessive
18	LAMA3	600805	Junctional epidermolysis bullosa (JEB) Herlitz type; JEB non-Herlitz type	Autosomal recessive
7	LAMB1	150240	Lissencephaly, type 5	Autosomal recessive
3	LAMB2	150325	Pierson syndrome; Nephrotic syndrome, type 5, with or without ocular abnormalities	Autosomal recessive; Autosomal recessive
1	LAMB3	150310	Junctional epidermolysis bullosa (JEB) Herlitz type; JEB non-Herlitz type	Autosomal recessive
1	LAMC2	150292	Junctional epidermolysis bullosa (JEB) Herlitz type; JEB non-Herlitz type	Autosomal recessive
9	LAMC3	604349	Cortical malformations, occipital	Autosomal recessive
22	LARGE1	603590	Muscular dystrophy-dystroglycanopathy, type 6A and 6B	Autosomal recessive
4	LARP7	612026	Alazami syndrome	Autosomal recessive
5	LARS1	151350	?Infantile liver failure syndrome 1 (ILFS1)	Autosomal recessive
3	LARS2	604544	Perrault syndrome, type 4	Autosomal recessive
16	LAT	602354	Immunodeficiency, type 52	Autosomal recessive
1	LBR	600024	Greenberg skeletal dysplasia	Autosomal recessive
6	LCA5	611408	Leber congenital amaurosis, type 5	Autosomal recessive
16	LCAT	606967	Familial LCAT deficiency; Fish-eye disease	Autosomal recessive
1	LCK	153390	?Immunodeficiency, type 22	Autosomal recessive
2	LCT	603202	Lactase deficiency, congenital	Autosomal recessive
11	LDHA	150000	Glycogen storage disease type 11	Autosomal recessive
19	LDLR	606945	Hypercholesterolemia, familial, type 1	Autosomal recessive; Autosomal dominant
1	LDLRAP1	605747	Hypercholesterolemia, familial, autosomal recessive	Autosomal recessive
6	LEMD2	616312	Cataract 46, juvenile-onset	Autosomal recessive
7	LEP	164160	Obesity, morbid, due to leptin deficiency	Autosomal recessive
1	LEPR	601007	Obesity, morbid, due to leptin receptor deficiency	Autosomal recessive
19	LGI4	608303	Arthrogryposis multiplex congenita, neurogenic, with myelin defect	Autosomal recessive
19	LHB	152780	Hypogonadotropic hypogonadism, type 23, with or without anosmia	Autosomal recessive
2	LHCGR	152790	Leydig cell hypoplasia	Autosomal recessive
6	LHFPL5	609427	Deafness, autosomal recessive, type 67	Autosomal recessive
9	LHX3	600577	Pituitary hormone deficiency, combined, type 3	Autosomal recessive
4	LIAS	607031	Hyperglycinemia, lactic acidosis, and seizures	Autosomal recessive
5	LIFR	151443	Stuve-Wiedemann syndrome / Schwartz-Jampel type 2 syndrome	Autosomal recessive
13	LIG4	601837	LIG4 syndrome	Autosomal recessive
19	LIM2	154045	Cataract 19, multiple types	Autosomal recessive
15	LINS1	610350	Mental retardation, autosomal recessive, type 27	Autosomal recessive
10	LIPA	613497	Lysosomal acid lipase deficiency	Autosomal recessive
19	LIPE	151750	Lipodystrophy, familial partial, type 6	Autosomal recessive
3	LIPH	607365	Hypotrichosis, type 7 or woolly hair, autosomal recessive, type 2, with or without hypotrichosis	Autosomal recessive
10	LIPN	613924	Ichthyosis, congenital, autosomal recessive 8	Autosomal recessive
2	LIPT1	610284	Lipoyltransferase 1 deficiency	Autosomal recessive
11	LIPT2	617659	Encephalopathy, neonatal severe, with lactic acidosis and brain abnormalities	Autosomal recessive
18	LMAN1	601567	Combined deficiency of factor V and factor VIII, type 1	Autosomal recessive
6	LMBRD1	612625	Methylmalonic aciduria and homocystinuria, cblF type	Autosomal recessive
16	LMF1	611761	Lipase deficiency, combined	Autosomal recessive
3	LMOD3	616112	Nemaline myopathy 10	Autosomal recessive
19	LONP1	605490	CODAS syndrome	Autosomal recessive
18	LOXHD1	613072	Deafness, autosomal recessive, type 77	Autosomal recessive
13	LPAR6	609239	Hypotrichosis, type 8 or woolly hair, autosomal recessive, type 1, with or without hypotrichosis	Autosomal recessive
2	LPIN1	605518	Myoglobinuria, acute recurrent, autosomal recessive	Autosomal recessive
18	LPIN2	605519	Majeed syndrome	Autosomal recessive
8	LPL	609708	Lipoprotein lipase deficiency	Autosomal recessive
4	LRAT	604863	Leber congenital amaurosis type 14	Autosomal recessive
4	LRBA	606453	Immunodeficiency, common variable, 8, with autoimmunity	Autosomal recessive
1	LRIG2	608869	Urofacial syndrome 2	Autosomal recessive
4	LRIT3	615004	Night blindness, congenital stationary (complete), 1F, autosomal recessive	Autosomal recessive
10	LRMDA	614537	Albinism, oculocutaneous, type 7	Autosomal recessive
2	LRP2	600073	Donnai-Barrow syndrome	Autosomal recessive
11	LRP4	604270	Cenani-Lenz syndactyly syndrome	Autosomal recessive
11	LRP5	603506	Osteoporosis-pseudoglioma syndrome	Autosomal recessive
4	LRPAP1	104225	Myopia, type 23, autosomal recessive	Autosomal recessive
2	LRPPRC	607544	Leigh syndrome, French-Canadian type	Autosomal recessive
9	LRSAM1	610933	Charcot-Marie-Tooth disease, axonal, type 2P	Autosomal recessive
11	LRTOMT	612414	Deafness, autosomal recessive, type 63	Autosomal recessive
21	LSS	600909	Alopecia-intellectual disability syndrome 4; Cataract 44; Hypotrichosis 14	Autosomal recessive
14	LTBP2	602091	Microspherophakia and/or megalocornea, with ectopia lentis and with or without secondary glaucoma	Autosomal recessive
11	LTBP3	602090	Dental anomalies and short stature	Autosomal recessive
19	LTBP4	604710	Cutis laxa, autosomal recessive, type 1C	Autosomal recessive
5	LYRM7	615831	Mitochondrial complex III deficiency, nuclear type 8	Autosomal recessive
1	LYST	606897	Chediak-Higashi syndrome	Autosomal recessive
3	LZTFL1	606568	Bardet-Biedl syndrome, type 17	Autosomal recessive
22	LZTR1	600574	Noonan syndrome, type 2	Autosomal recessive
19	MAG	159460	Spastic paraplegia, type 75, autosomal recessive	Autosomal recessive
7	MAGI2	606382	Nephrotic syndrome, type 15	Autosomal recessive
6	MAK	154235	Retinitis pigmentosa type 62	Autosomal recessive
18	MALT1	604860	Immunodeficiency, type 12	Autosomal recessive
9	MAN1B1	604346	Mental retardation, autosomal recessive, type 15	Autosomal recessive
19	MAN2B1	609458	Alpha-mannosidosis	Autosomal recessive
4	MANBA	609489	Mannosidosis, beta	Autosomal recessive
2	MAP3K20	609479	Centronuclear myopathy, type 6, with fiber-type disproportion	Autosomal recessive
15	MAPKBP1	616786	Nephronophthisis 20	Autosomal recessive
17	MAPT	157140	Supranuclear palsy, progressive atypical (parkinsonism syndrome)	Autosomal recessive
12	MARS1	156560	Interstitial lung and liver disease	Autosomal recessive
2	MARS2	609728	Spastic ataxia, type 3, autosomal recessive	Autosomal recessive
5	MARVELD2	610572	Deafness, autosomal recessive, type 49	Autosomal recessive
3	MASP1	600521	3MC syndrome 1	Autosomal recessive
10	MAT1A	610550	Methionine adenosyltransferase deficiency, autosomal recessive	Autosomal recessive
2	MATN3	602109	?Spondyloepimetaphyseal dysplasia	Autosomal recessive
19	MBOAT7	606048	Mental retardation, autosomal recessive 57	Autosomal recessive
18	MC2R	607397	Glucocorticoid deficiency, due to ACTH unresponsiveness	Autosomal recessive
3	MCCC1	609010	3-Methylcrotonyl-CoA carboxylase deficiency, type 1	Autosomal recessive
5	MCCC2	609014	3-Methylcrotonyl-CoA carboxylase deficiency, type 2	Autosomal recessive
2	MCEE	608419	Methylmalonyl-CoA epimerase deficiency	Autosomal recessive
2	MCFD2	607788	Combined deficiency of factor V and factor VIII, type 2	Autosomal recessive
5	MCIDAS	614086	Ciliary dyskinesia, primary, type 42	Autosomal recessive
21	MCM3AP	603294	Peripheral neuropathy, autosomal recessive, with or without impaired intellectual development	Autosomal recessive
8	MCM4	602638	Immunodeficiency, type 54	Autosomal recessive
6	MCM9	610098	Ovarian dysgenesis 4	Autosomal recessive
19	MCOLN1	605248	Mucolipidosis type 4	Autosomal recessive
8	MCPH1	607117	Microcephaly type 1, primary, autosomal recessive	Autosomal recessive
7	MDH2	154100	Epileptic encephalopathy, early infantile, 51	Autosomal recessive
X	MECP2	300005	Encephalopathy, neonatal severe; Rett syndrome	X-linked
1	MECR	608205	Dystonia, childhood-onset, with optic atrophy and basal ganglia abnormalities	Autosomal recessive
11	MED17	603810	Microcephaly, postnatal progressive, with seizures and brain atrophy	Autosomal recessive
6	MED23	605042	Mental retardation, autosomal recessive, type 18	Autosomal recessive
19	MED25	610197	Basel-Vanagait-Smirin-Yosef syndrome	Autosomal recessive
16	MEFV	608107	Familial Mediterranean fever	Autosomal recessive
5	MEGF10	612453	Myopathy, areflexia, respiratory distress, and dysphagia, early-onset	Autosomal recessive
19	MEGF8	604267	Carpenter syndrome, type 2	Autosomal recessive
17	MEOX1	600147	Klippel-Feil syndrome 2	Autosomal recessive
2	MERTK	604705	Retinitis pigmentosa type 38	Autosomal recessive
15	MESP2	605195	Spondylocostal dysostosis, type 2, autosomal recessive	Autosomal recessive
17	METTL23	615262	Mental retardation, autosomal recessive 44	Autosomal recessive
2	MFF	614785	Encephalopathy due to defective mitochondrial and peroxisomal fission, type 2	Autosomal recessive
1	MFN2	608507	Charcot-Marie-Tooth disease, axonal, type 2A2B	Autosomal recessive
11	MFRP	606227	Microphthalmia, isolated type 5	Autosomal recessive
1	MFSD2A	614397	Microcephaly 15, primary, autosomal recessive	Autosomal recessive
4	MFSD8	611124	Ceroid lipofuscinosis, neuronal, type 7	Autosomal recessive
14	MGAT2	602616	Congenital disorder of glycosylation, type 2a	Autosomal recessive
20	MGME1	615076	Mitochondrial DNA depletion syndrome 11	Autosomal recessive
12	MGP	154870	Keutel syndrome	Autosomal recessive
10	MICU1	605084	Myopathy with extrapyramidal signs	Autosomal recessive
X	MID1	300552	Opitz GBBB syndrome, type 1	X-linked
13	MIPEP	602241	Combined oxidative phosphorylation deficiency 31	Autosomal recessive
3	MITF	156845	COMMAD syndrome	Autosomal recessive
20	MKKS	604896	Bardet-Biedl syndrome type 6	Autosomal recessive
17	MKS1	609883	Bardet-Biedl syndrome type 13; Meckel syndrome, type 1; Joubert syndrome, type 28	Autosomal recessive
22	MLC1	605908	Megalencephalic leukoencephalopathy with subcortical cysts	Autosomal recessive
2	MLPH	606526	Griscelli syndrome, type 3	Autosomal recessive
16	MLYCD	606761	Malonyl-CoA decarboxylase deficiency	Autosomal recessive
4	MMAA	607481	Methylmalonic aciduria, vitamin B12-responsive	Autosomal recessive
12	MMAB	607568	Methylmalonic aciduria, vitamin B12-responsive, type cblB	Autosomal recessive
1	MMACHC	609831	Methylmalonic aciduria and homocystinuria, cblC type	Autosomal recessive; digenic inheritance (PRDX1 gene)
2	MMADHC	611935	Homocystinuria, cblD type, variant 1	Autosomal recessive
3	MME	120520	Charcot-Marie-Tooth disease, axonal, type 2T	Autosomal recessive*
11	MMP13	600108	Metaphyseal dysplasia, Spahr type	Autosomal recessive
16	MMP2	120360	Multicentric osteolysis, nodulosis, and arthropathy (MONA)	Autosomal recessive
11	MMP20	604629	Amelogenesis imperfecta, type 2A2 (hypomaturation type)	Autosomal recessive
10	MMP21	608416	Heterotaxy, visceral, 7, autosomal	Autosomal recessive
6	MMUT	609058	Methylmalonic aciduria, mut(0) type	Autosomal recessive
18	MOCOS	613274	Xanthinuria, type 2	Autosomal recessive
6	MOCS1	603707	Molybdenum cofactor deficiency A	Autosomal recessive
5	MOCS2	603708	Molybdenum cofactor deficiency B	Autosomal recessive
2	MOGS	601336	Congenital disorder of glycosylation, type 2B	Autosomal recessive
6	MPC1	614738	Mitochondrial pyruvate carrier deficiency	Autosomal recessive
17	MPDU1	604041	Congenital disorder of glycosylation, type 1F	Autosomal recessive
9	MPDZ	603785	Hydrocephalus, congenital, type 2, with or without brain or eye anomalies	Autosomal recessive
15	MPI	154550	Congenital disorder of glycosylation, type 1B	Autosomal recessive
6	MPIG6B	606520	Thrombocytopenia, anemia, and myelofibrosis	Autosomal recessive
1	MPL	159530	Thrombocytopenia, congenital amegakaryocytic	Autosomal recessive
7	MPLKIP	609188	Trichothiodystrophy, type 4, nonphotosensitive	Autosomal recessive
17	MPO	606989	Myeloperoxidase deficiency	Autosomal recessive
2	MPV17	137960	Mitochondrial DNA depletion syndrome type 6 (hepatocerebral); Charcot-Marie-Tooth disease, axonal, type 2EE	Autosomal recessive
1	MPZ	159440	Dejerine-Sottas disease	Autosomal recessive*
21	MRAP	609196	Glucocorticoid deficiency, type 2	Autosomal recessive
11	MRE11	600814	Ataxia-telangiectasia-like disorder 1	Autosomal recessive
10	MRPS16	609204	Combined oxidative phosphorylation deficiency 2	Autosomal recessive
3	MRPS22	605810	Combined oxidative phosphorylation deficiency type 5	Autosomal recessive
16	MRPS34	611994	Combined oxidative phosphorylation deficiency 32	Autosomal recessive
5	MSH3	600887	Familial adenomatous polyposis, type 4	Autosomal recessive
4	MSMO1	607545	Microcephaly, congenital cataract, and psoriasiform dermatitis	Autosomal recessive
12	MSRB3	613719	Deafness, autosomal recessive, type 74	Autosomal recessive
1	MSTO1	617619	Myopathy, mitochondrial, and ataxia	Autosomal recessive*
15	MTFMT	611766	Combined oxidative phosphorylation deficiency 15	Autosomal recessive
14	MTHFD1	172460	Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinemia	Autosomal recessive
1	MTHFR	607093	Homocystinuria due to MTHFR deficiency	Autosomal recessive
X	MTM1	300415	Myotubular myopathy, X-linked	X-linked
11	MTMR2	603557	Charcot-Marie-Tooth disease, type 4B1	Autosomal recessive
6	MTO1	614667	Combined oxidative phosphorylation deficiency 10	Autosomal recessive
1	MTR	156570	Homocystinuria-megaloblastic anemia, cblG complementation type	Autosomal recessive
12	MTRFR	613541	Combined oxidative phosphorylation deficiency 7; Spastic paraplegia, type 55, autosomal recessive	Autosomal recessive
5	MTRR	602568	Homocystinuria-megaloblastic anemia, cbl E type	Autosomal recessive
4	MTTP	157147	Abetalipoproteinemia	Autosomal recessive
9	MUSK	601296	Fetal akinesia deformation sequence, type 1; Myasthenic syndrome, congenital, type 9, associated with acetylcholine receptor deficiency	Autosomal recessive
1	MUTYH	604933	Adenomas, multiple colorectal	Autosomal recessive
12	MVK	251170	Mevalonic aciduria	Autosomal recessive
12	MYBPC1	160794	Lethal congenital contracture syndrome, type 4	Autosomal recessive
3	MYD88	602170	Immunodeficiency, type 68	Autosomal recessive
17	MYH2	160740	Proximal myopathy and ophthalmoplegia	Autosomal recessive
9	MYMK	615345	Carey-Fineman-Ziter syndrome	Autosomal recessive
17	MYO15A	602666	Deafness, autosomal recessive, type 3	Autosomal recessive
22	MYO18B	607295	Klippel-Feil syndrome, type 4, autosomal recessive, with myopathy and facial dysmorphism	Autosomal recessive
15	MYO1E	601479	Glomerulosclerosis, focal segmental, 6	Autosomal recessive
10	MYO3A	606808	Deafness, autosomal recessive, type 30	Autosomal recessive
15	MYO5A	160777	Griscelli syndrome, type 1	Autosomal recessive
18	MYO5B	606540	Microvillus inclusion disease	Autosomal recessive
6	MYO6	600970	Deafness, autosomal recessive, type 37	Autosomal recessive
11	MYO7A	276903	Usher syndrome, type 1B; Deafness, autosomal recessive, type 2	Autosomal recessive
10	MYPN	608517	Nemaline myopathy, type 11, autosomal recessive	Autosomal recessive
2	NADK2	615787	2,4-dienoyl-CoA reductase deficiency	Autosomal recessive
22	NAGA	104170	Schindler disease, type I; Schindler disease, type III; Kanzaki disease	Autosomal recessive
17	NAGLU	609701	Mucopolysaccharidosis, type 3B (Sanfilippo B)	Autosomal recessive
17	NAGS	608300	N-acetylglutamate synthase deficiency	Autosomal recessive
13	NALCN	611549	Hypotonia, infantile, with psychomotor retardation and characteristic facies 1	Autosomal recessive
9	NANS	605202	Spondyloepimetaphyseal dysplasia, Camera-Genevieve type	Autosomal recessive
11	NARS2	612803	Combined oxidative phosphorylation deficiency 24	Autosomal recessive
1	NAXE	608862	Encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy	Autosomal recessive
2	NBAS	608025	Infantile liver failure syndrome, type 2; Short stature, optic nerve atrophy, and Pelger-Huet anomaly	Autosomal recessive
3	NBEAL2	614169	Gray platelet syndrome	Autosomal recessive
8	NBN	602667	Nijmegen breakage syndrome	Autosomal recessive
11	NCAPD3	609276	Microcephaly 22, primary, autosomal recessive	Autosomal recessive
7	NCF1	608512	Chronic granulomatous disease, type 1	Autosomal recessive
1	NCF2	608515	Chronic granulomatous disease, type 2	Autosomal recessive
22	NCF4	601488	Chronic granulomatous disease, type 3	Autosomal recessive
16	NDE1	609449	Lissencephaly, type 4 (with microcephaly)	Autosomal recessive
X	NDP	300658	Norrie disease	X-linked
8	NDRG1	605262	Charcot-Marie-Tooth disease, type 4D	Autosomal recessive
5	NDST1	600853	Mental retardation, autosomal recessive, type 46	Autosomal recessive
2	NDUFA10	603835	Mitochondrial complex I deficiency, nuclear type 22	Autosomal recessive
19	NDUFA11	612638	Mitochondrial complex I deficiency, nuclear type 14	Autosomal recessive
12	NDUFA12	614530	?Mitochondrial complex I deficiency, nuclear type 23	Autosomal recessive
5	NDUFA2	602137	Mitochondrial complex I deficiency, nuclear type 13	Autosomal recessive
12	NDUFA9	603834	Mitochondrial complex I deficiency, nuclear type 26	Autosomal recessive
15	NDUFAF1	606934	Mitochondrial complex I deficiency, nuclear type 11	Autosomal recessive
5	NDUFAF2	609653	Mitochondrial complex I deficiency, nuclear type 10	Autosomal recessive
3	NDUFAF3	612911	Mitochondrial complex I deficiency, nuclear type 18	Autosomal recessive
20	NDUFAF5	612360	Mitochondrial complex I deficiency, nuclear type 16	Autosomal recessive
8	NDUFAF6	612392	Mitochondrial complex I deficiency, nuclear type 17	Autosomal recessive
2	NDUFB3	603839	Mitochondrial complex I deficiency, nuclear type 25	Autosomal recessive
8	NDUFB9	601445	Mitochondrial complex I deficiency, nuclear type 24	Autosomal recessive
2	NDUFS1	157655	Mitochondrial complex I deficiency, nuclear type 5	Autosomal recessive
1	NDUFS2	602985	Mitochondrial complex I deficiency, nuclear type 6	Autosomal recessive
11	NDUFS3	603846	Mitochondrial complex I deficiency, nuclear type 8	Autosomal recessive
5	NDUFS4	602694	Mitochondrial complex I deficiency, nuclear type 1	Autosomal recessive
5	NDUFS6	603848	Mitochondrial complex I deficiency, nuclear type 9	Autosomal recessive
19	NDUFS7	601825	Mitochondrial complex I deficiency, nuclear type 3	Autosomal recessive
11	NDUFS8	602141	Mitochondrial complex I deficiency, nuclear type 2	Autosomal recessive
11	NDUFV1	161015	Mitochondrial complex I deficiency, nuclear type 4	Autosomal recessive
18	NDUFV2	600532	Mitochondrial complex I deficiency, nuclear type 7	Autosomal recessive
2	NEB	161650	Nemaline myopathy type 2	Autosomal recessive
11	NECTIN1	600644	Cleft lip/palate-ectodermal dysplasia syndrome; Orofacial cleft 7	Autosomal recessive
1	NECTIN4	609607	Ectodermal dysplasia-syndactyly syndrome, type 1	Autosomal recessive
8	NEFL	162280	Charcot-Marie-Tooth disease, type 1F	Autosomal recessive
4	NEK1	604588	Short-rib thoracic dysplasia, type 6, with or without polydactyly	Autosomal recessive
17	NEK8	609799	Renal-hepatic-pancreatic dysplasia, type 2	Autosomal recessive
14	NEK9	609798	Lethal congenital contracture syndrome 10	Autosomal recessive
6	NEU1	608272	Sialidosis, type 1 and type 2	Autosomal recessive
10	NEUROG3	604882	Diarrhea 4, malabsorptive, congenital	Autosomal recessive
2	NFU1	608100	Multiple mitochondrial dysfunctions syndrome 1	Autosomal recessive
1	NGF	162030	Neuropathy, hereditary sensory and autonomic, type 5	Autosomal recessive
3	NGLY1	610661	Congenital disorder of deglycosylation	Autosomal recessive
2	NHEJ1	611290	Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation	Autosomal recessive
6	NHLRC1	608072	Epilepsy, progressive myoclonic, type 2B (Lafora)	Autosomal recessive
5	NHP2	606470	Dyskeratosis congenita, autosomal recessive type 2	Autosomal recessive
14	NIN	608684	Seckel syndrome, type 7	Autosomal recessive
5	NIPAL4	609383	Ichthyosis, congenital, autosomal recessive, type 6	Autosomal recessive
8	NKX2-6	611770	Conotruncal heart malformations	Autosomal recessive
4	NKX3-2	602183	Spondylo-megaepiphyseal-metaphyseal dysplasia	Autosomal recessive
10	NKX6-2	605955	Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy	Autosomal recessive
17	NLRP1	606636	Autoinflammation with arthritis and dyskeratosis	Autosomal recessive*
19	NLRP7	609661	Hydatidiform mole, recurrent, type 1	Autosomal recessive
7	NME8	607421	Ciliary dyskinesia, primary, type 6	Autosomal recessive
1	NMNAT1	608700	Leber congenital amaurosis 9; Spondyloepiphyseal dysplasia, sensorineural hearing loss, intellectual developmental disorder, and Leber congenital amaurosis	Autosomal recessive
5	NNT	607878	Glucocorticoid deficiency 4, with or without mineralocorticoid deficiency	Autosomal recessive
15	NOP10	606471	Dyskeratosis congenita, autosomal recessive type 1	Autosomal recessive
18	NPC1	607623	Niemann-Pick disease, type C1	Autosomal recessive
14	NPC2	601015	Niemann-pick disease, type C2	Autosomal recessive
2	NPHP1	607100	Joubert syndrome type 4	Autosomal recessive
3	NPHP3	608002	Meckel syndrome type 7	Autosomal recessive
1	NPHP4	607215	Nephronophthisis type 4	Autosomal recessive
19	NPHS1	602716	Nephrotic syndrome, type 1	Autosomal recessive
1	NPHS2	604766	Nephrotic syndrome, type 2	Autosomal recessive
9	NPR2	108961	Acromesomelic dysplasia, Maroteaux type	Autosomal recessive
X	NR0B1	300473	Adrenal hypoplasia, congenital	X-linked
12	NR1H4	603826	Cholestasis, progressive familial intrahepatic, type 5	Autosomal recessive
15	NR2E3	604485	Enhanced S-cone syndrome (Goldmann-Favre); Retinitis pigmentosa, type 37	Autosomal recessive; Autosomal recessive*
14	NRL	162080	Retinal degeneration, autosomal recessive, clumped pigment type	Autosomal recessive*
2	NRXN1	600565	Pitt-Hopkins-like syndrome, type 2	Autosomal recessive
8	NSMCE2	617246	Seckel syndrome, type 10	Autosomal recessive
5	NSUN2	610916	Mental retardation, autosomal recessive, type 5	Autosomal recessive
10	NT5C2	600417	Spastic paraplegia, type 45, autosomal recessive	Autosomal recessive
7	NT5C3A	606224	Anemia, hemolytic, due to UMPH1 deficiency	Autosomal recessive
6	NT5E	129190	Calcification of joints and arteries	Autosomal recessive
16	NTHL1	602656	Familial adenomatous polyposis, type 3	Autosomal recessive
1	NTRK1	191315	Insensitivity to pain, congenital, with anhidrosis	Autosomal recessive
14	NUBPL	613621	Mitochondrial complex I deficiency, nuclear type 21	Autosomal recessive
12	NUP107	607617	Nephrotic syndrome, type 11	Autosomal recessive
19	NUP62	605815	Striatonigral degeneration, infantile	Autosomal recessive
16	NUP93	614351	Nephrotic syndrome, type 12	Autosomal recessive
10	OAT	613349	Gyrate atrophy of choroid and retina	Autosomal recessive
2	OBSL1	610991	3M syndrome 2	Autosomal recessive
15	OCA2	611409	Oculocutaneous albinism type 2	Autosomal recessive
5	OCLN	602876	Pseudo-TORCH syndrome, type 1	Autosomal recessive
X	OCRL	300535	Lowe Syndrome; Dent disease type 2	X-linked
19	ODAD1	615038	Ciliary dyskinesia, primary, type 20	Autosomal recessive
10	ODAD2	615408	Ciliary dyskinesia, primary, type 23	Autosomal recessive
19	ODAD3	615956	Ciliary dyskinesia, primary, type 30	Autosomal recessive
3	OPA1	605290	Behr syndrome	Autosomal recessive
19	OPA3	606580	3-methylglutaconic aciduria, type 3	Autosomal recessive
X	OPHN1	300127	Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance	X-linked
10	OPTN	602432	Amyotrophic lateral sclerosis, type 12	Autosomal recessive
12	ORAI1	610277	Immunodeficiency, type 9	Autosomal recessive
1	ORC1	601902	Meier-Gorlin syndrome, type 1	Autosomal recessive
2	ORC4	603056	Meier-Gorlin syndrome, type 2	Autosomal recessive
16	ORC6	607213	Meier-Gorlin syndrome, type 3	Autosomal recessive
14	OSGEP	610107	Galloway-Mowat syndrome 3	Autosomal recessive
6	OSTM1	607649	Osteopetrosis, autosomal recessive type 5	Autosomal recessive
X	OTC	300461	Ornithine transcarbamylase deficiency	X-linked
16	OTOA	607038	Deafness, autosomal recessive, type 22	Autosomal recessive
2	OTOF	603681	Deafness, autosomal recessive, type 9	Autosomal recessive
11	OTOG	604487	Deafness, autosomal recessive, type 18B	Autosomal recessive
12	OTOGL	614925	Deafness, autosomal recessive, type 84B	Autosomal recessive
8	OTUD6B	612021	Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies	Autosomal recessive
5	OTULIN	615712	Autoinflammation, panniculitis, and dermatosis syndrome	Autosomal recessive
5	OXCT1	601424	Succinyl CoA:3-oxoacid CoA transferase deficiency	Autosomal recessive
3	P2RY12	600515	Bleeding disorder, platelet-type, type 8	Autosomal recessive
1	P3H1	610339	Osteogenesis imperfecta, type 8	Autosomal recessive
3	P3H2	610341	Myopia, high, with cataract and vitreoretinal degeneration	Autosomal recessive
1	PADI6	610363	Preimplantation embryonic lethality 2	Autosomal recessive
12	PAH	612349	Phenylketonuria	Autosomal recessive
X	PAK3	300142	Mental retardation, X-linked, type 30	X-linked
16	PALB2	610355	PALB2-related conditions	Autosomal recessive
16	PAM16	614336	Spondylometaphyseal dysplasia, Megarbane-Dagher-Melike type	Autosomal recessive
20	PANK2	606157	Neurodegeneration with brain iron accumulation type 1	Autosomal recessive
10	PAPSS2	603005	Brachyolmia, type 4, with mild epiphyseal and metaphyseal changes	Autosomal recessive
1	PARK7	602533	Parkinson disease, type 7, autosomal recessive, early-onset	Autosomal recessive
16	PARN	604212	Dyskeratosis congenita, autosomal recessive 6	Autosomal recessive
15	PATL2	614661	Oocyte maturation defect 4	Autosomal recessive
1	PAX7	167410	Rhabdomyosarcoma 2, alveolar	Autosomal recessive
11	PC	608786	Pyruvate carboxylase deficiency	Autosomal recessive
2	PCARE	613425	Retinitis pigmentosa, type 54	Autosomal recessive
10	PCBD1	126090	Hyperphenylalaninemia, BH4-deficient, type D	Autosomal recessive
13	PCCA	232000	Propionic acidemia	Autosomal recessive
3	PCCB	232050	Propionic acidemia	Autosomal recessive
5	PCDH12	605622	Microcephaly, seizures, spasticity, and brain calcification	Autosomal recessive
10	PCDH15	605514	Deafness, autosomal recessive, type 23; Usher syndrome, type 1D/F digenic	Autosomal recessive
14	PCK2	614095	PEPCK deficiency, mitochondrial	Autosomal recessive
21	PCNT	605925	Microcephalic osteodysplastic primordial dwarfism, type 2	Autosomal recessive
5	PCSK1	162150	Obesity with impaired prohormone processing	Autosomal recessive
3	PCYT1A	123695	Spondylometaphyseal dysplasia with cone-rod dystrophy	Autosomal recessive
6	PDE10A	610652	Dyskinesia, limb and orofacial, infantile-onset	Autosomal recessive
5	PDE6A	180071	Retinitis pigmentosa type 43	Autosomal recessive
4	PDE6B	180072	Retinitis pigmentosa type 40	Autosomal recessive
10	PDE6C	600827	Cone dystrophy type 4	Autosomal recessive
17	PDE6G	180073	Retinitis pigmentosa type 57	Autosomal recessive
12	PDE6H	601190	Retinal cone dystrophy 3 and achromatopsia 6	Autosomal recessive*
X	PDHA1	300502	Pyruvate dehydrogenase E1-alpha deficiency	X-linked
3	PDHB	179060	Pyruvate dehydrogenase E1-beta deficiency	Autosomal recessive
11	PDHX	608769	Lacticacidemia due to PDX1 deficiency	Autosomal recessive
8	PDP1	605993	Pyruvate dehydrogenase phosphatase deficiency	Autosomal recessive
10	PDSS1	607429	Coenzyme Q10 deficiency, primary, type 2	Autosomal recessive
6	PDSS2	610564	Coenzyme Q10 deficiency, primary, type 3	Autosomal recessive
13	PDX1	600733	Pancreatic agenesis type 1	Autosomal recessive
21	PDXK	179020	Neuropathy, hereditary motor and sensory, type VIC, with optic atrophy	Autosomal recessive
10	PDZD7	612971	Deafness, autosomal recessive, type 57; Usher syndrome, type 2C, digenic	Autosomal recessive; Digenic inheritance (ADGRV1 gene)
19	PEPD	613230	Prolidase deficiency	Autosomal recessive
19	PET100	614770	Mitochondrial complex IV deficiency, nuclear type 12	Autosomal recessive
7	PEX1	602136	Heimler syndrome 1; Peroxisome biogenesis disorder 1A (Zellweger); Peroxisome biogenesis disorder 1B (NALD/IRD)	Autosomal recessive
1	PEX10	602859	Peroxisome biogenesis disorder, type 6A (Zellweger syndrome); Peroxisome biogenesis disorder, type 6B	Autosomal recessive
1	PEX11B	603867	?Peroxisome biogenesis disorder 14B	Autosomal recessive
17	PEX12	601758	Peroxisome biogenesis disorder type 3A (Zellweger)	Autosomal recessive
2	PEX13	601789	Peroxisome biogenesis disorder, type 11A (Zellweger syndrome); Peroxisome biogenesis disorder, type 11B	Autosomal recessive
1	PEX14	601791	Peroxisome biogenesis disorder, type 13A (Zellweger syndrome)	Autosomal recessive
11	PEX16	603360	Peroxisome biogenesis disorder, type 8A (Zellweger syndrome); Peroxisome biogenesis disorder, type 8B	Autosomal recessive
1	PEX19	600279	Peroxisome biogenesis disorder, type 12A (Zellweger syndrome)	Autosomal recessive
8	PEX2	170993	Peroxisome biogenesis disorder type 5A (Zellweger)	Autosomal recessive
22	PEX26	608666	Peroxisome biogenesis disorder type 7A (Zellweger)	Autosomal recessive
6	PEX3	603164	Peroxisome biogenesis disorder, type 10A (Zellweger syndrome)	Autosomal recessive
12	PEX5	600414	Peroxisome biogenesis disorder type 2A (Zellweger)	Autosomal recessive
6	PEX6	601498	Peroxisome biogenesis disorder, type 4A (Zellweger syndrome); Peroxisome biogenesis disorder, type 4B; Heimler syndrome 2	Autosomal recessive; Autosomal recessive*; Autosomal recessive
6	PEX7	601757	Rhizomelic chondrodysplasia punctata, type 1	Autosomal recessive
12	PFKM	610681	Glycogen storage disease, type 7	Autosomal recessive
7	PGAM2	612931	Glycogen storage disease X	Autosomal recessive
2	PGAP1	611655	Mental retardation, autosomal recessive 42	Autosomal recessive
11	PGAP2	615187	Hyperphosphatasia with mental retardation syndrome 3	Autosomal recessive
17	PGAP3	611801	Hyperphosphatasia with mental retardation syndrome 4	Autosomal recessive
X	PGK1	311800	Phosphoglycerate kinase 1 deficiency	X-linked
1	PGM1	171900	Congenital disorder of glycosylation, type 1t	Autosomal recessive
6	PGM3	172100	Immunodeficiency, type 23	Autosomal recessive
X	PHF8	300560	Mental retardation syndrome, X-linked, Siderius type	X-linked
1	PHGDH	606879	Neu-Laxova syndrome, type 1; Phosphoglycerate dehydrogenase deficiency	Autosomal recessive
16	PHKB	172490	Glycogen storage disease, type 9B	Autosomal recessive
16	PHKG2	172471	Glycogen storage disease type 9c	Autosomal recessive
11	PHOX2A	602753	Fibrosis of extraocular muscles, congenital, 2	Autosomal recessive
10	PHYH	602026	Refsum disease	Autosomal recessive
22	PI4KA	600286	Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis	Autosomal recessive
13	PIBF1	607532	Joubert syndrome 33	Autosomal recessive
16	PIEZO1	611184	Lymphedema, hereditary, type 3	Autosomal recessive
18	PIEZO2	613629	Arthrogryposis, distal, with impaired proprioception and touch	Autosomal recessive
1	PIGC	601730	Glycosylphosphatidylinositol biosynthesis defect 16	Autosomal recessive
4	PIGG	616918	Mental retardation, autosomal recessive 53	Autosomal recessive
17	PIGL	605947	Zunich neuroectodermal syndrome	Autosomal recessive
1	PIGM	610273	Glycosylphosphatidylinositol deficiency	Autosomal recessive
18	PIGN	606097	Multiple congenital anomalies-hypotonia-seizures syndrome, type 1	Autosomal recessive
9	PIGO	614730	Hyperphosphatasia with mental retardation syndrome 2	Autosomal recessive
20	PIGT	610272	Multiple congenital anomalies-hypotonia-seizures syndrome 3	Autosomal recessive
1	PIGV	610274	Hyperphosphatasia with mental retardation syndrome 1	Autosomal recessive
17	PIGW	610275	Glycosylphosphatidylinositol biosynthesis defect 11	Autosomal recessive
4	PIGY	610662	Hyperphosphatasia with mental retardation syndrome 6	Autosomal recessive
1	PINK1	608309	Parkinson disease, type 6, early onset	Autosomal recessive
19	PIP5K1C	606102	Lethal congenital contractural syndrome, type 3	Autosomal recessive
2	PJVK	610219	Deafness, autosomal recessive, type 59	Autosomal recessive
7	PKD1L1	609721	Heterotaxy, visceral, 8, autosomal	Autosomal recessive
6	PKHD1	606702	Polycystic kidney disease type 4	Autosomal recessive
1	PKLR	609712	Pyruvate kinase deficiency	Autosomal recessive
1	PKP1	601975	Ectodermal dysplasia/skin fragility syndrome	Autosomal recessive
22	PLA2G6	603604	Infantile neuroaxonal dystrophy type 1	Autosomal recessive
9	PLAA	603873	Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies	Autosomal recessive
20	PLCB1	607120	Epileptic encephalopathy, early infantile, type 12	Autosomal recessive
20	PLCB4	600810	Auriculocondylar syndrome, type 2	Autosomal recessive*
3	PLCD1	602142	Nail disorder, nonsyndromic congenital, type 3 (leukonychia)	Autosomal recessive
10	PLCE1	608414	Nephrotic syndrome, type 3	Autosomal recessive
3	PLD1	602382	Cardiac valvular defect, developmental	Autosomal recessive
8	PLEC	601282	Epidermolysis bullosa simplex with muscular dystrophy	Autosomal recessive
1	PLEKHG5	611101	Charcot-Marie-Tooth disease, recessive intermediate, type C	Autosomal recessive
6	PLG	173350	Plasminogen deficiency, type I	Autosomal recessive
4	PLK4	605031	Microcephaly and chorioretinopathy, autosomal recessive, 2	Autosomal recessive
1	PLOD1	153454	Ehlers-Danlos syndrome, kyphoscoliotic type, 1	Autosomal recessive
3	PLOD2	601865	Bruck syndrome 2	Autosomal recessive
7	PLOD3	603066	Lysyl hydroxylase 3 deficiency	Autosomal recessive
X	PLP1	300401	Pelizaeus-Merzbacher disease	X-linked
8	PLPBP	604436	Epilepsy, early-onset, vitamin B6-dependent	Autosomal recessive
16	PMM2	601785	Congenital disorder of glycosylation, type 1A	Autosomal recessive
17	PMP22	601097	Dejerine-Sottas disease	Autosomal recessive*
9	PMPCA	613036	Spinocerebellar ataxia, autosomal recessive, type 2	Autosomal recessive
7	PMPCB	603131	Multiple mitochondrial dysfunctions syndrome 6	Autosomal recessive
19	PNKP	605610	Microcephaly, seizures, and developmental delay; Ataxia-oculomotor apraxia 4; ?Charcot-Marie-Tooth disease, type 2B2	Autosomal recessive
14	PNP	164050	Immunodeficiency due to purine nucleoside phosphorylase deficiency	Autosomal recessive
6	PNPLA1	612121	Ichthyosis, congenital, autosomal recessive, type 10	Autosomal recessive
11	PNPLA2	609059	Neutral lipid storage disease with myopathy	Autosomal recessive
19	PNPLA6	603197	Boucher-Neuhauser syndrome; Oliver-McFarlane syndrome; Spastic paraplegia, type 39, autosomal recessive	Autosomal recessive
17	PNPO	603287	Pyridoxamine 5'-phosphate oxidase deficiency	Autosomal recessive
2	PNPT1	610316	Combined oxidative phosphorylation deficiency 13	Autosomal recessive
3	POC1A	614783	Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis	Autosomal recessive
12	POC1B	614784	Cone-rod dystrophy 20	Autosomal recessive
12	POLE	174762	FILS syndrome	Autosomal recessive
15	POLG	174763	POLG-related disorders	Autosomal recessive
6	POLH	603968	Xeroderma pigmentosum, variant type	Autosomal recessive
6	POLR1C	610060	Leukodystrophy, hypomyelinating, type 11; Treacher Collins syndrome 3	Autosomal recessive
13	POLR1D	613715	Treacher Collins syndrome, type 2	Autosomal recessive*
10	POLR3A	614258	Leukodystrophy, hypomyelinating, type 7	Autosomal recessive
12	POLR3B	614366	Leukodystrophy, hypomyelinating, type 8	Autosomal recessive
2	POMC	176830	Obesity, adrenal insufficiency, and red hair due to POMC deficiency	Autosomal recessive
1	POMGNT1	606822	Muscular dystrophy-dystroglycanopathy, type 3A (Walker-Warburg syndrome); Type 3B; Type 3C (limb-girdle muscular dystrophy, type 15 [LGMDR15])	Autosomal recessive
3	POMGNT2	614828	Muscular dystrophy-dystroglycanopathy, type 8A (Walker-Warburg syndrome); Type 8C (limb-girdle muscular dystrophy, type 24 [LGMD R24])	Autosomal recessive
8	POMK	615247	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 12	Autosomal recessive
13	POMP	613386	Keratosis linearis with ichthyosis congenita and sclerosing keratoderma	Autosomal recessive
9	POMT1	607423	Muscular dystrophy-dystroglycanopathy, type 1A (Walker-Warburg syndrome); Type 1B; Type 1C (limb-girdle muscular dystrophy, type 11 [LGMD R11])	Autosomal recessive
14	POMT2	607439	Muscular dystrophy-dystroglycanopathy, type 2A (Walker-Warburg syndrome); Type 2B; Type 2C (limb-girdle muscular dystrophy, type 14 [LGMD R14])	Autosomal recessive
8	POP1	602486	Anauxetic dysplasia, type 2	Autosomal recessive
7	POR	124015	Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis	Autosomal recessive
3	POU1F1	173110	Pituitary hormone deficiency, combined, type 1	Autosomal recessive*
X	POU3F4	300039	Deafness, X-linked, type 2	X-linked
4	PPA2	609988	Sudden cardiac failure, infantile	Autosomal recessive
15	PPIB	123841	Osteogenesis imperfecta, type 9	Autosomal recessive
4	PPM1K	611065	?Maple syrup urine disease, mild variant	Autosomal recessive
1	PPP1R15B	613257	Microcephaly, short stature, and impaired glucose metabolism 2	Autosomal recessive
1	PPT1	600722	Ceroid lipofuscinosis, neuronal, type 1	Autosomal recessive
X	PQBP1	300463	Renpenning syndrome	X-linked
17	PRCD	610598	Retinitis pigmentosa, type 36	Autosomal recessive
9	PRDM12	616458	Neuropathy, hereditary sensory and autonomic, type VIII	Autosomal recessive
4	PRDM5	614161	Brittle cornea syndrome, type 2	Autosomal recessive
1	PRDX1	176763	Methylmalonic aciduria and homocystinuria, cblC type, digenic	Autosomal recessive; Digenic inheritance (MMACHC gene)
2	PREPL	609557	Myasthenic syndrome, congenital, type 22	Autosomal recessive
10	PRF1	170280	Hemophagocytic lymphohistiocytosis, familial, type 2	Autosomal recessive
1	PRG4	604283	Camptodactyly-arthropathy-coxa vara-pericarditis syndrome	Autosomal recessive
12	PRICKLE1	608500	Epilepsy, progressive myoclonic, type 1B	Autosomal recessive
3	PRKCD	176977	Autoimmune lymphoproliferative syndrome, type 3	Autosomal recessive
6	PRKN	602544	Parkinson disease, type 2, juvenile	Autosomal recessive
2	PRKRA	603424	Dystonia, type 16	Autosomal recessive
16	PRMT7	610087	Short stature, brachydactyly, intellectual developmental disability, and seizures	Autosomal recessive
2	PROC	612283	Thrombophilia due to protein C deficiency, autosomal recessive	Autosomal recessive
22	PRODH	606810	Hyperprolinemia, type 1	Autosomal recessive
4	PROM1	604365	Retinitis pigmentosa, type 41	Autosomal recessive
5	PROP1	601538	Pituitary hormone deficiency, combined, type 2	Autosomal recessive
3	PROS1	176880	Thrombophilia due to protein S deficiency, autosomal recessive	Autosomal recessive
6	PRPH2	179605	Leber congenital amaurosis 18; Retinitis punctata albescens	Autosomal recessive*
X	PRPS1	311850	PRPS1-related disoders	X-linked
1	PRRX1	167420	Agnathia-otocephaly complex	Autosomal recessive*
4	PRSS12	606709	Mental retardation, autosomal recessive, type 1	Autosomal recessive
2	PRSS56	613858	Microphthalmia, isolated, type 6	Autosomal recessive
1	PRUNE1	617413	Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies	Autosomal recessive
19	PRX	605725	Charcot-Marie-Tooth disease, type 4F	Autosomal recessive
10	PSAP	176801	Combined SAP deficiency	Autosomal recessive
9	PSAT1	610936	Neu-Laxova syndrome, type 2	Autosomal recessive
6	PSMB8	177046	Autoinflammation, lipodystrophy, and dermatosis syndrome	Autosomal recessive
17	PSMC3IP	608665	Ovarian dysgenesis 3	Autosomal recessive
7	PSPH	172480	Phosphoserine phosphatase deficiency	Autosomal recessive
10	PTF1A	607194	Pancreatic agenesis 2	Autosomal recessive
11	PTH	168450	Hypoparathyroidism, familial isolated, type 1	Autosomal recessive*
3	PTH1R	168468	Chondrodysplasia, Blomstrand type; Eiken syndrome	Autosomal recessive
3	PTPN23	606584	Neurodevelopmental disorder and structural brain anomalies with or without seizures and spasticity	Autosomal recessive
1	PTPRC	151460	Severe combined immunodeficiency, T cell-negative, B-cell/natural killer-cell positive	Autosomal recessive
12	PTPRO	600579	Nephrotic syndrome, type 6	Autosomal recessive
12	PTPRQ	603317	Deafness, autosomal recessive, type 84A	Autosomal recessive
17	PTRH2	608625	Infantile-onset multisystem neurologic, endocrine, and pancreatic disease	Autosomal recessive
11	PTS	612719	Hyperphenylalaninemia, BH4-deficient, type A	Autosomal recessive
12	PUS1	608109	Myopathy, lactic acidosis, and sideroblastic anemia, type 1	Autosomal recessive
2	PXDN	605158	Anterior segment dysgenesis, type 7, with sclerocornea	Autosomal recessive
17	PYCR1	179035	Cutis laxa, autosomal recessive, type 2B	Autosomal recessive
1	PYCR2	616406	Leukodystrophy, hypomyelinating, type 10	Autosomal recessive
14	PYGL	613741	Glycogen storage disease, type 6	Autosomal recessive
11	PYGM	608455	McArdle disease	Autosomal recessive
12	PYROXD1	617220	Myopathy, myofibrillar, type 8	Autosomal recessive
3	QARS1	603727	Microcephaly, progressive, seizures, and cerebral and cerebellar atrophy	Autosomal recessive
4	QDPR	612676	Hyperphenylalaninemia, BH4-deficient, type C	Autosomal recessive
10	RAB18	602207	Warburg micro syndrome, type 3	Autosomal recessive
6	RAB23	606144	Carpenter syndrome	Autosomal recessive
15	RAB27A	603868	Griscelli syndrome, type 2	Autosomal recessive
4	RAB28	612994	Cone-rod dystrophy 18	Autosomal recessive
4	RAB33B	605950	Smith-McCort dysplasia 2	Autosomal recessive
2	RAB3GAP1	602536	Warburg micro syndrome, type 1	Autosomal recessive
1	RAB3GAP2	609275	Martsolf syndrome 1; Warburg micro syndrome 2	Autosomal recessive
5	RAD50	604040	Nijmegen breakage syndrome-like disorder	Autosomal recessive
17	RAD51C	602774	RAD51C-related conditions	Autosomal recessive
11	RAG1	179615	Omenn syndrome; Severe combined immunodeficiency, B cell-negative	Autosomal recessive
11	RAG2	179616	Omenn syndrome; Severe combined immunodeficiency, B cell-negative	Autosomal recessive
11	RAPSN	601592	Fetal akinesia deformation sequence, type 2; Myasthenic syndrome, congenital, type 11, associated with AChR deficiency	Autosomal recessive
3	RARB	180220	Microphthalmia, syndromic 12	Autosomal recessive
5	RARS1	107820	Leukodystrophy, hypomyelinating, type 9	Autosomal recessive
6	RARS2	611524	Pontocerebellar hypoplasia, type 6	Autosomal recessive
15	RASGRP1	603962	Immunodeficiency, type 64	Autosomal recessive
18	RAX	601881	Isolated microphthalmia, type 3	Autosomal recessive
18	RBBP8	604124	Jawad syndrome; Seckel syndrome, type 2	Autosomal recessive
20	RBCK1	610924	Polyglucosan body myopathy 1 with or without immunodeficiency	Autosomal recessive
1	RBM8A	605313	Thrombocytopenia-absent radius syndrome	Autosomal recessive
10	RBP3	180290	?Retinitis pigmentosa 66	Autosomal recessive
