Upgraded CGT (CES)

Select your test and find the gene, mutations and diseases related to them.

  • CES CGT Exome
  • CES CGT Plus
  • CGT Bank
  • Other CGT
  • CGT 600
  • CGT 250
  • CGT Basic
  • CGT Essential

* Note:

The HFE gene can either be included in or excluded from the reports, depending on the agreement reached with the clinic.
El gen HFE puede incluirse o no en el informe, según el acuerdo establecido con la clínica.

  • CES CGT Exome V5.5.6
ChromosomeGeneOMIM Phenotype
XABCD1Adrenoleukodystrophy
X-linked
XAP1S2Mental retardation, X-linked, syndromic, type 5 (Pettigrew syndrome)
X-linked
XARAndrogen insensitivity syndrome, complete
X-linked
XARSLChondrodysplasia punctata, brachytelephalangic
X-linked
XARXEpileptic encephalopathy, early infantile, type 1
ARX-related developmental disorders
X-linked
XATP7AMenkes disease
Occipital horn syndrome
X-linked
XATRXMental retardation-hypotonic facies syndrome, X-linked
Alpha-thalassemia/mental retardation syndrome
X-linked
XBRWD3Mental retardation, X-linked, type 93
X-linked
XBTKAgammaglobulinemia X-linked, type 1
X-linked
XCD40LGHyper-IgM syndrome, type 1 (immunodeficiency, X-linked, with hyper-IgM, type 1)
X-linked
XCHMChoroideremia
X-linked
XCOL4A5Alport syndrome, X-linked
X-linked
XCUL4BMental retardation, X-linked, syndromic, type 15 (Cabezas type)
X-linked
XCYBBChronic granulomatous disease, X-linked
X-linked
XDCXLissencephaly, X-linked, type 1
X-linked
XDKC1Dyskeratosis congenita, X-linked
X-linked
XDLG3Mental retardation, X-linked, type 90
X-linked
XDMDDuchenne/Becker muscular dystrophy
X-linked
XEDAEctodermal dysplasia, type 1, hypohidrotic, X-linked
X-linked
XEMDEmery-Dreifuss muscular dystrophy, type 1, X-linked
X-linked
XF8Hemophilia A
X-linked
XF9Hemophilia B
X-linked
XFGD1Aarskog-Scott syndrome
Mental retardation, X-linked syndromic, type 16
X-linked
XFMR1Fragile X syndrome
X-linked
XFTSJ1Mental retardation, X-linked 44
X-linked
XG6PDHemolytic anemia, G6PD deficient (favism)
X-linked
XGJB1Charcot-Marie-Tooth neuropathy, X-linked dominant, type 1
X-linked
XGLAFabry disease
X-linked
XGPR143Ocular albinism, type 1 (Nettleship-Falls type)
X-linked
XHCFC1Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX
type )
X-linked
XHPRT1Lesch-Nyhan syndrome
X-linked
XHSD17B10HSD10 mitochondrial disease
X-linked
XIDSMucopolysaccharidosis, type 2
X-linked
XIL1RAPL1Mental retardation, X-linked, type 21/34
X-linked
XIL2RGSevere combined immunodeficiency, X-linked
X-linked
XKDM5CMental retardation, X-linked, syndromic, Claes-Jensen type
X-linked
XL1CAML1 Syndrome
X-linked
XMECP2Encephalopathy, neonatal severe
Rett syndrome
X-linked
XMID1Opitz GBBB syndrome, type 1
X-linked
XMTM1Myotubular myopathy, X-linked
X-linked
XNDPNorrie disease
X-linked
XNR0B1Adrenal hypoplasia, congenital
X-linked
XOCRLLowe Syndrome
Dent disease type 2
X-linked
XOPHN1Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial
appearance
X-linked
XOTCOrnithine transcarbamylase deficiency
X-linked
XPAK3Mental retardation, X-linked, type 30
X-linked
XPDHA1Pyruvate dehydrogenase E1-alpha deficiency
X-linked
XPGK1Phosphoglycerate kinase 1 deficiency
X-linked
XPHF8Mental retardation syndrome, X-linked, Siderius type
X-linked
XPLP1Pelizaeus-Merzbacher disease
X-linked
XPOU3F4Deafness, X-linked, type 2
X-linked
XPQBP1Renpenning syndrome
X-linked
XPRPS1PRPS1-related disoders
X-linked
XRP2Retinitis pigmentosa, type 2, X-linked
X-linked
XRPGRRetinitis pigmentosa, type 3, X-linked
Cone-rod dystrophy, X-linked, 1
X-linked
XRS1Retinoschisis
X-linked
XSH2D1ALymphoproliferative syndrome, X-linked, type 1
X-linked
XSLC16A2Allan-Herndon-Dudley syndrome
X-linked
XSLC6A8Cerebral creatine deficiency syndrome, type 1
X-linked
XSYN1Epilepsy, X-linked, with variable learning disabilities and behavior disorders
X-linked
XTHOC2Mental retardation, X-linked 12
X-linked
XUPF3BMental retardation, X-linked, syndromic, type 14
X-linked
XWASWiskott-Aldrich syndrome
Thrombocytopenia, X-linked
X-linked
XZDHHC9Mental retardation, X-linked syndromic, Raymond type
X-linked
XZNF711Mental retardation, X-linked, type 97
X-linked
12AAASTriple-A syndrome (achalasia-addisonianism-alacrimia)
Autosomal recessive
16AARS1Epileptic encephalopathy, early infantile, type 29
Autosomal recessive
6AARS2Combined oxidative phosphorylation deficiency 8
Leukoencephalopathy, progressive, with ovarian failure
Autosomal recessive
7AASSHyperlysinemia, type 1 and type 2
Autosomal recessive
16ABATGABA-transaminase deficiency
Autosomal recessive
9ABCA1Tangier disease
Autosomal recessive
2ABCA12Ichthyosis, congenital, autosomal recessive, type 4A
ICAR, type 4B (harlequin)
Autosomal recessive
16ABCA3Surfactant metabolism dysfunction, pulmonary, type 3
Autosomal recessive
1ABCA4Stargardt disease 1
Retinitis pigmentosa 19
Cone-rod dystrophy 3
Autosomal recessive
2ABCB11Cholestasis, benign recurrent intrahepatic, type 2
Cholestasis, progressive familial intrahepatic, type 2
Autosomal recessive
7ABCB4Cholestasis, progressive familial intrahepatic, type 3
Autosomal recessive
10ABCC2Dubin-Johnson syndrome
Autosomal recessive
16ABCC6Pseudoxanthoma elasticum
Generalized arterial calcification of infancy, type 2
Autosomal recessive
11ABCC8Hyperinsulinemic hypoglycemia, type 1 (congenital hyperinsulinism)
Permanent neonatal diabetes mellitus (PNDM)
Autosomal recessive*
14ABCD4Methylmalonic aciduria and homocystinuria, cblJ type
Autosomal recessive
2ABCG5Sitosterolemia 2
Autosomal recessive
2ABCG8Sitosterolemia 1
Autosomal recessive
20ABHD12PHARC syndrome (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa and
cataract)
Autosomal recessive
3ABHD5Chanarin-Dorfman syndrome
Autosomal recessive
11ACAD8Isobutyryl-CoA dehydrogenase deficiency
Autosomal recessive
3ACAD9Acyl-CoA dehydrogenase 9 deficiency (mitochondrial complex I deficiency, nuclear, type
20)
Autosomal recessive
1ACADMMedium-chain acyl-CoA dehydrogenase deficiency
Autosomal recessive
12ACADSShort-chain acyl-CoA dehydrogenase deficiency
Autosomal recessive
10ACADSBShort/branched-chain acyl-CoA dehydrogenase deficiency
Autosomal recessive
17ACADVLVery long-chain acyl-CoA dehydrogenase (VLCAD) deficiency
Autosomal recessive
11ACAT1Alpha-methylacetoacetic aciduria (3-ketothiolase deficiency)
Autosomal recessive
17ACERenal tubular dysgenesis
Autosomal recessive
22ACO2Infantile cerebellar-retinal degeneration
Autosomal recessive
17ACOX1Peroxisomal acyl-CoA oxidase deficiency
Autosomal recessive
19ACP5Spondyloenchondrodysplasia with immune dysregulation
Autosomal recessive
16ACSF3Combined malonic and methylmalonic aciduria
Autosomal recessive
1ACTA1Nemaline myopathy 3
Congenital fiber-type disproportion myopathy 1
Autosomal recessive*
3ACY1Aminoacylase 1 deficiency
Autosomal recessive
20ADASevere combined immunodeficiency due to adenosine deaminase deficiency (ADA)
Autosomal recessive
8ADAM9Cone-rod dystrophy 9
Autosomal recessive
19ADAMTS10Weill-Marchesani syndrome, type 1, recessive
Autosomal recessive
9ADAMTS13Thrombotic thrombocytopenic purpura, familial (Schulman-Upshaw syndrome)
Autosomal recessive
15ADAMTS17Weill-Marchesani syndrome, type 4, recessive
Autosomal recessive
16ADAMTS18Microcornea, myopic chorioretinal atrophy, and telecanthus
Autosomal recessive
5ADAMTS2Ehlers-Danlos syndrome, dermatosparaxis type
Autosomal recessive
9ADAMTSL2Geleophysic dysplasia type 1
Autosomal recessive
1ADAMTSL4Ectopia lentis et pupillae
Ectopia lentis, isolated, type 2
Autosomal recessive
1ADARAicardi-Goutieres syndrome, type 6
Autosomal recessive
16ADGRG1Polymicrogyria, bilateral frontoparietal
Autosomal recessive
5ADGRV1Usher syndrome, type 2C
Autosomal recessive; Digenic inheritance (PDZD7 gene)
10ADKHypermethioninemia due to adenosine kinase deficiency
Autosomal recessive
22ADSLAdenylosuccinase deficiency
Autosomal recessive
18AFG3L2Spastic ataxia, type 5, autosomal recessive
Autosomal recessive
4AFPAlpha-fetoprotein deficiency
Autosomal recessive
4AGAAspartylglucosaminuria (glycosylasparaginase deficiency)
Autosomal recessive
2AGBL5Retinitis pigmentosa 75
Autosomal recessive
7AGKCataract 38
Sengers syndrome
Autosomal recessive
1AGLGlycogen storage disease, type 3
Autosomal recessive
9AGPAT2Congenital generalized lipodystrophy (Berardinelli-Seip syndrome)
Autosomal recessive
2AGPSRhizomelic chondrodysplasia punctata, type 3
Autosomal recessive
1AGRNMyasthenic syndrome, congenital, type 8
Autosomal recessive
1AGTRenal tubular dysgenesis
Autosomal recessive
3AGTR1Renal tubular dysgenesis
Autosomal recessive
2AGXTHyperoxaluria, primary, type 1
Autosomal recessive
20AHCYHypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase
Autosomal recessive
6AHI1Joubert syndrome, type 3
Autosomal recessive
12AICDAImmunodeficiency with hyper-IgM, type 2
Autosomal recessive
4AIMP1Leukodystrophy, hypomyelinating, type 3
Autosomal recessive
17AIPL1Leber congenital amaurosis, type 4
Autosomal recessive
21AIREAutoimmune polyendocrinopathy syndrome, type 1
Autosomal recessive*
9AK1Hemolytic anemia due to adenylate kinase deficiency
Autosomal recessive
1AK2Reticular dysgenesis
Autosomal recessive
10AKR1C246,XY disorder of sex development due to testicular 17,20-desmolase deficiency
Autosomal recessive
7AKR1D1Bile acid synthesis defect, congenital, type 2
Autosomal recessive
9ALADPorphyria, acute hepatic
Autosomal recessive
4ALBAnalbuminemia
Autosomal recessive
10ALDH18A1Spastic paraplegia, type 9B, autosomal recessive
Cutis laxa, type 3A (De Barsy syndrome)
Autosomal recessive
17ALDH3A2Sjogren-Larsson syndrome
Autosomal recessive
1ALDH4A1Hyperprolinemia, type 2
Autosomal recessive
6ALDH5A1Succinic semialdehyde dehydrogenase deficiency
Autosomal recessive
14ALDH6A1Methylmalonate semialdehyde dehydrogenase deficiency
Autosomal recessive
5ALDH7A1Epilepsy, pyridoxine-dependent
Autosomal recessive
16ALDOAGlycogen storage disease type 12
Autosomal recessive
9ALDOBFructose intolerance, hereditary
Autosomal recessive
16ALG1Congenital disorder of glycosylation, type 1K
Autosomal recessive
13ALG11Congenital disorder of glycosylation, type 1P
Autosomal recessive
22ALG12Congenital disorder of glycosylation, type 1G
Autosomal recessive
9ALG2Myasthenic syndrome, congenital, type 14, with tubular aggregates
Autosomal recessive
3ALG3Congenital disorder of glycosylation, type 1D
Autosomal recessive
1ALG6Congenital disorder of glycosylation, type 1C
Autosomal recessive
11ALG8Congenital disorder of glycosylation, type 1H
Autosomal recessive
11ALG9Congenital disorder of glycosylation, type 1L
Gillessen-Kaesbach-Nishimura syndrome
Autosomal recessive
2ALMS1Alström syndrome
Autosomal recessive
17ALOX12BIchthyosis, congenital, autosomal recessive, type 2
Autosomal recessive
17ALOXE3Ichthyosis, congenital, autosomal recessive, type 3
Autosomal recessive
15ALPK3Cardiomyopathy, familial hypertrophic, type 27
Autosomal recessive
1ALPLHypophosphatasia, infantile, Hypophosphatasia, childhood
Autosomal recessive
2ALS2Amyotrophic lateral sclerosis, type 2, juvenile
Primary lateral sclerosis, juvenile
Spastic paralysis, infantile onset ascending
Autosomal recessive
12ALX1Frontonasal dysplasia, type 3
Autosomal recessive
1ALX3Frontonasal dysplasia, type 1
Autosomal recessive
11ALX4Frontonasal dysplasia, type 2
Autosomal recessive
5AMACRBile acid synthesis defect, congenital, type 4
Alpha-methylacyl-CoA racemase deficiency
Autosomal recessive
4AMBNAmelogenesis imperfecta, type IF
Autosomal recessive
19AMHPersistent Mullerian duct syndrome, type 1
Autosomal recessive
12AMHR2Persistent Mullerian duct syndrome, type II
Autosomal recessive
14AMNMegaloblastic anemia 1 (Imerslund-Grasbeck syndrome)
Autosomal recessive
1AMPD1Myopathy due to myoadenylate deaminase deficiency
Autosomal recessive
3AMTGlycine encephalopathy
Autosomal recessive
9ANKS6Nephronophthisis 16
Autosomal recessive
3ANO10Spinocerebellar ataxia, autosomal recessive, type 10
Autosomal recessive
11ANO5Limb-girdle muscular dystrophy, type 12 (LGMD R12)
Autosomal recessive
2ANTXR1GAPO syndrome
Autosomal recessive
4ANTXR2Hyaline fibromatosis syndrome
Autosomal recessive
7AP1S1MEDNIK syndrome
Autosomal recessive
5AP3B1Hermansky-Pudlak syndrome, type 2
Autosomal recessive
15AP3B2Epileptic encephalopathy, early infantile, type 48
Autosomal recessive
19AP3D1?Hermansky-Pudlak syndrome, type 10
Autosomal recessive
1AP4B1Spastic paraplegia, type 47, autosomal recessive
Autosomal recessive
15AP4E1Spastic paraplegia, type 51, autosomal recessive
Autosomal recessive
7AP4M1Spastic paraplegia, type 50, autosomal recessive
Autosomal recessive
14AP4S1Spastic paraplegia, type 52, autosomal recessive
Autosomal recessive
7AP5Z1Spastic paraplegia, type 48, autosomal recessive
Autosomal recessive
19APOC2Hyperlipoproteinemia, type 1B
Autosomal recessive
19APOESea-blue histiocyte disease
Autosomal recessive
16APRTAdenine phosphoribosyltransferase deficiency
Autosomal recessive
9APTXAtaxia, early-onset, with oculomotor apraxia and hypoalbuminemia
Autosomal recessive
12AQP2Diabetes insipidus, nephrogenic, type 2
Autosomal recessive*
20ARFGEF2Periventricular heterotopia with microcephaly
Autosomal recessive
6ARG1Argininemia (arginase deficiency)
Autosomal recessive
17ARHGDIANephrotic syndrome, type 8
Autosomal recessive
19ARHGEF18Retinitis pigmentosa 78
Autosomal recessive
3ARL13BJoubert syndrome type 8
Autosomal recessive
16ARL2BPRetinitis pigmentosa with or without situs inversus
Autosomal recessive
3ARL6Bardet-Biedl syndrome, type 3
Autosomal recessive
22ARSAMetachromatic leukodystrophy
Autosomal recessive
5ARSBMucopolysaccharidosis, type 6 (Maroteaux-Lamy syndrome)
Autosomal recessive
8ASAH1Farber lipogranulomatosis
Spinal muscular atrophy with progressive myoclonic epilepsy
Autosomal recessive
7ASLArgininosuccinic aciduria
Autosomal recessive
7ASNSAsparagine synthetase deficiency
Autosomal recessive
17ASPACanavan disease
Autosomal recessive
1ASPMPrimary microcephaly type 5, autosomal recessive
Autosomal recessive
9ASS1Citrullinemia, type 1
Autosomal recessive
1ATF6Achromatopsia, type 7
Autosomal recessive
2ATICAICA-ribosiduria due to ATIC deficiency
Autosomal recessive
11ATMAtaxia-telangiectasia
Autosomal recessive
10ATOH7Persistent hyperplastic primary vitreous, autosomal recessive
Autosomal recessive
1ATP13A2Kufor-Rakeb syndrome
Spastic paraplegia, type 78, autosomal recessive
Autosomal recessive
16ATP2A1Brody myopathy
Autosomal recessive
12ATP6V0A2Cutis laxa, autosomal recessive, type 2A
Wrinkly skin syndrome
Autosomal recessive
7ATP6V0A4Renal tubular acidosis, distal, autosomal recessive
Autosomal recessive
2ATP6V1B1Renal tubular acidosis with deafness
Autosomal recessive
13ATP7BWilson disease
Autosomal recessive
18ATP8B1Cholestasis, progressive familial intrahepatic, type 1
Cholestasis, benign recurrent intrahepatic, type 1
Autosomal recessive
3ATRSeckel syndrome, type 1
Autosomal recessive
9AUH3-methylglutaconic aciduria, type 1
Autosomal recessive
19AURKCSpermatogenic failure, type 5
Autosomal recessive
15B2MImmunodeficiency, type 43
Autosomal recessive
1B3GALNT2Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type
A, 11
Autosomal recessive
1B3GALT6Ehlers-Danlos syndrome, spondylodysplastic type, 2
Autosomal recessive
11B3GAT3Multiple joint dislocations, short stature, craniofacial dysmorphism, with or without
congenital heart defects
Autosomal recessive
13B3GLCTPeters-plus syndrome
Autosomal recessive
12B4GALNT1Spastic paraplegia, type 26, autosomal recessive
Autosomal recessive
9B4GALT1Congenital disorder of glycosylation, type 2D
Autosomal recessive
5B4GALT7Ehlers-Danlos syndrome, spondylodysplastic, type 1
Autosomal recessive
11B4GAT1Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies),
type A, 13
Autosomal recessive
17B9D1Joubert syndrome, type 27
?Meckel syndrome 9
Autosomal recessive
19B9D2Joubert syndrome, type 34
?Meckel syndrome, type 10
Autosomal recessive
11BBS1Bardet-Biedl syndrome, type 1
Autosomal recessive
12BBS10Bardet-Biedl syndrome, type 10
Autosomal recessive
4BBS12Bardet-Biedl syndrome, type 12
Autosomal recessive
16BBS2Bardet-Biedl syndrome, type 2
Autosomal recessive
15BBS4Bardet-Biedl syndrome, type 4
Autosomal recessive
2BBS5Bardet-Biedl syndrome, type 5
Autosomal recessive
4BBS7Bardet-Biedl syndrome, type 7
Autosomal recessive
7BBS9Bardet-Biedl syndrome, type 9
Autosomal recessive
19BCAT2?Hypervalinemia or hyperleucine-isoleucinemia
Autosomal recessive
3BCHEButyrylcholinesterase deficiency
Autosomal recessive
19BCKDHAMaple syrup urine disease, type 1A
Autosomal recessive
6BCKDHBMaple syrup urine disease, type 1B
Autosomal recessive
16BCKDKBranched-chain ketoacid dehydrogenase kinase deficiency
Autosomal recessive
1BCL10?Immunodeficiency, type 37
Autosomal recessive
2BCS1LBCS1L-related disorders, including Leigh syndrome
Autosomal recessive
11BEST1Bestrophinopathy, AR
Autosomal recessive
20BFSP1Cataract 33, multiple types
Autosomal recessive*
17BHLHA9Syndactyly, mesoaxial synostotic, with phalangeal reduction
Autosomal recessive
2BIN1Centronuclear myopathy, type 2
Autosomal recessive
15BLMBloom syndrome
Autosomal recessive
10BLNK?Agammaglobulinemia 4
Autosomal recessive
19BLOC1S3Hermansky-Pudlak syndrome, type 8
Autosomal recessive
15BLOC1S6?Hermansky-Pudlak syndrome, type 9
Autosomal recessive
7BLVRAHyperbiliverdinemia
Autosomal recessive*
8BMP1Osteogenesis imperfecta, type 13
Autosomal recessive
7BMPERDiaphanospondylodysostosis
Autosomal recessive
4BMPR1BAcromesomelic dysplasia, Demirhan type
Autosomal recessive
2BOLA3Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia
Autosomal recessive
7BPGMErythrocytosis due to bisphosphoglycerate mutase deficiency
Autosomal recessive
8BPNT2Chondrodysplasia with joint dislocations, GPAPP type
Autosomal recessive
7BRAT1Rigidity and multifocal seizure syndrome, lethal neonatal
Neurodevelopmental disorder with cerebellar atrophy and with or without seizures
Autosomal recessive
14BRF1Cerebellofaciodental syndrome
Autosomal recessive
17BRIP1Fanconi anemia, complementation group J
Autosomal recessive
11BSCL2Congenital generalized lipodystrophy, type 2
Encephalopathy, progressive, with or without lipodystrophy
Autosomal recessive
1BSNDBartter syndrome, type 4A
Autosomal recessive
3BTDBiotinidase deficiency
Autosomal recessive
15BUB1BMosaic variegated aneuploidy syndrome 1
Autosomal recessive
12C12ORF57Temtamy syndrome
Autosomal recessive
19C19ORF12Neurodegeneration with brain iron accumulation, type 4
Autosomal recessive*
1C1QAC1q deficiency
Autosomal recessive
1C1QBC1q deficiency
Autosomal recessive
1C1QCC1q deficiency
Autosomal recessive
12C1SC1s deficiency
Autosomal recessive
11C2CD3Orofaciodigital syndrome, type 14
Autosomal recessive
19C3Complement component 3 deficiency
Autosomal recessive
9C5Complement component 5 deficiency
Autosomal recessive
5C6Complement component 6 deficiency
Autosomal recessive
5C7Complement component 7 deficiency
Autosomal recessive
1C8BComplement component 8 deficiency, type 2
Autosomal recessive
15CA12Hyperchlorhidrosis, isolated
Autosomal recessive
8CA2Osteopetrosis with renal tubular acidosis (osteopetrosis, autosomal recessive, type 3)
Autosomal recessive
8CA8Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3
Autosomal recessive
11CABP2Deafness, autosomal recessive, type 93
Autosomal recessive
11CABP4Congenital stationary night blindness, type 2B
Autosomal recessive
3CACNA1DSinoatrial node dysfunction and deafness
Autosomal recessive
12CACNA2D4Retinal cone dystrophy 4
Autosomal recessive
2CALCRL?Lymphatic malformation 8
Autosomal recessive
17CANT1Desbuquois dysplasia, type 1
Epiphyseal dysplasia, multiple, type 7
Autosomal recessive
15CAPN3Limb-girdle muscular dystrophy, type 1 (LGMD R1)
Autosomal recessive
7CARD11Immunodeficiency, type 11A
Autosomal recessive
9CARD9Candidiasis, familial, type 2, autosomal recessive
Autosomal recessive
1CASQ2Ventricular tachycardia, catecholaminergic polymorphic, type 2
Autosomal recessive
3CASRHyperparathyroidism, neonatal
Autosomal recessive*
11CATAcatalasemia
Autosomal recessive
11CATSPER1Spermatogenic failure, type 7
Autosomal recessive
17CAVIN1Lipodystrophy, congenital generalized, type 4
Autosomal recessive
11CBLIFIntrinsic factor deficiency
Autosomal recessive
21CBSHomocystinuria due to cystathionine beta-synthase
Autosomal recessive
19CC2D1AMental retardation, autosomal recessive, type 3
Autosomal recessive
4CC2D2AJoubert syndrome, type 9
Meckel syndrome, type 6
COACH syndrome, 2
Autosomal recessive
18CCBE1Hennekam lymphangiectasia-lymphedema syndrome, type 1
Autosomal recessive
17CCDC103Ciliary dyskinesia, primary, type 17
Autosomal recessive
3CCDC39Ciliary dyskinesia, primary, type 14
Autosomal recessive
17CCDC40Ciliary dyskinesia, primary, type 15
Autosomal recessive
12CCDC65Ciliary dyskinesia, primary, type 27
Autosomal recessive
19CCDC83M syndrome 3
Autosomal recessive
14CCDC88CHydrocephalus, congenital, type 1
Autosomal recessive
6CCN6Progressive pseudorheumatoid dysplasia
Autosomal recessive
5CCNOCiliary dyskinesia, primary, type 29
Autosomal recessive
16CD19Immunodeficiency, common variable, type 3
Autosomal recessive
1CD247?Immunodeficiency, type 25
Autosomal recessive
12CD27Lymphoproliferative syndrome 2
Autosomal recessive
6CD2APGlomerulosclerosis, focal segmental, type 3, susceptibility to
Autosomal recessive*
19CD320Methylmalonic aciduria, transient, due to transcobalamin receptor defect
Autosomal recessive
7CD36Platelet glycoprotein 4 deficiency
Autosomal recessive
11CD3DImmunodeficiency, type 19
Autosomal recessive
11CD3EImmunodeficiency, type 18
Autosomal recessive
11CD3GImmunodeficiency, type 17, CD3 gamma deficient
Autosomal recessive
20CD40Immunodeficiency with hyper-IgM, type 3
Autosomal recessive
1CD55Complement hyperactivation, angiopathic thrombosis, and protein-losing enteropathy
(CHAPLE)
Autosomal recessive
11CD59CD59 deficiency
Autosomal recessive
19CD79AAgammaglobulinemia 3
Autosomal recessive
17CD79BAgammaglobulinemia 6
Autosomal recessive
11CD81Immunodeficiency, common variable, type 6
Autosomal recessive
2CD8ACD8 deficiency, familial
Autosomal recessive
15CDAN1Dyserythropoietic anemia, congenital, type 1A
Autosomal recessive
10CDH23Deafness, autosomal recessive, type 12
Usher syndrome, type 1D
Autosomal recessive
16CDH3Ectodermal dysplasia, ectrodactyly, and macular dystrophy
Autosomal recessive
10CDHR1Cone-rod dystrophy, type 15
Autosomal recessive
9CDK5RAP2Primary microcephaly type 3, autosomal recessive
Autosomal recessive
16CDT1Meier-Gorlin syndrome, type 4
Autosomal recessive
14CEBPESpecific granule deficiency
Autosomal recessive
13CENPJPrimary microcephaly type 6, autosomal recessive
Autosomal recessive
1CEP104Joubert syndrome 25
Autosomal recessive
5CEP120Short-rib thoracic dysplasia 13 with or without polydactyly
Autosomal recessive
4CEP135Microcephaly 8, primary, autosomal recessive
Autosomal recessive
15CEP152Primary microcephaly type 9, autosomal recessive
Autosomal recessive
11CEP164Nephronophthisis 15
Autosomal recessive
12CEP290Meckel syndrome, type 4
Joubert syndrome, type 5
Leber congenital amaurosis, type 10
Autosomal recessive
7CEP41Joubert syndrome, type 15
Autosomal recessive
11CEP57Mosaic variegated aneuploidy syndrome 2
Autosomal recessive
12CEP83Nephronophthisis 18
Autosomal recessive
2CERKLRetinitis pigmentosa, type 26
Autosomal recessive
8CFAP418Bardet-Biedl syndrome, type 21
Cone-rod dystrophy 16 and Retintis pigmentosa 64
Autosomal recessive
18CFAP53Heterotaxy, visceral, 6, autosomal recessive
Autosomal recessive
19CFDComplement factor D deficiency
Autosomal recessive
1CFHComplement factor H deficiency
Autosomal recessive
4CFIComplement factor I deficiency
Autosomal recessive
14CFL2Nemaline myopathy, type 7, autosomal recessive
Autosomal recessive
7CFTRCystic fibrosis
Autosomal recessive
10CHATMyasthenic syndrome, congenital, type 6, presynaptic
Autosomal recessive
22CHKBMuscular dystrophy, congenital, megaconial type
Autosomal recessive
16CHMP1APontocerebellar hypoplasia, type 8
Autosomal recessive
2CHRNA1Multiple pterygium syndrome, lethal type
Autosomal recessive
17CHRNB1?Myasthenic syndrome, congenital, 2C, associated with acetylcholine receptor
deficiency
Autosomal recessive
2CHRNDMyasthenic syndrome, congenital, type 3B, fast-channel
Multiple pterygium syndrome, lethal type
Autosomal recessive
17CHRNEMyasthenic syndrome, congenital, type 4B, fast-channel
Myasthenic syndrome, congenital, type 4C, associated with acetylcholine receptor
deficiency
Autosomal recessive
2CHRNGMultiple pterygium syndrome (MPS), Escobar type
MPS, lethal type
Autosomal recessive
15CHST14Ehlers-Danlos syndrome, musculocontractural, type 1
Autosomal recessive
10CHST3Spondyloepiphyseal dysplasia with congenital joint dislocations
Autosomal recessive
16CHST6Macular corneal dystrophy
Autosomal recessive
15CHSY1Temtamy preaxial brachydactyly syndrome
Autosomal recessive
10CHUKCocoon syndrome
Autosomal recessive
15CIB2Deafness, autosomal recessive, type 48
Usher syndrome, type 1J
Autosomal recessive
16CIITABare lymphocyte syndrome, type 2, complementation group A
Autosomal recessive
6CILK1Endocrine-cerebroosteodysplasia
Autosomal recessive
4CISD2Wolfram syndrome 2
Autosomal recessive
11CLCF1Cold-induced sweating syndrome 2
Autosomal recessive
7CLCN1Myotonia congenita, recessive
Autosomal recessive
3CLCN2Leukoencephalopathy with ataxia
Autosomal recessive
16CLCN7Osteopetrosis, autosomal recessive type 4
Autosomal recessive
1CLCNKABartter syndrome, type 4B, digenic
Digenic inheritance (CLCNKB gene)
1CLCNKBBartter syndrome, type 3
Bartter syndrome, type 4B, digenic
Autosomal recessive; Digenic inheritance (CLCNKA gene)
3CLDN1Ichthyosis, leukocyte vacuoles, alopecia, and sclerosing cholangitis
Autosomal recessive
21CLDN14Deafness type 29, autosomal recessive
Autosomal recessive
3CLDN16Hypomagnesemia, type 3, renal
Autosomal recessive
1CLDN19Rena hypomagnesemia type 5, with ocular involvement
Autosomal recessive
11CLMPCongenital short bowel syndrome
Autosomal recessive
16CLN3Ceroid lipofuscinosis, neuronal, type 3
Autosomal recessive
13CLN5Ceroid lipofuscinosis, neuronal, type 5
Autosomal recessive
15CLN6Ceroid lipofuscinosis, neuronal, type 6
Autosomal recessive
8CLN8Ceroid lipofuscinosis, neuronal, type 8
Autosomal recessive
11CLPB3-methylglutaconic aciduria, type 7, with cataracts, neurologic involvement and
neutropenia
autosomal recessive
19CLPPPerrault syndrome 3
Autosomal recessive
3CLRN1Usher syndrome, type 3A
Autosomal recessive
4CNGA1Retinitis pigmentosa type 49
Autosomal recessive
2CNGA3Achromatopsia, type 2
Autosomal recessive
16CNGB1Retinitis pigmentosa type 45
Autosomal recessive
8CNGB3Achromatopsia, type 3
Autosomal recessive
10CNNM2Hypomagnesemia, seizures, and mental retardation
Autosomal recessive*
2CNNM4Jalili syndrome
Autosomal recessive
6CNPY3Epileptic encephalopathy, early infantile, type 60
Autosomal recessive
7CNTNAP2Pitt-Hopkins like syndrome 1
Autosomal recessive
1COA6Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 4
Autosomal recessive
17COASYNeurodegeneration with brain iron accumulation 6
Autosomal recessive
17COG1Congenital disorder of glycosylation, type IIg
Autosomal recessive
16COG4Congenital disorder of glycosylation, type 2J
Autosomal recessive
7COG5Congenital disorder of glycosylation, type 2I
Autosomal recessive
13COG6Congenital disorder of glycosylation, type 2L
Shaheen syndrome
Autosomal recessive
16COG7Congenital disorder of glycosylation, type 2E
Autosomal recessive
16COG8Congenital disorder of glycosylation, type 2H
Autosomal recessive
1COL11A1Fibrochondrogenesis type 1
Autosomal recessive
6COL11A2Otospondylomegaepiphyseal dysplasia, autosomal recessive
Autosomal recessive
10COL17A1Epidermolysis bullosa, junctional, non-Herlitz type
Autosomal recessive
21COL18A1Knobloch syndrome, type 1
Autosomal recessive
7COL1A2Ehlers-Danlos syndrome, cardiac valvular type
Autosomal recessive
4COL25A1Fibrosis of extraocular muscles, congenital, type 5
Autosomal recessive
2COL4A3Alport syndrome, autosomal recessive, type 2
Autosomal recessive
2COL4A4Alport syndrome, autosomal recessive, type 2
Autosomal recessive
21COL6A1Ullrich congenital muscular dystrophy, type 1 (Limb-girdle muscular dystrophy, type 22
[LGMD R22])
Autosomal recessive*
21COL6A2Ullrich congenital muscular dystrophy, type 1 (Limb-girdle muscular dystrophy, type 22
[LGMD R22])
Autosomal recessive*
2COL6A3Bethlem myopathy 1, Ullrich congenital muscular dystrophy 1, Dystonia 27
Autosomal recessive*;Autosomal recessive*;Autosomal recessive
3COL7A1Dystrophic epidermolysis bullosa (DEB), Hallopeau-Siemens (HS) type and non-HS type
DEB pruriginosa
DEB pretibial
Autosomal recessive; Autosomal recessive*; Autosomal recessive*
6COL9A1Stickler syndrome, type 4
Autosomal recessive
1COL9A2?Stickler syndrome, type V
Autosomal recessive
2COLEC113MC syndrome 2
Autosomal recessive
3COLQMyasthenic syndrome, congenital, type 5
Autosomal recessive
4COQ2Primary coenzyme Q10 deficiency, type 1
Autosomal recessive
14COQ6Coenzyme Q10 deficiency, primary, type 6
Autosomal recessive
1COQ8APrimary coenzyme Q10 deficiency, type 4
Autosomal recessive
16COQ9Coenzyme Q10 deficiency, primary, type 5
Autosomal recessive
16CORO1AImmunodeficiency, type 8
Autosomal recessive
17COX10Mitochondrial complex IV deficiency, nuclear type 3
Autosomal recessive
10COX15Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, type
2
Leigh syndrome due to cytochrome c oxidase deficiency
Autosomal recessive
19COX6B1Mitochondrial complex IV deficiency, nuclear type 7
Autosomal recessive
3CPAceruloplasminemia
Autosomal recessive
8CPA6Febrile seizures, familial, type 11
Autosomal recessive
5CPLANE1Joubert syndrome 17
Autosomal recessive
2CPS1Carbamoylphosphate synthetase 1 deficiency
Autosomal recessive
11CPT1ACarnitine palmitoyltransferase type 1A deficiency, hepatic
Autosomal recessive
1CPT2Carnitine palmitoyltransferase type 2 deficiency, lethal neonatal
Carnitine palmitoyltransferase type 2 deficiency, infantile
Autosomal recessive
1CR2Immunodeficiency, common variable, type 7
Autosomal recessive
12CRADDMental retardation, autosomal recessive, type 34, with variant lissencephaly
Autosomal recessive
1CRB1Retinitis pigmentosa, type 12
Leber congenital amaurosis, type 8
Autosomal recessive
9CRB2Ventriculomegaly with cystic kidney disease
Autosomal recessive
3CRBNMental retardation, autosomal recessive, type 2
Autosomal recessive
19CRLF1Cold-induced sweating syndrome type 1
Autosomal recessive
7CRPPAMuscular dystrophy-dystroglycanopathy, type A7
Muscular dystrophy-dystroglycanopathy, type C7
Autosomal recessive
3CRTAPOsteogenesis imperfecta, type 7
Autosomal recessive
11CRYABMyopathy, myofibrillar, fatal infantile hypertonic, alpha-B crystallin-related
Cataract 16, multiple types
Autosomal recessive; Autosomal recessive*
22CRYBB1Cataract 17
Autosomal recessive*
22CRYBB3Cataract 22
Autosomal recessive
22CSF2RBSurfactant metabolism dysfunction, pulmonary, type 5
Autosomal recessive
1CSF3RNeutropenia, severe congenital, type 7, autosomal recessive
Autosomal recessive
8CSPP1Joubert syndrome 21
Autosomal recessive
3CSTAPeeling skin syndrome, type 4
Autosomal recessive
21CSTBEpilepsy, progressive myoclonic type 1A (Unverricht and Lundborg)
Autosomal recessive
17CTC1Cerebroretinal microangiopathy with calcifications and cysts
Autosomal recessive
1CTHCystathioninuria
Autosomal recessive
17CTNSNephropathic cystinosis
Autosomal recessive
20CTSAGalactosialidosis
Autosomal recessive
11CTSCPapillon-Lefevre syndrome
Haim-Munk syndrome
Periodontitis 1, juvenile
Autosomal recessive;Autosomal recessive;Autosomal recessive
11CTSDCeroid lipofuscinosis, neuronal, type 10
Autosomal recessive
1CTSKPycnodysostosis
Autosomal recessive
10CUBNMegaloblastic anemia 1 (Imerslund-Grasbeck syndrome)
Autosomal recessive
6CUL73M syndrome 1
Autosomal recessive
18CYB5A46,XY disorder of sex development due to isolated 17,20-lyase deficiency
Autosomal recessive
22CYB5R3Methemoglobinemia, type 1
Methemoglobinemia, type 2
Autosomal recessive
16CYBAChronic granulomatous disease, type 4
Autosomal recessive
15CYP11A146,XY disorder of sex development-adrenal insufficiency due to CYP11A1 deficiency
Autosomal recessive
8CYP11B1Adrenal hyperplasia, congenital, due to 11-beta-hydroxylase deficiency
Autosomal recessive
8CYP11B2Hypoaldosteronism, congenital, due to CMO I deficiency
Autosomal recessive
10CYP17A117 alpha(α)-hydroxylase/17,20-lyase deficiency
Autosomal recessive
15CYP19A1Aromatase deficiency
Autosomal recessive
2CYP1B1Glaucoma, primary congenital, type 3A
Autosomal recessive
6CYP21A2Congenital adrenal hyperplasia due to 21-hydroxylase deficiency
Autosomal recessive
20CYP24A1Hypercalcemia, infantile, type 1
Autosomal recessive
2CYP26B1Craniosynostosis with radiohumeral fusions and other skeletal and craniofacial
anomalies
Autosomal recessive
10CYP26C1Focal facial dermal dysplasia 4
Autosomal recessive
2CYP27A1Cerebrotendinous xanthomatosis
Autosomal recessive
12CYP27B1Vitamin D-dependent rickets, type 1
Autosomal recessive
11CYP2R1Rickets due to defect in vitamin D 25-hydroxylation
Autosomal recessive
4CYP2U1Spastic paraplegia, type 56, autosomal recessive
Autosomal recessive
19CYP4F22Ichthyosis, congenital, autosomal recessive, type 5
Autosomal recessive
4CYP4V2Bietti crystalline corneoretinal dystrophy
Autosomal recessive
8CYP7B1Spastic paraplegia, type 5A, autosomal recessive
Autosomal recessive
2D2HGDHD-2-hydroxyglutaric aciduria
Autosomal recessive
3DAG1Muscular dystrophy-dystroglycanopathy type A9
Muscular dystrophy-dystroglycanopathy type C9
Autosomal recessive
1DARS2Leukoencephalopathy with brain stem and spinal cord involvement and lactate
elevation
Autosomal recessive
9DBHDopamine beta-hydroxylase deficiency
Autosomal recessive
1DBTMaple syrup urine disease, type 2
Autosomal recessive
2DCAF17Woodhouse-Sakati syndrome
Autosomal recessive
18DCCGaze palsy, familial horizontal, with progressive scoliosis, type 2
Autosomal recessive
10DCLRE1COmenn syndrome
Severe combined immunodeficiency, Athabascan type
Autosomal recessive
11DDB2Xeroderma pigmentosum, complementation group E
Autosomal recessive