10	RBP4	180250	Retinal dystrophy, iris coloboma, and comedogenic acne syndrome	Autosomal recessive
13	RCBTB1	607867	Retinal dystrophy with or without extraocular anomalies	Autosomal recessive
1	RD3	180040	Leber congenital amaurosis, type 12	Autosomal recessive
14	RDH12	608830	Leber congenital amaurosis, type 13	Autosomal recessive
12	RDH5	601617	Fundus albipunctatus	Autosomal recessive*
11	RDX	179410	Deafness, autosomal recessive, type 24	Autosomal recessive
8	RECQL4	603780	Baller-Gerold syndrome; RAPADILINO syndrome; Rothmund-Thomson syndrome	Autosomal recessive
19	REEP6	609346	Retinitis pigmentosa 77	Autosomal recessive
7	RELN	600514	Lissencephaly 2 (Norman-Roberts type)	Autosomal recessive
1	REN	179820	Renal tubular dysgenesis	Autosomal recessive
5	RETREG1	613114	Neuropathy, hereditary sensory and autonomic, type 2B	Autosomal recessive
3	RFT1	611908	Congenital disorder of glycosylation, type In	Autosomal recessive
1	RFX5	601863	Bare lymphocyte syndrome, type 2	Autosomal recessive
6	RFX6	612659	Mitchell-Riley syndrome	Autosomal recessive
19	RFXANK	603200	Bare lymphocyte syndrome, type 2, complementation group B	Autosomal recessive
13	RFXAP	601861	Bare lymphocyte syndrome, type 2	Autosomal recessive
3	RHO	180380	Retinitis pigmentosa, type 4; Retinitis punctata albescens	Autosomal recessive*
20	RIN2	610222	Macs syndrome	Autosomal recessive
21	RIPK4	605706	Popliteal pterygium syndrome, Bartsocas-Papas type	Autosomal recessive
6	RIPOR2	611410	Deafness, autosomal recessive, type 104	Autosomal recessive
15	RLBP1	180090	Bothnia retinal dystrophy; Fundus albipunctatus	Autosomal recessive; Autosomal recessive*
6	RMND1	614917	Combined oxidative phosphorylation deficiency 11	Autosomal recessive
9	RMRP	157660	Anauxetic dysplasia, type 1	Autosomal recessive
2	RNASEH1	604123	Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 2	Autosomal recessive
19	RNASEH2A	606034	Aicardi-Goutieres syndrome, type 4	Autosomal recessive
13	RNASEH2B	610326	Aicardi-Goutieres syndrome, type 2	Autosomal recessive
11	RNASEH2C	610330	Aicardi-Goutieres syndrome, type 3	Autosomal recessive
6	RNASET2	612944	Leukoencephalopathy, cystic, without megalencephaly	Autosomal recessive
3	RNF168	612688	RIDDLE syndrome	Autosomal recessive
7	RNF216	609948	Gordon Holmes syndrome	Autosomal recessive
11	ROBO3	608630	Gaze palsy, familial horizontal, with progressive scoliosis, type 1	Autosomal recessive
16	ROGDI	614574	Kohlschutter-Tonz syndrome	Autosomal recessive
11	ROM1	180721	Retinitis pigmentosa, type 7, digenic	Autosomal recessive
9	ROR2	602337	Robinow syndrome, autosomal recessive	Autosomal recessive
1	RORC	602943	Immunodeficiency, type 42	Autosomal recessive
8	RP1	603937	Retinitis pigmentosa, type 1	Autosomal recessive
X	RP2	300757	Retinitis pigmentosa, type 2, X-linked	X-linked
1	RPE65	180069	RPE65-related Leber congenital amaurosis/early-onset severe retinal dystrophy	Autosomal recessive
X	RPGR	312610	Retinitis pigmentosa, type 3, X-linked; Cone-rod dystrophy, X-linked, 1	X-linked
14	RPGRIP1	605446	Leber congenital amaurosis, type 6	Autosomal recessive
16	RPGRIP1L	610937	Joubert syndrome, type 7; Meckel syndrome, type 5; COACH syndrome	Autosomal recessive
8	RRM2B	604712	Mitochondrial DNA depletion syndrome, type 8A (encephalomyopathic type with renal tubulopathy) and type 8B (MNGIE type)	Autosomal recessive
X	RS1	300839	Retinoschisis	X-linked
21	RSPH1	609314	Ciliary dyskinesia, primary, type 24	Autosomal recessive
6	RSPH3	615876	Ciliary dyskinesia, primary, type 32	Autosomal recessive
6	RSPH4A	612647	Ciliary dyskinesia, primary, type 11	Autosomal recessive
6	RSPH9	612648	Ciliary dyskinesia, primary, type 12	Autosomal recessive
20	RSPO4	610573	Anonychia congenita	Autosomal recessive
16	RSPRY1	616585	Spondyloepimetaphyseal dysplasia, Faden-Alkuraya type	Autosomal recessive
20	RTEL1	608833	Dyskeratosis congenita, autosomal recessive type 5	Autosomal recessive*
6	RTN4IP1	610502	Optic atrophy 10 with or without ataxia, mental retardation, and seizures	Autosomal recessive
18	RTTN	610436	Microcephaly, short stature, and polymicrogyria with seizures	Autosomal recessive
9	RUSC2	611053	Mental retardation, autosomal recessive 61	Autosomal recessive
12	RXYLT1	605862	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10	Autosomal recessive
19	RYR1	180901	Malignant hyperthermia susceptibility, type 1	Autosomal dominant
19	S1PR2	605111	Deafness, autosomal recessive, type 68	Autosomal recessive
13	SACS	604490	Spastic ataxia, Charlevoix-Saguenay, type	Autosomal recessive
2	SAG	181031	Oguchi disease, type 1	Autosomal recessive
7	SAMD9	610456	Tumoral calcinosis, familial, normophosphatemic	Autosomal recessive
20	SAMHD1	606754	Aicardi-Goutieres syndrome, type 5	Autosomal recessive
5	SAR1B	607690	Chylomicron retention disease	Autosomal recessive
19	SARS2	612804	Hyperuricemia, pulmonary hypertension, renal failure, and alkalosis	Autosomal recessive
7	SBDS	607444	Shwachman-Diamond syndrome	Autosomal recessive
22	SBF1	603560	Charcot-Marie-Tooth disease, type 4B3	Autosomal recessive
11	SBF2	607697	Charcot-Marie-Tooth disease, type 4B2	Autosomal recessive
11	SC5D	602286	Lathosterolosis	Autosomal recessive
4	SCARB2	602257	Epilepsy, progressive myoclonic, type 4, with or without renal failure	Autosomal recessive
22	SCARF2	613619	Van den Ende-Gupta syndrome	Autosomal recessive
19	SCN1B	600235	Epileptic encephalopathy, early infantile, type 52	Autosomal recessive
17	SCN4A	603967	Myasthenic syndrome, congenital, type 16	Autosomal recessive
2	SCN9A	603415	Indifference to pain and autosomal recessive hereditary sensory neuropathy type 2D	Autosomal recessive
12	SCNN1A	600228	Pseudohypoaldosteronism, type 1	Autosomal recessive
16	SCNN1B	600760	Pseudohypoaldosteronism, type 1	Autosomal recessive
16	SCNN1G	600761	Pseudohypoaldosteronism, type 1	Autosomal recessive
17	SCO1	603644	Mitochondrial complex IV deficiency, nuclear type 4	Autosomal recessive
22	SCO2	604272	Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, type 1	Autosomal recessive
11	SCYL1	607982	Spinocerebellar ataxia, autosomal recessive, type 21	Autosomal recessive
1	SDCCAG8	613524	Bardet-Biedl syndrome, type 16	Autosomal recessive
5	SDHA	600857	Mitochondrial respiratory chain complex II deficiency; Leigh syndrome	Autosomal recessive
19	SDHAF1	612848	Mitochondrial complex II deficiency	Autosomal recessive
12	SDR9C7	609769	Ichthyosis, congenital, autosomal recessive 13	Autosomal recessive
14	SEC23A	610511	Craniolenticulosutural dysplasia	Autosomal recessive
20	SEC23B	610512	Dyserythropoietic anemia, congenital, type 2	Autosomal recessive
4	SEC24D	607186	Cole-Carpenter syndrome 2	Autosomal recessive
9	SECISBP2	607693	Thyroid hormone metabolism, abnormal	Autosomal recessive
1	SELENON	606210	Muscular dystrophy, rigid spine, type 1	Autosomal recessive
1	SEMA4A	607292	Cone-rod dystrophy, type 10; Retinitis pigmentosa, type 35	Autosomal recessive
4	SEPSECS	613009	Pontocerebellar hypoplasia, type 2D	Autosomal recessive
6	SERAC1	614725	3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL)	Autosomal recessive
14	SERPINA1	107400	Alpha-1 antitrypsin deficiency	Autosomal recessive
18	SERPINB7	603357	Palmoplantar keratoderma, Nagashima type	Autosomal recessive
18	SERPINB8	601697	Peeling skin syndrome 5	Autosomal recessive
1	SERPINC1	107300	Thrombophilia due to antithrombin III deficiency	Autosomal recessive*
7	SERPINE1	173360	Plasminogen activator inhibitor-1 deficiency	Autosomal recessive*
17	SERPINF1	172860	Osteogenesis imperfecta, type 6	Autosomal recessive
17	SERPINF2	613168	Alpha-2-plasmin inhibitor deficiency	Autosomal recessive
11	SERPING1	606860	Angioedema, hereditary, types 1 and 2	Autosomal recessive*
11	SERPINH1	600943	Osteogenesis imperfecta, type 10	Autosomal recessive
9	SETX	608465	Spinocerebellar ataxia, autosomal recessive, type 1	Autosomal recessive
7	SFRP4	606570	Pyle disease	Autosomal recessive
2	SFTPB	178640	Surfactant metabolism dysfunction, pulmonary, type 1	Autosomal recessive
10	SFXN4	615564	Combined oxidative phosphorylation deficiency 18	Autosomal recessive
17	SGCA	600119	Limb-girdle muscular dystrophy, type 3 (LGMD R3)	Autosomal recessive
4	SGCB	600900	Limb-girdle muscular dystrophy, type 4 (LGMD R4)	Autosomal recessive
5	SGCD	601411	Limb-girdle muscular dystrophy, type 6 (LGMD R6)	Autosomal recessive
13	SGCG	608896	Limb-girdle muscular dystrophy, type 5 (LGMD R5)	Autosomal recessive
10	SGPL1	603729	Nephrotic syndrome, type 14	Autosomal recessive
17	SGSH	605270	Mucopolysaccharidosis, type 3A (Sanfilippo A)	Autosomal recessive
X	SH2D1A	300490	Lymphoproliferative syndrome, X-linked, type 1	X-linked
5	SH3PXD2B	613293	Frank-ter Haar syndrome	Autosomal recessive
5	SH3TC2	608206	Charcot-Marie-Tooth disease, type 4C	Autosomal recessive
3	SI	609845	Sucrase-isomaltase deficiency, congenital	Autosomal recessive
5	SIL1	608005	Marinesco-Sjogren syndrome	Autosomal recessive
14	SIX6	606326	Optic disc anomalies with retinal and/or macular dystrophy	Autosomal recessive
6	SKIC2	600478	Trichohepatoenteric syndrome, type 2 (diarrhea, syndromic)	Autosomal recessive
5	SKIC3	614589	Trichohepatoenteric syndrome, type 1 (diarrhea, syndromic)	Autosomal recessive
13	SLC10A2	601295	Bile acid malabsorption, primary	Autosomal recessive
12	SLC11A2	600523	Anemia, hypochromic microcytic, with iron overload 1	Autosomal recessive
15	SLC12A1	600839	Bartter syndrome, type 1	Autosomal recessive
16	SLC12A3	600968	Gitelman syndrome	Autosomal recessive
20	SLC12A5	606726	Epileptic encephalopathy, early infantile, 34	Autosomal recessive
15	SLC12A6	604878	Agenesis of the corpus callosum with peripheral neuropathy	Autosomal recessive
17	SLC13A5	608305	Epileptic encephalopathy, early infantile, 25	Autosomal recessive
1	SLC16A1	600682	Monocarboxylate transporter 1 deficiency	Autosomal recessive*
X	SLC16A2	300095	Allan-Herndon-Dudley syndrome	X-linked
6	SLC17A5	604322	Salla disease	Autosomal recessive
10	SLC18A3	600336	Myasthenic syndrome, congenital, 21, presynaptic	Autosomal recessive
1	SLC19A2	603941	Thiamine-responsive megaloblastic anemia syndrome	Autosomal recessive
2	SLC19A3	606152	Thiamine metabolism dysfunction syndrome, type 2 (biotin- or thiamine-responsive encephalopathy type)	Autosomal recessive
9	SLC1A1	133550	Dicarboxylic aminoaciduria	Autosomal recessive
2	SLC1A4	600229	Spastic tetraplegia, thin corpus callosum, and progressive microcephaly	Autosomal recessive
11	SLC22A12	607096	Hypouricemia, renal	Autosomal recessive
5	SLC22A5	603377	Carnitine deficiency, systemic primary	Autosomal recessive
15	SLC24A1	603617	Night blindness, congenital stationary (complete), type 1D, autosomal recessive	Autosomal recessive
14	SLC24A4	609840	Amelogenesis imperfecta, type IIA5	Autosomal recessive
15	SLC24A5	609802	Albinism, oculocutaneous, type 6	Autosomal recessive
22	SLC25A1	190315	Combined D-2- and L-2-hydroxyglutaric aciduria	Autosomal recessive
2	SLC25A12	603667	Epileptic encephalopathy, early infantile, type 39	Autosomal recessive
7	SLC25A13	603859	Citrullinemia, type 2, neonatal-onset; Citrullinemia, type 2, adult-onset	Autosomal recessive
13	SLC25A15	603861	Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome	Autosomal recessive
17	SLC25A19	606521	Microcephaly, Amish type; Thiamine metabolism dysfunction syndrome 4 (progressive polyneuropathy type)	Autosomal recessive
3	SLC25A20	613698	Carnitine-acylcarnitine translocase deficiency	Autosomal recessive
11	SLC25A22	609302	Epileptic encephalopathy, early infantile, type 3	Autosomal recessive
3	SLC25A26	611037	Combined oxidative phosphorylation deficiency 28	Autosomal recessive
12	SLC25A3	600370	Mitochondrial phosphate carrier deficiency	Autosomal recessive
3	SLC25A38	610819	Anemia, sideroblastic, type 2, pyridoxine-refractory	Autosomal recessive
4	SLC25A4	103220	Mitochondrial DNA depletion syndrome, type 12B (cardiomyopathic type) AR	Autosomal recessive
5	SLC25A46	610826	Neuropathy, hereditary motor and sensory, type VIB	Autosomal recessive
5	SLC26A2	606718	Achondrogenesis Ib; Atelosteogenesis, type II;De la Chapelle dysplasia; Diastrophic dysplasia;Diastrophic dysplasia, broad bone-platyspondylic variant;Epiphyseal dysplasia, multiple, 4	Autosomal recessive
7	SLC26A3	126650	Diarrhea 1, secretory chloride, congenital	Autosomal recessive
7	SLC26A4	605646	Deafness, autosomal recessive, type 4; Pendred syndrome	Autosomal recessive
7	SLC26A5	604943	?Deafness, autosomal recessive, type 61	Autosomal recessive
9	SLC27A4	604194	Ichthyosis prematurity syndrome	Autosomal recessive
10	SLC29A3	612373	Histiocytosis-lymphadenopathy plus syndrome	Autosomal recessive
1	SLC2A1	138140	GLUT1 deficiency syndrome 1, infantile onset, severe	Autosomal recessive*
20	SLC2A10	606145	Arterial tortuosity syndrome	Autosomal recessive
3	SLC2A2	138160	Fanconi-Bickel syndrome	Autosomal recessive
4	SLC2A9	606142	Hypouricemia, renal, type 2	Autosomal recessive*
1	SLC30A10	611146	Hypermanganesemia with dystonia, type 1	Autosomal recessive
3	SLC33A1	603690	Congenital cataracts, hearing loss, and neurodegeneration	Autosomal recessive
5	SLC34A1	182309	Hypercalcemia, infantile, type 2	Autosomal recessive
4	SLC34A2	604217	Pulmonary alveolar microlithiasis	Autosomal recessive
9	SLC34A3	609826	Hypophosphatemic rickets with hypercalciuria	Autosomal recessive
6	SLC35A1	605634	Congenital disorder of glycosylation, type 2F	Autosomal recessive
1	SLC35A3	605632	Arthrogryposis, impaired intellectual development, and seizures	Autosomal recessive
11	SLC35C1	605881	Congenital disorder of glycosylation, type 2C	Autosomal recessive
1	SLC35D1	610804	Schneckenbecken dysplasia	Autosomal recessive
11	SLC37A4	602671	Glycogen storage disease, type 1B	Autosomal recessive
16	SLC38A8	615585	Foveal hypoplasia 2, with or without optic nerve misrouting and/or anterior segment dysgenesis	Autosomal recessive
11	SLC39A13	608735	Ehlers-Danlos syndrome, spondylodysplastic type, 3	Autosomal recessive
8	SLC39A14	608736	Hypermanganesemia with dystonia 2	Autosomal recessive
8	SLC39A4	607059	Acrodermatitis enteropathica	Autosomal recessive
4	SLC39A8	608732	Congenital disorder of glycosylation, type IIn	Autosomal recessive
2	SLC3A1	104614	Cystinuria	Autosomal recessive*
1	SLC45A1	605763	Intellectual developmental disorder with neuropsychiatric features	Autosomal recessive
5	SLC45A2	606202	Albinism, oculocutaneous, type 4	Autosomal recessive
17	SLC46A1	611672	Folate malabsorption, hereditary	Autosomal recessive
17	SLC4A1	109270	Distal renal tubular acidosis	Autosomal recessive
20	SLC4A11	610206	Corneal endothelial dystrophy, autosomal recessive	Autosomal recessive
4	SLC4A4	603345	Renal tubular acidosis, proximal, with ocular abnormalities	Autosomal recessive
8	SLC52A2	607882	Brown-Vialetto-Van Laere syndrome, type 2	Autosomal recessive
20	SLC52A3	613350	Brown-Vialetto-Van Laere syndrome, type 1	Autosomal recessive
22	SLC5A1	182380	Glucose/galactose malabsorption	Autosomal recessive
16	SLC5A2	182381	Renal glucosuria	Autosomal recessive*
19	SLC5A5	601843	Thyroid dyshormonogenesis, type 1	Autosomal recessive
2	SLC5A7	608761	Myasthenic syndrome, congenital, type 20, presynaptic	Autosomal recessive
1	SLC6A17	610299	Mental retardation, autosomal recessive 48	Autosomal recessive
5	SLC6A19	608893	Hartnup disorder	Autosomal recessive
5	SLC6A3	126455	Parkinsonism-dystonia, infantile	Autosomal recessive
11	SLC6A5	604159	Hyperekplexia, type 3	Autosomal recessive*
X	SLC6A8	300036	Cerebral creatine deficiency syndrome, type 1	X-linked
1	SLC6A9	601019	Glycine encephalopathy with normal serum glycine	Autosomal recessive
3	SLC7A14	615720	Retinitis pigmentosa 68	Autosomal recessive
14	SLC7A7	603593	Lysinuric protein intolerance	Autosomal recessive
19	SLC7A9	604144	Cystinuria	Autosomal recessive*
5	SLC9A3	182307	Diarrhea 8, secretory sodium, congenital	Autosomal recessive
3	SLCO2A1	601460	Hypertrophic osteoarthropathy, primary, autosomal recessive, type 2	Autosomal recessive
13	SLITRK6	609681	Deafness and myopia	Autosomal recessive
8	SLURP1	606119	Meleda disease	Autosomal recessive
16	SLX4	613278	Fanconi anemia, complementation group P	Autosomal recessive
2	SMARCAL1	606622	Schimke immunoosseous dysplasia	Autosomal recessive
17	SMARCD2	601736	Specific granule deficiency 2	Autosomal recessive
19	SMG9	613176	Heart and brain malformation syndrome	Autosomal recessive
5	SMN1	600354	Spinal muscular atrophy	Autosomal recessive
14	SMOC1	608488	Microphthalmia. with limb anomalies	Autosomal recessive
6	SMOC2	607223	Dentin dysplasia, type 1, with microdontia and misshapen teeth	Autosomal recessive
11	SMPD1	607608	Niemann-Pick disease, type A; Niemann-Pick disease, type B	Autosomal recessive
22	SNAP29	604202	Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome	Autosomal recessive
7	SNX10	614780	Osteopetrosis, autosomal recessive, type 8	Autosomal recessive
6	SNX14	616105	Spinocerebellar ataxia, autosomal recessive, type 20	Autosomal recessive
6	SOBP	613667	Mental retardation, anterior maxillary protrusion, and strabismus	Autosomal recessive
21	SOD1	147450	Spastic tetraplegia and axial hypotonia, progressive; Amyotrophic lateral sclerosis, type 1	Autosomal recessive; Autosomal recessive*
9	SOHLH1	610224	Ovarian dysgenesis 5	Autosomal recessive
17	SOST	605740	Sclerosteosis, type 1; Van Buchem disease	Autosomal recessive
20	SOX18	601618	Hypotrichosis-lymphedema-telangiectasia syndrome	Autosomal recessive
2	SP110	604457	Hepatic venoocclusive disease with immunodeficiency	Autosomal recessive
12	SP7	606633	Osteogenesis imperfecta, type XII	Autosomal recessive
8	SPAG1	603395	Ciliary dyskinesia, primary, type 28	Autosomal recessive
5	SPARC	182120	Osteogenesis imperfecta, type XVII	Autosomal recessive
13	SPART	607111	Spactic paraplegia, type 20, autosomal recessive	Autosomal recessive
4	SPATA5	613940	Epilepsy, hearing loss, and mental retardation syndrome	Autosomal recessive
14	SPATA7	609868	Leber congenital amaurosis, type 3	Autosomal recessive
2	SPEG	615950	Centronuclear myopathy, type 5	Autosomal recessive
15	SPG11	610844	Amyotrophic lateral sclerosis 5, juvenile; Charcot-Marie-Tooth disease, axonal, type 2X; Spastic paraplegia 11	Autosomal recessive
15	SPG21	608181	Mast syndrome	Autosomal recessive
16	SPG7	602783	Spastic paraplegia, type 7, autosomal recessive	Autosomal recessive
5	SPINK1	167790	Tropical calcific pancreatitis	Autosomal recessive*
5	SPINK5	605010	Netherton syndrome	Autosomal recessive
19	SPINT2	605124	Diarrhea 3, secretory sodium, congenital, syndromic	Autosomal recessive
2	SPR	182125	Dystonia, dopa-responsive, due to sepiapterin reductase deficiency	Autosomal recessive*
1	SPRTN	616086	Ruijs-Aalfs syndrome	Autosomal recessive
1	SPTA1	182860	Pyropoikilocytosis; Spherocytosis, type 3	Autosomal recessive
11	SPTBN2	604985	Spinocerebellar ataxia, autosomal recessive, type 14	Autosomal recessive
19	SPTBN4	606214	Neurodevelopmental disorder with hypotonia, neuropathy, and deafness	Autosomal recessive
5	SQSTM1	601530	Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset	Autosomal recessive
2	SRD5A2	607306	46,XY disorder of sex development due to 5-alpha-reductase 2 deficiency (pseudovaginal perineoscrotal hypospadias)	Autosomal recessive
4	SRD5A3	611715	Congenital disorder of glycosylation, type 1Q; Kahrizi syndrome	Autosomal recessive
11	ST14	606797	Ichthyosis, congenital, autosomal recessive, type 11	Autosomal recessive
1	ST3GAL3	606494	Mental retardation, autosomal recessive 12	Autosomal recessive
2	ST3GAL5	604402	Salt and pepper developmental regression syndrome	Autosomal recessive
12	STAC3	615521	Native American myopathy	Autosomal recessive
7	STAG3	608489	Premature ovarian failure, type 8; Spermatogenic failure 61	Autosomal recessive
2	STAMBP	606247	Microcephaly-capillary malformation syndrome	Autosomal recessive
8	STAR	600617	Lipoid adrenal hyperplasia	Autosomal recessive
2	STAT1	600555	Immunodeficiency, type 31B, mycobacterial and viral infections	Autosomal recessive
12	STAT2	600556	Immunodeficiency, type 44	Autosomal recessive
17	STAT5B	604260	Laron syndrome with immunodeficiency	Autosomal recessive
1	STIL	181590	Microcephaly, type 7, primary, autosomal recessive	Autosomal recessive
11	STIM1	605921	Immunodeficiency, type 10	Autosomal recessive
20	STK4	604965	T-cell immunodeficiency, recurrent infections, autoimmunity, and cardiac malformations	Autosomal recessive
15	STRA6	610745	Microphthalmia, isolated, with coloboma, type 8	Autosomal recessive
17	STRADA	608626	Polyhydramnios, megalencephaly, and symptomatic epilepsy	Autosomal recessive
15	STRC	606440	Deafness, autosomal recessive, type 16	Autosomal recessive
16	STUB1	607207	Spinocerebellar ataxia, autosomal recessive, type 16	Autosomal recessive
6	STX11	605014	Hemophagocytic lymphohistiocytosis, familial, type 4	Autosomal recessive
19	STXBP2	601717	Hemophagocytic lymphohistiocytosis, familial, type 5	Autosomal recessive
13	SUCLA2	603921	Mitochondrial DNA depletion syndrome, type 5 (encephalomyopathic with or without methylmalonic aciduria)	Autosomal recessive
2	SUCLG1	611224	Mitochondrial DNA depletion syndrome, type 9 (encephalomyopathic, type with methylmalonic aciduria)	Autosomal recessive
10	SUFU	607035	Joubert syndrome, type 32	Autosomal recessive
7	SUGCT	609187	Glutaric aciduria, type 3	Autosomal recessive
19	SULT2B1	604125	Ichthyosis, congenital, autosomal recessive, type 14	Autosomal recessive
3	SUMF1	607939	Multiple sulfatase deficiency	Autosomal recessive
20	SUN5	613942	Spermatogenic failure, type 16	Autosomal recessive
12	SUOX	606887	Sulfite oxidase deficiency	Autosomal recessive
9	SURF1	185620	Mitochondrial complex IV deficiency, nuclear type 1; Charcot-Marie-Tooth disease, type 4K	Autosomal recessive
X	SYN1	313440	Epilepsy, X-linked, with variable learning disabilities and behavior disorders	X-linked
6	SYNE1	608441	Spinocerebellar ataxia, autosomal recessive, type 8	Autosomal recessive
19	SYNE4	615535	Deafness, autosomal recessive, type 76	Autosomal recessive
21	SYNJ1	604297	Epileptic encephalopathy, early infantile, 53	Autosomal recessive
1	SYT14	610949	?Spinocerebellar ataxia, autosomal recessive, type 11	Autosomal recessive
1	SZT2	615463	Epileptic encephalopathy, early infantile, 18	Autosomal recessive
12	TAC3	162330	Hypogonadotropic hypogonadism, type 10, with or without anosmia	Autosomal recessive
17	TACO1	612958	Mitochondrial complex IV deficiency, nuclear type 8	Autosomal recessive
4	TACR3	162332	Hypogonadotropic hypogonadism, type 11, with or without anosmia	Autosomal recessive
1	TACSTD2	137290	Corneal dystrophy, gelatinous drop-like	Autosomal recessive
1	TAF13	600774	Mental retardation, autosomal recessive 60	Autosomal recessive
8	TAF2	604912	Mental retardation, autosomal recessive 40	Autosomal recessive
7	TAF6	602955	Alazami-Yuan syndrome	Autosomal recessive
11	TALDO1	602063	Transaldolase deficiency	Autosomal recessive
22	TANGO2	616830	Metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration	Autosomal recessive
6	TAP1	170260	Bare lymphocyte syndrome, type 1	Autosomal recessive
6	TAP2	170261	Bare lymphocyte syndrome, type 1, due to TAP2 deficiency	Autosomal recessive
6	TAPBP	601962	Bare lymphocyte syndrome, type 1	Autosomal recessive
4	TAPT1	612758	Osteochondrodysplasia, complex lethal, Symoens-Barnes-Gistelinck type	Autosomal recessive
16	TAT	613018	Tyrosinemia, type 2	Autosomal recessive
20	TBC1D20	611663	Warburg micro syndrome 4	Autosomal recessive
3	TBC1D23	617687	Pontocerebellar hypoplasia, type 11	Autosomal recessive
16	TBC1D24	613577	DOORS (deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures) syndrome; Epileptic encephalopathy, early infantile, type 16; Deafness, autosomal recessive, type 86	Autosomal recessive
6	TBC1D7	612655	Macrocephaly/megalencephaly syndrome, autosomal recessive	Autosomal recessive
17	TBCD	604649	Encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum	Autosomal recessive
1	TBCE	604934	Encephalopathy, progressive, with amyotrophy and optic atrophy; Hypoparathyroidism-retardation-dysmorphism syndrome; Kenny-Caffey syndrome, type 1	Autosomal recessive
4	TBCK	616899	Hypotonia, infantile, with psychomotor retardation and characteristic facies 3	Autosomal recessive
1	TBX15	604127	Cousin syndrome	Autosomal recessive
1	TBX19	604614	Congenital isolated adrenocorticotropic hormone deficiency	Autosomal recessive
7	TBXAS1	274180	Ghosal syndrome	Autosomal recessive
17	TCAP	604488	Limb-girdle muscular dystrophy, type 7 (LGMD R7)	Autosomal recessive
11	TCIRG1	604592	Osteopetrosis, autosomal recessive, type 1	Autosomal recessive
22	TCN2	613441	Transcobalamin II deficiency	Autosomal recessive
12	TCTN1	609863	Joubert syndrome, type 13	Autosomal recessive
12	TCTN2	613846	Joubert syndrome, type 24; ?Meckel syndrome, type 8	Autosomal recessive
10	TCTN3	613847	Joubert syndrome 18; Orofaciodigital syndrome IV	Autosomal recessive
14	TDP1	607198	?Spinocerebellar ataxia, autosomal recessive with axonal neuropathy	Autosomal recessive
6	TDP2	605764	Spinocerebellar ataxia, autosomal recessive, type 23	Autosomal recessive
9	TDRD7	611258	Cataract 36	Autosomal recessive
14	TECPR2	615000	Spastic paraplegia, type 49, autosomal recessive	Autosomal recessive
19	TECR	610057	Mental retardation, autosomal recessive, type 14	Autosomal recessive
4	TECRL	617242	Ventricular tachycardia, catecholaminergic polymorphic, 3	Autosomal recessive
11	TECTA	602574	Deafness, autosomal recessive, type 21	Autosomal recessive
16	TELO2	611140	You-Hoover-Fong syndrome	Autosomal recessive
4	TENM3	610083	Microphthalmia, isolated, with coloboma 9	Autosomal recessive
5	TERT	187270	Dyskeratosis congenita, autosomal recessive, type 4	Autosomal recessive
8	TEX15	605795	Spermatogenic failure, type 25	Autosomal recessive
3	TF	190000	Atransferrinemia	Autosomal recessive
7	TFR2	604720	Hemochromatosis, type 3	Autosomal recessive
3	TFRC	190010	Immunodeficiency, type 46	Autosomal recessive
8	TG	188450	Thyroid dyshormonogenesis, type 3	Autosomal recessive
13	TGDS	616146	Catel-Manzke syndrome	Autosomal recessive
14	TGM1	190195	Ichthyosis, congenital, autosomal recessive, type 1	Autosomal recessive
15	TGM5	603805	Peeling skin syndrome, type 2	Autosomal recessive
11	TH	191290	Segawa syndrome, recessive	Autosomal recessive
X	THOC2	300395	Mental retardation, X-linked 12	X-linked
16	THOC6	615403	Beaulieu-Boycott-Innes syndrome	Autosomal recessive
3	THRB	190160	Thyroid hormone resistance, autosomal recessive	Autosomal recessive
19	TIMM50	607381	3-methylglutaconic aciduria, type 9	Autosomal recessive
3	TIMMDC1	615534	Mitochondrial complex I deficiency, nuclear type 31	Autosomal recessive
9	TJP2	607709	Cholestasis, progressive familial intrahepatic 4; Hypercholanemia, familial 1	Autosomal recessive
16	TK2	188250	Mitochondrial DNA depletion syndrome , type 2 (myopathic type)	Autosomal recessive
3	TKT	606781	Short stature, developmental delay, and congenital heart defects	Autosomal recessive
19	TLE6	612399	Preimplantation embryonic lethality	Autosomal recessive
9	TMC1	606706	Deafness, autosomal recessive, type 7	Autosomal recessive
17	TMC6	605828	Epidermodysplasia verruciformis	Autosomal recessive
17	TMC8	605829	Epidermodysplasia verruciformis	Autosomal recessive
1	TMCO1	614123	Craniofacial dysmorphism, skeletal anomalies, and mental retardation syndrome	Autosomal recessive
17	TMEM107	616183	Meckel syndrome, type 13; Orofaciodigital syndrome, type 16	Autosomal recessive
11	TMEM126A	612988	Optic atrophy 7	Autosomal recessive
11	TMEM126B	615533	Mitochondrial complex I deficiency, nuclear type 29	Autosomal recessive
11	TMEM138	614459	Joubert syndrome 16	Autosomal recessive
4	TMEM165	614726	Congenital disorder of glycosylation, type 2K	Autosomal recessive
17	TMEM199	616815	Congenital disorder of glycosylation, type 2P	Autosomal recessive
11	TMEM216	613277	Joubert syndrome, type 2; Meckel syndrome, type 2	Autosomal recessive
16	TMEM231	614949	Joubert syndrome, type 20; Meckel syndrome,type 11	Autosomal recessive
2	TMEM237	614423	Joubert syndrome, type 14	Autosomal recessive
14	TMEM260	617449	Structural heart defects and renal anomalies syndrome	Autosomal recessive
8	TMEM67	609884	Meckel syndrome 3; COACH syndrome 1; Joubert syndrome 6; Nephronophthisis 11	Autosomal recessive
8	TMEM70	612418	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 2	Autosomal recessive
3	TMIE	607237	Deafness, autosomal recessive, type 6	Autosomal recessive
21	TMPRSS15	606635	Enterokinase deficiency	Autosomal recessive
21	TMPRSS3	605511	Deafness, autosomal recessive, type 8/10	Autosomal recessive
22	TMPRSS6	609862	Iron-refractory iron deficiency anemia	Autosomal recessive
12	TMTC3	617218	Lissencephaly 8	Autosomal recessive
18	TNFRSF11A	603499	Osteopetrosis, autosomal recessive, type 7	Autosomal recessive
8	TNFRSF11B	602643	Paget disease of bone, type 5, juvenile-onset	Autosomal recessive
17	TNFRSF13B	604907	Immunodeficiency, common variable, type 2	Autosomal recessive
13	TNFSF11	602642	Osteopetrosis, autosomal recessive, type 2	Autosomal recessive
3	TNIK	610005	Mental retardation, autosomal recessive 54	Autosomal recessive
19	TNNT1	191041	Nemaline myopathy , type 5, Amish type	Autosomal recessive
6	TNXB	600985	Ehlers-Danlos syndrome, classic-like	Autosomal recessive
1	TOE1	613931	Pontocerebellar hypoplasia, type 7	Autosomal recessive
17	TOP3A	601243	Microcephaly, growth restriction, and increased sister chromatid exchange 2	Autosomal recessive
20	TP53RK	608679	Galloway-Mowat syndrome 4	Autosomal recessive
12	TPI1	190450	Hemolytic anemia due to triosephosphate isomerase deficiency	Autosomal recessive
7	TPK1	606370	Episodic encephalopathy due to thiamine pyrophosphokinase deficiency	Autosomal recessive
1	TPM3	191030	Nemaline myopathy, type 1; Congenital fiber-type disproportion myopathy	Autosomal recessive*
2	TPO	606765	Thyroid dyshormonogenesis, type 2A	Autosomal recessive
11	TPP1	607998	Ceroid lipofuscinosis, neuronal, type 2; Spinocerebellar ataxia, autosomal recessive, type 7	Autosomal recessive
9	TPRN	613354	Deafness, autosomal recessive, type 79	Autosomal recessive
2	TRAF3IP1	607380	Senior-Loken syndrome, type 9	Autosomal recessive
3	TRAIP	605958	Seckel syndrome, type 9	Autosomal recessive
4	TRAPPC11	614138	Limb-girdle muscular dystrophy, type 18 (LGMD R18)	Autosomal recessive
2	TRAPPC12	614139	Encephalopathy, progressive, early-onset, with brain atrophy and spasticity	Autosomal recessive
14	TRAPPC6B	610397	Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy	Autosomal recessive
8	TRAPPC9	611966	Mental retardation, autosomal recessive, type 13	Autosomal recessive
6	TRDN	603283	Ventricular tachycardia, catecholaminergic polymorphic, type 5, with or without muscle weakness	Autosomal recessive
6	TREM2	605086	Nasu-Hakola disease	Autosomal recessive
3	TREX1	606609	Aicardi-Goutieres syndrome, type 1	Autosomal recessive
8	TRHR	188545	Hypothyroidism, congenital, nongoitrous, type 7	Autosomal recessive
4	TRIM2	614141	Charcot-Marie-Tooth disease, type 2R	Autosomal recessive
9	TRIM32	602290	Limb-girdle muscular dystrophy, type 8 (LGMD R8)	Autosomal recessive
17	TRIM37	605073	Mulibrey nanism	Autosomal recessive
22	TRIOBP	609761	Deafness, autosomal recessive, type 28	Autosomal recessive
14	TRIP11	604505	Achondrogenesis, type 1A	Autosomal recessive
5	TRIP13	604507	Mosaic variegated aneuploidy syndrome 3	Autosomal recessive
15	TRIP4	604501	Spinal muscular atrophy with congenital bone fractures 1	Autosomal recessive
1	TRIT1	617840	Combined oxidative phosphorylation deficiency 35	Autosomal recessive
4	TRMT10A	616013	Microcephaly, short stature, and impaired glucose metabolism 1	Autosomal recessive
3	TRMT10C	615423	Combined oxidative phosphorylation deficiency 30	Autosomal recessive
14	TRMT5	611023	Combined oxidative phosphorylation deficiency 26	Autosomal recessive
22	TRMU	610230	Liver failure, transient infantile	Autosomal recessive
3	TRNT1	612907	Retinitis pigmentosa and erythrocytic microcytosis	Autosomal recessive
15	TRPM1	603576	Night blindness, congenital stationary (complete), type 1C, autosomal recessive	Autosomal recessive
9	TRPM6	607009	Familial hypomagnesemia with secondary hypocalcemia	Autosomal recessive
7	TRPV6	606680	Hyperparathyroidism, transient neonatal	Autosomal recessive
1	TSEN15	608756	Pontocerebellar hypoplasia, type 2F	Autosomal recessive
3	TSEN2	608753	Pontocerebellar hypoplasia, type 2B	Autosomal recessive
19	TSEN34	608754	Pontocerebellar hypoplasia type 2C	Autosomal recessive
17	TSEN54	608755	Pontocerebellar hypoplasia, type 2A; Pontocerebellar hypoplasia, type 4	Autosomal recessive
12	TSFM	604723	Combined oxidative phosphorylation deficiency, type 3	Autosomal recessive
1	TSHB	188540	Hypothyroidism, congenital, nongoitrous, type 4	Autosomal recessive
14	TSHR	603372	Hypothyroidism, congenital, nongoitrous, type 1	Autosomal recessive
17	TTC19	613814	Mitochondrial complex III deficiency, nuclear type 2	Autosomal recessive
2	TTC21B	612014	Short-rib thoracic dysplasia, type 4, with or without polydactyly	Autosomal recessive
2	TTC7A	609332	Gastrointestinal defects and immunodeficiency syndrome	Autosomal recessive
14	TTC8	608132	Bardet-Biedl syndrome, type 8	Autosomal recessive
8	TTI2	614426	Mental retardation, autosomal recessive, type 39	Autosomal recessive
14	TTLL5	612268	Cone-rod dystrophy 19	Autosomal recessive
2	TTN	188840	Limb-girdle muscular dystrophy type 10 (LGMDR10); Early-onset myopathy with fatal cardiomyopathy (Salih myopathy)	Autosomal recessive
8	TTPA	600415	Ataxia with isolated vitamin E deficiency	Autosomal recessive
22	TUBA8	605742	Cortical dysplasia, complex, with other brain malformations, type 8	Autosomal recessive
15	TUBGCP4	609610	Microcephaly and chorioretinopathy, autosomal recessive, type 3	Autosomal recessive
22	TUBGCP6	610053	Microcephaly and chorioretinopathy, autosomal recessive, type 1	Autosomal recessive
16	TUFM	602389	Combined oxidative phosphorylation deficiency 4	Autosomal recessive
6	TULP1	602280	Retinitis pigmentosa 14; Leber congenital amaurosis 15	Autosomal recessive
8	TUSC3	601385	Mental retardation, autosomal recessive, type 7	Autosomal recessive
2	TWIST2	607556	Focal facial dermal dysplasia, type 3 (Setleis type)	Autosomal recessive
10	TWNK	606075	Mitochondrial DNA depletion syndrome, type 7 (hepatocerebral type); Perrault syndrome type 5	Autosomal recessive
18	TXNL4A	611595	Burn-McKeown syndrome	Autosomal recessive
19	TYK2	176941	Immunodeficiency, type 35	Autosomal recessive
22	TYMP	131222	Mitochondrial DNA depletion syndrome, type 1 (MNGIE type)	Autosomal recessive
11	TYR	606933	Oculocutaneous albinism (OCA) type 1A; OCA type 1B	Autosomal recessive
19	TYROBP	604142	Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy, type 1 (Nasu-Hakola disease)	Autosomal recessive
9	TYRP1	115501	Albinism, oculocutaneous, type 3	Autosomal recessive
3	UBA5	610552	Epileptic encephalopathy, early infantile, 44	Autosomal recessive
1	UBE2T	610538	Fanconi anemia, complementation group T	Autosomal recessive
15	UBE3A	601623	Angelman syndrome	Autosomal dominant*
12	UBE3B	608047	Kaufman oculocerebrofacial syndrome	Autosomal recessive
15	UBR1	605981	Johanson-Blizzard syndrome	Autosomal recessive
4	UCHL1	191342	Spastic paraplegia, type 79, autosomal recessive	Autosomal recessive
13	UFM1	610553	Leukodystrophy, hypomyelinating, type 14	Autosomal recessive
2	UGT1A1	191740	Crigler-Najjar syndrome, type 1; Crigler-Najjar syndrome, type 2	Autosomal recessive
3	UMPS	613891	Orotic aciduria	Autosomal recessive
17	UNC13D	608897	Hemophagocytic lymphohistiocytosis, familial, type 3	Autosomal recessive
2	UNC80	612636	Hypotonia, infantile, with psychomotor retardation and characteristic facies, type 2	Autosomal recessive
12	UNG	191525	Immunodeficiency with hyper IgM, type 5	Autosomal recessive
22	UPB1	606673	Beta-ureidopropionase deficiency	Autosomal recessive
X	UPF3B	300298	Mental retardation, X-linked, syndromic, type 14	X-linked
8	UQCRB	191330	Mitochondrial complex III deficiency, nuclear, type 3	Autosomal recessive
16	UQCRC2	191329	Mitochondrial complex III deficiency, nuclear type 5	Autosomal recessive
5	UQCRQ	612080	Mitochondrial complex III deficiency, nuclear, type 4	Autosomal recessive
1	UROD	613521	Porphyria cutanea tarda	Autosomal recessive
10	UROS	606938	Porphyria, congenital erythropoietic	Autosomal recessive
16	USB1	613276	Poikiloderma with neutropenia	Autosomal recessive
11	USH1C	605242	Usher syndrome, type 1C; Deafness, autosomal recessive, type 18A	Autosomal recessive
17	USH1G	607696	Usher syndrome, type 1G	Autosomal recessive
1	USH2A	608400	Usher syndrome, type 2A; Retinitis pigmentosa 39	Autosomal recessive
22	USP18	607057	Pseudo-TORCH syndrome 2	Autosomal recessive
4	UVSSA	614632	UV-sensitive syndrome, type 3	Autosomal recessive
16	VAC14	604632	Striatonigral degeneration, childhood-onset	Autosomal recessive
6	VARS1	192150	Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy	Autosomal recessive
6	VARS2	612802	Combined oxidative phosphorylation deficiency 20	Autosomal recessive
12	VDR	601769	Rickets, vitamin D-resistant, type 2A	Autosomal recessive
14	VIPAS39	613401	Arthrogryposis, renal dysfunction and cholestasis, type 2	Autosomal recessive
16	VKORC1	608547	Vitamin K-dependent clotting factors, combined deficiency of, type 2	Autosomal recessive
9	VLDLR	192977	Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion, type 1	Autosomal recessive
9	VPS13A	605978	Choreoacanthocytosis	Autosomal recessive
8	VPS13B	607817	Cohen syndrome	Autosomal recessive
15	VPS13C	608879	Parkinson disease 23, autosomal recessive, early onset	Autosomal recessive
15	VPS33B	608552	Arthrogryposis, renal dysfunction and cholestasis, type 1	Autosomal recessive
8	VPS37A	609927	Spastic paraplegia, type 53, autosomal recessive	Autosomal recessive
1	VPS45	610035	Neutropenia, severe congenital, type 5	Autosomal recessive
17	VPS53	615850	Pontocerebellar hypoplasia, type 2E	Autosomal recessive
14	VRK1	602168	Pontocerebellar hypoplasia, type 1A	Autosomal recessive
14	VSX2	142993	Microphthalmia with coloboma 3; Isolated microphthalmia 2	Autosomal recessive
12	VWF	613160	von Willibrand disease, type 3	Autosomal recessive
1	WARS2	604733	Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures	Autosomal recessive
X	WAS	300392	Wiskott-Aldrich syndrome; Thrombocytopenia, X-linked	X-linked
12	WASHC4	615748	?Mental retardation, autosomal recessive, type 43	Autosomal recessive
8	WASHC5	610657	Ritscher-Schinzel syndrome, type 1	Autosomal recessive
4	WDR19	608151	Nephronophthisis, type 13; Senior-Loken syndrome, type 8	Autosomal recessive
2	WDR35	613602	Cranioectodermal dysplasia 2	Autosomal recessive
17	WDR45B	609226	Neurodevelopmental disorder with spastic quadriplegia and brain abnormalities with or without seizures	Autosomal recessive
19	WDR62	613583	Microcephaly, type 2, primary, autosomal recessive, with or without cortical malformations	Autosomal recessive
15	WDR72	613214	Amelogenesis imperfecta, type 2A3 (hypomaturation type)	Autosomal recessive
15	WDR73	616144	Galloway-Mowat syndrome 1	Autosomal recessive
17	WDR81	614218	Cerebellar ataxia, mental retardation, and dysequilibrium syndrome, type 2	Autosomal recessive
7	WEE2	614084	Oocyte maturation defect 5	Autosomal recessive
4	WFS1	606201	Wolfram syndrome, type 1	Autosomal recessive
9	WHRN	607928	Usher syndrome, type 2D; Deafness, autosomal recessive, type 31	Autosomal recessive
2	WIPF1	602357	?Wiskott-Aldrich syndrome 2	Autosomal recessive
12	WNK1	605232	Neuropathy, hereditary sensory and autonomic, type 2	Autosomal recessive
12	WNT1	164820	Osteogenesis imperfecta, type XV	Autosomal recessive
2	WNT10A	606268	WNT10A-related conditions	Autosomal recessive
12	WNT10B	601906	Split-hand/foot malformation, type 6	Autosomal recessive
17	WNT3	165330	?Tetra-amelia syndrome	Autosomal recessive
3	WNT7A	601570	Fuhrmann syndrome	Autosomal recessive
17	WRAP53	612661	Dyskeratosis congenita, autosomal recessive, type 3	Autosomal recessive
8	WRN	604611	Werner syndrome	Autosomal recessive
16	WWOX	605131	Epileptic encephalopathy, early infantile, type 28; Spinocerebellar ataxia, autosomal recessive, type 12	Autosomal recessive
2	XDH	607633	Xanthinuria, type 1	Autosomal recessive
9	XPA	611153	Xeroderma pigmentosum, group A	Autosomal recessive
3	XPC	613208	Xeroderma pigmentosum, group C	Autosomal recessive
22	XPNPEP3	613553	Nephronophthisis-like nephropathy, type 1	Autosomal recessive
5	XRCC4	194363	Short stature, microcephaly, and endocrine dysfunction	Autosomal recessive
16	XYLT1	608124	Desbuquois dysplasia, type 2	Autosomal recessive
17	XYLT2	608125	Spondyloocular syndrome	Autosomal recessive
12	YARS2	610957	Myopathy, lactic acidosis, and sideroblastic anemia, type 2	Autosomal recessive
1	YY1AP1	607860	Grange syndrome	Autosomal recessive
2	ZAP70	176947	Autoimmune disease, multisystem, infantile-onset, type 2; Immunodeficiency, type 48	Autosomal recessive
11	ZBTB16	176797	Skeletal defects, genital hypoplasia, and mental retardation	Autosomal recessive
6	ZBTB24	614064	Immunodeficiency-centromeric instability-facial anomalies syndrome, type 2	Autosomal recessive
14	ZC3H14	613279	Mental retardation, autosomal recessive, type 56	Autosomal recessive
X	ZDHHC9	300646	Mental retardation, X-linked syndromic, Raymond type	X-linked
14	ZFYVE26	612012	Spastic paraplegia, type 15, autosomal recessive	Autosomal recessive
1	ZMPSTE24	606480	Mandibuloacral dysplasia with, type B lipodystrophy	Autosomal recessive
3	ZMYND10	607070	Ciliary dyskinesia, primary, type 22	Autosomal recessive
11	ZNF408	616454	Retinitis pigmentosa, type 72	Autosomal recessive
16	ZNF423	604557	Joubert syndrome, type 19	Autosomal recessive
16	ZNF469	612078	Brittle cornea syndrome, type 1	Autosomal recessive
X	ZNF711	314990	Mental retardation, X-linked, type 97	X-linked
17	ZNHIT3	604500	PEHO syndrome	Autosomal recessive
11	ZP1	195000	Oocyte maturation defect, type 1	Autosomal recessive

Download CGT Exome v1.0

Export Download CGT Exome v1.1

Export Download CGT Exome v1.2

Export Download CGT Exome v2.0

Export Download CGT Exome v3.1.2

Export Download CGT Exome v3.2.3

Export Download CGT EXOME v3.3.4

Export

CGT Plus V5.4.8
Historic Versions

Chromosome	Gene symbol	OMIM (gene)	Disease name (phenotype)	Inheritance
12	AAAS	605378	Triple-A syndrome (achalasia-addisonianism-alacrimia)	Autosomal recessive
2	ABCA12	607800	Ichthyosis, congenital, autosomal recessive, type 4A; ICAR, type 4B (harlequin)	Autosomal recessive
16	ABCA3	601615	Surfactant metabolism dysfunction, pulmonary, type 3	Autosomal recessive
1	ABCA4	601691	Stargardt disease 1; Retinitis pigmentosa 19; Cone-rod dystrophy 3	Autosomal recessive
2	ABCB11	603201	Cholestasis, benign recurrent intrahepatic, type 2; Cholestasis, progressive familial intrahepatic, type 2	Autosomal recessive
11	ABCC8	600509	Hyperinsulinemic hypoglycemia, type 1 (congenital hyperinsulinism); Permanent neonatal diabetes mellitus (PNDM)	Autosomal recessive*
X	ABCD1	300371	Adrenoleukodystrophy	X-linked
14	ABCD4	603214	Methylmalonic aciduria and homocystinuria, cblJ type	Autosomal recessive
11	ACAD8	604773	Isobutyryl-CoA dehydrogenase deficiency	Autosomal recessive
3	ACAD9	611103	Acyl-CoA dehydrogenase 9 deficiency (mitochondrial complex I deficiency, nuclear, type 20)	Autosomal recessive
1	ACADM	607008	Medium-chain acyl-CoA dehydrogenase deficiency	Autosomal recessive
12	ACADS	606885	Short-chain acyl-CoA dehydrogenase deficiency	Autosomal recessive
10	ACADSB	600301	Short/branched-chain acyl-CoA dehydrogenase deficiency	Autosomal recessive
17	ACADVL	609575	Very long-chain acyl-CoA dehydrogenase (VLCAD) deficiency	Autosomal recessive
11	ACAT1	607809	Alpha-methylacetoacetic aciduria (3-ketothiolase deficiency)	Autosomal recessive
17	ACOX1	609751	Peroxisomal acyl-CoA oxidase deficiency	Autosomal recessive
16	ACSF3	614245	Combined malonic and methylmalonic aciduria	Autosomal recessive
20	ADA	608958	Severe combined immunodeficiency due to adenosine deaminase deficiency (ADA)	Autosomal recessive
5	ADAMTS2	604539	Ehlers-Danlos syndrome, dermatosparaxis type	Autosomal recessive
16	ADGRG1	604110	Polymicrogyria, bilateral frontoparietal	Autosomal recessive
5	ADGRV1	602851	Usher syndrome, type 2C	Autosomal recessive; Digenic inheritance (PDZD7 gene)
10	ADK	102750	Hypermethioninemia due to adenosine kinase deficiency	Autosomal recessive
4	AGA	613228	Aspartylglucosaminuria (glycosylasparaginase deficiency)	Autosomal recessive
1	AGL	610860	Glycogen storage disease, type 3	Autosomal recessive
2	AGPS	603051	Rhizomelic chondrodysplasia punctata, type 3	Autosomal recessive
2	AGXT	604285	Hyperoxaluria, primary, type 1	Autosomal recessive
20	AHCY	180960	Hypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase	Autosomal recessive
6	AHI1	608894	Joubert syndrome, type 3	Autosomal recessive
17	AIPL1	604392	Leber congenital amaurosis, type 4	Autosomal recessive
21	AIRE	607358	Autoimmune polyendocrinopathy syndrome, type 1	Autosomal recessive*
17	ALDH3A2	609523	Sjogren-Larsson syndrome	Autosomal recessive
1	ALDH4A1	606811	Hyperprolinemia, type 2	Autosomal recessive
9	ALDOB	612724	Fructose intolerance, hereditary	Autosomal recessive
16	ALG1	605907	Congenital disorder of glycosylation, type 1K	Autosomal recessive
1	ALG6	604566	Congenital disorder of glycosylation, type 1C	Autosomal recessive
2	ALMS1	606844	Alström syndrome	Autosomal recessive
1	ALPL	171760	ALPL-related conditions	Autosomal recessive
3	AMT	238310	Glycine encephalopathy	Autosomal recessive
3	ANO10	613726	Spinocerebellar ataxia, autosomal recessive, type 10	Autosomal recessive
X	AP1S2	300629	Mental retardation, X-linked, syndromic, type 5 (Pettigrew syndrome)	X-linked
12	AQP2	107777	Diabetes insipidus, nephrogenic, type 2	Autosomal recessive*
X	AR	313700	Androgen insensitivity syndrome	X-linked
6	ARG1	608313	Argininemia (arginase deficiency)	Autosomal recessive
3	ARL13B	608922	Joubert syndrome type 8	Autosomal recessive
22	ARSA	607574	Metachromatic leukodystrophy	Autosomal recessive
5	ARSB	611542	Mucopolysaccharidosis, type 6 (Maroteaux-Lamy syndrome)	Autosomal recessive
X	ARSL	300180	Chondrodysplasia punctata, brachytelephalangic	X-linked
X	ARX	300382	Epileptic encephalopathy, early infantile, type 1; ARX-related developmental disorders	X-linked
7	ASL	608310	Argininosuccinic aciduria	Autosomal recessive
7	ASNS	108370	Asparagine synthetase deficiency	Autosomal recessive
17	ASPA	608034	Canavan disease	Autosomal recessive
9	ASS1	603470	Citrullinemia, type 1	Autosomal recessive
11	ATM	607585	ATM-related conditions	Autosomal recessive
2	ATP6V1B1	192132	Renal tubular acidosis with deafness	Autosomal recessive
X	ATP7A	300011	Menkes disease; Occipital horn syndrome	X-linked
13	ATP7B	606882	Wilson disease	Autosomal recessive
18	ATP8B1	602397	Cholestasis, progressive familial intrahepatic, type 1; Cholestasis, benign recurrent intrahepatic, type 1	Autosomal recessive
X	ATRX	300032	Mental retardation-hypotonic facies syndrome, X-linked; Alpha-thalassemia/mental retardation syndrome	X-linked
9	AUH	600529	3-methylglutaconic aciduria, type 1	Autosomal recessive
9	B4GALT1	137060	Congenital disorder of glycosylation, type 2D	Autosomal recessive
11	BBS1	209901	Bardet-Biedl syndrome, type 1	Autosomal recessive
12	BBS10	610148	Bardet-Biedl syndrome, type 10	Autosomal recessive
4	BBS12	610683	Bardet-Biedl syndrome, type 12	Autosomal recessive
16	BBS2	606151	Bardet-Biedl syndrome, type 2	Autosomal recessive
3	BCHE	177400	Butyrylcholinesterase deficiency	Autosomal recessive
19	BCKDHA	608348	Maple syrup urine disease, type 1A	Autosomal recessive
6	BCKDHB	248611	Maple syrup urine disease, type 1B	Autosomal recessive
2	BCS1L	603647	Mitochondrial complex III deficiency nuclear type 1; GRACILE syndrome; Bjornstad syndrome	Autosomal recessive
15	BLM	604610	Bloom syndrome	Autosomal recessive
X	BRWD3	300553	Mental retardation, X-linked, type 93	X-linked
1	BSND	606412	Bartter syndrome, type 4A	Autosomal recessive
3	BTD	609019	Biotinidase deficiency	Autosomal recessive
X	BTK	300300	Agammaglobulinemia X-linked, type 1	X-linked
8	CA2	611492	Osteopetrosis with renal tubular acidosis (osteopetrosis, autosomal recessive, type 3)	Autosomal recessive
15	CAPN3	114240	Limb-girdle muscular dystrophy, type 1 (LGMD R1)	Autosomal recessive
1	CASQ2	114251	Ventricular tachycardia, catecholaminergic polymorphic, type 2	Autosomal recessive
21	CBS	613381	Homocystinuria due to cystathionine beta-synthase	Autosomal recessive
4	CC2D2A	612013	Joubert syndrome, type 9; Meckel syndrome, type 6; COACH syndrome, 2	Autosomal recessive
14	CCDC88C	611204	Hydrocephalus, congenital, type 1	Autosomal recessive
6	CCN6	603400	Progressive pseudorheumatoid dysplasia	Autosomal recessive
X	CD40LG	300386	Hyper-IgM syndrome, type 1 (immunodeficiency, X-linked, with hyper-IgM, type 1)	X-linked
10	CDH23	605516	Deafness, autosomal recessive, type 12; Usher syndrome, type 1D	Autosomal recessive
12	CEP290	610142	Meckel syndrome, type 4; Joubert syndrome, type 5; Leber congenital amaurosis, type 10	Autosomal recessive
2	CERKL	608381	Retinitis pigmentosa, type 26	Autosomal recessive
7	CFTR	602421	Cystic fibrosis	Autosomal recessive
10	CHAT	118490	Myasthenic syndrome, congenital, type 6, presynaptic	Autosomal recessive
X	CHM	300390	Choroideremia	X-linked
17	CHRNE	100725	Myasthenic syndrome, congenital, type 4B, fast-channel; Myasthenic syndrome, congenital, type 4C, associated with acetylcholine receptor deficiency	Autosomal recessive
2	CHRNG	100730	Multiple pterygium syndrome (MPS), Escobar type; MPS, lethal type	Autosomal recessive
16	CHST6	605294	Macular corneal dystrophy	Autosomal recessive
16	CIITA	600005	Bare lymphocyte syndrome, type 2, complementation group A	Autosomal recessive
7	CLCN1	118425	Myotonia congenita, recessive	Autosomal recessive
16	CLN3	607042	Ceroid lipofuscinosis, neuronal, type 3	Autosomal recessive
13	CLN5	608102	Ceroid lipofuscinosis, neuronal, type 5	Autosomal recessive
15	CLN6	606725	Ceroid lipofuscinosis, neuronal, type 6	Autosomal recessive
8	CLN8	607837	Ceroid lipofuscinosis, neuronal, type 8	Autosomal recessive
3	CLRN1	606397	Usher syndrome, type 3A	Autosomal recessive
4	CNGA1	123825	Retinitis pigmentosa type 49	Autosomal recessive
16	CNGB1	600724	Retinitis pigmentosa type 45	Autosomal recessive
8	CNGB3	605080	Achromatopsia, type 3	Autosomal recessive
9	COL27A1	608461	Steel syndrome	Autosomal recessive
2	COL4A3	120070	Alport syndrome, autosomal recessive, type 2	Autosomal recessive; Autosomal dominant
2	COL4A4	120131	Alport syndrome, autosomal recessive, type 2	Autosomal recessive; Autosomal dominant
X	COL4A5	303630	Alport syndrome, X-linked	X-linked
3	COL7A1	120120	Dystrophic epidermolysis bullosa (DEB), Hallopeau-Siemens (HS) type and non-HS type; DEB pruriginosa; DEB pretibial	Autosomal recessive; Autosomal recessive; Autosomal recessive
3	COLQ	603033	Myasthenic syndrome, congenital, type 5	Autosomal recessive
10	COX15	603646	Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, type 2; Leigh syndrome due to cytochrome c oxidase deficiency	Autosomal recessive
2	CPS1	608307	Carbamoylphosphate synthetase 1 deficiency	Autosomal recessive
11	CPT1A	600528	Carnitine palmitoyltransferase type 1A deficiency, hepatic	Autosomal recessive
1	CPT2	600650	Carnitine palmitoyltransferase type 2 deficiency, lethal neonatal; Carnitine palmitoyltransferase type 2 deficiency, infantile	Autosomal recessive
1	CRB1	604210	Retinitis pigmentosa, type 12; Leber congenital amaurosis, type 8	Autosomal recessive
3	CRTAP	605497	Osteogenesis imperfecta, type 7	Autosomal recessive
1	CTH	607657	Cystathioninuria	Autosomal recessive
17	CTNS	606272	Nephropathic cystinosis	Autosomal recessive
20	CTSA	613111	Galactosialidosis	Autosomal recessive
11	CTSC	602365	Haim-Munk syndrome; Papillon-Lefevre syndrome	Autosomal recessive
11	CTSD	116840	Ceroid lipofuscinosis, neuronal, type 10	Autosomal recessive
1	CTSK	601105	Pycnodysostosis	Autosomal recessive
X	CUL4B	300304	Mental retardation, X-linked, syndromic, type 15 (Cabezas type)	X-linked
16	CYBA	608508	Chronic granulomatous disease, type 4	Autosomal recessive
X	CYBB	300481	Chronic granulomatous disease, X-linked	X-linked
15	CYP11A1	118485	46,XY disorder of sex development-adrenal insufficiency due to CYP11A1 deficiency	Autosomal recessive
8	CYP11B1	610613	Adrenal hyperplasia, congenital, due to 11-beta-hydroxylase deficiency	Autosomal recessive
8	CYP11B2	124080	Hypoaldosteronism, congenital, due to CMO I deficiency	Autosomal recessive
10	CYP17A1	609300	17 alpha(?)-hydroxylase/17,20-lyase deficiency	Autosomal recessive
15	CYP19A1	107910	Aromatase deficiency	Autosomal recessive
2	CYP1B1	601771	Glaucoma, primary congenital, type 3A	Autosomal recessive
6	CYP21A2	613815	Congenital adrenal hyperplasia due to 21-hydroxylase deficiency	Autosomal recessive
2	CYP27A1	606530	Cerebrotendinous xanthomatosis	Autosomal recessive
12	CYP27B1	609506	Vitamin D-dependent rickets, type 1	Autosomal recessive
1	DBT	248610	Maple syrup urine disease, type 2	Autosomal recessive
10	DCLRE1C	605988	Omenn syndrome; Severe combined immunodeficiency, Athabascan type	Autosomal recessive
X	DCX	300121	Lissencephaly, X-linked, type 1	X-linked
11	DDB2	600811	Xeroderma pigmentosum, complementation group E	Autosomal recessive
11	DHCR7	602858	Smith-Lemli-Opitz syndrome	Autosomal recessive
1	DHDDS	608172	Retinitis pigmentosa, type 59	Autosomal recessive
X	DKC1	300126	Dyskeratosis congenita, X-linked	X-linked
7	DLD	238331	Dihydrolipoamide dehydrogenase deficiency	Autosomal recessive
X	DLG3	300189	Mental retardation, X-linked, type 90	X-linked
X	DMD	300377	DMD-related conditions	X-linked
5	DNAH5	603335	Ciliary dyskinesia, primary, type 3, with or without situs inversus	Autosomal recessive
9	DNAI1	604366	Ciliary dyskinesia, primary, type 1, with or without situs inversus	Autosomal recessive
17	DNAI2	605483	Ciliary dyskinesia, primary, type 9, with or without situs inversus	Autosomal recessive
10	DNAJC12	606060	Hyperphenylalaninemia, mild, non-BH4-deficient	Autosomal recessive
4	DOK7	610285	Fetal akinesia deformation sequence, type 3; Myasthenic syndrome, congenital, type 10	Autosomal recessive
9	DOLK	610746	Congenital disorder of glycosylation, type 1M	Autosomal recessive
11	DPAGT1	191350	Congenital disorder of glycosylation, type 1J; Myasthenic syndrome, congenital, type 13	Autosomal recessive
20	DPM1	603503	Congenital disorder of glycosylation, type 1E	Autosomal recessive
1	DPYD	612779	Dihydropyrimidine dehydrogenase deficiency	Autosomal recessive
15	DUOX2	606759	Thyroid dyshormonogenesis, type 6	Autosomal recessive
15	DUOXA2	612772	Thyroid dyshormonogenesis, type 5	Autosomal recessive
11	DYNC2H1	603297	Short-rib thoracic dysplasia, type 3, with or without polydactyly	Autosomal recessive
2	DYSF	603009	Miyoshi muscular dystrophy, type 1; Limb-girdle muscular dystrophy, type 2 (LGMD R2)	Autosomal recessive
X	EDA	300451	Ectodermal dysplasia, type 1, hypohidrotic, X-linked	X-linked
2	EDAR	604095	Ectodermal dysplasia 10B, hypohidrotic/hair/tooth type	Autosomal recessive
2	EIF2AK3	604032	Wolcott-Rallison syndrome	Autosomal recessive
3	EIF2B5	603945	Leukoencephalopathy with vanishing white matter (VWM)	Autosomal recessive
9	ELP1	603722	Familial dysautonomia	Autosomal recessive
X	EMD	300384	Emery-Dreifuss muscular dystrophy, type 1, X-linked	X-linked
19	ERCC2	126340	Trichothiodystrophy, type 1; Xeroderma pigmentosum, group D	Autosomal recessive
2	ERCC3	133510	Trichothiodystrophy, type 2	Autosomal recessive
13	ERCC5	133530	Cerebrooculofacioskeletal syndrome 3; Xeroderma pigmentosum, group G;Xeroderma pigmentosum, group G/Cockayne syndrome	Autosomal recessive
10	ERCC6	609413	Cockayne syndrome, type B; Cerebrooculofacioskeletal syndrome, type 1	Autosomal recessive
5	ERCC8	609412	Cockayne syndrome, type A	Autosomal recessive
8	ESCO2	609353	Roberts syndrome	Autosomal recessive
15	ETFA	608053	Glutaric acidemia, type 2A	Autosomal recessive
19	ETFB	130410	Glutaric acidemia, type 2B	Autosomal recessive
4	ETFDH	231675	Glutaric acidemia, type 2C	Autosomal recessive
19	ETHE1	608451	Ethylmalonic encephalopathy	Autosomal recessive
4	EVC	604831	Ellis-van Creveld syndrome	Autosomal recessive
4	EVC2	607261	Ellis-van Creveld syndrome	Autosomal recessive
9	EXOSC3	606489	Pontocerebellar hypoplasia, type 1B	Autosomal recessive
6	EYS	612424	Retinitis pigmentosa, type 25	Autosomal recessive
4	F11	264900	Factor XI deficiency	Autosomal recessive*
11	F2	176930	Prothrombin deficiency	Autosomal recessive
1	F5	612309	Factor V deficiency	Autosomal recessive
X	F8	300841	Hemophilia A	X-linked
X	F9	300746	Hemophilia B	X-linked
15	FAH	613871	Tyrosinemia, type 1	Autosomal recessive
2	FAM161A	613596	Retinitis pigmentosa, type 28	Autosomal recessive
7	FAM20C	611061	Raine syndrome	Autosomal recessive
16	FANCA	607139	Fanconi anemia, complementation group A	Autosomal recessive
9	FANCC	613899	Fanconi anemia, complementation group C	Autosomal recessive
9	FANCG	602956	Fanconi anemia, complementation group G	Autosomal recessive
X	FGD1	300546	Aarskog-Scott syndrome; Mental retardation, X-linked syndromic, type 16	X-linked
1	FH	136850	Fumarase deficiency	Autosomal recessive
19	FKRP	606596	Muscular dystrophy-dystroglycanopathy, type 5A (Walker-Warburg syndrome); Type 5B; Type 5C (limb-girdle muscular dystrophy, type 9 [LGMDR9])	Autosomal recessive
9	FKTN	607440	Muscular dystrophy-dystroglycanopathy, type 4A (Walker-Warburg syndrome); Type 4B; Type 4C (limb-girdle muscular dystrophy, type 13 [LGMD R13])	Autosomal recessive
1	FMO3	136132	Trimethylaminuria	Autosomal recessive
X	FMR1	309550	FMR1-related conditions	X-linked
11	FOXRED1	613622	Mitochondrial complex I deficiency, nuclear type 19	Autosomal recessive
4	FRAS1	607830	Fraser syndrome, type 1	Autosomal recessive
21	FTCD	606806	Glutamate formiminotransferase deficiency	Autosomal recessive
X	FTSJ1	300499	Mental retardation, X-linked 44	X-linked
1	FUCA1	612280	Fucosidosis	Autosomal recessive
9	FXN	606829	Friedreich ataxia	Autosomal recessive
17	G6PC1	613742	Glycogen storage disease, type 1A	Autosomal recessive
17	G6PC3	611045	Dursun syndrome	Autosomal recessive
X	G6PD	305900	G6PD deficiency	X-linked
17	GAA	606800	Glycogen storage disease, type 2	Autosomal recessive
14	GALC	606890	Krabbe disease	Autosomal recessive
1	GALE	606953	Galactose epimerase deficiency	Autosomal recessive
17	GALK1	604313	Galactokinase deficiency with cataracts	Autosomal recessive
16	GALNS	612222	Mucopolysaccharidosis, type 4A	Autosomal recessive
9	GALT	606999	Galactosemia	Autosomal recessive
19	GAMT	601240	Cerebral creatine deficiency syndrome, type 2	Autosomal recessive
1	GBA1	606463	Gaucher disease	Autosomal recessive
3	GBE1	607839	Glycogen storage disease, type 4	Autosomal recessive
19	GCDH	608801	Glutaricaciduria, type 1	Autosomal recessive
14	GCH1	600225	Hyperphenylalaninemia, BH4-deficient, type B	Autosomal recessive
16	GCSH	238330	Multiple mitochondrial dysfunctions syndrome 7	Autosomal recessive
8	GDAP1	606598	Charcot-Marie-Tooth disease, recessive intermediate, type A	Autosomal recessive
20	GDF5	601146	Chondrodysplasia, Grebe type	Autosomal recessive
3	GFM1	606639	Combined oxidative phosphorylation deficiency, type 1	Autosomal recessive
7	GHRHR	139191	Growth hormone deficiency, isolated, type 1B	Autosomal recessive
X	GJB1	304040	Charcot-Marie-Tooth neuropathy, X-linked dominant, type 1	X-linked
13	GJB2	121011	Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6	Autosomal recessive; Digenic inheritance (GJB6 gene)
13	GJB6	604418	Deafness, autosomal recessive, type 1B; Deafness, digenic GJB2/GJB6	Autosomal recessive; Digenic inheritance (GJB2 gene)
X	GLA	300644	Fabry disease	X-linked
3	GLB1	611458	GM1-gangliosidosis, types 1-3; Mucopolysaccharidosis, type 4B (Morquio)	Autosomal recessive
9	GLDC	238300	Glycine encephalopathy	Autosomal recessive
9	GLE1	603371	Lethal congenital contracture syndrome, type 1; Congenital arthrogryposis with anterior horn cell disease	Autosomal recessive
9	GNE	603824	Inclusion body myopathy, type 2 (Nonaka myopathy)	Autosomal recessive
6	GNMT	606628	Glycine N-methyltransferase deficiency	Autosomal recessive
12	GNPTAB	607840	Mucolipidosis 2 alpha/beta; Mucolipidosis 3 alpha/beta	Autosomal recessive
16	GNPTG	607838	Mucolipidosis III gamma	Autosomal recessive
4	GNRHR	138850	Hypogonadotropic hypogonadism, type 7, without anosmia	Autosomal recessive
12	GNS	607664	Mucopolysaccharidosis, type 3D (Sanfilippo syndrome D)	Autosomal recessive
17	GP1BA	606672	Bernard-Soulier syndrome, type A1	Autosomal recessive
22	GP1BB	138720	Bernard-Soulier syndrome, type B	Autosomal recessive
3	GP9	173515	Bernard-Soulier syndrome, type C	Autosomal recessive
X	GPR143	300808	Ocular albinism, type 1 (Nettleship-Falls type)	X-linked
9	GRHPR	604296	Hyperoxaluria, primary, type 2	Autosomal recessive
12	GRIP1	604597	Fraser syndrome 3	Autosomal recessive
20	GSS	601002	Glutathione synthetase deficiency	Autosomal recessive
17	GUCY2D	600179	Leber congenital amaurosis, type 1	Autosomal recessive
7	GUSB	611499	Mucopolysaccharidosis, type 7	Autosomal recessive
4	HADH	601609	3-hydroxyacyl-CoA dehydrogenase deficiency	Autosomal recessive
2	HADHA	600890	Long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD) deficiency; Mitochondrial trifunctional protein deficiency	Autosomal recessive
2	HADHB	143450	Mitochondrial trifunctional protein deficiency	Autosomal recessive
1	HAX1	605998	Neutropenia, severe congenital, type 3, autosomal recessive	Autosomal recessive
16	HBA1	141800	Alpha thalassemia	Autosomal recessive
16	HBA2	141850	Alpha thalassemia	Autosomal recessive
11	HBB	141900	HBB-related hemoglobinopathies	Autosomal recessive
X	HCFC1	300019	Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type )	X-linked
15	HEXA	606869	Tay-Sachs disease	Autosomal recessive
5	HEXB	606873	Sandhoff disease, infantile, juvenile, and adult forms	Autosomal recessive
6	HFE	613609	Hemochromatosis, type 1	Autosomal recessive
3	HGD	607474	Alkaptonuria	Autosomal recessive
8	HGSNAT	610453	Mucopolysaccharidosis type 3C (Sanfilippo syndrome C)	Autosomal recessive
1	HJV	608374	Hemochromatosis, type 2A	Autosomal recessive
21	HLCS	609018	Holocarboxylase synthetase deficiency	Autosomal recessive
1	HMGCL	613898	HMG-CoA lyase deficiency	Autosomal recessive
22	HMOX1	141250	Heme oxygenase-1 deficiency	Autosomal recessive
10	HOGA1	613597	Hyperoxaluria, primary, type 3	Autosomal recessive
12	HPD	609695	Tyrosinemia, type 3	Autosomal recessive
X	HPRT1	308000	Lesch-Nyhan syndrome	X-linked
10	HPS1	604982	Hermansky-Pudlak syndrome, type 1	Autosomal recessive
3	HPS3	606118	Hermansky-Pudlak syndrome, type 3	Autosomal recessive
X	HSD17B10	300256	HSD10 mitochondrial disease	X-linked
9	HSD17B3	605573	46,XY disorder of sex development due to 17-beta-hydroxysteroid dehydrogenase 3 deficiency	Autosomal recessive
5	HSD17B4	601860	D-bifunctional protein deficiency	Autosomal recessive
1	HSD3B2	613890	Adrenal hyperplasia, congenital, due to 3-beta-hydroxysteroid dehydrogenase 2 deficiency	Autosomal recessive
1	HSPG2	142461	Schwartz-Jampel syndrome, type 1; Dyssegmental dysplasia, Silverman-Handmaker type	Autosomal recessive
3	HYAL1	607071	?Mucopolysaccharidosis, type 9	Autosomal recessive
11	HYLS1	610693	Hydrolethalus syndrome	Autosomal recessive
20	IDH3B	604526	Retinitis pigmentosa, type 46	Autosomal recessive
X	IDS	300823	Mucopolysaccharidosis, type 2	X-linked
4	IDUA	252800	Mucopolysaccharidosis type 1	Autosomal recessive
11	IGHMBP2	600502	Charcot-Marie-Tooth disease, axonal, type 2S	Autosomal recessive
X	IL1RAPL1	300206	Mental retardation, X-linked, type 21/34	X-linked
X	IL2RG	308380	Severe combined immunodeficiency, X-linked	X-linked
15	IVD	607036	Isovaleric acidemia	Autosomal recessive
6	IYD	612025	Thyroid dyshormonogenesis, type 4	Autosomal recessive
19	JAK3	600173	Severe Combined Immunodeficiency, autosomal recessive, T-negative/B-positive type	Autosomal recessive
11	KCNJ11	600937	Hyperinsulinemic hypoglycemia, type 2 (congenital hyperinsulinism); Permanent neonatal diabetes mellitus (PNDM)	Autosomal recessive; Autosomal recessive*
X	KDM5C	314690	Mental retardation, X-linked, syndromic, Claes-Jensen type	X-linked
X	L1CAM	308840	L1 Syndrome	X-linked
6	LAMA2	156225	LAMA2-related muscular dystrophy	Autosomal recessive
18	LAMA3	600805	Junctional epidermolysis bullosa (JEB) Herlitz type; JEB non-Herlitz type	Autosomal recessive
1	LAMB3	150310	Junctional epidermolysis bullosa (JEB) Herlitz type; JEB non-Herlitz type	Autosomal recessive
1	LAMC2	150292	Junctional epidermolysis bullosa (JEB) Herlitz type; JEB non-Herlitz type	Autosomal recessive
22	LARGE1	603590	Muscular dystrophy-dystroglycanopathy, type 6A and 6B	Autosomal recessive
6	LCA5	611408	Leber congenital amaurosis, type 5	Autosomal recessive
19	LDLR	606945	Hypercholesterolemia, familial, type 1	Autosomal recessive; Autosomal dominant
1	LDLRAP1	605747	Hypercholesterolemia, familial, autosomal recessive	Autosomal recessive
2	LHCGR	152790	Leydig cell hypoplasia	Autosomal recessive
9	LHX3	600577	Pituitary hormone deficiency, combined, type 3	Autosomal recessive
5	LIFR	151443	Stuve-Wiedemann syndrome / Schwartz-Jampel type 2 syndrome	Autosomal recessive
10	LIPA	613497	Lysosomal acid lipase deficiency	Autosomal recessive
3	LIPH	607365	Hypotrichosis, type 7 or woolly hair, autosomal recessive, type 2, with or without hypotrichosis	Autosomal recessive
6	LMBRD1	612625	Methylmalonic aciduria and homocystinuria, cblF type	Autosomal recessive
18	LOXHD1	613072	Deafness, autosomal recessive, type 77	Autosomal recessive
8	LPL	609708	Lipoprotein lipase deficiency	Autosomal recessive
2	LRP2	600073	Donnai-Barrow syndrome	Autosomal recessive
2	LRPPRC	607544	Leigh syndrome, French-Canadian type	Autosomal recessive
1	LYST	606897	Chediak-Higashi syndrome	Autosomal recessive
19	MAN2B1	609458	Alpha-mannosidosis	Autosomal recessive
4	MANBA	609489	Mannosidosis, beta	Autosomal recessive
10	MAT1A	610550	Methionine adenosyltransferase deficiency, autosomal recessive	Autosomal recessive
3	MCCC1	609010	3-Methylcrotonyl-CoA carboxylase deficiency, type 1	Autosomal recessive
5	MCCC2	609014	3-Methylcrotonyl-CoA carboxylase deficiency, type 2	Autosomal recessive
2	MCEE	608419	Methylmalonyl-CoA epimerase deficiency	Autosomal recessive
19	MCOLN1	605248	Mucolipidosis type 4	Autosomal recessive
8	MCPH1	607117	Microcephaly type 1, primary, autosomal recessive	Autosomal recessive
X	MECP2	300005	Encephalopathy, neonatal severe; Rett syndrome	X-linked
11	MED17	603810	Microcephaly, postnatal progressive, with seizures and brain atrophy	Autosomal recessive
16	MEFV	608107	Familial Mediterranean fever	Autosomal recessive
15	MESP2	605195	Spondylocostal dysostosis, type 2, autosomal recessive	Autosomal recessive
4	MFSD8	611124	Ceroid lipofuscinosis, neuronal, type 7	Autosomal recessive
X	MID1	300552	Opitz GBBB syndrome, type 1	X-linked
17	MKS1	609883	Bardet-Biedl syndrome type 13; Meckel syndrome, type 1; Joubert syndrome, type 28	Autosomal recessive
22	MLC1	605908	Megalencephalic leukoencephalopathy with subcortical cysts	Autosomal recessive
16	MLYCD	606761	Malonyl-CoA decarboxylase deficiency	Autosomal recessive
4	MMAA	607481	Methylmalonic aciduria, vitamin B12-responsive	Autosomal recessive
12	MMAB	607568	Methylmalonic aciduria, vitamin B12-responsive, type cblB	Autosomal recessive
1	MMACHC	609831	Methylmalonic aciduria and homocystinuria, cblC type	Autosomal recessive; digenic inheritance (PRDX1 gene)
2	MMADHC	611935	Homocystinuria, cblD type, variant 1	Autosomal recessive
6	MMUT	609058	Methylmalonic aciduria, mut(0) type	Autosomal recessive
2	MOGS	601336	Congenital disorder of glycosylation, type 2B	Autosomal recessive
15	MPI	154550	Congenital disorder of glycosylation, type 1B	Autosomal recessive
1	MPL	159530	Thrombocytopenia, congenital amegakaryocytic	Autosomal recessive
2	MPV17	137960	Mitochondrial DNA depletion syndrome type 6 (hepatocerebral); Charcot-Marie-Tooth disease, axonal, type 2EE	Autosomal recessive
1	MTHFR	607093	Homocystinuria due to MTHFR deficiency	Autosomal recessive
X	MTM1	300415	Myotubular myopathy, X-linked	X-linked
11	MTMR2	603557	Charcot-Marie-Tooth disease, type 4B1	Autosomal recessive
1	MTR	156570	Homocystinuria-megaloblastic anemia, cblG complementation type	Autosomal recessive
5	MTRR	602568	Homocystinuria-megaloblastic anemia, cbl E type	Autosomal recessive
4	MTTP	157147	Abetalipoproteinemia	Autosomal recessive
12	MVK	251170	Mevalonic aciduria	Autosomal recessive
17	MYO15A	602666	Deafness, autosomal recessive, type 3	Autosomal recessive
11	MYO7A	276903	Usher syndrome, type 1B; Deafness, autosomal recessive, type 2	Autosomal recessive
2	NADK2	615787	2,4-dienoyl-CoA reductase deficiency	Autosomal recessive
22	NAGA	104170	Schindler disease, type I; Schindler disease, type III; Kanzaki disease	Autosomal recessive
17	NAGLU	609701	Mucopolysaccharidosis, type 3B (Sanfilippo B)	Autosomal recessive
17	NAGS	608300	N-acetylglutamate synthase deficiency	Autosomal recessive
8	NBN	602667	Nijmegen breakage syndrome	Autosomal recessive
7	NCF1	608512	Chronic granulomatous disease, type 1	Autosomal recessive
1	NCF2	608515	Chronic granulomatous disease, type 2	Autosomal recessive
X	NDP	300658	Norrie disease	X-linked
8	NDRG1	605262	Charcot-Marie-Tooth disease, type 4D	Autosomal recessive
5	NDUFAF2	609653	Mitochondrial complex I deficiency, nuclear type 10	Autosomal recessive
20	NDUFAF5	612360	Mitochondrial complex I deficiency, nuclear type 16	Autosomal recessive
5	NDUFS4	602694	Mitochondrial complex I deficiency, nuclear type 1	Autosomal recessive
5	NDUFS6	603848	Mitochondrial complex I deficiency, nuclear type 9	Autosomal recessive
19	NDUFS7	601825	Mitochondrial complex I deficiency, nuclear type 3	Autosomal recessive
11	NDUFV1	161015	Mitochondrial complex I deficiency, nuclear type 4	Autosomal recessive
2	NEB	161650	Nemaline myopathy type 2	Autosomal recessive
6	NEU1	608272	Sialidosis, type 1 and type 2	Autosomal recessive
5	NHP2	606470	Dyskeratosis congenita, autosomal recessive type 2	Autosomal recessive
19	NLRP7	609661	Hydatidiform mole, recurrent, type 1	Autosomal recessive
15	NOP10	606471	Dyskeratosis congenita, autosomal recessive type 1	Autosomal recessive
18	NPC1	607623	Niemann-Pick disease, type C1	Autosomal recessive
14	NPC2	601015	Niemann-pick disease, type C2	Autosomal recessive
2	NPHP1	607100	Joubert syndrome type 4	Autosomal recessive
19	NPHS1	602716	Nephrotic syndrome, type 1	Autosomal recessive
1	NPHS2	604766	Nephrotic syndrome, type 2	Autosomal recessive
X	NR0B1	300473	Adrenal hypoplasia, congenital	X-linked
15	NR2E3	604485	Enhanced S-cone syndrome (Goldmann-Favre); Retinitis pigmentosa, type 37	Autosomal recessive; Autosomal recessive*
1	NTRK1	191315	Insensitivity to pain, congenital, with anhidrosis	Autosomal recessive
10	OAT	613349	Gyrate atrophy of choroid and retina	Autosomal recessive
15	OCA2	611409	Oculocutaneous albinism type 2	Autosomal recessive
X	OCRL	300535	Lowe Syndrome; Dent disease type 2	X-linked
19	OPA3	606580	3-methylglutaconic aciduria, type 3	Autosomal recessive
X	OPHN1	300127	Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance	X-linked
6	OSTM1	607649	Osteopetrosis, autosomal recessive type 5	Autosomal recessive
X	OTC	300461	Ornithine transcarbamylase deficiency	X-linked
2	OTOF	603681	Deafness, autosomal recessive, type 9	Autosomal recessive
1	P3H1	610339	Osteogenesis imperfecta, type 8	Autosomal recessive
12	PAH	612349	Phenylketonuria	Autosomal recessive
X	PAK3	300142	Mental retardation, X-linked, type 30	X-linked
20	PANK2	606157	Neurodegeneration with brain iron accumulation type 1	Autosomal recessive
11	PC	608786	Pyruvate carboxylase deficiency	Autosomal recessive
10	PCBD1	126090	Hyperphenylalaninemia, BH4-deficient, type D	Autosomal recessive
13	PCCA	232000	Propionic acidemia	Autosomal recessive
3	PCCB	232050	Propionic acidemia	Autosomal recessive
10	PCDH15	605514	Deafness, autosomal recessive, type 23; Usher syndrome, type 1D/F digenic	Autosomal recessive
5	PDE6A	180071	Retinitis pigmentosa type 43	Autosomal recessive
X	PDHA1	300502	Pyruvate dehydrogenase E1-alpha deficiency	X-linked
3	PDHB	179060	Pyruvate dehydrogenase E1-beta deficiency	Autosomal recessive
7	PEX1	602136	Heimler syndrome 1; Peroxisome biogenesis disorder 1A (Zellweger); Peroxisome biogenesis disorder 1B (NALD/IRD)	Autosomal recessive
1	PEX10	602859	Peroxisome biogenesis disorder, type 6A (Zellweger syndrome); Peroxisome biogenesis disorder, type 6B	Autosomal recessive
17	PEX12	601758	Peroxisome biogenesis disorder type 3A (Zellweger)	Autosomal recessive
8	PEX2	170993	Peroxisome biogenesis disorder type 5A (Zellweger)	Autosomal recessive
22	PEX26	608666	Peroxisome biogenesis disorder type 7A (Zellweger)	Autosomal recessive
12	PEX5	600414	Peroxisome biogenesis disorder type 2A (Zellweger)	Autosomal recessive
6	PEX6	601498	Peroxisome biogenesis disorder, type 4A (Zellweger syndrome); Peroxisome biogenesis disorder, type 4B; Heimler syndrome 2	Autosomal recessive; Autosomal recessive*; Autosomal recessive
6	PEX7	601757	Rhizomelic chondrodysplasia punctata, type 1	Autosomal recessive
12	PFKM	610681	Glycogen storage disease, type 7	Autosomal recessive
X	PGK1	311800	Phosphoglycerate kinase 1 deficiency	X-linked
X	PHF8	300560	Mental retardation syndrome, X-linked, Siderius type	X-linked
1	PHGDH	606879	Neu-Laxova syndrome, type 1; Phosphoglycerate dehydrogenase deficiency	Autosomal recessive
6	PKHD1	606702	Polycystic kidney disease type 4	Autosomal recessive
22	PLA2G6	603604	Infantile neuroaxonal dystrophy type 1	Autosomal recessive
1	PLOD1	153454	Ehlers-Danlos syndrome, kyphoscoliotic type, 1	Autosomal recessive
X	PLP1	300401	Pelizaeus-Merzbacher disease	X-linked
16	PMM2	601785	Congenital disorder of glycosylation, type 1A	Autosomal recessive
17	PNPO	603287	Pyridoxamine 5'-phosphate oxidase deficiency	Autosomal recessive
15	POLG	174763	POLG-related disorders	Autosomal recessive
6	POLR1C	610060	Leukodystrophy, hypomyelinating, type 11; Treacher Collins syndrome 3	Autosomal recessive
1	POMGNT1	606822	Muscular dystrophy-dystroglycanopathy, type 3A (Walker-Warburg syndrome); Type 3B; Type 3C (limb-girdle muscular dystrophy, type 15 [LGMDR15])	Autosomal recessive
9	POMT1	607423	Muscular dystrophy-dystroglycanopathy, type 1A (Walker-Warburg syndrome); Type 1B; Type 1C (limb-girdle muscular dystrophy, type 11 [LGMD R11])	Autosomal recessive
14	POMT2	607439	Muscular dystrophy-dystroglycanopathy, type 2A (Walker-Warburg syndrome); Type 2B; Type 2C (limb-girdle muscular dystrophy, type 14 [LGMD R14])	Autosomal recessive
7	POR	124015	Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis	Autosomal recessive
3	POU1F1	173110	Pituitary hormone deficiency, combined, type 1	Autosomal recessive*
X	POU3F4	300039	Deafness, X-linked, type 2	X-linked
4	PPM1K	611065	?Maple syrup urine disease, mild variant	Autosomal recessive
1	PPT1	600722	Ceroid lipofuscinosis, neuronal, type 1	Autosomal recessive
X	PQBP1	300463	Renpenning syndrome	X-linked
1	PRDX1	176763	Methylmalonic aciduria and homocystinuria, cblC type, digenic	Autosomal recessive; Digenic inheritance (MMACHC gene)
10	PRF1	170280	Hemophagocytic lymphohistiocytosis, familial, type 2	Autosomal recessive
22	PRODH	606810	Hyperprolinemia, type 1	Autosomal recessive
5	PROP1	601538	Pituitary hormone deficiency, combined, type 2	Autosomal recessive
X	PRPS1	311850	PRPS1-related disoders	X-linked
10	PSAP	176801	Combined SAP deficiency	Autosomal recessive
11	PTS	612719	Hyperphenylalaninemia, BH4-deficient, type A	Autosomal recessive
12	PUS1	608109	Myopathy, lactic acidosis, and sideroblastic anemia, type 1	Autosomal recessive
11	PYGM	608455	McArdle disease	Autosomal recessive
4	QDPR	612676	Hyperphenylalaninemia, BH4-deficient, type C	Autosomal recessive
6	RAB23	606144	Carpenter syndrome	Autosomal recessive
11	RAG1	179615	Omenn syndrome; Severe combined immunodeficiency, B cell-negative	Autosomal recessive
11	RAG2	179616	Omenn syndrome; Severe combined immunodeficiency, B cell-negative	Autosomal recessive
11	RAPSN	601592	Fetal akinesia deformation sequence, type 2; Myasthenic syndrome, congenital, type 11, associated with AChR deficiency	Autosomal recessive
6	RARS2	611524	Pontocerebellar hypoplasia, type 6	Autosomal recessive
18	RAX	601881	Isolated microphthalmia, type 3	Autosomal recessive
14	RDH12	608830	Leber congenital amaurosis, type 13	Autosomal recessive
9	RMRP	157660	Anauxetic dysplasia, type 1	Autosomal recessive
13	RNASEH2B	610326	Aicardi-Goutieres syndrome, type 2	Autosomal recessive
11	RNASEH2C	610330	Aicardi-Goutieres syndrome, type 3	Autosomal recessive
X	RP2	300757	Retinitis pigmentosa, type 2, X-linked	X-linked
1	RPE65	180069	RPE65-related Leber congenital amaurosis/early-onset severe retinal dystrophy	Autosomal recessive
X	RPGR	312610	Retinitis pigmentosa, type 3, X-linked; Cone-rod dystrophy, X-linked, 1	X-linked
16	RPGRIP1L	610937	Joubert syndrome, type 7; Meckel syndrome, type 5; COACH syndrome	Autosomal recessive
X	RS1	300839	Retinoschisis	X-linked
20	RTEL1	608833	Dyskeratosis congenita, autosomal recessive type 5	Autosomal recessive*
13	SACS	604490	Spastic ataxia, Charlevoix-Saguenay, type	Autosomal recessive
2	SAG	181031	Oguchi disease, type 1	Autosomal recessive
20	SAMHD1	606754	Aicardi-Goutieres syndrome, type 5	Autosomal recessive
7	SBDS	607444	Shwachman-Diamond syndrome	Autosomal recessive
22	SCO2	604272	Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, type 1	Autosomal recessive
4	SEPSECS	613009	Pontocerebellar hypoplasia, type 2D	Autosomal recessive
14	SERPINA1	107400	Alpha-1 antitrypsin deficiency	Autosomal recessive
17	SGCA	600119	Limb-girdle muscular dystrophy, type 3 (LGMD R3)	Autosomal recessive
4	SGCB	600900	Limb-girdle muscular dystrophy, type 4 (LGMD R4)	Autosomal recessive
5	SGCD	601411	Limb-girdle muscular dystrophy, type 6 (LGMD R6)	Autosomal recessive
13	SGCG	608896	Limb-girdle muscular dystrophy, type 5 (LGMD R5)	Autosomal recessive
17	SGSH	605270	Mucopolysaccharidosis, type 3A (Sanfilippo A)	Autosomal recessive
X	SH2D1A	300490	Lymphoproliferative syndrome, X-linked, type 1	X-linked
5	SH3TC2	608206	Charcot-Marie-Tooth disease, type 4C	Autosomal recessive
5	SKIC3	614589	Trichohepatoenteric syndrome, type 1 (diarrhea, syndromic)	Autosomal recessive
16	SLC12A3	600968	Gitelman syndrome	Autosomal recessive
15	SLC12A6	604878	Agenesis of the corpus callosum with peripheral neuropathy	Autosomal recessive
X	SLC16A2	300095	Allan-Herndon-Dudley syndrome	X-linked
6	SLC17A5	604322	Salla disease	Autosomal recessive
1	SLC19A2	603941	Thiamine-responsive megaloblastic anemia syndrome	Autosomal recessive
2	SLC19A3	606152	Thiamine metabolism dysfunction syndrome, type 2 (biotin- or thiamine-responsive encephalopathy type)	Autosomal recessive
5	SLC22A5	603377	Carnitine deficiency, systemic primary	Autosomal recessive
7	SLC25A13	603859	Citrullinemia, type 2, neonatal-onset; Citrullinemia, type 2, adult-onset	Autosomal recessive
13	SLC25A15	603861	Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome	Autosomal recessive
3	SLC25A20	613698	Carnitine-acylcarnitine translocase deficiency	Autosomal recessive
5	SLC26A2	606718	Achondrogenesis Ib; Atelosteogenesis, type II;De la Chapelle dysplasia; Diastrophic dysplasia;Diastrophic dysplasia, broad bone-platyspondylic variant;Epiphyseal dysplasia, multiple, 4	Autosomal recessive
7	SLC26A3	126650	Diarrhea 1, secretory chloride, congenital	Autosomal recessive
7	SLC26A4	605646	Deafness, autosomal recessive, type 4; Pendred syndrome	Autosomal recessive
6	SLC35A1	605634	Congenital disorder of glycosylation, type 2F	Autosomal recessive
1	SLC35A3	605632	Arthrogryposis, impaired intellectual development, and seizures	Autosomal recessive
11	SLC35C1	605881	Congenital disorder of glycosylation, type 2C	Autosomal recessive
1	SLC35D1	610804	Schneckenbecken dysplasia	Autosomal recessive
11	SLC37A4	602671	Glycogen storage disease, type 1B	Autosomal recessive
8	SLC39A4	607059	Acrodermatitis enteropathica	Autosomal recessive
2	SLC3A1	104614	Cystinuria	Autosomal recessive*
5	SLC45A2	606202	Albinism, oculocutaneous, type 4	Autosomal recessive
17	SLC46A1	611672	Folate malabsorption, hereditary	Autosomal recessive
20	SLC4A11	610206	Corneal endothelial dystrophy, autosomal recessive	Autosomal recessive
19	SLC5A5	601843	Thyroid dyshormonogenesis, type 1	Autosomal recessive
5	SLC6A19	608893	Hartnup disorder	Autosomal recessive
X	SLC6A8	300036	Cerebral creatine deficiency syndrome, type 1	X-linked
14	SLC7A7	603593	Lysinuric protein intolerance	Autosomal recessive
19	SLC7A9	604144	Cystinuria	Autosomal recessive*
2	SMARCAL1	606622	Schimke immunoosseous dysplasia	Autosomal recessive
5	SMN1	600354	Spinal muscular atrophy	Autosomal recessive
11	SMPD1	607608	Niemann-Pick disease, type A; Niemann-Pick disease, type B	Autosomal recessive
15	SPG11	610844	Amyotrophic lateral sclerosis 5, juvenile; Charcot-Marie-Tooth disease, axonal, type 2X; Spastic paraplegia 11	Autosomal recessive
16	SPG7	602783	Spastic paraplegia, type 7, autosomal recessive	Autosomal recessive
2	SRD5A2	607306	46,XY disorder of sex development due to 5-alpha-reductase 2 deficiency (pseudovaginal perineoscrotal hypospadias)	Autosomal recessive
2	ST3GAL5	604402	Salt and pepper developmental regression syndrome	Autosomal recessive
8	STAR	600617	Lipoid adrenal hyperplasia	Autosomal recessive
3	SUMF1	607939	Multiple sulfatase deficiency	Autosomal recessive
9	SURF1	185620	Mitochondrial complex IV deficiency, nuclear type 1; Charcot-Marie-Tooth disease, type 4K	Autosomal recessive
X	SYN1	313440	Epilepsy, X-linked, with variable learning disabilities and behavior disorders	X-linked
16	TAT	613018	Tyrosinemia, type 2	Autosomal recessive
11	TCIRG1	604592	Osteopetrosis, autosomal recessive, type 1	Autosomal recessive
14	TECPR2	615000	Spastic paraplegia, type 49, autosomal recessive	Autosomal recessive
3	TF	190000	Atransferrinemia	Autosomal recessive
7	TFR2	604720	Hemochromatosis, type 3	Autosomal recessive
8	TG	188450	Thyroid dyshormonogenesis, type 3	Autosomal recessive
14	TGM1	190195	Ichthyosis, congenital, autosomal recessive, type 1	Autosomal recessive
11	TH	191290	Segawa syndrome, recessive	Autosomal recessive
X	THOC2	300395	Mental retardation, X-linked 12	X-linked
11	TMEM216	613277	Joubert syndrome, type 2; Meckel syndrome, type 2	Autosomal recessive
8	TMEM67	609884	Meckel syndrome 3; COACH syndrome 1; Joubert syndrome 6; Nephronophthisis 11	Autosomal recessive
21	TMPRSS3	605511	Deafness, autosomal recessive, type 8/10	Autosomal recessive
6	TNXB	600985	Ehlers-Danlos syndrome, classic-like	Autosomal recessive
2	TPO	606765	Thyroid dyshormonogenesis, type 2A	Autosomal recessive
11	TPP1	607998	Ceroid lipofuscinosis, neuronal, type 2; Spinocerebellar ataxia, autosomal recessive, type 7	Autosomal recessive
6	TRDN	603283	Ventricular tachycardia, catecholaminergic polymorphic, type 5, with or without muscle weakness	Autosomal recessive
3	TREX1	606609	Aicardi-Goutieres syndrome, type 1	Autosomal recessive
9	TRIM32	602290	Limb-girdle muscular dystrophy, type 8 (LGMD R8)	Autosomal recessive
17	TRIM37	605073	Mulibrey nanism	Autosomal recessive
22	TRMU	610230	Liver failure, transient infantile	Autosomal recessive
17	TSEN54	608755	Pontocerebellar hypoplasia, type 2A; Pontocerebellar hypoplasia, type 4	Autosomal recessive
12	TSFM	604723	Combined oxidative phosphorylation deficiency, type 3	Autosomal recessive
1	TSHB	188540	Hypothyroidism, congenital, nongoitrous, type 4	Autosomal recessive
14	TSHR	603372	Hypothyroidism, congenital, nongoitrous, type 1	Autosomal recessive
8	TTPA	600415	Ataxia with isolated vitamin E deficiency	Autosomal recessive
22	TYMP	131222	Mitochondrial DNA depletion syndrome, type 1 (MNGIE type)	Autosomal recessive
11	TYR	606933	Oculocutaneous albinism (OCA) type 1A; OCA type 1B	Autosomal recessive
9	TYRP1	115501	Albinism, oculocutaneous, type 3	Autosomal recessive
15	UBE3A	601623	Angelman syndrome	Autosomal dominant*
2	UGT1A1	191740	Crigler-Najjar syndrome, type 1; Crigler-Najjar syndrome, type 2	Autosomal recessive
17	UNC13D	608897	Hemophagocytic lymphohistiocytosis, familial, type 3	Autosomal recessive
X	UPF3B	300298	Mental retardation, X-linked, syndromic, type 14	X-linked
11	USH1C	605242	Usher syndrome, type 1C; Deafness, autosomal recessive, type 18A	Autosomal recessive
17	USH1G	607696	Usher syndrome, type 1G	Autosomal recessive
1	USH2A	608400	Usher syndrome, type 2A; Retinitis pigmentosa 39	Autosomal recessive
9	VPS13A	605978	Choreoacanthocytosis	Autosomal recessive
8	VPS13B	607817	Cohen syndrome	Autosomal recessive
1	VPS45	610035	Neutropenia, severe congenital, type 5	Autosomal recessive
17	VPS53	615850	Pontocerebellar hypoplasia, type 2E	Autosomal recessive
14	VRK1	602168	Pontocerebellar hypoplasia, type 1A	Autosomal recessive
14	VSX2	142993	Microphthalmia with coloboma 3; Isolated microphthalmia 2	Autosomal recessive
X	WAS	300392	Wiskott-Aldrich syndrome; Thrombocytopenia, X-linked	X-linked
9	WHRN	607928	Usher syndrome, type 2D; Deafness, autosomal recessive, type 31	Autosomal recessive
2	WNT10A	606268	WNT10A-related conditions	Autosomal recessive
8	WRN	604611	Werner syndrome	Autosomal recessive
9	XPA	611153	Xeroderma pigmentosum, group A	Autosomal recessive
3	XPC	613208	Xeroderma pigmentosum, group C	Autosomal recessive
X	ZDHHC9	300646	Mental retardation, X-linked syndromic, Raymond type	X-linked
14	ZFYVE26	612012	Spastic paraplegia, type 15, autosomal recessive	Autosomal recessive
X	ZNF711	314990	Mental retardation, X-linked, type 97	X-linked

Download CGT Plus v1.0

Export Download CGT Plus v1.1

Export Download CGT Plus v1.2

Export Download CGT Plus v2.0

Export Download CGT Plus v3.0.1

Export Download CGT Plus v3.1.1

Export Download CGT Plus v3.2.3

Export Download CGT Plus v3.3.5

Export

CGT Bank v3.3.10
CGT Bank v3.3.11
Historic Versions

chrom	OMIM (gene)	gene	previous symbol	OMIM (phen)	disease name (phenotype)	inheritance
X	300371	ABCD1		300100	Adrenoleukodystrophy	X-linked
X	300629	AP1S2		304340	Mental retardation, X-linked, syndromic, type 5 (Pettigrew syndrome)	X-linked
X	313700	AR		300068	Androgen insensitivity syndrome, complete	X-linked
X	300180	ARSL	ARSE	302950	Chondrodysplasia punctata, brachytelephalangic	X-linked
X	300382	ARX		308350; 300215; 309510	Epileptic encephalopathy, early infantile, type 1; ARX-related developmental disorders	X-linked
X	300011	ATP7A		309400; 304150	Menkes disease; Occipital horn syndrome	X-linked
X	300504	ATRX		309580; 301040	Mental retardation-hypotonic facies syndrome, X-linked; Alpha-thalassemia/mental retardation syndrome	X-linked
X	300553	BRWD3		300659	Mental retardation, X-linked, type 93	X-linked
X	300300	BTK		300755	Agammaglobulinemia X-linked, type 1	X-linked
X	300386	CD40LG		308230	Hyper-IgM syndrome, type 1 (immunodeficiency, X-linked, with hyper-IgM, type 1)	X-linked
7	602421	CFTR		219700	Cystic fibrosis	Autosomal recessive
X	300390	CHM		303100	Choroideremia	X-linked
X	303630	COL4A5		301050	Alport syndrome, X-linked	X-linked
X	300304	CUL4B		300354	Mental retardation, X-linked, syndromic, type 15 (Cabezas type)	X-linked
X	300481	CYBB		306400	Chronic granulomatous disease, X-linked	X-linked
6	613815	CYP21A2		201910	Congenital adrenal hyperplasia due to 21-hydroxylase deficiency	Autosomal recessive
X	300121	DCX		300067	Lissencephaly, X-linked, type 1	X-linked
X	300126	DKC1		305000	Dyskeratosis congenita, X-linked	X-linked
X	300189	DLG3		300850	Mental retardation, X-linked, type 90	X-linked
X	300377	DMD		310200; 300376	Duchenne/Becker muscular dystrophy	X-linked
X	300451	EDA		305100	Ectodermal dysplasia, type 1, hypohidrotic, X-linked	X-linked
X	300384	EMD		310300	Emery-Dreifuss muscular dystrophy, type 1, X-linked	X-linked
X	300841	F8		306700	Hemophilia A	X-linked
X	300746	F9		306900	Hemophilia B	X-linked
X	300546	FGD1		305400	Aarskog-Scott syndrome; Mental retardation, X-linked syndromic, type 16	X-linked
X	309550	FMR1		300624	Fragile X syndrome	X-linked
X	300499	FTSJ1		309549	Mental retardation, X-linked 44	X-linked
X	305900	G6PD		300908	Hemolytic anemia, G6PD deficient (favism)	X-linked
X	304040	GJB1		302800	Charcot-Marie-Tooth neuropathy, X-linked dominant, type 1	X-linked
13	121011	GJB2		220290	Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6	Autosomal recessive; Digenic inheritance (GJB6 gene)
X	300644	GLA		301500	Fabry disease	X-linked
X	300808	GPR143		300500	Ocular albinism, type 1 (Nettleship-Falls type)	X-linked
16	141800	HBA1		604131	Thalassemia, alpha-	Autosomal recessive
16	141850	HBA2		604131	Thalassemia, alpha-	Autosomal recessive
11	141900	HBB		603903	HBB-related hemoglobinopathy	Autosomal recessive
X	300019	HCFC1		309541	Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type )	X-linked
X	308000	HPRT1		300322	Lesch-Nyhan syndrome	X-linked
X	300256	HSD17B10		300438	HSD10 mitochondrial disease	X-linked
X	300823	IDS		309900	Mucopolysaccharidosis, type 2	X-linked
X	300206	IL1RAPL1		300143	Mental retardation, X-linked, type 21/34	X-linked
X	308380	IL2RG		300400	Severe combined immunodeficiency, X-linked	X-linked
X	314690	KDM5C		300534	Mental retardation, X-linked, syndromic, Claes-Jensen type	X-linked
X	308840	L1CAM		307000; 303350; 304100	L1 Syndrome	X-linked
X	300005	MECP2		300673; 312750	Encephalopathy, neonatal severe; Rett syndrome	X-linked
X	300415	MTM1		310400	Myotubular myopathy, X-linked	X-linked
X	300658	NDP		310600	Norrie disease	X-linked
X	300473	NR0B1		300200	Adrenal hypoplasia, congenital	X-linked
X	300535	OCRL		309000; 300555	Lowe Syndrome; Dent disease type 2	X-linked
X	300127	OPHN1		300486	Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance	X-linked
X	300461	OTC		311250	Ornithine transcarbamylase deficiency	X-linked
X	300142	PAK3		300558	Mental retardation, X-linked, type 30	X-linked
X	300502	PDHA1		312170	Pyruvate dehydrogenase E1-alpha deficiency	X-linked
X	311800	PGK1		300653	Phosphoglycerate kinase 1 deficiency	X-linked
X	300560	PHF8		300263	Mental retardation syndrome, X-linked, Siderius type	X-linked
X	300401	PLP1		312080	Pelizaeus-Merzbacher disease	X-linked
X	300039	POU3F4		304400	Deafness, X-linked, type 2	X-linked
X	300463	PQBP1		309500	Renpenning syndrome	X-linked
X	311850	PRPS1		300661; 304500; 311070; 301835	PRPS1-related disoders	X-linked
X	300757	RP2		312600	Retinitis pigmentosa, type 2, X-linked	X-linked
X	312610	RPGR		300029; 304020	Retinitis pigmentosa, type 3, X-linked; Cone-rod dystrophy, X-linked, 1	X-linked
X	300839	RS1		312700	Retinoschisis	X-linked
X	300490	SH2D1A		308240	Lymphoproliferative syndrome, X-linked, type 1	X-linked
X	300095	SLC16A2		300523	Allan-Herndon-Dudley syndrome	X-linked
X	300036	SLC6A8		300352	Cerebral creatine deficiency syndrome, type 1	X-linked
5	600354	SMN1		253300	Spinal muscular atrophy	Autosomal recessive
X	313440	SYN1		300491	Epilepsy, X-linked, with variable learning disabilities and behavior disorders	X-linked
X	300395	THOC2		300957	Mental retardation, X-linked 12	X-linked
X	300298	UPF3B		300676	Mental retardation, X-linked, syndromic, type 14	X-linked
X	300392	WAS		301000; 313900	Wiskott-Aldrich syndrome; Thrombocytopenia, X-linked	X-linked
X	300646	ZDHHC9		300799	Mental retardation, X-linked syndromic, Raymond type	X-linked
X	314990	ZNF711		300803	Mental retardation, X-linked, type 97	X-linked

chrom	OMIM (gene)	Gene	Previous Symbol	OMIM (phen)	disease name (phenotype)	inheritance
X	300371	ABCD1		300100	Adrenoleukodystrophy	X-linked
1	607008	ACADM		201450	Medium-chain acyl-CoA dehydrogenase deficiency	Autosomal recessive
2	604285	AGXT		259900	Hyperoxaluria, primary, type 1	Autosomal recessive
X	300629	AP1S2		304340	Mental retardation, X-linked, syndromic, type 5 (Pettigrew syndrome)	X-linked
X	313700	AR		300068	Androgen insensitivity syndrome, complete	X-linked
22	607574	ARSA		250100	Metachromatic leukodystrophy	Autosomal recessive
X	300180	ARSL	ARSE	302950	Chondrodysplasia punctata, brachytelephalangic	X-linked
X	300382	ARX		308350; 300215; 309510	Epileptic encephalopathy, early infantile, type 1; ARX-related developmental disorders	X-linked
X	300011	ATP7A		309400; 304150	Menkes disease; Occipital horn syndrome	X-linked
X	300504	ATRX		309580; 301040	Mental retardation-hypotonic facies syndrome, X-linked; Alpha-thalassemia/mental retardation syndrome	X-linked
X	300553	BRWD3		300659	Mental retardation, X-linked, type 93	X-linked
3	609019	BTD		253260	Biotinidase deficiency	Autosomal recessive
X	300300	BTK		300755	Agammaglobulinemia X-linked, type 1	X-linked
21	613381	CBS		236200	Homocystinuria due to cystathionine beta-synthase	Autosomal recessive
X	300386	CD40LG		308230	Hyper-IgM syndrome, type 1 (immunodeficiency, X-linked, with hyper-IgM, type 1)	X-linked
7	602421	CFTR		219700	Cystic fibrosis	Autosomal recessive
X	300390	CHM		303100	Choroideremia	X-linked
X	303630	COL4A5		301050	Alport syndrome, X-linked	X-linked
X	300304	CUL4B		300354	Mental retardation, X-linked, syndromic, type 15 (Cabezas type)	X-linked
X	300481	CYBB		306400	Chronic granulomatous disease, X-linked	X-linked
X	300121	DCX		300067	Lissencephaly, X-linked, type 1	X-linked
11	602858	DHCR7		270400	Smith-Lemli-Opitz syndrome	Autosomal recessive
X	300126	DKC1		305000	Dyskeratosis congenita, X-linked	X-linked
X	300189	DLG3		300850	Mental retardation, X-linked, type 90	X-linked
X	300377	DMD		310200; 300376	Duchenne/Becker muscular dystrophy	X-linked
X	300451	EDA		305100	Ectodermal dysplasia, type 1, hypohidrotic, X-linked	X-linked
X	300384	EMD		310300	Emery-Dreifuss muscular dystrophy, type 1, X-linked	X-linked
X	300841	F8		306700	Hemophilia A	X-linked
X	300746	F9		306900	Hemophilia B	X-linked
X	300546	FGD1		305400	Aarskog-Scott syndrome; Mental retardation, X-linked syndromic, type 16	X-linked
X	309550	FMR1		300624	Fragile X syndrome	X-linked
X	300499	FTSJ1		309549	Mental retardation, X-linked 44	X-linked
X	305900	G6PD		300908	Hemolytic anemia, G6PD deficient (favism)	X-linked
17	606800	GAA		232300	Glycogen storage disease, type 2	Autosomal recessive
9	606999	GALT		230400	Galactosemia	Autosomal recessive
X	304040	GJB1		302800	Charcot-Marie-Tooth neuropathy, X-linked dominant, type 1	X-linked
13	121011	GJB2		220290	Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6	Autosomal recessive; Digenic inheritance (GJB6 gene)
X	300644	GLA		301500	Fabry disease	X-linked
X	300808	GPR143		300500	Ocular albinism, type 1 (Nettleship-Falls type)	X-linked
2	600890	HADHA		609016; 609015	Long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD) deficiency; Mitochondrial trifunctional protein deficiency	Autosomal recessive
16	141800	HBA1		604131	Thalassemia, alpha-	Autosomal recessive
16	141850	HBA2		604131	Thalassemia, alpha-	Autosomal recessive
11	141900	HBB		603903	HBB-related hemoglobinopathy	Autosomal recessive
X	300019	HCFC1		309541	Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type )	X-linked
X	308000	HPRT1		300322	Lesch-Nyhan syndrome	X-linked
X	300256	HSD17B10		300438	HSD10 mitochondrial disease	X-linked
X	300823	IDS		309900	Mucopolysaccharidosis, type 2	X-linked
X	300206	IL1RAPL1		300143	Mental retardation, X-linked, type 21/34	X-linked
X	308380	IL2RG		300400	Severe combined immunodeficiency, X-linked	X-linked
X	314690	KDM5C		300534	Mental retardation, X-linked, syndromic, Claes-Jensen type	X-linked
X	308840	L1CAM		307000; 303350; 304100	L1 Syndrome	X-linked
X	300005	MECP2		300673; 312750	Encephalopathy, neonatal severe; Rett syndrome	X-linked
1	609831	MMACHC		277400	Methylmalonic aciduria and homocystinuria, cblC type	Autosomal recessive, digenic inheritance (PRDX1 gene)
X	300415	MTM1		310400	Myotubular myopathy, X-linked	X-linked
X	300658	NDP		310600	Norrie disease	X-linked
X	300473	NR0B1		300200	Adrenal hypoplasia, congenital	X-linked
X	300535	OCRL		309000; 300555	Lowe Syndrome; Dent disease type 2	X-linked
X	300127	OPHN1		300486	Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance	X-linked
X	300461	OTC		311250	Ornithine transcarbamylase deficiency	X-linked
12	612349	PAH		261600	Phenylketonuria	Autosomal recessive
X	300142	PAK3		300558	Mental retardation, X-linked, type 30	X-linked
X	300502	PDHA1		312170	Pyruvate dehydrogenase E1-alpha deficiency	X-linked
X	311800	PGK1		300653	Phosphoglycerate kinase 1 deficiency	X-linked
X	300560	PHF8		300263	Mental retardation syndrome, X-linked, Siderius type	X-linked
X	300401	PLP1		312080	Pelizaeus-Merzbacher disease	X-linked
16	601785	PMM2		212065	Congenital disorder of glycosylation, type 1A	Autosomal recessive
X	300039	POU3F4		304400	Deafness, X-linked, type 2	X-linked
X	300463	PQBP1		309500	Renpenning syndrome	X-linked
X	311850	PRPS1		300661; 304500; 311070; 301835	PRPS1-related disoders	X-linked
X	300757	RP2		312600	Retinitis pigmentosa, type 2, X-linked	X-linked
X	312610	RPGR		300029; 304020	Retinitis pigmentosa, type 3, X-linked; Cone-rod dystrophy, X-linked, 1	X-linked
X	300839	RS1		312700	Retinoschisis	X-linked
X	300490	SH2D1A		308240	Lymphoproliferative syndrome, X-linked, type 1	X-linked
X	300095	SLC16A2		300523	Allan-Herndon-Dudley syndrome	X-linked
5	606718	SLC26A2		600972	Achondrogenesis, type 1B (diastrophic dysplasia)	Autosomal recessive
X	300036	SLC6A8		300352	Cerebral creatine deficiency syndrome, type 1	X-linked
5	600354	SMN1		253300	Spinal muscular atrophy	Autosomal recessive
X	313440	SYN1		300491	Epilepsy, X-linked, with variable learning disabilities and behavior disorders	X-linked
X	300395	THOC2		300957	Mental retardation, X-linked 12	X-linked
X	300298	UPF3B		300676	Mental retardation, X-linked, syndromic, type 14	X-linked
X	300392	WAS		301000; 313900	Wiskott-Aldrich syndrome; Thrombocytopenia, X-linked	X-linked
X	300646	ZDHHC9		300799	Mental retardation, X-linked syndromic, Raymond type	X-linked
X	314990	ZNF711		300803	Mental retardation, X-linked, type 97	X-linked