7DDCAromatic L-amino acid decarboxylase deficiency
Autosomal recessive
14DDHD1Spastic paraplegia, type 28, autosomal recessive
Autosomal recessive
8DDHD2Spastic paraplegia, type 54, autosomal recessive
Autosomal recessive
1DDR2Spondylometaepiphyseal dysplasia, short limb-hand type
Autosomal recessive
20DDRGK1Spondyloepimetaphyseal dysplasia, Shohat type
Autosomal recessive
2DESMyopathy, myofibrillar, type 1
Autosomal recessive*
17DGKENephrotic syndrome, type 7
Autosomal recessive
2DGUOKDGUOK-related mitochondrial DNA depletion syndrome
Autosomal recessive
1DHCR24Desmosterolosis
Autosomal recessive
11DHCR7Smith-Lemli-Opitz syndrome
Autosomal recessive
1DHDDSRetinitis pigmentosa, type 59
Autosomal recessive
5DHFRMegaloblastic anemia due to dihydrofolate reductase deficiency
Autosomal recessive
12DHH46,XY complete gonadal dysgenesis
Autosomal recessive
16DHODHMiller syndrome
Autosomal recessive
10DHTKD12-aminoadipic 2-oxoadipic aciduria
Autosomal recessive
5DIAPH1Seizures, cortical blindness, microcephaly syndrome
Autosomal recessive
2DIS3L2Perlman syndrome
Autosomal recessive
11DLATPyruvate dehydrogenase E2 deficiency
Autosomal recessive
7DLDDihydrolipoamide dehydrogenase deficiency
Autosomal recessive
19DLL3Spondylocostal dysostosis type 1
Autosomal recessive
5DMGDHDimethylglycine dehydrogenase deficiency
Autosomal recessive
4DMP1Hypophosphatemic rickets, autosomal recessive
Autosomal recessive
16DNAAF1Ciliary dyskinesia, primary, type 13
Autosomal recessive
8DNAAF11Ciliary dyskinesia, primary, type 19
Autosomal recessive
14DNAAF2Ciliary dyskinesia, primary, type 10
Autosomal recessive
19DNAAF3Ciliary dyskinesia, primary, type 2
Autosomal recessive
15DNAAF4Ciliary dyskinesia, primary, type 25
Autosomal recessive
7DNAAF5Ciliary dyskinesia, primary, type 18
Autosomal recessive
7DNAH11Ciliary dyskinesia, primary, type 7, with or without situs inversus
Autosomal recessive
5DNAH5Ciliary dyskinesia, primary, type 3, with or without situs inversus
Autosomal recessive
17DNAH9Ciliary dyskinesia, primary, type 40
Autosomal recessive
9DNAI1Ciliary dyskinesia, primary, type 1, with or without situs inversus
Autosomal recessive
17DNAI2Ciliary dyskinesia, primary, type 9, with or without situs inversus
Autosomal recessive
2DNAJB2Spinal muscular atrophy, distal, autosomal recessive, type 5
Autosomal recessive
3DNAJC193-methylglutaconic aciduria, type 5
Autosomal recessive
1DNAJC6Parkinson disease, type 19A, juvenile-onset
Parkinson disease, type 19B, early-onset
Autosomal recessive
14DNAL1Ciliary dyskinesia, primary, type 16
Autosomal recessive
3DNASE1L3Systemic lupus erythematosus 16
Autosomal recessive
12DNM1LEncephalopathy due to defective mitochondrial and peroxisomal fission, type 1
Autosomal recessive*
19DNM2Lethal congenital contracture syndrome, type 5
Autosomal recessive
20DNMT3BImmunodeficiency-centromeric instability-facial anomalies syndrome, type 1
Autosomal recessive
19DOCK6Adams-Oliver syndrome 2
Autosomal recessive
1DOCK7Epileptic encephalopathy, early infantile, 23
Autosomal recessive
9DOCK8Hyper-IgE recurrent infection syndrome, autosomal recessive
Autosomal recessive
4DOK7Fetal akinesia deformation sequence, type 3
Myasthenic syndrome, congenital, type 10
Autosomal recessive
9DOLKCongenital disorder of glycosylation, type 1M
Autosomal recessive
11DPAGT1Congenital disorder of glycosylation, type 1J
Myasthenic syndrome, congenital, type 13
Autosomal recessive
20DPM1Congenital disorder of glycosylation, type 1E
Autosomal recessive
9DPM2Congenital disorder of glycosylation, type Iu
Autosomal recessive
1DPM3Congenital disorder of glycosylation, type Io
Autosomal recessive
12DPY19L2Spermatogenic failure, type 9
Autosomal recessive
1DPYDDihydropyrimidine dehydrogenase deficiency
Autosomal recessive
8DPYSDihydropyrimidinuria
Autosomal recessive
18DSG1Erythroderma, congenital, with palmoplantar keratoderma, hypotrichosis, and hyper
IgE
Autosomal recessive
18DSG4Hypotrichosis, type 6
Autosomal recessive
6DSPCardiomyopathy, dilated, with woolly hair and keratoderma
Epidermolysis bullosa, lethal acantholytic
Autosomal recessive
6DSTNeuropathy, hereditary sensory and autonomic, type VI
Epidermolysis bullosa simplex 3, localized or generalized intermediate, with bp230
deficiency
Autosomal recessive
1DSTYKSpastic paraplegia, type 23, autosomal recessive
Autosomal recessive
6DTNBP1Hermansky-Pudlak syndrome, type 7
Autosomal recessive
15DUOX2Thyroid dyshormonogenesis, type 6
Autosomal recessive
15DUOXA2Thyroid dyshormonogenesis, type 5
Autosomal recessive
18DYMSmith-McCort dysplasia
Dyggve-Melchior-Clausen disease
Autosomal recessive
11DYNC2H1Short-rib thoracic dysplasia, type 3, with or without polydactyly
Autosomal recessive
2DYSFMiyoshi muscular dystrophy, type 1
Limb-girdle muscular dystrophy, type 2 (LGMD R2)
Autosomal recessive
16EARS2Combined oxidative phosphorylation deficiency 12
Autosomal recessive
1ECM1Urbach-Wiethe disease
Autosomal recessive
2EDAREctodermal dysplasia 10B, hypohidrotic/hair/tooth type
Autosomal recessive
1EDARADDEctodermal dysplasia 11B, hypohidrotic/hair/tooth type
Autosomal recessive
6EDN1Auriculocondylar syndrome, type 3
Autosomal recessive
20EDN3Waardenburg syndrome, type 4B
Autosomal recessive
13EDNRBABCD syndrome
Autosomal recessive
11EFEMP2Cutis laxa, autosomal recessive, type 1B
Autosomal recessive
7EGFR?Inflammatory skin and bowel disease, neonatal, 2
Autosomal recessive
10EGR2Dejerine-Sottas disease
Autosomal recessive*
2EIF2AK3Wolcott-Rallison syndrome
Autosomal recessive
12EIF2B1Leukoencephalopathy with vanishing white matter (VWM)
Autosomal recessive
14EIF2B2Leukoencephalopathy with vanishing white matter (VWM)
Autosomal recessive
1EIF2B3Leukoencephalopathy with vanishing white matter (VWM)
Autosomal recessive
2EIF2B4Leukoencephalopathy with vanishing white matter (VWM)
Autosomal recessive
3EIF2B5Leukoencephalopathy with vanishing white matter (VWM)
Autosomal recessive
17ELAC2Combined oxidative phosphorylation deficiency 17
Autosomal recessive
6ELOVL4Ichthyosis, spastic quadriplegia, and mental retardation
Autosomal recessive
9ELP1Familial dysautonomia
Autosomal recessive
18ELP2Mental retardation, autosomal recessive, type 58
Autosomal recessive
4ENAMAmelogenesis imperfecta, type 1C
Autosomal recessive
17ENO3?Glycogen storage disease XIII
Autosomal recessive
6ENPP1Arterial calcification, generalized, of infancy, type 1
Autosomal recessive
10ENTPD1Spastic paraplegia, type 64, autosomal recessive
Autosomal recessive
3EOGTAdams-Oliver syndrome 4
Autosomal recessive
1EPB41Elliptocytosis, type 1
Autosomal recessive*
15EPB42Spherocytosis, type 5
Autosomal recessive
2EPCAMDiarrhea 5, with tufting enteropathy, congenital
Autosomal recessive
6EPM2AEpilepsy, progressive myoclonic, type 2A (Lafora)
Autosomal recessive
12ERBB3Lethal congenital contractural syndrome, type 2
Autosomal recessive
19ERCC1Cerebrooculofacioskeletal syndrome, type 4
Autosomal recessive
19ERCC2Trichothiodystrophy, type 1
Xeroderma pigmentosum, group D
Autosomal recessive
2ERCC3Trichothiodystrophy, type 2
Autosomal recessive
16ERCC4Fanconi anemia, complementation group Q
Autosomal recessive
13ERCC5Cerebrooculofacioskeletal syndrome 3
Xeroderma pigmentosum, group G
Xeroderma pigmentosum, group G/Cockayne syndrome
Autosomal recessive
10ERCC6Cockayne syndrome, type B
Cerebrooculofacioskeletal syndrome, type 1
Autosomal recessive
5ERCC8Cockayne syndrome, type A
Autosomal recessive
8ERLIN2Spastic paraplegia, type 18, autosomal recessive
Autosomal recessive
8ESCO2Roberts syndrome
Autosomal recessive
1ESPNDeafness, autosomal recessive, type 36
Autosomal recessive
6ESR1Estrogen resistance
Autosomal recessive
14ESRRBDeafness, autosomal recessive, type 35
Autosomal recessive
15ETFAGlutaric acidemia, type 2A
Autosomal recessive
19ETFBGlutaric acidemia, type 2B
Autosomal recessive
4ETFDHGlutaric acidemia, type 2C
Autosomal recessive
19ETHE1Ethylmalonic encephalopathy
Autosomal recessive
4EVCEllis-van Creveld syndrome
Autosomal recessive
4EVC2Ellis-van Creveld syndrome
Autosomal recessive
9EXOSC3Pontocerebellar hypoplasia, type 1B
Autosomal recessive
11EXPH5Epidermolysis bullosa, nonspecific, autosomal recessive
Autosomal recessive
8EXTL3Immunoskeletal dysplasia with neurodevelopmental abnormalities
Autosomal recessive
6EYSRetinitis pigmentosa, type 25
Autosomal recessive
13F10Factor X deficiency
Autosomal recessive
4F11Factor XI deficiency
Autosomal recessive*
6F13A1Factor XIIIA deficiency
Autosomal recessive
1F13BFactor XIIIB deficiency
Autosomal recessive
11F2Prothrombin deficiency
Autosomal recessive
1F5Factor V deficiency
Autosomal recessive
13F7Factor VII deficiency
Autosomal recessive
16FA2HSpastic paraplegia, type 35, autosomal recessive
Autosomal recessive
11FADDInfections, recurrent, with encephalopathy, hepatic dysfunction, and cardiovascular
malformations
Autosomal recessive
15FAHTyrosinemia, type 1
Autosomal recessive
7FAM126ALeukodystrophy, hypomyelinating, type 5
Autosomal recessive
2FAM161ARetinitis pigmentosa, type 28
Autosomal recessive
17FAM20AAmelogenesis imperfecta, type 1G (Enamel-renal syndrome)
Autosomal recessive
7FAM20CRaine syndrome
Autosomal recessive
15FAN1Interstitial nephritis, karyomegalic
Autosomal recessive
16FANCAFanconi anemia, complementation group A
Autosomal recessive
9FANCCFanconi anemia, complementation group C
Autosomal recessive
3FANCD2Fanconi anemia, complementation group D2
Autosomal recessive
6FANCEFanconi anemia, complementation group E
Autosomal recessive
11FANCFFanconi anemia, complementation group F
Autosomal recessive
9FANCGFanconi anemia, complementation group G
Autosomal recessive
15FANCIFanconi anemia, complementation group I
Autosomal recessive
2FANCLFanconi anemia, complementation group L
Autosomal recessive
14FANCMSpermatogenic failure 28
?Premature ovarian failure 15
Autosomal recessive
6FARS2Combined oxidative phosphorylation deficiency 14
Spastic paraplegia, type 77, autosomal recessive
Autosomal recessive
2FASTKD2Combined oxidative phosphorylation deficiency 44
Autosomal recessive
4FAT4Hennekam lymphangiectasia-lymphedema syndrome 2
Autosomal recessive
14FBLN5Cutis laxa, autosomal recessive, type 1A
Autosomal recessive
9FBP1Fructose-1,6-bisphosphatase deficiency
Autosomal recessive
6FBXL4Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type)
Autosomal recessive
22FBXO7Parkinson disease, type 15, autosomal recessive
Autosomal recessive
18FECHProtoporphyria, erythropoietic, autosomal recessive
Autosomal recessive
20FERMT1Kindler syndrome
Autosomal recessive
11FERMT3Leukocyte adhesion deficiency, type 3
Autosomal recessive
4FGAAfibrinogenemia, congenital
Autosomal recessive
4FGBCongenital afibrinogenemia
Autosomal recessive
12FGD4Charcot-Marie-Tooth disease, type 4H
Autosomal recessive
12FGF23Tumoral calcinosis, hyperphosphatemic, familial, type 2
Autosomal recessive
11FGF3Deafness, congenital with inner ear agenesis, microtia, and microdontia
Autosomal recessive
4FGGAfibrinogenemia, congenital
Hypofibrinogenemia, congenital
Autosomal recessive
1FHFumarase deficiency
Autosomal recessive
6FIG4Charcot-Marie-Tooth disease, type 4J
Yunis-Varon syndrome
Autosomal recessive
17FKBP10Bruck syndrome 1
Autosomal recessive
7FKBP14Ehlers-Danlos syndrome, kyphoscoliotic type, 2
Autosomal recessive
19FKRPMuscular dystrophy-dystroglycanopathy, type 5A (Walker-Warburg syndrome)
Type 5B
Type 5C (limb-girdle muscular dystrophy, type 9 [LGMDR9])
Autosomal recessive
9FKTNMuscular dystrophy-dystroglycanopathy, type 4A (Walker-Warburg syndrome)
Type 4B
Type 4C (limb-girdle muscular dystrophy, type 13 [LGMD R13])
Autosomal recessive
1FLAD1Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency
Autosomal recessive
1FLGIchthyosis vulgaris
Autosomal recessive*
11FLI1Bleeding disorder, platelet-type, type 21
Autosomal recessive*
3FLNBSpondylocarpotarsal synostosis syndrome
Autosomal recessive
1FLVCR1Posterior column ataxia-retinitis pigmentosa syndrome
Autosomal recessive
14FLVCR2Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome
Autosomal recessive
1FMN2Mental retardation, autosomal recessive, type 47
Autosomal recessive
1FMO3Trimethylaminuria
Autosomal recessive
11FOLR1Neurodegeneration due to cerebral folate transport deficiency
Autosomal recessive
9FOXE1Bamforth-Lazarus syndrome
Autosomal recessive
1FOXE3Anterior segment dysgenesis, type 2, multiple subtypes
Autosomal recessive
17FOXN1T-cell immunodeficiency, congenital alopecia and nail dystrophy
Autosomal recessive
11FOXRED1Mitochondrial complex I deficiency, nuclear type 19
Autosomal recessive
4FRAS1Fraser syndrome, type 1
Autosomal recessive
9FREM1Manitoba oculotrichoanal syndrome
Autosomal recessive
13FREM2Fraser syndrome, type 2
Autosomal recessive
11FSHBHypogonadotropic hypogonadism, type 24, without anosmia
Autosomal recessive
2FSHROvarian dysgenesis 1
Autosomal recessive
21FTCDGlutamate formiminotransferase deficiency
Autosomal recessive
19FTLL-ferritin deficiency
Autosomal recessive*
16FTOGrowth retardation, developmental delay, facial dysmorphism
Autosomal recessive
1FUCA1Fucosidosis
Autosomal recessive
14FUT8Congenital disorder of glycosylation with defective fucosylation, type 1
Autosomal recessive
9FXNFriedreich ataxia
Autosomal recessive
3FYCO1Cataract 18
Autosomal recessive
8FZD6Nail disorder, nonsyndromic congenital, type 10 (claw-shaped nails)
Autosomal recessive
17G6PC1Glycogen storage disease, type 1A
Autosomal recessive
17G6PC3Dursun syndrome
Autosomal recessive
17GAAGlycogen storage disease, type 2
Autosomal recessive
14GALCKrabbe disease
Autosomal recessive
1GALEGalactose epimerase deficiency
Autosomal recessive
17GALK1Galactokinase deficiency with cataracts
Autosomal recessive
16GALNSMucopolysaccharidosis, type 4A
Autosomal recessive
2GALNT3Tumoral calcinosis, hyperphosphatemic, familial, type 1
Autosomal recessive
9GALTGalactosemia
Autosomal recessive
19GAMTCerebral creatine deficiency syndrome, type 2
Autosomal recessive
16GANGiant axonal neuropathy, type 1
Autosomal recessive
16GAS8Ciliary dyskinesia, primary, type 33
Autosomal recessive
15GATMCerebral creatine deficiency syndrome, type 3
Autosomal recessive
1GBAGaucher disease, perinatal lethal
Gaucher disease, type I
Gaucher disease, type II
Gaucher disease, type III
Gaucher disease, type IIIC
Autosomal recessive
3GBE1Glycogen storage disease, type 4
Autosomal recessive
19GCDHGlutaricaciduria, type 1
Autosomal recessive
14GCH1Hyperphenylalaninemia, BH4-deficient, type B
Autosomal recessive
7GCKPermanent neonatal diabetes mellitus (PNDM)
Autosomal recessive*
6GCM2Hypoparathyroidism, familial isolated (FIH) 2
Autosomal recessive
6GCNT2Cataract 13, with adult i phenotype
Autosomal recessive
8GDAP1Charcot-Marie-Tooth disease, recessive intermediate, type A
Autosomal recessive
19GDF1Right atrial isomerism (Ivemark syndrome)
Autosomal recessive
20GDF5Chondrodysplasia, Grebe type
Autosomal recessive
8GDF6Leber congenital amaurosis, type 17
Autosomal recessive
16GFERMyopathy, mitochondrial progressive, with congenital cataract, hearing loss, and
developmental delay
Autosomal recessive
3GFM1Combined oxidative phosphorylation deficiency, type 1
Autosomal recessive
2GFPT1Myasthenia, congenital, type 12, with tubular aggregates
Autosomal recessive
2GGCXVitamin K-dependent clotting factors, combined deficiency of, type 1
Autosomal recessive
17GH1Growth hormone deficiency, isolated, type 1A
Kowarski syndrome
Autosomal recessive
5GHRLaron dwarfism
Autosomal recessive
7GHRHRGrowth hormone deficiency, isolated, type 1B
Autosomal recessive
3GHSRGrowth hormone deficiency, isolated partial
Autosomal recessive
19GIPC3Deafness, autosomal recessive, type 15
Autosomal recessive
6GJA1Craniometaphyseal dysplasia, autosomal recessive
Autosomal recessive
13GJB2Deafness, autosomal recessive, type 1A
Deafness, digenic, GJB2/GJB6
Autosomal recessive; Digenic inheritance (GJB6 gene)
13GJB6Deafness, autosomal recessive, type 1B
Deafness, digenic GJB2/GJB6
Autosomal recessive; Digenic inheritance (GJB2 gene)
1GJC2Spastic paraplegia, type 44, autosomal recessive
Autosomal recessive
3GLB1GM1-gangliosidosis, types 1-3
Mucopolysaccharidosis, type 4B (Morquio)
Autosomal recessive
9GLDCGlycine encephalopathy
Autosomal recessive
9GLE1Lethal congenital contracture syndrome, type 1
Congenital arthrogryposis with anterior horn cell disease
Autosomal recessive
16GLIS2Nephronophthisis, type 7
Autosomal recessive
9GLIS3Diabetes mellitus, neonatal, with congenital hypothyroidism
Autosomal recessive
5GLRA1Hyperekplexia, type 1
Autosomal recessive*
4GLRBHyperekplexia, type 2
Autosomal recessive
14GLRX5Anemia, sideroblastic, type 3, pyridoxine-refractory
Spasticity, childhood-onset, with hyperglycinemia
Autosomal recessive
1GLULGlutamine deficiency, congenital
Autosomal recessive
3GLYCTKD-glyceric aciduria
Autosomal recessive
5GM2AGM2-gangliosidosis, AB variant
Autosomal recessive
2GMPPAAlacrima, achalasia, and mental retardation syndrome
Autosomal recessive
3GMPPBMuscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies),
type A, 14
Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B,
14
Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 14
Autosomal recessive
3GNAT1Night blindness, congenital stationary, type 1G
Autosomal recessive
1GNAT2Achromatopsia, type 4
Autosomal recessive
9GNEInclusion body myopathy, type 2 (Nonaka myopathy)
Autosomal recessive
6GNMTGlycine N-methyltransferase deficiency
Autosomal recessive
1GNPATRhizomelic chondrodysplasia punctata, type 2
Autosomal recessive
12GNPTABMucolipidosis 2 alpha/beta
Mucolipidosis 3 alpha/beta
Autosomal recessive
16GNPTGMucolipidosis III gamma
Autosomal recessive
4GNRHRHypogonadotropic hypogonadism, type 7, without anosmia
Autosomal recessive
12GNSMucopolysaccharidosis, type 3D (Sanfilippo syndrome D)
Autosomal recessive
1GORABGeroderma osteodysplasticum
Autosomal recessive
17GOSR2Epilepsy, progressive myoclonic, type 6
Autosomal recessive
17GP1BABernard-Soulier syndrome, type A1
Autosomal recessive
22GP1BBBernard-Soulier syndrome, type B
Autosomal recessive
19GP6Bleeding disorder, platelet-type, type 11
Autosomal recessive
3GP9Bernard-Soulier syndrome, type C
Autosomal recessive
13GPC6Omodysplasia, type 1
Autosomal recessive
12GPD1Hypertriglyceridemia, transient infantile
Autosomal recessive
14GPHNMolybdenum cofactor deficiency C
Autosomal recessive
19GPIHemolytic anemia, nonspherocytic, due to glucose phosphate isomerase deficiency
Autosomal recessive
8GPIHBP1Hyperlipoproteinemia, type 1D
Autosomal recessive
17GPR179Night blindness, congenital stationary (complete), type 1E, autosomal recessive
Autosomal recessive
1GPSM2Chudley-McCullough syndrome
Autosomal recessive
19GPX4Spondylometaphyseal dysplasia, Sedaghatian type
Autosomal recessive
8GRHL2Ectodermal dysplasia/short stature syndrome
Autosomal recessive
9GRHPRHyperoxaluria, primary, type 2
Autosomal recessive
4GRID2Spinocerebellar ataxia, autosomal recessive, type 18
Autosomal recessive
6GRIK2Mental retardation, autosomal recessive, type, 6
Autosomal recessive
9GRIN1Neurodevelopmental disorder with or without hyperkinetic movements and seizures,
autosomal recessive
Autosomal recessive
12GRIP1Fraser syndrome 3
Autosomal recessive
13GRK1Oguchi disease-2
Autosomal recessive
6GRM1Spinocerebellar ataxia, autosomal recessive, type 13
Autosomal recessive
5GRM6Night blindness, congenital stationary (complete), type 1B, autosomal recessive
Autosomal recessive
17GRNCeroid lipofuscinosis, neuronal, type 11
Autosomal recessive
4GRXCR1Deafness, autosomal recessive, type 25
Autosomal recessive
14GSCShort stature, auditory canal atresia, mandibular hypoplasia, skeletal abnormalities
Autosomal recessive
20GSSGlutathione synthetase deficiency
Autosomal recessive
6GTF2H5Trichothiodystrophy, type 3, photosensitive
Autosomal recessive
19GTPBP3Combined oxidative phosphorylation deficiency 23
Autosomal recessive
12GUCY2CMeconium ileus
Autosomal recessive
17GUCY2DLeber congenital amaurosis, type 1
Autosomal recessive
7GUSBMucopolysaccharidosis, type 7
Autosomal recessive
3GYG1Polyglucosan body myopathy, type 2
Autosomal recessive
19GYS1Glycogen storage disease, type 0, muscle
Autosomal recessive
12GYS2Glycogen storage disease, type 0, liver
Autosomal recessive
1H6PDCortisone reductase deficiency 1
Autosomal recessive
6HACE1Spastic paraplegia and psychomotor retardation with or without seizures
Autosomal recessive
4HADH3-hydroxyacyl-CoA dehydrogenase deficiency
Autosomal recessive
2HADHALCHAD deficiency
Mitochondrial trifunctional protein deficiency
Autosomal recessive
2HADHBMitochondrial trifunctional protein deficiency
Autosomal recessive
19HAMPHemochromatosis, type 2B
Autosomal recessive
5HARS1Usher syndrome, type 3B
Autosomal recessive
1HAX1Neutropenia, severe congenital, type 3, autosomal recessive
Autosomal recessive
16HBA1Thalassemia, alpha-
Autosomal recessive
16HBA2Thalassemia, alpha-
Autosomal recessive
11HBBBeta-thalassemia
Sickle cell anemia and other HBB-related hemoglobinopathies
Autosomal recessive
11HEPACAMMegalencephalic leukoencephalopathy with subcortical cysts 2A
Autosomal recessive
15HERC1Macrocephaly, dysmorphic facies, and psychomotor retardation
Autosomal recessive
17HES7Spondylocostal dysostosis, type 4, autosomal recessive
Autosomal recessive
3HESX1Growth hormone deficiency with pituitary anomalies
Autosomal recessive
15HEXATay-Sachs disease
Autosomal recessive
5HEXBSandhoff disease, infantile, juvenile, and adult forms
Autosomal recessive
6HFE*Hemochromatosis, type 1
Autosomal recessive
3HGDAlkaptonuria
Autosomal recessive
7HGFDeafness, autosomal recessive, type 39
Autosomal recessive
8HGSNATMucopolysaccharidosis type 3C (Sanfilippo syndrome C)
Autosomal recessive
2HIBCH3-hydroxyisobutryl-CoA hydrolase deficiency
Autosomal recessive
5HINT1Neuromyotonia and axonal neuropathy, autosomal recessive
Autosomal recessive
1HJVHemochromatosis, type 2A
Autosomal recessive
10HK1Charcot-Marie-Tooth disease, type 4G
Autosomal recessive
21HLCSHolocarboxylase synthetase deficiency
Autosomal recessive
1HMGCLHMG-CoA lyase deficiency
Autosomal recessive
1HMGCS2HMG-CoA synthase-2 deficiency
Autosomal recessive
22HMOX1Heme oxygenase-1 deficiency
Autosomal recessive
4HMX1Oculoauricular syndrome
Autosomal recessive
2HNMTMental retardation, autosomal recessive, type 51
Autosomal recessive
10HOGA1Hyperoxaluria, primary, type 3
Autosomal recessive
7HOXA1Athabaskan brainstem dysgenesis syndrome
Autosomal recessive
17HOXB1Facial paresis, hereditary congenital, 3
Autosomal recessive
12HOXC13Ectodermal dysplasia 9, hair/nail type
Autosomal recessive
12HPDTyrosinemia, type 3
Autosomal recessive
4HPGDHypertrophic osteoarthropathy, primary, type 1 (pachydermoperiostosis)
Autosomal recessive
10HPS1Hermansky-Pudlak syndrome, type 1
Autosomal recessive
3HPS3Hermansky-Pudlak syndrome, type 3
Autosomal recessive
22HPS4Hermansky-Pudlak syndrome, type 4
Autosomal recessive
11HPS5Hermansky-Pudlak syndrome, type 5
Autosomal recessive
10HPS6Hermansky-Pudlak syndrome, type 6
Autosomal recessive
10HPSE2Urofacial syndrome, type 1
Autosomal recessive
8HRAlopecia universalis
Atrichia with papular lesions
Autosomal recessive
16HSD11B2Apparent mineralocorticoid excess
Autosomal recessive
9HSD17B346,XY disorder of sex development due to 17-beta-hydroxysteroid dehydrogenase 3
deficiency
Autosomal recessive
5HSD17B4D-bifunctional protein deficiency
Autosomal recessive
1HSD3B2Adrenal hyperplasia, congenital, due to 3-beta-hydroxysteroid dehydrogenase 2
deficiency
Autosomal recessive
16HSD3B7Bile acid synthesis defect, congenital, type 1
Autosomal recessive
5HSPA9Even-plus syndrome
Autosomal recessive
2HSPD1Leukodystrophy, hypomyelinating, type 4
Autosomal recessive
1HSPG2Schwartz-Jampel syndrome, type 1
Dyssegmental dysplasia, Silverman-Handmaker type
Autosomal recessive
10HTRA1CARASIL syndrome
Autosomal recessive
2HTRA23-methylglutaconic aciduria, type 8
Autosomal recessive
3HYAL1Mucopolysaccharidosis type IX
Autosomal recessive
16HYDINCiliary dyskinesia, primary, type 5
Autosomal recessive
11HYLS1Hydrolethalus syndrome
Autosomal recessive
2ICOSImmunodeficiency, common variable, 1
Autosomal recessive
20IDH3BRetinitis pigmentosa, type 46
Autosomal recessive
4IDUAMucopolysaccharidosis type 1
Autosomal recessive
18IER3IP1Microcephaly, epilepsy, and diabetes syndrome
Autosomal recessive
6IFNGR1Immunodeficiency, type 27A, mycobacteriosis
Autosomal recessive
21IFNGR2Immunodeficiency, type 28, mycobacteriosis
Autosomal recessive
3IFT122Cranioectodermal dysplasia 1
Autosomal recessive
16IFT140Retinitis pigmentosa, type 80
Short-rib thoracic dysplasia 9 with or without polydactyly
Autosomal recessive
2IFT172Short-rib thoracic dysplasia 10 with or without polydactyly
Autosomal recessive
14IFT43Short-rib thoracic dysplasia 18 with polydactyly
Autosomal recessive
3IFT80Short-rib thoracic dysplasia, type 2, with or without polydactyly
Autosomal recessive
12IGF1Growth retardation with deafness and mental retardation due to IGF1 deficiency
Autosomal recessive
15IGF1RInsulin-like growth factor I, resistance to
Autosomal recessive*
16IGFALSAcid-labile subunit deficiency
Autosomal recessive
4IGFBP7Retinal arterial macroaneurysm with supravalvular pulmonic stenosis
Autosomal recessive
11IGHMBP2Charcot-Marie-Tooth disease, axonal, type 2S
Neuronopathy, distal hereditary motor, type VI
Autosomal recessive
22IGLL1Agammaglobulinemia 2
Autosomal recessive
2IHHAcrocapitofemoral dysplasia
Autosomal recessive
8IKBKBImmunodeficiency, type 15
Autosomal recessive
11IL10RAInflammatory bowel disease, type 28, early onset, autosomal recessive
Autosomal recessive
21IL10RBInflammatory bowel disease, type 25, early onset, autosomal recessive
Autosomal recessive
9IL11RACraniosynostosis and dental anomalies
Autosomal recessive
5IL12BImmunodeficiency, type 29, mycobacteriosis
Autosomal recessive
19IL12RB1Immunodeficiency, type 30
Autosomal recessive
22IL17RAImmunodeficiency, type 51
Autosomal recessive
2IL1RNSterile multifocal osteomyelitis with periostitis and pustulosis
Autosomal recessive
16IL21RImmunodeficiency, type 56
Autosomal recessive
10IL2RAImmunodeficiency, type 41, with lymphoproliferation and autoimmunity
Autosomal recessive
2IL36RNPsoriasis, type 14, pustular
Autosomal recessive
5IL7RSevere combined immunodeficiency, T-cell negative, B-cell/natural killer cell-positive
type
Autosomal recessive
3ILDR1Deafness, autosomal recessive, type 42
Autosomal recessive
3IMPG2Retinitis pigmentosa, type 56
Autosomal recessive
11INSPermanent neonatal diabetes mellitus (PNDM)
Autosomal recessive*
19INSRDiabetes mellitus, insulin-resistant, with acanthosis nigricans, type A
Autosomal recessive
9INVSNephronophthisis, type 2, infantile
Autosomal recessive
3IQCB1Senior-Loken syndrome, type 5
Autosomal recessive
12IRAK4Immunodeficiency, type 67 (IRAK4 deficiency)
Autosomal recessive
16IRF8Immunodeficiency, type 32B, monocyte and dendritic cell deficiency
Autosomal recessive
16IRX5Hamamy syndrome
Autosomal recessive
12ISCUMyopathy with lactic acidosis, hereditary
Autosomal recessive
20ITCHAutoimmune disease, multisystem, with facial dysmorphism
Autosomal recessive
17ITGA2BGlanzmann thrombasthenia
Autosomal recessive
17ITGA3Interstitial lung disease, nephrotic syndrome, and epidermolysis bullosa, congenital
Autosomal recessive
2ITGA6Epidermolysis bullosa, junctional, with pyloric stenosis
Autosomal recessive
12ITGA7Muscular dystrophy, congenital, due to ITGA7 deficiency
Autosomal recessive
21ITGB2Leukocyte adhesion deficiency
Autosomal recessive
17ITGB3Glanzmann thrombasthenia
Autosomal recessive
17ITGB4Epidermolysis bullosa, junctional, with pyloric atresia
Autosomal recessive
2ITGB6Amelogenesis imperfecta, type 1H
Autosomal recessive
5ITKLymphoproliferative syndrome 1
Autosomal recessive
20ITPAEpileptic encephalopathy, early infantile, type 35
Autosomal recessive
3ITPR1Gillespie syndrome
Autosomal recessive*
15IVDIsovaleric acidemia
Autosomal recessive
6IYDThyroid dyshormonogenesis, type 4
Autosomal recessive
19JAK3Severe Combined Immunodeficiency, autosomal recessive, T-negative/B-positive type
Autosomal recessive
11JAM3Hemorrhagic destruction of the brain, subependymal calcification, and cataracts
Autosomal recessive
17JUPNaxos disease
Autosomal recessive
16KARS1Deafness, autosomal recessive, type 89
Autosomal recessive
11KCNJ1Bartter syndrome, type 2
Autosomal recessive
1KCNJ10SESAME syndrome
Autosomal recessive
11KCNJ11Hyperinsulinemic hypoglycemia, type 2 (congenital hyperinsulinism)
Permanent neonatal diabetes mellitus (PNDM)
Autosomal recessive; Autosomal recessive*
9KCNV2Retinal cone dystrophy, type 3B
Autosomal recessive
7KCTD7Epilepsy, progressive myoclonic, type 3, with or without intracellular inclusions
Autosomal recessive
12KERACornea plana 2, autosomal recessive
Autosomal recessive
6KHDC3LHydatidiform mole, recurrent, type 2
Autosomal recessive
14KIAA0586Short-rib thoracic dysplasia 14 with polydactyly
Autosomal recessive
7KIAA1549Retinitis pigmentosa, type 86
Autosomal recessive
2KIF1ANeuropathy, hereditary sensory, type 2C
Spastic paraplegia, type 30, autosomal recessive
Autosomal recessive
15KIF7Acrocallosal syndrome
Joubert syndrome, type 12
Autosomal recessive
10KIFBPGoldberg-Shprintzen megacolon syndrome
Autosomal recessive
19KISS1RHypogonadotropic hypogonadism, type 8, with or without anosmia
Autosomal recessive
20KIZRetinitis pigmentosa 69
Autosomal recessive
5KLHL3Pseudohypoaldosteronism, type 2D
Autosomal recessive
7KLHL7Cold-induced sweating syndrome 3
Autosomal recessive
19KLK4Amelogenesis imperfecta, type 2A1 (hypomaturation type)
Autosomal recessive
4KLKB1Fletcher factor (prekallikrein) deficiency
Autosomal recessive
15KNL1Microcephaly 4, primary, autosomal recessive
Autosomal recessive
17KRT10Epidermolytic hyperkeratosis
Autosomal recessive*
17KRT14Epidermolysis bullosa simplex, autosomal recessive, type 1
Autosomal recessive
12KRT5Epidermolysis bullosa simplex, autosomal recessive, type 1
Autosomal recessive
12KRT85Ectodermal dysplasia 4, hair/nail type
Autosomal recessive
2KYNUVertebral, cardiac, renal, and limb defects syndrome, type 2
Autosomal recessive
14L2HGDHL-2-hydroxyglutaric aciduria
Autosomal recessive
18LAMA1Poretti-Boltshauser syndrome
Autosomal recessive
6LAMA2LAMA2-related muscular dystrophy
Autosomal recessive
18LAMA3Junctional epidermolysis bullosa (JEB) Herlitz type
JEB non-Herlitz type
Autosomal recessive
7LAMB1Lissencephaly, type 5
Autosomal recessive
3LAMB2Pierson syndrome
Nephrotic syndrome, type 5, with or without ocular abnormalities
Autosomal recessive; Autosomal recessive
1LAMB3Junctional epidermolysis bullosa (JEB) Herlitz type
JEB non-Herlitz type
Autosomal recessive
1LAMC2Junctional epidermolysis bullosa (JEB) Herlitz type
JEB non-Herlitz type
Autosomal recessive
9LAMC3Cortical malformations, occipital
Autosomal recessive
22LARGE1Muscular dystrophy-dystroglycanopathy, type 6A and 6B
Autosomal recessive
3LARS2Perrault syndrome, type 4
Autosomal recessive
1LBRGreenberg skeletal dysplasia
Autosomal recessive
6LCA5Leber congenital amaurosis, type 5
Autosomal recessive
16LCATFamilial LCAT deficiency
Fish-eye disease
Autosomal recessive
1LCK?Immunodeficiency, type 22
Autosomal recessive
2LCTLactase deficiency, congenital
Autosomal recessive
11LDHAGlycogen storage disease type 11
Autosomal recessive
19LDLRHypercholesterolemia, familial, type 1
Autosomal recessive*
1LDLRAP1Hypercholesterolemia, familial, autosomal recessive
Autosomal recessive
7LEPObesity, morbid, due to leptin deficiency
Autosomal recessive
1LEPRObesity, morbid, due to leptin receptor deficiency
Autosomal recessive
19LGI4Arthrogryposis multiplex congenita, neurogenic, with myelin defect
Autosomal recessive
19LHBHypogonadotropic hypogonadism, type 23, with or without anosmia
Autosomal recessive
2LHCGRLeydig cell hypoplasia
Autosomal recessive
6LHFPL5Deafness, autosomal recessive, type 67
Autosomal recessive
9LHX3Pituitary hormone deficiency, combined, type 3
Autosomal recessive
4LIASHyperglycinemia, lactic acidosis, and seizures
Autosomal recessive
5LIFRStuve-Wiedemann syndrome / Schwartz-Jampel type 2 syndrome
Autosomal recessive
13LIG4LIG4 syndrome
Autosomal recessive
19LIM2Cataract 19, multiple types
Autosomal recessive
15LINS1Mental retardation, autosomal recessive, type 27
Autosomal recessive
10LIPALysosomal acid lipase deficiency
Autosomal recessive
3LIPHHypotrichosis, type 7 or woolly hair, autosomal recessive, type 2, with or without
hypotrichosis
Autosomal recessive
10LIPNIchthyosis, congenital, autosomal recessive 8
Autosomal recessive
18LMAN1Combined deficiency of factor V and factor VIII, type 1
Autosomal recessive
6LMBRD1Methylmalonic aciduria and homocystinuria, cblF type
Autosomal recessive
16LMF1Lipase deficiency, combined
Autosomal recessive
18LOXHD1Deafness, autosomal recessive, type 77
Autosomal recessive
2LPIN1Myoglobinuria, acute recurrent, autosomal recessive
Autosomal recessive
18LPIN2Majeed syndrome
Autosomal recessive
8LPLLipoprotein lipase deficiency
Autosomal recessive
4LRATLeber congenital amaurosis type 14
Autosomal recessive
4LRBAImmunodeficiency, common variable, 8, with autoimmunity
Autosomal recessive
4LRIT3Night blindness, congenital stationary (complete), 1F, autosomal recessive
Autosomal recessive
10LRMDAAlbinism, oculocutaneous, type 7
Autosomal recessive
2LRP2Donnai-Barrow syndrome
Autosomal recessive
11LRP4Cenani-Lenz syndactyly syndrome
Autosomal recessive
11LRP5Osteoporosis-pseudoglioma syndrome
Autosomal recessive
2LRPPRCLeigh syndrome, French-Canadian type
Autosomal recessive
9LRSAM1Charcot-Marie-Tooth disease, axonal, type 2P
Autosomal recessive
11LRTOMTDeafness, autosomal recessive, type 63
Autosomal recessive
14LTBP2Microspherophakia and/or megalocornea, with ectopia lentis and with or without
secondary glaucoma
Autosomal recessive
11LTBP3Dental anomalies and short stature
Autosomal recessive
19LTBP4Cutis laxa, autosomal recessive, type 1C
Autosomal recessive
1LYSTChediak-Higashi syndrome
Autosomal recessive
3LZTFL1Bardet-Biedl syndrome, type 17
Autosomal recessive
22LZTR1Noonan syndrome, type 2