Download CGT Bank v1.1

Export Download CGT Bank v2.0

Export Download CGT Bank v2.1

Export Download CGT Bank v2.2

Export Download CGT Bank v2.3

Export Download CGT Bank v3.0.2

Export Download CGT Bank v3.1.1

Export Download CGT Bank v3.1.2

Export Download CGT Bank v3.1.3

Export Download CGT Bank v3.1.5

Export Download CGT Bank v3.2.3

Export Download CGT Bank v3.2.2

Export Download CGT Bank v3.2.1

Export Download CGT Bankv3.3.1.0

Export Download CGT Bankv3.3.1.1

Export

CGT 600 v1
CGT 600 v2

Gene	Disease	Transcript	Mutations	Disease.description	products
ABCA4	Cone-rod dystrophy type 3	NM_000350.2	NM_000350.2:c.3540_3555delGTCTAAGGGTTTCTCC, NM_000350.2:c.2616_2617delCT, NM_000350.2:c.4793C>A, NM_000350.2:c.6179T>G, NM_000350.2:c.1222C>T, NM_000350.2:c.763C>T	Cone rod dystrophy type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness. The prevalence is 1:100,000-9100,000.	250,600
ABCA4	Retinitis pigmentosa type 19	NM_000350.2	NM_000350.2:c.1848delA	Retinitis pigmentosa type 19 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	250,600
ABCA4	Stargardt disease type 1	NM_000350.2	NM_000350.2:c.1018T>G, NM_000350.2:c.4457C>T, NM_000350.2:c.1225delA, NM_000350.2:c.1622T>C, NM_000350.2:c.1715G>A, NM_000350.2:c.1755delA, NM_000350.2:c.1771delT, NM_000350.2:c.1804C>T, NM_000350.2:c.6449G>A, NM_000350.2:c.1938-1G>A, NM_000350.2:c.1964T>G, NM_000350.2:c.2160+1G>T, NM_000350.2:c.2588G>C, NM_000350.2:c.4469G>A, NM_000350.2:c.2690C>T, NM_000350.2:c.2791G>A, NM_000350.2:c.286A>G, NM_000350.2:c.2971G>C, NM_000350.2:c.3083C>T, NM_000350.2:c.3106G>A, NM_000350.2:c.3210_3211dupGT, NM_000350.2:c.3364G>A, NM_000350.2:c.6320G>A, NM_000350.2:c.3970delG, NM_000350.2:c.4139C>T, NM_000350.2:c.4429C>T, NM_000350.2:c.2300T>A, NM_000350.2:c.3322C>T, NM_000350.2:c.52C>T, NM_000350.2:c.5512delC, NM_000350.2:c.5819T>C, NM_000350.2:c.5881G>A, NM_000350.2:c.5882G>A, NM_000350.2:c.5912T>G, NM_000350.2:c.634C>T, NM_000350.2:c.5714+5G>A, NM_000350.2:c.6394G>T, NM_000350.2:c.67-2A>G, NM_000350.2:c.5461-10T>C, NM_000350.2:c.6089G>A, NM_000350.2:c.6118C>T, NM_000350.2:c.6148G>C, NM_000350.2:c.661G>A, NM_000350.2:c.5338C>G	Stargardt disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by progressive central vision loss, mild loss of color vision, delayed dark adaptation and macular atrophy with or without paramacular flecks and degeneration of the underlying retinal pigment ephitelium. The prevalence is 1:10,000- 5:10,000.	250,600
ABCB7	Sideroblastic anemia and ataxia, X-linked	NM_004299.4	NM_004299.4:c.1203T>G, NM_004299.4:c.1234G>C, NM_004299.4:c.1300G>A	X-linked sideroblastic anemia with ataxia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ABCB7 gene located on chromosomal region Xq13.3. The age of onset is neonatal/infantile. This disease is characterized by core neurological features including motor delay, ataxia evident from early childhood, and dysarthria and patients usually have a mild asymptomatic anaemia or a borderline decreased mean corpuscular volume. The prevalence is <1:1,000,000.	600
ACAD9	Acyl-CoA dehydrogenase type 9 deficiency	NM_014049.4	NM_014049.4:c.1240C>T, NM_014049.4:c.1249C>T, NM_014049.4:c.130T>A, NM_014049.4:c.1594C>T, NM_014049.4:c.23delT, NM_014049.4:c.358delT, NM_014049.4:c.797G>A, NM_014049.4:c.976G>C, NM_014049.4:c.453+1G>A	Acyl-CoA dehydrogenase type 9 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAD9 gene located on chromosomal region 3q21.3. The age of onset is neonatal/infantile. This disease is characterized by failure to thrive, hypertrophic cardiomyopathy, exercise intolerance and mild to severe neurological dysfunction.	250,600
ACADM	Acyl-CoA dehydrogenase deficiency, medium-chain	NM_000016.5	NM_000016.5:c.1102_1105delTTAG, NM_000016.5:c.1232_1233delAA, NM_000016.5:c.287-2A>G, NM_000016.5:c.362C>T, NM_000016.5:c.447G>A, NM_000016.5:c.447G>T, NM_000016.5:c.449_452delCTGA, NM_000016.5:c.616C>T, NM_000016.5:c.617G>A, NM_000016.5:c.683C>A, NM_000016.5:c.797A>G, NM_000016.5:c.799G>A, NM_000016.5:c.815_827delTTGCAATGGGAGC, NM_000016.5:c.890A>G, NM_000016.5:c.984delG, NM_000016.5:c.985A>G, NM_000016.5:c.127G>A, NM_000016.5:c.734C>T, NM_000016.5:c.250C>T	Medium chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADM gene located on chromosomal region 1p31. The age of onset is neonatal/infantile. This disease is characterized by a rapidly progressive metabolic crisis, often presenting as hypoketotic hypoglycemia, lethargy, vomiting, seizures and coma. The prevalence is 1:4,900-1:27,000 in Caucasian populations and 1:14,600 in worldwide populations.	250,600
ACADS	Acyl-CoA dehydrogenase deficiency, short-chain	NM_000017.2	NM_000017.2:c.1095G>T, NM_000017.2:c.1108A>G, NM_000017.2:c.1147C>T, NM_000017.2:c.136C>T, NM_000017.2:c.319C>T, NM_000017.2:c.417G>C, NM_000017.2:c.529T>C, NM_000017.2:c.561_568delCAATGCCT, NM_000017.2:c.826G>A, NM_000017.2:c.314T>A	Short chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADS gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by seizures, developmental delay, failure to grow with poor feeding, and usually muscle weakness and hypotonia. The prevalence is <1:50,000.	250,600
ACADSB	2-Methylbutyryl-CoA dehydrogenase deficiency	NM_001609.3	NM_001609.3:c.1159G>A, NM_001609.3:c.443C>T, NM_001609.3:c.763C>T, NM_001609.3:c.621G>A, NM_001609.3:c.303+1G>A	2-Methylbutyryl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADSB gene located on chromosomal region 10q26.3. The age of onset is neonatal/infantile. This disease is characterized by muscle hypotonia, cerebral palsy, developmental delay, lethargy, hypoglycemia, and metabolic acidosis. The prevalence is <1:1,000,000.	250,600
ACADVL	Very long chain acyl-CoA dehydrogenase deficiency	NM_000018.3	NM_000018.3:c.1096C>T, NM_000018.3:c.1097G>A, NM_000018.3:c.1106T>C, NM_000018.3:c.1141_1143delGAG, NM_000018.3:c.1182+1G>A, NM_000018.3:c.1357C>T, NM_000018.3:c.1360G>A, NM_000018.3:c.1375dupC, NM_000018.3:c.1389dupG, NM_000018.3:c.1406G>A, NM_000018.3:c.1468G>C, NM_000018.3:c.1532+1G>A, NM_000018.3:c.1837C>T, NM_000018.3:c.1843C>T, NM_000018.3:c.1882delC, NM_000018.3:c.278-1G>A, NM_000018.3:c.298_299delCA, NM_000018.3:c.343delG, NM_000018.3:c.400C>T, NM_000018.3:c.477+1G>C, NM_000018.3:c.520G>A, NM_000018.3:c.685C>T, NM_000018.3:c.739A>C, NM_000018.3:c.753-2A>C, NM_000018.3:c.896_898delAGA, NM_000018.3:c.917T>C, NM_000018.3:c.1844G>A, NM_000018.3:c.848T>C	Very long chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADVL gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by cardiomyopathy, hypoketotic hypoglycemia, liver disease, exercise intolerance and rhabdomyolysis. The prevalence is 1:100,000-9:100,000.	250,600
ACAT1	Beta-ketothiolase deficiency	NM_000019.3	NM_000019.3:c.1035_1037delAGA, NM_000019.3:c.1083dupA, NM_000019.3:c.1136G>T, NM_000019.3:c.1138G>A, NM_000019.3:c.2T>A, NM_000019.3:c.410_417delCTCAAAGT, NM_000019.3:c.547G>A, NM_000019.3:c.622C>T, NM_000019.3:c.905delA	Beta-ketothiolase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAT1 gene located on chromosomal region 11q22.3. The age of onset is neonatal/infantile. This disease is characterized by normal early development followed by a progressive loss of mental and motor skills. The prevalence is < 1:1,000,000.	600
ACE	Renal tubular dysgenesis	NM_000789.3	NM_000789.3:c.1319_1322delTGGA, NM_000789.3:c.1510delC, NM_000789.3:c.3381-4C>T, NM_000789.3:c.798C>G, NM_000789.3:c.1486C>T, NM_000789.3:c.2371C>T, NM_000789.3:c.1587-2A>G	Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.	250,600
ACOX1	Peroxisomal acyl-CoA oxidase deficiency	NM_004035.6	NM_004035.6:c.832A>G, NM_004035.6:c.532G>T, NM_004035.6:c.591delG	Peroxisomal acyl-CoA oxidase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACOX1 gene located on chromosomal region 17q25.1. The age of onset is neonatal/infantile. This disease is characterized by hypotonia and seizures in the neonatal period and neurological regression in early infancy. The prevalence is < 1:1,000,000.	600
ACTN4	Glomerulosclerosis, focal segmental, type 1	NM_004924.4	NM_004924.4:c.763A>G, NM_004924.4:c.2619_2620insC, NM_004924.4:c.776C>T, NM_004924.4:c.784T>C	Focal segmental glomerulosclerosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACTN4 gene located on chromosomal region 19q13.2. The age of onset is variable. This disease is characterized by severe proteinuria with low serum albumin and possible edemas.	600
ADA	Adenosine deaminase deficiency	NM_000022.2	NM_000022.2:c.226C>T, NM_000022.2:c.632G>A, NM_000022.2:c.890C>A, NM_000022.2:c.247G>A, NM_000022.2:c.320T>C, NM_000022.2:c.872C>T, NM_000022.2:c.956_960delAAGAG, NM_000022.2:c.986C>T	Adenosine deaminase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADA gene located on chromosomal region 20q13.12. The age of onset is neonatal/infantile. This disease is characterized by profound lymphopenia and very low immunoglobulin levels of all isotypes resulting in severe and recurrent opportunistic infections. The annual incidence is 1:200,000-1:1,000,000. The prevalence is 1:100,000-9:100,000.	250,600
ADAMTS2	Ehlers-Danlos syndrome type 7C	NM_014244.4	NM_014244.4:c.2384G>A	Ehlers-Danlos syndrome type 7C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADAMTS2 gene located on chromosomal region 5q35.3. The age of onset is neonatal/infantile. This disease is characterized by extremely fragile tissues, hyperextensible skin and easy bruising. The prevalence is <1:1,000,000.	600
ADAMTSL2	Geleophysic dysplasia type 1	NM_014694.3	NM_014694.3:c.338G>A, NM_014694.3:c.440C>T, NM_014694.3:c.661C>T, NM_014694.3:c.340G>A	Geleophysic dysplasia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADAMTSL2 gene located on chromosomal region 9q34.2. The age of onset is infantile. This disease is characterized by extremely by short stature, prominent abnormalities in hands and feet, and a characteristic facial appearance. The prevalence is <1:1,000,000.	600
ADCK3	Primary coenzyme Q10 deficiency type 4	NM_020247.4	NM_020247.4:c.911C>T, NM_020247.4:c.815G>T, NM_020247.4:c.993C>T, NM_020247.4:c.1541A>G, NM_020247.4:c.1645G>A, NM_020247.4:c.1651G>A, NM_020247.4:c.1750_1752delACC, NM_020247.4:c.1813_1814insG, NM_020247.4:c.589-3C>G, NM_020247.4:c.637C>T, NM_020247.4:c.815G>A	Primary coenzyme Q10 deficiency type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADCK3 gene located on chromosomal region 1q42.13. The age of onset is infantile. This disease is characterized by progressive ataxia, cerebellar atrophy, and often exercise intolerance with elevated lactate levels and mild intellectual deficit.	250,600
AGA	Aspartylglucosaminuria	NM_000027.3	NM_000027.3:c.488G>C, NM_000027.3:c.755G>A, NM_000027.3:c.214T>C, NM_000027.3:c.302C>T, NM_000027.3:c.800dupT, NM_000027.3:c.904G>A	Aspartylglucosaminuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGA gene located on chromosomal region 4q34.3. The age of onset is infantile. This disease is characterized by slowly developping mental retardation, beginning with clumsiness, late speech, and hyperkinesia, mild facial dysmorphism, and slight kyphoscoliosis.	600
AGL	Glycogen storage disease type 3	NM_000642.2	NM_000642.2:c.1783C>T, NM_000642.2:c.18_19delGA, NM_000642.2:c.112A>G, NM_000642.2:c.1222C>T, NM_000642.2:c.1481G>A, NM_000642.2:c.1485delT, NM_000642.2:c.16C>T, NM_000642.2:c.4260-1G>T, NM_000642.2:c.3214_3215delGA, NM_000642.2:c.1999delC, NM_000642.2:c.2039G>A, NM_000642.2:c.2590C>T, NM_000642.2:c.4456delT, NM_000642.2:c.3216_3217delGA, NM_000642.2:c.3980G>A, NM_000642.2:c.4342G>C, NM_000642.2:c.4529dupA, NM_000642.2:c.294-2A>T, NM_000642.2:c.4260-12A>G	Glycogen storage disease type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGL gene located on chromosomal region 1p21.2. The age of onset is infantile. This disease is characterized by hepatomegaly, growth retardation and occasional seizures related to hypoglycemia and frequently muscular hypotonia and hypertrophic cardiomyopathy.	250,600
AGPS	Rhizomelic chondrodysplasia punctata type 3	NM_003659.3	NM_003659.3:c.1256G>A, NM_003659.3:c.926C>T, NM_003659.3:c.1406T>C, NM_003659.3:c.1703C>T	Rhizomelic chondrodysplasia punctata type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGPS gene located on chromosomal region 2q31.2. The age of onset is neonatal/infantile. This disease is characterized by shortness of the femur and humerus, vertebral disorders, cataract, cutaneous lesions and severe intellectual deficit. The prevalence is 1:100,000-9:100,000.	600
AGT	Renal tubular dysgenesis	NM_000029.3	NM_000029.3:c.1124G>A, NM_000029.3:c.604C>T, NM_000029.3:c.1290_1291insT, NM_000029.3:c.1290delT	Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.	600
AGTR1	Renal tubular dysgenesis	NM_031850.3	NM_031850.3:c.481delC, NM_031850.3:c.259dupG, NM_031850.3:c.215dupT, NM_031850.3:c.481C>T	Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.	600
AGXT	Primary hyperoxaluria type 1	NM_000030.2	NM_000030.2:c.166-2A>G, NM_000030.2:c.121G>A, NM_000030.2:c.32C>A, NM_000030.2:c.245G>A, NM_000030.2:c.25_26insC, NM_000030.2:c.322T>C, NM_000030.2:c.508G>A, NM_000030.2:c.560C>T, NM_000030.2:c.590G>A, NM_000030.2:c.613T>C, NM_000030.2:c.697C>T, NM_000030.2:c.698G>A, NM_000030.2:c.731T>C, NM_000030.2:c.738G>A, NM_000030.2:c.836T>C, NM_000030.2:c.860G>A, NM_000030.2:c.33_34insC, NM_000030.2:c.454T>A, NM_000030.2:c.466G>A, NM_000030.2:c.248A>G	Primary hyperoxaluria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGXT gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by variable clinical presentation, ranging from occasional symptomatic nephrolithiasis to nephrocalcinosis and end-stage renal disease with systemic involvement. The prevalence is 1:1,000,000-9:1,000,000.	250,600
AHI1	Joubert syndrome type 3	NM_017651.4	NM_017651.4:c.1303C>T, NM_017651.4:c.1484G>A, NM_017651.4:c.2295_2296insA, NM_017651.4:c.2295dupA, NM_017651.4:c.3257A>G, NM_017651.4:c.2168G>A, NM_017651.4:c.985C>T, NM_017651.4:c.989A>G, NM_017651.4:c.3263_3264delGG, NM_017651.4:c.1051C>T, NM_017651.4:c.1052G>T	El síndrome de Joubert tipo 3 sigue un patrón de herencia autosómico recesivo y está causado por variantes patogénicas en el gen AHI1 localizado en la región cromosómica 6q23.3. La edad de aparición es neonatal/infantil con síntomas como los rasgos neurológicos del síndrome de Joubert (hipotonía neonatal, retraso del desarrollo, discapacidad intelectural de leve a grave, ataxia, movimiento ocular anormal incluyendo apraxia oculomotora y nistagmo en posición primaria) asociados a una distrofia retiniana.	250,600
AIPL1	Cone-rod dystrophy	NM_014336.4	NM_014336.4:c.1053_1064delTGCAGAGCCACC	La distrofia de conos y bastones causada por variantes patogénicas en el gen AIPL1 localizado en la región cromosómica 17p13.2 sigue un patrón de herencia autosómico recesivo. La edad de aparición es temprana. Se caracteriza por una agudeza visual disminuida, defectos en la visión de los colores, fotoaversión y disminución de la sensibilidad en el centro del campo visual, seguido por una pérdida de la visión periférica y ceguera nocturna.	250,600
AIPL1	Leber congenital amaurosis type 4	NM_014336.4	NM_014336.4:c.905G>T, NM_014336.4:c.834G>A, NM_014336.4:c.589G>C, NM_014336.4:c.715T>C	Leber congenital amaurosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AIPL1gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. The prevalence is 1:100,000-9:100,000.	250,600
ALAS2	Erythropoietic protoporphyria	NM_000032.4	NM_000032.4:c.1699_1700delAT, NM_000032.4:c.1706_1709delAGTG	Erythropoietic protoporphyria caused by pathogenic variants in the ALAS2 gene located on chromosomal region Xp11.21 follows a dominant X-linked pattern of inheritance. The age of onset is neonatal/infancy. This disease is characterized by cutaneous manifestations of acute painful photosensitivity with erythema and edema, sometimes with petechiae, together with stinging and burning sensations without blistering, upon exposure to sunlight or artificial light (400-700 nm). These episodes have a variable severity depending on the exposure duration and may result in chronic permanent lesions on exposed skin. There is a risk of .cholelithiasis with obstructive episodes, and chronic liver disease that might evolve to acute liver failure. The global prevalence is ranging between 1/75,000 and 1/200,000.	600
ALAS2	Sideroblastic anemia, X-linked	NM_000032.4	NM_000032.4:c.1354C>T	X-linked sideroblastic anemia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ALAS2 gene located on chromosomal region Xp11.21. The age of onset is variable. This disease is characterized by clinical features of anemia and/or iron overload such as pallor, fatigue, weakness, and more rarely breathlessness, mild splenomegaly, cardiac problems, abnormal liver function, hyperglycemia, glucose intolerance and skin hyperpigmentation.	600
ALDH4A1	Hyperprolinemia type 2	NM_003748.3	NM_003748.3:c.1055C>T	Hyperprolinemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDH4A1 gene located on chromosomal region 1p36. The age of onset is variable. This disease is characterized by seizures, intellectual deficit and mild developmental delay.	600
ALDH5A1	Succinic semialdehyde dehydrogenase deficiency	NM_001080.3	NM_001080.3:c.1234C>T, NM_001080.3:c.1226G>A, NM_001080.3:c.901A>G, NM_001080.3:c.1540C>T, NM_001080.3:c.1579C>T, NM_001080.3:c.612G>A, NM_001080.3:c.803G>A, NM_001080.3:c.862A>G	Succinic semialdehyde dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDH451 gene located on chromosomal region 6p22. The age of onset is infantile. This disease is characterized by psychomotor retardation, delayed speech development, hypotonia and ataxia. It is a rare disease with around 350 cases reported.	600
ALDOA	Glycogen storage disease type 12	NM_000034.3	NM_000034.3:c.619G>A, NM_000034.3:c.386A>G	Glycogen storage disease type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOA gene located on chromosomal region 16p11.2. The age of onset is neonatal/infantile. This disease is characterized by myopathy with exercise intolerance and rhabdomyolysis associated with hemolytic anaemia.	600
ALDOB	Hereditary fructose intolerance	NM_000035.3	NM_000035.3:c.1005C>G, NM_000035.3:c.178C>T, NM_000035.3:c.1027T>C, NM_000035.3:c.10C>T, NM_000035.3:c.136A>T, NM_000035.3:c.448G>C, NM_000035.3:c.2T>C, NM_000035.3:c.360_363delCAAA, NM_000035.3:c.442T>C, NM_000035.3:c.1013C>T, NM_000035.3:c.113-1_115delGGTA, NM_000035.3:c.1067C>A, NM_000035.3:c.612T>A, NM_000035.3:c.720C>A, NM_000035.3:c.524C>A	Hereditary fructose intolerance follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOB gene located on chromosomal region 9q21.3-q22.2. The age of onset is neonatal/infantile. This disease is characterized by severe abdominal pain, vomiting, and hypoglycemia following ingestion of fructose or other sugars metabolised through fructose-1-phosphate. The prevalence is 1:100,000-9:100,000.	250,600
ALG1	Congenital disorders of glycosylation type 1k	NM_019109.4	NM_019109.4:c.1187+1G>A, NM_019109.4:c.1079C>T, NM_019109.4:c.1129A>G, NM_019109.4:c.901+1G>A, NM_019109.4:c.434G>A, NM_019109.4:c.450C>G, NM_019109.4:c.773C>T	Congenital disorder of glycosylation type 1k follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG1 gene located on chromosomal region 16p13.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay, seizures, microcephaly and coagulation anomalies. The prevalence is <1:1,000,000.	600
ALG6	Congenital disorders of glycosylation type Ic	NM_013339.3	NM_013339.3:c.897_899delAAT, NM_013339.3:c.998C>T, NM_013339.3:c.495-3C>G, NM_013339.3:c.53G>A, NM_013339.3:c.316C>T, NM_013339.3:c.482A>G, NM_013339.3:c.1432T>C	Congenital disorder of glycosylation type 1c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG6 gene located on chromosomal region 1p31.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay and muscular hypotonia, and possible coagulation anomalies, hormonal abnormalities and seizures. The prevalence is <1:1,000,000.	250,600
ALMS1	Alström syndrome	NM_015120.4	NM_015120.4:c.11443C>T, NM_015120.4:c.10775delC, NM_015120.4:c.11316_11319delAGAG, NM_015120.4:c.2323C>T, NM_015120.4:c.11449C>T, NM_015120.4:c.11452_11453insA, NM_015120.4:c.1574_1576delCTCinsT, NM_015120.4:c.8383C>T, NM_015120.4:c.9612_9616delAACAG, NM_015120.4:c.10579_10580delAT, NM_015120.4:c.11610_11611delCT, NM_015120.4:c.12439C>T, NM_015120.4:c.12445C>T, NM_015120.4:c.891_907delTCAGCACCCGCTTATAG, NM_015120.4:c.9911-1G>A, NM_015120.4:c.11618_11619delCT, NM_015120.4:c.4245delC, NM_015120.4:c.5584C>T, NM_015120.4:c.8164C>T	Alström syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALMS1 gene located on chromosomal region 2p13.1. The age of onset is neonatal/infantile. This disease is characterized by cone-rod dystrophy, hearing loss, obesity, insulin resistance and hyperinsulinemia, type 2 diabetes mellitus, dilated cardiomyopathy and progressive hepatic and renal dysfunction. The prevalence is 1:10,000-1:1,000,000.	250,600
ALPL	Hypophosphatasia	NM_000478.4	NM_000478.4:c.1001G>A, NM_000478.4:c.1366G>A, NM_000478.4:c.211C>T, NM_000478.4:c.212G>C, NM_000478.4:c.323C>T, NM_000478.4:c.346G>A, NM_000478.4:c.407G>A, NM_000478.4:c.526G>A, NM_000478.4:c.535G>A, NM_000478.4:c.571G>A, NM_000478.4:c.620A>C, NM_000478.4:c.1133A>T, NM_000478.4:c.1250A>G, NM_000478.4:c.1306T>C, NM_000478.4:c.98C>T, NM_000478.4:c.1574delG, NM_000478.4:c.892G>A, NM_000478.4:c.814C>T, NM_000478.4:c.881A>C	Childhood-onset hypophosphatasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALPL gene located on chromosomal region 1p36.12. The age of onset is infantile. This disease is characterized by clinical features ranging from stillbirth without mineralized bone to pathologic fractures of the lower extremities in later adulthood.	600
AMACR	Alpha-methylacyl-CoA racemase deficiency	NM_014324.5	NM_014324.5:c.857delT, NM_014324.5:c.320T>C, NM_014324.5:c.43delG, NM_014324.5:c.154T>C	Alpha-methylacyl-Coa racemase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMACR gene located on chromosomal region 5p13. The age of onset is variable. This disease is characterized by mild cholestatic liver disease, fat malabsorption and/or neurological disease. The prevalence is <1:1,000,000.	600
AMT	Glycine encephalopathy	NM_000481.3	NM_000481.3:c.139G>A, NM_000481.3:c.125A>G, NM_000481.3:c.959G>A, NM_000481.3:c.574C>T, NM_000481.3:c.806G>A, NM_000481.3:c.826G>C, NM_000481.3:c.259-1G>C	Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMT and GLDC genes located on chromosomal regions 3p21.31 and 9p24.1 respectively. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000.	600
ANO5	Limb-girdle muscular dystrophy type 2L, autosomal recessive	NM_213599.2	NM_213599.2:c.155A>G, NM_213599.2:c.1622_1623insA, NM_213599.2:c.1407+5G>A, NM_213599.2:c.1887delA, NM_213599.2:c.1733T>C, NM_213599.2:c.692G>T, NM_213599.2:c.1627_1628insA, NM_213599.2:c.172C>T, NM_213599.2:c.206_207delAT, NM_213599.2:c.1210C>T, NM_213599.2:c.1295C>G, NM_213599.2:c.1914G>A, NM_213599.2:c.184_185insA, NM_213599.2:c.1898+1G>A, NM_213599.2:c.191_192insA	Autosomal recessive limb-girdle muscular dystrophy type 2L follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ANO5 gene located on chromosomal region 11p14.3. The age of onset is adult. This disease is characterized by weakness and wasting restricted to the limb musculature, proximal greater than distal, and muscle degeneration/regeneration on muscle biopsy. The prevalence is <1:1,000,000.	250,600
APTX	Ataxia with oculomotor apraxia type 1	NM_175073.2	NM_175073.2:c.167delT, NM_175073.2:c.788T>G, NM_175073.2:c.320delC, NM_175073.2:c.617C>T, NM_175073.2:c.659C>T, NM_175073.2:c.134-2A>G, NM_175073.2:c.166C>T, NM_175073.2:c.124C>T, NM_175073.2:c.875-1G>A, NM_175073.2:c.837G>A, NM_175073.2:c.596G>A	Ataxia with oculomotor apraxia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the APTX gene located on chromosomal region 9p13.1. The age of onset is infantile. This disease is characterized by a progressive cerebellar ataxia associated with oculomotor apraxia, choeroathetosis and severe peripheral neuropathy. The prevalence is 0,4:100.000 in Portugal.	250,600
AR	Androgen insensitivity syndrome	NM_000044.3	NM_000044.3:c.2650A>T, NM_000044.3:c.340C>T, NM_000044.3:c.1937C>A, NM_000044.3:c.2323C>T, NM_000044.3:c.2391G>A, NM_000044.3:c.2567G>A, NM_000044.3:c.1769-11T>A, NM_000044.3:c.1771A>T, NM_000044.3:c.2395C>G	Androgen insensitivity syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the AR gene located on chromosomal region Xq12. The age of onset is variable. This disease is characterized by the presence of female external genitalia in a 46,XY individual with normal testis development but undescended testes and unresponsiveness to age-appropriate levels of androgens. The prevalence is 2:100,000-5:100,000.	250,600
ARG1	Argininemia	NM_000045.3	NM_000045.3:c.61C>T, NM_000045.3:c.365G>A, NM_000045.3:c.413G>T, NM_000045.3:c.871C>T, NM_000045.3:c.32T>C, NM_000045.3:c.703G>C, NM_000045.3:c.869C>G	Argininemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARG1gene located on chromosomal region 6q23. The age of onset is neonatal/infantile. This disease is characterized by variable degrees of hyperammonemia, developing from about 3 years of age, and leading to progressive loss of developmental milestones and spasticity in the absence of treatment. The prevalence is 1:350,000-1:1,000,000.	600
ARL13B	Joubert syndrome type 8	NM_182896.2	NM_182896.2:c.1186C>G, NM_182896.2:c.246G>A, NM_182896.2:c.1252C>T, NM_182896.2:c.598C>T	Joubert syndrome type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL13B gene located on chromosomal region 3q11.1. The age of onset is neonatal/infantile. This disease is characterized by congenital malformation of the brainstem and agenesis or hypoplasia of the cerebellar vermis leading to an abnormal respiratory pattern, nystagmus, hypotonia, ataxia and delay in achieving motor milestones. The prevalence is 1/80,000 to 1/100,000.	600
ARL6	Bardet-Biedl syndrome type 3	NM_177976.2	NM_177976.2:c.4G>T, NM_177976.2:c.92C>G, NM_177976.2:c.281T>C, NM_177976.2:c.92C>T, NM_177976.2:c.431C>T, NM_177976.2:c.364C>T	Bardet-Biedl syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL6 gene located on chromosomal region 3q11.2. The age of onset is early. A syndrome characterized by usually severe pigmentary retinopathy, early-onset obesity, polydactyly, hypogenitalism, renal malformation and mental retardation. Secondary features include diabetes mellitus, hypertension and congenital heart disease.	600
ARL6	Retinitis pigmentosa type 55	NM_177976.2	NM_177976.2:c.266C>T	Retinitis pigmentosa type 55 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL6 gene located on chromosomal region 3q11.2. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	600
ARSA	Metachromatic leukodystrophy	NM_000487.5	NM_000487.5:c.1241delC, NM_000487.5:c.1283C>T, NM_000487.5:c.346C>T, NM_000487.5:c.34delG, NM_000487.5:c.1210+1G>A, NM_000487.5:c.1232C>T, NM_000487.5:c.582delC, NM_000487.5:c.583delT, NM_000487.5:c.542dupT, NM_000487.5:c.542T>G, NM_000487.5:c.1408_1418delGCAGCTGTGAC, NM_000487.5:c.195delC, NM_000487.5:c.641C>T, NM_000487.5:c.1401_1411delGTTAGACGCAG, NM_000487.5:c.869G>A, NM_000487.5:c.869G>T, NM_000487.5:c.883G>A, NM_000487.5:c.899T>C, NM_000487.5:c.931G>A, NM_000487.5:c.937C>T, NM_000487.5:c.938G>A, NM_000487.5:c.979G>A, NM_000487.5:c.737G>A, NM_000487.5:c.739G>A, NM_000487.5:c.763G>A, NM_000487.5:c.827C>T, NM_000487.5:c.854+1G>A, NM_000487.5:c.1108-2A>G, NM_000487.5:c.1125_1126delCT, NM_000487.5:c.1150G>A, NM_000487.5:c.1174C>T, NM_000487.5:c.1175G>A, NM_000487.5:c.986C>T, NM_000487.5:c.991G>T, NM_000487.5:c.465+1G>A, NM_000487.5:c.257G>A, NM_000487.5:c.293C>T, NM_000487.5:c.302G>A	Metachromatic leukodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSA gene located on chromosomal region 22q13.33. The age of onset is variable. This disease is characterized by hypotonia, walking difficulties, optic atrophy and motor regression preceding mental impairment in the late infantile form, arrested intellectual development, followed by motor regression, epileptic seizures and ataxia in the juvenile form, and motor or psychiatric disorders, but with slow progression in the adult form. The incidence is 0.5:5,000-1:50,000 and the prevalence is 1:10,000 -5/10,000.	250,600
ARSB	Mucopolysaccharidosis type 6	NM_000046.3	NM_000046.3:c.410G>T, NM_000046.3:c.427delG, NM_000046.3:c.349T>C, NM_000046.3:c.389C>T, NM_000046.3:c.937C>G, NM_000046.3:c.944G>A, NM_000046.3:c.971G>T, NM_000046.3:c.979C>T, NM_000046.3:c.1562G>A, NM_000046.3:c.629A>G, NM_000046.3:c.1143-1G>C, NM_000046.3:c.571C>T, NM_000046.3:c.589C>T, NM_000046.3:c.1178A>C, NM_000046.3:c.1214G>A, NM_000046.3:c.1143-8T>G, NM_000046.3:c.1161dupC, NM_000046.3:c.707T>C, NM_000046.3:c.753C>G, NM_000046.3:c.1366C>T, NM_000046.3:c.1438_1439insG, NM_000046.3:c.921delA	Mucopolysaccharidosis type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSB gene located on chromosomal region 5q14.1. The age of onset is infantile. This disease is characterized by educed pulmonary function, hepatosplenomegaly, hearing loss, sleep apnea, corneal clouding, carpal tunnel disease and occasionally central nervous system findings may include cervical cord compression caused by cervical spinal instability, meningeal thickening and/or bony stenosis, communicating hydrocephalus, optic nerve atrophy and blindness. The prevalence is 1:250,000-1:600,000 newborns.	250,600
ARSE	Chondrodysplasia punctata type 1, X-linked	NM_000047.2	NM_000047.2:c.119T>G, NM_000047.2:c.1429delG, NM_000047.2:c.1442C>T, NM_000047.2:c.1732C>T, NM_000047.2:c.1743G>A, NM_000047.2:c.24-1G>A, NM_000047.2:c.410G>C, NM_000047.2:c.410G>T	X-linked chondrodysplasia punctata type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARSE gene located on chromosomal region Xp22.33. The age of onset is neonatal. This disease is characterized by chondrodysplasia punctata (stippled epiphyses), brachytelephalangy (shortening of the distal phalanges), and nasomaxillary hypoplasia. The prevalence is 1:500,000.	250,600
ARX	Epileptic encephalopathy, early infantile, type 1	NM_139058.2	NM_139058.2:c.1058C>T	Early infantile epileptic encephalopathy type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARX gene located on chromosomal region Xp21.3. The age of onset is neonatal/infantile. This disease is characterized by poor suckling reflexes, hypotonia and generalized and symmetrical tonic spasms. The prevalence is 1:500,000.	600
ARX	Lissencephaly with abnormal genitalia, X-linked	NM_139058.2	NM_139058.2:c.980_983delAACA	X-linked lissencephaly with abnormal genitalia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARX gene located on chromosomal region Xp21.3. The age of onset is neonatal/infantile. It is a severe neurological disorder that only manifests in genotypic males and includes lissencephaly with posterior-to-anterior gradient and only moderate increase in thickness of the cortex, absent corpus callosum, neonatal-onset severe epilepsy, hypothalamic dysfunction including defective temperature regulation, and ambiguous genitalia with micropenis and cryptorchidism.	600
ASL	Argininosuccinic aciduria	NM_000048.3	NM_000048.3:c.1135C>T, NM_000048.3:c.1060C>T, NM_000048.3:c.1255_1256delCT, NM_000048.3:c.1366C>T, NM_000048.3:c.1045_1057delGTCATCTCTACGC, NM_000048.3:c.578G>A, NM_000048.3:c.539T>G, NM_000048.3:c.544C>T, NM_000048.3:c.557G>A, NM_000048.3:c.1144-2A>G, NM_000048.3:c.602+1G>A, NM_000048.3:c.857A>G, NM_000048.3:c.925G>A, NM_000048.3:c.446+1G>A, NM_000048.3:c.505T>C, NM_000048.3:c.525-2A>T, NM_000048.3:c.532G>A, NM_000048.3:c.337C>T, NM_000048.3:c.346C>T, NM_000048.3:c.35G>A, NM_000048.3:c.1369dupG, NM_000048.3:c.437G>A, NM_000048.3:c.392C>T, NM_000048.3:c.1153C>T	Argininosuccinic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASL gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by severe hyperammonemic coma, hypotonia, growth failure, anorexia and chronic vomiting or behavioral disorders during childhood, and hyperammonemic coma or behavioral disorders that simulate psychiatric disorders later in life. The prevalence is 1:70,000 newborns.	250,600
ASPA	Canavan disease	NM_000049.2	NM_000049.2:c.838C>T, NM_000049.2:c.693C>A, NM_000049.2:c.654C>A, NM_000049.2:c.433-2A>G, NM_000049.2:c.854A>C, NM_000049.2:c.914C>A, NM_000049.2:c.212G>A, NM_000049.2:c.863A>G	Canavan disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPA gene located on chromosomal region 17p13.3. The age of onset is neonatal/infantile. This disease is characterized by a variable spectrum between severe forms with leukodystrophy, macrocephaly and severe developmental delay, and a very rare mild/juvenile form characterized by mild developmental delay. The prevalence is 1:6,400- 1:13,500 in Askenazis Jewis.	250,600
ASPM	Microcephaly primary, type 5, autosomal recessive	NM_018136.4	NM_018136.4:c.1002delA, NM_018136.4:c.3055C>T, NM_018136.4:c.2389C>T, NM_018136.4:c.2967G>A, NM_018136.4:c.1260_1266delTCAAGTC, NM_018136.4:c.10059C>A, NM_018136.4:c.1154_1155delAG, NM_018136.4:c.1179delT, NM_018136.4:c.1729_1730delAG, NM_018136.4:c.1959_1962delCAAA, NM_018136.4:c.1990C>T, NM_018136.4:c.3979C>T, NM_018136.4:c.4195dupA, NM_018136.4:c.4583delA, NM_018136.4:c.4795C>T, NM_018136.4:c.4858_4859delAT, NM_018136.4:c.5136C>A, NM_018136.4:c.5149delA, NM_018136.4:c.1366G>T, NM_018136.4:c.1406_1413delATCCTAAA, NM_018136.4:c.1590delA, NM_018136.4:c.6189T>G, NM_018136.4:c.6232C>T, NM_018136.4:c.6337_6338delAT, NM_018136.4:c.6732delA, NM_018136.4:c.719_720delCT, NM_018136.4:c.7491_7495delTATTA, NM_018136.4:c.7565T>G, NM_018136.4:c.7761T>G, NM_018136.4:c.7782_7783delGA, NM_018136.4:c.7860_7861delGA, NM_018136.4:c.7894C>T, NM_018136.4:c.8131_8132delAA, NM_018136.4:c.8230_8231insA, NM_018136.4:c.8378delT, NM_018136.4:c.8508_8509delGA, NM_018136.4:c.8668C>T, NM_018136.4:c.8844delC, NM_018136.4:c.9115_9118dupCATT, NM_018136.4:c.9159delA, NM_018136.4:c.9178C>T, NM_018136.4:c.3082G>A, NM_018136.4:c.3188T>G, NM_018136.4:c.3477_3481delCGCTA, NM_018136.4:c.349C>T, NM_018136.4:c.3527C>G, NM_018136.4:c.3663delG, NM_018136.4:c.3710C>G, NM_018136.4:c.3796G>T, NM_018136.4:c.3811C>T, NM_018136.4:c.3978G>A, NM_018136.4:c.9747_9748delCT, NM_018136.4:c.9754delA, NM_018136.4:c.9789T>A, NM_018136.4:c.8711_8712delAA, NM_018136.4:c.9190C>T, NM_018136.4:c.9238A>T, NM_018136.4:c.9319C>T, NM_018136.4:c.5439_5440delAG, NM_018136.4:c.577C>T, NM_018136.4:c.6073delG, NM_018136.4:c.9677dupG, NM_018136.4:c.9685delA, NM_018136.4:c.9697C>T, NM_018136.4:c.9730C>T, NM_018136.4:c.9557C>G, NM_018136.4:c.9492T>G, NM_018136.4:c.9539A>C	Primary autosomal recessive microcephaly type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPM gene located on chromosomal region 1q31. The age of onset is neonatal/infantile. This disease is characterized by a reduction in head circumference at birth, mild to moderate non-progressive intellectual impairment and delay in early motor milestones, speech delay and hyperactive behavior are common. The annual incidence is 1:1,000,000.	250,600
ASS1	Citrullinemia type 1	NM_000050.4	NM_000050.4:c.421-2A>G, NM_000050.4:c.40G>A, NM_000050.4:c.1088G>A, NM_000050.4:c.470G>A, NM_000050.4:c.1085G>T, NM_000050.4:c.1087C>T, NM_000050.4:c.257G>A, NM_000050.4:c.323G>T, NM_000050.4:c.349G>A, NM_000050.4:c.380G>A, NM_000050.4:c.836G>A, NM_000050.4:c.910C>T, NM_000050.4:c.928A>C, NM_000050.4:c.496-2A>G, NM_000050.4:c.535T>C, NM_000050.4:c.539G>A, NM_000050.4:c.53C>T, NM_000050.4:c.571G>A, NM_000050.4:c.787G>A, NM_000050.4:c.793C>T, NM_000050.4:c.794G>A, NM_000050.4:c.805G>A, NM_000050.4:c.835C>T, NM_000050.4:c.919C>T, NM_000050.4:c.970G>A, NM_000050.4:c.814C>T, NM_000050.4:c.970+5G>A, NM_000050.4:c.1168G>A, NM_000050.4:c.1194-1G>C, NM_000050.4:c.256C>T	Citrullinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASS1 gene located on chromosomal region 9q34.1. The age of onset is variable. This disease is characterized by hyperammonemia, progressive lethargy, poor feeding and vomiting in the neonatal form and by variable hyperammonemia in the later-onset form. The prevalence is 1:100,000-9:100,000.	250,600
ATIC	AICA-ribosiduria	NM_004044.6	NM_004044.6:c.223+1G>A, NM_004044.6:c.1277A>G, NM_004044.6:c.625delG	AICA-ribosiduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATIC gene located on chromosomal region 2q35. The age of onset is neonatal/infantile. This disease is characterized by profound intellectual deficit, epilepsy, dysmorphic features of the knees, elbows, and shoulders and congenital blindness. The prevalence is <1:1,000,000.	250,600
ATP7A	Menkes disease	NM_000052.6	NM_000052.6:c.2938C>T, NM_000052.6:c.2531G>A, NM_000052.6:c.1639C>T, NM_000052.6:c.1974_1977dupGTTT, NM_000052.6:c.3257_3258delAC, NM_000052.6:c.3294+2T>G, NM_000052.6:c.3915_3921delCTCCCCA, NM_000052.6:c.3931A>G	Menkes disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ATP7A gene located on chromosomal region Xq21.1. The age of onset is neonatal/infantile. This disease is characterized by progressive neurodegeneration and marked connective tissue anomalies as well as typical sparse abnormal steely hair. The birth incidence is 1:300,000 in Europe, 1:360,000 in Japan and 1:50,000-1:100,000 in Australia, and The prevalence is 1:100,000 newborns.	600
ATP7A	Occipital horn syndrome	NM_000052.6	NM_000052.6:c.3911A>G	Occipital horn syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ATP7A gene located on chromosomal region Xq21.1. The age of onset is variable. This disease is characterized by progressive neurodegeneration and connective tissue disorders due to a copper transport defect. The prevalence is 1:100,000 newborns.	600
ATP7A	Spinal muscular atrophy, distal, X-linked	NM_000052.6	NM_000052.6:c.2981C>T	Spinal muscular atrophy, distal follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ATP7A gene located on chromosomal region Xq21.1. The age of onset is infantile. This disease is characterized by distal weakness, atrophy of the muscles of the lower limbs, particularly in the tibioperoneal compartment and pes cavus.	600
ATP7B	Wilson disease	NM_000053.3	NM_000053.3:c.2532delA, NM_000053.3:c.2356-2A>G, NM_000053.3:c.1285+5G>T, NM_000053.3:c.2305A>G, NM_000053.3:c.1145_1151delCCCAACT, NM_000053.3:c.1934T>G, NM_000053.3:c.2071G>A, NM_000053.3:c.2297C>G, NM_000053.3:c.2972C>T, NM_000053.3:c.2975C>T, NM_000053.3:c.3083delA, NM_000053.3:c.2605G>A, NM_000053.3:c.2621C>T, NM_000053.3:c.2755C>G, NM_000053.3:c.2755C>T, NM_000053.3:c.2762G>A, NM_000053.3:c.2795C>A, NM_000053.3:c.2804C>T, NM_000053.3:c.2807T>A, NM_000053.3:c.2906G>A, NM_000053.3:c.2930C>T, NM_000053.3:c.4301C>T, NM_000053.3:c.915T>A, NM_000053.3:c.98T>C, NM_000053.3:c.1745_1746delTA, NM_000053.3:c.2123T>C, NM_000053.3:c.2267C>T, NM_000053.3:c.4088C>T, NM_000053.3:c.4135C>T, NM_000053.3:c.1512_1513insT, NM_000053.3:c.19_20delCA, NM_000053.3:c.1922T>C, NM_000053.3:c.3955C>T, NM_000053.3:c.3990_3993delTTAT, NM_000053.3:c.4058G>A, NM_000053.3:c.3207C>A, NM_000053.3:c.3359T>A, NM_000053.3:c.3688A>G, NM_000053.3:c.3101A>G, NM_000053.3:c.3796G>A, NM_000053.3:c.3809A>G, NM_000053.3:c.562C>T, NM_000053.3:c.3694A>C, NM_000053.3:c.1846C>T	Wilson disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATP7B gene located on chromosomal region 13q14.3. The age of onset is infantile. This disease is characterized by the toxic accumulation of copper, mainly in the liver and central nervous system, and symptomatic patients may present with hepatic, neurologic or psychiatric forms. The birth incidence is 1:30,000-1:100,000 in France and The prevalence is 1:10,000-1:30,000.	250,600
ATR	Seckel syndrome type 1	NM_001184.3	NM_001184.3:c.2341+1G>A, NM_001184.3:c.5645delA, NM_001184.3:c.6037_6038insA, NM_001184.3:c.6488delT, NM_001184.3:c.975_976delCT, NM_001184.3:c.5635G>T	Seckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATR gene located on chromosomal region 3q23. The age of onset is neonatal/infantile. This disease is characterized by a proportionate dwarfism of prenatal onset, a severe microcephaly with a bird-headed like appearance and mental retardation. The prevalence is <1:1,000,000.	250,600
AUH	3-Methylglutaconic aciduria type 1	NM_001698.2	NM_001698.2:c.471delT, NM_001698.2:c.559G>A, NM_001698.2:c.589C>T, NM_001698.2:c.650G>A, NM_001698.2:c.895-1G>A, NM_001698.2:c.991A>T, NM_001698.2:c.656-2A>G, NM_001698.2:c.943-2A>G	3-Methylglutaconic aciduria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AUH gene located on chromosomal region 9q22.31. The age of onset is neonatal/infantile. This disease is characterized by a variable clinical phenotype ranging from mildly delayed speech to psychomotor retardation, coma, failure to thrive, metabolic acidosis and dystonia. The prevalence is <1:1,000,000.	600
B4GALT1	Congenital disorders of glycosylation type 2d	NM_001497.3	NM_001497.3:c.1031dupC	Congenital disorder of glycosylation type 2d follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the B4GALT1 gene located on chromosomal region 9p13. The age of onset is neonatal/infantile. This disease is characterized by macrocephaly, hydrocephaly, hypotonia, myopathy and coagulation anomalies. The prevalence is <1:1,000,000.	600
B9D2	Meckel syndrome type 10	NM_030578.3	NM_030578.3:c.301A>C	Meckel syndrome type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the B9D2 gene located on chromosomal region 19q13.2. The age of onset is neonatal/infantile. This disease is characterized by a combination of renal cysts developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and polydactyly. The prevalence is <1:1,000,000.	600
BCKDHA	Maple syrup urine disease type 1A	NM_000709.3	NM_000709.3:c.1037G>A, NM_000709.3:c.1036C>T, NM_000709.3:c.1234G>A, NM_000709.3:c.14delT, NM_000709.3:c.761C>A, NM_000709.3:c.929C>G, NM_000709.3:c.964C>T, NM_000709.3:c.979G>A, NM_000709.3:c.905A>C, NM_000709.3:c.632C>T, NM_000709.3:c.659C>T, NM_000709.3:c.740_741insT, NM_000709.3:c.868G>A, NM_000709.3:c.909_910delGT, NM_000709.3:c.917delT, NM_000709.3:c.853G>C, NM_000709.3:c.796delA	Maple syrup urine disease type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHA gene located on chromosomal region 19q13.1-13.2. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:1,000,000-9:1,000,000.	250,600
BCKDHB	Maple syrup urine disease type 1B	NM_183050.2	NM_183050.2:c.1046G>A, NM_183050.2:c.547C>T, NM_183050.2:c.509G>A, NM_183050.2:c.526A>T, NM_183050.2:c.344-1G>A, NM_183050.2:c.1114G>T, NM_183050.2:c.302G>A, NM_183050.2:c.342T>G, NM_183050.2:c.508C>A, NM_183050.2:c.508C>G, NM_183050.2:c.508C>T, NM_183050.2:c.748G>T, NM_183050.2:c.752T>C, NM_183050.2:c.799C>T, NM_183050.2:c.548G>C, NM_183050.2:c.884delT, NM_183050.2:c.902T>G, NM_183050.2:c.952-1G>A, NM_183050.2:c.853C>T, NM_183050.2:c.832G>A, NM_183050.2:c.356T>G, NM_183050.2:c.970C>T, NM_183050.2:c.488A>T, NM_183050.2:c.479T>G	Maple syrup urine disease type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHB gene located on chromosomal region 6q14.1. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:10,000-5:10,000.	600
BCS1L	Björnstad syndrome	NM_004328.4	NM_004328.4:c.548G>A	Björnstadt syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal/infantile. This disease is characterized by congenital sensorineural hearing loss and pili torti. The prevalence is <1:1,000,000.	250,600
BCS1L	GRACILE syndrome	NM_004328.4	NM_004328.4:c.232A>G	GRACILE syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal/infantile. This disease is characterized by fetal growth restriction (GR), aminoaciduria (A), cholestasis (C), iron overload (I), lactacidosis (L) and early death (E). The birth incidence is 1:50,000 in Finland and the prevalence is <1:1,000,000.	250,600
BCS1L	Mitochondrial comlpex III deficiency, nuclear type 1	NM_004328.4	NM_004328.4:c.1057G>A, NM_004328.4:c.830G>A, NM_004328.4:c.133C>T, NM_004328.4:c.103G>C, NM_004328.4:c.696delT, NM_004328.4:c.148A>G, NM_004328.4:c.166C>T, NM_004328.4:c.550C>T, NM_004328.4:c.547C>T	Mitochondrial comlpex III deficiency, nuclear type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal and it is characterized by lactic acidosis, hypotonia, hypoglycemia, failure to thrive, encephalopathy, and delayed psychomotor development.	250,600
BEST1	Bestrophinopathy	NM_004183.3	NM_004183.3:c.934G>A, NM_004183.3:c.598C>T, NM_004183.3:c.752G>A, NM_004183.3:c.949G>A, NM_004183.3:c.521_522delTG	Bestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram.	250,600
BEST1	Retinitis pigmentosa type 50	NM_004183.3	NM_004183.3:c.1383_1384insGCCTTGATGGA, NM_004183.3:c.1444delG, NM_004183.3:c.1491_1497dupCAAAGAC, NM_004183.3:c.1566_1576dupCTTGATGGAGC, NM_004183.3:c.341_342delTG, NM_004183.3:c.1308_1309insACCAAAG, NM_004183.3:c.1264delG, NM_004183.3:c.418C>G, NM_004183.3:c.614T>C, NM_004183.3:c.682G>A, NM_004183.3:c.344delG, NM_004183.3:c.524delG	Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 50 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q12.3. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.	250,600
BEST1	Vitelliform macular dystrophy type 2	NM_004183.3	NM_004183.3:c.122T>C, NM_004183.3:c.422G>A	Vitelliform macular dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q12.3. The age of onset is infancy or adolescence. This disease is characterized by normal vision at birth, then progresses through distinct stages that include an asymptomatic previtelliform phase (stage 1) followed by the formation of a yellow, egg yolk-like (vitelliform) lesion in the macula (stage 2). The contents become less homogenous and develop a "scrambled-egg" appearance (stage 2a). The lesion eventually develops a fluid, yellow-colored vitelline substance (pseudohypopyon or stage 3) and finally breaks down, leaving a scar that causes central visual acuity deterioration (20/200). This may be complicated by a subfoveal choroidal neovascular (CNV) membrane (rare in children). Anomalous color discrimination (mainly the protan axis) and metamorphopsia may be observed but patients retain normal peripheral vision and dark adaptation. Some affected individuals remain asymptomatic. The prevalence is 1/5,000 to 1/67,000.	250,600
BRCA2	Fanconi anemia, complementation group D1	NM_000059.3	NM_000059.3:c.1514T>C, NM_000059.3:c.4648G>T, NM_000059.3:c.8415A>T, NM_000059.3:c.7544C>T, NM_000059.3:c.7994A>G, NM_000059.3:c.5574_5577delAATT, NM_000059.3:c.4889C>G, NM_000059.3:c.4936_4939delGAAA, NM_000059.3:c.5066_5067insA, NM_000059.3:c.6024dupG, NM_000059.3:c.6860delG, NM_000059.3:c.7235C>A, NM_000059.3:c.9382C>T, NM_000059.3:c.9900dupA, NM_000059.3:c.3847_3848delGT, NM_000059.3:c.5718_5719delCT, NM_000059.3:c.5837_5838delCAinsAG, NM_000059.3:c.6023_6024insG, NM_000059.3:c.8503T>C, NM_000059.3:c.6486_6489delACAA, NM_000059.3:c.657_658delTG, NM_000059.3:c.6997_6998insT	Fanconi anemia, complementation group D1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BRCA2 gene located on chromosomal region 13q12.3. The age of onset is infantile. This disease is characterized by physical abnormalities, bone marrow failure, and increased risk of malignancy. The prevalence is 1:1,000,000-9:1,000,000.	250,600