Autosomal recessive
7MAGI2Nephrotic syndrome, type 15
Autosomal recessive
6MAKRetinitis pigmentosa type 62
Autosomal recessive
18MALT1Immunodeficiency, type 12
Autosomal recessive
9MAN1B1Mental retardation, autosomal recessive, type 15
Autosomal recessive
19MAN2B1Alpha-mannosidosis
Autosomal recessive
4MANBAMannosidosis, beta
Autosomal recessive
17MAPTSupranuclear palsy, progressive atypical (parkinsonism syndrome)
Autosomal recessive
2MARS2Spastic ataxia, type 3, autosomal recessive
Autosomal recessive
5MARVELD2Deafness, autosomal recessive, type 49
Autosomal recessive
3MASP13MC syndrome 1
Autosomal recessive
10MAT1AMethionine adenosyltransferase deficiency, autosomal recessive
Autosomal recessive
2MATN3?Spondyloepimetaphyseal dysplasia
Autosomal recessive
19MBOAT7Mental retardation, autosomal recessive 57
Autosomal recessive
18MC2RGlucocorticoid deficiency, due to ACTH unresponsiveness
Autosomal recessive
3MCCC13-Methylcrotonyl-CoA carboxylase deficiency, type 1
Autosomal recessive
5MCCC23-Methylcrotonyl-CoA carboxylase deficiency, type 2
Autosomal recessive
2MCEEMethylmalonyl-CoA epimerase deficiency
Autosomal recessive
2MCFD2Combined deficiency of factor V and factor VIII, type 2
Autosomal recessive
8MCM4Immunodeficiency, type 54
Autosomal recessive
6MCM9Ovarian dysgenesis 4
Autosomal recessive
19MCOLN1Mucolipidosis type 4
Autosomal recessive
8MCPH1Microcephaly type 1, primary, autosomal recessive
Autosomal recessive
11MED17Microcephaly, postnatal progressive, with seizures and brain atrophy
Autosomal recessive
6MED23Mental retardation, autosomal recessive, type 18
Autosomal recessive
19MED25Basel-Vanagait-Smirin-Yosef syndrome
Autosomal recessive
16MEFVFamilial Mediterranean fever
Autosomal recessive
5MEGF10Myopathy, areflexia, respiratory distress, and dysphagia, early-onset
Autosomal recessive
19MEGF8Carpenter syndrome, type 2
Autosomal recessive
2MERTKRetinitis pigmentosa type 38
Autosomal recessive
15MESP2Spondylocostal dysostosis, type 2, autosomal recessive
Autosomal recessive
2MFFEncephalopathy due to defective mitochondrial and peroxisomal fission, type 2
Autosomal recessive
1MFN2Charcot-Marie-Tooth disease, axonal, type 2A2B
Autosomal recessive
11MFRPMicrophthalmia, isolated type 5
Autosomal recessive
4MFSD8Ceroid lipofuscinosis, neuronal, type 7
Autosomal recessive
14MGAT2Congenital disorder of glycosylation, type 2a
Autosomal recessive
12MGPKeutel syndrome
Autosomal recessive
10MICU1Myopathy with extrapyramidal signs
Autosomal recessive
3MITFCOMMAD syndrome
Autosomal recessive
20MKKSBardet-Biedl syndrome type 6
Autosomal recessive
17MKS1Bardet-Biedl syndrome type 13
Meckel syndrome, type 1
Joubert syndrome, type 28
Autosomal recessive
22MLC1Megalencephalic leukoencephalopathy with subcortical cysts
Autosomal recessive
2MLPHGriscelli syndrome, type 3
Autosomal recessive
16MLYCDMalonyl-CoA decarboxylase deficiency
Autosomal recessive
4MMAAMethylmalonic aciduria, vitamin B12-responsive
Autosomal recessive
12MMABMethylmalonic aciduria, vitamin B12-responsive, type cblB
Autosomal recessive
1MMACHCMethylmalonic aciduria and homocystinuria, cblC type
Autosomal recessive; digenic inheritance (PRDX1 gene)
2MMADHCHomocystinuria, cblD type, variant 1
Autosomal recessive
3MMECharcot-Marie-Tooth disease, axonal, type 2T
Autosomal recessive*
11MMP13Metaphyseal dysplasia, Spahr type
Autosomal recessive
16MMP2Multicentric osteolysis, nodulosis, and arthropathy (MONA)
Autosomal recessive
11MMP20Amelogenesis imperfecta, type 2A2 (hypomaturation type)
Autosomal recessive
6MMUTMethylmalonic aciduria, mut(0) type
Autosomal recessive
18MOCOSXanthinuria, type 2
Autosomal recessive
6MOCS1Molybdenum cofactor deficiency A
Autosomal recessive
5MOCS2Molybdenum cofactor deficiency B
Autosomal recessive
2MOGSCongenital disorder of glycosylation, type 2B
Autosomal recessive
6MPC1Mitochondrial pyruvate carrier deficiency
Autosomal recessive
17MPDU1Congenital disorder of glycosylation, type 1F
Autosomal recessive
9MPDZHydrocephalus, congenital, type 2, with or without brain or eye anomalies
Autosomal recessive
15MPICongenital disorder of glycosylation, type 1B
Autosomal recessive
1MPLThrombocytopenia, congenital amegakaryocytic
Autosomal recessive
7MPLKIPTrichothiodystrophy, type 4, nonphotosensitive
Autosomal recessive
17MPOMyeloperoxidase deficiency
Autosomal recessive
2MPV17Mitochondrial DNA depletion syndrome type 6 (hepatocerebral)
Charcot-Marie-Tooth disease, axonal, type 2EE
Autosomal recessive
1MPZDejerine-Sottas disease
Autosomal recessive*
21MRAPGlucocorticoid deficiency, type 2
Autosomal recessive
11MRE11Ataxia-telangiectasia-like disorder 1
Autosomal recessive
10MRPS16Combined oxidative phosphorylation deficiency 2
Autosomal recessive
3MRPS22Combined oxidative phosphorylation deficiency type 5
Autosomal recessive
5MSH3Familial adenomatous polyposis, type 4
Autosomal recessive
4MSMO1Microcephaly, congenital cataract, and psoriasiform dermatitis
Autosomal recessive
12MSRB3Deafness, autosomal recessive, type 74
Autosomal recessive
15MTFMTCombined oxidative phosphorylation deficiency 15
Autosomal recessive
14MTHFD1Combined immunodeficiency and megaloblastic anemia with or without
hyperhomocysteinemia
Autosomal recessive
1MTHFRHomocystinuria due to MTHFR deficiency
Autosomal recessive
11MTMR2Charcot-Marie-Tooth disease, type 4B1
Autosomal recessive
6MTO1Combined oxidative phosphorylation deficiency 10
Autosomal recessive
1MTRHomocystinuria-megaloblastic anemia, cblG complementation type
Autosomal recessive
12MTRFRCombined oxidative phosphorylation deficiency 7
Spastic paraplegia, type 55, autosomal recessive
Autosomal recessive
5MTRRHomocystinuria-megaloblastic anemia, cbl E type
Autosomal recessive
4MTTPAbetalipoproteinemia
Autosomal recessive
9MUSKFetal akinesia deformation sequence, type 1
Myasthenic syndrome, congenital, type 9, associated with acetylcholine receptor
deficiency
Autosomal recessive
1MUTYHAdenomas, multiple colorectal
Autosomal recessive
12MVKMevalonic aciduria
Autosomal recessive
12MYBPC1Lethal congenital contracture syndrome, type 4
Autosomal recessive
3MYD88Immunodeficiency, type 68
Autosomal recessive
17MYH2Proximal myopathy and ophthalmoplegia
Autosomal recessive
17MYO15ADeafness, autosomal recessive, type 3
Autosomal recessive
15MYO1EGlomerulosclerosis, focal segmental, 6
Autosomal recessive
10MYO3ADeafness, autosomal recessive, type 30
Autosomal recessive
15MYO5AGriscelli syndrome, type 1
Autosomal recessive
18MYO5BMicrovillus inclusion disease
Autosomal recessive
6MYO6Deafness, autosomal recessive, type 37
Autosomal recessive
11MYO7AUsher syndrome, type 1B
Deafness, autosomal recessive, type 2
Autosomal recessive
10MYPNNemaline myopathy, type 11, autosomal recessive
Autosomal recessive
22NAGASchindler disease, type I
Autosomal recessive
17NAGLUMucopolysaccharidosis, type 3B (Sanfilippo B)
Autosomal recessive
17NAGSN-acetylglutamate synthase deficiency
Autosomal recessive
13NALCNHypotonia, infantile, with psychomotor retardation and characteristic facies 1
Autosomal recessive
11NARS2Combined oxidative phosphorylation deficiency 24
Autosomal recessive
2NBASInfantile liver failure syndrome, type 2
Short stature, optic nerve atrophy, and Pelger-Huet anomaly
Autosomal recessive
3NBEAL2Gray platelet syndrome
Autosomal recessive
8NBNNijmegen breakage syndrome
Autosomal recessive
1NCF2Chronic granulomatous disease, type 2
Autosomal recessive
22NCF4Chronic granulomatous disease, type 3
Autosomal recessive
16NDE1Lissencephaly, type 4 (with microcephaly)
Autosomal recessive
8NDRG1Charcot-Marie-Tooth disease, type 4D
Autosomal recessive
5NDST1Mental retardation, autosomal recessive, type 46
Autosomal recessive
2NDUFA10Mitochondrial complex I deficiency, nuclear type 22
Autosomal recessive
19NDUFA11Mitochondrial complex I deficiency, nuclear type 14
Autosomal recessive
12NDUFA12?Mitochondrial complex I deficiency, nuclear type 23
Autosomal recessive
5NDUFA2Mitochondrial complex I deficiency, nuclear type 13
Autosomal recessive
12NDUFA9Mitochondrial complex I deficiency, nuclear type 26
Autosomal recessive
15NDUFAF1Mitochondrial complex I deficiency, nuclear type 11
Autosomal recessive
3NDUFAF3Mitochondrial complex I deficiency, nuclear type 18
Autosomal recessive
20NDUFAF5Mitochondrial complex I deficiency, nuclear type 16
Autosomal recessive
8NDUFAF6Mitochondrial complex I deficiency, nuclear type 17
Autosomal recessive
2NDUFB3Mitochondrial complex I deficiency, nuclear type 25
Autosomal recessive
8NDUFB9Mitochondrial complex I deficiency, nuclear type 24
Autosomal recessive
2NDUFS1Mitochondrial complex I deficiency, nuclear type 5
Autosomal recessive
1NDUFS2Mitochondrial complex I deficiency, nuclear type 6
Autosomal recessive
11NDUFS3Mitochondrial complex I deficiency, nuclear type 8
Autosomal recessive
5NDUFS4Mitochondrial complex I deficiency, nuclear type 1
Autosomal recessive
5NDUFS6Mitochondrial complex I deficiency, nuclear type 9
Autosomal recessive
19NDUFS7Mitochondrial complex I deficiency, nuclear type 3
Autosomal recessive
11NDUFS8Mitochondrial complex I deficiency, nuclear type 2
Autosomal recessive
11NDUFV1Mitochondrial complex I deficiency, nuclear type 4
Autosomal recessive
18NDUFV2Mitochondrial complex I deficiency, nuclear type 7
Autosomal recessive
2NEBNemaline myopathy type 2
Autosomal recessive
11NECTIN1Cleft lip/palate-ectodermal dysplasia syndrome
Orofacial cleft 7
Autosomal recessive
1NECTIN4Ectodermal dysplasia-syndactyly syndrome, type 1
Autosomal recessive
8NEFLCharcot-Marie-Tooth disease, type 1F
Autosomal recessive
4NEK1Short-rib thoracic dysplasia, type 6, with or without polydactyly
Autosomal recessive
17NEK8Renal-hepatic-pancreatic dysplasia, type 2
Autosomal recessive
6NEU1Sialidosis, type 1 and type 2
Autosomal recessive
10NEUROG3Diarrhea 4, malabsorptive, congenital
Autosomal recessive
2NFU1Multiple mitochondrial dysfunctions syndrome 1
Autosomal recessive
1NGFNeuropathy, hereditary sensory and autonomic, type 5
Autosomal recessive
3NGLY1Congenital disorder of deglycosylation
Autosomal recessive
2NHEJ1Severe combined immunodeficiency with microcephaly, growth retardation, and
sensitivity to ionizing radiation
Autosomal recessive
6NHLRC1Epilepsy, progressive myoclonic, type 2B (Lafora)
Autosomal recessive
14NINSeckel syndrome, type 7
Autosomal recessive
5NIPAL4Ichthyosis, congenital, autosomal recessive, type 6
Autosomal recessive
8NKX2-6Conotruncal heart malformations
Autosomal recessive
4NKX3-2Spondylo-megaepiphyseal-metaphyseal dysplasia
Autosomal recessive
17NLRP1Autoinflammation with arthritis and dyskeratosis
Autosomal recessive*
19NLRP7Hydatidiform mole, recurrent, type 1
Autosomal recessive
7NME8Ciliary dyskinesia, primary, type 6
Autosomal recessive
1NMNAT1Leber congenital amaurosis type 9
Autosomal recessive
5NNTGlucocorticoid deficiency 4, with or without mineralocorticoid deficiency
Autosomal recessive
15NOP10Dyskeratosis congenita, autosomal recessive type 1
Autosomal recessive
18NPC1Niemann-Pick disease, type C1
Autosomal recessive
14NPC2Niemann-pick disease, type C2
Autosomal recessive
2NPHP1Joubert syndrome type 4
Autosomal recessive
3NPHP3Meckel syndrome type 7
Autosomal recessive
1NPHP4Nephronophthisis type 4
Autosomal recessive
19NPHS1Nephrotic syndrome, type 1
Autosomal recessive
1NPHS2Nephrotic syndrome, type 2
Autosomal recessive
9NPR2Acromesomelic dysplasia, Maroteaux type
Autosomal recessive
12NR1H4Cholestasis, progressive familial intrahepatic, type 5
Autosomal recessive
15NR2E3Enhanced S-cone syndrome (Goldmann-Favre)
Retinitis pigmentosa, type 37
Autosomal recessive; Autosomal recessive*
14NRLRetinal degeneration, autosomal recessive, clumped pigment type
Autosomal recessive*
2NRXN1Pitt-Hopkins-like syndrome, type 2
Autosomal recessive
5NSUN2Mental retardation, autosomal recessive, type 5
Autosomal recessive
7NT5C3AAnemia, hemolytic, due to UMPH1 deficiency
Autosomal recessive
6NT5ECalcification of joints and arteries
Autosomal recessive
16NTHL1Familial adenomatous polyposis, type 3
Autosomal recessive
1NTRK1Insensitivity to pain, congenital, with anhidrosis
Autosomal recessive
14NUBPLMitochondrial complex I deficiency, nuclear type 21
Autosomal recessive
12NUP107Nephrotic syndrome, type 11
Autosomal recessive
19NUP62Striatonigral degeneration, infantile
Autosomal recessive
10OATGyrate atrophy of choroid and retina
Autosomal recessive
2OBSL13M syndrome 2
Autosomal recessive
15OCA2Oculocutaneous albinism type 2
Autosomal recessive
5OCLNPseudo-TORCH syndrome, type 1
Autosomal recessive
19ODAD1Ciliary dyskinesia, primary, type 20
Autosomal recessive
3OPA1Behr syndrome
Autosomal recessive
19OPA33-methylglutaconic aciduria, type 3
Autosomal recessive
10OPTNAmyotrophic lateral sclerosis, type 12
Autosomal recessive
12ORAI1Immunodeficiency, type 9
Autosomal recessive
1ORC1Meier-Gorlin syndrome, type 1
Autosomal recessive
2ORC4Meier-Gorlin syndrome, type 2
Autosomal recessive
16ORC6Meier-Gorlin syndrome, type 3
Autosomal recessive
6OSTM1Osteopetrosis, autosomal recessive type 5
Autosomal recessive
16OTOADeafness, autosomal recessive, type 22
Autosomal recessive
2OTOFDeafness, autosomal recessive, type 9
Autosomal recessive
11OTOGDeafness, autosomal recessive, type 18B
Autosomal recessive
12OTOGLDeafness, autosomal recessive, type 84B
Autosomal recessive
5OXCT1Succinyl CoA:3-oxoacid CoA transferase deficiency
Autosomal recessive
3P2RY12Bleeding disorder, platelet-type, type 8
Autosomal recessive
1P3H1Osteogenesis imperfecta, type 8
Autosomal recessive
3P3H2Myopia, high, with cataract and vitreoretinal degeneration
Autosomal recessive
12PAHPhenylketonuria
Autosomal recessive
16PALB2Fanconi anemia, complementation group N
Autosomal recessive
20PANK2Neurodegeneration with brain iron accumulation type 1
Autosomal recessive
10PAPSS2Brachyolmia, type 4, with mild epiphyseal and metaphyseal changes
Autosomal recessive
1PARK7Parkinson disease, type 7, autosomal recessive, early-onset
Autosomal recessive
16PARNDyskeratosis congenita, autosomal recessive 6
Autosomal recessive
1PAX7Rhabdomyosarcoma 2, alveolar
Autosomal recessive
11PCPyruvate carboxylase deficiency
Autosomal recessive
2PCARERetinitis pigmentosa, type 54
Autosomal recessive
10PCBD1Hyperphenylalaninemia, BH4-deficient, type D
Autosomal recessive
13PCCAPropionic acidemia
Autosomal recessive
3PCCBPropionic acidemia
Autosomal recessive
10PCDH15Deafness, autosomal recessive, type 23
Usher syndrome, type 1D/F digenic
Autosomal recessive
14PCK2PEPCK deficiency, mitochondrial
Autosomal recessive
21PCNTMicrocephalic osteodysplastic primordial dwarfism, type 2
Autosomal recessive
5PCSK1Obesity with impaired prohormone processing
Autosomal recessive
3PCYT1ASpondylometaphyseal dysplasia with cone-rod dystrophy
Autosomal recessive
5PDE6ARetinitis pigmentosa type 43
Autosomal recessive
4PDE6BRetinitis pigmentosa type 40
Autosomal recessive
10PDE6CCone dystrophy type 4
Autosomal recessive
17PDE6GRetinitis pigmentosa type 57
Autosomal recessive
12PDE6HRetinal cone dystrophy 3 and achromatopsia 6
Autosomal recessive*
3PDHBPyruvate dehydrogenase E1-beta deficiency
Autosomal recessive
11PDHXLacticacidemia due to PDX1 deficiency
Autosomal recessive
8PDP1Pyruvate dehydrogenase phosphatase deficiency
Autosomal recessive
10PDSS1Coenzyme Q10 deficiency, primary, type 2
Autosomal recessive
6PDSS2Coenzyme Q10 deficiency, primary, type 3
Autosomal recessive
13PDX1Pancreatic agenesis type 1
Autosomal recessive
10PDZD7Deafness, autosomal recessive, type 57
Usher syndrome, type 2C, digenic
Autosomal recessive; Digenic inheritance (ADGRV1 gene)
19PEPDProlidase deficiency
Autosomal recessive
7PEX1Heimler syndrome 1
Peroxisome biogenesis disorder 1A (Zellweger)
Peroxisome biogenesis disorder 1B (NALD/IRD)
Autosomal recessive
1PEX10Peroxisome biogenesis disorder, type 6A (Zellweger syndrome)
Peroxisome biogenesis disorder, type 6B
Autosomal recessive
1PEX11B?Peroxisome biogenesis disorder 14B
Autosomal recessive
17PEX12Peroxisome biogenesis disorder type 3A (Zellweger)
Autosomal recessive
2PEX13Peroxisome biogenesis disorder, type 11A (Zellweger syndrome)
Peroxisome biogenesis disorder, type 11B
Autosomal recessive
1PEX14Peroxisome biogenesis disorder, type 13A (Zellweger syndrome)
Autosomal recessive
11PEX16Peroxisome biogenesis disorder, type 8A (Zellweger syndrome)
Peroxisome biogenesis disorder, type 8B
Autosomal recessive
1PEX19Peroxisome biogenesis disorder, type 12A (Zellweger syndrome)
Autosomal recessive
8PEX2Peroxisome biogenesis disorder type 5A (Zellweger)
Autosomal recessive
22PEX26Peroxisome biogenesis disorder type 7A (Zellweger)
Autosomal recessive
6PEX3Peroxisome biogenesis disorder, type 10A (Zellweger syndrome)
Autosomal recessive
12PEX5Peroxisome biogenesis disorder type 2A (Zellweger)
Autosomal recessive
6PEX6Peroxisome biogenesis disorder, type 4A (Zellweger syndrome)
Peroxisome biogenesis disorder, type 4B
Heimler syndrome 2
Autosomal recessive; Autosomal recessive*; Autosomal recessive
6PEX7Rhizomelic chondrodysplasia punctata, type 1
Autosomal recessive
12PFKMGlycogen storage disease, type 7
Autosomal recessive
7PGAM2Glycogen storage disease X
Autosomal recessive
11PGAP2Hyperphosphatasia with mental retardation syndrome 3
Autosomal recessive
17PGAP3Hyperphosphatasia with mental retardation syndrome 4
Autosomal recessive
1PGM1Congenital disorder of glycosylation, type 1t
Autosomal recessive
1PHGDHNeu-Laxova syndrome, type 1
Phosphoglycerate dehydrogenase deficiency
Autosomal recessive
16PHKBGlycogen storage disease, type 9B
Autosomal recessive
16PHKG2Glycogen storage disease type 9c
Autosomal recessive
11PHOX2AFibrosis of extraocular muscles, congenital, 2
Autosomal recessive
10PHYHRefsum disease
Autosomal recessive
17PIGLZunich neuroectodermal syndrome
Autosomal recessive
1PIGMGlycosylphosphatidylinositol deficiency
Autosomal recessive
18PIGNMultiple congenital anomalies-hypotonia-seizures syndrome, type 1
Autosomal recessive
9PIGOHyperphosphatasia with mental retardation syndrome 2
Autosomal recessive
20PIGTMultiple congenital anomalies-hypotonia-seizures syndrome 3
Autosomal recessive
1PIGVHyperphosphatasia with mental retardation syndrome 1
Autosomal recessive
1PINK1Parkinson disease, type 6, early onset
Autosomal recessive
19PIP5K1CLethal congenital contractural syndrome, type 3
Autosomal recessive
2PJVKDeafness, autosomal recessive, type 59
Autosomal recessive
6PKHD1Polycystic kidney disease type 4
Autosomal recessive
1PKLRPyruvate kinase deficiency
Autosomal recessive
1PKP1Ectodermal dysplasia/skin fragility syndrome
Autosomal recessive
22PLA2G6Infantile neuroaxonal dystrophy 1
Neurodegeneration with brain iron accumulation 2B
Parkinson disease 14, autosomal recessive
Autosomal recessive
20PLCB1Epileptic encephalopathy, early infantile, type 12
Autosomal recessive
20PLCB4Auriculocondylar syndrome, type 2
Autosomal recessive*
3PLCD1Nail disorder, nonsyndromic congenital, type 3 (leukonychia)
Autosomal recessive
10PLCE1Nephrotic syndrome, type 3
Autosomal recessive
8PLECEpidermolysis bullosa simplex with muscular dystrophy
Autosomal recessive
1PLEKHG5Charcot-Marie-Tooth disease, recessive intermediate, type C
Autosomal recessive
6PLGPlasminogen deficiency, type I
Autosomal recessive
4PLK4Microcephaly and chorioretinopathy, autosomal recessive, 2
Autosomal recessive
1PLOD1Ehlers-Danlos syndrome, kyphoscoliotic type, 1
Autosomal recessive
3PLOD2Bruck syndrome 2
Autosomal recessive
7PLOD3Lysyl hydroxylase 3 deficiency
Autosomal recessive
16PMM2Congenital disorder of glycosylation, type 1A
Autosomal recessive
17PMP22Dejerine-Sottas disease
Autosomal recessive*
9PMPCASpinocerebellar ataxia, autosomal recessive, type 2
Autosomal recessive
19PNKPAtaxia-oculomotor apraxia, type 4
Microcephaly, seizures, and developmental delay
Autosomal recessive
14PNPImmunodeficiency due to purine nucleoside phosphorylase deficiency
Autosomal recessive
6PNPLA1Ichthyosis, congenital, autosomal recessive, type 10
Autosomal recessive
11PNPLA2Neutral lipid storage disease with myopathy
Autosomal recessive
19PNPLA6Boucher-Neuhauser syndrome
Oliver-McFarlane syndrome
Spastic paraplegia, type 39, autosomal recessive
Autosomal recessive
17PNPOPyridoxamine 5'-phosphate oxidase deficiency
Autosomal recessive
2PNPT1Combined oxidative phosphorylation deficiency 13
Autosomal recessive
3POC1AShort stature, onychodysplasia, facial dysmorphism, and hypotrichosis
Autosomal recessive
12POC1BCone-rod dystrophy 20
Autosomal recessive
12POLEFILS syndrome
Autosomal recessive
15POLGPOLG-related disorders
Autosomal recessive
6POLHXeroderma pigmentosum, variant type
Autosomal recessive
6POLR1CLeukodystrophy, hypomyelinating, type 11
Treacher Collins syndrome 3
Autosomal recessive
13POLR1DTreacher Collins syndrome, type 2
Autosomal recessive*
10POLR3ALeukodystrophy, hypomyelinating, type 7
Autosomal recessive
12POLR3BLeukodystrophy, hypomyelinating, type 8
Autosomal recessive
2POMCObesity, adrenal insufficiency, and red hair due to POMC deficiency
Autosomal recessive
1POMGNT1Muscular dystrophy-dystroglycanopathy, type 3A (Walker-Warburg syndrome)
Type 3B
Type 3C (limb-girdle muscular dystrophy, type 15 [LGMDR15])
Autosomal recessive
3POMGNT2Muscular dystrophy-dystroglycanopathy, type 8A (Walker-Warburg syndrome)
Type 8C (limb-girdle muscular dystrophy, type 24 [LGMD R24])
Autosomal recessive
8POMKMuscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies),
type A, 12
Autosomal recessive
13POMPKeratosis linearis with ichthyosis congenita and sclerosing keratoderma
Autosomal recessive
9POMT1Muscular dystrophy-dystroglycanopathy, type 1A (Walker-Warburg syndrome)
Type 1B
Type 1C (limb-girdle muscular dystrophy, type 11 [LGMD R11])
Autosomal recessive
14POMT2Muscular dystrophy-dystroglycanopathy, type 2A (Walker-Warburg syndrome)
Type 2B
Type 2C (limb-girdle muscular dystrophy, type 14 [LGMD R14])
Autosomal recessive
8POP1Anauxetic dysplasia, type 2
Autosomal recessive
7PORAntley-Bixler syndrome with genital anomalies and disordered steroidogenesis
Autosomal recessive
3POU1F1Pituitary hormone deficiency, combined, type 1
Autosomal recessive*
4PPA2Sudden cardiac failure, infantile
Autosomal recessive
15PPIBOsteogenesis imperfecta, type 9
Autosomal recessive
4PPM1K?Maple syrup urine disease, mild variant
Autosomal recessive
1PPT1Ceroid lipofuscinosis, neuronal, type 1
Autosomal recessive
17PRCDRetinitis pigmentosa, type 36
Autosomal recessive
4PRDM5Brittle cornea syndrome, type 2
Autosomal recessive
2PREPLMyasthenic syndrome, congenital, type 22
Autosomal recessive
10PRF1Hemophagocytic lymphohistiocytosis, familial, type 2
Autosomal recessive
1PRG4Camptodactyly-arthropathy-coxa vara-pericarditis syndrome
Autosomal recessive
12PRICKLE1Epilepsy, progressive myoclonic, type 1B
Autosomal recessive
6PRKNParkinson disease, type 2, juvenile
Autosomal recessive
16PRMT7Short stature, brachydactyly, intellectual developmental disability, and seizures
Autosomal recessive
2PROCThrombophilia due to protein C deficiency, autosomal recessive
Autosomal recessive
4PROM1Retinitis pigmentosa, type 41
Autosomal recessive
5PROP1Pituitary hormone deficiency, combined, type 2
Autosomal recessive
3PROS1Thrombophilia due to protein S deficiency, autosomal recessive
Autosomal recessive
6PRPH2Leber congenital amaurosis 18
Retinitis punctata albescens
Autosomal recessive*
1PRRX1Agnathia-otocephaly complex
Autosomal recessive*
4PRSS12Mental retardation, autosomal recessive, type 1
Autosomal recessive
2PRSS56Microphthalmia, isolated, type 6
Autosomal recessive
19PRXCharcot-Marie-Tooth disease, type 4F
Autosomal recessive
10PSAPCombined SAP deficiency
Autosomal recessive
9PSAT1Neu-Laxova syndrome, type 2
Autosomal recessive
6PSMB8Autoinflammation, lipodystrophy, and dermatosis syndrome
Autosomal recessive
17PSMC3IPOvarian dysgenesis 3
Autosomal recessive
7PSPHPhosphoserine phosphatase deficiency
Autosomal recessive
10PTF1APancreatic agenesis 2
Autosomal recessive
11PTHHypoparathyroidism, familial isolated, type 1
Autosomal recessive*
3PTH1RChondrodysplasia, Blomstrand type
Eiken syndrome
Autosomal recessive
1PTPRCSevere combined immunodeficiency, T cell-negative, B-cell/natural killer-cell positive
Autosomal recessive
12PTPRONephrotic syndrome, type 6
Autosomal recessive
12PTPRQDeafness, autosomal recessive, type 84A
Autosomal recessive
11PTSHyperphenylalaninemia, BH4-deficient, type A
Autosomal recessive
12PUS1Myopathy, lactic acidosis, and sideroblastic anemia, type 1
Autosomal recessive
2PXDNAnterior segment dysgenesis, type 7, with sclerocornea
Autosomal recessive
17PYCR1Cutis laxa, autosomal recessive, type 2B
Autosomal recessive
14PYGLGlycogen storage disease, type 6
Autosomal recessive
11PYGMMcArdle disease
Autosomal recessive
4QDPRHyperphenylalaninemia, BH4-deficient, type C
Autosomal recessive
10RAB18Warburg micro syndrome, type 3
Autosomal recessive
6RAB23Carpenter syndrome
Autosomal recessive
15RAB27AGriscelli syndrome, type 2
Autosomal recessive
2RAB3GAP1Warburg micro syndrome, type 1
Autosomal recessive
1RAB3GAP2Martsolf syndrome 1
Warburg micro syndrome 2
Autosomal recessive
5RAD50Nijmegen breakage syndrome-like disorder
Autosomal recessive
17RAD51CFanconi anemia, complementation group O
Autosomal recessive
11RAG1Omenn syndrome
Severe combined immunodeficiency, B cell-negative
Autosomal recessive
11RAG2Omenn syndrome
Severe combined immunodeficiency, B cell-negative
Autosomal recessive
11RAPSNFetal akinesia deformation sequence, type 2
Myasthenic syndrome, congenital, type 11, associated with AChR deficiency
Autosomal recessive
6RARS2Pontocerebellar hypoplasia, type 6
Autosomal recessive
15RASGRP1Immunodeficiency, type 64
Autosomal recessive
18RAXIsolated microphthalmia, type 3
Autosomal recessive
18RBBP8Jawad syndrome
Seckel syndrome, type 2
Autosomal recessive
10RBP3?Retinitis pigmentosa 66
Autosomal recessive
10RBP4Retinal dystrophy, iris coloboma, and comedogenic acne syndrome
Autosomal recessive
13RCBTB1Retinal dystrophy with or without extraocular anomalies
Autosomal recessive
1RD3Leber congenital amaurosis, type 12
Autosomal recessive
14RDH12Leber congenital amaurosis, type 13
Autosomal recessive
12RDH5Fundus albipunctatus
Autosomal recessive*
11RDXDeafness, autosomal recessive, type 24
Autosomal recessive
8RECQL4Baller-Gerold syndrome
RAPADILINO syndrome
Rothmund-Thomson syndrome
Autosomal recessive
19REEP6Retinitis pigmentosa 77
Autosomal recessive
7RELNLissencephaly 2 (Norman-Roberts type)
Autosomal recessive
1RENRenal tubular dysgenesis
Autosomal recessive
5RETREG1Neuropathy, hereditary sensory and autonomic, type 2B
Autosomal recessive
3RFT1Congenital disorder of glycosylation, type In
Autosomal recessive
1RFX5Bare lymphocyte syndrome, type 2
Autosomal recessive
6RFX6Mitchell-Riley syndrome
Autosomal recessive
19RFXANKBare lymphocyte syndrome, type 2, complementation group B
Autosomal recessive
13RFXAPBare lymphocyte syndrome, type 2
Autosomal recessive
3RHORetinitis pigmentosa, type 4
Retinitis punctata albescens
Autosomal recessive*
20RIN2Macs syndrome
Autosomal recessive
21RIPK4Popliteal pterygium syndrome, Bartsocas-Papas type
Autosomal recessive
15RLBP1Bothnia retinal dystrophy
Fundus albipunctatus
Autosomal recessive; Autosomal recessive*
6RMND1Combined oxidative phosphorylation deficiency 11
Autosomal recessive
19RNASEH2AAicardi-Goutieres syndrome, type 4
Autosomal recessive
13RNASEH2BAicardi-Goutieres syndrome, type 2
Autosomal recessive
11RNASEH2CAicardi-Goutieres syndrome, type 3
Autosomal recessive
6RNASET2Leukoencephalopathy, cystic, without megalencephaly
Autosomal recessive
3RNF168RIDDLE syndrome
Autosomal recessive
11ROBO3Gaze palsy, familial horizontal, with progressive scoliosis, type 1
Autosomal recessive
16ROGDIKohlschutter-Tonz syndrome
Autosomal recessive
11ROM1Retinitis pigmentosa, type 7, digenic
Autosomal recessive
9ROR2Robinow syndrome, autosomal recessive
Autosomal recessive
8RP1Retinitis pigmentosa, type 1
Autosomal recessive
1RPE65RPE65-related Leber
Autosomal recessive
14RPGRIP1Leber congenital amaurosis, type 6
Autosomal recessive
16RPGRIP1LJoubert syndrome, type 7
Meckel syndrome, type 5
COACH syndrome
Autosomal recessive
8RRM2BMitochondrial DNA depletion syndrome, type 8A (encephalomyopathic type with renal
tubulopathy) and type 8B (MNGIE type)
Autosomal recessive
21RSPH1Ciliary dyskinesia, primary, type 24
Autosomal recessive
6RSPH3Ciliary dyskinesia, primary, type 32
Autosomal recessive
6RSPH4ACiliary dyskinesia, primary, type 11
Autosomal recessive
6RSPH9Ciliary dyskinesia, primary, type 12
Autosomal recessive
20RSPO4Anonychia congenita
Autosomal recessive
20RTEL1Dyskeratosis congenita, autosomal recessive type 5
Autosomal recessive*
6RTN4IP1Optic atrophy 10 with or without ataxia, mental retardation, and seizures
Autosomal recessive
18RTTNMicrocephaly, short stature, and polymicrogyria with seizures
Autosomal recessive
12RXYLT1Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies),
type A, 10
Autosomal recessive
19RYR1Congenital myopathy 1B, autosomal recessive
Autosomal recessive
13SACSSpastic ataxia, Charlevoix-Saguenay, type
Autosomal recessive
2SAGOguchi disease, type 1
Autosomal recessive
7SAMD9Tumoral calcinosis, familial, normophosphatemic
Autosomal recessive
20SAMHD1Aicardi-Goutieres syndrome, type 5
Autosomal recessive
5SAR1BChylomicron retention disease
Autosomal recessive
19SARS2Hyperuricemia, pulmonary hypertension, renal failure, and alkalosis
Autosomal recessive
7SBDSShwachman-Diamond syndrome
Autosomal recessive
11SBF2Charcot-Marie-Tooth disease, type 4B2
Autosomal recessive
11SC5DLathosterolosis
Autosomal recessive
4SCARB2Epilepsy, progressive myoclonic, type 4, with or without renal failure
Autosomal recessive
22SCARF2Van den Ende-Gupta syndrome
Autosomal recessive
19SCN1BEpileptic encephalopathy, early infantile, type 52
Autosomal recessive
17SCN4AMyasthenic syndrome, congenital, type 16
Autosomal recessive
2SCN9AIndifference to pain and autosomal recessive hereditary sensory neuropathy type 2D
Autosomal recessive
12SCNN1APseudohypoaldosteronism, type 1
Autosomal recessive
16SCNN1BPseudohypoaldosteronism, type 1
Autosomal recessive
16SCNN1GPseudohypoaldosteronism, type 1
Autosomal recessive
17SCO1Mitochondrial complex IV deficiency, nuclear type 4
Autosomal recessive
22SCO2Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, type
1
Autosomal recessive
1SDCCAG8Bardet-Biedl syndrome, type 16
Autosomal recessive
5SDHAMitochondrial respiratory chain complex II deficiency
Leigh syndrome
Autosomal recessive
19SDHAF1Mitochondrial complex II deficiency
Autosomal recessive
14SEC23ACraniolenticulosutural dysplasia
Autosomal recessive
20SEC23BDyserythropoietic anemia, congenital, type 2
Autosomal recessive
9SECISBP2Thyroid hormone metabolism, abnormal
Autosomal recessive
1SELENONMuscular dystrophy, rigid spine, type 1
Autosomal recessive
1SEMA4ACone-rod dystrophy, type 10
Retinitis pigmentosa, type 35
Autosomal recessive
4SEPSECSPontocerebellar hypoplasia, type 2D
Autosomal recessive
6SERAC13-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome
(MEGDEL)
Autosomal recessive
14SERPINA1Alpha-1 antitrypsin deficiency
Autosomal recessive
1SERPINC1Thrombophilia due to antithrombin III deficiency
Autosomal recessive*
7SERPINE1Plasminogen activator inhibitor-1 deficiency
Autosomal recessive*
17SERPINF1Osteogenesis imperfecta, type 6
Autosomal recessive
17SERPINF2Alpha-2-plasmin inhibitor deficiency
Autosomal recessive
11SERPING1Angioedema, hereditary, types 1 and 2
Autosomal recessive*
11SERPINH1Osteogenesis imperfecta, type 10
Autosomal recessive
9SETXSpinocerebellar ataxia, autosomal recessive, type 1
Autosomal recessive
2SFTPBSurfactant metabolism dysfunction, pulmonary, type 1
Autosomal recessive
17SGCALimb-girdle muscular dystrophy, type 3 (LGMD R3)
Autosomal recessive
4SGCBLimb-girdle muscular dystrophy, type 4 (LGMD R4)
Autosomal recessive
5SGCDLimb-girdle muscular dystrophy, type 6 (LGMD R6)
Autosomal recessive
13SGCGLimb-girdle muscular dystrophy, type 5 (LGMD R5)
Autosomal recessive
17SGSHMucopolysaccharidosis, type 3A (Sanfilippo A)
Autosomal recessive
5SH3PXD2BFrank-ter Haar syndrome
Autosomal recessive
5SH3TC2Charcot-Marie-Tooth disease, type 4C
Autosomal recessive
3SISucrase-isomaltase deficiency, congenital
Autosomal recessive
5SIL1Marinesco-Sjogren syndrome
Autosomal recessive
14SIX6Optic disc anomalies with retinal and/or macular dystrophy
Autosomal recessive
6SKIC2Trichohepatoenteric syndrome 2
Autosomal recessive
5SKIC3Trichohepatoenteric syndrome, type 1 (diarrhea, syndromic)
Autosomal recessive
13SLC10A2Bile acid malabsorption, primary
Autosomal recessive
12SLC11A2Anemia, hypochromic microcytic, with iron overload 1
Autosomal recessive
15SLC12A1Bartter syndrome, type 1
Autosomal recessive
16SLC12A3Gitelman syndrome
Autosomal recessive
20SLC12A5Epileptic encephalopathy, early infantile, 34
Autosomal recessive
15SLC12A6Agenesis of the corpus callosum with peripheral neuropathy
Autosomal recessive
17SLC13A5Epileptic encephalopathy, early infantile, 25
Autosomal recessive
1SLC16A1Monocarboxylate transporter 1 deficiency
Autosomal recessive*
6SLC17A5Salla disease
Autosomal recessive
1SLC19A2Thiamine-responsive megaloblastic anemia syndrome
Autosomal recessive
2SLC19A3Thiamine metabolism dysfunction syndrome, type 2 (biotin- or thiamine-responsive
encephalopathy type)
Autosomal recessive
9SLC1A1Dicarboxylic aminoaciduria
Autosomal recessive
11SLC22A12Hypouricemia, renal
Autosomal recessive
5SLC22A5Carnitine deficiency, systemic primary
Autosomal recessive
15SLC24A1Night blindness, congenital stationary (complete), type 1D, autosomal recessive
Autosomal recessive
15SLC24A5Albinism, oculocutaneous, type 6
Autosomal recessive
22SLC25A1Combined D-2- and L-2-hydroxyglutaric aciduria
Autosomal recessive
2SLC25A12Epileptic encephalopathy, early infantile, type 39
Autosomal recessive
7SLC25A13Citrullinemia, type 2, neonatal-onset
Citrullinemia, type 2, adult-onset
Autosomal recessive
13SLC25A15Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome
Autosomal recessive
17SLC25A19Microcephaly, Amish type
Thiamine metabolism dysfunction syndrome 4 (progressive polyneuropathy type)
Autosomal recessive
3SLC25A20Carnitine-acylcarnitine translocase deficiency
Autosomal recessive
11SLC25A22Epileptic encephalopathy, early infantile, type 3
Autosomal recessive
12SLC25A3Mitochondrial phosphate carrier deficiency
Autosomal recessive
3SLC25A38Anemia, sideroblastic, type 2, pyridoxine-refractory
Autosomal recessive
4SLC25A4Mitochondrial DNA depletion syndrome, type 12B (cardiomyopathic type) AR
Autosomal recessive
5SLC26A2Achondrogenesis Ib
Atelosteogenesis, type II
De la Chapelle dysplasia
Diastrophic dysplasia
Diastrophic dysplasia, broad bone-platyspondylic variant
Epiphyseal dysplasia, multiple, 4
Autosomal recessive
7SLC26A3Diarrhea 1, secretory chloride, congenital
Autosomal recessive
7SLC26A4Deafness, autosomal recessive, type 4
Pendred syndrome
Autosomal recessive
7SLC26A5?Deafness, autosomal recessive, type 61
Autosomal recessive
9SLC27A4Ichthyosis prematurity syndrome
Autosomal recessive
10SLC29A3Histiocytosis-lymphadenopathy plus syndrome
Autosomal recessive
1SLC2A1GLUT1 deficiency syndrome 1, infantile onset, severe
Autosomal recessive*
20SLC2A10Arterial tortuosity syndrome
Autosomal recessive
3SLC2A2Fanconi-Bickel syndrome
Autosomal recessive
4SLC2A9Hypouricemia, renal, type 2
Autosomal recessive*
1SLC30A10Hypermanganesemia with dystonia, type 1
Autosomal recessive
3SLC33A1Congenital cataracts, hearing loss, and neurodegeneration
Autosomal recessive
5SLC34A1Hypercalcemia, infantile, type 2
Autosomal recessive
4SLC34A2Pulmonary alveolar microlithiasis
Autosomal recessive
9SLC34A3Hypophosphatemic rickets with hypercalciuria
Autosomal recessive
6SLC35A1Congenital disorder of glycosylation, type 2F
Autosomal recessive
1SLC35A3Arthrogryposis, impaired intellectual development, and seizures
Autosomal recessive
11SLC35C1Congenital disorder of glycosylation, type 2C
Autosomal recessive
1SLC35D1Schneckenbecken dysplasia
Autosomal recessive
11SLC37A4Glycogen storage disease, type 1B
Autosomal recessive
11SLC39A13Ehlers-Danlos syndrome, spondylodysplastic type, 3
Autosomal recessive
8SLC39A4Acrodermatitis enteropathica
Autosomal recessive
2SLC3A1Cystinuria
Autosomal recessive*
5SLC45A2Albinism, oculocutaneous, type 4
Autosomal recessive
17SLC46A1Folate malabsorption, hereditary
Autosomal recessive
17SLC4A1Distal renal tubular acidosis
Autosomal recessive
20SLC4A11Corneal endothelial dystrophy, autosomal recessive
Autosomal recessive
4SLC4A4Renal tubular acidosis, proximal, with ocular abnormalities
Autosomal recessive
8SLC52A2Brown-Vialetto-Van Laere syndrome, type 2
Autosomal recessive
20SLC52A3Brown-Vialetto-Van Laere syndrome, type 1
Autosomal recessive
22SLC5A1Glucose/galactose malabsorption
Autosomal recessive
16SLC5A2Renal glucosuria
Autosomal recessive*
19SLC5A5Thyroid dyshormonogenesis, type 1
Autosomal recessive
2SLC5A7Myasthenic syndrome, congenital, type 20, presynaptic
Autosomal recessive
1SLC6A17Mental retardation, autosomal recessive 48
Autosomal recessive
5SLC6A19Hartnup disorder
Iminoglycinuria (IG)
Autosomal recessive; Digenic inheritance (SLC36A2)
5SLC6A3Parkinsonism-dystonia, infantile
Autosomal recessive
11SLC6A5Hyperekplexia, type 3
Autosomal recessive*
1SLC6A9Glycine encephalopathy with normal serum glycine
Autosomal recessive
3SLC7A14Retinitis pigmentosa 68
Autosomal recessive
14SLC7A7Lysinuric protein intolerance
Autosomal recessive
19SLC7A9Cystinuria
Autosomal recessive*
5SLC9A3Diarrhea 8, secretory sodium, congenital
Autosomal recessive
3SLCO2A1Hypertrophic osteoarthropathy, primary, autosomal recessive, type 2
Autosomal recessive
13SLITRK6Deafness and myopia
Autosomal recessive
8SLURP1Meleda disease
Autosomal recessive
16SLX4Fanconi anemia, complementation group P
Autosomal recessive
2SMARCAL1Schimke immunoosseous dysplasia
Autosomal recessive
5SMN1Spinal muscular atrophy
Autosomal recessive
14SMOC1Microphthalmia. with limb anomalies
Autosomal recessive
6SMOC2Dentin dysplasia, type 1, with microdontia and misshapen teeth
Autosomal recessive
11SMPD1Niemann-Pick disease, type A
Niemann-Pick disease, type B
Autosomal recessive
22SNAP29Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma
syndrome
Autosomal recessive
7SNX10Osteopetrosis, autosomal recessive, type 8
Autosomal recessive
6SOBPMental retardation, anterior maxillary protrusion, and strabismus
Autosomal recessive
21SOD1Spastic tetraplegia and axial hypotonia, progressive
Amyotrophic lateral sclerosis, type 1
Autosomal recessive; Autosomal recessive*
9SOHLH1Ovarian dysgenesis 5
Autosomal recessive
17SOSTSclerosteosis, type 1
Van Buchem disease
Autosomal recessive
20SOX18Hypotrichosis-lymphedema-telangiectasia syndrome
Autosomal recessive
2SP110Hepatic venoocclusive disease with immunodeficiency
Autosomal recessive
12SP7Osteogenesis imperfecta, type XII
Autosomal recessive
8SPAG1Ciliary dyskinesia, primary, type 28
Autosomal recessive
13SPARTSpactic paraplegia, type 20, autosomal recessive
Autosomal recessive
4SPATA5Epilepsy, hearing loss, and mental retardation syndrome
Autosomal recessive
14SPATA7Leber congenital amaurosis, type 3
Autosomal recessive
2SPEGCentronuclear myopathy, type 5
Autosomal recessive
15SPG11Amyotrophic lateral sclerosis 5, juvenile
Charcot-Marie-Tooth disease, axonal, type 2X
Spastic paraplegia 11
Autosomal recessive
15SPG21Mast syndrome
Autosomal recessive
16SPG7Spastic paraplegia, type 7, autosomal recessive
Autosomal recessive
5SPINK1Tropical calcific pancreatitis
Autosomal recessive*
5SPINK5Netherton syndrome
Autosomal recessive
19SPINT2Diarrhea 3, secretory sodium, congenital, syndromic
Autosomal recessive
2SPRDystonia, dopa-responsive, due to sepiapterin reductase deficiency
Autosomal recessive*
1SPTA1Pyropoikilocytosis
Spherocytosis, type 3
Autosomal recessive
11SPTBN2Spinocerebellar ataxia, autosomal recessive, type 14
Autosomal recessive
5SQSTM1Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset
Autosomal recessive
2SRD5A246,XY disorder of sex development due to 5-alpha-reductase 2 deficiency
(pseudovaginal perineoscrotal hypospadias)
Autosomal recessive
4SRD5A3Congenital disorder of glycosylation, type 1Q
Kahrizi syndrome
Autosomal recessive
11ST14Ichthyosis, congenital, autosomal recessive, type 11
Autosomal recessive
1ST3GAL3Mental retardation, autosomal recessive 12
Autosomal recessive
2ST3GAL5Salt and pepper developmental regression syndrome
Autosomal recessive
8STARLipoid adrenal hyperplasia
Autosomal recessive
2STAT1Immunodeficiency, type 31B, mycobacterial and viral infections
Autosomal recessive
17STAT5BLaron syndrome with immunodeficiency
Autosomal recessive
1STILMicrocephaly, type 7, primary, autosomal recessive
Autosomal recessive
11STIM1Immunodeficiency, type 10
Autosomal recessive
20STK4T-cell immunodeficiency, recurrent infections, autoimmunity, and cardiac
malformations
Autosomal recessive
15STRA6Microphthalmia, isolated, with coloboma, type 8
Autosomal recessive
17STRADAPolyhydramnios, megalencephaly, and symptomatic epilepsy
Autosomal recessive
15STRCDeafness, autosomal recessive, type 16
Autosomal recessive
6STX11Hemophagocytic lymphohistiocytosis, familial, type 4
Autosomal recessive
19STXBP2Hemophagocytic lymphohistiocytosis, familial, type 5
Autosomal recessive
13SUCLA2Mitochondrial DNA depletion syndrome, type 5 (encephalomyopathic with or without
methylmalonic aciduria)
Autosomal recessive
2SUCLG1Mitochondrial DNA depletion syndrome, type 9 (encephalomyopathic, type with
methylmalonic aciduria)
Autosomal recessive
10SUFUJoubert syndrome, type 32
Autosomal recessive
7SUGCTGlutaric aciduria, type 3
Autosomal recessive
19SULT2B1Ichthyosis, congenital, autosomal recessive, type 14
Autosomal recessive
3SUMF1Multiple sulfatase deficiency
Autosomal recessive
12SUOXSulfite oxidase deficiency
Autosomal recessive
9SURF1Mitochondrial complex IV deficiency, nuclear type 1
Charcot-Marie-Tooth disease, type 4K
Autosomal recessive
6SYNE1Spinocerebellar ataxia, autosomal recessive, type 8
Autosomal recessive
1SYT14?Spinocerebellar ataxia, autosomal recessive, type 11
Autosomal recessive
1SZT2Epileptic encephalopathy, early infantile, 18
Autosomal recessive
12TAC3Hypogonadotropic hypogonadism, type 10, with or without anosmia
Autosomal recessive
17TACO1Mitochondrial complex IV deficiency, nuclear type 8
Autosomal recessive
4TACR3Hypogonadotropic hypogonadism, type 11, with or without anosmia
Autosomal recessive
1TACSTD2Corneal dystrophy, gelatinous drop-like
Autosomal recessive
8TAF2Mental retardation, autosomal recessive 40
Autosomal recessive
11TALDO1Transaldolase deficiency
Autosomal recessive
6TAP2Bare lymphocyte syndrome, type 1, due to TAP2 deficiency
Autosomal recessive
16TATTyrosinemia, type 2
Autosomal recessive
3TBC1D23Pontocerebellar hypoplasia, type 11
Autosomal recessive
16TBC1D24DOORS (deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures)
syndrome
Epileptic encephalopathy, early infantile, type 16
Deafness, autosomal recessive, type 86
Autosomal recessive
1TBCEEncephalopathy, progressive, with amyotrophy and optic atrophy
Hypoparathyroidism-retardation-dysmorphism syndrome
Kenny-Caffey syndrome, type 1
Autosomal recessive
4TBCKHypotonia, infantile, with psychomotor retardation and characteristic facies 3
Autosomal recessive
1TBX15Cousin syndrome
Autosomal recessive
1TBX19Congenital isolated adrenocorticotropic hormone deficiency
Autosomal recessive
7TBXAS1Ghosal syndrome
Autosomal recessive
17TCAPLimb-girdle muscular dystrophy, type 7 (LGMD R7)
Autosomal recessive
11TCIRG1Osteopetrosis, autosomal recessive, type 1
Autosomal recessive
22TCN2Transcobalamin II deficiency
Autosomal recessive
12TCTN1Joubert syndrome, type 13
Autosomal recessive
12TCTN2Joubert syndrome, type 24
?Meckel syndrome, type 8
Autosomal recessive
10TCTN3Joubert syndrome 18
Autosomal recessive
14TDP1?Spinocerebellar ataxia, autosomal recessive with axonal neuropathy
Autosomal recessive
9TDRD7Cataract 36
Autosomal recessive
14TECPR2Spastic paraplegia, type 49, autosomal recessive
Autosomal recessive
19TECRMental retardation, autosomal recessive, type 14
Autosomal recessive
4TECRLVentricular tachycardia, catecholaminergic polymorphic, 3
Autosomal recessive
11TECTADeafness, autosomal recessive, type 21
Autosomal recessive
5TERTDyskeratosis congenita, autosomal recessive, type 4
Autosomal recessive
3TFAtransferrinemia
Autosomal recessive
7TFR2Hemochromatosis, type 3
Autosomal recessive
3TFRCImmunodeficiency, type 46
Autosomal recessive
8TGThyroid dyshormonogenesis, type 3
Autosomal recessive
14TGM1Ichthyosis, congenital, autosomal recessive, type 1
Autosomal recessive
15TGM5Peeling skin syndrome, type 2
Autosomal recessive
11THSegawa syndrome, recessive
Autosomal recessive
3THRBThyroid hormone resistance, autosomal recessive
Autosomal recessive
9TJP2Cholestasis, progressive familial intrahepatic 4
Hypercholanemia, familial 1
Autosomal recessive
16TK2Mitochondrial DNA depletion syndrome , type 2 (myopathic type)
Autosomal recessive
9TMC1Deafness, autosomal recessive, type 7
Autosomal recessive
17TMC6Epidermodysplasia verruciformis
Autosomal recessive
17TMC8Epidermodysplasia verruciformis
Autosomal recessive
1TMCO1Craniofacial dysmorphism, skeletal anomalies, and mental retardation syndrome
Autosomal recessive
11TMEM126AOptic atrophy 7
Autosomal recessive
11TMEM138Joubert syndrome 16
Autosomal recessive
4TMEM165Congenital disorder of glycosylation, type 2K
Autosomal recessive
11TMEM216Joubert syndrome, type 2
Meckel syndrome, type 2
Autosomal recessive
16TMEM231Joubert syndrome, type 20
Meckel syndrome,type 11
Autosomal recessive
2TMEM237Joubert syndrome, type 14
Autosomal recessive
8TMEM67Meckel syndrome 3
COACH syndrome 1
Joubert syndrome 6
Nephronophthisis 11
Autosomal recessive
8TMEM70Mitochondrial complex V (ATP synthase) deficiency, nuclear type 2
Autosomal recessive
3TMIEDeafness, autosomal recessive, type 6
Autosomal recessive
21TMPRSS15Enterokinase deficiency
Autosomal recessive
21TMPRSS3Deafness, autosomal recessive, type 8/10
Autosomal recessive
22TMPRSS6Iron-refractory iron deficiency anemia
Autosomal recessive
12TMTC3Lissencephaly 8
Autosomal recessive
18TNFRSF11AOsteopetrosis, autosomal recessive, type 7
Autosomal recessive
8TNFRSF11BPaget disease of bone, type 5, juvenile-onset
Autosomal recessive
17TNFRSF13BImmunodeficiency, common variable, type 2
Autosomal recessive
13TNFSF11Osteopetrosis, autosomal recessive, type 2
Autosomal recessive
19TNNT1Nemaline myopathy , type 5, Amish type
Autosomal recessive
6TNXBEhlers-Danlos syndrome, classic-like
Autosomal recessive
20TP53RKGalloway-Mowat syndrome 4
Autosomal recessive
7TPK1Episodic encephalopathy due to thiamine pyrophosphokinase deficiency
Autosomal recessive
1TPM3Nemaline myopathy, type 1
Congenital fiber-type disproportion myopathy
Autosomal recessive*
2TPOThyroid dyshormonogenesis, type 2A
Autosomal recessive
11TPP1Ceroid lipofuscinosis, neuronal, type 2
Spinocerebellar ataxia, autosomal recessive, type 7
Autosomal recessive
9TPRNDeafness, autosomal recessive, type 79
Autosomal recessive
8TRAPPC9Mental retardation, autosomal recessive, type 13
Autosomal recessive
6TRDNVentricular tachycardia, catecholaminergic polymorphic, type 5, with or without muscle
weakness
Autosomal recessive
6TREM2Nasu-Hakola disease
Autosomal recessive
3TREX1Aicardi-Goutieres syndrome, type 1
Autosomal recessive
8TRHRHypothyroidism, congenital, nongoitrous, type 7
Autosomal recessive
9TRIM32Limb-girdle muscular dystrophy, type 8 (LGMD R8)
Autosomal recessive
17TRIM37Mulibrey nanism
Autosomal recessive
22TRIOBPDeafness, autosomal recessive, type 28
Autosomal recessive
14TRIP11Achondrogenesis, type 1A
Autosomal recessive
5TRIP13Mosaic variegated aneuploidy syndrome 3
Oocyte maturation defect 9
Autosomal recessive
22TRMULiver failure, transient infantile
Autosomal recessive
3TRNT1Retinitis pigmentosa and erythrocytic microcytosis
Autosomal recessive
15TRPM1Night blindness, congenital stationary (complete), type 1C, autosomal recessive
Autosomal recessive
9TRPM6Familial hypomagnesemia with secondary hypocalcemia
Autosomal recessive
7TRPV6Hyperparathyroidism
transient neonatal
Autosomal recessive
3TSEN2Pontocerebellar hypoplasia, type 2B
Autosomal recessive
19TSEN34Pontocerebellar hypoplasia type 2C
Autosomal recessive
17TSEN54Pontocerebellar hypoplasia, type 2A
Pontocerebellar hypoplasia, type 4
Autosomal recessive
12TSFMCombined oxidative phosphorylation deficiency, type 3
Autosomal recessive
1TSHBHypothyroidism, congenital, nongoitrous, type 4
Autosomal recessive
14TSHRHypothyroidism, congenital, nongoitrous, type 1
Autosomal recessive
17TTC19Mitochondrial complex III deficiency, nuclear type 2
Autosomal recessive
2TTC21BShort-rib thoracic dysplasia, type 4, with or without polydactyly
Autosomal recessive
14TTC8Bardet-Biedl syndrome, type 8
Autosomal recessive
8TTI2Mental retardation, autosomal recessive, type 39
Autosomal recessive
2TTNLimb-girdle muscular dystrophy type 10 (LGMDR10)
Early-onset myopathy with fatal cardiomyopathy (Salih myopathy)
Autosomal recessive
8TTPAAtaxia with isolated vitamin E deficiency
Autosomal recessive
22TUBA8Cortical dysplasia, complex, with other brain malformations, type 8
Autosomal recessive
22TUBGCP6Microcephaly and chorioretinopathy, autosomal recessive, type 1
Autosomal recessive
16TUFMCombined oxidative phosphorylation deficiency 4
Autosomal recessive
6TULP1Leber congenital amaurosis, type 15
Autosomal recessive
8TUSC3Mental retardation, autosomal recessive, type 7
Autosomal recessive
2TWIST2Focal facial dermal dysplasia, type 3 (Setleis type)
Autosomal recessive
10TWNKMitochondrial DNA depletion syndrome, type 7 (hepatocerebral type)
Perrault syndrome type 5
Autosomal recessive
19TYK2Immunodeficiency, type 35
Autosomal recessive
22TYMPMitochondrial DNA depletion syndrome, type 1 (MNGIE type)
Autosomal recessive
11TYROculocutaneous albinism (OCA) type 1A
OCA type 1B
Autosomal recessive
19TYROBPPolycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy, type 1
(Nasu-Hakola disease)
Autosomal recessive
9TYRP1Albinism, oculocutaneous, type 3
Autosomal recessive
15UBE3AAngelman syndrome
Autosomal dominant*
12UBE3BKaufman oculocerebrofacial syndrome
Autosomal recessive
15UBR1Johanson-Blizzard syndrome
Autosomal recessive
4UCHL1Spastic paraplegia, type 79, autosomal recessive
Autosomal recessive
2UGT1A1Crigler-Najjar syndrome, type 1
Crigler-Najjar syndrome, type 2
Autosomal recessive
3UMPSOrotic aciduria
Autosomal recessive
17UNC13DHemophagocytic lymphohistiocytosis, familial, type 3
Autosomal recessive
2UNC80Hypotonia, infantile, with psychomotor retardation and characteristic facies, type 2
Autosomal recessive
12UNGImmunodeficiency with hyper IgM, type 5
Autosomal recessive
22UPB1Beta-ureidopropionase deficiency
Autosomal recessive
8UQCRBMitochondrial complex III deficiency, nuclear, type 3
Autosomal recessive
5UQCRQMitochondrial complex III deficiency, nuclear, type 4
Autosomal recessive
1URODPorphyria cutanea tarda
Autosomal recessive
10UROSPorphyria, congenital erythropoietic
Autosomal recessive
16USB1Poikiloderma with neutropenia
Autosomal recessive
11USH1CUsher syndrome, type 1C
Deafness, autosomal recessive, type 18A
Autosomal recessive
17USH1GUsher syndrome, type 1G
Autosomal recessive
1USH2AUsher syndrome, type 2A
Retinitis pigmentosa 39
Autosomal recessive
4UVSSAUV-sensitive syndrome, type 3
Autosomal recessive
12VDRRickets, vitamin D-resistant, type 2A
Autosomal recessive
14VIPAS39Arthrogryposis, renal dysfunction and cholestasis, type 2
Autosomal recessive
16VKORC1Vitamin K-dependent clotting factors, combined deficiency of, type 2
Autosomal recessive
9VLDLRCerebellar hypoplasia and mental retardation with or without quadrupedal locomotion,
type 1
Autosomal recessive
9VPS13AChoreoacanthocytosis
Autosomal recessive
8VPS13BCohen syndrome
Autosomal recessive
15VPS13CParkinson disease 23, autosomal recessive, early onset
Autosomal recessive
15VPS33BArthrogryposis, renal dysfunction and cholestasis, type 1
Autosomal recessive
8VPS37ASpastic paraplegia, type 53, autosomal recessive
Autosomal recessive
17VPS53Pontocerebellar hypoplasia, type 2E
Autosomal recessive
14VRK1Pontocerebellar hypoplasia, type 1A
Autosomal recessive
14VSX2Microphthalmia with coloboma 3
Isolated microphthalmia 2
Autosomal recessive
12VWFvon Willibrand disease, type 3
Autosomal recessive
12WASHC4?Mental retardation, autosomal recessive, type 43
Autosomal recessive
8WASHC5Ritscher-Schinzel syndrome, type 1
Autosomal recessive
4WDR19Nephronophthisis, type 13
Senior-Loken syndrome, type 8
Autosomal recessive
2WDR35Cranioectodermal dysplasia 2
Autosomal recessive
17WDR45BNeurodevelopmental disorder with spastic quadriplegia and brain abnormalities with or
without seizures
Autosomal recessive
19WDR62Microcephaly, type 2, primary, autosomal recessive, with or without cortical
malformations
Autosomal recessive
15WDR72Amelogenesis imperfecta, type 2A3 (hypomaturation type)
Autosomal recessive
17WDR81Cerebellar ataxia, mental retardation, and dysequilibrium syndrome, type 2
Autosomal recessive
4WFS1Wolfram syndrome, type 1
Autosomal recessive
9WHRNUsher syndrome, type 2D
Deafness, autosomal recessive, type 31
Autosomal recessive
2WIPF1?Wiskott-Aldrich syndrome 2
Autosomal recessive
12WNK1Neuropathy, hereditary sensory and autonomic, type 2
Autosomal recessive
12WNT1Osteogenesis imperfecta, type XV
Autosomal recessive
2WNT10AOdontoonychodermal dysplasia
Autosomal recessive
12WNT10BSplit-hand/foot malformation, type 6
Autosomal recessive
17WNT3?Tetra-amelia syndrome
Autosomal recessive
3WNT7AFuhrmann syndrome
Autosomal recessive
17WRAP53Dyskeratosis congenita, autosomal recessive, type 3
Autosomal recessive
8WRNWerner syndrome
Autosomal recessive
16WWOXEpileptic encephalopathy, early infantile, type 28
Spinocerebellar ataxia, autosomal recessive, type 12
Autosomal recessive
2XDHXanthinuria, type 1
Autosomal recessive
9XPAXeroderma pigmentosum, group A
Autosomal recessive
3XPCXeroderma pigmentosum, group C
Autosomal recessive
22XPNPEP3Nephronophthisis-like nephropathy, type 1
Autosomal recessive
5XRCC4Short stature, microcephaly, and endocrine dysfunction
Autosomal recessive
16XYLT1Desbuquois dysplasia, type 2
Autosomal recessive
17XYLT2Spondyloocular syndrome
Autosomal recessive
12YARS2Myopathy, lactic acidosis, and sideroblastic anemia, type 2
Autosomal recessive
1YY1AP1Grange syndrome
Autosomal recessive
2ZAP70Autoimmune disease, multisystem, infantile-onset, type 2
Immunodeficiency, type 48
Autosomal recessive
11ZBTB16Skeletal defects, genital hypoplasia, and mental retardation
Autosomal recessive
6ZBTB24Immunodeficiency-centromeric instability-facial anomalies syndrome, type 2
Autosomal recessive
14ZC3H14Mental retardation, autosomal recessive, type 56
Autosomal recessive
14ZFYVE26Spastic paraplegia, type 15, autosomal recessive
Autosomal recessive
1ZMPSTE24Mandibuloacral dysplasia with, type B lipodystrophy
Autosomal recessive
11ZNF408Retinitis pigmentosa, type 72
Autosomal recessive
16ZNF423Joubert syndrome, type 19
Autosomal recessive
16ZNF469Brittle cornea syndrome, type 1
Autosomal recessive
  • CES CGT Plus V5.5.9
ChromosomeGeneOMIM Phenotype
XABCD1Adrenoleukodystrophy
X-linked
XAP1S2Mental retardation, X-linked, syndromic, type 5 (Pettigrew syndrome)
X-linked
XARAndrogen insensitivity syndrome, complete
X-linked
XARSLChondrodysplasia punctata, brachytelephalangic
X-linked
XARXEpileptic encephalopathy, early infantile, type 1
ARX-related developmental disorders
X-linked
XATP7AMenkes disease
Occipital horn syndrome
X-linked
XATRXMental retardation-hypotonic facies syndrome, X-linked
Alpha-thalassemia/mental retardation syndrome
X-linked
XBRWD3Mental retardation, X-linked, type 93
X-linked
XBTKAgammaglobulinemia X-linked, type 1
X-linked
XCD40LGHyper-IgM syndrome, type 1 (immunodeficiency, X-linked, with hyper-IgM, type 1)
X-linked
XCHMChoroideremia
X-linked
XCOL4A5Alport syndrome, X-linked
X-linked
XCUL4BMental retardation, X-linked, syndromic, type 15 (Cabezas type)
X-linked
XCYBBChronic granulomatous disease, X-linked
X-linked
XDCXLissencephaly, X-linked, type 1
X-linked
XDKC1Dyskeratosis congenita, X-linked
X-linked
XDLG3Mental retardation, X-linked, type 90
X-linked
XDMDDuchenne/Becker muscular dystrophy
X-linked
XEDAEctodermal dysplasia, type 1, hypohidrotic, X-linked
X-linked
XEMDEmery-Dreifuss muscular dystrophy, type 1, X-linked
X-linked
XF8Hemophilia A
X-linked
XF9Hemophilia B
X-linked
XFGD1Aarskog-Scott syndrome
Mental retardation, X-linked syndromic, type 16
X-linked
XFMR1Fragile X syndrome
X-linked
XFTSJ1Mental retardation, X-linked 44
X-linked
XG6PDHemolytic anemia, G6PD deficient (favism)
X-linked
XGJB1Charcot-Marie-Tooth neuropathy, X-linked dominant, type 1
X-linked
XGLAFabry disease
X-linked
XGPR143Ocular albinism, type 1 (Nettleship-Falls type)
X-linked
XHCFC1Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX
type )
X-linked
XHPRT1Lesch-Nyhan syndrome
X-linked
XHSD17B10HSD10 mitochondrial disease
X-linked
XIDSMucopolysaccharidosis, type 2
X-linked
XIL1RAPL1Mental retardation, X-linked, type 21/34
X-linked
XIL2RGSevere combined immunodeficiency, X-linked
X-linked
XKDM5CMental retardation, X-linked, syndromic, Claes-Jensen type
X-linked
XL1CAML1 Syndrome
X-linked
XMECP2Encephalopathy, neonatal severe
Rett syndrome
X-linked
XMID1Opitz GBBB syndrome, type 1
X-linked
XMTM1Myotubular myopathy, X-linked
X-linked
XNDPNorrie disease
X-linked
XNR0B1Adrenal hypoplasia, congenital
X-linked
XOCRLLowe Syndrome
Dent disease type 2
X-linked
XOPHN1Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial
appearance
X-linked
XOTCOrnithine transcarbamylase deficiency
X-linked
XPAK3Mental retardation, X-linked, type 30
X-linked
XPDHA1Pyruvate dehydrogenase E1-alpha deficiency
X-linked
XPGK1Phosphoglycerate kinase 1 deficiency
X-linked
XPHF8Mental retardation syndrome, X-linked, Siderius type
X-linked
XPLP1Pelizaeus-Merzbacher disease
X-linked
XPOU3F4Deafness, X-linked, type 2
X-linked
XPQBP1Renpenning syndrome
X-linked
XPRPS1PRPS1-related disoders
X-linked
XRP2Retinitis pigmentosa, type 2, X-linked
X-linked
XRPGRRetinitis pigmentosa, type 3, X-linked
Cone-rod dystrophy, X-linked, 1
X-linked
XRS1Retinoschisis
X-linked
XSH2D1ALymphoproliferative syndrome, X-linked, type 1
X-linked
XSLC16A2Allan-Herndon-Dudley syndrome
X-linked
XSLC6A8Cerebral creatine deficiency syndrome, type 1
X-linked
XSYN1Epilepsy, X-linked, with variable learning disabilities and behavior disorders
X-linked
XTHOC2Mental retardation, X-linked 12
X-linked
XUPF3BMental retardation, X-linked, syndromic, type 14
X-linked
XWASWiskott-Aldrich syndrome
Thrombocytopenia, X-linked
X-linked
XZDHHC9Mental retardation, X-linked syndromic, Raymond type
X-linked
XZNF711Mental retardation, X-linked, type 97
X-linked
12AAASTriple-A syndrome (achalasia-addisonianism-alacrimia)
Autosomal recessive
2ABCA12Ichthyosis, congenital, autosomal recessive, type 4A
ICAR, type 4B (harlequin)
Autosomal recessive
16ABCA3Surfactant metabolism dysfunction, pulmonary, type 3
Autosomal recessive
1ABCA4Stargardt disease 1
Retinitis pigmentosa 19
Cone-rod dystrophy 3
Autosomal recessive
2ABCB11Cholestasis, benign recurrent intrahepatic, type 2
Cholestasis, progressive familial intrahepatic, type 2
Autosomal recessive
11ABCC8Hyperinsulinemic hypoglycemia, type 1 (congenital hyperinsulinism)
Permanent neonatal diabetes mellitus (PNDM)
Autosomal recessive*
14ABCD4Methylmalonic aciduria and homocystinuria, cblJ type
Autosomal recessive
11ACAD8Isobutyryl-CoA dehydrogenase deficiency
Autosomal recessive
3ACAD9Acyl-CoA dehydrogenase 9 deficiency (mitochondrial complex I deficiency, nuclear, type
20)
Autosomal recessive
1ACADMMedium-chain acyl-CoA dehydrogenase deficiency
Autosomal recessive
12ACADSShort-chain acyl-CoA dehydrogenase deficiency
Autosomal recessive
10ACADSBShort/branched-chain acyl-CoA dehydrogenase deficiency
Autosomal recessive
17ACADVLVery long-chain acyl-CoA dehydrogenase (VLCAD) deficiency
Autosomal recessive
11ACAT1Alpha-methylacetoacetic aciduria (3-ketothiolase deficiency)
Autosomal recessive
17ACOX1Peroxisomal acyl-CoA oxidase deficiency
Autosomal recessive
16ACSF3Combined malonic and methylmalonic aciduria
Autosomal recessive
20ADASevere combined immunodeficiency due to adenosine deaminase deficiency (ADA)
Autosomal recessive
5ADAMTS2Ehlers-Danlos syndrome, dermatosparaxis type
Autosomal recessive
16ADGRG1Polymicrogyria, bilateral frontoparietal
Autosomal recessive
5ADGRV1Usher syndrome, type 2C
Autosomal recessive; Digenic inheritance (PDZD7 gene)
10ADKHypermethioninemia due to adenosine kinase deficiency
Autosomal recessive
4AGAAspartylglucosaminuria (glycosylasparaginase deficiency)
Autosomal recessive
1AGLGlycogen storage disease, type 3
Autosomal recessive
2AGPSRhizomelic chondrodysplasia punctata, type 3
Autosomal recessive
2AGXTHyperoxaluria, primary, type 1
Autosomal recessive
20AHCYHypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase
Autosomal recessive
6AHI1Joubert syndrome, type 3
Autosomal recessive
17AIPL1Leber congenital amaurosis, type 4
Autosomal recessive
21AIREAutoimmune polyendocrinopathy syndrome, type 1
Autosomal recessive*
17ALDH3A2Sjogren-Larsson syndrome
Autosomal recessive
1ALDH4A1Hyperprolinemia, type 2
Autosomal recessive
9ALDOBFructose intolerance, hereditary
Autosomal recessive
16ALG1Congenital disorder of glycosylation, type 1K
Autosomal recessive
1ALG6Congenital disorder of glycosylation, type 1C
Autosomal recessive
2ALMS1Alström syndrome
Autosomal recessive
1ALPLHypophosphatasia, infantile, Hypophosphatasia, childhood
Autosomal recessive
3AMTGlycine encephalopathy
Autosomal recessive
3ANO10Spinocerebellar ataxia, autosomal recessive, type 10
Autosomal recessive
12AQP2Diabetes insipidus, nephrogenic, type 2
Autosomal recessive*
6ARG1Argininemia (arginase deficiency)
Autosomal recessive
3ARL13BJoubert syndrome type 8
Autosomal recessive
22ARSAMetachromatic leukodystrophy
Autosomal recessive
5ARSBMucopolysaccharidosis, type 6 (Maroteaux-Lamy syndrome)
Autosomal recessive
7ASLArgininosuccinic aciduria
Autosomal recessive
7ASNSAsparagine synthetase deficiency
Autosomal recessive
17ASPACanavan disease
Autosomal recessive
9ASS1Citrullinemia, type 1
Autosomal recessive
11ATMAtaxia-telangiectasia
Autosomal recessive
2ATP6V1B1Renal tubular acidosis with deafness
Autosomal recessive
13ATP7BWilson disease
Autosomal recessive
18ATP8B1Cholestasis, progressive familial intrahepatic, type 1
Cholestasis, benign recurrent intrahepatic, type 1
Autosomal recessive
9AUH3-methylglutaconic aciduria, type 1
Autosomal recessive
9B4GALT1Congenital disorder of glycosylation, type 2D
Autosomal recessive
11BBS1Bardet-Biedl syndrome, type 1
Autosomal recessive
12BBS10Bardet-Biedl syndrome, type 10
Autosomal recessive
4BBS12Bardet-Biedl syndrome, type 12
Autosomal recessive
16BBS2Bardet-Biedl syndrome, type 2
Autosomal recessive
3BCHEButyrylcholinesterase deficiency
Autosomal recessive
19BCKDHAMaple syrup urine disease, type 1A
Autosomal recessive
6BCKDHBMaple syrup urine disease, type 1B
Autosomal recessive
2BCS1LBCS1L-related disorders, including Leigh syndrome
Autosomal recessive
15BLMBloom syndrome
Autosomal recessive
1BSNDBartter syndrome, type 4A
Autosomal recessive
3BTDBiotinidase deficiency
Autosomal recessive
8CA2Osteopetrosis with renal tubular acidosis (osteopetrosis, autosomal recessive, type 3)
Autosomal recessive
15CAPN3Limb-girdle muscular dystrophy, type 1 (LGMD R1)
Autosomal recessive
1CASQ2Ventricular tachycardia, catecholaminergic polymorphic, type 2
Autosomal recessive
21CBSHomocystinuria due to cystathionine beta-synthase
Autosomal recessive
4CC2D2AJoubert syndrome, type 9
Meckel syndrome, type 6
COACH syndrome, 2
Autosomal recessive
14CCDC88CHydrocephalus, congenital, type 1
Autosomal recessive
6CCN6Progressive pseudorheumatoid dysplasia
Autosomal recessive
10CDH23Deafness, autosomal recessive, type 12
Usher syndrome, type 1D
Autosomal recessive
12CEP290Meckel syndrome, type 4
Joubert syndrome, type 5
Leber congenital amaurosis, type 10
Autosomal recessive
2CERKLRetinitis pigmentosa, type 26
Autosomal recessive
7CFTRCystic fibrosis
Autosomal recessive
10CHATMyasthenic syndrome, congenital, type 6, presynaptic
Autosomal recessive
17CHRNEMyasthenic syndrome, congenital, type 4B, fast-channel
Myasthenic syndrome, congenital, type 4C, associated with acetylcholine receptor
deficiency
Autosomal recessive
2CHRNGMultiple pterygium syndrome (MPS), Escobar type
MPS, lethal type
Autosomal recessive
16CHST6Macular corneal dystrophy
Autosomal recessive
16CIITABare lymphocyte syndrome, type 2, complementation group A
Autosomal recessive
7CLCN1Myotonia congenita, recessive
Autosomal recessive
16CLN3Ceroid lipofuscinosis, neuronal, type 3
Autosomal recessive
13CLN5Ceroid lipofuscinosis, neuronal, type 5
Autosomal recessive
15CLN6Ceroid lipofuscinosis, neuronal, type 6
Autosomal recessive
8CLN8Ceroid lipofuscinosis, neuronal, type 8
Autosomal recessive
3CLRN1Usher syndrome, type 3A
Autosomal recessive
4CNGA1Retinitis pigmentosa type 49
Autosomal recessive
16CNGB1Retinitis pigmentosa type 45
Autosomal recessive
8CNGB3Achromatopsia, type 3
Autosomal recessive
2COL4A3Alport syndrome, autosomal recessive, type 2
Autosomal recessive
2COL4A4Alport syndrome, autosomal recessive, type 2
Autosomal recessive
3COL7A1Dystrophic epidermolysis bullosa (DEB), Hallopeau-Siemens (HS) type and non-HS type
DEB pruriginosa
DEB pretibial
Autosomal recessive; Autosomal recessive*; Autosomal recessive*
3COLQMyasthenic syndrome, congenital, type 5
Autosomal recessive
10COX15Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, type
2
Leigh syndrome due to cytochrome c oxidase deficiency
Autosomal recessive
2CPS1Carbamoylphosphate synthetase 1 deficiency
Autosomal recessive
11CPT1ACarnitine palmitoyltransferase type 1A deficiency, hepatic
Autosomal recessive
1CPT2Carnitine palmitoyltransferase type 2 deficiency, lethal neonatal
Carnitine palmitoyltransferase type 2 deficiency, infantile
Autosomal recessive
1CRB1Retinitis pigmentosa, type 12
Leber congenital amaurosis, type 8
Autosomal recessive
3CRTAPOsteogenesis imperfecta, type 7
Autosomal recessive
1CTHCystathioninuria
Autosomal recessive
17CTNSNephropathic cystinosis
Autosomal recessive
20CTSAGalactosialidosis
Autosomal recessive
11CTSCPapillon-Lefevre syndrome
Haim-Munk syndrome
Periodontitis 1, juvenile
Autosomal recessive;Autosomal recessive;Autosomal recessive
11CTSDCeroid lipofuscinosis, neuronal, type 10
Autosomal recessive
1CTSKPycnodysostosis
Autosomal recessive
16CYBAChronic granulomatous disease, type 4
Autosomal recessive
15CYP11A146,XY disorder of sex development-adrenal insufficiency due to CYP11A1 deficiency
Autosomal recessive
8CYP11B1Adrenal hyperplasia, congenital, due to 11-beta-hydroxylase deficiency
Autosomal recessive
8CYP11B2Hypoaldosteronism, congenital, due to CMO I deficiency
Autosomal recessive
10CYP17A117 alpha(α)-hydroxylase/17,20-lyase deficiency
Autosomal recessive
15CYP19A1Aromatase deficiency
Autosomal recessive
2CYP1B1Glaucoma, primary congenital, type 3A
Autosomal recessive
6CYP21A2Congenital adrenal hyperplasia due to 21-hydroxylase deficiency
Autosomal recessive
2CYP27A1Cerebrotendinous xanthomatosis
Autosomal recessive
12CYP27B1Vitamin D-dependent rickets, type 1
Autosomal recessive
1DBTMaple syrup urine disease, type 2
Autosomal recessive
10DCLRE1COmenn syndrome
Severe combined immunodeficiency, Athabascan type
Autosomal recessive
11DDB2Xeroderma pigmentosum, complementation group E
Autosomal recessive
11DHCR7Smith-Lemli-Opitz syndrome
Autosomal recessive
1DHDDSRetinitis pigmentosa, type 59
Autosomal recessive
7DLDDihydrolipoamide dehydrogenase deficiency
Autosomal recessive
5DNAH5Ciliary dyskinesia, primary, type 3, with or without situs inversus
Autosomal recessive
9DNAI1Ciliary dyskinesia, primary, type 1, with or without situs inversus
Autosomal recessive
17DNAI2Ciliary dyskinesia, primary, type 9, with or without situs inversus
Autosomal recessive