BRIP1	Fanconi anemia, complementation group J	NM_032043.2	NM_032043.2:c.2990_2993delCAAA, NM_032043.2:c.1045G>C, NM_032043.2:c.2237_2240delTCAA, NM_032043.2:c.3209C>A, NM_032043.2:c.502C>T, NM_032043.2:c.139C>G, NM_032043.2:c.1702_1703delAA, NM_032043.2:c.2392C>T	Fanconi anemia, complementation group J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BRIP1 gene located on chromosomal region 17q22.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:1,000,000- 9:1,000,000.	250,600
BSCL2	Berardinelli-Seip congenital lipodystrophy	NM_032667.6	NM_032667.6:c.634G>C, NM_032667.6:c.412C>T, NM_032667.6:c.782_783insG, NM_032667.6:c.823C>T, NM_032667.6:c.985C>T, NM_032667.6:c.672-3C>G, NM_032667.6:c.974_975insG, NM_032667.6:c.671+5G>A	Berardinelli-Seip congenital lipodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSCL2 gene located on chromosomal region 11q13. The age of onset is neonatal/infantile. This disease is characterized the association of lipoatrophy, hypertriglyceridemia, hepatomegaly and acromegaloid features. The prevalence is 1.27:100,000.	600
BSCL2	Severe neurodegenerative syndrome with lipodystrophy	NM_032667.6	NM_032667.6:c.793C>T	Severe neurodegenerative syndrome with lipodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSCL2 gene located on chromosomal region 11q13. The age of onset is neonatal/infantile. This disease is characterized by developmental regression of motor and cognitive skills in the first years of life, often leading to death in the first decade, hyperactive behavior, seizures, tremor and ataxic gait. Patients may show a mild or typical lipodystrophic appearance. The prevalence is 1.27:100,000.	600
BSND	Bartter syndrome type 4A	NM_057176.2	NM_057176.2:c.1A>T, NM_057176.2:c.22C>T, NM_057176.2:c.3G>A, NM_057176.2:c.10G>T, NM_057176.2:c.23G>T, NM_057176.2:c.35T>C, NM_057176.2:c.23G>A, NM_057176.2:c.139G>A	Bartter syndrome type 4A with deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSND gene located on chromosomal region 1p32.3. The age of onset is neonatal/infantile. This disease is characterized by maternal polyhydramnios, premature delivery, polyuria, sensorineural deafness and is associated with hypokalemic alkalosis, increased levels of plasma renin and aldosterone, low blood pressure, and vascular resistance to angiotensin II.	250,600
BTD	Biotinidase deficiency	NM_000060.3	NM_000060.3:c.1531C>G, NM_000060.3:c.1508_1512delGGATG, NM_000060.3:c.1339C>T, NM_000060.3:c.1352G>A, NM_000060.3:c.1489C>T, NM_000060.3:c.643C>T, NM_000060.3:c.664G>A, NM_000060.3:c.755A>G, NM_000060.3:c.1368A>C, NM_000060.3:c.933delT, NM_000060.3:c.1595C>T, NM_000060.3:c.1612C>T, NM_000060.3:c.757C>T, NM_000060.3:c.1106C>T, NM_000060.3:c.1321delG, NM_000060.3:c.794A>T, NM_000060.3:c.595G>A, NM_000060.3:c.629A>G, NM_000060.3:c.631C>T, NM_000060.3:c.235C>T, NM_000060.3:c.334G>C, NM_000060.3:c.511G>A, NM_000060.3:c.184G>A, NM_000060.3:c.557G>A, NM_000060.3:c.583A>G, NM_000060.3:c.968A>G, NM_000060.3:c.528G>T, NM_000060.3:c.443G>A	Biotinidase deficiency an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BTD gene located on chromosomal region 3p25. The age of onset is neonatal/infantile. This disease is characterized by seizures, breathing difficulties, hypotonia, skin rash, alopecia, hearing loss and delayed development.	250,600
BTK	Agammaglobulinemia, X-linked	NM_000061.2	NM_000061.2:c.1275C>A, NM_000061.2:c.1506C>A, NM_000061.2:c.1125T>G, NM_000061.2:c.1223T>C, NM_000061.2:c.1288A>G, NM_000061.2:c.1082A>G, NM_000061.2:c.763C>T, NM_000061.2:c.1516T>C, NM_000061.2:c.718G>T, NM_000061.2:c.755G>A, NM_000061.2:c.1766A>G, NM_000061.2:c.1773C>A, NM_000061.2:c.1558C>T, NM_000061.2:c.1559G>A, NM_000061.2:c.1889T>A, NM_000061.2:c.1906G>T, NM_000061.2:c.338T>A, NM_000061.2:c.1820C>A, NM_000061.2:c.862C>T, NM_000061.2:c.919A>G, NM_000061.2:c.1838G>A, NM_000061.2:c.1001A>C	X-linked agammaglobulinemia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the BTK gene located on chromosomal region Xq21.33-q22. The age of onset is infantile. This disease is characterized by recurrent bacterial infections during infancy. The prevalence is 3:1,000,000-6:1,000,000 men.	600
C10orf2	Infantile onset spinocerebellar ataxia	NM_021830.4	NM_021830.4:c.1523A>G	La ataxia espinocerebelosa infantil sigue un patrón de herencia autosómico recesivo y está causada por variantes patogénicas en el gen C10orf2 localizado en la región cromosómica 10q24. La edad de aparición es neonatal/infantil con síntomas como inicio temprano ataxia, atetosis y reducción de los reflejos tendinosos.	600
C10orf2	Mitochondrial DNA depletion syndrome, hepatocerebrorenal form	NM_021830.4	NM_021830.4:c.1287C>T, NM_021830.4:c.952G>A, NM_021830.4:c.1370C>T, NM_021830.4:c.524_525insG	Mitochondrial DNA depletion syndrome, hepatocerebrorenal form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C10orf2 gene located on chromosomal region 10q24. The age of onset is neonatal/infantile. It is a severe disease associated with mitochondrial dysfunction. Some patients are affected by progressive atrophy of the cerebellum, brain stem, the spinal cord, and sensory axonal neuropathy. Clinical features include hypotonia, athetosis, ataxia, ophthalmoplegia, sensorineural hearing deficit, sensory axonal neuropathy, epileptic encephalopathy and female hypogonadism. In some individuals liver dysfunction and multi-organ failure is present.	600
C10orf2	Sensory ataxic neuropathy - dysarthria - ophthalmoparesis	NM_021830.4	NM_021830.4:c.955A>G	Sensory ataxic neuropathy - dysarthria - ophthalmoparesis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C10orf2 gene located on chromosomal region 10q24. This syndrome is characterised by adult-onset severe sensory ataxic neuropathy, dysarthria and chronic progressive external ophthalmoplegia. The prevalence is unknown. Other common features include progressive gait unsteadiness, absent deep tendon reflexes, the presence of Romberg's sign, a decreased sense of vibration and proprioception and detection of red ragged fibres on muscle biopsy.	600
C3	Atypical hemolytic-uremic syndrome with C3 anomaly	NM_000064.2	NM_000064.2:c.2562C>G	Atypical hemolytic-uremic syndrome with C3 anomaly follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C3 gene located on chromosomal region 19p13.3-p13.2. An atypical form of hemolytic uremic syndrome. It is a complex genetic disease characterized by microangiopathic hemolytic anemia, thrombocytopenia, renal failure and absence of episodes of enterocolitis and diarrhea. In contrast to typical hemolytic uremic syndrome, atypical forms have a poorer prognosis, with higher death rates and frequent progression to end-stage renal disease. The prevalence is <1:1.000.000.	600
C3	C3 deficiency	NM_000064.2	NM_000064.2:c.2354+1G>A, NM_000064.2:c.4851-1G>A, NM_000064.2:c.1119+1G>T, NM_000064.2:c.3116dupT, NM_000064.2:c.3627_3628insGGGGCCC, NM_000064.2:c.1004-2A>T	C3 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C3 gene located on chromosomal region 19p13.3-p13.2. The age of onset is infantile. It is a rare defect of the complement classical pathway. Patients develop recurrent, severe, pyogenic infections because of ineffective opsonization of pathogens. Some patients may also develop autoimmune disorders, such as arthralgia and vasculitic rashes, lupus-like syndrome and membranoproliferative glomerulonephritis. The prevalence is <1:1.000.000.	600
CA2	Osteopetrosis, autosomal recessive, type 3	NM_000067.2	NM_000067.2:c.663+2T>C, NM_000067.2:c.319C>T, NM_000067.2:c.120T>G	Osteopetrosis, autosomal recessive, type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CA2 gene located on chromosomal region 8q22. The age of onset is neonatal/infantile. This disease is characterized by osteopetrosis, renal tubular acidosis, and neurological disorders related to cerebral calcifications. The prevalence is <1:1.000.000.	600
CAPN3	Limb-girdle muscular dystrophy type 2A	NM_000070.2	NM_000070.2:c.1838delA, NM_000070.2:c.2120A>G, NM_000070.2:c.1795_1796insA, NM_000070.2:c.1469G>A, NM_000070.2:c.1599_1602delGAGC, NM_000070.2:c.1715G>A, NM_000070.2:c.1743_1745+1delTGAG, NM_000070.2:c.257C>T, NM_000070.2:c.328C>T, NM_000070.2:c.549delA, NM_000070.2:c.2212C>T, NM_000070.2:c.223dupT, NM_000070.2:c.2243G>A, NM_000070.2:c.2251_2254dupGTCA, NM_000070.2:c.2257G>A, NM_000070.2:c.2306G>A, NM_000070.2:c.2361_2363delAGinsTCATCT, NM_000070.2:c.2361_2364delAGinsTCATCT, NM_000070.2:c.2362_2363delAGinsTCATCT, NM_000070.2:c.246G>A, NM_000070.2:c.676G>A, NM_000070.2:c.551C>T, NM_000070.2:c.580delT, NM_000070.2:c.133G>A, NM_000070.2:c.550delA, NM_000070.2:c.1468C>T, NM_000070.2:c.956C>T, NM_000070.2:c.1322delG, NM_000070.2:c.1466G>A, NM_000070.2:c.662G>T, NM_000070.2:c.855_864dupGTTGATTGCA, NM_000070.2:c.1610A>G, NM_000070.2:c.598_612delTTCTGGAGTGCTCTG	Limb-girdle muscular dystrophy type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CAPN3 gene located on chromosomal region 15q15.1. The age of onset is variable. This disease is characterized by symmetrical and selective atrophy and weakness of proximal limb and girdle muscles. The prevalence is 1:100,000- 9:100,000.	250,600
CBS	Homocystinuria	NM_000071.2	NM_000071.2:c.1150A>G, NM_000071.2:c.1058C>T, NM_000071.2:c.1136G>A, NM_000071.2:c.341C>T, NM_000071.2:c.1006C>T, NM_000071.2:c.325T>C, NM_000071.2:c.1316G>A, NM_000071.2:c.374G>A, NM_000071.2:c.1265C>T, NM_000071.2:c.1280C>T, NM_000071.2:c.146C>T, NM_000071.2:c.1471C>T, NM_000071.2:c.1616T>C, NM_000071.2:c.162G>A, NM_000071.2:c.833T>C, NM_000071.2:c.904G>A, NM_000071.2:c.919G>A, NM_000071.2:c.393G>C, NM_000071.2:c.415G>A, NM_000071.2:c.430G>A, NM_000071.2:c.434C>T, NM_000071.2:c.502G>A, NM_000071.2:c.526G>T, NM_000071.2:c.572C>T, NM_000071.2:c.676G>A, NM_000071.2:c.689delT, NM_000071.2:c.797G>A, NM_000071.2:c.959T>C, NM_000071.2:c.969G>A, NM_000071.2:c.992C>A, NM_000071.2:c.1330G>A, NM_000071.2:c.1379C>T, NM_000071.2:c.1397C>T, NM_000071.2:c.304A>C	Homocystinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CBS gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by the multiple involvement of the eye, skeleton, central nervous system and vascular system. The prevalence is 1:200,000-1:335,000.	250,600
CC2D2A	Joubert syndrome type 9	NM_001080522.2	NM_001080522.2:c.4179delG, NM_001080522.2:c.3594+1G>A, NM_001080522.2:c.3289delG, NM_001080522.2:c.4582C>T, NM_001080522.2:c.4667A>T, NM_001080522.2:c.2848C>T, NM_001080522.2:c.3364C>T, NM_001080522.2:c.4333C>T, NM_001080522.2:c.4181delG	Joubert syndrome type 9 defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized neonatal hypotonia, developmental delay, intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia, primary position nystagmus and congenital hepatic fibrosis.	250,600
CC2D2A	Meckel syndrome type 6	NM_001080522.2	NM_001080522.2:c.3145C>T, NM_001080522.2:c.2486+1G>C	Meckel syndrome type 6 with hepatic defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized by a combination of renal cysts, developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and polydactyly.	250,600
CD2AP	Focal segmental glomerulosclerosis type 3	NM_012120.2	NM_012120.2:c.730-1delGinsCT, NM_012120.2:c.1575_1577delAGA, NM_012120.2:c.1488G>A	Focal segmental glomerulosclerosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CD2AP gene located on chromosomal region 6p12. The age of onset is variable. A renal pathology defined by the presence of segmental sclerosis in glomeruli and resulting in proteinuria, reduced glomerular filtration rate and progressive decline in renal function. Renal insufficiency often progresses to end-stage renal disease, a highly morbid state requiring either dialysis therapy or kidney transplantation.	600
CD40LG	Hyper IgM syndrome, X-linked	NM_000074.2	NM_000074.2:c.386A>G, NM_000074.2:c.368C>A, NM_000074.2:c.384T>A, NM_000074.2:c.632C>A, NM_000074.2:c.107T>G	X-linked hyper-IgM syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the CD40LG gene located on chromosomal region Xq26. The age of onset is neonatal/infantile. This disease is characterized by lower-respiratory tract bacterial infections, opportunistic infections, recurrent or protracted diarrhea associated with failure to thrive, neutropenia, thrombocytopenia and anemia. The prevalence is 2:1,000,000 male newborns.	600
CDH23	Deafness type 12, autosomal recessive	NM_022124.5	NM_022124.5:c.6442G>A, NM_022124.5:c.5663T>C, NM_022124.5:c.9565C>T, NM_022124.5:c.7823G>A, NM_022124.5:c.902G>A	Non-syndromic autosomal recessive deafness type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	250,600
CDH23	Usher syndrome type 1D	NM_022124.5	NM_022124.5:c.288+1G>A, NM_022124.5:c.193delC, NM_022124.5:c.6050-9G>A, NM_022124.5:c.3141C>A, NM_022124.5:c.146-2A>G, NM_022124.5:c.4504C>T, NM_022124.5:c.3516_3519delATCC, NM_022124.5:c.3579+2T>C, NM_022124.5:c.3293A>G, NM_022124.5:c.9319+1_9319+4delGTAA, NM_022124.5:c.5237G>A, NM_022124.5:c.1858+2T>G, NM_022124.5:c.6392delC, NM_022124.5:c.7660G>A	Usher syndrome type 1D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by sensorineural deafness, retinitis pigmentosa and progressive vision loss.	250,600
CDH3	Ectodermal dysplasia - ectrodactyly - macular dystrophy	NM_001793.4	NM_001793.4:c.455_456insC, NM_001793.4:c.981delG, NM_001793.4:c.1508G>A, NM_001793.4:c.965A>T, NM_001793.4:c.830delG, NM_001793.4:c.965A>G	Ectodermal dysplasia - ectrodactyly - macular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH3 gene located on chromosomal region 16q22.1. The age of onset is neonatal/infantile. This disease is characterized by the association of ectodermal dysplasia, ectrodactyly, and macular dystrophy. The prevalence is <1:1,000,000.	600
CDHR1	Retinitis pigmentosa type 65	NM_033100.3	NM_033100.3:c.1485+2T>C, NM_033100.3:c.1463delG, NM_033100.3:c.1110delC, NM_033100.3:c.338delG, NM_033100.3:c.524dupA, NM_033100.3:c.1485+2T>G, NM_033100.3:c.1112delC, NM_033100.3:c.640delG	Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 65 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDHR1 gene located on chromosomal region 10q23.1. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.	250,600
CDK5RAP2	Microcephaly, primary, type 3, autosomal recessive	NM_018249.5	NM_018249.5:c.4661_4662insTATT, NM_018249.5:c.246T>A, NM_018249.5:c.4546G>T, NM_018249.5:c.127+1G>C, NM_018249.5:c.4672C>T, NM_018249.5:c.524_528delAGGCA, NM_018249.5:c.700G>T	Primary autosomal recessive microcephaly type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDK5RAP2 gene located on chromosomal region 9q33.2. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.	600
CENPJ	Microcephaly primary, type 6, autosomal recessive	NM_018451.4	NM_018451.4:c.3243_3246delTCAG, NM_018451.4:c.2614delT, NM_018451.4:c.3415G>T, NM_018451.4:c.3653C>T, NM_018451.4:c.2462C>T, NM_018451.4:c.3699_3702dupAATA, NM_018451.4:c.3568_3571dupGTCA, NM_018451.4:c.3843_3844insTA, NM_018451.4:c.757_760delGTCT, NM_018451.4:c.1952_1953insAGTG, NM_018451.4:c.3704A>T, NM_018451.4:c.232_236delCAGAA, NM_018451.4:c.2460_2463delGACG, NM_018451.4:c.2968_2972delAAAAA, NM_018451.4:c.40C>T, NM_018451.4:c.289dupA	Primary autosomal recessive microcephaly type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CENPJ gene located on chromosomal region 13q12.12. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.	250,600
CEP152	Microcephaly, primary, type 9, autosomal recessive	NM_014985.3	NM_014985.3:c.794A>C, NM_014985.3:c.749_750delGA	Primary autosomal recessive microcephaly type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP152 gene located on chromosomal region 15q21.1. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.	600
CEP152	Seckel syndrome type 5	NM_014985.3	NM_014985.3:c.2034T>G, NM_014985.3:c.1578-1G>A	Seckel syndrome type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP152 gene located on chromosomal region 15q21.1. The age of onset is neonatal/infantile. This disease is characterized by proportionate dwarfism of prenatal onset associated with low birth weight, growth retardation, severe microcephaly with a bird-headed like appearance, and mental retardation.	600
CEP290	Joubert syndrome, Senior-Loken type	NM_025114.3	NM_025114.3:c.5611_5614delCAAA, NM_025114.3:c.164_167delCTCA	Joubert syndrome, Senior-Loken type syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infantile. This disease is characterized by symptoms of nephronophthisis such as polyuria, polydipsia, secondary eneuresis and anemia. The progression of the disease can lead to acute or chronic renal insufficiency and finally to end-stage kidney disease. Ocular features include congenital or early-onset severe visual loss, due to retinal dystrophy. In rare occasions, other additional clinical signs may be observed like liver fibrosis, obesity and neurologic disorders.. The prevalence is <1:1,000,000.	250,600
CEP290	Joubert syndrome type 5	NM_025114.3	NM_025114.3:c.4656delA, NM_025114.3:c.21G>T, NM_025114.3:c.5668G>T	Joubert syndrome with oculorenal defect 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infantile. This disease is characterized by neonatal hypotonia, developmental delay, intellectrual disability, ataxia, abnormal eye movements including oculomotor apraxia, primary position nystagmus and renal and ocular disease.	250,600
CEP290	Leber congenital amaurosis type 10	NM_025114.3	NM_025114.3:c.7341_7342insA, NM_025114.3:c.4705-1G>T, NM_025114.3:c.4723A>T, NM_025114.3:c.4962_4963delAA, NM_025114.3:c.4916C>A, NM_025114.3:c.6624delG, NM_025114.3:c.6645+1G>A, NM_025114.3:c.7324G>T, NM_025114.3:c.6798G>A, NM_025114.3:c.7394_7395delAG, NM_025114.3:c.1681C>T, NM_025114.3:c.7341delA, NM_025114.3:c.6448_6455delCAGTTGAA, NM_025114.3:c.1665_1666delAA, NM_025114.3:c.384_387delTAGA, NM_025114.3:c.2249T>G, NM_025114.3:c.3185delT, NM_025114.3:c.4393C>T, NM_025114.3:c.1501G>T	Leber congenital amaurosis type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infancy/neonatal. This disease is characterized by retinal dystrophy defined by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.	250,600
CEP290	Meckel syndrome type 4	NM_025114.3	NM_025114.3:c.613C>T	Meckel syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is neonatal. This disease is characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically occipital encephalocele), hepatic ductal dysplasia and cysts, and postaxial polydactyly. The prevalence is <1 / 1,000,000.	250,600
CERKL	Retinitis pigmentosa tipo 26	NM_201548.4	NM_201548.4:c.1012C>T, NM_201548.4:c.1090C>T, NM_201548.4:c.312delA, NM_201548.4:c.715C>T, NM_201548.4:c.769C>T, NM_201548.4:c.780delT, NM_201548.4:c.847C>T, NM_201548.4:c.1553_1569dupTTATCAGTCTTTATGGA	Retinitis pigmentosa 26 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CERKL gene located on chromosomal region 2q31.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	250,600
CFH	Complement factor H deficiency	NM_000186.3	NM_000186.3:c.3628C>T, NM_000186.3:c.2876G>A, NM_000186.3:c.380G>T, NM_000186.3:c.481G>T, NM_000186.3:c.1606T>C	Immunodeficiency with factor H anomaly follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFH gene located on chromosomal region 1q32. This disease is characterized by recurrent bacterial infections and renal failure.	250,600
CFTR	Cystic fibrosis	NM_000492.3	NM_000492.3:c.1327_1330dupGATA, NM_000492.3:c.1210-7_1210-6delTT, NM_000492.3:c.125C>T, NM_000492.3:c.1301_1307delCACTTCT, NM_000492.3:c.1397C>A, NM_000492.3:c.1340delA, NM_000492.3:c.1364C>A, NM_000492.3:c.1393-1G>A, NM_000492.3:c.1438G>T, NM_000492.3:c.1466C>A, NM_000492.3:c.1475C>T, NM_000492.3:c.1477C>T, NM_000492.3:c.1516A>G, NM_000492.3:c.1519_1521delATC, NM_000492.3:c.1521_1523delCTT, NM_000492.3:c.1545_1546delTA, NM_000492.3:c.1624G>T, NM_000492.3:c.1692delA, NM_000492.3:c.1706A>G, NM_000492.3:c.1721C>A, NM_000492.3:c.178G>T, NM_000492.3:c.1970delG, NM_000492.3:c.200C>T, NM_000492.3:c.2012delT, NM_000492.3:c.2051_2052delAAinsG, NM_000492.3:c.2052_2053insA, NM_000492.3:c.2052delA, NM_000492.3:c.1000C>T, NM_000492.3:c.1007T>A, NM_000492.3:c.1013C>T, NM_000492.3:c.1021T>C, NM_000492.3:c.1022_1023insTC, NM_000492.3:c.1040G>A, NM_000492.3:c.1040G>C, NM_000492.3:c.1055G>A, NM_000492.3:c.1081delT, NM_000492.3:c.115C>T, NM_000492.3:c.2538G>A, NM_000492.3:c.254G>A, NM_000492.3:c.2551C>T, NM_000492.3:c.2583delT, NM_000492.3:c.262_263delTT, NM_000492.3:c.2657+5G>A, NM_000492.3:c.2668C>T, NM_000492.3:c.273+1G>A, NM_000492.3:c.2737_2738insG, NM_000492.3:c.2739T>A, NM_000492.3:c.274-1G>A, NM_000492.3:c.274G>A, NM_000492.3:c.274G>T, NM_000492.3:c.2780T>C, NM_000492.3:c.2834C>T, NM_000492.3:c.2855T>C, NM_000492.3:c.2869_2870insG, NM_000492.3:c.2875delG, NM_000492.3:c.2908G>C, NM_000492.3:c.292C>T, NM_000492.3:c.2939T>A, NM_000492.3:c.2989-1G>A, NM_000492.3:c.3067_3072delATAGTG, NM_000492.3:c.3140-26A>G, NM_000492.3:c.3194T>C, NM_000492.3:c.3196C>T, NM_000492.3:c.3197G>A, NM_000492.3:c.3230T>C, NM_000492.3:c.325_327delTATinsG, NM_000492.3:c.3266G>A, NM_000492.3:c.3276C>A, NM_000492.3:c.3276C>G, NM_000492.3:c.328G>C, NM_000492.3:c.328G>T, NM_000492.3:c.3302T>A, NM_000492.3:c.3310G>T, NM_000492.3:c.349C>T, NM_000492.3:c.350G>T, NM_000492.3:c.3528delC, NM_000492.3:c.3533_3536delCAAC, NM_000492.3:c.3587C>G, NM_000492.3:c.358G>A, NM_000492.3:c.3611G>A, NM_000492.3:c.3612G>A, NM_000492.3:c.3659delC, NM_000492.3:c.366T>A, NM_000492.3:c.3731G>A, NM_000492.3:c.3744delA, NM_000492.3:c.3752G>A, NM_000492.3:c.3761T>G, NM_000492.3:c.3764C>A, NM_000492.3:c.3773_3774insT, NM_000492.3:c.3846G>A, NM_000492.3:c.3909C>G, NM_000492.3:c.3937C>T, NM_000492.3:c.4056G>T, NM_000492.3:c.4077_4080delinsAA, NM_000492.3:c.4077_4080delTGTTinsAA, NM_000492.3:c.4251delA, NM_000492.3:c.4333G>A, NM_000492.3:c.4426C>T, NM_000492.3:c.442delA, NM_000492.3:c.445G>A, NM_000492.3:c.445G>T, NM_000492.3:c.446G>T, NM_000492.3:c.531delT, NM_000492.3:c.532G>A, NM_000492.3:c.571T>G, NM_000492.3:c.577G>T, NM_000492.3:c.579+1G>T, NM_000492.3:c.579+3A>G, NM_000492.3:c.579+5G>A, NM_000492.3:c.592G>A, NM_000492.3:c.595C>T, NM_000492.3:c.613C>T, NM_000492.3:c.617T>G, NM_000492.3:c.650A>G, NM_000492.3:c.658C>T, NM_000492.3:c.708delT, NM_000492.3:c.722_743delGGAGAATGATGATGAAGTACAG, NM_000492.3:c.803delA, NM_000492.3:c.935_937delTCT, NM_000492.3:c.988G>T, NM_000492.3:c.1046C>T, NM_000492.3:c.14C>T, NM_000492.3:c.1558G>A, NM_000492.3:c.1585-1G>A, NM_000492.3:c.1684G>C, NM_000492.3:c.1766+1G>A, NM_000492.3:c.1397C>G, NM_000492.3:c.1399C>T, NM_000492.3:c.1400T>C, NM_000492.3:c.3380G>A, NM_000492.3:c.3409A>G, NM_000492.3:c.3868C>A, NM_000492.3:c.489+1G>T, NM_000492.3:c.2537G>A, NM_000492.3:c.2125C>T, NM_000492.3:c.2128A>T, NM_000492.3:c.2175_2176insA, NM_000492.3:c.2052dupA, NM_000492.3:c.2195T>G, NM_000492.3:c.2215delG, NM_000492.3:c.223C>T, NM_000492.3:c.2175dupA, NM_000492.3:c.221G>A, NM_000492.3:c.2930C>T, NM_000492.3:c.3205G>A, NM_000492.3:c.2249C>T	Cystic fibrosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFTR gene located on chromosomal region 7q31.2. The age of onset of severe form is neonatal or infantile but there are also variants associated with moderate clinical or late onset. This disease is characterized by the production of sweat with a high salt content, mucus secretions with an abnormal viscosity, chronic bronchitis, pancreatic insufficiency, adolescent diabetes and, more rarely, stercoral obstruction and cirrhosis. Male sterility is a constant feature. Late-onset forms, which are usually only mild or monosymptomatic. The prevalence is 1:10,000-9:10,000.	250,600
CHST6	Macular corneal dystrophy	NM_021615.4	NM_021615.4:c.820G>T, NM_021615.4:c.853delC, NM_021615.4:c.993G>T, NM_021615.4:c.327_328delCT, NM_021615.4:c.392C>A	Macular corneal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CHST6 gene located on chromosomal region 16q22. The age of onset is variable. This disease is characterized by bilateral ill-defined cloudy regions within a hazy stroma, and eventually severe visual impairment. The prevalence is 1:100,000-9:100,000.	250,600
CLCN1	Myotonia congenita, autosomal recessive	NM_000083.2	NM_000083.2:c.1453A>G, NM_000083.2:c.409T>G, NM_000083.2:c.568G>A, NM_000083.2:c.899G>A, NM_000083.2:c.1169G>A, NM_000083.2:c.1238T>G, NM_000083.2:c.871G>A, NM_000083.2:c.180+3A>T, NM_000083.2:c.225dupC, NM_000083.2:c.501C>G, NM_000083.2:c.2680C>T	Myotonia congenita (Becker disease) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN1 gene located on chromosomal region 7q35. The age of onset is neonatal/infantile. This disease is characterized by slow muscle relaxation, that it is relieved with exercise, associated with hyperexcitation of the muscle fibres. The prevalence is 1:100,000.	250,600
CLCN7	Osteopetrosis type 4, autosomal recessive	NM_001287.5	NM_001287.5:c.622C>T, NM_001287.5:c.781A>T	Osteopetrosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN7 gene located on chromosomal region 16p13. The age of onset is neonatal/infantile. This disease is characterized bone marrow failure, fractures and visual impairment. The incidence is 1:200,000 live births and the prevalence is 1:100,000.	600
CLDN14	Deafness type 29, autosomal recessive	NM_144492.2	NM_144492.2:c.254T>A, NM_144492.2:c.301G>A, NM_144492.2:c.398delT	Deafness type 29, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN14 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	600
CLDN19	Hypomagnesemia type 5, renal failure with severe ocular abnormalities	NM_148960.2	NM_148960.2:c.269T>C, NM_148960.2:c.425_437delCCCTGGTGACCCA, NM_148960.2:c.59G>A, NM_148960.2:c.169C>G, NM_148960.2:c.599G>A	Hypomagnesemia type 5, renal failure with severe ocular abnormalities follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN19 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by excessive magnesium and calcium renal wasting, bilateral nephrocalcinosis, progressive renal failure and severe ocular abnormalities. The prevalence is <1:1,000,000.	250,600
CLN3	Ceroid-lipofuscinoses neuronal type 3	NM_001042432.1	NM_001042432.1:c.883G>A, NM_001042432.1:c.597C>A, NM_001042432.1:c.622_623insT, NM_001042432.1:c.1272delG, NM_001042432.1:c.1210C>A	Juvenile neuronal ceroid lipofuscinosis 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN3 gene located on chromosomal region 16p12.1. The age of onset is infantile. This disease is characterized by onset at early school age with vision loss due to retinopathy, seizures and the decline of mental and motor capacities. The annual birth incidence is 1:217,000-1:450,000 in Sweden and 1:143,000 in Germany, and the prevalence is 1.5:1,000,000-9:1,000,000.	600
CLN5	Neuronal ceroid lipofuscinosis type 5	NM_006493.2	NM_006493.2:c.619T>C, NM_006493.2:c.335G>A, NM_006493.2:c.377G>A, NM_006493.2:c.620G>C, NM_006493.2:c.669dupC, NM_006493.2:c.335G>C, NM_006493.2:c.565C>T, NM_006493.2:c.575A>G, NM_006493.2:c.593T>C, NM_006493.2:c.595C>T, NM_006493.2:c.613C>T, NM_006493.2:c.919delA, NM_006493.2:c.924_925delAT, NM_006493.2:c.955_970delGGAAATGAAACATCTG, NM_006493.2:c.835G>A, NM_006493.2:c.526dupA, NM_006493.2:c.1026C>A, NM_006493.2:c.524T>G, NM_006493.2:c.433C>T	Neuronal ceroid lipofuscinosis type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN5 gene located on chromosomal region 3q21.1-q32. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy and vision loss through retinal degeneration. The prevalence is <1:1,000,000.	600
CLN6	Ceroid lipofuscinosis, neuronal, type 6	NM_017882.2	NM_017882.2:c.200T>C, NM_017882.2:c.214G>C, NM_017882.2:c.139C>T, NM_017882.2:c.307C>T, NM_017882.2:c.214G>T, NM_017882.2:c.663C>G	Late infantile neuronal ceroid lipofuscinosis 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN6 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy and vision loss through retinal degeneration. The prevalence is <1:1,000,000.	600
CLN8	Ceroid lipofuscinosis, neuronal, type 8	NM_018941.3	NM_018941.3:c.88delG, NM_018941.3:c.789G>C, NM_018941.3:c.610C>T, NM_018941.3:c.88G>C	Late infantile neuronal ceroid lipofuscinosis 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN8 gene located on chromosomal region 8p23.3. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy, and vision loss through retinal degeneration. The prevalence is <1:1,000,000.	600
CLRN1	Retinitis pigmentosa type 61	NM_174878.2	NM_174878.2:c.92C>T	Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 61 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1gene located on chromosomal region 3q25.1. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.	250,600
CLRN1	Usher syndrome type 3A	NM_174878.2	NM_174878.2:c.591_592insT, NM_174878.2:c.630_631insT, NM_174878.2:c.118T>G, NM_174878.2:c.433+1061A>T, NM_174878.2:c.189C>A, NM_174878.2:c.144T>G	Usher syndrome type 3A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1 gene located on chromosomal region 3q25.1. The age of onset is neonatal/infantile. This disease is characterized by the association of sensorineural deafness with retinitis pigmentosa and progressive vision loss. The prevalence is 1:1.000.000- 9/1.000.000.	250,600
CNGA1	Retinitis pigmentosa type 49	NM_000087.3	NM_000087.3:c.1747C>T, NM_000087.3:c.1540C>T, NM_000087.3:c.2071T>C, NM_000087.3:c.1927C>T, NM_000087.3:c.1271G>A, NM_000087.3:c.1001G>A, NM_000087.3:c.959C>T, NM_000087.3:c.97_98insA, NM_000087.3:c.449+2T>C, NM_000087.3:c.1972delA, NM_000087.3:c.238G>T, NM_000087.3:c.794G>A, NM_000087.3:c.238G>A	Retinitis pigmentosa 49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGA1 gene located on chromosomal region 4p12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	250,600
CNGB1	Retinitis pigmentosa tipo 45	NM_001297.4	NM_001297.4:c.3150delG, NM_001297.4:c.2762_2765delACGA, NM_001297.4:c.2957A>T, NM_001297.4:c.413-1G>A, NM_001297.4:c.218-2A>G, NM_001297.4:c.2492+2T>G, NM_001297.4:c.3462+1G>A, NM_001297.4:c.2653delG, NM_001297.4:c.3425delT, NM_001297.4:c.1122-2A>T, NM_001297.4:c.1958-1G>A, NM_001297.4:c.952C>T	Retinitis pigmentosa 45 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB1 gene located on chromosomal region 16q13. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000 to 5:10,000.	250,600
CNGB3	Achromatopsia type 3	NM_019098.4	NM_019098.4:c.2011G>T, NM_019098.4:c.1063C>T, NM_019098.4:c.1208G>A, NM_019098.4:c.1672G>T, NM_019098.4:c.819_826delCAGACTCC, NM_019098.4:c.1148delC, NM_019098.4:c.886_890delACTTC, NM_019098.4:c.2048_2049delCA, NM_019098.4:c.446_447insT, NM_019098.4:c.893_897delCAAAA, NM_019098.4:c.887_896delCTTCTACAAA	Achromatopsia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is neonatal/Infantile. This disease is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, and reduced or complete loss of color discrimination. Most individuals have complete form, with total lack of function in all three types of cones. Rarely, individuals have incomplete form, with similar, but generally less severe symptoms. The prevalence is 1/30,000-1/50,000.	250,600
CNGB3	Macular degeneration, juvenile	NM_019098.4	NM_019098.4:c.1405T>G	Juvenile macular degeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is infancy or adolescence. This disease is characterized by blurred or distorted central vision with dark areas. Normally, side vision is not affected, but the perception of color can vary during the later stages of the disease.	250,600
COL11A1	Stickler syndrome type 2	NM_001854.3	NM_001854.3:c.1750dupG, NM_001854.3:c.2350G>C, NM_001854.3:c.4606C>G, NM_001854.3:c.4642C>G, NM_001854.3:c.3709-1G>A	Stickler syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL11A1 gene located on chromosomal region 1p21. The age of onset is neonatal/infantile. Autosomal recessive Stickler syndrome is a rare type of Stickler syndrome manifesting with opthalmological (myopia, retinal detachment and cataracts), orofacial (micrognathia, midface hypoplasia and cleft palate) auditory (sensorineural hearing loss) and articular (epiphyseal dysplasia) symptoms.	600
COL17A1	Epidermolysis bullosa, junctional, non-Herlitz type	NM_000494.3	NM_000494.3:c.1898G>A, NM_000494.3:c.3827_3828insC, NM_000494.3:c.2228-3_2235delCAGGTCCTGCTinsTTG, NM_000494.3:c.1706delC, NM_000494.3:c.2336-2A>G, NM_000494.3:c.3897_3900delATCT, NM_000494.3:c.3908G>A, NM_000494.3:c.2336-1G>T, NM_000494.3:c.2965delA, NM_000494.3:c.3043C>T, NM_000494.3:c.3067C>T, NM_000494.3:c.3277+1G>A, NM_000494.3:c.3676C>T, NM_000494.3:c.4319_4320insC, NM_000494.3:c.433C>T, NM_000494.3:c.520_521delAG, NM_000494.3:c.4003_4004delGG, NM_000494.3:c.2551+1G>T, NM_000494.3:c.3800delC, NM_000494.3:c.2564T>G, NM_000494.3:c.2430_2431insCCGA, NM_000494.3:c.2383C>T, NM_000494.3:c.2944_2947+1delGAAGG	Epidermolysis bullosa, junctional, non-Herlitz type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL17A1 gene located on chromosomal region 10q24.3. The age of onset is neonatal/infantile. This disease is characterized by a generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.	250,600
COL18A1	Knobloch syndrome type 1	NM_030582.3	NM_030582.3:c.3367_3379delCCCCCAGGCCCAC, NM_030582.3:c.3493_3501delGGCCCCCCA, NM_030582.3:c.2797C>T, NM_030582.3:c.995_996insGACGTGAAAGAGGGG, NM_030582.3:c.3502_3511delGGCCCCCCAG, NM_030582.3:c.3618_3618+1delGG, NM_030582.3:c.994_995insGGACGTGAAAGAGGG, NM_030582.3:c.3517_3518delCC, NM_030582.3:c.1535_1536insGACGTGAAAGAGGGG, NM_030582.3:c.2589_2590delAG, NM_030582.3:c.4054_4055delCT, NM_030582.3:c.4463_4464insG	Knobloch syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL18A1 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by vitreoretinal and macular degeneration, and occipital encephalocele. The prevalence is <1:1,000,000.	250,600
COL1A2	Ehlers-Danlos syndrome, cardiac valvular type	NM_000089.3	NM_000089.3:c.3601G>T, NM_000089.3:c.1404+1G>A, NM_000089.3:c.559G>C, NM_000089.3:c.133-1G>A, NM_000089.3:c.1404+1G>C, NM_000089.3:c.240_247delGTATGATG, NM_000089.3:c.293_294insC	Ehlers-Danlos syndrome, cardiac valvular type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL1A2 gene located on chromosomal region 7q22.1. The age of onset is neonatal/infantile. This disease is characterized by joint hypermobility, skin hyperextensibility and cardiac valvular defects. The prevalence is 6/100,000 to 7/100,000.	600
COL2A1	Otospondylomegaepiphyseal dysplasia	NM_001844.4	NM_001844.4:c.1052delG, NM_001844.4:c.3106C>T	Otospondylomegaepiphyseal dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL2A1 gene located on chromosomal region 12q13.11. The age of onset is neonatal/infantile. This disease is characterized by sensorineural hearing loss, enlarged epiphyses, skeletal dysplasia with disproportionately short limbs, vertebral body anomalies and a characteristic facies. The prevalence is 1:7,500-1:9,000.	600
COL4A3	Alport syndrome, autosomal recessive	NM_000091.4	NM_000091.4:c.345delG, NM_000091.4:c.346C>A, NM_000091.4:c.898G>A, NM_000091.4:c.4421T>C, NM_000091.4:c.2110delC, NM_000091.4:c.343delG, NM_000091.4:c.4420_4424delCTTTT, NM_000091.4:c.5002_*6delAAAAGACACTGAAGCTAA, NM_000091.4:c.2083G>A, NM_000091.4:c.2954G>T, NM_000091.4:c.4484A>G, NM_000091.4:c.4571C>G, NM_000091.4:c.4441C>T	Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.	250,600
COL4A4	Alport syndrome, autosomal recessive	NM_000092.4	NM_000092.4:c.3713C>A, NM_000092.4:c.4129C>T, NM_000092.4:c.4923C>A, NM_000092.4:c.3601G>A, NM_000092.4:c.2312delG, NM_000092.4:c.71+1G>A	Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.	250,600
COL7A1	Epidermolysis bullosa dystrophica, Hallopeau-Siemens type	NM_000094.3	NM_000094.3:c.4039G>C, NM_000094.3:c.425A>G, NM_000094.3:c.336C>G, NM_000094.3:c.3809C>T, NM_000094.3:c.4119+1G>T, NM_000094.3:c.6205C>T, NM_000094.3:c.6527_6528insC, NM_000094.3:c.6573+1G>T, NM_000094.3:c.6187C>T, NM_000094.3:c.6752G>A, NM_000094.3:c.6859G>A, NM_000094.3:c.6946G>A, NM_000094.3:c.6670G>T, NM_000094.3:c.1907G>T, NM_000094.3:c.2471_2472insG, NM_000094.3:c.7440+4delC, NM_000094.3:c.7912G>T, NM_000094.3:c.7930-1G>C, NM_000094.3:c.7957G>A, NM_000094.3:c.8245G>A, NM_000094.3:c.8371C>T, NM_000094.3:c.8393T>A, NM_000094.3:c.8440C>T, NM_000094.3:c.8479C>T, NM_000094.3:c.8524_8527+10delGAAGGTGAGGACAG, NM_000094.3:c.887delG, NM_000094.3:c.933C>A, NM_000094.3:c.238G>T, NM_000094.3:c.3831+1G>T, NM_000094.3:c.4373C>T, NM_000094.3:c.6091G>A, NM_000094.3:c.4888C>T, NM_000094.3:c.5052+1G>A, NM_000094.3:c.5096C>T, NM_000094.3:c.4783G>C, NM_000094.3:c.5443G>C, NM_000094.3:c.5532+1G>A, NM_000094.3:c.5821-1G>A, NM_000094.3:c.5287C>T, NM_000094.3:c.706C>T, NM_000094.3:c.7345-1G>A, NM_000094.3:c.592G>A, NM_000094.3:c.7411C>T	Epidermolysis bullosa dystrophica, Hallopeau-Siemens type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL7A1 gene located on chromosomal region 3p21.1. The age of onset is neonatal/infantile. This disease is characterized by generalized cutaneous and mucosal blistering and scarring associated with severe deformities and major extracutaneous involvement. The prevalence is <1:1,000,000.	250,600
COL9A1	Stickler syndrome type 4	NM_001851.4	NM_001851.4:c.883C>T, NM_001851.4:c.706C>T	Stickler syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL9A1 gene located on chromosomal region 6q13. The age of onset is infantile. This disease is characterized by opthalmological (myopia, retinal detachment and cataracts), orofacial (micrognathia, midface hypoplasia and cleft palate) auditory (sensorineural hearing loss) and articular (epiphyseal dysplasia) symptoms. The prevalence is <1:1,000,000.	600
COL9A2	Stickler syndrome type 5	NM_001852.3	NM_001852.3:c.1918C>T, NM_001852.3:c.1097_1098insC, NM_001852.3:c.793-1G>C	Stickler syndrome type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL9A2 gene located on chromosomal region 1p33-p32. The age of onset is infantile. This disease is characterized by opthalmological (myopia, retinal detachment and cataracts), orofacial (micrognathia, midface hypoplasia and cleft palate) auditory (sensorineural hearing loss) and articular (epiphyseal dysplasia) symptoms. The prevalence is <1:1,000,000.	600
COQ2	Primary coenzyme Q10 deficiency type 1	NM_015697.7	NM_015697.7:c.683A>G, NM_015697.7:c.1197delT, NM_015697.7:c.590G>A, NM_015697.7:c.723delT, NM_015697.7:c.890A>G	Coenzyme Q10 deficiency, primary follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ2 gene located on chromosomal region 4q21.23. The age of onset is neonatal/infantile. The phenotypes include an encephalomyopathic form with seizures and ataxia; a multisystem infantile form with encephalopathy, cardiomyopathy and renal failure; a predominantly cerebellar form with ataxia and cerebellar atrophy; Leigh syndrome with growth retardation; and an isolated myopathic form.	250,600
CPS1	Carbamoylphosphate synthetase type 1 deficiency	NM_001875.4	NM_001875.4:c.1912C>T, NM_001875.4:c.697C>T, NM_001875.4:c.1631C>T, NM_001875.4:c.3556delA	Carbamoylphosphate synthetase deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPS1 gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by congenital hyperammonemia and defective citrulline synthesis. The prevalence is 1:800,000 newborn in Japan.	600
CPT1A	Carnitine palmitoyltransferase type 1A deficiency	NM_001876.3	NM_001876.3:c.1216C>T, NM_001876.3:c.1241C>T, NM_001876.3:c.1361A>G, NM_001876.3:c.222C>A, NM_001876.3:c.1079A>G, NM_001876.3:c.1436C>T, NM_001876.3:c.1493A>G, NM_001876.3:c.335_336delCC, NM_001876.3:c.1393G>T, NM_001876.3:c.281+1G>A, NM_001876.3:c.1538C>T, NM_001876.3:c.298C>T	Carnitine palmitoyl transferase 1A deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT1A gene located on chromosomal region 11q13.2. The age of onset is neonatal/infantile. This disease is characterized by recurrent attacks of fasting-induced hypoketotic hypoglycemia and risk of liver failure. The prevalence is 1.3:1,000 newborn.	600
CPT2	Carnitine palmitoyltransferase deficiency, type 2	NM_000098.2	NM_000098.2:c.1239_1240delGA, NM_000098.2:c.1369A>T, NM_000098.2:c.1237C>T, NM_000098.2:c.680C>T, NM_000098.2:c.1437C>G, NM_000098.2:c.149C>A, NM_000098.2:c.1784delC, NM_000098.2:c.886C>T, NM_000098.2:c.1763C>G, NM_000098.2:c.359A>G, NM_000098.2:c.370C>T, NM_000098.2:c.1883A>C, NM_000098.2:c.1891C>T, NM_000098.2:c.1148T>A, NM_000098.2:c.638A>G, NM_000098.2:c.725_726delAC, NM_000098.2:c.452G>A, NM_000098.2:c.338C>T, NM_000098.2:c.481C>T, NM_000098.2:c.464dupT, NM_000098.2:c.520G>A	Carnitine palmitoyl transferase type 2 deficiency, infantile form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT2 gene located on chromosomal region 1p32. The age of onset is neonatal/infantile. This disease is characterized by a severe fasting intolerance leading to metabolic derangements of hypoketotic hypoglycemia, resulting in coma and seizures, and hepatic encephalopathy leading to liver failure. The prevalence is <1:1,000,000.	250,600
CRB1	Leber congenital amaurosis type 8	NM_201253.2	NM_201253.2:c.3299T>G, NM_201253.2:c.3383delT, NM_201253.2:c.3419T>A, NM_201253.2:c.3094G>A, NM_201253.2:c.936T>G, NM_201253.2:c.493_501delGATGGAATT, NM_201253.2:c.3997G>T, NM_201253.2:c.498_506delAATTGATGG, NM_201253.2:c.2688T>A, NM_201253.2:c.613_619delATAGGAA, NM_201253.2:c.2401A>T, NM_201253.2:c.610_616delGAAATAG	Leber congenital amaurosis follows an autosomal recessive pattern of inheritance. Type 8 is caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. The age of onset is neonatal/infancy. This disease comprises a group of early-onset childhood retinal dystrophies characterized by vision loss, nystagmus, and severe retinal dysfunction. Patients usually present at birth with profound vision loss and pendular nystagmus. Electroretinogram responses are usually nonrecordable. Other clinical findings may include high hypermetropia, photodysphoria, oculodigital sign, keratoconus, cataracts, and a variable appearance to the fundus.	250,600
CRB1	Pigmented paravenous chorioretinal atrophy	NM_201253.2	NM_201253.2:c.484G>A	Pigmented paravenous chorioretinal atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRB1 gene located on chromosomal region 19p12. The age of onset is variable. This disease is characterized by an unusual retinal degeneration characterized by accumulation of pigmentation along retinal veins.	250,600
CRB1	Retinitis pigmentosa type 12	NM_201253.2	NM_201253.2:c.3053_3054insTTATA, NM_201253.2:c.3122T>C, NM_201253.2:c.2416G>T, NM_201253.2:c.2843G>A, NM_201253.2:c.3299T>C, NM_201253.2:c.2983G>T, NM_201253.2:c.2290C>T	Retinitis pigmentosa 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.	250,600
CRLF1	Cold-induced sweating syndrome	NM_004750.4	NM_004750.4:c.538C>T, NM_004750.4:c.303delC, NM_004750.4:c.413C>T, NM_004750.4:c.527+5G>A, NM_004750.4:c.226T>G, NM_004750.4:c.829C>T, NM_004750.4:c.397+1G>A, NM_004750.4:c.708_709delCCinsT, NM_004750.4:c.713_714insC, NM_004750.4:c.1125delG, NM_004750.4:c.676dupA, NM_004750.4:c.856-1G>A, NM_004750.4:c.852G>T, NM_004750.4:c.935G>A, NM_004750.4:c.1137C>G, NM_004750.4:c.845_846delTG	Cold-induced sweating syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRLF1 gene located on chromosomal region 19p12. The age of onset is infantile. This disease is characterized by profuse sweating (involving the chest, face, arms and trunk) induced by cold ambient temperature kyphoscoliosis, a high-arched palate, depressed nasal bridge and impaired peripheral sensitivity to pain and temperature. The prevalence is <1:1,000,000.	600
CRTAP	Osteogenesis imperfecta type 7	NM_006371.4	NM_006371.4:c.826C>T, NM_006371.4:c.180G>A, NM_006371.4:c.561T>G, NM_006371.4:c.634C>T	Osteogenesis imperfecta type VII follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRTAP gene located on chromosomal region 3p22.3. The age of onset is variable. This disease is characterized by increased bone fragility, low bone mass, and susceptibility to bone fractures with variable severity. The prevalence is 6:100,000-7:100,000.	600
CRX	Leber congenital amaurosis type 7	NM_000554.4	NM_000554.4:c.425A>G, NM_000554.4:c.196G>A, NM_000554.4:c.898T>C	Leber congenital amaurosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRX gene located on chromosomal region 19q13.3. The age of onset is neonatal/infantile. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. The prevalence is 2:100,000-3:100,000 newborn.	250,600
CSTB	Progressive myoclonic epilepsy type 1A	NM_000100.3	NM_000100.3:c.212A>C, NM_000100.3:c.202C>T	Progressive myoclonic epilepsy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CSTB gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by severe, stimulus-sensitive myoclonus and tonic-clonic seizures. The onset, occurring between 6 and 13 years of age, is characterized by convulsions. Myoclonus begins 1 to 5 years later. The twitchings occur predominantly in the proximal muscles of the extremities and are bilaterally symmetrical, although asynchronous. At first small, they become late in the clinical course so violent that the victim is thrown to the floor. Mental deterioration and eventually dementia develop. The prevalence is 1:20,000 newborn.	600
CTNS	Cystinosis, ocular nonnephropathic	NM_004937.2	NM_004937.2:c.589G>A, NM_004937.2:c.853-3C>G	Ocular non nephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. It presents typical ocular findings of nephropathic cystinosis. However, systemic manifestations are absent and kidney disease does not occur. The prevalence is 1:100,000-1:200,000.	250,600
CTNS	Nephropathic cystinosis	NM_004937.2	NM_004937.2:c.416C>T, NM_004937.2:c.414G>A, NM_004937.2:c.124G>A, NM_004937.2:c.357_360delCAGC, NM_004937.2:c.397_398delAT, NM_004937.2:c.1015G>A, NM_004937.2:c.646dupA, NM_004937.2:c.283G>T, NM_004937.2:c.329G>T, NM_004937.2:c.506G>A	Nephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. This disease is characterized by hypothyroidism, insulin-dependent diabetes, hepatosplenomegaly with portal hypertension, and muscle, cerebral and ocular involvement, caused by cystine deposits in various organs. The prevalence is 1:100,000-1:200,000.	250,600
CTSD	Ceroid lipofuscinosis, neuronal, type 10	NM_001909.4	NM_001909.4:c.685T>A, NM_001909.4:c.1149G>C	Neuronal ceroid lipofuscinosis type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSD gene located on chromosomal region 11p15.5. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 2:100,000-4:100,000 newborn.	600