4DOK7Fetal akinesia deformation sequence, type 3
Myasthenic syndrome, congenital, type 10
Autosomal recessive
9DOLKCongenital disorder of glycosylation, type 1M
Autosomal recessive
11DPAGT1Congenital disorder of glycosylation, type 1J
Myasthenic syndrome, congenital, type 13
Autosomal recessive
20DPM1Congenital disorder of glycosylation, type 1E
Autosomal recessive
1DPYDDihydropyrimidine dehydrogenase deficiency
Autosomal recessive
15DUOX2Thyroid dyshormonogenesis, type 6
Autosomal recessive
15DUOXA2Thyroid dyshormonogenesis, type 5
Autosomal recessive
11DYNC2H1Short-rib thoracic dysplasia, type 3, with or without polydactyly
Autosomal recessive
2DYSFMiyoshi muscular dystrophy, type 1
Limb-girdle muscular dystrophy, type 2 (LGMD R2)
Autosomal recessive
2EDAREctodermal dysplasia 10B, hypohidrotic/hair/tooth type
Autosomal recessive
2EIF2AK3Wolcott-Rallison syndrome
Autosomal recessive
3EIF2B5Leukoencephalopathy with vanishing white matter (VWM)
Autosomal recessive
9ELP1Familial dysautonomia
Autosomal recessive
19ERCC2Trichothiodystrophy, type 1
Xeroderma pigmentosum, group D
Autosomal recessive
2ERCC3Trichothiodystrophy, type 2
Autosomal recessive
13ERCC5Cerebrooculofacioskeletal syndrome 3
Xeroderma pigmentosum, group G
Xeroderma pigmentosum, group G/Cockayne syndrome
Autosomal recessive
10ERCC6Cockayne syndrome, type B
Cerebrooculofacioskeletal syndrome, type 1
Autosomal recessive
5ERCC8Cockayne syndrome, type A
Autosomal recessive
8ESCO2Roberts syndrome
Autosomal recessive
15ETFAGlutaric acidemia, type 2A
Autosomal recessive
19ETFBGlutaric acidemia, type 2B
Autosomal recessive
4ETFDHGlutaric acidemia, type 2C
Autosomal recessive
19ETHE1Ethylmalonic encephalopathy
Autosomal recessive
4EVCEllis-van Creveld syndrome
Autosomal recessive
4EVC2Ellis-van Creveld syndrome
Autosomal recessive
9EXOSC3Pontocerebellar hypoplasia, type 1B
Autosomal recessive
6EYSRetinitis pigmentosa, type 25
Autosomal recessive
4F11Factor XI deficiency
Autosomal recessive*
11F2Prothrombin deficiency
Autosomal recessive
1F5Factor V deficiency
Autosomal recessive
15FAHTyrosinemia, type 1
Autosomal recessive
2FAM161ARetinitis pigmentosa, type 28
Autosomal recessive
7FAM20CRaine syndrome
Autosomal recessive
16FANCAFanconi anemia, complementation group A
Autosomal recessive
9FANCCFanconi anemia, complementation group C
Autosomal recessive
9FANCGFanconi anemia, complementation group G
Autosomal recessive
1FHFumarase deficiency
Autosomal recessive
19FKRPMuscular dystrophy-dystroglycanopathy, type 5A (Walker-Warburg syndrome)
Type 5B
Type 5C (limb-girdle muscular dystrophy, type 9 [LGMDR9])
Autosomal recessive
9FKTNMuscular dystrophy-dystroglycanopathy, type 4A (Walker-Warburg syndrome)
Type 4B
Type 4C (limb-girdle muscular dystrophy, type 13 [LGMD R13])
Autosomal recessive
1FMO3Trimethylaminuria
Autosomal recessive
11FOXRED1Mitochondrial complex I deficiency, nuclear type 19
Autosomal recessive
4FRAS1Fraser syndrome, type 1
Autosomal recessive
21FTCDGlutamate formiminotransferase deficiency
Autosomal recessive
1FUCA1Fucosidosis
Autosomal recessive
9FXNFriedreich ataxia
Autosomal recessive
17G6PC1Glycogen storage disease, type 1A
Autosomal recessive
17G6PC3Dursun syndrome
Autosomal recessive
17GAAGlycogen storage disease, type 2
Autosomal recessive
14GALCKrabbe disease
Autosomal recessive
1GALEGalactose epimerase deficiency
Autosomal recessive
17GALK1Galactokinase deficiency with cataracts
Autosomal recessive
16GALNSMucopolysaccharidosis, type 4A
Autosomal recessive
9GALTGalactosemia
Autosomal recessive
19GAMTCerebral creatine deficiency syndrome, type 2
Autosomal recessive
1GBAGaucher disease, perinatal lethal
Gaucher disease, type I
Gaucher disease, type II
Gaucher disease, type III
Gaucher disease, type IIIC
Autosomal recessive
3GBE1Glycogen storage disease, type 4
Autosomal recessive
19GCDHGlutaricaciduria, type 1
Autosomal recessive
14GCH1Hyperphenylalaninemia, BH4-deficient, type B
Autosomal recessive
8GDAP1Charcot-Marie-Tooth disease, recessive intermediate, type A
Autosomal recessive
20GDF5Chondrodysplasia, Grebe type
Autosomal recessive
3GFM1Combined oxidative phosphorylation deficiency, type 1
Autosomal recessive
7GHRHRGrowth hormone deficiency, isolated, type 1B
Autosomal recessive
13GJB2Deafness, autosomal recessive, type 1A
Deafness, digenic, GJB2/GJB6
Autosomal recessive; Digenic inheritance (GJB6 gene)
13GJB6Deafness, autosomal recessive, type 1B
Deafness, digenic GJB2/GJB6
Autosomal recessive; Digenic inheritance (GJB2 gene)
3GLB1GM1-gangliosidosis, types 1-3
Mucopolysaccharidosis, type 4B (Morquio)
Autosomal recessive
9GLDCGlycine encephalopathy
Autosomal recessive
9GLE1Lethal congenital contracture syndrome, type 1
Congenital arthrogryposis with anterior horn cell disease
Autosomal recessive
9GNEInclusion body myopathy, type 2 (Nonaka myopathy)
Autosomal recessive
6GNMTGlycine N-methyltransferase deficiency
Autosomal recessive
12GNPTABMucolipidosis 2 alpha/beta
Mucolipidosis 3 alpha/beta
Autosomal recessive
16GNPTGMucolipidosis III gamma
Autosomal recessive
4GNRHRHypogonadotropic hypogonadism, type 7, without anosmia
Autosomal recessive
12GNSMucopolysaccharidosis, type 3D (Sanfilippo syndrome D)
Autosomal recessive
17GP1BABernard-Soulier syndrome, type A1
Autosomal recessive
22GP1BBBernard-Soulier syndrome, type B
Autosomal recessive
3GP9Bernard-Soulier syndrome, type C
Autosomal recessive
9GRHPRHyperoxaluria, primary, type 2
Autosomal recessive
12GRIP1Fraser syndrome 3
Autosomal recessive
20GSSGlutathione synthetase deficiency
Autosomal recessive
17GUCY2DLeber congenital amaurosis, type 1
Autosomal recessive
7GUSBMucopolysaccharidosis, type 7
Autosomal recessive
4HADH3-hydroxyacyl-CoA dehydrogenase deficiency
Autosomal recessive
2HADHALCHAD deficiency
Mitochondrial trifunctional protein deficiency
Autosomal recessive
2HADHBMitochondrial trifunctional protein deficiency
Autosomal recessive
1HAX1Neutropenia, severe congenital, type 3, autosomal recessive
Autosomal recessive
16HBA1Thalassemia, alpha-
Autosomal recessive
16HBA2Thalassemia, alpha-
Autosomal recessive
11HBBBeta-thalassemia
Sickle cell anemia and other HBB-related hemoglobinopathies
Autosomal recessive
15HEXATay-Sachs disease
Autosomal recessive
5HEXBSandhoff disease, infantile, juvenile, and adult forms
Autosomal recessive
6HFE*Hemochromatosis, type 1
Autosomal recessive
3HGDAlkaptonuria
Autosomal recessive
8HGSNATMucopolysaccharidosis type 3C (Sanfilippo syndrome C)
Autosomal recessive
1HJVHemochromatosis, type 2A
Autosomal recessive
21HLCSHolocarboxylase synthetase deficiency
Autosomal recessive
1HMGCLHMG-CoA lyase deficiency
Autosomal recessive
22HMOX1Heme oxygenase-1 deficiency
Autosomal recessive
10HOGA1Hyperoxaluria, primary, type 3
Autosomal recessive
12HPDTyrosinemia, type 3
Autosomal recessive
10HPS1Hermansky-Pudlak syndrome, type 1
Autosomal recessive
3HPS3Hermansky-Pudlak syndrome, type 3
Autosomal recessive
9HSD17B346,XY disorder of sex development due to 17-beta-hydroxysteroid dehydrogenase 3
deficiency
Autosomal recessive
5HSD17B4D-bifunctional protein deficiency
Autosomal recessive
1HSD3B2Adrenal hyperplasia, congenital, due to 3-beta-hydroxysteroid dehydrogenase 2
deficiency
Autosomal recessive
1HSPG2Schwartz-Jampel syndrome, type 1
Dyssegmental dysplasia, Silverman-Handmaker type
Autosomal recessive
3HYAL1Mucopolysaccharidosis type IX
Autosomal recessive
11HYLS1Hydrolethalus syndrome
Autosomal recessive
20IDH3BRetinitis pigmentosa, type 46
Autosomal recessive
4IDUAMucopolysaccharidosis type 1
Autosomal recessive
11IGHMBP2Charcot-Marie-Tooth disease, axonal, type 2S
Neuronopathy, distal hereditary motor, type VI
Autosomal recessive
15IVDIsovaleric acidemia
Autosomal recessive
6IYDThyroid dyshormonogenesis, type 4
Autosomal recessive
19JAK3Severe Combined Immunodeficiency, autosomal recessive, T-negative/B-positive type
Autosomal recessive
11KCNJ11Hyperinsulinemic hypoglycemia, type 2 (congenital hyperinsulinism)
Permanent neonatal diabetes mellitus (PNDM)
Autosomal recessive; Autosomal recessive*
6LAMA2LAMA2-related muscular dystrophy
Autosomal recessive
18LAMA3Junctional epidermolysis bullosa (JEB) Herlitz type
JEB non-Herlitz type
Autosomal recessive
1LAMB3Junctional epidermolysis bullosa (JEB) Herlitz type
JEB non-Herlitz type
Autosomal recessive
1LAMC2Junctional epidermolysis bullosa (JEB) Herlitz type
JEB non-Herlitz type
Autosomal recessive
22LARGE1Muscular dystrophy-dystroglycanopathy, type 6A and 6B
Autosomal recessive
6LCA5Leber congenital amaurosis, type 5
Autosomal recessive
19LDLRHypercholesterolemia, familial, type 1
Autosomal recessive*
1LDLRAP1Hypercholesterolemia, familial, autosomal recessive
Autosomal recessive
2LHCGRLeydig cell hypoplasia
Autosomal recessive
9LHX3Pituitary hormone deficiency, combined, type 3
Autosomal recessive
5LIFRStuve-Wiedemann syndrome / Schwartz-Jampel type 2 syndrome
Autosomal recessive
10LIPALysosomal acid lipase deficiency
Autosomal recessive
3LIPHHypotrichosis, type 7 or woolly hair, autosomal recessive, type 2, with or without
hypotrichosis
Autosomal recessive
6LMBRD1Methylmalonic aciduria and homocystinuria, cblF type
Autosomal recessive
18LOXHD1Deafness, autosomal recessive, type 77
Autosomal recessive
8LPLLipoprotein lipase deficiency
Autosomal recessive
2LRP2Donnai-Barrow syndrome
Autosomal recessive
2LRPPRCLeigh syndrome, French-Canadian type
Autosomal recessive
1LYSTChediak-Higashi syndrome
Autosomal recessive
19MAN2B1Alpha-mannosidosis
Autosomal recessive
4MANBAMannosidosis, beta
Autosomal recessive
10MAT1AMethionine adenosyltransferase deficiency, autosomal recessive
Autosomal recessive
3MCCC13-Methylcrotonyl-CoA carboxylase deficiency, type 1
Autosomal recessive
5MCCC23-Methylcrotonyl-CoA carboxylase deficiency, type 2
Autosomal recessive
2MCEEMethylmalonyl-CoA epimerase deficiency
Autosomal recessive
19MCOLN1Mucolipidosis type 4
Autosomal recessive
8MCPH1Microcephaly type 1, primary, autosomal recessive
Autosomal recessive
11MED17Microcephaly, postnatal progressive, with seizures and brain atrophy
Autosomal recessive
16MEFVFamilial Mediterranean fever
Autosomal recessive
15MESP2Spondylocostal dysostosis, type 2, autosomal recessive
Autosomal recessive
4MFSD8Ceroid lipofuscinosis, neuronal, type 7
Autosomal recessive
17MKS1Bardet-Biedl syndrome type 13
Meckel syndrome, type 1
Joubert syndrome, type 28
Autosomal recessive
22MLC1Megalencephalic leukoencephalopathy with subcortical cysts
Autosomal recessive
16MLYCDMalonyl-CoA decarboxylase deficiency
Autosomal recessive
4MMAAMethylmalonic aciduria, vitamin B12-responsive
Autosomal recessive
12MMABMethylmalonic aciduria, vitamin B12-responsive, type cblB
Autosomal recessive
1MMACHCMethylmalonic aciduria and homocystinuria, cblC type
Autosomal recessive; digenic inheritance (PRDX1 gene)
2MMADHCHomocystinuria, cblD type, variant 1
Autosomal recessive
6MMUTMethylmalonic aciduria, mut(0) type
Autosomal recessive
2MOGSCongenital disorder of glycosylation, type 2B
Autosomal recessive
15MPICongenital disorder of glycosylation, type 1B
Autosomal recessive
1MPLThrombocytopenia, congenital amegakaryocytic
Autosomal recessive
2MPV17Mitochondrial DNA depletion syndrome type 6 (hepatocerebral)
Charcot-Marie-Tooth disease, axonal, type 2EE
Autosomal recessive
1MTHFRHomocystinuria due to MTHFR deficiency
Autosomal recessive
11MTMR2Charcot-Marie-Tooth disease, type 4B1
Autosomal recessive
1MTRHomocystinuria-megaloblastic anemia, cblG complementation type
Autosomal recessive
5MTRRHomocystinuria-megaloblastic anemia, cbl E type
Autosomal recessive
4MTTPAbetalipoproteinemia
Autosomal recessive
12MVKMevalonic aciduria
Autosomal recessive
17MYO15ADeafness, autosomal recessive, type 3
Autosomal recessive
11MYO7AUsher syndrome, type 1B
Deafness, autosomal recessive, type 2
Autosomal recessive
22NAGASchindler disease, type I
Autosomal recessive
17NAGLUMucopolysaccharidosis, type 3B (Sanfilippo B)
Autosomal recessive
17NAGSN-acetylglutamate synthase deficiency
Autosomal recessive
8NBNNijmegen breakage syndrome
Autosomal recessive
1NCF2Chronic granulomatous disease, type 2
Autosomal recessive
8NDRG1Charcot-Marie-Tooth disease, type 4D
Autosomal recessive
20NDUFAF5Mitochondrial complex I deficiency, nuclear type 16
Autosomal recessive
5NDUFS4Mitochondrial complex I deficiency, nuclear type 1
Autosomal recessive
5NDUFS6Mitochondrial complex I deficiency, nuclear type 9
Autosomal recessive
19NDUFS7Mitochondrial complex I deficiency, nuclear type 3
Autosomal recessive
11NDUFV1Mitochondrial complex I deficiency, nuclear type 4
Autosomal recessive
2NEBNemaline myopathy type 2
Autosomal recessive
6NEU1Sialidosis, type 1 and type 2
Autosomal recessive
19NLRP7Hydatidiform mole, recurrent, type 1
Autosomal recessive
15NOP10Dyskeratosis congenita, autosomal recessive type 1
Autosomal recessive
18NPC1Niemann-Pick disease, type C1
Autosomal recessive
14NPC2Niemann-pick disease, type C2
Autosomal recessive
2NPHP1Joubert syndrome type 4
Autosomal recessive
19NPHS1Nephrotic syndrome, type 1
Autosomal recessive
1NPHS2Nephrotic syndrome, type 2
Autosomal recessive
15NR2E3Enhanced S-cone syndrome (Goldmann-Favre)
Retinitis pigmentosa, type 37
Autosomal recessive; Autosomal recessive*
1NTRK1Insensitivity to pain, congenital, with anhidrosis
Autosomal recessive
10OATGyrate atrophy of choroid and retina
Autosomal recessive
15OCA2Oculocutaneous albinism type 2
Autosomal recessive
19OPA33-methylglutaconic aciduria, type 3
Autosomal recessive
6OSTM1Osteopetrosis, autosomal recessive type 5
Autosomal recessive
2OTOFDeafness, autosomal recessive, type 9
Autosomal recessive
1P3H1Osteogenesis imperfecta, type 8
Autosomal recessive
12PAHPhenylketonuria
Autosomal recessive
20PANK2Neurodegeneration with brain iron accumulation type 1
Autosomal recessive
11PCPyruvate carboxylase deficiency
Autosomal recessive
10PCBD1Hyperphenylalaninemia, BH4-deficient, type D
Autosomal recessive
13PCCAPropionic acidemia
Autosomal recessive
3PCCBPropionic acidemia
Autosomal recessive
10PCDH15Deafness, autosomal recessive, type 23
Usher syndrome, type 1D/F digenic
Autosomal recessive
5PDE6ARetinitis pigmentosa type 43
Autosomal recessive
3PDHBPyruvate dehydrogenase E1-beta deficiency
Autosomal recessive
7PEX1Heimler syndrome 1
Peroxisome biogenesis disorder 1A (Zellweger)
Peroxisome biogenesis disorder 1B (NALD/IRD)
Autosomal recessive
1PEX10Peroxisome biogenesis disorder, type 6A (Zellweger syndrome)
Peroxisome biogenesis disorder, type 6B
Autosomal recessive
17PEX12Peroxisome biogenesis disorder type 3A (Zellweger)
Autosomal recessive
8PEX2Peroxisome biogenesis disorder type 5A (Zellweger)
Autosomal recessive
22PEX26Peroxisome biogenesis disorder type 7A (Zellweger)
Autosomal recessive
12PEX5Peroxisome biogenesis disorder type 2A (Zellweger)
Autosomal recessive
6PEX6Peroxisome biogenesis disorder, type 4A (Zellweger syndrome)
Peroxisome biogenesis disorder, type 4B
Heimler syndrome 2
Autosomal recessive; Autosomal recessive*; Autosomal recessive
6PEX7Rhizomelic chondrodysplasia punctata, type 1
Autosomal recessive
12PFKMGlycogen storage disease, type 7
Autosomal recessive
1PHGDHNeu-Laxova syndrome, type 1
Phosphoglycerate dehydrogenase deficiency
Autosomal recessive
6PKHD1Polycystic kidney disease type 4
Autosomal recessive
22PLA2G6Infantile neuroaxonal dystrophy 1
Neurodegeneration with brain iron accumulation 2B
Parkinson disease 14, autosomal recessive
Autosomal recessive
1PLOD1Ehlers-Danlos syndrome, kyphoscoliotic type, 1
Autosomal recessive
16PMM2Congenital disorder of glycosylation, type 1A
Autosomal recessive
17PNPOPyridoxamine 5'-phosphate oxidase deficiency
Autosomal recessive
15POLGPOLG-related disorders
Autosomal recessive
6POLR1CLeukodystrophy, hypomyelinating, type 11
Treacher Collins syndrome 3
Autosomal recessive
1POMGNT1Muscular dystrophy-dystroglycanopathy, type 3A (Walker-Warburg syndrome)
Type 3B
Type 3C (limb-girdle muscular dystrophy, type 15 [LGMDR15])
Autosomal recessive
9POMT1Muscular dystrophy-dystroglycanopathy, type 1A (Walker-Warburg syndrome)
Type 1B
Type 1C (limb-girdle muscular dystrophy, type 11 [LGMD R11])
Autosomal recessive
14POMT2Muscular dystrophy-dystroglycanopathy, type 2A (Walker-Warburg syndrome)
Type 2B
Type 2C (limb-girdle muscular dystrophy, type 14 [LGMD R14])
Autosomal recessive
7PORAntley-Bixler syndrome with genital anomalies and disordered steroidogenesis
Autosomal recessive
3POU1F1Pituitary hormone deficiency, combined, type 1
Autosomal recessive*
4PPM1K?Maple syrup urine disease, mild variant
Autosomal recessive
1PPT1Ceroid lipofuscinosis, neuronal, type 1
Autosomal recessive
10PRF1Hemophagocytic lymphohistiocytosis, familial, type 2
Autosomal recessive
5PROP1Pituitary hormone deficiency, combined, type 2
Autosomal recessive
10PSAPCombined SAP deficiency
Autosomal recessive
11PTSHyperphenylalaninemia, BH4-deficient, type A
Autosomal recessive
12PUS1Myopathy, lactic acidosis, and sideroblastic anemia, type 1
Autosomal recessive
11PYGMMcArdle disease
Autosomal recessive
4QDPRHyperphenylalaninemia, BH4-deficient, type C
Autosomal recessive
6RAB23Carpenter syndrome
Autosomal recessive
11RAG1Omenn syndrome
Severe combined immunodeficiency, B cell-negative
Autosomal recessive
11RAG2Omenn syndrome
Severe combined immunodeficiency, B cell-negative
Autosomal recessive
11RAPSNFetal akinesia deformation sequence, type 2
Myasthenic syndrome, congenital, type 11, associated with AChR deficiency
Autosomal recessive
6RARS2Pontocerebellar hypoplasia, type 6
Autosomal recessive
18RAXIsolated microphthalmia, type 3
Autosomal recessive
14RDH12Leber congenital amaurosis, type 13
Autosomal recessive
13RNASEH2BAicardi-Goutieres syndrome, type 2
Autosomal recessive
11RNASEH2CAicardi-Goutieres syndrome, type 3
Autosomal recessive
1RPE65RPE65-related Leber
Autosomal recessive
16RPGRIP1LJoubert syndrome, type 7
Meckel syndrome, type 5
COACH syndrome
Autosomal recessive
20RTEL1Dyskeratosis congenita, autosomal recessive type 5
Autosomal recessive*
13SACSSpastic ataxia, Charlevoix-Saguenay, type
Autosomal recessive
2SAGOguchi disease, type 1
Autosomal recessive
20SAMHD1Aicardi-Goutieres syndrome, type 5
Autosomal recessive
7SBDSShwachman-Diamond syndrome
Autosomal recessive
22SCO2Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, type
1
Autosomal recessive
4SEPSECSPontocerebellar hypoplasia, type 2D
Autosomal recessive
14SERPINA1Alpha-1 antitrypsin deficiency
Autosomal recessive
17SGCALimb-girdle muscular dystrophy, type 3 (LGMD R3)
Autosomal recessive
4SGCBLimb-girdle muscular dystrophy, type 4 (LGMD R4)
Autosomal recessive
5SGCDLimb-girdle muscular dystrophy, type 6 (LGMD R6)
Autosomal recessive
13SGCGLimb-girdle muscular dystrophy, type 5 (LGMD R5)
Autosomal recessive
17SGSHMucopolysaccharidosis, type 3A (Sanfilippo A)
Autosomal recessive
5SH3TC2Charcot-Marie-Tooth disease, type 4C
Autosomal recessive
5SKIC3Trichohepatoenteric syndrome, type 1 (diarrhea, syndromic)
Autosomal recessive
16SLC12A3Gitelman syndrome
Autosomal recessive
15SLC12A6Agenesis of the corpus callosum with peripheral neuropathy
Autosomal recessive
6SLC17A5Salla disease
Autosomal recessive
1SLC19A2Thiamine-responsive megaloblastic anemia syndrome
Autosomal recessive
2SLC19A3Thiamine metabolism dysfunction syndrome, type 2 (biotin- or thiamine-responsive
encephalopathy type)
Autosomal recessive
5SLC22A5Carnitine deficiency, systemic primary
Autosomal recessive
7SLC25A13Citrullinemia, type 2, neonatal-onset
Citrullinemia, type 2, adult-onset
Autosomal recessive
13SLC25A15Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome
Autosomal recessive
3SLC25A20Carnitine-acylcarnitine translocase deficiency
Autosomal recessive
5SLC26A2Achondrogenesis Ib
Atelosteogenesis, type II
De la Chapelle dysplasia
Diastrophic dysplasia
Diastrophic dysplasia, broad bone-platyspondylic variant
Epiphyseal dysplasia, multiple, 4
Autosomal recessive
7SLC26A3Diarrhea 1, secretory chloride, congenital
Autosomal recessive
7SLC26A4Deafness, autosomal recessive, type 4
Pendred syndrome
Autosomal recessive
6SLC35A1Congenital disorder of glycosylation, type 2F
Autosomal recessive
1SLC35A3Arthrogryposis, impaired intellectual development, and seizures
Autosomal recessive
11SLC35C1Congenital disorder of glycosylation, type 2C
Autosomal recessive
1SLC35D1Schneckenbecken dysplasia
Autosomal recessive
11SLC37A4Glycogen storage disease, type 1B
Autosomal recessive
8SLC39A4Acrodermatitis enteropathica
Autosomal recessive
2SLC3A1Cystinuria
Autosomal recessive*
5SLC45A2Albinism, oculocutaneous, type 4
Autosomal recessive
17SLC46A1Folate malabsorption, hereditary
Autosomal recessive
20SLC4A11Corneal endothelial dystrophy, autosomal recessive
Autosomal recessive
19SLC5A5Thyroid dyshormonogenesis, type 1
Autosomal recessive
5SLC6A19Hartnup disorder
Iminoglycinuria (IG)
Autosomal recessive; Digenic inheritance (SLC36A2)
14SLC7A7Lysinuric protein intolerance
Autosomal recessive
19SLC7A9Cystinuria
Autosomal recessive*
2SMARCAL1Schimke immunoosseous dysplasia
Autosomal recessive
5SMN1Spinal muscular atrophy
Autosomal recessive
11SMPD1Niemann-Pick disease, type A
Niemann-Pick disease, type B
Autosomal recessive
15SPG11Amyotrophic lateral sclerosis 5, juvenile
Charcot-Marie-Tooth disease, axonal, type 2X
Spastic paraplegia 11
Autosomal recessive
16SPG7Spastic paraplegia, type 7, autosomal recessive
Autosomal recessive
2SRD5A246,XY disorder of sex development due to 5-alpha-reductase 2 deficiency
(pseudovaginal perineoscrotal hypospadias)
Autosomal recessive
2ST3GAL5Salt and pepper developmental regression syndrome
Autosomal recessive
8STARLipoid adrenal hyperplasia
Autosomal recessive
3SUMF1Multiple sulfatase deficiency
Autosomal recessive
9SURF1Mitochondrial complex IV deficiency, nuclear type 1
Charcot-Marie-Tooth disease, type 4K
Autosomal recessive
16TATTyrosinemia, type 2
Autosomal recessive
11TCIRG1Osteopetrosis, autosomal recessive, type 1
Autosomal recessive
14TECPR2Spastic paraplegia, type 49, autosomal recessive
Autosomal recessive
3TFAtransferrinemia
Autosomal recessive
7TFR2Hemochromatosis, type 3
Autosomal recessive
8TGThyroid dyshormonogenesis, type 3
Autosomal recessive
14TGM1Ichthyosis, congenital, autosomal recessive, type 1
Autosomal recessive
11THSegawa syndrome, recessive
Autosomal recessive
11TMEM216Joubert syndrome, type 2
Meckel syndrome, type 2
Autosomal recessive
8TMEM67Meckel syndrome 3
COACH syndrome 1
Joubert syndrome 6
Nephronophthisis 11
Autosomal recessive
21TMPRSS3Deafness, autosomal recessive, type 8/10
Autosomal recessive
6TNXBEhlers-Danlos syndrome, classic-like
Autosomal recessive
2TPOThyroid dyshormonogenesis, type 2A
Autosomal recessive
11TPP1Ceroid lipofuscinosis, neuronal, type 2
Spinocerebellar ataxia, autosomal recessive, type 7
Autosomal recessive
6TRDNVentricular tachycardia, catecholaminergic polymorphic, type 5, with or without muscle
weakness
Autosomal recessive
3TREX1Aicardi-Goutieres syndrome, type 1
Autosomal recessive
9TRIM32Limb-girdle muscular dystrophy, type 8 (LGMD R8)
Autosomal recessive
17TRIM37Mulibrey nanism
Autosomal recessive
22TRMULiver failure, transient infantile
Autosomal recessive
17TSEN54Pontocerebellar hypoplasia, type 2A
Pontocerebellar hypoplasia, type 4
Autosomal recessive
12TSFMCombined oxidative phosphorylation deficiency, type 3
Autosomal recessive
1TSHBHypothyroidism, congenital, nongoitrous, type 4
Autosomal recessive
14TSHRHypothyroidism, congenital, nongoitrous, type 1
Autosomal recessive
8TTPAAtaxia with isolated vitamin E deficiency
Autosomal recessive
22TYMPMitochondrial DNA depletion syndrome, type 1 (MNGIE type)
Autosomal recessive
11TYROculocutaneous albinism (OCA) type 1A
OCA type 1B
Autosomal recessive
9TYRP1Albinism, oculocutaneous, type 3
Autosomal recessive
15UBE3AAngelman syndrome
Autosomal dominant*
2UGT1A1Crigler-Najjar syndrome, type 1
Crigler-Najjar syndrome, type 2
Autosomal recessive
17UNC13DHemophagocytic lymphohistiocytosis, familial, type 3
Autosomal recessive
11USH1CUsher syndrome, type 1C
Deafness, autosomal recessive, type 18A
Autosomal recessive
17USH1GUsher syndrome, type 1G
Autosomal recessive
1USH2AUsher syndrome, type 2A
Retinitis pigmentosa 39
Autosomal recessive
9VPS13AChoreoacanthocytosis
Autosomal recessive
8VPS13BCohen syndrome
Autosomal recessive
17VPS53Pontocerebellar hypoplasia, type 2E
Autosomal recessive
14VRK1Pontocerebellar hypoplasia, type 1A
Autosomal recessive
14VSX2Microphthalmia with coloboma 3
Isolated microphthalmia 2
Autosomal recessive
9WHRNUsher syndrome, type 2D
Deafness, autosomal recessive, type 31
Autosomal recessive
2WNT10AOdontoonychodermal dysplasia
Autosomal recessive
8WRNWerner syndrome
Autosomal recessive
9XPAXeroderma pigmentosum, group A
Autosomal recessive
3XPCXeroderma pigmentosum, group C
Autosomal recessive
14ZFYVE26Spastic paraplegia, type 15, autosomal recessive
Autosomal recessive
  • CGT Bank v3.3.10
  • CGT Bank v3.3.11
  • Historic Versions
chromOMIM (gene)geneprevious symbolOMIM (phen)disease name (phenotype)inheritance
X300371ABCD1300100AdrenoleukodystrophyX-linked
X300629AP1S2304340Mental retardation, X-linked, syndromic, type 5 (Pettigrew syndrome)X-linked
X313700AR300068Androgen insensitivity syndrome, completeX-linked
X300180ARSLARSE302950Chondrodysplasia punctata, brachytelephalangicX-linked
X300382ARX308350; 300215; 309510Epileptic encephalopathy, early infantile, type 1; ARX-related developmental disordersX-linked
X300011ATP7A309400; 304150Menkes disease; Occipital horn syndromeX-linked
X300504ATRX309580; 301040Mental retardation-hypotonic facies syndrome, X-linked; Alpha-thalassemia/mental retardation syndromeX-linked
X300553BRWD3300659Mental retardation, X-linked, type 93X-linked
X300300BTK300755Agammaglobulinemia X-linked, type 1X-linked
X300386CD40LG308230Hyper-IgM syndrome, type 1 (immunodeficiency, X-linked, with hyper-IgM, type 1)X-linked
7602421CFTR219700Cystic fibrosisAutosomal recessive
X300390CHM303100ChoroideremiaX-linked
X303630COL4A5301050Alport syndrome, X-linkedX-linked
X300304CUL4B300354Mental retardation, X-linked, syndromic, type 15 (Cabezas type)X-linked
X300481CYBB306400Chronic granulomatous disease, X-linkedX-linked
6613815CYP21A2201910Congenital adrenal hyperplasia due to 21-hydroxylase deficiencyAutosomal recessive
X300121DCX300067Lissencephaly, X-linked, type 1X-linked
X300126DKC1305000Dyskeratosis congenita, X-linkedX-linked
X300189DLG3300850Mental retardation, X-linked, type 90X-linked
X300377DMD310200; 300376Duchenne/Becker muscular dystrophyX-linked
X300451EDA305100Ectodermal dysplasia, type 1, hypohidrotic, X-linkedX-linked
X300384EMD310300Emery-Dreifuss muscular dystrophy, type 1, X-linkedX-linked
X300841F8306700Hemophilia AX-linked
X300746F9306900Hemophilia BX-linked
X300546FGD1305400Aarskog-Scott syndrome; Mental retardation, X-linked syndromic, type 16X-linked
X309550FMR1300624Fragile X syndromeX-linked
X300499FTSJ1309549Mental retardation, X-linked 44X-linked
X305900G6PD300908Hemolytic anemia, G6PD deficient (favism)X-linked
X304040GJB1302800Charcot-Marie-Tooth neuropathy, X-linked dominant, type 1X-linked
13121011GJB2220290Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6Autosomal recessive; Digenic inheritance (GJB6 gene)
X300644GLA301500Fabry diseaseX-linked
X300808GPR143300500Ocular albinism, type 1 (Nettleship-Falls type)X-linked
16141800HBA1604131Thalassemia, alpha-Autosomal recessive
16141850HBA2604131Thalassemia, alpha-Autosomal recessive
11141900HBB603903HBB-related hemoglobinopathyAutosomal recessive
X300019HCFC1309541Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type )X-linked
X308000HPRT1300322Lesch-Nyhan syndromeX-linked
X300256HSD17B10300438HSD10 mitochondrial diseaseX-linked
X300823IDS309900Mucopolysaccharidosis, type 2X-linked
X300206IL1RAPL1300143Mental retardation, X-linked, type 21/34X-linked
X308380IL2RG300400Severe combined immunodeficiency, X-linkedX-linked
X314690KDM5C300534Mental retardation, X-linked, syndromic, Claes-Jensen typeX-linked
X308840L1CAM307000; 303350; 304100L1 SyndromeX-linked
X300005MECP2300673; 312750Encephalopathy, neonatal severe; Rett syndromeX-linked
X300415MTM1310400Myotubular myopathy, X-linkedX-linked
X300658NDP310600Norrie diseaseX-linked
X300473NR0B1300200Adrenal hypoplasia, congenitalX-linked
X300535OCRL309000; 300555Lowe Syndrome; Dent disease type 2X-linked
X300127OPHN1300486Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearanceX-linked
X300461OTC311250Ornithine transcarbamylase deficiencyX-linked
X300142PAK3300558Mental retardation, X-linked, type 30X-linked
X300502PDHA1312170Pyruvate dehydrogenase E1-alpha deficiencyX-linked
X311800PGK1300653Phosphoglycerate kinase 1 deficiencyX-linked
X300560PHF8300263Mental retardation syndrome, X-linked, Siderius typeX-linked
X300401PLP1312080Pelizaeus-Merzbacher diseaseX-linked
X300039POU3F4304400Deafness, X-linked, type 2X-linked
X300463PQBP1309500Renpenning syndromeX-linked
X311850PRPS1300661; 304500; 311070; 301835PRPS1-related disodersX-linked
X300757RP2312600Retinitis pigmentosa, type 2, X-linkedX-linked
X312610RPGR300029; 304020Retinitis pigmentosa, type 3, X-linked; Cone-rod dystrophy, X-linked, 1X-linked
X300839RS1312700RetinoschisisX-linked
X300490SH2D1A308240Lymphoproliferative syndrome, X-linked, type 1X-linked
X300095SLC16A2300523Allan-Herndon-Dudley syndromeX-linked
X300036SLC6A8300352Cerebral creatine deficiency syndrome, type 1X-linked
5600354SMN1253300Spinal muscular atrophyAutosomal recessive
X313440SYN1300491Epilepsy, X-linked, with variable learning disabilities and behavior disordersX-linked
X300395THOC2300957Mental retardation, X-linked 12X-linked
X300298UPF3B300676Mental retardation, X-linked, syndromic, type 14X-linked
X300392WAS301000; 313900Wiskott-Aldrich syndrome; Thrombocytopenia, X-linkedX-linked
X300646ZDHHC9300799Intellectual developmental disorder, X-linked syndromic, Raymond typeX-linked
X314990ZNF711300803Mental retardation, X-linked, type 97X-linked
chromOMIM (gene)GenePrevious SymbolOMIM (phen)disease name (phenotype)inheritance
X300371ABCD1300100AdrenoleukodystrophyX-linked
1607008ACADM201450Medium-chain acyl-CoA dehydrogenase deficiencyAutosomal recessive
2604285AGXT259900Hyperoxaluria, primary, type 1Autosomal recessive
X300629AP1S2304340Mental retardation, X-linked, syndromic, type 5 (Pettigrew syndrome)X-linked
X313700AR300068Androgen insensitivity syndrome, completeX-linked
22607574ARSA250100Metachromatic leukodystrophyAutosomal recessive
X300180ARSLARSE302950Chondrodysplasia punctata, brachytelephalangicX-linked
X300382ARX308350; 300215; 309510Epileptic encephalopathy, early infantile, type 1; ARX-related developmental disordersX-linked
X300011ATP7A309400; 304150Menkes disease; Occipital horn syndromeX-linked
X300504ATRX309580; 301040Mental retardation-hypotonic facies syndrome, X-linked; Alpha-thalassemia/mental retardation syndromeX-linked
X300553BRWD3300659Mental retardation, X-linked, type 93X-linked
3609019BTD253260Biotinidase deficiencyAutosomal recessive
X300300BTK300755Agammaglobulinemia X-linked, type 1X-linked
21613381CBS236200Homocystinuria due to cystathionine beta-synthaseAutosomal recessive
X300386CD40LG308230Hyper-IgM syndrome, type 1 (immunodeficiency, X-linked, with hyper-IgM, type 1)X-linked
7602421CFTR219700Cystic fibrosisAutosomal recessive
X300390CHM303100ChoroideremiaX-linked
X303630COL4A5301050Alport syndrome, X-linkedX-linked
X300304CUL4B300354Mental retardation, X-linked, syndromic, type 15 (Cabezas type)X-linked
X300481CYBB306400Chronic granulomatous disease, X-linkedX-linked
X300121DCX300067Lissencephaly, X-linked, type 1X-linked
11602858DHCR7270400Smith-Lemli-Opitz syndromeAutosomal recessive
X300126DKC1305000Dyskeratosis congenita, X-linkedX-linked
X300189DLG3300850Mental retardation, X-linked, type 90X-linked
X300377DMD310200; 300376Duchenne/Becker muscular dystrophyX-linked
X300451EDA305100Ectodermal dysplasia, type 1, hypohidrotic, X-linkedX-linked
X300384EMD310300Emery-Dreifuss muscular dystrophy, type 1, X-linkedX-linked
X300841F8306700Hemophilia AX-linked
X300746F9306900Hemophilia BX-linked
X300546FGD1305400Aarskog-Scott syndrome; Mental retardation, X-linked syndromic, type 16X-linked
X309550FMR1300624Fragile X syndromeX-linked
X300499FTSJ1309549Mental retardation, X-linked 44X-linked
X305900G6PD300908Hemolytic anemia, G6PD deficient (favism)X-linked
17606800GAA232300Glycogen storage disease, type 2Autosomal recessive
9606999GALT230400GalactosemiaAutosomal recessive
X304040GJB1302800Charcot-Marie-Tooth neuropathy, X-linked dominant, type 1X-linked
13121011GJB2220290Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6Autosomal recessive; Digenic inheritance (GJB6 gene)
X300644GLA301500Fabry diseaseX-linked
X300808GPR143300500Ocular albinism, type 1 (Nettleship-Falls type)X-linked
2600890HADHA609016; 609015Long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD) deficiency; Mitochondrial trifunctional protein deficiencyAutosomal recessive
16141800HBA1604131Thalassemia, alpha-Autosomal recessive
16141850HBA2604131Thalassemia, alpha-Autosomal recessive
11141900HBB603903HBB-related hemoglobinopathyAutosomal recessive
X300019HCFC1309541Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type )X-linked
X308000HPRT1300322Lesch-Nyhan syndromeX-linked
X300256HSD17B10300438HSD10 mitochondrial diseaseX-linked
X300823IDS309900Mucopolysaccharidosis, type 2X-linked
X300206IL1RAPL1300143Mental retardation, X-linked, type 21/34X-linked
X308380IL2RG300400Severe combined immunodeficiency, X-linkedX-linked
X314690KDM5C300534Mental retardation, X-linked, syndromic, Claes-Jensen typeX-linked
X308840L1CAM307000; 303350; 304100L1 SyndromeX-linked
X300005MECP2300673; 312750Encephalopathy, neonatal severe; Rett syndromeX-linked
1609831MMACHC277400Methylmalonic aciduria and homocystinuria, cblC typeAutosomal recessive, digenic inheritance (PRDX1 gene)
X300415MTM1310400Myotubular myopathy, X-linkedX-linked
X300658NDP310600Norrie diseaseX-linked
X300473NR0B1300200Adrenal hypoplasia, congenitalX-linked
X300535OCRL309000; 300555Lowe Syndrome; Dent disease type 2X-linked
X300127OPHN1300486Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearanceX-linked
X300461OTC311250Ornithine transcarbamylase deficiencyX-linked
12612349PAH261600PhenylketonuriaAutosomal recessive
X300142PAK3300558Mental retardation, X-linked, type 30X-linked
X300502PDHA1312170Pyruvate dehydrogenase E1-alpha deficiencyX-linked
X311800PGK1300653Phosphoglycerate kinase 1 deficiencyX-linked
X300560PHF8300263Mental retardation syndrome, X-linked, Siderius typeX-linked
X300401PLP1312080Pelizaeus-Merzbacher diseaseX-linked
16601785PMM2212065Congenital disorder of glycosylation, type 1AAutosomal recessive
X300039POU3F4304400Deafness, X-linked, type 2X-linked
X300463PQBP1309500Renpenning syndromeX-linked
X311850PRPS1300661; 304500; 311070; 301835PRPS1-related disodersX-linked
X300757RP2312600Retinitis pigmentosa, type 2, X-linkedX-linked
X312610RPGR300029; 304020Retinitis pigmentosa, type 3, X-linked; Cone-rod dystrophy, X-linked, 1X-linked
X300839RS1312700RetinoschisisX-linked
X300490SH2D1A308240Lymphoproliferative syndrome, X-linked, type 1X-linked
X300095SLC16A2300523Allan-Herndon-Dudley syndromeX-linked
5606718SLC26A2600972Achondrogenesis, type 1B (diastrophic dysplasia)Autosomal recessive
X300036SLC6A8300352Cerebral creatine deficiency syndrome, type 1X-linked
5600354SMN1253300Spinal muscular atrophyAutosomal recessive
X313440SYN1300491Epilepsy, X-linked, with variable learning disabilities and behavior disordersX-linked
X300395THOC2300957Mental retardation, X-linked 12X-linked
X300298UPF3B300676Mental retardation, X-linked, syndromic, type 14X-linked
X300392WAS301000; 313900Wiskott-Aldrich syndrome; Thrombocytopenia, X-linkedX-linked
X300646ZDHHC9300799Intellectual developmental disorder, X-linked syndromic, Raymond typeX-linked
X314990ZNF711300803Mental retardation, X-linked, type 97X-linked
Download CGT Bank v1.1 Export Download CGT Bank v2.0 Export Download CGT Bank v2.1 Export Download CGT Bank v2.2 Export Download CGT Bank v2.3 Export Download CGT Bank v3.0.2 Export Download CGT Bank v3.1.1 Export Download CGT Bank v3.1.2 Export Download CGT Bank v3.1.3 Export Download CGT Bank v3.1.5 Export Download CGT Bank v3.2.3 Export Download CGT Bank v3.2.2 Export Download CGT Bank v3.2.1 Export Download CGT Bankv3.3.1.0 Export Download CGT Bankv3.3.1.1 Export
  • CGT 600 v1
  • CGT 600 v2
GeneDiseaseTranscriptMutationsDisease.descriptionproducts
ABCA4Cone-rod dystrophy type 3NM_000350.2NM_000350.2:c.3540_3555delGTCTAAGGGTTTCTCC, NM_000350.2:c.2616_2617delCT, NM_000350.2:c.4793C>A, NM_000350.2:c.6179T>G, NM_000350.2:c.1222C>T, NM_000350.2:c.763C>TCone rod dystrophy type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness. The prevalence is 1:100,000-9100,000.250,600
ABCA4Retinitis pigmentosa type 19NM_000350.2NM_000350.2:c.1848delARetinitis pigmentosa type 19 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.250,600
ABCA4Stargardt disease type 1NM_000350.2NM_000350.2:c.1018T>G, NM_000350.2:c.4457C>T, NM_000350.2:c.1225delA, NM_000350.2:c.1622T>C, NM_000350.2:c.1715G>A, NM_000350.2:c.1755delA, NM_000350.2:c.1771delT, NM_000350.2:c.1804C>T, NM_000350.2:c.6449G>A, NM_000350.2:c.1938-1G>A, NM_000350.2:c.1964T>G, NM_000350.2:c.2160+1G>T, NM_000350.2:c.2588G>C, NM_000350.2:c.4469G>A, NM_000350.2:c.2690C>T, NM_000350.2:c.2791G>A, NM_000350.2:c.286A>G, NM_000350.2:c.2971G>C, NM_000350.2:c.3083C>T, NM_000350.2:c.3106G>A, NM_000350.2:c.3210_3211dupGT, NM_000350.2:c.3364G>A, NM_000350.2:c.6320G>A, NM_000350.2:c.3970delG, NM_000350.2:c.4139C>T, NM_000350.2:c.4429C>T, NM_000350.2:c.2300T>A, NM_000350.2:c.3322C>T, NM_000350.2:c.52C>T, NM_000350.2:c.5512delC, NM_000350.2:c.5819T>C, NM_000350.2:c.5881G>A, NM_000350.2:c.5882G>A, NM_000350.2:c.5912T>G, NM_000350.2:c.634C>T, NM_000350.2:c.5714+5G>A, NM_000350.2:c.6394G>T, NM_000350.2:c.67-2A>G, NM_000350.2:c.5461-10T>C, NM_000350.2:c.6089G>A, NM_000350.2:c.6118C>T, NM_000350.2:c.6148G>C, NM_000350.2:c.661G>A, NM_000350.2:c.5338C>GStargardt disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by progressive central vision loss, mild loss of color vision, delayed dark adaptation and macular atrophy with or without paramacular flecks and degeneration of the underlying retinal pigment ephitelium. The prevalence is 1:10,000- 5:10,000.250,600
ABCB7Sideroblastic anemia and ataxia, X-linkedNM_004299.4NM_004299.4:c.1203T>G, NM_004299.4:c.1234G>C, NM_004299.4:c.1300G>AX-linked sideroblastic anemia with ataxia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ABCB7 gene located on chromosomal region Xq13.3. The age of onset is neonatal/infantile. This disease is characterized by core neurological features including motor delay, ataxia evident from early childhood, and dysarthria and patients usually have a mild asymptomatic anaemia or a borderline decreased mean corpuscular volume. The prevalence is <1:1,000,000.600
ACAD9Acyl-CoA dehydrogenase type 9 deficiencyNM_014049.4NM_014049.4:c.1240C>T, NM_014049.4:c.1249C>T, NM_014049.4:c.130T>A, NM_014049.4:c.1594C>T, NM_014049.4:c.23delT, NM_014049.4:c.358delT, NM_014049.4:c.797G>A, NM_014049.4:c.976G>C, NM_014049.4:c.453+1G>AAcyl-CoA dehydrogenase type 9 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAD9 gene located on chromosomal region 3q21.3. The age of onset is neonatal/infantile. This disease is characterized by failure to thrive, hypertrophic cardiomyopathy, exercise intolerance and mild to severe neurological dysfunction.250,600
ACADMAcyl-CoA dehydrogenase deficiency, medium-chainNM_000016.5NM_000016.5:c.1102_1105delTTAG, NM_000016.5:c.1232_1233delAA, NM_000016.5:c.287-2A>G, NM_000016.5:c.362C>T, NM_000016.5:c.447G>A, NM_000016.5:c.447G>T, NM_000016.5:c.449_452delCTGA, NM_000016.5:c.616C>T, NM_000016.5:c.617G>A, NM_000016.5:c.683C>A, NM_000016.5:c.797A>G, NM_000016.5:c.799G>A, NM_000016.5:c.815_827delTTGCAATGGGAGC, NM_000016.5:c.890A>G, NM_000016.5:c.984delG, NM_000016.5:c.985A>G, NM_000016.5:c.127G>A, NM_000016.5:c.734C>T, NM_000016.5:c.250C>TMedium chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADM gene located on chromosomal region 1p31. The age of onset is neonatal/infantile. This disease is characterized by a rapidly progressive metabolic crisis, often presenting as hypoketotic hypoglycemia, lethargy, vomiting, seizures and coma. The prevalence is 1:4,900-1:27,000 in Caucasian populations and 1:14,600 in worldwide populations.250,600
ACADSAcyl-CoA dehydrogenase deficiency, short-chainNM_000017.2NM_000017.2:c.1095G>T, NM_000017.2:c.1108A>G, NM_000017.2:c.1147C>T, NM_000017.2:c.136C>T, NM_000017.2:c.319C>T, NM_000017.2:c.417G>C, NM_000017.2:c.529T>C, NM_000017.2:c.561_568delCAATGCCT, NM_000017.2:c.826G>A, NM_000017.2:c.314T>AShort chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADS gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by seizures, developmental delay, failure to grow with poor feeding, and usually muscle weakness and hypotonia. The prevalence is <1:50,000.250,600
ACADSB2-Methylbutyryl-CoA dehydrogenase deficiencyNM_001609.3NM_001609.3:c.1159G>A, NM_001609.3:c.443C>T, NM_001609.3:c.763C>T, NM_001609.3:c.621G>A, NM_001609.3:c.303+1G>A2-Methylbutyryl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADSB gene located on chromosomal region 10q26.3. The age of onset is neonatal/infantile. This disease is characterized by muscle hypotonia, cerebral palsy, developmental delay, lethargy, hypoglycemia, and metabolic acidosis. The prevalence is <1:1,000,000.250,600
ACADVLVery long chain acyl-CoA dehydrogenase deficiencyNM_000018.3NM_000018.3:c.1096C>T, NM_000018.3:c.1097G>A, NM_000018.3:c.1106T>C, NM_000018.3:c.1141_1143delGAG, NM_000018.3:c.1182+1G>A, NM_000018.3:c.1357C>T, NM_000018.3:c.1360G>A, NM_000018.3:c.1375dupC, NM_000018.3:c.1389dupG, NM_000018.3:c.1406G>A, NM_000018.3:c.1468G>C, NM_000018.3:c.1532+1G>A, NM_000018.3:c.1837C>T, NM_000018.3:c.1843C>T, NM_000018.3:c.1882delC, NM_000018.3:c.278-1G>A, NM_000018.3:c.298_299delCA, NM_000018.3:c.343delG, NM_000018.3:c.400C>T, NM_000018.3:c.477+1G>C, NM_000018.3:c.520G>A, NM_000018.3:c.685C>T, NM_000018.3:c.739A>C, NM_000018.3:c.753-2A>C, NM_000018.3:c.896_898delAGA, NM_000018.3:c.917T>C, NM_000018.3:c.1844G>A, NM_000018.3:c.848T>CVery long chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADVL gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by cardiomyopathy, hypoketotic hypoglycemia, liver disease, exercise intolerance and rhabdomyolysis. The prevalence is 1:100,000-9:100,000.250,600
ACAT1Beta-ketothiolase deficiencyNM_000019.3NM_000019.3:c.1035_1037delAGA, NM_000019.3:c.1083dupA, NM_000019.3:c.1136G>T, NM_000019.3:c.1138G>A, NM_000019.3:c.2T>A, NM_000019.3:c.410_417delCTCAAAGT, NM_000019.3:c.547G>A, NM_000019.3:c.622C>T, NM_000019.3:c.905delABeta-ketothiolase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAT1 gene located on chromosomal region 11q22.3. The age of onset is neonatal/infantile. This disease is characterized by normal early development followed by a progressive loss of mental and motor skills. The prevalence is < 1:1,000,000.600
ACERenal tubular dysgenesisNM_000789.3NM_000789.3:c.1319_1322delTGGA, NM_000789.3:c.1510delC, NM_000789.3:c.3381-4C>T, NM_000789.3:c.798C>G, NM_000789.3:c.1486C>T, NM_000789.3:c.2371C>T, NM_000789.3:c.1587-2A>GRenal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.250,600
ACOX1Peroxisomal acyl-CoA oxidase deficiencyNM_004035.6NM_004035.6:c.832A>G, NM_004035.6:c.532G>T, NM_004035.6:c.591delGPeroxisomal acyl-CoA oxidase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACOX1 gene located on chromosomal region 17q25.1. The age of onset is neonatal/infantile. This disease is characterized by hypotonia and seizures in the neonatal period and neurological regression in early infancy. The prevalence is < 1:1,000,000.600
ACTN4Glomerulosclerosis, focal segmental, type 1NM_004924.4NM_004924.4:c.763A>G, NM_004924.4:c.2619_2620insC, NM_004924.4:c.776C>T, NM_004924.4:c.784T>CFocal segmental glomerulosclerosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACTN4 gene located on chromosomal region 19q13.2. The age of onset is variable. This disease is characterized by severe proteinuria with low serum albumin and possible edemas.600
ADAAdenosine deaminase deficiencyNM_000022.2NM_000022.2:c.226C>T, NM_000022.2:c.632G>A, NM_000022.2:c.890C>A, NM_000022.2:c.247G>A, NM_000022.2:c.320T>C, NM_000022.2:c.872C>T, NM_000022.2:c.956_960delAAGAG, NM_000022.2:c.986C>TAdenosine deaminase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADA gene located on chromosomal region 20q13.12. The age of onset is neonatal/infantile. This disease is characterized by profound lymphopenia and very low immunoglobulin levels of all isotypes resulting in severe and recurrent opportunistic infections. The annual incidence is 1:200,000-1:1,000,000. The prevalence is 1:100,000-9:100,000.250,600
ADAMTS2Ehlers-Danlos syndrome type 7CNM_014244.4NM_014244.4:c.2384G>AEhlers-Danlos syndrome type 7C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADAMTS2 gene located on chromosomal region 5q35.3. The age of onset is neonatal/infantile. This disease is characterized by extremely fragile tissues, hyperextensible skin and easy bruising. The prevalence is <1:1,000,000.600
ADAMTSL2Geleophysic dysplasia type 1NM_014694.3NM_014694.3:c.338G>A, NM_014694.3:c.440C>T, NM_014694.3:c.661C>T, NM_014694.3:c.340G>AGeleophysic dysplasia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADAMTSL2 gene located on chromosomal region 9q34.2. The age of onset is infantile. This disease is characterized by extremely by short stature, prominent abnormalities in hands and feet, and a characteristic facial appearance. The prevalence is <1:1,000,000.600
ADCK3Primary coenzyme Q10 deficiency type 4NM_020247.4NM_020247.4:c.911C>T, NM_020247.4:c.815G>T, NM_020247.4:c.993C>T, NM_020247.4:c.1541A>G, NM_020247.4:c.1645G>A, NM_020247.4:c.1651G>A, NM_020247.4:c.1750_1752delACC, NM_020247.4:c.1813_1814insG, NM_020247.4:c.589-3C>G, NM_020247.4:c.637C>T, NM_020247.4:c.815G>APrimary coenzyme Q10 deficiency type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADCK3 gene located on chromosomal region 1q42.13. The age of onset is infantile. This disease is characterized by progressive ataxia, cerebellar atrophy, and often exercise intolerance with elevated lactate levels and mild intellectual deficit.250,600
AGAAspartylglucosaminuriaNM_000027.3NM_000027.3:c.488G>C, NM_000027.3:c.755G>A, NM_000027.3:c.214T>C, NM_000027.3:c.302C>T, NM_000027.3:c.800dupT, NM_000027.3:c.904G>AAspartylglucosaminuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGA gene located on chromosomal region 4q34.3. The age of onset is infantile. This disease is characterized by slowly developping mental retardation, beginning with clumsiness, late speech, and hyperkinesia, mild facial dysmorphism, and slight kyphoscoliosis.600
AGLGlycogen storage disease type 3NM_000642.2NM_000642.2:c.1783C>T, NM_000642.2:c.18_19delGA, NM_000642.2:c.112A>G, NM_000642.2:c.1222C>T, NM_000642.2:c.1481G>A, NM_000642.2:c.1485delT, NM_000642.2:c.16C>T, NM_000642.2:c.4260-1G>T, NM_000642.2:c.3214_3215delGA, NM_000642.2:c.1999delC, NM_000642.2:c.2039G>A, NM_000642.2:c.2590C>T, NM_000642.2:c.4456delT, NM_000642.2:c.3216_3217delGA, NM_000642.2:c.3980G>A, NM_000642.2:c.4342G>C, NM_000642.2:c.4529dupA, NM_000642.2:c.294-2A>T, NM_000642.2:c.4260-12A>GGlycogen storage disease type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGL gene located on chromosomal region 1p21.2. The age of onset is infantile. This disease is characterized by hepatomegaly, growth retardation and occasional seizures related to hypoglycemia and frequently muscular hypotonia and hypertrophic cardiomyopathy.250,600
AGPSRhizomelic chondrodysplasia punctata type 3NM_003659.3NM_003659.3:c.1256G>A, NM_003659.3:c.926C>T, NM_003659.3:c.1406T>C, NM_003659.3:c.1703C>TRhizomelic chondrodysplasia punctata type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGPS gene located on chromosomal region 2q31.2. The age of onset is neonatal/infantile. This disease is characterized by shortness of the femur and humerus, vertebral disorders, cataract, cutaneous lesions and severe intellectual deficit. The prevalence is 1:100,000-9:100,000.600
AGTRenal tubular dysgenesisNM_000029.3NM_000029.3:c.1124G>A, NM_000029.3:c.604C>T, NM_000029.3:c.1290_1291insT, NM_000029.3:c.1290delTRenal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.600
AGTR1Renal tubular dysgenesisNM_031850.3NM_031850.3:c.481delC, NM_031850.3:c.259dupG, NM_031850.3:c.215dupT, NM_031850.3:c.481C>TRenal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.600
AGXTPrimary hyperoxaluria type 1NM_000030.2NM_000030.2:c.166-2A>G, NM_000030.2:c.121G>A, NM_000030.2:c.32C>A, NM_000030.2:c.245G>A, NM_000030.2:c.25_26insC, NM_000030.2:c.322T>C, NM_000030.2:c.508G>A, NM_000030.2:c.560C>T, NM_000030.2:c.590G>A, NM_000030.2:c.613T>C, NM_000030.2:c.697C>T, NM_000030.2:c.698G>A, NM_000030.2:c.731T>C, NM_000030.2:c.738G>A, NM_000030.2:c.836T>C, NM_000030.2:c.860G>A, NM_000030.2:c.33_34insC, NM_000030.2:c.454T>A, NM_000030.2:c.466G>A, NM_000030.2:c.248A>GPrimary hyperoxaluria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGXT gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by variable clinical presentation, ranging from occasional symptomatic nephrolithiasis to nephrocalcinosis and end-stage renal disease with systemic involvement. The prevalence is 1:1,000,000-9:1,000,000.250,600
AHI1Joubert syndrome type 3NM_017651.4NM_017651.4:c.1303C>T, NM_017651.4:c.1484G>A, NM_017651.4:c.2295_2296insA, NM_017651.4:c.2295dupA, NM_017651.4:c.3257A>G, NM_017651.4:c.2168G>A, NM_017651.4:c.985C>T, NM_017651.4:c.989A>G, NM_017651.4:c.3263_3264delGG, NM_017651.4:c.1051C>T, NM_017651.4:c.1052G>TEl síndrome de Joubert tipo 3 sigue un patrón de herencia autosómico recesivo y está causado por variantes patogénicas en el gen AHI1 localizado en la región cromosómica 6q23.3. La edad de aparición es neonatal/infantil con síntomas como los rasgos neurológicos del síndrome de Joubert (hipotonía neonatal, retraso del desarrollo, discapacidad intelectural de leve a grave, ataxia, movimiento ocular anormal incluyendo apraxia oculomotora y nistagmo en posición primaria) asociados a una distrofia retiniana.250,600
AIPL1Cone-rod dystrophyNM_014336.4NM_014336.4:c.1053_1064delTGCAGAGCCACCLa distrofia de conos y bastones causada por variantes patogénicas en el gen AIPL1 localizado en la región cromosómica 17p13.2 sigue un patrón de herencia autosómico recesivo. La edad de aparición es temprana. Se caracteriza por una agudeza visual disminuida, defectos en la visión de los colores, fotoaversión y disminución de la sensibilidad en el centro del campo visual, seguido por una pérdida de la visión periférica y ceguera nocturna.250,600
AIPL1Leber congenital amaurosis type 4NM_014336.4NM_014336.4:c.905G>T, NM_014336.4:c.834G>A, NM_014336.4:c.589G>C, NM_014336.4:c.715T>CLeber congenital amaurosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AIPL1gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. The prevalence is 1:100,000-9:100,000.250,600
ALAS2Erythropoietic protoporphyriaNM_000032.4NM_000032.4:c.1699_1700delAT, NM_000032.4:c.1706_1709delAGTGErythropoietic protoporphyria caused by pathogenic variants in the ALAS2 gene located on chromosomal region Xp11.21 follows a dominant X-linked pattern of inheritance. The age of onset is neonatal/infancy. This disease is characterized by cutaneous manifestations of acute painful photosensitivity with erythema and edema, sometimes with petechiae, together with stinging and burning sensations without blistering, upon exposure to sunlight or artificial light (400-700 nm). These episodes have a variable severity depending on the exposure duration and may result in chronic permanent lesions on exposed skin. There is a risk of .cholelithiasis with obstructive episodes, and chronic liver disease that might evolve to acute liver failure. The global prevalence is ranging between 1/75,000 and 1/200,000.600
ALAS2Sideroblastic anemia, X-linkedNM_000032.4NM_000032.4:c.1354C>TX-linked sideroblastic anemia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ALAS2 gene located on chromosomal region Xp11.21. The age of onset is variable. This disease is characterized by clinical features of anemia and/or iron overload such as pallor, fatigue, weakness, and more rarely breathlessness, mild splenomegaly, cardiac problems, abnormal liver function, hyperglycemia, glucose intolerance and skin hyperpigmentation.600
ALDH4A1Hyperprolinemia type 2NM_003748.3NM_003748.3:c.1055C>THyperprolinemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDH4A1 gene located on chromosomal region 1p36. The age of onset is variable. This disease is characterized by seizures, intellectual deficit and mild developmental delay.600
ALDH5A1Succinic semialdehyde dehydrogenase deficiencyNM_001080.3NM_001080.3:c.1234C>T, NM_001080.3:c.1226G>A, NM_001080.3:c.901A>G, NM_001080.3:c.1540C>T, NM_001080.3:c.1579C>T, NM_001080.3:c.612G>A, NM_001080.3:c.803G>A, NM_001080.3:c.862A>GSuccinic semialdehyde dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDH451 gene located on chromosomal region 6p22. The age of onset is infantile. This disease is characterized by psychomotor retardation, delayed speech development, hypotonia and ataxia. It is a rare disease with around 350 cases reported.600
ALDOAGlycogen storage disease type 12NM_000034.3NM_000034.3:c.619G>A, NM_000034.3:c.386A>GGlycogen storage disease type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOA gene located on chromosomal region 16p11.2. The age of onset is neonatal/infantile. This disease is characterized by myopathy with exercise intolerance and rhabdomyolysis associated with hemolytic anaemia. 600
ALDOBHereditary fructose intoleranceNM_000035.3NM_000035.3:c.1005C>G, NM_000035.3:c.178C>T, NM_000035.3:c.1027T>C, NM_000035.3:c.10C>T, NM_000035.3:c.136A>T, NM_000035.3:c.448G>C, NM_000035.3:c.2T>C, NM_000035.3:c.360_363delCAAA, NM_000035.3:c.442T>C, NM_000035.3:c.1013C>T, NM_000035.3:c.113-1_115delGGTA, NM_000035.3:c.1067C>A, NM_000035.3:c.612T>A, NM_000035.3:c.720C>A, NM_000035.3:c.524C>AHereditary fructose intolerance follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOB gene located on chromosomal region 9q21.3-q22.2. The age of onset is neonatal/infantile. This disease is characterized by severe abdominal pain, vomiting, and hypoglycemia following ingestion of fructose or other sugars metabolised through fructose-1-phosphate. The prevalence is 1:100,000-9:100,000.250,600
ALG1Congenital disorders of glycosylation type 1kNM_019109.4NM_019109.4:c.1187+1G>A, NM_019109.4:c.1079C>T, NM_019109.4:c.1129A>G, NM_019109.4:c.901+1G>A, NM_019109.4:c.434G>A, NM_019109.4:c.450C>G, NM_019109.4:c.773C>TCongenital disorder of glycosylation type 1k follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG1 gene located on chromosomal region 16p13.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay, seizures, microcephaly and coagulation anomalies. The prevalence is <1:1,000,000.600
ALG6Congenital disorders of glycosylation type IcNM_013339.3NM_013339.3:c.897_899delAAT, NM_013339.3:c.998C>T, NM_013339.3:c.495-3C>G, NM_013339.3:c.53G>A, NM_013339.3:c.316C>T, NM_013339.3:c.482A>G, NM_013339.3:c.1432T>CCongenital disorder of glycosylation type 1c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG6 gene located on chromosomal region 1p31.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay and muscular hypotonia, and possible coagulation anomalies, hormonal abnormalities and seizures. The prevalence is <1:1,000,000.250,600
ALMS1Alström syndromeNM_015120.4NM_015120.4:c.11443C>T, NM_015120.4:c.10775delC, NM_015120.4:c.11316_11319delAGAG, NM_015120.4:c.2323C>T, NM_015120.4:c.11449C>T, NM_015120.4:c.11452_11453insA, NM_015120.4:c.1574_1576delCTCinsT, NM_015120.4:c.8383C>T, NM_015120.4:c.9612_9616delAACAG, NM_015120.4:c.10579_10580delAT, NM_015120.4:c.11610_11611delCT, NM_015120.4:c.12439C>T, NM_015120.4:c.12445C>T, NM_015120.4:c.891_907delTCAGCACCCGCTTATAG, NM_015120.4:c.9911-1G>A, NM_015120.4:c.11618_11619delCT, NM_015120.4:c.4245delC, NM_015120.4:c.5584C>T, NM_015120.4:c.8164C>TAlström syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALMS1 gene located on chromosomal region 2p13.1. The age of onset is neonatal/infantile. This disease is characterized by cone-rod dystrophy, hearing loss, obesity, insulin resistance and hyperinsulinemia, type 2 diabetes mellitus, dilated cardiomyopathy and progressive hepatic and renal dysfunction. The prevalence is 1:10,000-1:1,000,000.250,600
ALPLHypophosphatasiaNM_000478.4NM_000478.4:c.1001G>A, NM_000478.4:c.1366G>A, NM_000478.4:c.211C>T, NM_000478.4:c.212G>C, NM_000478.4:c.323C>T, NM_000478.4:c.346G>A, NM_000478.4:c.407G>A, NM_000478.4:c.526G>A, NM_000478.4:c.535G>A, NM_000478.4:c.571G>A, NM_000478.4:c.620A>C, NM_000478.4:c.1133A>T, NM_000478.4:c.1250A>G, NM_000478.4:c.1306T>C, NM_000478.4:c.98C>T, NM_000478.4:c.1574delG, NM_000478.4:c.892G>A, NM_000478.4:c.814C>T, NM_000478.4:c.881A>CChildhood-onset hypophosphatasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALPL gene located on chromosomal region 1p36.12. The age of onset is infantile. This disease is characterized by clinical features ranging from stillbirth without mineralized bone to pathologic fractures of the lower extremities in later adulthood.600
AMACRAlpha-methylacyl-CoA racemase deficiencyNM_014324.5NM_014324.5:c.857delT, NM_014324.5:c.320T>C, NM_014324.5:c.43delG, NM_014324.5:c.154T>CAlpha-methylacyl-Coa racemase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMACR gene located on chromosomal region 5p13. The age of onset is variable. This disease is characterized by mild cholestatic liver disease, fat malabsorption and/or neurological disease. The prevalence is <1:1,000,000.600
AMTGlycine encephalopathyNM_000481.3NM_000481.3:c.139G>A, NM_000481.3:c.125A>G, NM_000481.3:c.959G>A, NM_000481.3:c.574C>T, NM_000481.3:c.806G>A, NM_000481.3:c.826G>C, NM_000481.3:c.259-1G>CGlycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMT and GLDC genes located on chromosomal regions 3p21.31 and 9p24.1 respectively. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000.600
ANO5Limb-girdle muscular dystrophy type 2L, autosomal recessiveNM_213599.2NM_213599.2:c.155A>G, NM_213599.2:c.1622_1623insA, NM_213599.2:c.1407+5G>A, NM_213599.2:c.1887delA, NM_213599.2:c.1733T>C, NM_213599.2:c.692G>T, NM_213599.2:c.1627_1628insA, NM_213599.2:c.172C>T, NM_213599.2:c.206_207delAT, NM_213599.2:c.1210C>T, NM_213599.2:c.1295C>G, NM_213599.2:c.1914G>A, NM_213599.2:c.184_185insA, NM_213599.2:c.1898+1G>A, NM_213599.2:c.191_192insAAutosomal recessive limb-girdle muscular dystrophy type 2L follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ANO5 gene located on chromosomal region 11p14.3. The age of onset is adult. This disease is characterized by weakness and wasting restricted to the limb musculature, proximal greater than distal, and muscle degeneration/regeneration on muscle biopsy. The prevalence is <1:1,000,000.250,600
APTXAtaxia with oculomotor apraxia type 1NM_175073.2NM_175073.2:c.167delT, NM_175073.2:c.788T>G, NM_175073.2:c.320delC, NM_175073.2:c.617C>T, NM_175073.2:c.659C>T, NM_175073.2:c.134-2A>G, NM_175073.2:c.166C>T, NM_175073.2:c.124C>T, NM_175073.2:c.875-1G>A, NM_175073.2:c.837G>A, NM_175073.2:c.596G>AAtaxia with oculomotor apraxia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the APTX gene located on chromosomal region 9p13.1. The age of onset is infantile. This disease is characterized by a progressive cerebellar ataxia associated with oculomotor apraxia, choeroathetosis and severe peripheral neuropathy. The prevalence is 0,4:100.000 in Portugal.250,600
ARAndrogen insensitivity syndromeNM_000044.3NM_000044.3:c.2650A>T, NM_000044.3:c.340C>T, NM_000044.3:c.1937C>A, NM_000044.3:c.2323C>T, NM_000044.3:c.2391G>A, NM_000044.3:c.2567G>A, NM_000044.3:c.1769-11T>A, NM_000044.3:c.1771A>T, NM_000044.3:c.2395C>GAndrogen insensitivity syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the AR gene located on chromosomal region Xq12. The age of onset is variable. This disease is characterized by the presence of female external genitalia in a 46,XY individual with normal testis development but undescended testes and unresponsiveness to age-appropriate levels of androgens. The prevalence is 2:100,000-5:100,000.250,600
ARG1ArgininemiaNM_000045.3NM_000045.3:c.61C>T, NM_000045.3:c.365G>A, NM_000045.3:c.413G>T, NM_000045.3:c.871C>T, NM_000045.3:c.32T>C, NM_000045.3:c.703G>C, NM_000045.3:c.869C>GArgininemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARG1gene located on chromosomal region 6q23. The age of onset is neonatal/infantile. This disease is characterized by variable degrees of hyperammonemia, developing from about 3 years of age, and leading to progressive loss of developmental milestones and spasticity in the absence of treatment. The prevalence is 1:350,000-1:1,000,000.600
ARL13BJoubert syndrome type 8NM_182896.2NM_182896.2:c.1186C>G, NM_182896.2:c.246G>A, NM_182896.2:c.1252C>T, NM_182896.2:c.598C>TJoubert syndrome type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL13B gene located on chromosomal region 3q11.1. The age of onset is neonatal/infantile. This disease is characterized by congenital malformation of the brainstem and agenesis or hypoplasia of the cerebellar vermis leading to an abnormal respiratory pattern, nystagmus, hypotonia, ataxia and delay in achieving motor milestones. The prevalence is 1/80,000 to 1/100,000.600
ARL6Bardet-Biedl syndrome type 3NM_177976.2NM_177976.2:c.4G>T, NM_177976.2:c.92C>G, NM_177976.2:c.281T>C, NM_177976.2:c.92C>T, NM_177976.2:c.431C>T, NM_177976.2:c.364C>TBardet-Biedl syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL6 gene located on chromosomal region 3q11.2. The age of onset is early. A syndrome characterized by usually severe pigmentary retinopathy, early-onset obesity, polydactyly, hypogenitalism, renal malformation and mental retardation. Secondary features include diabetes mellitus, hypertension and congenital heart disease.600
ARL6Retinitis pigmentosa type 55NM_177976.2NM_177976.2:c.266C>TRetinitis pigmentosa type 55 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL6 gene located on chromosomal region 3q11.2. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.600
ARSAMetachromatic leukodystrophyNM_000487.5NM_000487.5:c.1241delC, NM_000487.5:c.1283C>T, NM_000487.5:c.346C>T, NM_000487.5:c.34delG, NM_000487.5:c.1210+1G>A, NM_000487.5:c.1232C>T, NM_000487.5:c.582delC, NM_000487.5:c.583delT, NM_000487.5:c.542dupT, NM_000487.5:c.542T>G, NM_000487.5:c.1408_1418delGCAGCTGTGAC, NM_000487.5:c.195delC, NM_000487.5:c.641C>T, NM_000487.5:c.1401_1411delGTTAGACGCAG, NM_000487.5:c.869G>A, NM_000487.5:c.869G>T, NM_000487.5:c.883G>A, NM_000487.5:c.899T>C, NM_000487.5:c.931G>A, NM_000487.5:c.937C>T, NM_000487.5:c.938G>A, NM_000487.5:c.979G>A, NM_000487.5:c.737G>A, NM_000487.5:c.739G>A, NM_000487.5:c.763G>A, NM_000487.5:c.827C>T, NM_000487.5:c.854+1G>A, NM_000487.5:c.1108-2A>G, NM_000487.5:c.1125_1126delCT, NM_000487.5:c.1150G>A, NM_000487.5:c.1174C>T, NM_000487.5:c.1175G>A, NM_000487.5:c.986C>T, NM_000487.5:c.991G>T, NM_000487.5:c.465+1G>A, NM_000487.5:c.257G>A, NM_000487.5:c.293C>T, NM_000487.5:c.302G>AMetachromatic leukodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSA gene located on chromosomal region 22q13.33. The age of onset is variable. This disease is characterized by hypotonia, walking difficulties, optic atrophy and motor regression preceding mental impairment in the late infantile form, arrested intellectual development, followed by motor regression, epileptic seizures and ataxia in the juvenile form, and motor or psychiatric disorders, but with slow progression in the adult form. The incidence is 0.5:5,000-1:50,000 and the prevalence is 1:10,000 -5/10,000.250,600
ARSBMucopolysaccharidosis type 6NM_000046.3NM_000046.3:c.410G>T, NM_000046.3:c.427delG, NM_000046.3:c.349T>C, NM_000046.3:c.389C>T, NM_000046.3:c.937C>G, NM_000046.3:c.944G>A, NM_000046.3:c.971G>T, NM_000046.3:c.979C>T, NM_000046.3:c.1562G>A, NM_000046.3:c.629A>G, NM_000046.3:c.1143-1G>C, NM_000046.3:c.571C>T, NM_000046.3:c.589C>T, NM_000046.3:c.1178A>C, NM_000046.3:c.1214G>A, NM_000046.3:c.1143-8T>G, NM_000046.3:c.1161dupC, NM_000046.3:c.707T>C, NM_000046.3:c.753C>G, NM_000046.3:c.1366C>T, NM_000046.3:c.1438_1439insG, NM_000046.3:c.921delAMucopolysaccharidosis type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSB gene located on chromosomal region 5q14.1. The age of onset is infantile. This disease is characterized by educed pulmonary function, hepatosplenomegaly, hearing loss, sleep apnea, corneal clouding, carpal tunnel disease and occasionally central nervous system findings may include cervical cord compression caused by cervical spinal instability, meningeal thickening and/or bony stenosis, communicating hydrocephalus, optic nerve atrophy and blindness. The prevalence is 1:250,000-1:600,000 newborns.250,600
ARSEChondrodysplasia punctata type 1, X-linkedNM_000047.2NM_000047.2:c.119T>G, NM_000047.2:c.1429delG, NM_000047.2:c.1442C>T, NM_000047.2:c.1732C>T, NM_000047.2:c.1743G>A, NM_000047.2:c.24-1G>A, NM_000047.2:c.410G>C, NM_000047.2:c.410G>TX-linked chondrodysplasia punctata type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARSE gene located on chromosomal region Xp22.33. The age of onset is neonatal. This disease is characterized by chondrodysplasia punctata (stippled epiphyses), brachytelephalangy (shortening of the distal phalanges), and nasomaxillary hypoplasia. The prevalence is 1:500,000.250,600
ARXEpileptic encephalopathy, early infantile, type 1NM_139058.2NM_139058.2:c.1058C>TEarly infantile epileptic encephalopathy type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARX gene located on chromosomal region Xp21.3. The age of onset is neonatal/infantile. This disease is characterized by poor suckling reflexes, hypotonia and generalized and symmetrical tonic spasms. The prevalence is 1:500,000.600
ARXLissencephaly with abnormal genitalia, X-linkedNM_139058.2NM_139058.2:c.980_983delAACAX-linked lissencephaly with abnormal genitalia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARX gene located on chromosomal region Xp21.3. The age of onset is neonatal/infantile. It is a severe neurological disorder that only manifests in genotypic males and includes lissencephaly with posterior-to-anterior gradient and only moderate increase in thickness of the cortex, absent corpus callosum, neonatal-onset severe epilepsy, hypothalamic dysfunction including defective temperature regulation, and ambiguous genitalia with micropenis and cryptorchidism.600
ASLArgininosuccinic aciduriaNM_000048.3NM_000048.3:c.1135C>T, NM_000048.3:c.1060C>T, NM_000048.3:c.1255_1256delCT, NM_000048.3:c.1366C>T, NM_000048.3:c.1045_1057delGTCATCTCTACGC, NM_000048.3:c.578G>A, NM_000048.3:c.539T>G, NM_000048.3:c.544C>T, NM_000048.3:c.557G>A, NM_000048.3:c.1144-2A>G, NM_000048.3:c.602+1G>A, NM_000048.3:c.857A>G, NM_000048.3:c.925G>A, NM_000048.3:c.446+1G>A, NM_000048.3:c.505T>C, NM_000048.3:c.525-2A>T, NM_000048.3:c.532G>A, NM_000048.3:c.337C>T, NM_000048.3:c.346C>T, NM_000048.3:c.35G>A, NM_000048.3:c.1369dupG, NM_000048.3:c.437G>A, NM_000048.3:c.392C>T, NM_000048.3:c.1153C>TArgininosuccinic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASL gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by severe hyperammonemic coma, hypotonia, growth failure, anorexia and chronic vomiting or behavioral disorders during childhood, and hyperammonemic coma or behavioral disorders that simulate psychiatric disorders later in life. The prevalence is 1:70,000 newborns.250,600