CTSK	Pycnodysostosis	NM_000396.3	NM_000396.3:c.236G>A, NM_000396.3:c.154A>T, NM_000396.3:c.436G>C, NM_000396.3:c.926T>C, NM_000396.3:c.721C>T	Pycnodysostosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSK gene located on chromosomal region 1q21. The age of onset is variable. This disease is characterized by osteosclerosis, short stature or dwarfism, acroosteolysis of the distal phalanges, fragile bones associated with spontaneous fractures and dysplasia of the clavicles. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
CYP21A2	Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency	-	hybrid 5'CYP21A1P/3'CYP21A2, hybrid 5'CYP21A2/3'CYP21A1P (Detection by MLPA)	Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP21A2 gene located on chromosomal region 6p21.3. The age of onset is neonatal/infantile. This disease is characterized by simple virilizing or salt wasting forms that can manifest with genital ambiguity in females, and in both sexes with adrenal insufficiency with dehydration during the neonatal period, life threatening hypoglycemia and hyperandrogenia. The prevalence is 1/100,000 to 9/100,000.	600
CYP21A2	Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency	NM_000500.7	NM_000500.7:c.518T>A, NM_000500.7:c.955C>T, NM_000500.7:c.1069C>T, NM_000500.7:c.719T>A, NM_000500.7:c.[713T>A;719T>A], NM_000500.7:c.293-13A/C>G, NM_000500.7:c.332_339del, NM_000500.7:c.[710T>A;719T>A], NM_000500.7:c.923_924insT, NM_000500.7:c.[710T>A;713T>A], NM_000500.7:c.713T>A, NM_000500.7:c.[710T>A;713T>A;719T>A], NM_000500.7:c.710T>A (Detection by minisequencing)	Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP21A2 gene located on chromosomal region 6p21.3. The age of onset is neonatal/infantile. This disease is characterized by simple virilizing or salt wasting forms that can manifest with genital ambiguity in females, and in both sexes with adrenal insufficiency with dehydration during the neonatal period, life threatening hypoglycemia and hyperandrogenia. The prevalence is 1/100,000 to 9/100,000.	600
CYP21A2	Non-classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency	NM_000500.7	NM_000500.7:c.92C>T, NM_000500.7:c.844G>T, NM_000500.7:c.1360C>T (Detection by minisequencing)	Nonclassic congenital adrenal hyperplasia due to 21-hydroxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP21A2 gene located on chromosomal region 6p21.3. This is a common milder form of congenital adrenal hyperplasia characterized by a later onset of androgen excess symptoms seen in females and precocious pseudopuberty in both sexes. Cortisol and aldosterone levels are normal but there is an increased amount of androgens. Disease onset occurs in adolescence with variable degrees of postnatal androgen excess (precocious pubarche, hirsutism, acne, alopecia, anovulation and menstrual irregularies and in the post-pubertal period it can mimic polycystic ovary syndrome. It is also sometimes asymptomatic. The prevalence ranges from 1/1,000-1/500 in the general Caucasian population, but up to 1-2% among inbred populations, such as Eastern European (Ashkenazi) Jews.	600
CYP4V2	Bietti crystalline corneoretinal dystrophy	NM_207352.3	NM_207352.3:c.1523G>A, NM_207352.3:c.130T>A, NM_207352.3:c.327+1G>A, NM_207352.3:c.332T>C	Bietti crystalline corneoretinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP4V2 gene located on chromosomal region 4q35.2. The age of onset is adult. This disease is characterized by nightblindness, decreased vision, paracentral scotoma, and, in the end stages of the disease, legal blindness.	250,600
CYP7B1	Congenital bile acid synthesis defect type 3	NM_004820.3	NM_004820.3:c.1162C>T	Congenital bile acid synthesis defect type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by severe neonatal cholestatic liver disease. The prevalence is below 1,000,000.	250,600
CYP7B1	Spastic paraplegia type 5A, autosomal recessive	NM_004820.3	NM_004820.3:c.1460_1461insT, NM_004820.3:c.321_324delACAA, NM_004820.3:c.825T>A, NM_004820.3:c.889A>G, NM_004820.3:c.1456C>T, NM_004820.3:c.187C>T	Autosomal recessive spastic paraplegia type 5A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. The prevalence is below 1,000,000.	250,600
D2HGDH	D-2-Hydroxyglutaric aciduria	NM_152783.4	NM_152783.4:c.1315A>G, NM_152783.4:c.1276G>A, NM_152783.4:c.440T>G, NM_152783.4:c.1333_1334delAC, NM_152783.4:c.1123G>T, NM_152783.4:c.1331T>C	D-2-Hydroxyglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the D2HGDH gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by extremely variable clinical manifestations, with severe cases characterized by neonatal or early infantile-onset epileptic encephalopathy, and marked hypotonia, and cerebral visual failure, developmental delay, seizures, involuntary movements, and cardiomyopathy are also common in these cases. The prevalence is below 1,000,000.	250,600
DBT	Maple syrup urine disease type 2	NM_001918.3	NM_001918.3:c.670G>T, NM_001918.3:c.827T>G, NM_001918.3:c.294C>G, NM_001918.3:c.581C>G, NM_001918.3:c.772+1G>A, NM_001918.3:c.272_275delCAGT, NM_001918.3:c.1281+1G>A, NM_001918.3:c.871C>T, NM_001918.3:c.901C>T, NM_001918.3:c.939G>C, NM_001918.3:c.126T>G	Maple syrup urine disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DBT gene located on chromosomal region 1p31. The age of onset is neonatal/infantile. This disease is characterized by a maple syrup odor in the cerumen at birth, poor feeding, lethargy and focal dystonia, followed by progressive encephalopathy and central respiratory failure if untreated. The prevalence is 1/10,000 to 5/10,000.	250,600
DCLRE1C	Omenn syndrome	NM_001033855.2	NM_001033855.2:c.2T>C	Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency.	250,600
DCLRE1C	Severe combined immunodeficiency due to DCLRE1C deficiency	NM_001033855.2	NM_001033855.2:c.1558_1559insA, NM_001033855.2:c.597C>A, NM_001033855.2:c.780+1delG, NM_001033855.2:c.1639G>T, NM_001033855.2:c.1903_1904insA, NM_001033855.2:c.457G>A, NM_001033855.2:c.1559_1560insA	Severe combined immunodeficiency due to DCLRE1C deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DCLRE1C gene located on chromosomal region 10p13. The age of onset is neonatal/infantile. This disease is characterized by severe and recurrent infections, diarrhea, failure to thrive, and cell sensitivity to ionizing radiation. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
DDB2	Xeroderma pigmentosum complementation group E	NM_000107.2	NM_000107.2:c.730A>G, NM_000107.2:c.937C>T, NM_000107.2:c.818G>A, NM_000107.2:c.919G>T	Xeroderma pigmentosum complementation group E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DDB2 gene located on chromosomal region 11p12-p11. The age of onset is variable. This disease is characterized by mild xeroderma pigmentosum symptoms and no neurological abnormalities. The prevalence is 1/1,000,000.	600
DDC	Aromatic L-amino acid decarboxylase deficiency	NM_000790.3	NM_000790.3:c.100delG, NM_000790.3:c.1040G>A, NM_000790.3:c.823G>A, NM_000790.3:c.304G>A, NM_000790.3:c.272C>T, NM_000790.3:c.749C>T	Aromatic L-amino acid decarboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DDC gene located on chromosomal region 7p12.2. The age of onset is neonatal/infantile. This disease is characterized by severe developmental delay, weak muscle tone (hypotonia), muscle stiffness, difficulty moving, and involuntary writhing movements of the limbs (athetosis). The prevalence is below 1,000,000.	600
DFNB31	Deafness type 31, autosomal recessive	NM_015404.3	NM_015404.3:c.1135C>T, NM_015404.3:c.817C>T	Deafness, autosomal recessive type 31 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DFNB31 gene located on chromosomal region 9q32. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	250,600
DFNB59	Deafness type 59, autosomal recessive	NM_001042702.3	NM_001042702.3:c.122delA, NM_001042702.3:c.420delT, NM_001042702.3:c.113dupT, NM_001042702.3:c.988delG, NM_001042702.3:c.726delT, NM_001042702.3:c.161C>T, NM_001042702.3:c.817_818insT	Autosomal recessive nonsyndromic sensorineural deafness type DFNB59 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DFNB59 gene located on chromosomal region 2q31.2. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	600
DGUOK	Mitochondrial DNA depletion syndrome type 3	NM_080916.2	NM_080916.2:c.137A>G, NM_080916.2:c.707+2T>G, NM_080916.2:c.763G>T, NM_080916.2:c.425G>A, NM_080916.2:c.313C>T, NM_080916.2:c.494A>T	Mitochondrial DNA depletion syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DGUOK gene located on chromosomal region 2p13. The age of onset is neonatal/infantile. This disease is characterized by progressive liver failure, hypoglycemia and neurologic abnormalities including hypotonia, encephalopathy and peripheral neuropathy	250,600
DHCR7	Smith-Lemli-Opitz syndrome	NM_001360.2	NM_001360.2:c.1055G>A, NM_001360.2:c.1210C>T, NM_001360.2:c.1054C>T, NM_001360.2:c.461C>G, NM_001360.2:c.151C>T, NM_001360.2:c.1031G>A, NM_001360.2:c.453G>A, NM_001360.2:c.506C>T, NM_001360.2:c.356A>T, NM_001360.2:c.1228G>A, NM_001360.2:c.1A>G, NM_001360.2:c.976G>T, NM_001360.2:c.964-1G>C, NM_001360.2:c.682C>T, NM_001360.2:c.452G>A, NM_001360.2:c.1337G>A, NM_001360.2:c.1342G>A, NM_001360.2:c.730G>A, NM_001360.2:c.292C>T, NM_001360.2:c.904T>C, NM_001360.2:c.907G>A, NM_001360.2:c.841G>A, NM_001360.2:c.744G>T, NM_001360.2:c.724C>T, NM_001360.2:c.725G>A, NM_001360.2:c.866C>T, NM_001360.2:c.278C>T, NM_001360.2:c.839A>G, NM_001360.2:c.832-1G>C	Smith-Lemli-Opitz syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHCR7 gene located on chromosomal region 11q13.4. The age of onset is neonatal/infantile. This disease is characterized by multiple congenital anomalies, intellectual deficit, and behavioral problems. The prevalence is 1/20,000 to 1/40,000 newborn.	250,600
DHDDS	Retinitis pigmentosa type 59	NM_024887.3	NM_024887.3:c.328delA, NM_024887.3:c.998C>G, NM_024887.3:c.124A>G	Retinitis pigmentosa type 59 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHDDS gene located on chromosomal region 1p36.11. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000.	600
DKC1	Dyskeratosis congenita, X-linked	NM_001363.4	NM_001363.4:c.91C>A, NM_001363.4:c.214_215delCTinsTA, NM_001363.4:c.194G>C, NM_001363.4:c.838A>C, NM_001363.4:c.91C>G, NM_001363.4:c.196A>G	Dyskeratosis congenital, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DKC1 gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by the mucocutaneous triad of abnormal skin pigmentation, nail dystrophy and mucosal leucoplakia. The prevalence is 1-9/1,000,000.	600
DKC1	Hoyeraal-Hreidarsson syndrome	NM_001363.4	NM_001363.4:c.200C>T, NM_001363.4:c.204C>A	Hoyeraal-Hreidarsson syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DKC1 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by intrauterine growth retardation, microcephaly, cerebellar hypoplasia, progressive combined immune deficiency and aplastic anemia. The prevalence is below 1/1,000,000.	600
DLD	Dihydrolipoamide dehydrogenase deficiency E3	NM_000108.4	NM_000108.4:c.916_926delTGTGATGTACT, NM_000108.4:c.105_106insA, NM_000108.4:c.1483A>G	Dihydrolipoamide dehydrogenase deficiency E3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DLD gene located on chromosomal region 7q31-q32. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting and a maple syrup odor in the cerumen (and later in urine) noted soon after birth, followed by progressive encephalopathy and central respiratory failure if untreated. The prevalence is 1/1,000,000 to 9/1,000,000.	600
DLL3	Spondylocostal dysostosis type 1	NM_016941.3	NM_016941.3:c.231C>A, NM_016941.3:c.712C>T	Spondylocostal dysostosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DLL3 gene located on chromosomal region 19q13. The age of onset is neonatal/infantile. This disease is associated with vertebral and rib segmentation defects and characterised by a short neck with limited mobility, winged scapulae, a short trunk, and short stature with multiple vertebral anomalies at all levels of the spine. The prevalence is below 1/1,000,000.	600
DMD	Becker muscular dystrophy	NM_004006.2	NM_004006.2:c.3432+3A>G, NM_004006.2:c.3432+1G>A, NM_004006.2:c.137A>T	Becker muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/18,000 to 1/31,000 male newborns and the prevalence is 1/10,000 to 5/10,000.	600
DMD	Becker muscular dystrophy	-	insBecker, delBecker (Detection by MLPA)	Becker muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/18,000 to 1/31,000 male newborns and the prevalence is 1/10,000 to 5/10,000.	600
DMD	Dilated cardiomyopathy type 3B	NM_004006.2	NM_004006.2:c.5922+3G>C	Dilated cardiomyopathy type 3B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is variable. This disease is characterized by ventricular dilatation and impaired systolic function. Patients with DCM suffer from heart failure, arrhythmia, and are at risk of premature death. The incidence is 1/3,300 male newborns and the prevalence is 1/16,000 to 1/125,000.	600
DMD	Duchenne muscular dystrophy	NM_004006.2	NM_004006.2:c.1261C>T, NM_004006.2:c.1286C>A, NM_004006.2:c.1070delC, NM_004006.2:c.10086+1G>A, NM_004006.2:c.1886C>A, NM_004006.2:c.1900A>T, NM_004006.2:c.10774delA, NM_004006.2:c.204dupC, NM_004006.2:c.1900_1903dupAAGT, NM_004006.2:c.10141C>T, NM_004006.2:c.10033C>T, NM_004006.2:c.10453_10454delCT, NM_004006.2:c.1012G>T, NM_004006.2:c.1048G>T, NM_004006.2:c.2302C>T, NM_004006.2:c.1734delA, NM_004006.2:c.2380+1G>C, NM_004006.2:c.2380+2T>C, NM_004006.2:c.2479delG, NM_004006.2:c.2482T>G, NM_004006.2:c.2484T>G, NM_004006.2:c.251delT, NM_004006.2:c.2523delA, NM_004006.2:c.10446_10447delCT, NM_004006.2:c.2650C>T, NM_004006.2:c.10454delT, NM_004006.2:c.2294_2297delCCAT, NM_004006.2:c.2803+1G>A, NM_004006.2:c.2803+1G>T, NM_004006.2:c.2804-1G>A, NM_004006.2:c.2804-2A>T, NM_004006.2:c.2815_2816delTT, NM_004006.2:c.1306dupG, NM_004006.2:c.1332-9A>G, NM_004006.2:c.133C>T, NM_004006.2:c.1341_1342dupAG, NM_004006.2:c.2547delT, NM_004006.2:c.1371delG, NM_004006.2:c.2755A>T, NM_004006.2:c.2758C>T, NM_004006.2:c.1529_1530delTC, NM_004006.2:c.160_162delCTC, NM_004006.2:c.3295C>T, NM_004006.2:c.6182delC, NM_004006.2:c.6226G>T, NM_004006.2:c.3639dupA, NM_004006.2:c.199G>T, NM_004006.2:c.3747delG, NM_004006.2:c.2125delC, NM_004006.2:c.137_138dupAT, NM_004006.2:c.4117C>T, NM_004006.2:c.412_413delAA, NM_004006.2:c.2281_2285delGAAAA, NM_004006.2:c.4375C>T, NM_004006.2:c.4405C>T, NM_004006.2:c.2332C>T, NM_004006.2:c.4471_4472delAA, NM_004006.2:c.4486delG, NM_004006.2:c.4500delA, NM_004006.2:c.4518+5G>A, NM_004006.2:c.4735G>T, NM_004006.2:c.4806A>T, NM_004006.2:c.4843A>T, NM_004006.2:c.489G>A, NM_004006.2:c.5287C>T, NM_004006.2:c.530+1delG, NM_004006.2:c.5313dupT, NM_004006.2:c.5353C>T, NM_004006.2:c.5363C>G, NM_004006.2:c.5530C>T, NM_004006.2:c.5554C>T, NM_004006.2:c.5570_5571dupAA, NM_004006.2:c.5640T>A, NM_004006.2:c.5671A>T, NM_004006.2:c.5697delA, NM_004006.2:c.5773G>T, NM_004006.2:c.5807T>A, NM_004006.2:c.583C>T, NM_004006.2:c.8944C>T, NM_004006.2:c.1489C>T, NM_004006.2:c.6000T>A, NM_004006.2:c.6014_6017delCTCA, NM_004006.2:c.615T>A, NM_004006.2:c.9346C>T, NM_004006.2:c.9361+1G>A, NM_004006.2:c.6238delC, NM_004006.2:c.3697delC, NM_004006.2:c.6292C>T, NM_004006.2:c.3779_3785delCTTTGGAinsGG, NM_004006.2:c.4071G>C, NM_004006.2:c.6391_6392delCA, NM_004006.2:c.6392_6393insCA, NM_004006.2:c.433C>T, NM_004006.2:c.676_678delAAG, NM_004006.2:c.6834delT, NM_004006.2:c.4409_4412dupGTCT, NM_004006.2:c.6936delA, NM_004006.2:c.6943G>T, NM_004006.2:c.6964delG, NM_004006.2:c.6982A>T, NM_004006.2:c.6986dupA, NM_004006.2:c.7682G>A, NM_004006.2:c.7683G>A, NM_004006.2:c.7764dupT, NM_004006.2:c.7771G>T, NM_004006.2:c.7894C>T, NM_004006.2:c.7922delA, NM_004006.2:c.8064_8065delTA, NM_004006.2:c.8069T>G, NM_004006.2:c.8086delC, NM_004006.2:c.8358G>A, NM_004006.2:c.8374_8375delAA, NM_004006.2:c.8443C>T, NM_004006.2:c.8464C>T, NM_004006.2:c.8608C>T, NM_004006.2:c.8652_8653delCT, NM_004006.2:c.8656C>T, NM_004006.2:c.8668G>A, NM_004006.2:c.8713C>T, NM_004006.2:c.3121C>T, NM_004006.2:c.9164-1G>C, NM_004006.2:c.9164-1G>T, NM_004006.2:c.9337C>T, NM_004006.2:c.6906G>A, NM_004006.2:c.9361+1G>C, NM_004006.2:c.9380C>G, NM_004006.2:c.9564-1G>A, NM_004006.2:c.9568C>T, NM_004006.2:c.9612_9613ins341, NM_004006.2:c.9650-2A>G, NM_004006.2:c.9767dupG, NM_004006.2:c.9851G>A, NM_004006.2:c.9854_9863delTGAGACTGGA, NM_004006.2:c.9862G>T, NM_004006.2:c.3276+1G>A, NM_004006.2:c.2866C>T, NM_004006.2:c.2929dupC, NM_004006.2:c.3022A>T, NM_004006.2:c.2816T>A, NM_004006.2:c.3087G>A, NM_004006.2:c.5899C>T, NM_004006.2:c.3124A>T, NM_004006.2:c.3076G>T, NM_004006.2:c.6373C>T, NM_004006.2:c.627delA, NM_004006.2:c.2137C>T, NM_004006.2:c.3246_3247insTTTCTAAAAA, NM_004006.2:c.220delC, NM_004006.2:c.2169-3_2169-1delinsAA, NM_004006.2:c.6340A>T, NM_004006.2:c.6763-2A>G	Duchenne muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/3,300 male newborns and the prevalence is 1/16,000 to 1/125,000.	600
DMD	Duchenne muscular dystrophy	-	insDuchenne, delDuchenne (Detection by MLPA)	Duchenne muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/3,300 male newborns and the prevalence is 1/16,000 to 1/125,000.	600
DMP1	Hypophosphatemic rickets type 1, autosomal recessive	NM_004407.3	NM_004407.3:c.1A>G, NM_004407.3:c.55-1G>C, NM_004407.3:c.31delT, NM_004407.3:c.362delC	Hypophosphatemic rickets type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DMP1 gene located on chromosomal region 4q21. The age of onset is variable. This disease is associated with vertebral and rib segmentation defects and characterised by hypophosphatemia, rickets and/or osteomalacia and slow growth. The prevalence is below 1/20,000 newborns.	600
DNAJC19	Dilated cardiomyopathy with ataxia	NM_145261.3	NM_145261.3:c.300delA	Dilated cardiomyopathy with ataxia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DNAJC19 gene located on chromosomal region 3q26.33. The age of onset is infantile. This disease is characterised by severe early onset (before the age of three years) dilated cardiomyopathy with conduction defects (long QT syndrome), non-progressive cerebellar ataxia, testicular dysgenesis, and 3-methylglutaconic aciduria.	600
DPAGT1	Congenital disorder of glycosylation type 1j	NM_001382.3	NM_001382.3:c.791T>G, NM_001382.3:c.358C>A, NM_001382.3:c.643+1G>A, NM_001382.3:c.902G>A, NM_001382.3:c.349G>A, NM_001382.3:c.980_981delCT	Congenital disorder of glycosylation type 1j follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPAGT1 gene located on chromosomal region 11q23.3. The age of onset is neonatal/infantile. This disease is characterised by severe psychomotor delay, seizures, hypotonia and dysmorphism (microcephaly, ocular exotropia, micrognathia and clinodactyly). The prevalence is below 1,000,000.	600
DPM1	Congenital disorders of glycosylation type 1e	NM_003859.1	NM_003859.1:c.564-1G>A, NM_003859.1:c.628delC, NM_003859.1:c.274C>G, NM_003859.1:c.679-1G>T, NM_003859.1:c.742T>C	Congenital disorder of glycosylation type 1e follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPM1 gene located on chromosomal region 20q13.13. The age of onset is neonatal/infantile. This disease is characterised by psychomotor delay, seizures, hypotonia, facial dysmorphism and microcephaly. The prevalence is below 1,000,000.	600
DPYD	Dihydropyrimidine dehydrogenase deficiency	NM_000110.3	NM_000110.3:c.775A>G, NM_000110.3:c.1679T>G, NM_000110.3:c.299_302delTCAT, NM_000110.3:c.703C>T, NM_000110.3:c.1109_1110delTA, NM_000110.3:c.1905+1G>A, NM_000110.3:c.257C>T	Dihydropyrimidine dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPYD gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterised by mental and motor retardation and convulsions.	250,600
DSP	Cardiomyopathy, arrhythmogenic	NM_004415.2	NM_004415.2:c.7000C>T, NM_004415.2:c.88G>A, NM_004415.2:c.6370_6371delCT, NM_004415.2:c.7180_7181delAG, NM_004415.2:c.643G>A, NM_004415.2:c.3098delA, NM_004415.2:c.8188C>T	Cardiomyopathy, arrhythmogenic follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is a heart condition in which the heart muscle fibers are gradually replaced by fibrous or fibro-fatty tissue, causing abnormal heart electrical rhythms and heart failure. Consequently pumping blood to the body is weakened and sometimes leads to sudden cardiac death. The prevalence is below 1,000,000.	250,600
DSP	Cardiomyopathy, dilated, with woolly hair and keratoderma	NM_004415.2	NM_004415.2:c.5513G>A	Cardiomyopathy, dilated, with woolly hair and keratoderma follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterized by a generalized striate keratoderma particularly affecting the palmoplantar epidermis, woolly hair, and dilated left ventricular cardiomyopathy. The prevalence is below 1,000,000.	250,600
DSP	Lethal acantholytic epidermolysis bullosa	NM_004415.2	NM_004415.2:c.5800C>T	Lethal acantholytic epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterised by generalized oozing erosions, usually in the absence of blisters. The prevalence is below 1,000,000.	250,600
DYSF	Dysferlinopathy	NM_003494.3	NM_003494.3:c.1398-2A>G, NM_003494.3:c.1392dupA, NM_003494.3:c.1398-1G>A, NM_003494.3:c.5266C>T, NM_003494.3:c.1620delA, NM_003494.3:c.1481-1G>A, NM_003494.3:c.3041A>G, NM_003494.3:c.3985C>G, NM_003494.3:c.4090C>T, NM_003494.3:c.5713C>T, NM_003494.3:c.1053+1G>A, NM_003494.3:c.200_201delTGinsAT, NM_003494.3:c.2869C>T, NM_003494.3:c.2870_2874delAGACC, NM_003494.3:c.458-390C>T, NM_003494.3:c.757C>T, NM_003494.3:c.3065G>A, NM_003494.3:c.393_394delCC, NM_003494.3:c.3859A>T, NM_003494.3:c.5429G>A, NM_003494.3:c.3130C>T, NM_003494.3:c.3444_3445delTGinsAA, NM_003494.3:c.1638+2T>A, NM_003494.3:c.4108_4109delGT, NM_003494.3:c.3641delC, NM_003494.3:c.1368C>A, NM_003494.3:c.4872_4876delGCCCGinsCCCC, NM_003494.3:c.5341-2A>C, NM_003494.3:c.509C>A, NM_003494.3:c.5836_5839delCAGC, NM_003494.3:c.5644C>T, NM_003494.3:c.1861G>C, NM_003494.3:c.5429+1G>T, NM_003494.3:c.3957delC, NM_003494.3:c.5998C>T, NM_003494.3:c.3724C>T, NM_003494.3:c.5525+1G>A, NM_003494.3:c.3477C>A, NM_003494.3:c.3708delA, NM_003494.3:c.5992G>T, NM_003494.3:c.3113G>C, NM_003494.3:c.1216T>C, NM_003494.3:c.3903delG	Dysferlinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. Dysferlinopathy includes a spectrum of muscle disease characterized by two main phenotypes: Miyoshi myopathy with primarily distal weakness and limb-girdle muscular dystrophy type 2B (LGMD2B) with primarily proximal weakness. Miyoshi myopathy (median age of onset 19 years) is characterized by muscle weakness and atrophy, most marked in the distal parts of the legs, especially the gastrocnemius and soleus muscles. Over a period of years, the weakness and atrophy spread to the thighs and gluteal muscles. The forearms may become mildly atrophic with decrease in grip strength; the small muscles of the hands are spared. LGMD2B is characterized by early weakness and atrophy of the pelvic and shoulder girdle muscles in adolescence or young adulthood, with slow progression. Other phenotypes are scapuloperoneal syndrome, distal myopathy with anterior tibial onset, elevated serum CK concentration only, and congenital muscular dystrophy. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
DYSF	Miyoshi myopathy	NM_003494.3	NM_003494.3:c.1555G>A, NM_003494.3:c.5509G>A, NM_003494.3:c.5077C>T, NM_003494.3:c.5698_5699delAG, NM_003494.3:c.3892A>G, NM_003494.3:c.286A>C, NM_003494.3:c.1120G>C, NM_003494.3:c.1284+2T>C, NM_003494.3:c.5497G>T, NM_003494.3:c.3478C>T, NM_003494.3:c.2997G>T, NM_003494.3:c.3121C>T, NM_003494.3:c.1813C>T, NM_003494.3:c.3181_3182insAGGCGG, NM_003494.3:c.937+1G>A, NM_003494.3:c.3158T>G, NM_003494.3:c.1276G>A, NM_003494.3:c.701G>A, NM_003494.3:c.610C>T, NM_003494.3:c.5594delG, NM_003494.3:c.3112C>T, NM_003494.3:c.4199C>A, NM_003494.3:c.5999G>A, NM_003494.3:c.4756C>T, NM_003494.3:c.6124C>T, NM_003494.3:c.2966C>T, NM_003494.3:c.663+1G>C, NM_003494.3:c.3175-2A>T, NM_003494.3:c.895G>T, NM_003494.3:c.4985C>T, NM_003494.3:c.6203C>T	Miyoshi myopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. This disease is characterised by weakness in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
DYSF	Muscular dystrophy, limb girdle type 2B	NM_003494.3	NM_003494.3:c.5979dupA, NM_003494.3:c.565C>G, NM_003494.3:c.1663C>T, NM_003494.3:c.1873G>T, NM_003494.3:c.1834C>T, NM_003494.3:c.5201A>G, NM_003494.3:c.895G>A, NM_003494.3:c.3805G>T, NM_003494.3:c.4003G>A, NM_003494.3:c.4253G>A	Muscular dystrophy, limb girdle type 2B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. This disease is characterised by limb-girdle weakness and atrophy mostly in the shoulder pelvic girdle. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
EDA	Hypohidrotic ectodermal dysplasia, X-linked	NM_001399.4	NM_001399.4:c.206G>T, NM_001399.4:c.463C>T, NM_001399.4:c.187G>A, NM_001399.4:c.573_574insT, NM_001399.4:c.466C>T, NM_001399.4:c.826C>T, NM_001399.4:c.183C>G, NM_001399.4:c.181T>C, NM_001399.4:c.467G>A, NM_001399.4:c.671G>C, NM_001399.4:c.1045G>A	Hypohidrotic ectodermal dysplasia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EDA gene located on chromosomal region Xq12-q13.1. The age of onset is neonatal/infantile. This disease is characterized by malformation of ectodermal structures such as skin, hair, teeth and sweat glands. The prevalence is 1/5,000 to 1/10,000 newborns.	250,600
EDN3	Shah-Waardenburg syndrome type 4B	NM_207034.1	NM_207034.1:c.277C>G, NM_207034.1:c.568_569delGA, NM_207034.1:c.262_263delGCinsT, NM_207034.1:c.559_560insA, NM_207034.1:c.565_566insA, NM_207034.1:c.476G>T	Waardenburg-Shah syndrome type 4B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EDN3 gene located on chromosomal region 20q13.2-q13.3. The age of onset is neonatal/infantile. This disease is characterised by the association of Waardenburg syndrome (sensorineural hearing loss and pigmentary abnormalities) and Hirschsprung disease (signs of intestinal obstruction). The prevalence is below 1/40,000.	600
EDNRB	Shah-Waardenburg syndrome type 4A	NM_000115.3	NM_000115.3:c.914C>A, NM_000115.3:c.548C>G, NM_000115.3:c.828G>T, NM_000115.3:c.-51-946delC	Waardenburg-Shah syndrome type 4A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EDNRB gene located on chromosomal region 13q22. The age of onset is neonatal/infantile. This disease is characterised by the association of Waardenburg syndrome (sensorineural hearing loss and pigmentary abnormalities) and Hirschsprung disease (signs of intestinal obstruction). The prevalence is below 1/1,000,000.	600
EGR2	Charcot-Marie-Tooth disease type 4E	NM_000399.3	NM_000399.3:c.803T>A	Charcot-Marie-Tooth disease type 4E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EGR2 gene located on chromosomal region 10q21.1. The age of onset is neonatal/infantile. This disease is characterised by distal muscle weakness and atrophy associated with sensory loss and, frequently, pes cavus foot deformity. The prevalence is 15/100,000 to 20/100,000.	600
EIF2AK3	Wolcott-Rallison syndrome	NM_004836.5	NM_004836.5:c.994G>T, NM_004836.5:c.1763G>A	Wolcott-Rallison syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EIF2AK3 gene located on chromosomal region 2p12. The age of onset is neonatal/infantile. This disease is characterised by permanent neonatal diabetes mellitus with multiple epiphyseal dysplasia and other clinical manifestations, including recurrent episodes of acute liver failure. The prevalence is above 1/10,000 newborns.	600
EMD	Emery-Dreifuss muscular dystrophy type 1, X-linked	NM_000117.2	NM_000117.2:c.547C>A, NM_000117.2:c.631_635delCGTGC	Emery-Dreifuss muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EMD gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by muscular weakness and atrophy, with early joint contractures and cardiomyopathy. The prevalence is 1/100,000.	600
ENO3	Glycogen storage disease type 13	NM_053013.3	NM_053013.3:c.667+1G>T, NM_053013.3:c.1121G>A, NM_053013.3:c.953delA, NM_053013.3:c.692_707dupTCCAGGCGGCTGGTTA, NM_053013.3:c.467G>A, NM_053013.3:c.1303T>C	Glycogen storage disease type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENO3 gene located on chromosomal region 17p13.2. The age of onset is adult. This disease is characterised by exercise intolerance and myalgia due to severe enolase deficiency in muscle. The prevalence is below 1/1,000,000.	250,600
ENPP1	Generalized arterial calcification of infancy and pseudoxanthoma elasticum	NM_006208.2	NM_006208.2:c.1612G>C	Idiopathic infantile arterial calcification follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENPP1 gene located on chromosomal region 6q22-q23. The age of onset is neonatal/infancy. A severe autosomal recessive disorder characterized by calcification of the internal elastic lamina of muscular arteries and stenosis due to myointimal proliferation. The disorder is often fatal within the first 6 months of life because of myocardial ischemia resulting in refractory heart failure.	600
ENPP1	Hypophosphatemic rickets type 2, Autosomal recessive	NM_006208.2	NM_006208.2:c.797G>T, NM_006208.2:c.2702A>C	Hypophosphatemic rickets type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENPP1 gene located on chromosomal region 6q22-q23. The age of onset is variable. This disease is characterised by hypophosphatemia, rickets and/or osteomalacia and slow growth.	600
ENPP1	Idiopathic infantile arterial calcification	NM_006208.2	NM_006208.2:c.1112A>T, NM_006208.2:c.1025G>T, NM_006208.2:c.783C>G, NM_006208.2:c.2677G>T, NM_006208.2:c.913C>A, NM_006208.2:c.2230C>T, NM_006208.2:c.900G>A	Idiopathic infantile arterial calcification follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENPP1 gene located on chromosomal region 6q22-q23. The age of onset is neonatal/infancy. A severe autosomal recessive disorder characterized by calcification of the internal elastic lamina of muscular arteries and stenosis due to myointimal proliferation. The disorder is often fatal within the first 6 months of life because of myocardial ischemia resulting in refractory heart failure.	600
ERCC2	Trichothiodystrophy	NM_000400.3	NM_000400.3:c.1972C>T	Trichothiodystrophy is a heterogeneous group of disorders that follows an autosomal recessive pattern of inheritance. It is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.32. The age of onset is neonatal or infantile. This disease is characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. The abnormalities are usually obvious at birth, with variable clinical expression.	250,600
ERCC2	Xeroderma pigmentosum complementation group D	NM_000400.3	NM_000400.3:c.1308-1G>A, NM_000400.3:c.1454T>C, NM_000400.3:c.1621A>C, NM_000400.3:c.1703_1704delTT, NM_000400.3:c.1381C>G, NM_000400.3:c.719-1G>A, NM_000400.3:c.2230_2233dupCTAG, NM_000400.3:c.183+2T>A, NM_000400.3:c.567G>A, NM_000400.3:c.1354C>T, NM_000400.3:c.2047C>T, NM_000400.3:c.1304T>G, NM_000400.3:c.2176C>T, NM_000400.3:c.950-2A>G, NM_000400.3:c.949+1G>A	Xeroderma pigmentosum complementation group D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.3. The age of onset is variable. This disease is characterised by typical xeroderma pigmentosum manifestations (photosensitivity of skin with burning, freckling, and dryness of skin, skin cancers) associated with a spectrum of neurological anomalies (from no abnormality to severe neurological disease).	250,600
ERCC3	Xeroderma pigmentosum complementation group B	NM_000122.1	NM_000122.1:c.1633C>T, NM_000122.1:c.1757_1758delAG, NM_000122.1:c.296T>C, NM_000122.1:c.1273C>T, NM_000122.1:c.1757delA, NM_000122.1:c.1858delG	Xeroderma pigmentosum complementation group B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC3 gene located on chromosomal region 2q21. The age of onset is variable. This disease is characterised by classic xeroderma pigmentosum features of varying severity (photosensitivity of skin with burning and freckling, skin and eye tumors) and mild neurological abnormalities, or in other cases classical xeroderma pigmentosum features with systemic and neurological manifestations of Cockayne syndrome such as short stature, bilateral sensorineural hearing loss and hyperreflexia. The prevalence is 1/1,000,000.	600
ERCC4	Xeroderma pigmentosum complementation group F	NM_005236.2	NM_005236.2:c.49G>T, NM_005236.2:c.1467_1468insA, NM_005236.2:c.2281_2284delTTTG, NM_005236.2:c.2T>C, NM_005236.2:c.538_539delAG, NM_005236.2:c.706T>C, NM_005236.2:c.2395C>T	Xeroderma pigmentosum complementation group F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC4 gene located on chromosomal region 16p13.12. The age of onset is variable. This disease is characterised very mild skin symptoms and no ocular or neurological disease. The prevalence is 1/1,000,000.	250,600
ERCC5	Xeroderma pigmentosum complementation group G	NM_000123.3	NM_000123.3:c.2620G>A, NM_000123.3:c.463_464insA, NM_000123.3:c.526C>T, NM_000123.3:c.88+2T>C, NM_000123.3:c.2144dupA, NM_000123.3:c.2375C>T, NM_000123.3:c.381-2A>G, NM_000123.3:c.2573T>C, NM_000123.3:c.406C>T, NM_000123.3:c.215C>A, NM_000123.3:c.787C>T, NM_000123.3:c.2751delA	Xeroderma pigmentosum complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC5 gene located on chromosomal region 13q33. The age of onset is variable. This disease is characterised by variable clinical manifestations, as some patients present with a mild xeroderma pigmentosum phenotype (UV sensitivity, hyper- or hypo-pigmented skin lesions and increased incidence of skin cancer) and others combine symptoms of xeroderma pigmentosum with systemic and neurological manifestations of Cockayne syndrome. The prevalence is 1/1,000,000.	250,600
ERCC6	Cerebrooculofacioskeletal syndrome tipo 1	NM_000124.3	NM_000124.3:c.2047C>T	Cerebrooculofacioskeletal syndrome tipo 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterised by congenital microcephaly, congenital cataract and/or microphthalmia, arthrogryposis, severe psychomotor developmental delay, height-weight growth delay (principally postnatal) and facial dysmorphism (prominent metopic suture, micrognathism). The prevalence is below 1,000,000.	250,600
ERCC6	Cockayne syndrome type B	NM_000124.3	NM_000124.3:c.207_208insG, NM_000124.3:c.2203C>T, NM_000124.3:c.1357C>T, NM_000124.3:c.48_49delCT, NM_000124.3:c.3592_3593insGA, NM_000124.3:c.422+1G>A, NM_000124.3:c.1550G>A, NM_000124.3:c.3284C>G, NM_000124.3:c.2587C>T, NM_000124.3:c.3862C>T	Cockayne syndrome type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterised by growth failure at birth, with little or no postnatal neurologic development.	250,600
ERCC8	Cockayne syndrome type A	NM_000082.3	NM_000082.3:c.1103_1108delAGTTinsTTATATGAACCTTATATGAA, NM_000082.3:c.618-1G>A, NM_000082.3:c.593_594dupAT, NM_000082.3:c.613G>C, NM_000082.3:c.966C>A, NM_000082.3:c.37G>T	Cockayne syndrome type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC8 gene located on chromosomal region 5q12.1. The age of onset is variable. This disease is characterised by normal prenatal growth with the onset of growth and developmental abnormalities in the first two years. The prevalence is 2.7/1,000,000 newborns in Western Europe.	600
ESCO2	Roberts syndrome	NM_001017420.2	NM_001017420.2:c.1615T>G, NM_001017420.2:c.879_880delAG, NM_001017420.2:c.1597dupT, NM_001017420.2:c.505C>T, NM_001017420.2:c.291_292insGA, NM_001017420.2:c.308_309delAA, NM_001017420.2:c.876_879delCAGA, NM_001017420.2:c.874_877delGACA	Roberts syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESCO2 gene located on chromosomal region 8p21.1. The age of onset is neonatal/infantile. This disease is characterised by pre- and postnatal growth retardation, severe symmetric limb reduction defects, craniofacial anomalies and severe intellectual deficit.	600
ESCO2	SC Phocomelia syndrome	NM_001017420.2	NM_001017420.2:c.1269G>A, NM_001017420.2:c.604C>T	SC phocomelia syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESCO2 gene located on chromosomal region 8p21.1. The age of onset is neonatal/infantile. This disease has a milder phenotype than Roberts syndrome, with a lesser degree of symmetric limb reduction and additionally includes flexion contractures of various joints, midfacial hemangioma, hypoplastic cartilage of ears and nose, scant silvery-blond hair, and cloudy corneae. Although microcephaly is present, mental retardation may be mild and survival into adulthood is common.	600
ESPN	Deafness type 36, autosomal recessive	NM_031475.2	NM_031475.2:c.1988_1991delAGAG, NM_031475.2:c.2230G>A, NM_031475.2:c.2470_2473delTCAG	Autosomal recessive nonsyndromic sensorineural deafness type DFNB36 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESPN gene located on chromosomal region 1p36.31. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	600
ESRRB	Deafness type 35, autosomal recessive	NM_004452.3	NM_004452.3:c.329C>T	Autosomal recessive nonsyndromic sensorineural deafness type DFNB35 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESRRB gene located on chromosomal region 14q24.3. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.	600
ETFA	Glutaric acidemia type 2A	NM_000126.3	NM_000126.3:c.470T>G, NM_000126.3:c.797C>T	Glutaric acidemia type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFA gene located on chromosomal region 15q23-q25. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.	600
ETFB	Glutaric acidemia type 2B	NM_001985.2	NM_001985.2:c.278_279insG, NM_001985.2:c.490C>T, NM_001985.2:c.491G>A, NM_001985.2:c.382G>A, NM_001985.2:c.58-53_58-52insG, NM_001985.2:c.61C>T, NM_001985.2:c.614_616delAGA	Glutaric acidemia type 2B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFB gene located on chromosomal region 19q13.3. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.	600
ETFDH	Glutaric acidemia type 2C	NM_004453.3	NM_004453.3:c.1823delG, NM_004453.3:c.1570_1571delCT, NM_004453.3:c.2T>C, NM_004453.3:c.1234G>T, NM_004453.3:c.250G>A, NM_004453.3:c.1351G>C, NM_004453.3:c.1367C>T, NM_004453.3:c.524G>T, NM_004453.3:c.1001T>C, NM_004453.3:c.1773_1774delAT, NM_004453.3:c.1832G>A, NM_004453.3:c.508G>T, NM_004453.3:c.413T>G, NM_004453.3:c.643G>A	Glutaric acidemia type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFDH gene located on chromosomal region 4q32-q35. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.	600
ETHE1	Ethylmalonic encephalopathy	NM_014297.3	NM_014297.3:c.487C>T, NM_014297.3:c.554T>G, NM_014297.3:c.440_450delACAGCATGGCC, NM_014297.3:c.604dupG, NM_014297.3:c.221dupA, NM_014297.3:c.488G>A	Ethylmalonic encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETHE1 gene located on chromosomal region 19q13.31. The age of onset is neonatal/infantile. This disease is characterised by elevated excretion of ethylmalonic acid with recurrent petechiae, orthostatic acrocyanosis and chronic diarrhoea associated with neurodevelopmental delay, psychomotor regression and hypotonia with brain magnetic resonance imaging abnormalities. The prevalence is below 1/1,000,000, with total of 30 cases of patients reported worldwide, mainly for Mediterranean and Arab populations.	600
EYS	Retinitis pigmentosa type 25	NM_001142800.1	NM_001142800.1:c.5044G>T, NM_001142800.1:c.9036delT, NM_001142800.1:c.490C>T, NM_001142800.1:c.5928-2A>G, NM_001142800.1:c.571dupA, NM_001142800.1:c.4597_4613delTCAAGCAACCAGAGACT, NM_001142800.1:c.7822C>T, NM_001142800.1:c.5857G>T, NM_001142800.1:c.6170delA, NM_001142800.1:c.8569G>T, NM_001142800.1:c.232delT, NM_001142800.1:c.6102_6103insT, NM_001142800.1:c.8834G>A, NM_001142800.1:c.1211_1212insA, NM_001142800.1:c.4350_4356delTATAGCT, NM_001142800.1:c.4469_4470insAGCCCCTC, NM_001142800.1:c.8648_8655delCATGCAGA, NM_001142800.1:c.4120C>T, NM_001142800.1:c.863-4_863-3insT, NM_001142800.1:c.8629_8632dupACAG, NM_001142800.1:c.9299_9302delCTCA, NM_001142800.1:c.103C>T, NM_001142800.1:c.2826_2827delAT, NM_001142800.1:c.4045C>T, NM_001142800.1:c.5757_5758insT, NM_001142800.1:c.8408dupA, NM_001142800.1:c.7095T>G, NM_001142800.1:c.3329C>G, NM_001142800.1:c.9405T>A	Retinitis pigmentosa 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EYS gene located on chromosomal region 6q12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000.	250,600
F11	Factor 11 deficiency	NM_000128.3	NM_000128.3:c.1613C>T, NM_000128.3:c.166T>C, NM_000128.3:c.403G>T, NM_000128.3:c.731A>G, NM_000128.3:c.809A>T, NM_000128.3:c.1693G>A, NM_000128.3:c.1211C>A, NM_000128.3:c.901T>C, NM_000128.3:c.595+3A>G, NM_000128.3:c.438C>A	Factor 11 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F11 gene located on chromosomal region 4q35. The age of onset is variable. This disease is characterized by reduced levels and activity of factor XI resulting in moderate bleeding symptoms, usually occurring after trauma or surgery. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
F5	Factor 5 deficiency	NM_000130.4	NM_000130.4:c.4876delA, NM_000130.4:c.439G>T, NM_000130.4:c.6419G>A, NM_000130.4:c.2401C>T, NM_000130.4:c.5521G>A, NM_000130.4:c.1083G>A, NM_000130.4:c.5189A>G, NM_000130.4:c.3799delC, NM_000130.4:c.6304C>T	Factor 5 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F5 gene located on chromosomal region 1q23. The age of onset is variable. This disease is characterized by mild to severe bleeding symptoms usually occurring after trauma or surgery. In severe forms of the disease, there can be a risk of intracranial, pulmonary or gastrointestinal bleedings. The severity of the bleeding manifestations correlates with the FV levels. The prevalence is 1/5,000.	250,600
F5	Thrombosis	NM_000130.4	NM_000130.4:c.1000A>G	Deep venous thrombosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F5 gene located on chromosomal region 1q23. The age of onset is variable. This disease is characterized by a poor anticoagulant response to activated Protein C and an increased risk for venous thromboembolism. Deep venous thrombosis and pulmonary embolism are the most common manifestations, but thrombosis in unusual locations also occurs. The prevalence is 1/5,000.	250,600