ASPACanavan diseaseNM_000049.2NM_000049.2:c.838C>T, NM_000049.2:c.693C>A, NM_000049.2:c.654C>A, NM_000049.2:c.433-2A>G, NM_000049.2:c.854A>C, NM_000049.2:c.914C>A, NM_000049.2:c.212G>A, NM_000049.2:c.863A>GCanavan disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPA gene located on chromosomal region 17p13.3. The age of onset is neonatal/infantile. This disease is characterized by a variable spectrum between severe forms with leukodystrophy, macrocephaly and severe developmental delay, and a very rare mild/juvenile form characterized by mild developmental delay. The prevalence is 1:6,400- 1:13,500 in Askenazis Jewis.250,600
ASPMMicrocephaly primary, type 5, autosomal recessiveNM_018136.4NM_018136.4:c.1002delA, NM_018136.4:c.3055C>T, NM_018136.4:c.2389C>T, NM_018136.4:c.2967G>A, NM_018136.4:c.1260_1266delTCAAGTC, NM_018136.4:c.10059C>A, NM_018136.4:c.1154_1155delAG, NM_018136.4:c.1179delT, NM_018136.4:c.1729_1730delAG, NM_018136.4:c.1959_1962delCAAA, NM_018136.4:c.1990C>T, NM_018136.4:c.3979C>T, NM_018136.4:c.4195dupA, NM_018136.4:c.4583delA, NM_018136.4:c.4795C>T, NM_018136.4:c.4858_4859delAT, NM_018136.4:c.5136C>A, NM_018136.4:c.5149delA, NM_018136.4:c.1366G>T, NM_018136.4:c.1406_1413delATCCTAAA, NM_018136.4:c.1590delA, NM_018136.4:c.6189T>G, NM_018136.4:c.6232C>T, NM_018136.4:c.6337_6338delAT, NM_018136.4:c.6732delA, NM_018136.4:c.719_720delCT, NM_018136.4:c.7491_7495delTATTA, NM_018136.4:c.7565T>G, NM_018136.4:c.7761T>G, NM_018136.4:c.7782_7783delGA, NM_018136.4:c.7860_7861delGA, NM_018136.4:c.7894C>T, NM_018136.4:c.8131_8132delAA, NM_018136.4:c.8230_8231insA, NM_018136.4:c.8378delT, NM_018136.4:c.8508_8509delGA, NM_018136.4:c.8668C>T, NM_018136.4:c.8844delC, NM_018136.4:c.9115_9118dupCATT, NM_018136.4:c.9159delA, NM_018136.4:c.9178C>T, NM_018136.4:c.3082G>A, NM_018136.4:c.3188T>G, NM_018136.4:c.3477_3481delCGCTA, NM_018136.4:c.349C>T, NM_018136.4:c.3527C>G, NM_018136.4:c.3663delG, NM_018136.4:c.3710C>G, NM_018136.4:c.3796G>T, NM_018136.4:c.3811C>T, NM_018136.4:c.3978G>A, NM_018136.4:c.9747_9748delCT, NM_018136.4:c.9754delA, NM_018136.4:c.9789T>A, NM_018136.4:c.8711_8712delAA, NM_018136.4:c.9190C>T, NM_018136.4:c.9238A>T, NM_018136.4:c.9319C>T, NM_018136.4:c.5439_5440delAG, NM_018136.4:c.577C>T, NM_018136.4:c.6073delG, NM_018136.4:c.9677dupG, NM_018136.4:c.9685delA, NM_018136.4:c.9697C>T, NM_018136.4:c.9730C>T, NM_018136.4:c.9557C>G, NM_018136.4:c.9492T>G, NM_018136.4:c.9539A>CPrimary autosomal recessive microcephaly type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPM gene located on chromosomal region 1q31. The age of onset is neonatal/infantile. This disease is characterized by a reduction in head circumference at birth, mild to moderate non-progressive intellectual impairment and delay in early motor milestones, speech delay and hyperactive behavior are common. The annual incidence is 1:1,000,000.250,600
ASS1Citrullinemia type 1NM_000050.4NM_000050.4:c.421-2A>G, NM_000050.4:c.40G>A, NM_000050.4:c.1088G>A, NM_000050.4:c.470G>A, NM_000050.4:c.1085G>T, NM_000050.4:c.1087C>T, NM_000050.4:c.257G>A, NM_000050.4:c.323G>T, NM_000050.4:c.349G>A, NM_000050.4:c.380G>A, NM_000050.4:c.836G>A, NM_000050.4:c.910C>T, NM_000050.4:c.928A>C, NM_000050.4:c.496-2A>G, NM_000050.4:c.535T>C, NM_000050.4:c.539G>A, NM_000050.4:c.53C>T, NM_000050.4:c.571G>A, NM_000050.4:c.787G>A, NM_000050.4:c.793C>T, NM_000050.4:c.794G>A, NM_000050.4:c.805G>A, NM_000050.4:c.835C>T, NM_000050.4:c.919C>T, NM_000050.4:c.970G>A, NM_000050.4:c.814C>T, NM_000050.4:c.970+5G>A, NM_000050.4:c.1168G>A, NM_000050.4:c.1194-1G>C, NM_000050.4:c.256C>TCitrullinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASS1 gene located on chromosomal region 9q34.1. The age of onset is variable. This disease is characterized by hyperammonemia, progressive lethargy, poor feeding and vomiting in the neonatal form and by variable hyperammonemia in the later-onset form. The prevalence is 1:100,000-9:100,000.250,600
ATICAICA-ribosiduriaNM_004044.6NM_004044.6:c.223+1G>A, NM_004044.6:c.1277A>G, NM_004044.6:c.625delGAICA-ribosiduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATIC gene located on chromosomal region 2q35. The age of onset is neonatal/infantile. This disease is characterized by profound intellectual deficit, epilepsy, dysmorphic features of the knees, elbows, and shoulders and congenital blindness. The prevalence is <1:1,000,000.250,600
ATP7AMenkes diseaseNM_000052.6NM_000052.6:c.2938C>T, NM_000052.6:c.2531G>A, NM_000052.6:c.1639C>T, NM_000052.6:c.1974_1977dupGTTT, NM_000052.6:c.3257_3258delAC, NM_000052.6:c.3294+2T>G, NM_000052.6:c.3915_3921delCTCCCCA, NM_000052.6:c.3931A>GMenkes disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ATP7A gene located on chromosomal region Xq21.1. The age of onset is neonatal/infantile. This disease is characterized by progressive neurodegeneration and marked connective tissue anomalies as well as typical sparse abnormal steely hair. The birth incidence is 1:300,000 in Europe, 1:360,000 in Japan and 1:50,000-1:100,000 in Australia, and The prevalence is 1:100,000 newborns.600
ATP7AOccipital horn syndromeNM_000052.6NM_000052.6:c.3911A>GOccipital horn syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ATP7A gene located on chromosomal region Xq21.1. The age of onset is variable. This disease is characterized by progressive neurodegeneration and connective tissue disorders due to a copper transport defect. The prevalence is 1:100,000 newborns.600
ATP7ASpinal muscular atrophy, distal, X-linkedNM_000052.6NM_000052.6:c.2981C>TSpinal muscular atrophy, distal follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ATP7A gene located on chromosomal region Xq21.1. The age of onset is infantile. This disease is characterized by distal weakness, atrophy of the muscles of the lower limbs, particularly in the tibioperoneal compartment and pes cavus.600
ATP7BWilson diseaseNM_000053.3NM_000053.3:c.2532delA, NM_000053.3:c.2356-2A>G, NM_000053.3:c.1285+5G>T, NM_000053.3:c.2305A>G, NM_000053.3:c.1145_1151delCCCAACT, NM_000053.3:c.1934T>G, NM_000053.3:c.2071G>A, NM_000053.3:c.2297C>G, NM_000053.3:c.2972C>T, NM_000053.3:c.2975C>T, NM_000053.3:c.3083delA, NM_000053.3:c.2605G>A, NM_000053.3:c.2621C>T, NM_000053.3:c.2755C>G, NM_000053.3:c.2755C>T, NM_000053.3:c.2762G>A, NM_000053.3:c.2795C>A, NM_000053.3:c.2804C>T, NM_000053.3:c.2807T>A, NM_000053.3:c.2906G>A, NM_000053.3:c.2930C>T, NM_000053.3:c.4301C>T, NM_000053.3:c.915T>A, NM_000053.3:c.98T>C, NM_000053.3:c.1745_1746delTA, NM_000053.3:c.2123T>C, NM_000053.3:c.2267C>T, NM_000053.3:c.4088C>T, NM_000053.3:c.4135C>T, NM_000053.3:c.1512_1513insT, NM_000053.3:c.19_20delCA, NM_000053.3:c.1922T>C, NM_000053.3:c.3955C>T, NM_000053.3:c.3990_3993delTTAT, NM_000053.3:c.4058G>A, NM_000053.3:c.3207C>A, NM_000053.3:c.3359T>A, NM_000053.3:c.3688A>G, NM_000053.3:c.3101A>G, NM_000053.3:c.3796G>A, NM_000053.3:c.3809A>G, NM_000053.3:c.562C>T, NM_000053.3:c.3694A>C, NM_000053.3:c.1846C>TWilson disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATP7B gene located on chromosomal region 13q14.3. The age of onset is infantile. This disease is characterized by the toxic accumulation of copper, mainly in the liver and central nervous system, and symptomatic patients may present with hepatic, neurologic or psychiatric forms. The birth incidence is 1:30,000-1:100,000 in France and The prevalence is 1:10,000-1:30,000.250,600
ATRSeckel syndrome type 1NM_001184.3NM_001184.3:c.2341+1G>A, NM_001184.3:c.5645delA, NM_001184.3:c.6037_6038insA, NM_001184.3:c.6488delT, NM_001184.3:c.975_976delCT, NM_001184.3:c.5635G>TSeckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATR gene located on chromosomal region 3q23. The age of onset is neonatal/infantile. This disease is characterized by a proportionate dwarfism of prenatal onset, a severe microcephaly with a bird-headed like appearance and mental retardation. The prevalence is <1:1,000,000.250,600
AUH3-Methylglutaconic aciduria type 1NM_001698.2NM_001698.2:c.471delT, NM_001698.2:c.559G>A, NM_001698.2:c.589C>T, NM_001698.2:c.650G>A, NM_001698.2:c.895-1G>A, NM_001698.2:c.991A>T, NM_001698.2:c.656-2A>G, NM_001698.2:c.943-2A>G3-Methylglutaconic aciduria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AUH gene located on chromosomal region 9q22.31. The age of onset is neonatal/infantile. This disease is characterized by a variable clinical phenotype ranging from mildly delayed speech to psychomotor retardation, coma, failure to thrive, metabolic acidosis and dystonia. The prevalence is <1:1,000,000.600
B4GALT1Congenital disorders of glycosylation type 2dNM_001497.3NM_001497.3:c.1031dupCCongenital disorder of glycosylation type 2d follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the B4GALT1 gene located on chromosomal region 9p13. The age of onset is neonatal/infantile. This disease is characterized by macrocephaly, hydrocephaly, hypotonia, myopathy and coagulation anomalies. The prevalence is <1:1,000,000.600
B9D2Meckel syndrome type 10NM_030578.3NM_030578.3:c.301A>CMeckel syndrome type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the B9D2 gene located on chromosomal region 19q13.2. The age of onset is neonatal/infantile. This disease is characterized by a combination of renal cysts developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and polydactyly. The prevalence is <1:1,000,000.600
BCKDHAMaple syrup urine disease type 1ANM_000709.3NM_000709.3:c.1037G>A, NM_000709.3:c.1036C>T, NM_000709.3:c.1234G>A, NM_000709.3:c.14delT, NM_000709.3:c.761C>A, NM_000709.3:c.929C>G, NM_000709.3:c.964C>T, NM_000709.3:c.979G>A, NM_000709.3:c.905A>C, NM_000709.3:c.632C>T, NM_000709.3:c.659C>T, NM_000709.3:c.740_741insT, NM_000709.3:c.868G>A, NM_000709.3:c.909_910delGT, NM_000709.3:c.917delT, NM_000709.3:c.853G>C, NM_000709.3:c.796delAMaple syrup urine disease type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHA gene located on chromosomal region 19q13.1-13.2. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:1,000,000-9:1,000,000.250,600
BCKDHBMaple syrup urine disease type 1BNM_183050.2NM_183050.2:c.1046G>A, NM_183050.2:c.547C>T, NM_183050.2:c.509G>A, NM_183050.2:c.526A>T, NM_183050.2:c.344-1G>A, NM_183050.2:c.1114G>T, NM_183050.2:c.302G>A, NM_183050.2:c.342T>G, NM_183050.2:c.508C>A, NM_183050.2:c.508C>G, NM_183050.2:c.508C>T, NM_183050.2:c.748G>T, NM_183050.2:c.752T>C, NM_183050.2:c.799C>T, NM_183050.2:c.548G>C, NM_183050.2:c.884delT, NM_183050.2:c.902T>G, NM_183050.2:c.952-1G>A, NM_183050.2:c.853C>T, NM_183050.2:c.832G>A, NM_183050.2:c.356T>G, NM_183050.2:c.970C>T, NM_183050.2:c.488A>T, NM_183050.2:c.479T>GMaple syrup urine disease type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHB gene located on chromosomal region 6q14.1. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:10,000-5:10,000.600
BCS1LBjörnstad syndromeNM_004328.4NM_004328.4:c.548G>ABjörnstadt syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal/infantile. This disease is characterized by congenital sensorineural hearing loss and pili torti. The prevalence is <1:1,000,000.250,600
BCS1LGRACILE syndromeNM_004328.4NM_004328.4:c.232A>GGRACILE syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal/infantile. This disease is characterized by fetal growth restriction (GR), aminoaciduria (A), cholestasis (C), iron overload (I), lactacidosis (L) and early death (E). The birth incidence is 1:50,000 in Finland and the prevalence is <1:1,000,000.250,600
BCS1LMitochondrial comlpex III deficiency, nuclear type 1NM_004328.4NM_004328.4:c.1057G>A, NM_004328.4:c.830G>A, NM_004328.4:c.133C>T, NM_004328.4:c.103G>C, NM_004328.4:c.696delT, NM_004328.4:c.148A>G, NM_004328.4:c.166C>T, NM_004328.4:c.550C>T, NM_004328.4:c.547C>TMitochondrial comlpex III deficiency, nuclear type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal and it is characterized by lactic acidosis, hypotonia, hypoglycemia, failure to thrive, encephalopathy, and delayed psychomotor development.250,600
BEST1BestrophinopathyNM_004183.3NM_004183.3:c.934G>A, NM_004183.3:c.598C>T, NM_004183.3:c.752G>A, NM_004183.3:c.949G>A, NM_004183.3:c.521_522delTGBestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram.250,600
BEST1Retinitis pigmentosa type 50NM_004183.3NM_004183.3:c.1383_1384insGCCTTGATGGA, NM_004183.3:c.1444delG, NM_004183.3:c.1491_1497dupCAAAGAC, NM_004183.3:c.1566_1576dupCTTGATGGAGC, NM_004183.3:c.341_342delTG, NM_004183.3:c.1308_1309insACCAAAG, NM_004183.3:c.1264delG, NM_004183.3:c.418C>G, NM_004183.3:c.614T>C, NM_004183.3:c.682G>A, NM_004183.3:c.344delG, NM_004183.3:c.524delGRetinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 50 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q12.3. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.250,600
BEST1Vitelliform macular dystrophy type 2NM_004183.3NM_004183.3:c.122T>C, NM_004183.3:c.422G>AVitelliform macular dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q12.3. The age of onset is infancy or adolescence. This disease is characterized by normal vision at birth, then progresses through distinct stages that include an asymptomatic previtelliform phase (stage 1) followed by the formation of a yellow, egg yolk-like (vitelliform) lesion in the macula (stage 2). The contents become less homogenous and develop a "scrambled-egg" appearance (stage 2a). The lesion eventually develops a fluid, yellow-colored vitelline substance (pseudohypopyon or stage 3) and finally breaks down, leaving a scar that causes central visual acuity deterioration (20/200). This may be complicated by a subfoveal choroidal neovascular (CNV) membrane (rare in children). Anomalous color discrimination (mainly the protan axis) and metamorphopsia may be observed but patients retain normal peripheral vision and dark adaptation. Some affected individuals remain asymptomatic. The prevalence is 1/5,000 to 1/67,000.250,600
BRCA2Fanconi anemia, complementation group D1NM_000059.3NM_000059.3:c.1514T>C, NM_000059.3:c.4648G>T, NM_000059.3:c.8415A>T, NM_000059.3:c.7544C>T, NM_000059.3:c.7994A>G, NM_000059.3:c.5574_5577delAATT, NM_000059.3:c.4889C>G, NM_000059.3:c.4936_4939delGAAA, NM_000059.3:c.5066_5067insA, NM_000059.3:c.6024dupG, NM_000059.3:c.6860delG, NM_000059.3:c.7235C>A, NM_000059.3:c.9382C>T, NM_000059.3:c.9900dupA, NM_000059.3:c.3847_3848delGT, NM_000059.3:c.5718_5719delCT, NM_000059.3:c.5837_5838delCAinsAG, NM_000059.3:c.6023_6024insG, NM_000059.3:c.8503T>C, NM_000059.3:c.6486_6489delACAA, NM_000059.3:c.657_658delTG, NM_000059.3:c.6997_6998insTFanconi anemia, complementation group D1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BRCA2 gene located on chromosomal region 13q12.3. The age of onset is infantile. This disease is characterized by physical abnormalities, bone marrow failure, and increased risk of malignancy. The prevalence is 1:1,000,000-9:1,000,000.250,600
BRIP1Fanconi anemia, complementation group JNM_032043.2NM_032043.2:c.2990_2993delCAAA, NM_032043.2:c.1045G>C, NM_032043.2:c.2237_2240delTCAA, NM_032043.2:c.3209C>A, NM_032043.2:c.502C>T, NM_032043.2:c.139C>G, NM_032043.2:c.1702_1703delAA, NM_032043.2:c.2392C>TFanconi anemia, complementation group J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BRIP1 gene located on chromosomal region 17q22.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:1,000,000- 9:1,000,000.250,600
BSCL2Berardinelli-Seip congenital lipodystrophyNM_032667.6NM_032667.6:c.634G>C, NM_032667.6:c.412C>T, NM_032667.6:c.782_783insG, NM_032667.6:c.823C>T, NM_032667.6:c.985C>T, NM_032667.6:c.672-3C>G, NM_032667.6:c.974_975insG, NM_032667.6:c.671+5G>ABerardinelli-Seip congenital lipodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSCL2 gene located on chromosomal region 11q13. The age of onset is neonatal/infantile. This disease is characterized the association of lipoatrophy, hypertriglyceridemia, hepatomegaly and acromegaloid features. The prevalence is 1.27:100,000.600
BSCL2Severe neurodegenerative syndrome with lipodystrophyNM_032667.6NM_032667.6:c.793C>TSevere neurodegenerative syndrome with lipodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSCL2 gene located on chromosomal region 11q13. The age of onset is neonatal/infantile. This disease is characterized by developmental regression of motor and cognitive skills in the first years of life, often leading to death in the first decade, hyperactive behavior, seizures, tremor and ataxic gait. Patients may show a mild or typical lipodystrophic appearance. The prevalence is 1.27:100,000.600
BSNDBartter syndrome type 4ANM_057176.2NM_057176.2:c.1A>T, NM_057176.2:c.22C>T, NM_057176.2:c.3G>A, NM_057176.2:c.10G>T, NM_057176.2:c.23G>T, NM_057176.2:c.35T>C, NM_057176.2:c.23G>A, NM_057176.2:c.139G>ABartter syndrome type 4A with deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSND gene located on chromosomal region 1p32.3. The age of onset is neonatal/infantile. This disease is characterized by maternal polyhydramnios, premature delivery, polyuria, sensorineural deafness and is associated with hypokalemic alkalosis, increased levels of plasma renin and aldosterone, low blood pressure, and vascular resistance to angiotensin II.250,600
BTDBiotinidase deficiencyNM_000060.3NM_000060.3:c.1531C>G, NM_000060.3:c.1508_1512delGGATG, NM_000060.3:c.1339C>T, NM_000060.3:c.1352G>A, NM_000060.3:c.1489C>T, NM_000060.3:c.643C>T, NM_000060.3:c.664G>A, NM_000060.3:c.755A>G, NM_000060.3:c.1368A>C, NM_000060.3:c.933delT, NM_000060.3:c.1595C>T, NM_000060.3:c.1612C>T, NM_000060.3:c.757C>T, NM_000060.3:c.1106C>T, NM_000060.3:c.1321delG, NM_000060.3:c.794A>T, NM_000060.3:c.595G>A, NM_000060.3:c.629A>G, NM_000060.3:c.631C>T, NM_000060.3:c.235C>T, NM_000060.3:c.334G>C, NM_000060.3:c.511G>A, NM_000060.3:c.184G>A, NM_000060.3:c.557G>A, NM_000060.3:c.583A>G, NM_000060.3:c.968A>G, NM_000060.3:c.528G>T, NM_000060.3:c.443G>ABiotinidase deficiency an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BTD gene located on chromosomal region 3p25. The age of onset is neonatal/infantile. This disease is characterized by seizures, breathing difficulties, hypotonia, skin rash, alopecia, hearing loss and delayed development.250,600
BTKAgammaglobulinemia, X-linkedNM_000061.2NM_000061.2:c.1275C>A, NM_000061.2:c.1506C>A, NM_000061.2:c.1125T>G, NM_000061.2:c.1223T>C, NM_000061.2:c.1288A>G, NM_000061.2:c.1082A>G, NM_000061.2:c.763C>T, NM_000061.2:c.1516T>C, NM_000061.2:c.718G>T, NM_000061.2:c.755G>A, NM_000061.2:c.1766A>G, NM_000061.2:c.1773C>A, NM_000061.2:c.1558C>T, NM_000061.2:c.1559G>A, NM_000061.2:c.1889T>A, NM_000061.2:c.1906G>T, NM_000061.2:c.338T>A, NM_000061.2:c.1820C>A, NM_000061.2:c.862C>T, NM_000061.2:c.919A>G, NM_000061.2:c.1838G>A, NM_000061.2:c.1001A>CX-linked agammaglobulinemia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the BTK gene located on chromosomal region Xq21.33-q22. The age of onset is infantile. This disease is characterized by recurrent bacterial infections during infancy. The prevalence is 3:1,000,000-6:1,000,000 men.600
C10orf2Infantile onset spinocerebellar ataxiaNM_021830.4NM_021830.4:c.1523A>GLa ataxia espinocerebelosa infantil sigue un patrón de herencia autosómico recesivo y está causada por variantes patogénicas en el gen C10orf2 localizado en la región cromosómica 10q24. La edad de aparición es neonatal/infantil con síntomas como inicio temprano ataxia, atetosis y reducción de los reflejos tendinosos.600
C10orf2Mitochondrial DNA depletion syndrome, hepatocerebrorenal formNM_021830.4NM_021830.4:c.1287C>T, NM_021830.4:c.952G>A, NM_021830.4:c.1370C>T, NM_021830.4:c.524_525insGMitochondrial DNA depletion syndrome, hepatocerebrorenal form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C10orf2 gene located on chromosomal region 10q24. The age of onset is neonatal/infantile. It is a severe disease associated with mitochondrial dysfunction. Some patients are affected by progressive atrophy of the cerebellum, brain stem, the spinal cord, and sensory axonal neuropathy. Clinical features include hypotonia, athetosis, ataxia, ophthalmoplegia, sensorineural hearing deficit, sensory axonal neuropathy, epileptic encephalopathy and female hypogonadism. In some individuals liver dysfunction and multi-organ failure is present.600
C10orf2Sensory ataxic neuropathy - dysarthria - ophthalmoparesisNM_021830.4NM_021830.4:c.955A>GSensory ataxic neuropathy - dysarthria - ophthalmoparesis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C10orf2 gene located on chromosomal region 10q24. This syndrome is characterised by adult-onset severe sensory ataxic neuropathy, dysarthria and chronic progressive external ophthalmoplegia. The prevalence is unknown. Other common features include progressive gait unsteadiness, absent deep tendon reflexes, the presence of Romberg's sign, a decreased sense of vibration and proprioception and detection of red ragged fibres on muscle biopsy.600
C3Atypical hemolytic-uremic syndrome with C3 anomalyNM_000064.2NM_000064.2:c.2562C>GAtypical hemolytic-uremic syndrome with C3 anomaly follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C3 gene located on chromosomal region 19p13.3-p13.2. An atypical form of hemolytic uremic syndrome. It is a complex genetic disease characterized by microangiopathic hemolytic anemia, thrombocytopenia, renal failure and absence of episodes of enterocolitis and diarrhea. In contrast to typical hemolytic uremic syndrome, atypical forms have a poorer prognosis, with higher death rates and frequent progression to end-stage renal disease. The prevalence is <1:1.000.000.600
C3C3 deficiencyNM_000064.2NM_000064.2:c.2354+1G>A, NM_000064.2:c.4851-1G>A, NM_000064.2:c.1119+1G>T, NM_000064.2:c.3116dupT, NM_000064.2:c.3627_3628insGGGGCCC, NM_000064.2:c.1004-2A>TC3 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C3 gene located on chromosomal region 19p13.3-p13.2. The age of onset is infantile. It is a rare defect of the complement classical pathway. Patients develop recurrent, severe, pyogenic infections because of ineffective opsonization of pathogens. Some patients may also develop autoimmune disorders, such as arthralgia and vasculitic rashes, lupus-like syndrome and membranoproliferative glomerulonephritis. The prevalence is <1:1.000.000.600
CA2Osteopetrosis, autosomal recessive, type 3NM_000067.2NM_000067.2:c.663+2T>C, NM_000067.2:c.319C>T, NM_000067.2:c.120T>GOsteopetrosis, autosomal recessive, type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CA2 gene located on chromosomal region 8q22. The age of onset is neonatal/infantile. This disease is characterized by osteopetrosis, renal tubular acidosis, and neurological disorders related to cerebral calcifications. The prevalence is <1:1.000.000.600
CAPN3Limb-girdle muscular dystrophy type 2ANM_000070.2NM_000070.2:c.1838delA, NM_000070.2:c.2120A>G, NM_000070.2:c.1795_1796insA, NM_000070.2:c.1469G>A, NM_000070.2:c.1599_1602delGAGC, NM_000070.2:c.1715G>A, NM_000070.2:c.1743_1745+1delTGAG, NM_000070.2:c.257C>T, NM_000070.2:c.328C>T, NM_000070.2:c.549delA, NM_000070.2:c.2212C>T, NM_000070.2:c.223dupT, NM_000070.2:c.2243G>A, NM_000070.2:c.2251_2254dupGTCA, NM_000070.2:c.2257G>A, NM_000070.2:c.2306G>A, NM_000070.2:c.2361_2363delAGinsTCATCT, NM_000070.2:c.2361_2364delAGinsTCATCT, NM_000070.2:c.2362_2363delAGinsTCATCT, NM_000070.2:c.246G>A, NM_000070.2:c.676G>A, NM_000070.2:c.551C>T, NM_000070.2:c.580delT, NM_000070.2:c.133G>A, NM_000070.2:c.550delA, NM_000070.2:c.1468C>T, NM_000070.2:c.956C>T, NM_000070.2:c.1322delG, NM_000070.2:c.1466G>A, NM_000070.2:c.662G>T, NM_000070.2:c.855_864dupGTTGATTGCA, NM_000070.2:c.1610A>G, NM_000070.2:c.598_612delTTCTGGAGTGCTCTGLimb-girdle muscular dystrophy type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CAPN3 gene located on chromosomal region 15q15.1. The age of onset is variable. This disease is characterized by symmetrical and selective atrophy and weakness of proximal limb and girdle muscles. The prevalence is 1:100,000- 9:100,000.250,600
CBSHomocystinuriaNM_000071.2NM_000071.2:c.1150A>G, NM_000071.2:c.1058C>T, NM_000071.2:c.1136G>A, NM_000071.2:c.341C>T, NM_000071.2:c.1006C>T, NM_000071.2:c.325T>C, NM_000071.2:c.1316G>A, NM_000071.2:c.374G>A, NM_000071.2:c.1265C>T, NM_000071.2:c.1280C>T, NM_000071.2:c.146C>T, NM_000071.2:c.1471C>T, NM_000071.2:c.1616T>C, NM_000071.2:c.162G>A, NM_000071.2:c.833T>C, NM_000071.2:c.904G>A, NM_000071.2:c.919G>A, NM_000071.2:c.393G>C, NM_000071.2:c.415G>A, NM_000071.2:c.430G>A, NM_000071.2:c.434C>T, NM_000071.2:c.502G>A, NM_000071.2:c.526G>T, NM_000071.2:c.572C>T, NM_000071.2:c.676G>A, NM_000071.2:c.689delT, NM_000071.2:c.797G>A, NM_000071.2:c.959T>C, NM_000071.2:c.969G>A, NM_000071.2:c.992C>A, NM_000071.2:c.1330G>A, NM_000071.2:c.1379C>T, NM_000071.2:c.1397C>T, NM_000071.2:c.304A>CHomocystinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CBS gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by the multiple involvement of the eye, skeleton, central nervous system and vascular system. The prevalence is 1:200,000-1:335,000.250,600
CC2D2AJoubert syndrome type 9NM_001080522.2NM_001080522.2:c.4179delG, NM_001080522.2:c.3594+1G>A, NM_001080522.2:c.3289delG, NM_001080522.2:c.4582C>T, NM_001080522.2:c.4667A>T, NM_001080522.2:c.2848C>T, NM_001080522.2:c.3364C>T, NM_001080522.2:c.4333C>T, NM_001080522.2:c.4181delGJoubert syndrome type 9 defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized neonatal hypotonia, developmental delay, intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia, primary position nystagmus and congenital hepatic fibrosis.250,600
CC2D2AMeckel syndrome type 6NM_001080522.2NM_001080522.2:c.3145C>T, NM_001080522.2:c.2486+1G>CMeckel syndrome type 6 with hepatic defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized by a combination of renal cysts, developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and polydactyly.250,600
CD2APFocal segmental glomerulosclerosis type 3NM_012120.2NM_012120.2:c.730-1delGinsCT, NM_012120.2:c.1575_1577delAGA, NM_012120.2:c.1488G>AFocal segmental glomerulosclerosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CD2AP gene located on chromosomal region 6p12. The age of onset is variable. A renal pathology defined by the presence of segmental sclerosis in glomeruli and resulting in proteinuria, reduced glomerular filtration rate and progressive decline in renal function. Renal insufficiency often progresses to end-stage renal disease, a highly morbid state requiring either dialysis therapy or kidney transplantation.600
CD40LGHyper IgM syndrome, X-linkedNM_000074.2NM_000074.2:c.386A>G, NM_000074.2:c.368C>A, NM_000074.2:c.384T>A, NM_000074.2:c.632C>A, NM_000074.2:c.107T>GX-linked hyper-IgM syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the CD40LG gene located on chromosomal region Xq26. The age of onset is neonatal/infantile. This disease is characterized by lower-respiratory tract bacterial infections, opportunistic infections, recurrent or protracted diarrhea associated with failure to thrive, neutropenia, thrombocytopenia and anemia. The prevalence is 2:1,000,000 male newborns.600
CDH23Deafness type 12, autosomal recessiveNM_022124.5NM_022124.5:c.6442G>A, NM_022124.5:c.5663T>C, NM_022124.5:c.9565C>T, NM_022124.5:c.7823G>A, NM_022124.5:c.902G>ANon-syndromic autosomal recessive deafness type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.250,600
CDH23Usher syndrome type 1DNM_022124.5NM_022124.5:c.288+1G>A, NM_022124.5:c.193delC, NM_022124.5:c.6050-9G>A, NM_022124.5:c.3141C>A, NM_022124.5:c.146-2A>G, NM_022124.5:c.4504C>T, NM_022124.5:c.3516_3519delATCC, NM_022124.5:c.3579+2T>C, NM_022124.5:c.3293A>G, NM_022124.5:c.9319+1_9319+4delGTAA, NM_022124.5:c.5237G>A, NM_022124.5:c.1858+2T>G, NM_022124.5:c.6392delC, NM_022124.5:c.7660G>AUsher syndrome type 1D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by sensorineural deafness, retinitis pigmentosa and progressive vision loss.250,600
CDH3Ectodermal dysplasia - ectrodactyly - macular dystrophyNM_001793.4NM_001793.4:c.455_456insC, NM_001793.4:c.981delG, NM_001793.4:c.1508G>A, NM_001793.4:c.965A>T, NM_001793.4:c.830delG, NM_001793.4:c.965A>GEctodermal dysplasia - ectrodactyly - macular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH3 gene located on chromosomal region 16q22.1. The age of onset is neonatal/infantile. This disease is characterized by the association of ectodermal dysplasia, ectrodactyly, and macular dystrophy. The prevalence is <1:1,000,000.600
CDHR1Retinitis pigmentosa type 65NM_033100.3NM_033100.3:c.1485+2T>C, NM_033100.3:c.1463delG, NM_033100.3:c.1110delC, NM_033100.3:c.338delG, NM_033100.3:c.524dupA, NM_033100.3:c.1485+2T>G, NM_033100.3:c.1112delC, NM_033100.3:c.640delGRetinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 65 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDHR1 gene located on chromosomal region 10q23.1. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.250,600
CDK5RAP2Microcephaly, primary, type 3, autosomal recessiveNM_018249.5NM_018249.5:c.4661_4662insTATT, NM_018249.5:c.246T>A, NM_018249.5:c.4546G>T, NM_018249.5:c.127+1G>C, NM_018249.5:c.4672C>T, NM_018249.5:c.524_528delAGGCA, NM_018249.5:c.700G>TPrimary autosomal recessive microcephaly type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDK5RAP2 gene located on chromosomal region 9q33.2. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.600
CENPJMicrocephaly primary, type 6, autosomal recessiveNM_018451.4NM_018451.4:c.3243_3246delTCAG, NM_018451.4:c.2614delT, NM_018451.4:c.3415G>T, NM_018451.4:c.3653C>T, NM_018451.4:c.2462C>T, NM_018451.4:c.3699_3702dupAATA, NM_018451.4:c.3568_3571dupGTCA, NM_018451.4:c.3843_3844insTA, NM_018451.4:c.757_760delGTCT, NM_018451.4:c.1952_1953insAGTG, NM_018451.4:c.3704A>T, NM_018451.4:c.232_236delCAGAA, NM_018451.4:c.2460_2463delGACG, NM_018451.4:c.2968_2972delAAAAA, NM_018451.4:c.40C>T, NM_018451.4:c.289dupAPrimary autosomal recessive microcephaly type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CENPJ gene located on chromosomal region 13q12.12. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.250,600
CEP152Microcephaly, primary, type 9, autosomal recessiveNM_014985.3NM_014985.3:c.794A>C, NM_014985.3:c.749_750delGAPrimary autosomal recessive microcephaly type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP152 gene located on chromosomal region 15q21.1. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.600
CEP152Seckel syndrome type 5NM_014985.3NM_014985.3:c.2034T>G, NM_014985.3:c.1578-1G>ASeckel syndrome type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP152 gene located on chromosomal region 15q21.1. The age of onset is neonatal/infantile. This disease is characterized by proportionate dwarfism of prenatal onset associated with low birth weight, growth retardation, severe microcephaly with a bird-headed like appearance, and mental retardation.600
CEP290Joubert syndrome, Senior-Loken typeNM_025114.3NM_025114.3:c.5611_5614delCAAA, NM_025114.3:c.164_167delCTCAJoubert syndrome, Senior-Loken type syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infantile. This disease is characterized by symptoms of nephronophthisis such as polyuria, polydipsia, secondary eneuresis and anemia. The progression of the disease can lead to acute or chronic renal insufficiency and finally to end-stage kidney disease. Ocular features include congenital or early-onset severe visual loss, due to retinal dystrophy. In rare occasions, other additional clinical signs may be observed like liver fibrosis, obesity and neurologic disorders.. The prevalence is <1:1,000,000.250,600
CEP290Joubert syndrome type 5NM_025114.3NM_025114.3:c.4656delA, NM_025114.3:c.21G>T, NM_025114.3:c.5668G>TJoubert syndrome with oculorenal defect 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infantile. This disease is characterized by neonatal hypotonia, developmental delay, intellectrual disability, ataxia, abnormal eye movements including oculomotor apraxia, primary position nystagmus and renal and ocular disease.250,600
CEP290Leber congenital amaurosis type 10NM_025114.3NM_025114.3:c.7341_7342insA, NM_025114.3:c.4705-1G>T, NM_025114.3:c.4723A>T, NM_025114.3:c.4962_4963delAA, NM_025114.3:c.4916C>A, NM_025114.3:c.6624delG, NM_025114.3:c.6645+1G>A, NM_025114.3:c.7324G>T, NM_025114.3:c.6798G>A, NM_025114.3:c.7394_7395delAG, NM_025114.3:c.1681C>T, NM_025114.3:c.7341delA, NM_025114.3:c.6448_6455delCAGTTGAA, NM_025114.3:c.1665_1666delAA, NM_025114.3:c.384_387delTAGA, NM_025114.3:c.2249T>G, NM_025114.3:c.3185delT, NM_025114.3:c.4393C>T, NM_025114.3:c.1501G>TLeber congenital amaurosis type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infancy/neonatal. This disease is characterized by retinal dystrophy defined by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.250,600
CEP290Meckel syndrome type 4NM_025114.3NM_025114.3:c.613C>TMeckel syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is neonatal. This disease is characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically occipital encephalocele), hepatic ductal dysplasia and cysts, and postaxial polydactyly. The prevalence is <1 / 1,000,000.250,600
CERKLRetinitis pigmentosa tipo 26NM_201548.4NM_201548.4:c.1012C>T, NM_201548.4:c.1090C>T, NM_201548.4:c.312delA, NM_201548.4:c.715C>T, NM_201548.4:c.769C>T, NM_201548.4:c.780delT, NM_201548.4:c.847C>T, NM_201548.4:c.1553_1569dupTTATCAGTCTTTATGGARetinitis pigmentosa 26 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CERKL gene located on chromosomal region 2q31.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.250,600
CFHComplement factor H deficiencyNM_000186.3NM_000186.3:c.3628C>T, NM_000186.3:c.2876G>A, NM_000186.3:c.380G>T, NM_000186.3:c.481G>T, NM_000186.3:c.1606T>CImmunodeficiency with factor H anomaly follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFH gene located on chromosomal region 1q32. This disease is characterized by recurrent bacterial infections and renal failure.250,600