F8	Hemophilia A	NM_000132.3	NM_000132.3:c.1075_1078delAATG, NM_000132.3:c.1042T>C, NM_000132.3:c.1078_1079delGA, NM_000132.3:c.120delC, NM_000132.3:c.1214T>G, NM_000132.3:c.1090G>A, NM_000132.3:c.1207C>G, NM_000132.3:c.1331_1332delAAinsT, NM_000132.3:c.1175C>A, NM_000132.3:c.1335dupC, NM_000132.3:c.1203G>A, NM_000132.3:c.128dupT, NM_000132.3:c.1331A>C, NM_000132.3:c.1301G>A, NM_000132.3:c.1234T>C, NM_000132.3:c.1316G>A, NM_000132.3:c.1293delG, NM_000132.3:c.1200_1201delTT, NM_000132.3:c.1310delG, NM_000132.3:c.1331_1332delAA, NM_000132.3:c.1410_1413delTTTA, NM_000132.3:c.1420G>T, NM_000132.3:c.143+1G>A, NM_000132.3:c.1432G>A, NM_000132.3:c.1438_1439delCT, NM_000132.3:c.1440_1441insA, NM_000132.3:c.144-11T>G, NM_000132.3:c.1442_1443dupTG, NM_000132.3:c.1175C>G, NM_000132.3:c.1324T>A, NM_000132.3:c.1324T>C, NM_000132.3:c.1325A>G, NM_000132.3:c.144-5C>G, NM_000132.3:c.1463C>G, NM_000132.3:c.1463C>T, NM_000132.3:c.1467_1472dupCAGACC, NM_000132.3:c.1477A>G, NM_000132.3:c.1538-1G>T, NM_000132.3:c.1538-2A>T, NM_000132.3:c.1560delT, NM_000132.3:c.1564_1565delATinsTA, NM_000132.3:c.1585A>G, NM_000132.3:c.1594T>G, NM_000132.3:c.1189_1190insC, NM_000132.3:c.1443+3A>C, NM_000132.3:c.1596G>A, NM_000132.3:c.1618C>A, NM_000132.3:c.1619C>G, NM_000132.3:c.1630G>A, NM_000132.3:c.1639T>C, NM_000132.3:c.1337G>A, NM_000132.3:c.1337G>C, NM_000132.3:c.1338delA, NM_000132.3:c.1348T>G, NM_000132.3:c.1357G>T, NM_000132.3:c.1390G>T, NM_000132.3:c.1595G>A, NM_000132.3:c.1596dupG, NM_000132.3:c.1400T>G, NM_000132.3:c.1406G>C, NM_000132.3:c.1736A>T, NM_000132.3:c.173delC, NM_000132.3:c.1752+5G>C, NM_000132.3:c.185C>G, NM_000132.3:c.1904-1G>A, NM_000132.3:c.1904-37G>A, NM_000132.3:c.1912G>A, NM_000132.3:c.1913G>A, NM_000132.3:c.1924_1927delGATA, NM_000132.3:c.1934A>C, NM_000132.3:c.1941_1944delAGTT, NM_000132.3:c.1943_1946delTTTG, NM_000132.3:c.1952A>C, NM_000132.3:c.195C>A, NM_000132.3:c.1985G>C, NM_000132.3:c.1988C>T, NM_000132.3:c.1990_1991delCA, NM_000132.3:c.1991A>C, NM_000132.3:c.199_200delAA, NM_000132.3:c.1992_1995dupGACT, NM_000132.3:c.1996_1999delGACT, NM_000132.3:c.1999delT, NM_000132.3:c.199A>G, NM_000132.3:c.1A>G, NM_000132.3:c.2009_2011delTCT, NM_000132.3:c.200A>C, NM_000132.3:c.201G>T, NM_000132.3:c.202_203insGA, NM_000132.3:c.202_207delACTCTG, NM_000132.3:c.2029T>C, NM_000132.3:c.2032A>T, NM_000132.3:c.203C>A, NM_000132.3:c.2057C>G, NM_000132.3:c.2058_2059delAC, NM_000132.3:c.2060T>C, NM_000132.3:c.2066T>G, NM_000132.3:c.1394C>G, NM_000132.3:c.1397G>A, NM_000132.3:c.2077_2078delTCinsCT, NM_000132.3:c.2088_2089delTG, NM_000132.3:c.2090T>A, NM_000132.3:c.2095A>C, NM_000132.3:c.2095A>G, NM_000132.3:c.2095A>T, NM_000132.3:c.1086G>A, NM_000132.3:c.2097G>A, NM_000132.3:c.1164delC, NM_000132.3:c.1172G>C, NM_000132.3:c.214G>A, NM_000132.3:c.217T>C, NM_000132.3:c.1187A>T, NM_000132.3:c.224delA, NM_000132.3:c.225T>A, NM_000132.3:c.1202G>A, NM_000132.3:c.2338delA, NM_000132.3:c.2360delA, NM_000132.3:c.2372dupG, NM_000132.3:c.2374delT, NM_000132.3:c.2383A>G, NM_000132.3:c.2384_2388delGAACA, NM_000132.3:c.2397delT, NM_000132.3:c.2404C>T, NM_000132.3:c.2409delT, NM_000132.3:c.2412_2421delCTCCTCTAGT, NM_000132.3:c.2419dupA, NM_000132.3:c.2462_2463delGG, NM_000132.3:c.250_255delAGGCCA, NM_000132.3:c.250A>G, NM_000132.3:c.253_255delCCA, NM_000132.3:c.265+1G>T, NM_000132.3:c.265G>A, NM_000132.3:c.3031A>T, NM_000132.3:c.3034G>C, NM_000132.3:c.3053delA, NM_000132.3:c.3150_3151insTC, NM_000132.3:c.3152delT, NM_000132.3:c.3168_3187delTGAGTTTAAAAAAGTGACAC, NM_000132.3:c.3196C>T, NM_000132.3:c.3202_3203delAG, NM_000132.3:c.3224delC, NM_000132.3:c.3251C>G, NM_000132.3:c.3255_3258delTAAA, NM_000132.3:c.3279G>A, NM_000132.3:c.3289C>T, NM_000132.3:c.3295delA, NM_000132.3:c.3298A>T, NM_000132.3:c.3302_3303delAG, NM_000132.3:c.3344delT, NM_000132.3:c.3371C>A, NM_000132.3:c.144-26A>T, NM_000132.3:c.1443+1G>A, NM_000132.3:c.1443+2T>C, NM_000132.3:c.3409_3410delCT, NM_000132.3:c.3416_3417delCT, NM_000132.3:c.3417dupT, NM_000132.3:c.3421C>T, NM_000132.3:c.3490delT, NM_000132.3:c.3493G>T, NM_000132.3:c.3496A>T, NM_000132.3:c.3500dupA, NM_000132.3:c.3505delG, NM_000132.3:c.3540delA, NM_000132.3:c.3548_3549delAA, NM_000132.3:c.3565dupA, NM_000132.3:c.3607G>T, NM_000132.3:c.3624delT, NM_000132.3:c.3631A>T, NM_000132.3:c.3651delA, NM_000132.3:c.3652delG, NM_000132.3:c.3710delC, NM_000132.3:c.3721_3739del19ins6, NM_000132.3:c.3735_3744delCCTTTTCTTAinsATTTCTTTTTCTTT, NM_000132.3:c.3736delC, NM_000132.3:c.3756delG, NM_000132.3:c.3766G>T, NM_000132.3:c.3771delT, NM_000132.3:c.3827C>G, NM_000132.3:c.3830delC, NM_000132.3:c.3833delA, NM_000132.3:c.3842_3844delAGAinsGG, NM_000132.3:c.3844A>T, NM_000132.3:c.3847_3848delCA, NM_000132.3:c.3858delT, NM_000132.3:c.3860delT, NM_000132.3:c.3863dupC, NM_000132.3:c.3870dupA, NM_000132.3:c.3886delT, NM_000132.3:c.3902delA, NM_000132.3:c.3907_3911delACCAA, NM_000132.3:c.3913C>T, NM_000132.3:c.3922G>T, NM_000132.3:c.3940A>C, NM_000132.3:c.3964C>T, NM_000132.3:c.3967C>T, NM_000132.3:c.3982C>T, NM_000132.3:c.3984dupA, NM_000132.3:c.3991_3992delAA, NM_000132.3:c.3994_3997delAGAG, NM_000132.3:c.4006C>T, NM_000132.3:c.4034delA, NM_000132.3:c.403G>A, NM_000132.3:c.4045delA, NM_000132.3:c.404A>G, NM_000132.3:c.405T>A, NM_000132.3:c.4072C>T, NM_000132.3:c.407A>C, NM_000132.3:c.4093_4099delCATTTGA, NM_000132.3:c.4100delC, NM_000132.3:c.4113_4153dup41, NM_000132.3:c.4156C>T, NM_000132.3:c.415C>T, NM_000132.3:c.4197delC, NM_000132.3:c.4201C>T, NM_000132.3:c.421G>T, NM_000132.3:c.4241C>A, NM_000132.3:c.4242dupA, NM_000132.3:c.4264_4265delTA, NM_000132.3:c.2071C>A, NM_000132.3:c.2072C>T, NM_000132.3:c.4293_4297delCTCTT, NM_000132.3:c.4296_4300delTTCTC, NM_000132.3:c.430G>T, NM_000132.3:c.4318delT, NM_000132.3:c.4336delG, NM_000132.3:c.4339dupG, NM_000132.3:c.2096T>A, NM_000132.3:c.4345delG, NM_000132.3:c.209T>C, NM_000132.3:c.2101_2105delATGGA, NM_000132.3:c.4363C>T, NM_000132.3:c.4382_4383delAC, NM_000132.3:c.223G>T, NM_000132.3:c.4408G>T, NM_000132.3:c.440T>A, NM_000132.3:c.230T>C, NM_000132.3:c.4424_4425delAA, NM_000132.3:c.4426_4427delAG, NM_000132.3:c.4429_4430delGA, NM_000132.3:c.4446dupG, NM_000132.3:c.4450delA, NM_000132.3:c.4458delA, NM_000132.3:c.446delC, NM_000132.3:c.4473C>A, NM_000132.3:c.4473C>G, NM_000132.3:c.4474A>T, NM_000132.3:c.4483delG, NM_000132.3:c.4483G>T, NM_000132.3:c.4491_4492delTG, NM_000132.3:c.4491_4495delTGTTC, NM_000132.3:c.4492_4496delGTTCT, NM_000132.3:c.4492delG, NM_000132.3:c.4512_4513ins32, NM_000132.3:c.4512delG, NM_000132.3:c.4513_4515delCCCinsGCAAAGTTGGTTTGCCAAAACCATGTTGCCG, NM_000132.3:c.4519delA, NM_000132.3:c.4531G>A, NM_000132.3:c.4542delT, NM_000132.3:c.4543_4544delCCinsA, NM_000132.3:c.4549_4550delGT, NM_000132.3:c.4561C>T, NM_000132.3:c.4619delT, NM_000132.3:c.4658delA, NM_000132.3:c.4662_4663delGA, NM_000132.3:c.4665_4688del24insAAGGAA, NM_000132.3:c.4672_4675delAACA, NM_000132.3:c.4683delA, NM_000132.3:c.4687delG, NM_000132.3:c.4694_4697delTTCT, NM_000132.3:c.4697_4701dupTGAGA, NM_000132.3:c.4710_4713delAGAA, NM_000132.3:c.3385delC, NM_000132.3:c.3388delA, NM_000132.3:c.3402delG, NM_000132.3:c.472C>T, NM_000132.3:c.476T>C, NM_000132.3:c.4770T>A, NM_000132.3:c.4794G>T, NM_000132.3:c.4798A>T, NM_000132.3:c.4805_4806delAA, NM_000132.3:c.4805delA, NM_000132.3:c.4814C>A, NM_000132.3:c.4825delA, NM_000132.3:c.4828G>T, NM_000132.3:c.4841delA, NM_000132.3:c.4848delC, NM_000132.3:c.4856delC, NM_000132.3:c.4858delC, NM_000132.3:c.4864G>A, NM_000132.3:c.4895delT, NM_000132.3:c.4895dupT, NM_000132.3:c.4899delT, NM_000132.3:c.489T>A, NM_000132.3:c.4918G>T, NM_000132.3:c.4922dupT, NM_000132.3:c.4925A>G, NM_000132.3:c.4926delA, NM_000132.3:c.4934G>A, NM_000132.3:c.4935G>A, NM_000132.3:c.493C>T, NM_000132.3:c.4942C>T, NM_000132.3:c.4969C>T, NM_000132.3:c.4979C>T, NM_000132.3:c.4987A>T, NM_000132.3:c.4996C>T, NM_000132.3:c.4999delC, NM_000132.3:c.5010delT, NM_000132.3:c.5012G>A, NM_000132.3:c.514_515insTCAAGATA, NM_000132.3:c.514T>C, NM_000132.3:c.515G>A, NM_000132.3:c.519_523delTACCT, NM_000132.3:c.5220-1G>A, NM_000132.3:c.5226_5227delGA, NM_000132.3:c.5243delA, NM_000132.3:c.5251A>T, NM_000132.3:c.5254delG, NM_000132.3:c.525C>A, NM_000132.3:c.5269delT, NM_000132.3:c.5269T>C, NM_000132.3:c.5291A>G, NM_000132.3:c.5301C>A, NM_000132.3:c.5308G>A, NM_000132.3:c.5321A>T, NM_000132.3:c.532C>G, NM_000132.3:c.5330T>C, NM_000132.3:c.5337delG, NM_000132.3:c.5339C>T, NM_000132.3:c.5343T>A, NM_000132.3:c.5345T>G, NM_000132.3:c.5348_5357delGAGCAGAAGT, NM_000132.3:c.535T>C, NM_000132.3:c.545A>T, NM_000132.3:c.553A>G, NM_000132.3:c.556G>A, NM_000132.3:c.557_559delACT, NM_000132.3:c.557A>G, NM_000132.3:c.560T>A, NM_000132.3:c.566C>A, NM_000132.3:c.5674G>A, NM_000132.3:c.5675dupT, NM_000132.3:c.5680G>A, NM_000132.3:c.5686G>C, NM_000132.3:c.5689_5690delCT, NM_000132.3:c.5696dupT, NM_000132.3:c.5697delC, NM_000132.3:c.5712G>C, NM_000132.3:c.5718dupA, NM_000132.3:c.5719A>T, NM_000132.3:c.571C>T, NM_000132.3:c.5721C>G, NM_000132.3:c.5722_5723delTGinsTCATCAAAGTACTTCAAAAA, NM_000132.3:c.5752delT, NM_000132.3:c.5766C>A, NM_000132.3:c.577G>A, NM_000132.3:c.5816-14delGTinsTA, NM_000132.3:c.5816C>A, NM_000132.3:c.5816C>T, NM_000132.3:c.5825G>T, NM_000132.3:c.5833A>G, NM_000132.3:c.5853A>C, NM_000132.3:c.5861_5866delCTCAGG, NM_000132.3:c.5869C>T, NM_000132.3:c.5879G>T, NM_000132.3:c.5881T>A, NM_000132.3:c.5884T>G, NM_000132.3:c.5888T>C, NM_000132.3:c.5891T>C, NM_000132.3:c.5894G>T, NM_000132.3:c.589_591delGTA, NM_000132.3:c.5914_5915delAT, NM_000132.3:c.5923dupA, NM_000132.3:c.5924T>A, NM_000132.3:c.5934T>G, NM_000132.3:c.5939A>C, NM_000132.3:c.5953delC, NM_000132.3:c.5954G>C, NM_000132.3:c.5955_5956delAA, NM_000132.3:c.5955delA, NM_000132.3:c.5964_5967dupGGAG, NM_000132.3:c.5999G>C, NM_000132.3:c.6016G>T, NM_000132.3:c.6037G>A, NM_000132.3:c.6046C>G, NM_000132.3:c.6070dupC, NM_000132.3:c.6078_6079delTG, NM_000132.3:c.6082delG, NM_000132.3:c.6089dupG, NM_000132.3:c.6094C>T, NM_000132.3:c.6099delT, NM_000132.3:c.6107A>G, NM_000132.3:c.6115+1G>A, NM_000132.3:c.6115+2T>C, NM_000132.3:c.6115+3G>T, NM_000132.3:c.6115+4A>G, NM_000132.3:c.6115+6T>A, NM_000132.3:c.6116-2A>G, NM_000132.3:c.6116_6117delAG, NM_000132.3:c.6120_6135delTCAGACTCCCCTGGGA, NM_000132.3:c.6120T>A, NM_000132.3:c.6127delC, NM_000132.3:c.6134G>T, NM_000132.3:c.6135dupA, NM_000132.3:c.6194G>A, NM_000132.3:c.6202_6257dup56, NM_000132.3:c.6213A>T, NM_000132.3:c.6239C>T, NM_000132.3:c.6242G>C, NM_000132.3:c.6243G>C, NM_000132.3:c.6250A>T, NM_000132.3:c.6253G>T, NM_000132.3:c.6263C>T, NM_000132.3:c.6269T>A, NM_000132.3:c.6273+1G>A, NM_000132.3:c.6430-3C>G, NM_000132.3:c.6449A>T, NM_000132.3:c.6464_6465delAA, NM_000132.3:c.6465delA, NM_000132.3:c.6467_6468delAC, NM_000132.3:c.6469_6470delAA, NM_000132.3:c.6473delT, NM_000132.3:c.6482C>A, NM_000132.3:c.6482C>T, NM_000132.3:c.6488T>G, NM_000132.3:c.6489delT, NM_000132.3:c.6494delC, NM_000132.3:c.6497delG, NM_000132.3:c.6501delC, NM_000132.3:c.6515C>G, NM_000132.3:c.6517_6519dupACT, NM_000132.3:c.6520C>G, NM_000132.3:c.6533G>A, NM_000132.3:c.6537C>G, NM_000132.3:c.6544C>G, NM_000132.3:c.6548T>G, NM_000132.3:c.6551A>T, NM_000132.3:c.6565_6566delGA, NM_000132.3:c.6574+1G>A, NM_000132.3:c.6574+1G>T, NM_000132.3:c.6574+3A>C, NM_000132.3:c.6574+5G>C, NM_000132.3:c.65G>C, NM_000132.3:c.6738delA, NM_000132.3:c.6739_6740delGA, NM_000132.3:c.6739G>T, NM_000132.3:c.6743G>C, NM_000132.3:c.6746T>G, NM_000132.3:c.6752T>A, NM_000132.3:c.6760C>T, NM_000132.3:c.6760delC, NM_000132.3:c.676A>T, NM_000132.3:c.6780_6788delAGGAGTAAC, NM_000132.3:c.6786_6787insCAA, NM_000132.3:c.6796G>A, NM_000132.3:c.6797delG, NM_000132.3:c.6797G>A, NM_000132.3:c.6804delA, NM_000132.3:c.680G>A, NM_000132.3:c.6825T>A, NM_000132.3:c.6827T>G, NM_000132.3:c.6836T>C, NM_000132.3:c.6836T>G, NM_000132.3:c.6839T>C, NM_000132.3:c.6842T>C, NM_000132.3:c.684_685delCT, NM_000132.3:c.6856_6866delGATGGCCATCA, NM_000132.3:c.6865C>T, NM_000132.3:c.6869G>T, NM_000132.3:c.6870G>A, NM_000132.3:c.687_688delAG, NM_000132.3:c.6886delA, NM_000132.3:c.6900+1G>A, NM_000132.3:c.6901-2A>G, NM_000132.3:c.6904T>G, NM_000132.3:c.6905T>C, NM_000132.3:c.6912_6916delAAATC, NM_000132.3:c.6915delT, NM_000132.3:c.6919_6920delGA, NM_000132.3:c.6921delC, NM_000132.3:c.693_696delAAAG, NM_000132.3:c.6969_6977delCTACCTTCG, NM_000132.3:c.6976C>G, NM_000132.3:c.6986C>T, NM_000132.3:c.6988delC, NM_000132.3:c.6995G>C, NM_000132.3:c.6996G>A, NM_000132.3:c.6997delG, NM_000132.3:c.7012delC, NM_000132.3:c.7016G>T, NM_000132.3:c.7021G>T, NM_000132.3:c.7030G>A, NM_000132.3:c.7030G>T, NM_000132.3:c.7031G>A, NM_000132.3:c.7033_7040delTGCGAGGC, NM_000132.3:c.7034G>A, NM_000132.3:c.709C>T, NM_000132.3:c.729delT, NM_000132.3:c.73delT, NM_000132.3:c.755C>A, NM_000132.3:c.760A>T, NM_000132.3:c.764G>A, NM_000132.3:c.770_771insCC, NM_000132.3:c.775A>T, NM_000132.3:c.779C>G, NM_000132.3:c.77T>C, NM_000132.3:c.787+2T>C, NM_000132.3:c.787G>C, NM_000132.3:c.788-1G>A, NM_000132.3:c.788-1G>C, NM_000132.3:c.788-1G>T, NM_000132.3:c.788-2A>T, NM_000132.3:c.796G>T, NM_000132.3:c.820T>C, NM_000132.3:c.822G>A, NM_000132.3:c.824A>G, NM_000132.3:c.832G>A, NM_000132.3:c.836T>A, NM_000132.3:c.849delT, NM_000132.3:c.850G>A, NM_000132.3:c.850G>T, NM_000132.3:c.86T>G, NM_000132.3:c.871G>T, NM_000132.3:c.872A>G, NM_000132.3:c.883T>C, NM_000132.3:c.886C>T, NM_000132.3:c.889delG, NM_000132.3:c.88G>A, NM_000132.3:c.899A>C, NM_000132.3:c.899A>T, NM_000132.3:c.902G>C, NM_000132.3:c.906delG, NM_000132.3:c.912C>T, NM_000132.3:c.918delA, NM_000132.3:c.920T>G, NM_000132.3:c.935delT, NM_000132.3:c.941C>T, NM_000132.3:c.943delG, NM_000132.3:c.948_951delAACA, NM_000132.3:c.967G>A, NM_000132.3:c.974_975delTT, NM_000132.3:c.97T>G, NM_000132.3:c.984delT, NM_000132.3:c.985dupT, NM_000132.3:c.986G>A, NM_000132.3:c.986G>C, NM_000132.3:c.986G>T, NM_000132.3:c.98G>A, NM_000132.3:c.1726G>T, NM_000132.3:c.4345G>T, NM_000132.3:c.435_436insTTT, NM_000132.3:c.433G>C, NM_000132.3:c.4719_4729delTGCAAAGACTC, NM_000132.3:c.439_447dupGTCTTCCCT, NM_000132.3:c.4720delG, NM_000132.3:c.1661G>A, NM_000132.3:c.4423C>T, NM_000132.3:c.1703G>T, NM_000132.3:c.1640G>A, NM_000132.3:c.1682A>C, NM_000132.3:c.1681G>A, NM_000132.3:c.1667T>A, NM_000132.3:c.4272delC, NM_000132.3:c.1653T>G, NM_000132.3:c.471G>A, NM_000132.3:c.1688C>G, NM_000132.3:c.4280delT, NM_000132.3:c.1675G>T	Hemophilia A follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F8 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor VIII deficiency. The prevalence is 1/4,000 to 1/ 5,000 male newborns.	600
F8	Hemophilia A	-	Inv22 (Detection by PCR)	Hemophilia A follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F8 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor VIII deficiency. The prevalence is 1/4,000 to 1/ 5,000 male newborns.	600
F9	Hemophilia B	NM_000133.3	NM_000133.3:c.1150C>T, NM_000133.3:c.52T>C, NM_000133.3:c.1031T>C, NM_000133.3:c.82T>C, NM_000133.3:c.1136G>A, NM_000133.3:c.79G>A, NM_000133.3:c.19A>T, NM_000133.3:c.80A>T	Hemophilia B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F9 gene located on chromosomal region Xq27.1-q27.2. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor IX deficiency. The prevalence is 1/100,000 to 9/100,000.	250,600
FAH	Tyrosinemia type 1	NM_000137.2	NM_000137.2:c.1141A>G, NM_000137.2:c.1069G>T, NM_000137.2:c.1090G>T, NM_000137.2:c.401C>A, NM_000137.2:c.456G>A, NM_000137.2:c.192G>T, NM_000137.2:c.607-6T>G, NM_000137.2:c.707-1G>A, NM_000137.2:c.939delC, NM_000137.2:c.103G>A, NM_000137.2:c.982C>T, NM_000137.2:c.837+1G>A, NM_000137.2:c.1009G>A, NM_000137.2:c.47A>T, NM_000137.2:c.554-1G>T, NM_000137.2:c.1027G>T, NM_000137.2:c.1062+5G>A, NM_000137.2:c.786G>A, NM_000137.2:c.1021C>T, NM_000137.2:c.782C>T	Tyrosinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAH gene located on chromosomal region 15q25.1. The age of onset is variable. This disease is characterized by progressive liver disease, renal tubular dysfunction, porphyria-like crises and a dramatic improvement in prognosis following treatment with nitisinone. The birth incidence is 1/100,000, notably in Québec, Canada, and the prevalence is 1/100,000 to 1/120,000 newborns.	250,600
FAM126A	Hypomyelination and congenital cataract	NM_032581.3	NM_032581.3:c.191A>G, NM_032581.3:c.158T>C	Hypomyelination - congenital cataract follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAM126A gene located on chromosomal region 7p15.3. The age of onset is neonatal/infantile. This disease is characterized by the onset of cataract either at birth or in the first two months of life, delayed psychomotor development by the end of the first year of life and moderate intellectual deficit. The prevalence is below 1/1,000,000.	600
FAM20C	Osteosclerotic bone dysplasia	NM_020223.3	NM_020223.3:c.1093G>C, NM_020223.3:c.773T>A, NM_020223.3:c.1364-5C>T, NM_020223.3:c.1163T>G, NM_020223.3:c.838G>A, NM_020223.3:c.1351G>A	Osteosclerotic bone dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAM20C gene located on chromosomal region 7p22.3. The age of onset is neonatal/infantile. This disease is characterized by generalized osteosclerosis with periosteal bone formation, characteristic facial dysmorphism, brain abnormalities including intracerebral calcifications, and neonatal lethal course. The prevalence is below 1/1,000,000.	600
FANCA	Fanconi anemia, complementation group A	NM_000135.2	NM_000135.2:c.3788_3790delTCT, NM_000135.2:c.2303T>C, NM_000135.2:c.3558_3559insG, NM_000135.2:c.4130C>G, NM_000135.2:c.233_236delTTGA, NM_000135.2:c.3763G>T, NM_000135.2:c.1115_1118delTTGG, NM_000135.2:c.131_132insA	Fanconi anemia complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCA gene located on chromosomal region 16q24.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCC	Fanconi anemia, complementation group C	NM_000136.2	NM_000136.2:c.1642C>T, NM_000136.2:c.37C>T, NM_000136.2:c.996+1G>T, NM_000136.2:c.67delG, NM_000136.2:c.416G>A, NM_000136.2:c.1015delA, NM_000136.2:c.1487T>G, NM_000136.2:c.1103_1104delTG	Fanconi anemia complementation group C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCC gene located on chromosomal region 9q22.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCD2	Fanconi anemia, complementation group D2	NM_033084.3	NM_033084.3:c.1278+1delG, NM_033084.3:c.2152C>T, NM_033084.3:c.2494+2T>C, NM_033084.3:c.958C>T, NM_033084.3:c.2444G>A, NM_033084.3:c.782A>T, NM_033084.3:c.904C>T	Fanconi anemia complementation group D2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCD2 gene located on chromosomal region 3p26. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCE	Fanconi anemia, complementation group E	NM_021922.2	NM_021922.2:c.1501C>T, NM_021922.2:c.929_930insC, NM_021922.2:c.421C>T, NM_021922.2:c.1114-8G>A, NM_021922.2:c.922_923insC, NM_021922.2:c.355C>T	Fanconi anemia complementation group E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCE gene located on chromosomal region 6p22-p21. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	600
FANCG	Fanconi anemia, complementation group G	NM_004629.1	NM_004629.1:c.1795_1804delTGGATCCGTC, NM_004629.1:c.313G>T, NM_004629.1:c.637_643delTACCGCC, NM_004629.1:c.1480+1G>C, NM_004629.1:c.1852_1853delAA, NM_004629.1:c.510+1G>A, NM_004629.1:c.1077-2A>G, NM_004629.1:c.908_909insCT	Fanconi anemia complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCG gene located on chromosomal region 9p13. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCI	Fanconi anemia, complementation group I	NM_001113378.1	NM_001113378.1:c.3816+1G>A, NM_001113378.1:c.52C>T, NM_001113378.1:c.989_991delTAA, NM_001113378.1:c.2097C>G, NM_001113378.1:c.3466G>C, NM_001113378.1:c.2292-1G>A, NM_001113378.1:c.3492delG, NM_001113378.1:c.3853C>T, NM_001113378.1:c.3626_3627delGT, NM_001113378.1:c.3854G>A	Fanconi anemia complementation group I follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCI gene located on chromosomal region 15q26.1. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCL	Fanconi anemia, complementation group L	NM_018062.3	NM_018062.3:c.1051_1052delAG, NM_018062.3:c.1066_1067delAG, NM_018062.3:c.1096_1099dupATTA, NM_018062.3:c.1099_1100insATTA	Fanconi anemia complementation group L follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCL gene located on chromosomal region 2p16.1. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FANCM	Fanconi anemia, complementation group M	NM_020937.2	NM_020937.2:c.2171C>A, NM_020937.2:c.5766_5769delGACT, NM_020937.2:c.5101C>T, NM_020937.2:c.1072G>T, NM_020937.2:c.2996_2997insC, NM_020937.2:c.2586_2589delAAAA, NM_020937.2:c.5791C>T, NM_020937.2:c.624_625delAA, NM_020937.2:c.5569G>A, NM_020937.2:c.5764_5767delCTGA	Fanconi anemia complementation group M follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCM gene located on chromosomal region 14q21.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FGA	Congenital fibrinogen deficiency (gene FGA)	NM_021871.2	NM_021871.2:c.1039C>T, NM_021871.2:c.1441delG, NM_021871.2:c.675_676insC, NM_021871.2:c.1359dupC, NM_021871.2:c.*1086delG, NM_021871.2:c.1906_1907insC	Congenital fibrinogen deficiency (gene FGA) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGA gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000.	600
FGB	Congenital afibrinogenemia	NM_005141.4	NM_005141.4:c.1289G>A, NM_005141.4:c.1148T>G, NM_005141.4:c.794C>T	Congenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGB gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000.	250,600
FGD4	Charcot-Marie-Tooth disease type 4H	NM_139241.2	NM_139241.2:c.1325G>A, NM_139241.2:c.893T>G, NM_139241.2:c.893T>C, NM_139241.2:c.670C>T	Charcot-Marie-Tooth disease type 4H follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGD4 gene located on chromosomal region 12p11.21. The age of onset is neonatal/infantile. This disease is characterized by slowly progressive muscle weakness in the distal extremities, and other common features include delayed walking, an abnormal gait, scoliosis and pes equines with toe retraction. The prevalence is 1/3,300.	600
FH	Fumaric aciduria	NM_000143.3	NM_000143.3:c.1067T>A, NM_000143.3:c.697C>T, NM_000143.3:c.698G>A, NM_000143.3:c.1236+1G>C, NM_000143.3:c.901dupA, NM_000143.3:c.320A>C, NM_000143.3:c.760C>T, NM_000143.3:c.1431_1433dupAAA, NM_000143.3:c.521C>G, NM_000143.3:c.1093A>G, NM_000143.3:c.1189G>A, NM_000143.3:c.1200delT, NM_000143.3:c.1394A>G, NM_000143.3:c.1255T>C, NM_000143.3:c.793G>A, NM_000143.3:c.40_41insC, NM_000143.3:c.1446_1449delAAAG, NM_000143.3:c.1293delA	Fumaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FH gene located on chromosomal region 1q42.1. The age of onset is neonatal/infantile. This disease is characterized by hypotonia, severe psychomotor impairment, convulsions, respiratory distress, feeding difficulties and frequent cerebral malformations, along with a distinctive facies, although some patients present with only moderate intellectual impairment. The prevalence is below 1,000,000.	600
FHL1	Emery-Dreifuss muscular dystrophy type 6	NM_001449.4	NM_001449.4:c.625T>C	Emery-Dreifuss muscular dystrophy tipe 6 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FHL1 gene located on chromosomal region Xq26. The age of onset is infantile. This disease is by muscular weakness and atrophy, with early joint contractures and cardiomyopathy. The prevalence is 1/1,000,000 to 9/1,000,000.	600
FHL1	Myopathy, reducing body	NM_001449.4	NM_001449.4:c.689-479G>A, NM_001449.4:c.310T>C	Reducing body myopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FH gene located on chromosomal region 1q42.1. The age of onset is neonatal/infantile. This disease is characterized by progressive muscle weakness and the presence of characteristic inclusion bodies in affected muscle fibres. The prevalence is below 1,000,000.	600
FIG4	Charcot-Marie-Tooth disease type 4J	NM_014845.5	NM_014845.5:c.592C>T, NM_014845.5:c.831_838delTAAATTTG, NM_014845.5:c.547C>T, NM_014845.5:c.501C>G, NM_014845.5:c.737G>A, NM_014845.5:c.122T>C, NM_014845.5:c.2296_2297insG	Charcot-Marie-Tooth disease type 4J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by rapidly progressive, asymmetric motor neuron degeneration with slow nerve conduction velocities, weakness and paralysis, without sensory loss. The prevalence is 4/100,000 to 8/100,000.	250,600
FIG4	Yunis-Varon syndrome	NM_014845.5	NM_014845.5:c.311G>A	Yunis-Varon syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by skeletal defects, including cleidocranial dysplasia and digital anomalies, and severe neurologic involvement with neuronal loss. Enlarged cytoplasmic vacuoles are found in neurons, muscle, and cartilage. The disorder is usually lethal in infancy. The prevalence is 4/100,000 to 8/100,000.	250,600
FKRP	Congenital muscular dystrophy type 5B	NM_024301.4	NM_024301.4:c.235G>A, NM_024301.4:c.1343C>T, NM_024301.4:c.1387A>G, NM_024301.4:c.1154C>A	Congenital muscular dystrophy type 5B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is neonatal/infantile. This disease is characterized by hypotonia, muscle wasting, weakness or delayed motor milestones. The prevalence is 1/14,500 to 1/123,000.	250,600
FKRP	Limb-girdle muscular dystrophy type 2I, autosomal recessive	NM_024301.4	NM_024301.4:c.160C>T	Autosomal recessive limb-girdle muscular dystrophy type 2I follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is infantile. This disease is characterized by proximal limb girdle weakness predominant in the legs, together with bilateral moderate scapulae winging, abdominal muscle weakness, waddling gait, calf hypertrophy, cardiomyopathy and respiratory insufficiency. The prevalence is 1/14,500 to 1/123,000.	250,600
FKTN	Fukuyama congenital muscular dystrophy	NM_001079802.1	NM_001079802.1:c.1112A>G, NM_001079802.1:c.509C>A, NM_001079802.1:c.411C>A, NM_001079802.1:c.1167dupA	Fukuyama congenital muscular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKTN gene located on chromosomal region 9q31-q33. The age of onset is infantile. This disease is characterized by brain malformation (cobblestone lissencephaly), dystrophic changes in skeletal muscle, severe intellectual deficit, epilepsy and motor impairment. The annual incidence is 1/50,000 to 2:50,000 live births in Japans and the prevalence is 1:1,000,000- 9:1,000,000.	600
FKTN	Muscular dystrophy, limb girdle, type 2M	NM_001079802.1	NM_001079802.1:c.1380dupA, NM_001079802.1:c.766C>T, NM_001079802.1:c.527T>C, NM_001079802.1:c.340G>A	Limb-girdle muscular dystrophy type 2M follows autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKTN gene located on chromosomal region 9q31-q33. The age of onset is from birth to early infancy. This disease is characterized by muscle weakness, joint contractures and spinal deformities. The prevalence is 1.92:100,000-3.68:100,000.	600
FLNA	Frontometaphyseal dysplasia	NM_001456.3	NM_001456.3:c.4447_4448insAT, NM_001456.3:c.760G>A, NM_001456.3:c.3476A>C, NM_001456.3:c.3557C>T	Fronto-metaphyseal dysplasia (FMD) follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FLNA gene located on chromosomal region Xq28. The age of onset is neonatal/infancy This disease is characterized by a characteristic face (prominent supraorbital ridges, hypertelorism, downslanted palpebral fissures, broad nasal bridge, and micrognathia with anomalies of teeth) and skeletal anomalies (fusion of carpal bones, increased density of long bone diaphyses, flared metaphyses and scoliosis). The prevalence is <1 / 1,000,000.	600
FLNA	Periventricular heterotopia	NM_001456.3	NM_001456.3:c.4543C>T, NM_001456.3:c.7129C>T, NM_001456.3:c.7733-1G>C, NM_001456.3:c.7527_7528+6delAGGTGAGC, NM_001456.3:c.5108_5109delTCinsAA, NM_001456.3:c.2761C>T, NM_001456.3:c.4777_4778dupAA	Periventricular heterotopia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FLNA gene located on chromosomal region Xq28. The age of onset is neonatal/infancy This disease is a brain malformation, due to abnormal neuronal migration, in which a subset of neurons fails to migrate into the developing cerebral cortex and remains as nodules that line the ventricular surface. Classical form is a rare X-linked dominant disorder far more frequent in females who present normal intelligence to borderline intellectual deficit, epilepsy of variable severity and extra-central nervous system signs, especially cardiovascular defects or coagulopathy. The disorder is generally associated with prenatal lethality in males. The prevalence is <1 / 1,000,000.	600
FLVCR1	Ataxia, posterior column, with retinitis pigmentosa	NM_014053.3	NM_014053.3:c.361A>G, NM_014053.3:c.574T>C, NM_014053.3:c.739-2delA	Posterior column ataxia - Retinitis pigmentosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FLVCR1 gene located on chromosomal region 1q32.3. The age of onset is childhood. This disease is characterized by sensory ataxia, proprioceptive loss and blindness. The prevalence is <1 / 1.000.000.	600
FMR1	Fragile X syndrome	-	(CGG)n pre-mutated allele (Detection by PCR and TP-PCR)	Fragile X syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FMR1 gene located on chromosomal region Xq27.3. The symptoms are variable depending on the range of CGG triplet expansion. In complete mutation the onset is infantile in men and is characterized by intellectual disability, characteristic appearance (large head, long face, prominent forehead and chin, protruding ears) joint laxity and large testes after puberty. In carrier female, the symptoms are milder and include primary ovarian insufficiency. The prevalence is 1/2,500 (full mutation allele) to 1/4,000 (prevalence of symptomatic cases) for both genders.	250,600
FOXN1	T-cell immunodeficiency, congenital alopecia, and nail dystrophy	NM_003593.2	NM_003593.2:c.763C>T	Severe T-cell immunodeficiency - congenital alopecia - nail dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FOXN1 gene located on chromosomal region 17q11.2. The age of onset is infantile. This disease is characterized by T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. The prevalence is <1:1,000,000.	600
FRAS1	Fraser syndrome	NM_025074.6	NM_025074.6:c.7813C>T, NM_025074.6:c.832_835delTGTG, NM_025074.6:c.11159_11166delAGCTGGAG, NM_025074.6:c.776T>G, NM_025074.6:c.6991_6992insGG, NM_025074.6:c.6433C>T, NM_025074.6:c.3799C>T, NM_025074.6:c.1071+1_1071+4delGTGA, NM_025074.6:c.4969+1_4969+2insTAGC, NM_025074.6:c.5605_5606insT	Fraser syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the genes FRAS1 (located on chromosomal region 4q21.21) and FREM2 (located on chromosomal region 13q13.3). The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000.	250,600
FREM2	Fraser syndrome	NM_207361.5	NM_207361.5:c.2361_2362insC, NM_207361.5:c.8409+1G>A, NM_207361.5:c.5914G>A, NM_207361.5:c.5920G>A, NM_207361.5:c.3792_3795delTTAT	Fraser syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the genes FRAS1 (located on chromosomal region 4q21.21) and FREM2 (located on chromosomal region 13q13.3). The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000.	600
FUCA1	Fucosidosis	NM_000147.4	NM_000147.4:c.244C>T, NM_000147.4:c.1279C>T, NM_000147.4:c.856C>T, NM_000147.4:c.648C>A, NM_000147.4:c.1229T>G, NM_000147.4:c.433T>C	Fucosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FUCA1 gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is characterized by facial dysmorphism, dysostosis multiplex, moderate hepatomegaly, severe intellectual deficit, deafness, and according to age, angiokeratomas. The prevalence is <1:1,000,000.	600
FXN	Friedreich ataxia	NM_000144.4	NM_000144.4:c.389G>T, NM_000144.4:c.460A>T, NM_000144.4:c.385-2A>G, NM_000144.4:c.317T>G	Friedreich ataxia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FXN gene located on chromosomal region 9q21.11. The age of onset is between age 10 and 15 years and usually before age 25 years. This disease is characterized by slowly progressive ataxia, dysarthria, muscle weakness, spasticity in the lower limbs, scoliosis, bladder dysfunction, absent lower limb reflexes, and loss of position and vibration sense. The prevalence is 2:100,000-4:100,000.	600
G6PC	Glycogen storage disease type 1a	NM_000151.3	NM_000151.3:c.508C>T, NM_000151.3:c.551G>A, NM_000151.3:c.447-1G>A, NM_000151.3:c.1039C>T, NM_000151.3:c.562G>C, NM_000151.3:c.380_381insTA, NM_000151.3:c.497T>G, NM_000151.3:c.247C>T, NM_000151.3:c.113A>T, NM_000151.3:c.229T>C, NM_000151.3:c.230+1G>C, NM_000151.3:c.47C>G, NM_000151.3:c.883C>T, NM_000151.3:c.370G>A, NM_000151.3:c.626A>G, NM_000151.3:c.248G>A	Glycogen storage disease type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000.	250,600
G6PC3	Severe congenital neutropenia type 4	NM_138387.3	NM_138387.3:c.346A>G, NM_138387.3:c.141C>G, NM_138387.3:c.778G>C, NM_138387.3:c.758G>A, NM_138387.3:c.935_936insT, NM_138387.3:c.784G>C	Severe congenital neutropenia type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC3 gene located on chromosomal region 17q21.31. This disease is characterized by familial pulmonary arterial hypertension, cardiac abnormalities including atrial septal defect, leukopenia including intermittent neutropenia, lymphopenia, monocytosis, and anemia. The prevalence is 1:100,000.	600
GAA	Glycogen storage disease type 2	NM_000152.3	NM_000152.3:c.118C>T, NM_000152.3:c.1316T>A, NM_000152.3:c.1799G>A, NM_000152.3:c.1827_1828insA, NM_000152.3:c.1846_1847insA, NM_000152.3:c.1115A>T, NM_000152.3:c.1552-3C>G, NM_000152.3:c.1445C>T, NM_000152.3:c.2238G>C, NM_000152.3:c.1327-2A>G, NM_000152.3:c.1650dupG, NM_000152.3:c.2238G>A, NM_000152.3:c.307T>G, NM_000152.3:c.230_240delCAGTGCCCACA, NM_000152.3:c.2512C>T, NM_000152.3:c.1431delT, NM_000152.3:c.1561G>A, NM_000152.3:c.1465G>A, NM_000152.3:c.1548G>A, NM_000152.3:c.546G>A, NM_000152.3:c.1064T>C, NM_000152.3:c.877G>A, NM_000152.3:c.925G>A, NM_000152.3:c.768_769insT, NM_000152.3:c.2560C>T, NM_000152.3:c.655G>A, NM_000152.3:c.1408_1410delAAC, NM_000152.3:c.953T>C, NM_000152.3:c.1933G>T, NM_000152.3:c.1935C>A, NM_000152.3:c.1585_1586delTCinsGT, NM_000152.3:c.1927G>A, NM_000152.3:c.2041-1G>A, NM_000152.3:c.2066_2070dupAGCCG, NM_000152.3:c.2105G>T, NM_000152.3:c.2237G>A, NM_000152.3:c.525delT, NM_000152.3:c.546+1_546+4delGTGG, NM_000152.3:c.2544delC, NM_000152.3:c.1912G>T, NM_000152.3:c.1634C>T, NM_000152.3:c.710C>T, NM_000152.3:c.2015G>A, NM_000152.3:c.546G>C, NM_000152.3:c.2012T>G, NM_000152.3:c.853C>T, NM_000152.3:c.697delA	Glycogen storage disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAA gene located on chromosomal region 17q25.3. There are two forms: adult and infantile.The age of onset in this last form is before the age of three months. This disease is characterized by severe hypotonia, hypertrophic cardiomyopathy and progressive hepatomegaly. The incidence is 1/57,000 for the adult form and 1/138,000 for infantile form.	250,600
GALC	Krabbe disease	NM_000153.3	NM_000153.3:c.1591C>T, NM_000153.3:c.1161+2T>G, NM_000153.3:c.1586C>T, NM_000153.3:c.1592G>A, NM_000153.3:c.1489+1_1489+2delGT, NM_000153.3:c.582+1G>A, NM_000153.3:c.388G>A, NM_000153.3:c.430delA, NM_000153.3:c.1695delT, NM_000153.3:c.1472delA, NM_000153.3:c.1004A>G, NM_000153.3:c.1153G>T, NM_000153.3:c.658C>T, NM_000153.3:c.1543G>A, NM_000153.3:c.332G>A, NM_000153.3:c.334A>G, NM_000153.3:c.205C>T, NM_000153.3:c.1796T>G, NM_000153.3:c.1814dupA, NM_000153.3:c.1700A>C, NM_000153.3:c.1723_1724insT, NM_000153.3:c.1964delC, NM_000153.3:c.236G>A, NM_000153.3:c.1488_1489+2delTGGT, NM_000153.3:c.453G>A, NM_000153.3:c.1488_1489delTG, NM_000153.3:c.628A>T, NM_000153.3:c.655C>T, NM_000153.3:c.953C>G, NM_000153.3:c.2056T>C	Krabbe disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALC gene located on chromosomal region 14q31.3. There are two forms of the disease: infantile form (2-6 months onset) more severe and adult form less severe. It is a degenerative disorder that affects the nervous system characterized by a muscle stiffness, blindness, deafness, and eventually death. The incidence is 1/100,000-1/250,000 and the prevalence is 1/100,000.	250,600
GALT	Galactosemia	NM_000155.3	NM_000155.3:c.130G>A, NM_000155.3:c.132delG, NM_000155.3:c.118G>T, NM_000155.3:c.265T>G, NM_000155.3:c.289_291delAAC, NM_000155.3:c.1138T>C, NM_000155.3:c.113A>C, NM_000155.3:c.152G>A, NM_000155.3:c.1048delA, NM_000155.3:c.290A>G, NM_000155.3:c.221T>C, NM_000155.3:c.253-2A>G, NM_000155.3:c.425T>A, NM_000155.3:c.428C>T, NM_000155.3:c.442C>T, NM_000155.3:c.143G>C, NM_000155.3:c.443G>A, NM_000155.3:c.158G>A, NM_000155.3:c.18delC, NM_000155.3:c.199C>T, NM_000155.3:c.200G>A, NM_000155.3:c.203A>C, NM_000155.3:c.218_219delCT, NM_000155.3:c.512T>C, NM_000155.3:c.547C>A, NM_000155.3:c.552C>A, NM_000155.3:c.563A>G, NM_000155.3:c.565_578delGTATGGGCCAGCAG, NM_000155.3:c.568T>C, NM_000155.3:c.580T>C, NM_000155.3:c.584T>C, NM_000155.3:c.598delC, NM_000155.3:c.601C>T, NM_000155.3:c.602G>A, NM_000155.3:c.1030C>A, NM_000155.3:c.510C>A, NM_000155.3:c.617A>G, NM_000155.3:c.619C>T, NM_000155.3:c.626A>G, NM_000155.3:c.634C>T, NM_000155.3:c.688-2A>C, NM_000155.3:c.692G>A, NM_000155.3:c.292G>A, NM_000155.3:c.329-2A>C, NM_000155.3:c.367C>T, NM_000155.3:c.377+7A>C, NM_000155.3:c.386T>C, NM_000155.3:c.607G>A, NM_000155.3:c.610C>T, NM_000155.3:c.413C>T, NM_000155.3:c.416T>G, NM_000155.3:c.41delinsTT, NM_000155.3:c.904+1G>T, NM_000155.3:c.905-2A>G, NM_000155.3:c.907G>A, NM_000155.3:c.442G>A, NM_000155.3:c.947G>A, NM_000155.3:c.443G>C, NM_000155.3:c.445dupG, NM_000155.3:c.997C>G, NM_000155.3:c.997C>T, NM_000155.3:c.998G>A, NM_000155.3:c.793C>G, NM_000155.3:c.820+13A>G, NM_000155.3:c.1052delC, NM_000155.3:c.844C>G, NM_000155.3:c.855G>T, NM_000155.3:c.719_728delTAGTACTGGT, NM_000155.3:c.772C>T, NM_000155.3:c.939G>A, NM_000155.3:c.71_72insA, NM_000155.3:c.404C>T, NM_000155.3:c.508-1G>C, NM_000155.3:c.775C>T, NM_000155.3:c.400delT, NM_000155.3:c.502_504delGTG, NM_000155.3:c.957C>A, NM_000155.3:c.823C>G, NM_000155.3:c.505C>A, NM_000155.3:c.1006A>T, NM_000155.3:c.985T>C, NM_000155.3:c.790delC, NM_000155.3:c.790_792delinsTAG	Galactosemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALT gene located on chromosomal region 9p13.3. The age of onset is neonatal. This disease is characterized by feeding difficulties, lethargy, and severe liver disease. Long-term complications appear including cognitive impairments, motor deficits, and ovarian dysfunction with reduced fertility in women and diminished bone density. The prevalence is 1/40,000-1/60,000.	250,600
GAMT	Guanidinoacetate methyltransferase deficiency	NM_000156.5	NM_000156.5:c.506G>A, NM_000156.5:c.590T>C	Guanidinoacetate methyltransferase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAMT gene located on chromosomal region 19p13.3. The age of onset is infantile. This disease is characterized by intellectual disability, seizures and behavioral problems, often in conjunction with pyramidal and/or extrapyramidal manifestations with muscular hypotony. Biochemical symptoms are also included with high urinary excretion of guanidinoacetate, low urinary excretion of creatinine and creatine depletion in brain and muscles.	600
GAN	Giant axonal neuropathy	NM_022041.3	NM_022041.3:c.1447C>T, NM_022041.3:c.1456G>A, NM_022041.3:c.1684C>G, NM_022041.3:c.1429C>T, NM_022041.3:c.601C>T, NM_022041.3:c.413G>A, NM_022041.3:c.505G>A, NM_022041.3:c.1268T>C	Giant axonal neuropathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAN gene located on chromosomal region 16q23.2. The age of onset is infantile. This disease is characterized by a progressive motor and sensitive peripheral and central nervous system neuropathy. Twenty families have been reported with this disease but the frequency is likely to be under-estimated.	250,600
GBA	Gaucher disease	NM_001005741.2	NM_001005741.2:c.1093G>A, NM_001005741.2:c.1090G>A, NM_001005741.2:c.1043C>T, NM_001005741.2:c.1274dupA, NM_001005741.2:c.1098dupA, NM_001005741.2:c.1085C>T, NM_001005741.2:c.1102C>T, NM_001005741.2:c.1049A>G, NM_001005741.2:c.1240G>T, NM_001005741.2:c.1246G>A, NM_001005741.2:c.1301G>C, NM_001005741.2:c.1088T>C, NM_001005741.2:c.1348T>A, NM_001005741.2:c.1361C>G, NM_001005741.2:c.1342G>C, NM_001005741.2:c.1448T>C, NM_001005741.2:c.1448T>G, NM_001005741.2:c.1504C>T, NM_001005741.2:c.1447_1466delCTGGACGCAGTGGCACTGATinsTG, NM_001005741.2:c.254G>A, NM_001005741.2:c.259C>T, NM_001005741.2:c.1053G>T, NM_001005741.2:c.160G>T, NM_001005741.2:c.431T>G, NM_001005741.2:c.475C>T, NM_001005741.2:c.476G>A, NM_001005741.2:c.481C>T, NM_001005741.2:c.487delG, NM_001005741.2:c.497A>T, NM_001005741.2:c.508C>T, NM_001005741.2:c.1141T>G, NM_001005741.2:c.115+1G>A, NM_001005741.2:c.1171G>C, NM_001005741.2:c.1174C>G, NM_001005741.2:c.354G>C, NM_001005741.2:c.1060G>C, NM_001005741.2:c.1208G>C, NM_001005741.2:c.1228C>G, NM_001005741.2:c.123A>G, NM_001005741.2:c.1240G>C, NM_001005741.2:c.914delC, NM_001005741.2:c.517A>C, NM_001005741.2:c.1295G>T, NM_001005741.2:c.1307T>C, NM_001005741.2:c.1265_1319del, NM_001005741.2:c.1319C>T, NM_001005741.2:c.1309G>T, NM_001005741.2:c.1226A>G, NM_001005741.2:c.407C>A, NM_001005741.2:c.1343A>T, NM_001005741.2:c.84_85insG, NM_001005741.2:c.518C>T, NM_001005741.2:c.1391A>C, NM_001005741.2:c.509G>T, NM_001005741.2:c.1604G>A, NM_001005741.2:c.84dupG, NM_001005741.2:c.535G>C, NM_001005741.2:c.586A>C, NM_001005741.2:c.1297G>T, NM_001005741.2:c.1184C>T, NM_001005741.2:c.1192C>T	Gaucher disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBA gene located on chromosomal region 1q22. Gaucher disease encompasses a continuum of clinical findings from a perinatal lethal disorder to an asymptomatic type. There are three major clinical types (1, 2, and 3) and two other subtypes (perinatal-lethal and cardiovascular). Type 1 is characterized by the presence of clinical or radiographic evidence of bone disease, hepatosplenomegaly, anemia and thrombocytopenia, lung disease, and the absence of primary central nervous system disease. GD types 2 and 3 are characterized by the presence of primary neurologic disease. Type 2 has an onset before age two years, limited psychomotor development, and a rapidly progressive course with death by age two to four years. Type 3 may have onset before age two years, but often have a more slowly progressive course, with survival into the third or fourth decade. The perinatal-lethal form is associated with ichthyosiform or collodion skin abnormalities or with nonimmune hydrops fetalis. The cardiovascular form is characterized by calcification of the aortic and mitral valves, mild splenomegaly, corneal opacities, and supranuclear ophthalmoplegia. Cardiopulmonary complications have been described with all the clinical subtypes, although varying in frequency and severity. The incidence is 1/60,000 and the prevalence is approximately 1/100,000.	250,600
GBE1	Glycogen storage disease type 4	NM_000158.3	NM_000158.3:c.1571G>A, NM_000158.3:c.1570C>T, NM_000158.3:c.1774G>T, NM_000158.3:c.771T>A, NM_000158.3:c.1543C>T, NM_000158.3:c.1883A>G, NM_000158.3:c.2052+1G>A, NM_000158.3:c.986A>C, NM_000158.3:c.466_470delCGTAT, NM_000158.3:c.1604A>G	Glycogen storage disease type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is infantile. This disease is characterized by failure to thrive; hepatomegaly, liver dysfunction, and progressive liver cirrhosis; hypotonia; cardiomyopathy and, finally, death.	250,600
GBE1	Polyglucosan body disease, adult	NM_000158.3	NM_000158.3:c.986A>G	Polyglucosan body disease, adult form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is late-onset, slowly progressive disorder affecting the central and peripheral nervous systems. This disease is characterized by a variable combination of cognitive impairment, pyramidal tetraparesis, peripheral neuropathy, and neurogenic bladder. Other manifestations include cerebellar dysfunction and extrapyramidal signs.	250,600
GCDH	Glutaric acidemia type 1	NM_000159.3	NM_000159.3:c.1093G>A, NM_000159.3:c.1060G>C, NM_000159.3:c.542A>G, NM_000159.3:c.442G>A, NM_000159.3:c.1199dupT, NM_000159.3:c.572T>C, NM_000159.3:c.1060G>A, NM_000159.3:c.1247C>T, NM_000159.3:c.74C>A, NM_000159.3:c.947C>A, NM_000159.3:c.1168G>C, NM_000159.3:c.416C>T, NM_000159.3:c.1198G>A, NM_000159.3:c.636-1G>A, NM_000159.3:c.1204C>T, NM_000159.3:c.1244-2A>C, NM_000159.3:c.751C>T, NM_000159.3:c.1262C>T, NM_000159.3:c.1148G>A, NM_000159.3:c.680G>C, NM_000159.3:c.883T>C, NM_000159.3:c.1015A>G, NM_000159.3:c.764C>T, NM_000159.3:c.271+1G>A, NM_000159.3:c.743C>T, NM_000159.3:c.877G>A, NM_000159.3:c.914C>T, NM_000159.3:c.1002_1003delGA, NM_000159.3:c.383G>A, NM_000159.3:c.769C>T	Glutaric acidemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCDH gene located on chromosomal region 19p13.2. The age of onset is infantile or neonatal. This disease is characterized by encephalopathic crises resulting in striatal injury and a severe dystonic dyskinetic movement disorder. The prevalence is 1 in 100,000 births.	250,600
GCSH	Glycine encephalopathy (GCSH)	NM_004483.4	NM_004483.4:c.337dupT	Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCSH gene located on chromosomal region 16q23.2. The age of onset is neonatal. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures.	600
GDAP1	Charcot-Marie-Tooth disease type 4A	NM_018972.2	NM_018972.2:c.358C>T, NM_018972.2:c.487C>T, NM_018972.2:c.311-1G>A, NM_018972.2:c.844C>T, NM_018972.2:c.715C>T, NM_018972.2:c.92G>A	Charcot-Marie-Tooth disease type 4A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GDAP1 gene located on chromosomal region 8q21.11. It is a severe, early-onset form of demyelinating CMT peripheral sensorimotor polyneuropathy characterized by severe motor retardation and progressive scoliosis. Vocal cord paresis may also occur.	600
GFM1	Combined oxidative phosphorylation deficiency type 1	NM_024996.5	NM_024996.5:c.1294_1297delACAG, NM_024996.5:c.748C>T, NM_024996.5:c.139C>T, NM_024996.5:c.1528_1529delAG, NM_024996.5:c.521A>G	Combined oxidative phosphorylation deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GFM1 gene located on chromosomal region 3q25.32. The age of onset is from early infancy until adult. This disease is characterized by ptosis, external ophthalmoplegia, proximal myopathy and exercise intolerance, cardiomyopathy, sensorineural deafness, optic atrophy, pigmentary retinopathy, and diabetes mellitus.	600
GJA1	Oculodentodigital dysplasia	NM_000165.4	NM_000165.4:c.227G>A, NM_000165.4:c.97C>T	Oculodentodigital dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJA1 gene located on chromosomal region 6q22.31. The age of onset is infantile. This disease is characterized by craniofacial, neurologic, limb and ocular abnormalities.	600
GJB2	Deafness type 1A, autosomal recessive	NM_004004.5	NM_004004.5:c.176_191delGCTGCAAGAACGTGTG, NM_004004.5:c.169C>T, NM_004004.5:c.270dupA, NM_004004.5:c.239A>C, NM_004004.5:c.269T>C, NM_004004.5:c.427C>T, NM_004004.5:c.299_300delAT, NM_004004.5:c.250G>T, NM_004004.5:c.230G>A, NM_004004.5:c.516G>A, NM_004004.5:c.439G>A, NM_004004.5:c.465T>A, NM_004004.5:c.229T>C, NM_004004.5:c.241C>G, NM_004004.5:c.235delC, NM_004004.5:c.238C>T, NM_004004.5:c.557C>T, NM_004004.5:c.269_270insT, NM_004004.5:c.617A>G, NM_004004.5:c.231G>A, NM_004004.5:c.310_323delAGGAAGTTCATCAA, NM_004004.5:c.313_326delAAGTTCATCAAGGG, NM_004004.5:c.358_360delGAG, NM_004004.5:c.35delG, NM_004004.5:c.249C>G, NM_004004.5:c.334_335delAA, NM_004004.5:c.402delG, NM_004004.5:c.413G>A, NM_004004.5:c.416G>A, NM_004004.5:c.299A>T, NM_004004.5:c.250G>C, NM_004004.5:c.550C>T, NM_004004.5:c.551G>C, NM_004004.5:c.503A>G, NM_004004.5:c.227T>C, NM_004004.5:c.380G>A, NM_004004.5:c.132G>A, NM_004004.5:c.365A>T, NM_004004.5:c.139G>T	Deafness, autosomal recessive type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 and GJB3 genes located on chromosomal regions 13q12.11 and 1p34.3 respectively. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.	250,600
GJB3	Deafness type 1A, autosomal recessive	NM_024009.2	NM_024009.2:c.529T>G, NM_024009.2:c.580G>A, NM_024009.2:c.94C>T	Deafness, autosomal recessive type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 and GJB3 genes located on chromosomal regions 13q12.11 and 1p34.3 respectively. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.	250,600
GJB6	Deafness type 1B, autosomal recessive	NM_006783.4	NM_006783.4:c.261dupA, NM_006783.4:c.169C>T, NM_006783.4:c.485dupA, NM_006783.4:c.689dupA, NM_006783.4:c.14C>T, NM_006783.4:c.443delC, NM_006783.4:c.383_384delTA, NM_006783.4:c.689_690insA	Nonsyndromic sensorineural deafness, autosomal recessive type DFNB1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB6 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.	250,600
GJC2	Pelizaeus-Merzbacher-like disease type 1	NM_020435.3	NM_020435.3:c.857T>C, NM_020435.3:c.814T>G, NM_020435.3:c.613C>T, NM_020435.3:c.787G>A, NM_020435.3:c.718C>T, NM_020435.3:c.268C>T	Pelizaeus-Merzbacher-like disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJC2 gene located on chromosomal region 1q42.13. It is an autosomal recessive leukodystrophy sharing identical clinical and radiological features as X-linked Pelizaeus-Merzbacher disease. The age of onset is early infantile. This disease is characterized by nystagmus, delayed motor milestones, ataxia, progressive spasticity, partial seizures, mild peripheral neuropathy, and diffuse leukodystrophy. The prevalence is <1.27:100,000.	600
GLB1	GM1 Gangliosidosis	NM_000404.2	NM_000404.2:c.1369C>T, NM_000404.2:c.1370G>A, NM_000404.2:c.1452C>G, NM_000404.2:c.176G>A, NM_000404.2:c.276G>A, NM_000404.2:c.1733A>G, NM_000404.2:c.1355dupA, NM_000404.2:c.442C>A, NM_000404.2:c.202C>T, NM_000404.2:c.591_592insT, NM_000404.2:c.622C>T, NM_000404.2:c.1549G>T, NM_000404.2:c.442C>T, NM_000404.2:c.457+2T>C, NM_000404.2:c.947A>G, NM_000404.2:c.438_440delTCT, NM_000404.2:c.601C>T, NM_000404.2:c.602G>A, NM_000404.2:c.1068+1G>T, NM_000404.2:c.1174_1175delCT, NM_000404.2:c.1004C>T, NM_000404.2:c.1051C>T, NM_000404.2:c.171C>G, NM_000404.2:c.1321G>A, NM_000404.2:c.1325G>A, NM_000404.2:c.818G>T, NM_000404.2:c.152T>C, NM_000404.2:c.1456_1466dupGGTGCATATAT, NM_000404.2:c.145C>T, NM_000404.2:c.175C>T, NM_000404.2:c.901G>A, NM_000404.2:c.1646C>T, NM_000404.2:c.1577dupG, NM_000404.2:c.1310A>T	Gangliosidosis GM1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. Although the three types differ in severity, their features can overlap significantly. The age of onset in type 1 is infantile, in type 2 is late-infantile or juvenile and adult in type3. This disease is characterized by arrest/regression of neurological development, hypotonia, visceromegaly, macular cherry-red spots, dysostosis and coarse facial features. The prevalence is 1:100,000 a 200,000 newborn.	250,600
GLB1	Mucopolysaccharidosis type 4B	NM_000404.2	NM_000404.2:c.1444C>T, NM_000404.2:c.1313G>A, NM_000404.2:c.817T>C, NM_000404.2:c.1445G>A, NM_000404.2:c.1223A>C	Mucopolysaccharidosis type 4B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. The age of onset is variable infantile/juvenile. In addition to skeletal involvement, significant morbidity can result from respiratory compromise, obstructive sleep apnea, valvular heart disease, hearing impairment, corneal clouding, and spinal cord compression. The prevalence is 1:200,000-1:300,000.	250,600
GLDC	Glycine encephalopathy	NM_000170.2	NM_000170.2:c.322G>T, NM_000170.2:c.1229G>A, NM_000170.2:c.1545G>C, NM_000170.2:c.1691G>T, NM_000170.2:c.1166C>T, NM_000170.2:c.2113G>A, NM_000170.2:c.2284G>A, NM_000170.2:c.1705G>A, NM_000170.2:c.2216G>A, NM_000170.2:c.2405C>T	Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMT and GLDC genes located on chromosomal regions 3p21.31 and 9p24.1 respectively. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000.	250,600
GLE1	Lethal arthrogryposis with anterior horn cell disease	NM_001003722.1	NM_001003722.1:c.2051T>C, NM_001003722.1:c.1412_1413delAG, NM_001003722.1:c.898-2A>G, NM_001003722.1:c.2069_2072delTTCT, NM_001003722.1:c.1807C>T	Lethal arthrogryposis with anterior horn cell disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLE1 gene located on chromosomal region 9q34.11. The age of onset is fetal. This disease is characterized by fetal akinesia, arthrogryposis and motor neuron loss. The fetus often survives delivery, but dies early as a result of respiratory failure. Neuropathological findings resemble those of lethal congenital contracture syndrome type 1, but are less severe.	250,600
GM2A	GM2 Gangliosidosis	NM_000405.4	NM_000405.4:c.285delC, NM_000405.4:c.160G>T, NM_000405.4:c.506G>C	GM2-gangliosidosis, AB variant follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GM2A gene located on chromosomal region 5q33.1. The age of onset is infantile. This disease is characterized by a group of neurodegenerative disorders: seizures, blindness, spasticity, eventual total incapacitation, and death. The prevalence is <1:100.000.	600
GNE	Distal myopathy Nonaka type	NM_005476.5	NM_005476.5:c.2116T>C, NM_005476.5:c.2135T>C, NM_005476.5:c.2086G>A, NM_005476.5:c.478C>T, NM_005476.5:c.1844C>G, NM_005476.5:c.737G>A, NM_005476.5:c.385C>T, NM_005476.5:c.1714G>T, NM_005476.5:c.1798G>A, NM_005476.5:c.2086G>T, NM_005476.5:c.787C>T, NM_005476.5:c.2023T>C, NM_005476.5:c.1993G>A, NM_005476.5:c.673G>A, NM_005476.5:c.909T>A, NM_005476.5:c.1727G>A	Distal myopathy, Nonaka type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNE gene located on chromosomal region 9p13.3. The age of onset is adult. This disease is characterized by progressive muscle weakness and joint deformity. The prevalence is 1:500-1:1,000.	250,600
GNPTAB	Mucolipidosis type 2/type 3	NM_024312.4	NM_024312.4:c.1931C>T, NM_024312.4:c.1799delC, NM_024312.4:c.3503_3504delTC, NM_024312.4:c.3173C>G, NM_024312.4:c.25C>T, NM_024312.4:c.3663delG, NM_024312.4:c.1906dupA, NM_024312.4:c.2383delG, NM_024312.4:c.732_733delAA, NM_024312.4:c.749dupA, NM_024312.4:c.2896delA, NM_024312.4:c.648_651delAGAA, NM_024312.4:c.3326dupA, NM_024312.4:c.3410T>A, NM_024312.4:c.10A>C, NM_024312.4:c.1000C>T, NM_024312.4:c.1196C>T, NM_024312.4:c.1759C>T, NM_024312.4:c.3565C>T, NM_024312.4:c.616_619delACAG, NM_024312.4:c.99delC, NM_024312.4:c.3598G>A, NM_024312.4:c.3560_3561delAG	Mucolipidosis type 2/type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNPTAB gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by growth retardation, skeletal abnormalities, facial dysmorphism, stiff skin, developmental delay and cardiomegaly and that is lethal in childhood. The prevalence is 1:123,500-1:625,500.	250,600
GNS	Mucopolysaccharidosis type 3D	NM_002076.3	NM_002076.3:c.1063C>T, NM_002076.3:c.1226dupG, NM_002076.3:c.1169delA, NM_002076.3:c.1168C>T, NM_002076.3:c.413C>G	Mucolipidosis type 3D (Sanfilippo disease) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNS gene located on chromosomal region 12q14.3. The age of onset is infantile. This disease is characterized by joint stiffness and pain initially in the shoulders, hips, and fingers; and gradual mild coarsening of facial features, cardiorespiratory complications and mild cognitive impairment. The incidence is 1:70,000 newborn.	600
GPR143	Ocular albinism, X-linked	NM_000273.2	NM_000273.2:c.992_993insCG, NM_000273.2:c.695C>A	X-linked recessive ocular albinism follows an X-linked pattern of inheritance and is caused by pathogenic variants in the GPR143 gene located on chromosomal region Xp22.2. The age of onset is infantile. This disease is characterized by ocular hypopigmentation, foveal hypoplasia, nystagmus, photodysphoria, and reduced visual acuity. The prevalence is 1/60,000 to 1/150,000 live male births.	600
GPR179	Night blindness, congenital stationary type 1E	NM_001004334.3	NM_001004334.3:c.1784+1G>A, NM_001004334.3:c.1368delT, NM_001004334.3:c.3656_3657delCT, NM_001004334.3:c.6847_6848delCT, NM_001004334.3:c.984delC, NM_001004334.3:c.1807C>T, NM_001004334.3:c.278_279insC, NM_001004334.3:c.5693_5694insT, NM_001004334.3:c.278delC, NM_001004334.3:c.1236G>A, NM_001004334.3:c.376G>C, NM_001004334.3:c.3233_3234delCT, NM_001004334.3:c.5763_5764delGA, NM_001004334.3:c.839_842delATCA, NM_001004334.3:c.4699_4700delAG	Congenital stationary night blindness type 1E follow an autosomal recessive, dominant or X-linked pattern of inheritance and is caused by pathogenic variants in the GPR179 gene located on chromosomal region 17q12. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity.	250,600
GPR98	Usher syndrome type 2C	NM_032119.3	NM_032119.3:c.11377G>T, NM_032119.3:c.8713_8716dupAACA, NM_032119.3:c.2864C>A, NM_032119.3:c.18131A>G, NM_032119.3:c.2258_2270delAAGTGCTGAAATC, NM_032119.3:c.6275-1G>A, NM_032119.3:c.2636C>T, NM_032119.3:c.14973-1G>C, NM_032119.3:c.17668_17669delAT, NM_032119.3:c.5357_5358delAA, NM_032119.3:c.5747C>T, NM_032119.3:c.15196_15199dupCAAA, NM_032119.3:c.3151G>T, NM_032119.3:c.6901C>T, NM_032119.3:c.8790delC, NM_032119.3:c.5830G>A, NM_032119.3:c.6311_6312insT	Usher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR98 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32 respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000.	250,600
GRHPR	Primary hyperoxaluria type 2	NM_012203.1	NM_012203.1:c.103delG, NM_012203.1:c.295C>T, NM_012203.1:c.755dupA, NM_012203.1:c.622C>T, NM_012203.1:c.435G>A	Primary hyperoxaluria type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRHPR gene located on chromosomal region 9p13.2. The age of onset is infantile. This disease is characterized by recurrent nephrolithiasis, nephrocalcinosis and end-stage renal disease with subsequent systemic oxalosis.	600
GRM6	Night blindness, congenital stationary type 1B	NM_000843.3	NM_000843.3:c.2341G>A, NM_000843.3:c.727_728insG, NM_000843.3:c.2213_2219delCCAGAGG, NM_000843.3:c.1861C>T, NM_000843.3:c.2560C>T, NM_000843.3:c.712C>T, NM_000843.3:c.2122C>T, NM_000843.3:c.719_720insG, NM_000843.3:c.1214T>C, NM_000843.3:c.1336C>T, NM_000843.3:c.1258C>T, NM_000843.3:c.1565G>A	Congenital stationary night blindness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRM6 gene located on chromosomal region 5q35.3. The age of onset is early infancy. This disease is characterized by hemeralopia with a moderate loss of visual acuity.	250,600
GRXCR1	Deafness type 25, autosomal recessive	NM_001080476.2	NM_001080476.2:c.229C>T, NM_001080476.2:c.190G>A, NM_001080476.2:c.710_711delAT	Autosomal recessive nonsyndromic sensorineural deafness type DFNB25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRXCR1 gene located on chromosomal region 4p13. The age of onset is infantile. This disease is characterized by hearing loss which is not associated visible abnormalities of the external ear or any related medical problems.	600
GSS	Glutathione synthetase deficiency	NM_000178.2	NM_000178.2:c.656A>G, NM_000178.2:c.847C>T, NM_000178.2:c.754C>T, NM_000178.2:c.799C>T, NM_000178.2:c.4delG, NM_000178.2:c.656A>C, NM_000178.2:c.491G>A, NM_000178.2:c.832C>T	Glutathione synthetase deficiency with 5-oxoprolinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GSS gene located on chromosomal region 20q11.22. The severity and age of onset are variable. This disease is characterized by affectation of the neutrophil respiratory burst and can increase host susceptibility to infections, is associated with hemolytic anemia and intellectual disability. The prevalence is <1:1,000,000.	600
GUCY2D	Leber congenital amaurosis type 1	NM_000180.3	NM_000180.3:c.1694T>C, NM_000180.3:c.2735_2736delTT, NM_000180.3:c.456C>A, NM_000180.3:c.622delC, NM_000180.3:c.2734_2735delTT, NM_000180.3:c.2945delG	Leber congenital amaurosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUCY2D gene located on chromosomal region 17p13.1. The age of onset is infantile. This disease is characterized by blindness, nystagmus, roving eye movement and severe visual impairment.	600
GUSB	Mucopolysaccharidosis type 7	NM_000181.3	NM_000181.3:c.1065+1G>T, NM_000181.3:c.1084G>A, NM_000181.3:c.1144C>T, NM_000181.3:c.1337G>A, NM_000181.3:c.1222C>T, NM_000181.3:c.1730G>T, NM_000181.3:c.1831C>T, NM_000181.3:c.1856C>T, NM_000181.3:c.1881G>T, NM_000181.3:c.442C>T, NM_000181.3:c.499C>T, NM_000181.3:c.526C>T, NM_000181.3:c.646C>T, NM_000181.3:c.820_821delAC, NM_000181.3:c.1061C>T, NM_000181.3:c.1050G>C, NM_000181.3:c.1534G>A, NM_000181.3:c.1244C>T, NM_000181.3:c.1219_1220insC, NM_000181.3:c.866G>A, NM_000181.3:c.1244+1G>A, NM_000181.3:c.1521G>A, NM_000181.3:c.1429C>T, NM_000181.3:c.1618G>T, NM_000181.3:c.1338G>A	Mucopolysaccharidosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUSB gene located on chromosomal region 7q11.21. The age of onset is variable. There are prenatal forms with non-immune hydrops fetalis, and severe neonatal forms with dysmorphism, hernias, hepatosplenomegaly, club feet, dysostosis, severe hypotonia and neurological disorders that ultimately lead to profound intellectual deficit and small stature in patients that survive. Finally, there are also very mild cases that are discovered during adolescence or adulthood following presentation with thoracic kyphosis. The prevalence is 1:250,000 in newborn.	250,600
HADHA	Trifunctional protein deficiency	NM_000182.4	NM_000182.4:c.1918C>T, NM_000182.4:c.274_278delTCATC, NM_000182.4:c.2131C>A, NM_000182.4:c.1793_1794delAT, NM_000182.4:c.1620+2_1620+6delTAAGG, NM_000182.4:c.2027G>A, NM_000182.4:c.1678C>T, NM_000182.4:c.2132_2133insC, NM_000182.4:c.2146+1G>A, NM_000182.4:c.919-2A>G, NM_000182.4:c.1644delC, NM_000182.4:c.1132C>T, NM_000182.4:c.1528G>C, NM_000182.4:c.499delA, NM_000182.4:c.845T>A, NM_000182.4:c.1422dupT	Mitochondrial trifunctional protein deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA and HADHB genes located on chromosomal region 2p23.3. The age of onset is neonatal/infancy. It is characterized by a wide clinical spectrum ranging from severe neonatal manifestations including cardiomyopathy, hypoglycemia, metabolic acidosis, skeletal myopathy and neuropathy, liver disease and death to a mild phenotype with peripheral polyneuropathy, episodic rhabdomyolysis and pigmentary retinopathy. The prevalence is <1 / 1,000,000.	250,600
HADHB	Trifunctional protein deficiency	NM_000183.2	NM_000183.2:c.788A>G, NM_000183.2:c.1364T>G, NM_000183.2:c.1331G>A	Mitochondrial trifunctional protein deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA and HADHB genes located on chromosomal region 2p23.3. The age of onset is neonatal/infancy. It is characterized by a wide clinical spectrum ranging from severe neonatal manifestations including cardiomyopathy, hypoglycemia, metabolic acidosis, skeletal myopathy and neuropathy, liver disease and death to a mild phenotype with peripheral polyneuropathy, episodic rhabdomyolysis and pigmentary retinopathy. The prevalence is <1 / 1,000,000.	600
HAL	Histidinemia	NM_002108.3	NM_002108.3:c.890_891insT, NM_002108.3:c.146_152delATGACGC, NM_002108.3:c.1287+2T>C, NM_002108.3:c.102_103insGC, NM_002108.3:c.903+1G>A	Histidinemia follows a pattern of inheritance and is caused by pathogenic variants in the HAL gene located on chromosomal region 12q23.1. The age of onset is infantile ans is characterized by high concentration of Histidine in blood and urine. This disease seems to be benign in most of cases but 2/3 of the patients could show mild development delay.	600
HBA	Alpha-thalassemia	-	--MED, --SEA, --THAI, -α4.2, -α3.7, --FIL, -(α)20.5 (Detection by PCR)	Alpha-thalassemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBA gene located on chromosomal region 16p13.3. The age of onset is infantile. It is characterized by impaired synthesis of alpha-globin chains leading to a variable clinical picture depending on the number of affected alleles. The disease can be classified into clinical subtypes of increasing severity: silent alpha thalassemia, alpha thalassemia trait (or alpha thalassemia minor), hemoglobin H disease (HbH), and Hb Bart's hydrops fetalis (see these terms). A rare form called alpha-thalassemia-intellectual deficit syndrome has also been identified (see these terms). Alpha thalassemia trait causes microcytosis and hypochromia with absent or mild anemia (often detected on routine blood tests), generally with no other symptoms. HbH patients develop moderate hemolytic anemia with variable amounts of HbH along with occasionally severe splenomegaly, sometimes complicated by hypersplenism. Hb Bart's hydrops fetalis involves a severe deficiency in alpha-globin with serious developmental implications. Alpha-thalassemia-intellectual deficit syndrome is characterized by very mild to severe anemia associated with developmental abnormalities. The prevalence is 1:10,000-5:10,000.	600
HBB	Beta-thalassemia	NM_000518.4	NM_000518.4:c.135delC, NM_000518.4:c.118C>T, NM_000518.4:c.217dupA, NM_000518.4:c.92+5G>C, NM_000518.4:c.208G>A, NM_000518.4:c.85_86insC, NM_000518.4:c.92+5G>A, NM_000518.4:c.27dupG, NM_000518.4:c.126_129delCTTT, NM_000518.4:c.93-23T>C, NM_000518.4:c.92+1G>A, NM_000518.4:c.-50-u32C>T, NM_000518.4:c.82G>T, NM_000518.4:c.315+1G>A, NM_000518.4:c.52A>T, NM_000518.4:c.380T>A, NM_000518.4:c.93-21G>A, NM_000518.4:c.79G>A, NM_000518.4:c.112delT, NM_000518.4:c.92+6T>C, NM_000518.4:c.59A>G, NM_000518.4:c.364G>A	Beta-thalassemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBB gene located on chromosomal region 11p15.4. The age of onset is infantile. Three main types of BT have been described, thalassemia minor is usually asymptomatic, thalassemia major is associated with splenomegaly and microcytic and hypochromic anemia and thalassemia intermedia, in which the anemia is less severe. The incidence is 1/100,000.	250,600
HBB	Sickle cell anaemia	NM_000518.4	NM_000518.4:c.19G>A, NM_000518.4:c.20A>T	Sickle cell anemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBB gene located on chromosomal region 11p15.4. The age of onset is infantile. This disease is characterized by chronic severe anemia, bacterial infections, and ischemic vaso-occlusive accidents. This results in tissue ischemia leading to acute and chronic pain as well as organ damage that can affect any organ in the body, including the bones, lungs, liver, kidneys, brain, eyes, and joints. The highest frequency of sickle cell disease is found in tropical regions, particularly sub-Saharan Africa, India and the Middle-East.	250,600
HESX1	Combined pituitary hormone deficiencies, genetic forms	NM_003865.2	NM_003865.2:c.374A>G, NM_003865.2:c.77T>C, NM_003865.2:c.445G>A, NM_003865.2:c.450_451delCA, NM_003865.2:c.18G>C	Combined pituitary hormone deficiencies, genetic forms follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the HESX1 gene located on chromosomal region 3p14.3. The age of onset is infantile. These diseases are characterized by short stature, cognitive alterations or delayed puberty. The incidence is 1:3,000 and 1:4,000 births.	250,600
HEXA	Tay-Sachs disease	NM_000520.4	NM_000520.4:c.1176G>A, NM_000520.4:c.1495C>T, NM_000520.4:c.1177C>T, NM_000520.4:c.116T>G, NM_000520.4:c.1510delC, NM_000520.4:c.1496G>A, NM_000520.4:c.1260G>C, NM_000520.4:c.1351C>G, NM_000520.4:c.1511G>A, NM_000520.4:c.1499delT, NM_000520.4:c.1510C>T, NM_000520.4:c.380T>G, NM_000520.4:c.459+5G>A, NM_000520.4:c.508C>T, NM_000520.4:c.509G>A, NM_000520.4:c.532C>T, NM_000520.4:c.533G>A, NM_000520.4:c.533G>T, NM_000520.4:c.1528C>T, NM_000520.4:c.173G>A, NM_000520.4:c.1A>G, NM_000520.4:c.1A>T, NM_000520.4:c.1444G>A, NM_000520.4:c.1453T>C, NM_000520.4:c.739C>T, NM_000520.4:c.745C>T, NM_000520.4:c.749G>A, NM_000520.4:c.759_774dupGCTTGCAGAGTTTGAC, NM_000520.4:c.772G>C, NM_000520.4:c.1214_1215delinsG, NM_000520.4:c.78G>A, NM_000520.4:c.538T>C, NM_000520.4:c.540C>G, NM_000520.4:c.805G>A, NM_000520.4:c.915_917delCTT, NM_000520.4:c.254-1G>C, NM_000520.4:c.2T>C, NM_000520.4:c.1537C>T, NM_000520.4:c.1490A>G, NM_000520.4:c.77G>A, NM_000520.4:c.1422G>C, NM_000520.4:c.805+1G>A, NM_000520.4:c.805+1G>C, NM_000520.4:c.672+1G>A, NM_000520.4:c.629C>T, NM_000520.4:c.987G>A, NM_000520.4:c.632T>C, NM_000520.4:c.1278_1279insTATC, NM_000520.4:c.1274_1277dupTATC, NM_000520.4:c.986+3A>G, NM_000520.4:c.611A>G, NM_000520.4:c.1277_1278insTAT	Tay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births.	250,600
HEXB	Sandhoff disease	NM_000521.3	NM_000521.3:c.1310_1311delCA, NM_000521.3:c.1380G>A, NM_000521.3:c.1367A>C, NM_000521.3:c.1238_1242delCAAAG, NM_000521.3:c.298delC, NM_000521.3:c.1345delT, NM_000521.3:c.797A>G, NM_000521.3:c.1539_1540delCT, NM_000521.3:c.1375G>T, NM_000521.3:c.508C>T, NM_000521.3:c.1517_1529dupCAAGTGCTGTTGG, NM_000521.3:c.841C>T, NM_000521.3:c.202_203insGG, NM_000521.3:c.1250C>T, NM_000521.3:c.1619_1620insTTCATGTTATCTACAGACGTG, NM_000521.3:c.1537_1538delCT, NM_000521.3:c.170delG, NM_000521.3:c.115delG, NM_000521.3:c.171delG, NM_000521.3:c.850C>T	Sandhoff disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXB gene located on chromosomal region 5q13.3. The age of onset is adult or infantile. This disease is characterized by central nervous system degeneration, with startle reactions, early blindness, progressive motor and mental deterioration, macrocephaly and cherry-red spots on the macula. The prevalence is 1/130.000.	250,600
HFE	Haemochromatosis	NM_000410.3	NM_000410.3:c.18G>C, NM_000410.3:c.252G>A, NM_000410.3:c.989G>T, NM_000410.3:c.314T>C, NM_000410.3:c.193A>T, NM_000410.3:c.829G>A, NM_000410.3:c.277G>C	Hemochromatosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HFE gene located on chromosomal region 6p22.2. The age of onset is adult. This disease is characterized by chronic fatigue, bronzed skin pigmentation and tissue damage in the liver, pancreas, joints, bone, endocrine glands, heart. The prevalence is 1/200 - 1/1.000.	250,600
HGD	Alkaptonuria	NM_000187.3	NM_000187.3:c.140C>T, NM_000187.3:c.16-1G>A, NM_000187.3:c.342+1G>A, NM_000187.3:c.1111_1112insC, NM_000187.3:c.899T>G, NM_000187.3:c.1189-2A>G, NM_000187.3:c.674G>A, NM_000187.3:c.175delA, NM_000187.3:c.283-5delT, NM_000187.3:c.172A>T, NM_000187.3:c.873C>A, NM_000187.3:c.283-4C>T, NM_000187.3:c.808G>A, NM_000187.3:c.1102A>G, NM_000187.3:c.469+2T>C, NM_000187.3:c.688C>T, NM_000187.3:c.481G>A	Alkaptonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGD gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by darkening of the urine when it is left exposed to air, grey-blue colouration of the eye sclerae and the ear helix (ochronosis), and a disabling joint disease involving both the axial and peripheral joints (ochronotic arthropathy). The prevalence is 1:250,000-1:1.000.000 newborn.	250,600
HGF	Deafness type 39, autosomal recessive	NM_000601.4	NM_000601.4:c.2028delA, NM_000601.4:c.1597C>T	Autosomal recessive nonsyndromic sensorineural deafness type DFNB239 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGF gene located on chromosomal region 7q21.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600
HGSNAT	Mucopolysaccharidosis type 3C	NM_152419.2	NM_152419.2:c.1378-1G>A, NM_152419.2:c.1843G>A, NM_152419.2:c.607C>T, NM_152419.2:c.1250+1G>A, NM_152419.2:c.848C>T, NM_152419.2:c.1464+1G>A, NM_152419.2:c.1501delA, NM_152419.2:c.1030C>T, NM_152419.2:c.1503delA, NM_152419.2:c.1553C>T, NM_152419.2:c.1622C>T, NM_152419.2:c.493+1G>A	Mucopolysaccharidosis type 3C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGSNAT gene located on chromosomal region 8p11.21. The age of onset is infantile. This disease is characterized by defective or missing enzymes to break down mucopolysaccharides are missing or are defective. The prevalence is <1:70.000 newborn.	250,600
HIBCH	3-Hydroxyisobutryl-CoA hydrolase deficiency	NM_014362.3	NM_014362.3:c.1012A>T, NM_014362.3:c.79-3C>G, NM_014362.3:c.494_495delTT, NM_014362.3:c.365A>G, NM_014362.3:c.220-9T>G	3-Hydroxyisobutryl-CoA hydrolase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HIBCH gene located on chromosomal region 2q32.2. The age of onset is infantile. This disease is characterized by delayed motor development, hypotonia and progressive neurodegeneration. The prevalence is <1:1,000,000.	600
HMGCL	3-hydroxy-3-methylglutaric aciduria	NM_000191.2	NM_000191.2:c.835G>A, NM_000191.2:c.230delT, NM_000191.2:c.122G>A, NM_000191.2:c.698A>G, NM_000191.2:c.206_207delCT, NM_000191.2:c.505_506delTC	3-hydroxy-3-methylglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HMGCL gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is is an organic aciduria, due to deficiency of 3-hydroxy-3-methylglutaryl-CoA-lyase (a key enzyme in ketogenesis and leucine metabolism) usually presenting in infancy with episodes of metabolic decompensation triggered by periods of fasting or infections, which when left untreated are life-threatening and may lead to neurological sequelae.	600
HPD	Tyrosinemia type 3	NM_002150.2	NM_002150.2:c.600C>G, NM_002150.2:c.774T>G, NM_002150.2:c.1005C>G, NM_002150.2:c.987delA	Tyrosinemia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPD gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by intellectual deficit and ataxia. The prevalence is 1:100,000-1:120,000 newborn.	250,600
HPRT1	Lesch-Nyhan syndrome	NM_000194.2	NM_000194.2:c.486-1G>A, NM_000194.2:c.508C>T, NM_000194.2:c.610-2A>G, NM_000194.2:c.532+2T>G	Lesch-Nyhan syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the HPRT1 gene located on chromosomal region Xq26.2-q26.3. The age of onset is infantile. This disease is characterized by acid overproduction, neurological troubles, and behavioral problems. The prevalence is 1:380,000.	600
HPS1	Hermansky-Pudlak syndrome type 1	NM_000195.3	NM_000195.3:c.972_973insC, NM_000195.3:c.972delC, NM_000195.3:c.1996G>T, NM_000195.3:c.398+5G>A, NM_000195.3:c.1472_1487dupCCAGCAGGGGAGGCCC, NM_000195.3:c.397G>T	Hermansky-Pudlak syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPS1 gene located on chromosomal region 10q24.2. The age of onset is early childhood. This disease is characterized by oculocutaneous albinism, bleeding diathesis and, in some cases, neutropenia, pulmonary fibrosis, or granulomatous colitis. The prevalence is 1/500,000 - 1/1,000,000.	600
HSD17B4	D-bifunctional protein deficiency	NM_000414.3	NM_000414.3:c.1369A>T, NM_000414.3:c.46G>A, NM_000414.3:c.972+1G>T, NM_000414.3:c.317G>C	Bifunctional enzyme deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSD17B4 gene located on chromosomal region 5q23. The age of onset is juvenile. This disease is characterized by slowly progressive cerebellar atrophy and ataxia, intellectual decline, hearing loss, hypogonadism, hyperreflexia, a demyelinating sensorimotor neuropathy.	600
HSD17B4	Perrault syndrome	NM_000414.3	NM_000414.3:c.650A>G	Perrault syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSD17B4 gene located on chromosomal region 5q23.1. The age of onset is adult. This disease is characterized by ovarian dysgenesis in females with sensorineural hearing impairment and other neurological alterations. The prevalence is <1:1,000,000.	600
HSPD1	Leukodystrophy hypomyelinating type 4	NM_002156.4	NM_002156.4:c.1381C>G, NM_002156.4:c.292G>A	Leukodystrophy hypomyelinating type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSPD1 gene located on chromosomal region 2q33.1. The age of onset is infantile. A severe autosomal recessive hypomyelinating leukodystrophy. Clinically characterized by infantile-onset rotary nystagmus, progressive spastic paraplegia, neurologic regression, motor impairment, profound mental retardation. Death usually occurs within the first two decades of life.	600
HSPG2	Schwartz-Jampel syndrome type 1	NM_005529.6	NM_005529.6:c.13075delC, NM_005529.6:c.1653_1654insT, NM_005529.6:c.10355G>A, NM_005529.6:c.1125C>A, NM_005529.6:c.9326delA, NM_005529.6:c.8464+4A>G	Schwartz-Jampel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSPG2 gene located on chromosomal region 1p36.12. The age of onset is infantile. This disease is characterized by myotonia and osteoarticular abnormalities. The prevalence is <1:1,000,000.	600
HTRA1	CARASIL syndrome	NM_002775.4	NM_002775.4:c.1108C>T, NM_002775.4:c.883G>A, NM_002775.4:c.904C>T, NM_002775.4:c.754G>A, NM_002775.4:c.889G>A	Cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy (CARASIL syndrome) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HTRA1 gene located on chromosomal region 10q26.13. The age of onset is adult. This disease is characterized by early-onset gait disturbances, premature scalp alopecia, ischemic stroke, acute mid to lower back pain and progressive cognitive disturbances leading to severe dementia. About 50 people diagnosed, mainly in Japan and China.	600
HYLS1	Hydrolethalus syndrome type 1	NM_145014.2	NM_145014.2:c.632A>G, NM_145014.2:c.724C>T, NM_145014.2:c.669G>A	Hydrolethalus syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HYLS1 gene located on chromosomal region 11q24.2. The age of onset is fetal. This disease is characterized by craniofacial dysmorphic features, central nervous system, cardiac, respiratory tract and limb abnormalities. The incidence is 1/20,000 in Finland and the prevalence is <1:1,000,000.	600
IDH3B	Retinitis pigmentosa type 46	NM_006899.3	NM_006899.3:c.395T>C, NM_006899.3:c.490C>T, NM_006899.3:c.589delA	Retinitis pigmentosa 46 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IDH3B gene located on chromosomal region 20p13. The age of onset is variable. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness. The prevalence is 1/3,000 to 1/5,000.	600
IDS	Mucopolysaccharidosis type 2	NM_000202.6	NM_000202.6:c.1464G>T, NM_000202.6:c.1466G>C, NM_000202.6:c.1505G>C, NM_000202.6:c.283A>G, NM_000202.6:c.208dupC, NM_000202.6:c.596_599delAACA, NM_000202.6:c.597delA, NM_000202.6:c.683C>T, NM_000202.6:c.1148delC, NM_000202.6:c.880-8A>G, NM_000202.6:c.937C>T, NM_000202.6:c.998C>T, NM_000202.6:c.690_691insT, NM_000202.6:c.1122C>T, NM_000202.6:c.587T>C, NM_000202.6:c.314_317dupTCAA, NM_000202.6:c.278delC, NM_000202.6:c.514C>T, NM_000202.6:c.1508T>A, NM_000202.6:c.388_389insG, NM_000202.6:c.240+1G>A, NM_000202.6:c.404A>G	Mucopolysaccharidosis type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IDS gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by distinctive coarse facial features, short stature, cardio-respiratory involvement and skeletal abnormalities. The prevalence is 1:100,000-1:170,000 mannewborn.	600
IFT80	Short-rib thoracic dysplasia type 2 with or without polydactyly	NM_020800.2	NM_020800.2:c.701C>G, NM_020800.2:c.721G>C, NM_020800.2:c.315C>G	Short-rib thoracic dysplasia type 2 with or without polydactyly an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IFT80 gene located on chromosomal region 3q25.33. The age of onset is antenatal/neonatal. This is, a group of autosomal recessive ciliopathies that are characterized by a constricted thoracic cage, short ribs, shortened tubular bones, and a trident appearance of the acetabular roof. Polydactyly is variably present. Non-skeletal involvement can include cleft lip/palate as well as anomalies of major organs such as the brain, eye, heart, kidneys, liver, pancreas, intestines, and genitalia. Some forms of the disease are lethal in the neonatal period due to respiratory insufficiency secondary to a severely restricted thoracic cage, whereas others are compatible with life. Disease spectrum encompasses Ellis-van Creveld syndrome, asphyxiating thoracic dystrophy (Jeune syndrome), Mainzer-Saldino syndrome, and short rib-polydactyly syndrome. The incidence is 1-5/500,000.	600
IGF1	Growth delay due to insulin-like growth factor type 1 deficiency	NM_000618.3	NM_000618.3:c.274G>A	Growth delay due to insulin-like growth factor type 1 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGF1 gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by the association of intrauterine and postnatal growth retardation with sensorineural deafness and intellectual deficit, addition clinical features include microcephaly, adiposity, and insulin resistance. The prevalence is <1:1,000,000.	600
IGHMBP2	Spinal muscular atrophy, distal, type 1, autosomal recessive	NM_002180.2	NM_002180.2:c.1488C>A, NM_002180.2:c.2611+1G>T, NM_002180.2:c.1540G>A, NM_002180.2:c.1738G>A, NM_002180.2:c.661delA, NM_002180.2:c.121C>T, NM_002180.2:c.1101_1116delCTACTTCGACGTGGTG, NM_002180.2:c.2922T>G, NM_002180.2:c.1107C>G, NM_002180.2:c.2362C>T, NM_002180.2:c.638A>G	Autosomal recessive distal spinal muscular atrophy type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGHMBP2 gene located on chromosomal region 11q13.3. The age of onset is infantile. This disease is characterized by neuromuscular disorder characterized by progressive weakness and atrophy of the diaphragm and skeletal muscles, leading to death in childhood. The prevalence is 4:100,000-10:100,000.	250,600
IKBKAP	Familial dysautonomia	NM_003640.3	NM_003640.3:c.3332delC, NM_003640.3:c.1460+2T>C, NM_003640.3:c.2204+6T>C, NM_003640.3:c.2328delT, NM_003640.3:c.2741C>T, NM_003640.3:c.2087G>C, NM_003640.3:c.2087G>A	Familial dysautonomia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IKBKAP gene located on chromosomal region 9q31.3. The age of onset is infantile. This disease is characterized by sensory dysfunction and severe impairment of the autonomic nervous system activity, resulting in multisystem dysfunction. The prevalence is <1:1,000,000	600
IL2RG	Severe combined immunodeficiency T-B+; X-linked	NM_000206.2	NM_000206.2:c.454+1G>A, NM_000206.2:c.452T>C, NM_000206.2:c.186T>A, NM_000206.2:c.664C>T, NM_000206.2:c.343T>C, NM_000206.2:c.854G>A, NM_000206.2:c.341G>A, NM_000206.2:c.355A>T	T-B+ severe combined immunodeficiency, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IL2RG gene located on chromosomal region Xq13.1. The age of onset is infantile. This disease is characterized by absent or markedly reduced numbers of T cells, leading to recurrent infections. The prevalence is 1:50,000-1:100,000.	600
IMPDH1	Retinitis pigmentosa type 10	NM_000883.3	NM_000883.3:c.1057G>A, NM_000883.3:c.1390delC, NM_000883.3:c.931G>A	Retinitis pigmentosa type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IMPDH1 gene located on chromosomal region 7q32.1. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades. The prevalence is 1/4,000.	250,600
IMPG2	Retinitis pigmentosa type 56	NM_016247.3	NM_016247.3:c.635C>G, NM_016247.3:c.3262C>T, NM_016247.3:c.502-1G>C, NM_016247.3:c.2890C>T	Retinitis pigmentosa type 56 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IMPG2 gene located on chromosomal region 3q12.3. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades. The prevalence is 1/4.000.	600
INPP5E	Joubert syndrome type 1	NM_019892.4	NM_019892.4:c.1132C>T, NM_019892.4:c.855_856insCG, NM_019892.4:c.1688G>A, NM_019892.4:c.1543C>T, NM_019892.4:c.1304G>A	Joubert syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized by congenital malformation of the brainstem and agenesis or hypoplasia of the cerebellar vermis leading to an abnormal respiratory pattern, nystagmus, hypotonia, ataxia, and delay in achieving motor milestones.. The prevalence is 1/100.000.	250,600
INPP5E	MORM syndrome	NM_019892.4	NM_019892.4:c.1879C>T	MORM syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized by the association of intellectual deficit, truncal obesity, retinal dystrophy and micropenis. The prevalence is 1/100.000.	250,600
INSR	Diabetes mellitus, insulin-resistant	NM_000208.2	NM_000208.2:c.3079C>T, NM_000208.2:c.3680G>C, NM_000208.2:c.3034G>A, NM_000208.2:c.1114C>T, NM_000208.2:c.1378A>G	Diabetes mellitus, insulin-resistant follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by the triad of hyperinsulinemia, acanthosis nigricans (skin lesions associated with insulin resistance), and signs of hyperandrogenism in females without lipodystrophy and who are not overweight. It is generally diagnosed in young women with marked signs of hyperandrogenism, but insulin resistance and acanthosis nigricans may be observed in men and in childhood. Acromegaloid facies or muscular cramps are sometimes associated. Hyperinsulinemia, a biological marker for insulin resistance, is often associated with glucose tolerance defects over the course of the disease, and diabetes progressively sets in. Hyperandrogenism (associated with polycystic ovarian syndrome (see this term) or ovarian hyperthecoses) leads to fertility problems. The prevalence is <1:1,000,000.	250,600
INSR	Leprechaunism	NM_000208.2	NM_000208.2:c.2668C>T, NM_000208.2:c.172G>A	Leprechaunism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by intrauterine and mainly postnatal severe growth retardation, extreme insulin resistance. The prevalence is <1:1,000,000.	250,600
IQCB1	Senior-Loken syndrome type 5	NM_001023570.2	NM_001023570.2:c.1036G>T, NM_001023570.2:c.817G>T, NM_001023570.2:c.1381C>T, NM_001023570.2:c.1465C>T, NM_001023570.2:c.1090C>T, NM_001023570.2:c.1518_1519delCA, NM_001023570.2:c.1069C>T	Senior-Loken syndrome type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IQCB1 gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by the association of nephronophthisis (NPHP), a chronic kidney disease, with retinal dystrophy. The prevalence is 1/1.000.000.	600
ISCU	Myopathy with deficiency of ISCU	NM_213595.3	NM_213595.3:c.338_339+2delCGGT, NM_213595.3:c.149G>A	Hereditary myopathy with lactic acidosis due to ISCU deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ISCU gene located on chromosomal region 12q23.3. The age of onset is infantile. This disease is characterized by myopathy with severe exercise intolerance.	600
ITGA6	Epidermolysis bullosa, junctional with pyloric atresia	NM_000210.2	NM_000210.2:c.791delC, NM_000210.2:c.1255dupA	Junctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGA6 and ITGB4 genes located on chromosomal regions 2q31.1 and 17q25.1 respectively. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract.	600
ITGB4	Epidermolysis bullosa, junctional with pyloric atresia	NM_001005731.1	NM_001005731.1:c.112T>C, NM_001005731.1:c.1684T>C, NM_001005731.1:c.1150delG, NM_001005731.1:c.1544G>A, NM_001005731.1:c.3977-19T>A, NM_001005731.1:c.4410delG, NM_001005731.1:c.4433G>A, NM_001005731.1:c.5119+2T>C, NM_001005731.1:c.3321_3331delACTGGACCGGA, NM_001005731.1:c.4618C>T, NM_001005731.1:c.182G>A, NM_001005731.1:c.2607delC, NM_001005731.1:c.3801_3802insT, NM_001005731.1:c.3841C>T, NM_001005731.1:c.2608delC, NM_001005731.1:c.3793+1G>A, NM_001005731.1:c.1660C>T, NM_001005731.1:c.3674G>A	Junctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGA6 and ITGB4 genes located on chromosomal regions 2q31.1 and 17q25.1 respectively. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract.	250,600
ITGB4	Epidermolysis bullosa, without pyloric atresia	NM_001005731.1	NM_001005731.1:c.2792G>A	Junctional epidermolysis bullosa with piloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGB4 gene located on chromosomal region 17q25.1. The age of onset is neonatal. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. More than 100 cases have been reported around the world.	250,600
IVD	Isovaleric acidemia	NM_002225.3	NM_002225.3:c.158G>C, NM_002225.3:c.1208A>G, NM_002225.3:c.157C>T, NM_002225.3:c.1141T>C, NM_002225.3:c.243+1G>A, NM_002225.3:c.1147+1_1147+4delGTGA, NM_002225.3:c.367G>A, NM_002225.3:c.605G>T, NM_002225.3:c.1145_1147+4delTTGGTGA, NM_002225.3:c.559+1G>A, NM_002225.3:c.134T>C, NM_002225.3:c.941C>T, NM_002225.3:c.627delT, NM_002225.3:c.793+1G>A, NM_002225.3:c.2T>G, NM_002225.3:c.1183C>T, NM_002225.3:c.390delT, NM_002225.3:c.406_407delTG, NM_002225.3:c.158G>A, NM_002225.3:c.593G>A, NM_002225.3:c.507delG, NM_002225.3:c.1188delT, NM_002225.3:c.465+2T>C, NM_002225.3:c.434_437dupATGA, NM_002225.3:c.860G>A, NM_002225.3:c.994_995delAT, NM_002225.3:c.1192C>T, NM_002225.3:c.478_479insGT	Isovaleric academia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IVD gene located on chromosomal region 15q15.1. The age of onset is neonatal. This disease is characterized by vomiting, dehydration, coma and abnormal movements. The prevalence is 1/100,000.	250,600
JAK3	Severe combined immunodeficiency T-B+NK-	NM_000215.3	NM_000215.3:c.452C>G, NM_000215.3:c.1765G>A, NM_000215.3:c.1333C>T, NM_000215.3:c.1172_1173insG, NM_000215.3:c.1837C>T, NM_000215.3:c.299A>G, NM_000215.3:c.1695C>A	Severe combined immunodeficiency T-B+NK- follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the JAK3 gene located on chromosomal region 19p13.11. The age of onset is infantile. This disease is characterized by chronic diarrhea, failure to thrive, recurrent respiratory infections and/or generalized infections due to opportunistic pathogens. The incidence is 1/100,000 and 1/1,000,000.	250,600
KCNJ1	Bartter syndrome type 2	NM_000220.4	NM_000220.4:c.1012C>T, NM_000220.4:c.1070T>C, NM_000220.4:c.592G>A, NM_000220.4:c.322G>C, NM_000220.4:c.372T>A, NM_000220.4:c.500G>A, NM_000220.4:c.237C>G, NM_000220.4:c.1014delA, NM_000220.4:c.641C>T, NM_000220.4:c.657C>G, NM_000220.4:c.996_999delAAAG, NM_000220.4:c.942T>G	Bartter syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ1 gene located on chromosomal region 11q24.3. The age of onset is antenatal. This disease is characterized by severe polyhydramnios in mother leading to premature delivery, postnatally newborns suffer from recurrent episodes of severe dehydration and electrolyte imbalance which can lead to fatal outcome.	250,600
KCNJ13	Leber congenital amaurosis type 16	NM_002242.4	NM_002242.4:c.722T>C	Leber congenital amaurosis type 16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ13 gene located on chromosomal region 2q37.1. The age of onset is early infantile. This disease is characterized by retinal dystrophy defined by blindness, nystagmus, roving eye movement, leading to severe visual impairment within the first year of life.	600
KCNV2	Retinal cone dystrophy type 3B	NM_133497.3	NM_133497.3:c.1016_1024delACCTGGTGG, NM_133497.3:c.1376G>A, NM_133497.3:c.427G>T, NM_133497.3:c.226C>T, NM_133497.3:c.325C>T, NM_133497.3:c.357_358insC, NM_133497.3:c.1480A>C, NM_133497.3:c.1132_1133insT, NM_133497.3:c.854T>G, NM_133497.3:c.491T>C, NM_133497.3:c.767C>G, NM_133497.3:c.916G>T, NM_133497.3:c.778A>T, NM_133497.3:c.442G>T	Retinal cone dystrophy type 3B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNV2 gene located on 9p24.2. The age of onset is in the first or second decade of life. This disease is characterized by is characterized by onset in the first or second decade of life of very marked photophobia, myopia, reduced color vision along the red-green axis with relatively preserved tritan discrimination, and central scotomata with peripheral widespread sensitivity loss predominating in the superior visual field. Nyctalopia is a later feature of the disorder. There is often retinal pigment epithelium disturbance at the macula with a normal retinal periphery.	250,600
KIF7	Acrocallosal syndrome	NM_198525.2	NM_198525.2:c.2473G>T, NM_198525.2:c.687delG, NM_198525.2:c.3001C>T, NM_198525.2:c.460C>T, NM_198525.2:c.61C>T, NM_198525.2:c.2896_2897delGC, NM_198525.2:c.3778_3779insC	Acrocallosal syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KIF7 gene located on chromosomal region 15q26.1. The age of onset is infantile. This disease is characterized by y agenesis of corpus callosum (CC), distal anomalies of limbs, minor craniofacial anomalies and intellectual deficit. The prevalence is <1:1,000,000.	600
L1CAM	MASA sindrome/hydrocephalus	NM_000425.4	NM_000425.4:c.3489_3490delTG, NM_000425.4:c.3201T>G, NM_000425.4:c.719C>T, NM_000425.4:c.3581C>T, NM_000425.4:c.2879delA, NM_000425.4:c.791G>A, NM_000425.4:c.2092G>A, NM_000425.4:c.924C>T, NM_000425.4:c.536T>G, NM_000425.4:c.23delT, NM_000425.4:c.2254G>A, NM_000425.4:c.800dupA, NM_000425.4:c.772C>T, NM_000425.4:c.1354G>A, NM_000425.4:c.551G>A, NM_000425.4:c.1792G>A, NM_000425.4:c.1108G>A	MASA sindrome/hydrocephalus follows an X-linked pattern of inheritance and is caused by pathogenic variants in the L1CAM gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by adducted thumbs, hypotonia progressing to spasticity or spastic paraplegia, delayed development of speech, mild to moderate intellectual deficit, and mild to moderate distension of the cerebral ventricles. Hydrocephalus appears frequently. The prevalence is 1:25,000-1:60,000 male.	600
LAMA2	Congenital muscular dystrophy type 1A	NM_000426.3	NM_000426.3:c.184G>T, NM_000426.3:c.1612C>T, NM_000426.3:c.3718C>T, NM_000426.3:c.2750-1G>C, NM_000426.3:c.2049_2050delAG, NM_000426.3:c.5050G>T, NM_000426.3:c.1634T>A, NM_000426.3:c.2045_2046delAG, NM_000426.3:c.4645C>T, NM_000426.3:c.2962C>T, NM_000426.3:c.2098_2099delTT, NM_000426.3:c.4437-5T>A, NM_000426.3:c.2901C>A, NM_000426.3:c.112+1G>A, NM_000426.3:c.7732C>T, NM_000426.3:c.6038delT, NM_000426.3:c.7888C>T, NM_000426.3:c.825delC, NM_000426.3:c.8314delA, NM_000426.3:c.3976C>T, NM_000426.3:c.9101_9104dupAACA, NM_000426.3:c.9253C>T, NM_000426.3:c.2323-2A>T, NM_000426.3:c.8748delA, NM_000426.3:c.6334A>T, NM_000426.3:c.1050delT, NM_000426.3:c.7536delC, NM_000426.3:c.8705delT, NM_000426.3:c.9221delA, NM_000426.3:c.5227G>T, NM_000426.3:c.6429+1G>A, NM_000426.3:c.6617delT, NM_000426.3:c.2451-2A>G, NM_000426.3:c.6011delA, NM_000426.3:c.7810C>T, NM_000426.3:c.8684C>G, NM_000426.3:c.3630delT, NM_000426.3:c.3215delG, NM_000426.3:c.3623_3645delAGGGCATTGTTTTTCAACATCCA, NM_000426.3:c.6955C>T, NM_000426.3:c.7279_7280delCT, NM_000426.3:c.725G>A, NM_000426.3:c.7147C>T, NM_000426.3:c.3237C>A	Congenital muscular dystrophy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMA2 gene located on chromosomal region 6q22.33. The age of onset is early infancy. This disease is characterized by hypotonia, muscle weakness and muscle wasting and motor development delayed. The prevalence is 1/30,000.	250,600
LAMA3	Epidermolysis bullosa, junctional	NM_000227.3	NM_000227.3:c.-122061G>T, NM_000227.3:c.335delG, NM_000227.3:c.4878dupT, NM_000227.3:c.2116A>T, NM_000227.3:c.4135C>T, NM_000227.3:c.751G>T, NM_000227.3:c.1981C>T, NM_000227.3:c.3350+2T>G, NM_000227.3:c.1182delG, NM_000227.3:c.4335_4336insA, NM_000227.3:c.2662C>T	Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 and LAMC2 genes located on chromosomal regions 1q32.2 and 1q25.3 respectively. The age of onset is infantile. It is a lethal form of junctional epidermolysis bullosa, a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement. In the Herlitz type, death occurs usually within the first six months of life. Occasionally, children survive to teens. It is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic.	600
LAMB3	Epidermolysis bullosa, junctional	NM_000228.2	NM_000228.2:c.1587_1588delAG, NM_000228.2:c.124C>T, NM_000228.2:c.1438_1442delCCGTG, NM_000228.2:c.1830G>A, NM_000228.2:c.565-2A>G, NM_000228.2:c.2806C>T, NM_000228.2:c.904delT, NM_000228.2:c.1357delT, NM_000228.2:c.3228+1G>T, NM_000228.2:c.628+1delG, NM_000228.2:c.496C>T, NM_000228.2:c.1903C>T, NM_000228.2:c.628G>A, NM_000228.2:c.3228+1G>A, NM_000228.2:c.727C>T	Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 and LAMC2 genes located on chromosomal regions 1q32.2 and 1q25.3 respectively. The age of onset is infantile. It is a lethal form of junctional epidermolysis bullosa, a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement. In the Herlitz type, death occurs usually within the first six months of life. Occasionally, children survive to teens. It is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic.	250,600
LAMC2	Epidermolysis bullosa, junctional	NM_005562.2	NM_005562.2:c.1659C>A, NM_005562.2:c.3069+1G>A, NM_005562.2:c.1782_1783delGC, NM_005562.2:c.2137_2143delCAGAACC, NM_005562.2:c.283C>T, NM_005562.2:c.343C>T, NM_005562.2:c.3512_3513insA, NM_005562.2:c.405-1G>A, NM_005562.2:c.3120_3121insA	Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 and LAMC2 genes located on chromosomal regions 1q32.2 and 1q25.3 respectively. The age of onset is infantile. It is a lethal form of junctional epidermolysis bullosa, a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement. In the Herlitz type, death occurs usually within the first six months of life. Occasionally, children survive to teens. It is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic.	600
LARGE	Muscular dystrophy-dystroglycanopathy type 6	NM_004737.4	NM_004737.4:c.1102C>T, NM_004737.4:c.992C>T, NM_004737.4:c.1525G>A, NM_004737.4:c.1483T>C	Muscular dystrophy-dystroglycanopathy type 6follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LARGE gene located on chromosomal region 22q12.3. The age of onset is infantile. There are two subtypes. Subtype 6A is associated with cobblestone lissencephaly and other brain anomalies, eye malformations, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Subtype 6B is associated with profound mental retardation, white matter changes and structural brain abnormalities. Skeletal muscle biopsies show reduced immunolabeling of alpha-dystroglycan. The prevalence is 1:100,000-9:100,000.	600
LBR	Greenberg skeletal dysplasia	NM_002296.3	NM_002296.3:c.1748G>A, NM_002296.3:c.1402delT, NM_002296.3:c.1114C>T, NM_002296.3:c.32_35delTGGT	Greenberg dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LBR gene located on chromosomal region 1q42.12. The age of onset is fetal. This disease is characterized by fetal hydrops, short limbs and abnormal chondro-osseous calcification. The prevalence is <1:1,000,000.	600
LDHA	Glycogen storage disease type 11	NM_005566.3	NM_005566.3:c.126+1_126+4delGTAA, NM_005566.3:c.126+1G>A, NM_005566.3:c.310G>T, NM_005566.3:c.126+1_126+4del, NM_005566.3:c.397G>T, NM_005566.3:c.213+1_213+4delGTAA, NM_005566.3:c.640_641delCT	Glycogen storage disease type 11 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LDHA gene located on chromosomal region 11p15.1. The age of onset is infantile. This disease is characterized by hepatic glycogenosis and renal Fanconi syndrome.	600
LEPRE1	Osteogenesis imperfecta type 8	NM_022356.3	NM_022356.3:c.2055+13_2055+31del19, NM_022356.3:c.1656C>A, NM_022356.3:c.1365_1366delAGinsC, NM_022356.3:c.2068_2086delCGAGCGGGTGAGAGCAGCT, NM_022356.3:c.747delC, NM_022356.3:c.1102C>T, NM_022356.3:c.1473+1G>T	Osteogenesis imperfecta type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LEPRE1 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by bone fragility, low bone mass and susceptibility to bone fractures. The prevalence is 6:100,000-7:100,000.	600
LHFPL5	Deafness type 67, autosomal recessive	NM_182548.3	NM_182548.3:c.494C>T, NM_182548.3:c.476G>A, NM_182548.3:c.649delG, NM_182548.3:c.250delC, NM_182548.3:c.380A>G	Autosomal recessive nonsyndromic sensorineural deafness type DFNB67 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LHFPL5 gene located on chromosomal region 6p21.31. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.	600
LHX3	Combined pituitary hormone deficiency type 3	NM_014564.3	NM_014564.3:c.687G>A, NM_014564.3:c.347A>G	Combined pituitary hormone deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LHX3 gene located on chromosomal reg