CFTRCystic fibrosisNM_000492.3NM_000492.3:c.1327_1330dupGATA, NM_000492.3:c.1210-7_1210-6delTT, NM_000492.3:c.125C>T, NM_000492.3:c.1301_1307delCACTTCT, NM_000492.3:c.1397C>A, NM_000492.3:c.1340delA, NM_000492.3:c.1364C>A, NM_000492.3:c.1393-1G>A, NM_000492.3:c.1438G>T, NM_000492.3:c.1466C>A, NM_000492.3:c.1475C>T, NM_000492.3:c.1477C>T, NM_000492.3:c.1516A>G, NM_000492.3:c.1519_1521delATC, NM_000492.3:c.1521_1523delCTT, NM_000492.3:c.1545_1546delTA, NM_000492.3:c.1624G>T, NM_000492.3:c.1692delA, NM_000492.3:c.1706A>G, NM_000492.3:c.1721C>A, NM_000492.3:c.178G>T, NM_000492.3:c.1970delG, NM_000492.3:c.200C>T, NM_000492.3:c.2012delT, NM_000492.3:c.2051_2052delAAinsG, NM_000492.3:c.2052_2053insA, NM_000492.3:c.2052delA, NM_000492.3:c.1000C>T, NM_000492.3:c.1007T>A, NM_000492.3:c.1013C>T, NM_000492.3:c.1021T>C, NM_000492.3:c.1022_1023insTC, NM_000492.3:c.1040G>A, NM_000492.3:c.1040G>C, NM_000492.3:c.1055G>A, NM_000492.3:c.1081delT, NM_000492.3:c.115C>T, NM_000492.3:c.2538G>A, NM_000492.3:c.254G>A, NM_000492.3:c.2551C>T, NM_000492.3:c.2583delT, NM_000492.3:c.262_263delTT, NM_000492.3:c.2657+5G>A, NM_000492.3:c.2668C>T, NM_000492.3:c.273+1G>A, NM_000492.3:c.2737_2738insG, NM_000492.3:c.2739T>A, NM_000492.3:c.274-1G>A, NM_000492.3:c.274G>A, NM_000492.3:c.274G>T, NM_000492.3:c.2780T>C, NM_000492.3:c.2834C>T, NM_000492.3:c.2855T>C, NM_000492.3:c.2869_2870insG, NM_000492.3:c.2875delG, NM_000492.3:c.2908G>C, NM_000492.3:c.292C>T, NM_000492.3:c.2939T>A, NM_000492.3:c.2989-1G>A, NM_000492.3:c.3067_3072delATAGTG, NM_000492.3:c.3140-26A>G, NM_000492.3:c.3194T>C, NM_000492.3:c.3196C>T, NM_000492.3:c.3197G>A, NM_000492.3:c.3230T>C, NM_000492.3:c.325_327delTATinsG, NM_000492.3:c.3266G>A, NM_000492.3:c.3276C>A, NM_000492.3:c.3276C>G, NM_000492.3:c.328G>C, NM_000492.3:c.328G>T, NM_000492.3:c.3302T>A, NM_000492.3:c.3310G>T, NM_000492.3:c.349C>T, NM_000492.3:c.350G>T, NM_000492.3:c.3528delC, NM_000492.3:c.3533_3536delCAAC, NM_000492.3:c.3587C>G, NM_000492.3:c.358G>A, NM_000492.3:c.3611G>A, NM_000492.3:c.3612G>A, NM_000492.3:c.3659delC, NM_000492.3:c.366T>A, NM_000492.3:c.3731G>A, NM_000492.3:c.3744delA, NM_000492.3:c.3752G>A, NM_000492.3:c.3761T>G, NM_000492.3:c.3764C>A, NM_000492.3:c.3773_3774insT, NM_000492.3:c.3846G>A, NM_000492.3:c.3909C>G, NM_000492.3:c.3937C>T, NM_000492.3:c.4056G>T, NM_000492.3:c.4077_4080delinsAA, NM_000492.3:c.4077_4080delTGTTinsAA, NM_000492.3:c.4251delA, NM_000492.3:c.4333G>A, NM_000492.3:c.4426C>T, NM_000492.3:c.442delA, NM_000492.3:c.445G>A, NM_000492.3:c.445G>T, NM_000492.3:c.446G>T, NM_000492.3:c.531delT, NM_000492.3:c.532G>A, NM_000492.3:c.571T>G, NM_000492.3:c.577G>T, NM_000492.3:c.579+1G>T, NM_000492.3:c.579+3A>G, NM_000492.3:c.579+5G>A, NM_000492.3:c.592G>A, NM_000492.3:c.595C>T, NM_000492.3:c.613C>T, NM_000492.3:c.617T>G, NM_000492.3:c.650A>G, NM_000492.3:c.658C>T, NM_000492.3:c.708delT, NM_000492.3:c.722_743delGGAGAATGATGATGAAGTACAG, NM_000492.3:c.803delA, NM_000492.3:c.935_937delTCT, NM_000492.3:c.988G>T, NM_000492.3:c.1046C>T, NM_000492.3:c.14C>T, NM_000492.3:c.1558G>A, NM_000492.3:c.1585-1G>A, NM_000492.3:c.1684G>C, NM_000492.3:c.1766+1G>A, NM_000492.3:c.1397C>G, NM_000492.3:c.1399C>T, NM_000492.3:c.1400T>C, NM_000492.3:c.3380G>A, NM_000492.3:c.3409A>G, NM_000492.3:c.3868C>A, NM_000492.3:c.489+1G>T, NM_000492.3:c.2537G>A, NM_000492.3:c.2125C>T, NM_000492.3:c.2128A>T, NM_000492.3:c.2175_2176insA, NM_000492.3:c.2052dupA, NM_000492.3:c.2195T>G, NM_000492.3:c.2215delG, NM_000492.3:c.223C>T, NM_000492.3:c.2175dupA, NM_000492.3:c.221G>A, NM_000492.3:c.2930C>T, NM_000492.3:c.3205G>A, NM_000492.3:c.2249C>TCystic fibrosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFTR gene located on chromosomal region 7q31.2. The age of onset of severe form is neonatal or infantile but there are also variants associated with moderate clinical or late onset. This disease is characterized by the production of sweat with a high salt content, mucus secretions with an abnormal viscosity, chronic bronchitis, pancreatic insufficiency, adolescent diabetes and, more rarely, stercoral obstruction and cirrhosis. Male sterility is a constant feature. Late-onset forms, which are usually only mild or monosymptomatic. The prevalence is 1:10,000-9:10,000.250,600
CHST6Macular corneal dystrophyNM_021615.4NM_021615.4:c.820G>T, NM_021615.4:c.853delC, NM_021615.4:c.993G>T, NM_021615.4:c.327_328delCT, NM_021615.4:c.392C>AMacular corneal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CHST6 gene located on chromosomal region 16q22. The age of onset is variable. This disease is characterized by bilateral ill-defined cloudy regions within a hazy stroma, and eventually severe visual impairment. The prevalence is 1:100,000-9:100,000.250,600
CLCN1Myotonia congenita, autosomal recessiveNM_000083.2NM_000083.2:c.1453A>G, NM_000083.2:c.409T>G, NM_000083.2:c.568G>A, NM_000083.2:c.899G>A, NM_000083.2:c.1169G>A, NM_000083.2:c.1238T>G, NM_000083.2:c.871G>A, NM_000083.2:c.180+3A>T, NM_000083.2:c.225dupC, NM_000083.2:c.501C>G, NM_000083.2:c.2680C>TMyotonia congenita (Becker disease) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN1 gene located on chromosomal region 7q35. The age of onset is neonatal/infantile. This disease is characterized by slow muscle relaxation, that it is relieved with exercise, associated with hyperexcitation of the muscle fibres. The prevalence is 1:100,000.250,600
CLCN7Osteopetrosis type 4, autosomal recessiveNM_001287.5NM_001287.5:c.622C>T, NM_001287.5:c.781A>TOsteopetrosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN7 gene located on chromosomal region 16p13. The age of onset is neonatal/infantile. This disease is characterized bone marrow failure, fractures and visual impairment. The incidence is 1:200,000 live births and the prevalence is 1:100,000.600
CLDN14Deafness type 29, autosomal recessiveNM_144492.2NM_144492.2:c.254T>A, NM_144492.2:c.301G>A, NM_144492.2:c.398delTDeafness type 29, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN14 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.600
CLDN19Hypomagnesemia type 5, renal failure with severe ocular abnormalitiesNM_148960.2NM_148960.2:c.269T>C, NM_148960.2:c.425_437delCCCTGGTGACCCA, NM_148960.2:c.59G>A, NM_148960.2:c.169C>G, NM_148960.2:c.599G>AHypomagnesemia type 5, renal failure with severe ocular abnormalities follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN19 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by excessive magnesium and calcium renal wasting, bilateral nephrocalcinosis, progressive renal failure and severe ocular abnormalities. The prevalence is <1:1,000,000.250,600
CLN3Ceroid-lipofuscinoses neuronal type 3NM_001042432.1NM_001042432.1:c.883G>A, NM_001042432.1:c.597C>A, NM_001042432.1:c.622_623insT, NM_001042432.1:c.1272delG, NM_001042432.1:c.1210C>AJuvenile neuronal ceroid lipofuscinosis 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN3 gene located on chromosomal region 16p12.1. The age of onset is infantile. This disease is characterized by onset at early school age with vision loss due to retinopathy, seizures and the decline of mental and motor capacities. The annual birth incidence is 1:217,000-1:450,000 in Sweden and 1:143,000 in Germany, and the prevalence is 1.5:1,000,000-9:1,000,000.600
CLN5Neuronal ceroid lipofuscinosis type 5NM_006493.2NM_006493.2:c.619T>C, NM_006493.2:c.335G>A, NM_006493.2:c.377G>A, NM_006493.2:c.620G>C, NM_006493.2:c.669dupC, NM_006493.2:c.335G>C, NM_006493.2:c.565C>T, NM_006493.2:c.575A>G, NM_006493.2:c.593T>C, NM_006493.2:c.595C>T, NM_006493.2:c.613C>T, NM_006493.2:c.919delA, NM_006493.2:c.924_925delAT, NM_006493.2:c.955_970delGGAAATGAAACATCTG, NM_006493.2:c.835G>A, NM_006493.2:c.526dupA, NM_006493.2:c.1026C>A, NM_006493.2:c.524T>G, NM_006493.2:c.433C>TNeuronal ceroid lipofuscinosis type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN5 gene located on chromosomal region 3q21.1-q32. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy and vision loss through retinal degeneration. The prevalence is <1:1,000,000.600
CLN6Ceroid lipofuscinosis, neuronal, type 6NM_017882.2NM_017882.2:c.200T>C, NM_017882.2:c.214G>C, NM_017882.2:c.139C>T, NM_017882.2:c.307C>T, NM_017882.2:c.214G>T, NM_017882.2:c.663C>GLate infantile neuronal ceroid lipofuscinosis 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN6 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy and vision loss through retinal degeneration. The prevalence is <1:1,000,000.600
CLN8Ceroid lipofuscinosis, neuronal, type 8NM_018941.3NM_018941.3:c.88delG, NM_018941.3:c.789G>C, NM_018941.3:c.610C>T, NM_018941.3:c.88G>CLate infantile neuronal ceroid lipofuscinosis 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN8 gene located on chromosomal region 8p23.3. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy, and vision loss through retinal degeneration. The prevalence is <1:1,000,000.600
CLRN1Retinitis pigmentosa type 61NM_174878.2NM_174878.2:c.92C>TRetinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 61 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1gene located on chromosomal region 3q25.1. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.250,600
CLRN1Usher syndrome type 3ANM_174878.2NM_174878.2:c.591_592insT, NM_174878.2:c.630_631insT, NM_174878.2:c.118T>G, NM_174878.2:c.433+1061A>T, NM_174878.2:c.189C>A, NM_174878.2:c.144T>GUsher syndrome type 3A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1 gene located on chromosomal region 3q25.1. The age of onset is neonatal/infantile. This disease is characterized by the association of sensorineural deafness with retinitis pigmentosa and progressive vision loss. The prevalence is 1:1.000.000- 9/1.000.000.250,600
CNGA1Retinitis pigmentosa type 49NM_000087.3NM_000087.3:c.1747C>T, NM_000087.3:c.1540C>T, NM_000087.3:c.2071T>C, NM_000087.3:c.1927C>T, NM_000087.3:c.1271G>A, NM_000087.3:c.1001G>A, NM_000087.3:c.959C>T, NM_000087.3:c.97_98insA, NM_000087.3:c.449+2T>C, NM_000087.3:c.1972delA, NM_000087.3:c.238G>T, NM_000087.3:c.794G>A, NM_000087.3:c.238G>ARetinitis pigmentosa 49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGA1 gene located on chromosomal region 4p12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.250,600
CNGB1Retinitis pigmentosa tipo 45NM_001297.4NM_001297.4:c.3150delG, NM_001297.4:c.2762_2765delACGA, NM_001297.4:c.2957A>T, NM_001297.4:c.413-1G>A, NM_001297.4:c.218-2A>G, NM_001297.4:c.2492+2T>G, NM_001297.4:c.3462+1G>A, NM_001297.4:c.2653delG, NM_001297.4:c.3425delT, NM_001297.4:c.1122-2A>T, NM_001297.4:c.1958-1G>A, NM_001297.4:c.952C>TRetinitis pigmentosa 45 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB1 gene located on chromosomal region 16q13. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000 to 5:10,000.250,600
CNGB3Achromatopsia type 3NM_019098.4NM_019098.4:c.2011G>T, NM_019098.4:c.1063C>T, NM_019098.4:c.1208G>A, NM_019098.4:c.1672G>T, NM_019098.4:c.819_826delCAGACTCC, NM_019098.4:c.1148delC, NM_019098.4:c.886_890delACTTC, NM_019098.4:c.2048_2049delCA, NM_019098.4:c.446_447insT, NM_019098.4:c.893_897delCAAAA, NM_019098.4:c.887_896delCTTCTACAAAAchromatopsia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is neonatal/Infantile. This disease is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, and reduced or complete loss of color discrimination. Most individuals have complete form, with total lack of function in all three types of cones. Rarely, individuals have incomplete form, with similar, but generally less severe symptoms. The prevalence is 1/30,000-1/50,000.250,600
CNGB3Macular degeneration, juvenileNM_019098.4NM_019098.4:c.1405T>GJuvenile macular degeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is infancy or adolescence. This disease is characterized by blurred or distorted central vision with dark areas. Normally, side vision is not affected, but the perception of color can vary during the later stages of the disease.250,600
COL11A1Stickler syndrome type 2NM_001854.3NM_001854.3:c.1750dupG, NM_001854.3:c.2350G>C, NM_001854.3:c.4606C>G, NM_001854.3:c.4642C>G, NM_001854.3:c.3709-1G>AStickler syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL11A1 gene located on chromosomal region 1p21. The age of onset is neonatal/infantile. Autosomal recessive Stickler syndrome is a rare type of Stickler syndrome manifesting with opthalmological (myopia, retinal detachment and cataracts), orofacial (micrognathia, midface hypoplasia and cleft palate) auditory (sensorineural hearing loss) and articular (epiphyseal dysplasia) symptoms.600
COL17A1Epidermolysis bullosa, junctional, non-Herlitz typeNM_000494.3NM_000494.3:c.1898G>A, NM_000494.3:c.3827_3828insC, NM_000494.3:c.2228-3_2235delCAGGTCCTGCTinsTTG, NM_000494.3:c.1706delC, NM_000494.3:c.2336-2A>G, NM_000494.3:c.3897_3900delATCT, NM_000494.3:c.3908G>A, NM_000494.3:c.2336-1G>T, NM_000494.3:c.2965delA, NM_000494.3:c.3043C>T, NM_000494.3:c.3067C>T, NM_000494.3:c.3277+1G>A, NM_000494.3:c.3676C>T, NM_000494.3:c.4319_4320insC, NM_000494.3:c.433C>T, NM_000494.3:c.520_521delAG, NM_000494.3:c.4003_4004delGG, NM_000494.3:c.2551+1G>T, NM_000494.3:c.3800delC, NM_000494.3:c.2564T>G, NM_000494.3:c.2430_2431insCCGA, NM_000494.3:c.2383C>T, NM_000494.3:c.2944_2947+1delGAAGGEpidermolysis bullosa, junctional, non-Herlitz type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL17A1 gene located on chromosomal region 10q24.3. The age of onset is neonatal/infantile. This disease is characterized by a generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.250,600
COL18A1Knobloch syndrome type 1NM_030582.3NM_030582.3:c.3367_3379delCCCCCAGGCCCAC, NM_030582.3:c.3493_3501delGGCCCCCCA, NM_030582.3:c.2797C>T, NM_030582.3:c.995_996insGACGTGAAAGAGGGG, NM_030582.3:c.3502_3511delGGCCCCCCAG, NM_030582.3:c.3618_3618+1delGG, NM_030582.3:c.994_995insGGACGTGAAAGAGGG, NM_030582.3:c.3517_3518delCC, NM_030582.3:c.1535_1536insGACGTGAAAGAGGGG, NM_030582.3:c.2589_2590delAG, NM_030582.3:c.4054_4055delCT, NM_030582.3:c.4463_4464insGKnobloch syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL18A1 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by vitreoretinal and macular degeneration, and occipital encephalocele. The prevalence is <1:1,000,000.250,600
COL1A2Ehlers-Danlos syndrome, cardiac valvular typeNM_000089.3NM_000089.3:c.3601G>T, NM_000089.3:c.1404+1G>A, NM_000089.3:c.559G>C, NM_000089.3:c.133-1G>A, NM_000089.3:c.1404+1G>C, NM_000089.3:c.240_247delGTATGATG, NM_000089.3:c.293_294insCEhlers-Danlos syndrome, cardiac valvular type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL1A2 gene located on chromosomal region 7q22.1. The age of onset is neonatal/infantile. This disease is characterized by joint hypermobility, skin hyperextensibility and cardiac valvular defects. The prevalence is 6/100,000 to 7/100,000.600
COL2A1Otospondylomegaepiphyseal dysplasiaNM_001844.4NM_001844.4:c.1052delG, NM_001844.4:c.3106C>TOtospondylomegaepiphyseal dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL2A1 gene located on chromosomal region 12q13.11. The age of onset is neonatal/infantile. This disease is characterized by sensorineural hearing loss, enlarged epiphyses, skeletal dysplasia with disproportionately short limbs, vertebral body anomalies and a characteristic facies. The prevalence is 1:7,500-1:9,000.600
COL4A3Alport syndrome 3B, autosomal recessiveNM_000091.4NM_000091.4:c.345delG, NM_000091.4:c.346C>A, NM_000091.4:c.898G>A, NM_000091.4:c.4421T>C, NM_000091.4:c.2110delC, NM_000091.4:c.343delG, NM_000091.4:c.4420_4424delCTTTT, NM_000091.4:c.5002_*6delAAAAGACACTGAAGCTAA, NM_000091.4:c.2083G>A, NM_000091.4:c.2954G>T, NM_000091.4:c.4484A>G, NM_000091.4:c.4571C>G, NM_000091.4:c.4441C>TAlport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.250,600
COL4A4Alport syndrome, autosomal recessiveNM_000092.4NM_000092.4:c.3713C>A, NM_000092.4:c.4129C>T, NM_000092.4:c.4923C>A, NM_000092.4:c.3601G>A, NM_000092.4:c.2312delG, NM_000092.4:c.71+1G>AAlport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.250,600
COL7A1Epidermolysis bullosa dystrophica, Hallopeau-Siemens typeNM_000094.3NM_000094.3:c.4039G>C, NM_000094.3:c.425A>G, NM_000094.3:c.336C>G, NM_000094.3:c.3809C>T, NM_000094.3:c.4119+1G>T, NM_000094.3:c.6205C>T, NM_000094.3:c.6527_6528insC, NM_000094.3:c.6573+1G>T, NM_000094.3:c.6187C>T, NM_000094.3:c.6752G>A, NM_000094.3:c.6859G>A, NM_000094.3:c.6946G>A, NM_000094.3:c.6670G>T, NM_000094.3:c.1907G>T, NM_000094.3:c.2471_2472insG, NM_000094.3:c.7440+4delC, NM_000094.3:c.7912G>T, NM_000094.3:c.7930-1G>C, NM_000094.3:c.7957G>A, NM_000094.3:c.8245G>A, NM_000094.3:c.8371C>T, NM_000094.3:c.8393T>A, NM_000094.3:c.8440C>T, NM_000094.3:c.8479C>T, NM_000094.3:c.8524_8527+10delGAAGGTGAGGACAG, NM_000094.3:c.887delG, NM_000094.3:c.933C>A, NM_000094.3:c.238G>T, NM_000094.3:c.3831+1G>T, NM_000094.3:c.4373C>T, NM_000094.3:c.6091G>A, NM_000094.3:c.4888C>T, NM_000094.3:c.5052+1G>A, NM_000094.3:c.5096C>T, NM_000094.3:c.4783G>C, NM_000094.3:c.5443G>C, NM_000094.3:c.5532+1G>A, NM_000094.3:c.5821-1G>A, NM_000094.3:c.5287C>T, NM_000094.3:c.706C>T, NM_000094.3:c.7345-1G>A, NM_000094.3:c.592G>A, NM_000094.3:c.7411C>TEpidermolysis bullosa dystrophica, Hallopeau-Siemens type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL7A1 gene located on chromosomal region 3p21.1. The age of onset is neonatal/infantile. This disease is characterized by generalized cutaneous and mucosal blistering and scarring associated with severe deformities and major extracutaneous involvement. The prevalence is <1:1,000,000.250,600
COL9A1Stickler syndrome type 4NM_001851.4NM_001851.4:c.883C>T, NM_001851.4:c.706C>TStickler syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL9A1 gene located on chromosomal region 6q13. The age of onset is infantile. This disease is characterized by opthalmological (myopia, retinal detachment and cataracts), orofacial (micrognathia, midface hypoplasia and cleft palate) auditory (sensorineural hearing loss) and articular (epiphyseal dysplasia) symptoms. The prevalence is <1:1,000,000.600
COL9A2Stickler syndrome type 5NM_001852.3NM_001852.3:c.1918C>T, NM_001852.3:c.1097_1098insC, NM_001852.3:c.793-1G>CStickler syndrome type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL9A2 gene located on chromosomal region 1p33-p32. The age of onset is infantile. This disease is characterized by opthalmological (myopia, retinal detachment and cataracts), orofacial (micrognathia, midface hypoplasia and cleft palate) auditory (sensorineural hearing loss) and articular (epiphyseal dysplasia) symptoms. The prevalence is <1:1,000,000.600
COQ2Primary coenzyme Q10 deficiency type 1NM_015697.7NM_015697.7:c.683A>G, NM_015697.7:c.1197delT, NM_015697.7:c.590G>A, NM_015697.7:c.723delT, NM_015697.7:c.890A>GCoenzyme Q10 deficiency, primary follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ2 gene located on chromosomal region 4q21.23. The age of onset is neonatal/infantile. The phenotypes include an encephalomyopathic form with seizures and ataxia; a multisystem infantile form with encephalopathy, cardiomyopathy and renal failure; a predominantly cerebellar form with ataxia and cerebellar atrophy; Leigh syndrome with growth retardation; and an isolated myopathic form.250,600
CPS1Carbamoylphosphate synthetase type 1 deficiencyNM_001875.4NM_001875.4:c.1912C>T, NM_001875.4:c.697C>T, NM_001875.4:c.1631C>T, NM_001875.4:c.3556delACarbamoylphosphate synthetase deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPS1 gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by congenital hyperammonemia and defective citrulline synthesis. The prevalence is 1:800,000 newborn in Japan.600
CPT1ACarnitine palmitoyltransferase type 1A deficiencyNM_001876.3NM_001876.3:c.1216C>T, NM_001876.3:c.1241C>T, NM_001876.3:c.1361A>G, NM_001876.3:c.222C>A, NM_001876.3:c.1079A>G, NM_001876.3:c.1436C>T, NM_001876.3:c.1493A>G, NM_001876.3:c.335_336delCC, NM_001876.3:c.1393G>T, NM_001876.3:c.281+1G>A, NM_001876.3:c.1538C>T, NM_001876.3:c.298C>TCarnitine palmitoyl transferase 1A deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT1A gene located on chromosomal region 11q13.2. The age of onset is neonatal/infantile. This disease is characterized by recurrent attacks of fasting-induced hypoketotic hypoglycemia and risk of liver failure. The prevalence is 1.3:1,000 newborn.600
CPT2Carnitine palmitoyltransferase deficiency, type 2NM_000098.2NM_000098.2:c.1239_1240delGA, NM_000098.2:c.1369A>T, NM_000098.2:c.1237C>T, NM_000098.2:c.680C>T, NM_000098.2:c.1437C>G, NM_000098.2:c.149C>A, NM_000098.2:c.1784delC, NM_000098.2:c.886C>T, NM_000098.2:c.1763C>G, NM_000098.2:c.359A>G, NM_000098.2:c.370C>T, NM_000098.2:c.1883A>C, NM_000098.2:c.1891C>T, NM_000098.2:c.1148T>A, NM_000098.2:c.638A>G, NM_000098.2:c.725_726delAC, NM_000098.2:c.452G>A, NM_000098.2:c.338C>T, NM_000098.2:c.481C>T, NM_000098.2:c.464dupT, NM_000098.2:c.520G>ACarnitine palmitoyl transferase type 2 deficiency, infantile form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT2 gene located on chromosomal region 1p32. The age of onset is neonatal/infantile. This disease is characterized by a severe fasting intolerance leading to metabolic derangements of hypoketotic hypoglycemia, resulting in coma and seizures, and hepatic encephalopathy leading to liver failure. The prevalence is <1:1,000,000.250,600
CRB1Leber congenital amaurosis type 8NM_201253.2NM_201253.2:c.3299T>G, NM_201253.2:c.3383delT, NM_201253.2:c.3419T>A, NM_201253.2:c.3094G>A, NM_201253.2:c.936T>G, NM_201253.2:c.493_501delGATGGAATT, NM_201253.2:c.3997G>T, NM_201253.2:c.498_506delAATTGATGG, NM_201253.2:c.2688T>A, NM_201253.2:c.613_619delATAGGAA, NM_201253.2:c.2401A>T, NM_201253.2:c.610_616delGAAATAGLeber congenital amaurosis follows an autosomal recessive pattern of inheritance. Type 8 is caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. The age of onset is neonatal/infancy. This disease comprises a group of early-onset childhood retinal dystrophies characterized by vision loss, nystagmus, and severe retinal dysfunction. Patients usually present at birth with profound vision loss and pendular nystagmus. Electroretinogram responses are usually nonrecordable. Other clinical findings may include high hypermetropia, photodysphoria, oculodigital sign, keratoconus, cataracts, and a variable appearance to the fundus.250,600
CRB1Pigmented paravenous chorioretinal atrophyNM_201253.2NM_201253.2:c.484G>APigmented paravenous chorioretinal atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRB1 gene located on chromosomal region 19p12. The age of onset is variable. This disease is characterized by an unusual retinal degeneration characterized by accumulation of pigmentation along retinal veins.250,600
CRB1Retinitis pigmentosa type 12NM_201253.2NM_201253.2:c.3053_3054insTTATA, NM_201253.2:c.3122T>C, NM_201253.2:c.2416G>T, NM_201253.2:c.2843G>A, NM_201253.2:c.3299T>C, NM_201253.2:c.2983G>T, NM_201253.2:c.2290C>TRetinitis pigmentosa 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.250,600
CRLF1Cold-induced sweating syndromeNM_004750.4NM_004750.4:c.538C>T, NM_004750.4:c.303delC, NM_004750.4:c.413C>T, NM_004750.4:c.527+5G>A, NM_004750.4:c.226T>G, NM_004750.4:c.829C>T, NM_004750.4:c.397+1G>A, NM_004750.4:c.708_709delCCinsT, NM_004750.4:c.713_714insC, NM_004750.4:c.1125delG, NM_004750.4:c.676dupA, NM_004750.4:c.856-1G>A, NM_004750.4:c.852G>T, NM_004750.4:c.935G>A, NM_004750.4:c.1137C>G, NM_004750.4:c.845_846delTGCold-induced sweating syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRLF1 gene located on chromosomal region 19p12. The age of onset is infantile. This disease is characterized by profuse sweating (involving the chest, face, arms and trunk) induced by cold ambient temperature kyphoscoliosis, a high-arched palate, depressed nasal bridge and impaired peripheral sensitivity to pain and temperature. The prevalence is <1:1,000,000.600
CRTAPOsteogenesis imperfecta type 7NM_006371.4NM_006371.4:c.826C>T, NM_006371.4:c.180G>A, NM_006371.4:c.561T>G, NM_006371.4:c.634C>TOsteogenesis imperfecta type VII follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRTAP gene located on chromosomal region 3p22.3. The age of onset is variable. This disease is characterized by increased bone fragility, low bone mass, and susceptibility to bone fractures with variable severity. The prevalence is 6:100,000-7:100,000.600
CRXLeber congenital amaurosis type 7NM_000554.4NM_000554.4:c.425A>G, NM_000554.4:c.196G>A, NM_000554.4:c.898T>CLeber congenital amaurosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRX gene located on chromosomal region 19q13.3. The age of onset is neonatal/infantile. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. The prevalence is 2:100,000-3:100,000 newborn.250,600
CSTBProgressive myoclonic epilepsy type 1ANM_000100.3NM_000100.3:c.212A>C, NM_000100.3:c.202C>TProgressive myoclonic epilepsy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CSTB gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by severe, stimulus-sensitive myoclonus and tonic-clonic seizures. The onset, occurring between 6 and 13 years of age, is characterized by convulsions. Myoclonus begins 1 to 5 years later. The twitchings occur predominantly in the proximal muscles of the extremities and are bilaterally symmetrical, although asynchronous. At first small, they become late in the clinical course so violent that the victim is thrown to the floor. Mental deterioration and eventually dementia develop. The prevalence is 1:20,000 newborn.600
CTNSCystinosis, ocular nonnephropathicNM_004937.2NM_004937.2:c.589G>A, NM_004937.2:c.853-3C>GOcular non nephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. It presents typical ocular findings of nephropathic cystinosis. However, systemic manifestations are absent and kidney disease does not occur. The prevalence is 1:100,000-1:200,000.250,600
CTNSNephropathic cystinosisNM_004937.2NM_004937.2:c.416C>T, NM_004937.2:c.414G>A, NM_004937.2:c.124G>A, NM_004937.2:c.357_360delCAGC, NM_004937.2:c.397_398delAT, NM_004937.2:c.1015G>A, NM_004937.2:c.646dupA, NM_004937.2:c.283G>T, NM_004937.2:c.329G>T, NM_004937.2:c.506G>ANephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. This disease is characterized by hypothyroidism, insulin-dependent diabetes, hepatosplenomegaly with portal hypertension, and muscle, cerebral and ocular involvement, caused by cystine deposits in various organs. The prevalence is 1:100,000-1:200,000.250,600
CTSDCeroid lipofuscinosis, neuronal, type 10NM_001909.4NM_001909.4:c.685T>A, NM_001909.4:c.1149G>CNeuronal ceroid lipofuscinosis type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSD gene located on chromosomal region 11p15.5. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 2:100,000-4:100,000 newborn.600
CTSKPycnodysostosisNM_000396.3NM_000396.3:c.236G>A, NM_000396.3:c.154A>T, NM_000396.3:c.436G>C, NM_000396.3:c.926T>C, NM_000396.3:c.721C>TPycnodysostosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSK gene located on chromosomal region 1q21. The age of onset is variable. This disease is characterized by osteosclerosis, short stature or dwarfism, acroosteolysis of the distal phalanges, fragile bones associated with spontaneous fractures and dysplasia of the clavicles. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
CYP21A2Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency-hybrid 5'CYP21A1P/3'CYP21A2, hybrid 5'CYP21A2/3'CYP21A1P (Detection by MLPA)Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP21A2 gene located on chromosomal region 6p21.3. The age of onset is neonatal/infantile. This disease is characterized by simple virilizing or salt wasting forms that can manifest with genital ambiguity in females, and in both sexes with adrenal insufficiency with dehydration during the neonatal period, life threatening hypoglycemia and hyperandrogenia. The prevalence is 1/100,000 to 9/100,000.600
CYP21A2Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiencyNM_000500.7NM_000500.7:c.518T>A, NM_000500.7:c.955C>T, NM_000500.7:c.1069C>T, NM_000500.7:c.719T>A, NM_000500.7:c.[713T>A;719T>A], NM_000500.7:c.293-13A/C>G, NM_000500.7:c.332_339del, NM_000500.7:c.[710T>A;719T>A], NM_000500.7:c.923_924insT, NM_000500.7:c.[710T>A;713T>A], NM_000500.7:c.713T>A, NM_000500.7:c.[710T>A;713T>A;719T>A], NM_000500.7:c.710T>A (Detection by minisequencing)Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP21A2 gene located on chromosomal region 6p21.3. The age of onset is neonatal/infantile. This disease is characterized by simple virilizing or salt wasting forms that can manifest with genital ambiguity in females, and in both sexes with adrenal insufficiency with dehydration during the neonatal period, life threatening hypoglycemia and hyperandrogenia. The prevalence is 1/100,000 to 9/100,000.600
CYP21A2Non-classic congenital adrenal hyperplasia due to 21-hydroxylase deficiencyNM_000500.7NM_000500.7:c.92C>T, NM_000500.7:c.844G>T, NM_000500.7:c.1360C>T (Detection by minisequencing)Nonclassic congenital adrenal hyperplasia due to 21-hydroxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP21A2 gene located on chromosomal region 6p21.3. This is a common milder form of congenital adrenal hyperplasia characterized by a later onset of androgen excess symptoms seen in females and precocious pseudopuberty in both sexes. Cortisol and aldosterone levels are normal but there is an increased amount of androgens. Disease onset occurs in adolescence with variable degrees of postnatal androgen excess (precocious pubarche, hirsutism, acne, alopecia, anovulation and menstrual irregularies and in the post-pubertal period it can mimic polycystic ovary syndrome. It is also sometimes asymptomatic. The prevalence ranges from 1/1,000-1/500 in the general Caucasian population, but up to 1-2% among inbred populations, such as Eastern European (Ashkenazi) Jews.600
CYP4V2Bietti crystalline corneoretinal dystrophyNM_207352.3NM_207352.3:c.1523G>A, NM_207352.3:c.130T>A, NM_207352.3:c.327+1G>A, NM_207352.3:c.332T>CBietti crystalline corneoretinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP4V2 gene located on chromosomal region 4q35.2. The age of onset is adult. This disease is characterized by nightblindness, decreased vision, paracentral scotoma, and, in the end stages of the disease, legal blindness.250,600
CYP7B1Congenital bile acid synthesis defect type 3NM_004820.3NM_004820.3:c.1162C>TCongenital bile acid synthesis defect type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by severe neonatal cholestatic liver disease. The prevalence is below 1,000,000.250,600
CYP7B1Spastic paraplegia type 5A, autosomal recessiveNM_004820.3NM_004820.3:c.1460_1461insT, NM_004820.3:c.321_324delACAA, NM_004820.3:c.825T>A, NM_004820.3:c.889A>G, NM_004820.3:c.1456C>T, NM_004820.3:c.187C>TAutosomal recessive spastic paraplegia type 5A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. The prevalence is below 1,000,000.250,600
D2HGDHD-2-Hydroxyglutaric aciduriaNM_152783.4NM_152783.4:c.1315A>G, NM_152783.4:c.1276G>A, NM_152783.4:c.440T>G, NM_152783.4:c.1333_1334delAC, NM_152783.4:c.1123G>T, NM_152783.4:c.1331T>CD-2-Hydroxyglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the D2HGDH gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by extremely variable clinical manifestations, with severe cases characterized by neonatal or early infantile-onset epileptic encephalopathy, and marked hypotonia, and cerebral visual failure, developmental delay, seizures, involuntary movements, and cardiomyopathy are also common in these cases. The prevalence is below 1,000,000.250,600
DBTMaple syrup urine disease type 2NM_001918.3NM_001918.3:c.670G>T, NM_001918.3:c.827T>G, NM_001918.3:c.294C>G, NM_001918.3:c.581C>G, NM_001918.3:c.772+1G>A, NM_001918.3:c.272_275delCAGT, NM_001918.3:c.1281+1G>A, NM_001918.3:c.871C>T, NM_001918.3:c.901C>T, NM_001918.3:c.939G>C, NM_001918.3:c.126T>GMaple syrup urine disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DBT gene located on chromosomal region 1p31. The age of onset is neonatal/infantile. This disease is characterized by a maple syrup odor in the cerumen at birth, poor feeding, lethargy and focal dystonia, followed by progressive encephalopathy and central respiratory failure if untreated. The prevalence is 1/10,000 to 5/10,000.250,600
DCLRE1COmenn syndromeNM_001033855.2NM_001033855.2:c.2T>COmenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency.250,600
DCLRE1CSevere combined immunodeficiency due to DCLRE1C deficiencyNM_001033855.2NM_001033855.2:c.1558_1559insA, NM_001033855.2:c.597C>A, NM_001033855.2:c.780+1delG, NM_001033855.2:c.1639G>T, NM_001033855.2:c.1903_1904insA, NM_001033855.2:c.457G>A, NM_001033855.2:c.1559_1560insASevere combined immunodeficiency due to DCLRE1C deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DCLRE1C gene located on chromosomal region 10p13. The age of onset is neonatal/infantile. This disease is characterized by severe and recurrent infections, diarrhea, failure to thrive, and cell sensitivity to ionizing radiation. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
DDB2Xeroderma pigmentosum complementation group ENM_000107.2NM_000107.2:c.730A>G, NM_000107.2:c.937C>T, NM_000107.2:c.818G>A, NM_000107.2:c.919G>TXeroderma pigmentosum complementation group E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DDB2 gene located on chromosomal region 11p12-p11. The age of onset is variable. This disease is characterized by mild xeroderma pigmentosum symptoms and no neurological abnormalities. The prevalence is 1/1,000,000.600
DDCAromatic L-amino acid decarboxylase deficiencyNM_000790.3NM_000790.3:c.100delG, NM_000790.3:c.1040G>A, NM_000790.3:c.823G>A, NM_000790.3:c.304G>A, NM_000790.3:c.272C>T, NM_000790.3:c.749C>TAromatic L-amino acid decarboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DDC gene located on chromosomal region 7p12.2. The age of onset is neonatal/infantile. This disease is characterized by severe developmental delay, weak muscle tone (hypotonia), muscle stiffness, difficulty moving, and involuntary writhing movements of the limbs (athetosis). The prevalence is below 1,000,000.600
DFNB31Deafness type 31, autosomal recessiveNM_015404.3NM_015404.3:c.1135C>T, NM_015404.3:c.817C>TDeafness, autosomal recessive type 31 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DFNB31 gene located on chromosomal region 9q32. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. 250,600
DFNB59Deafness type 59, autosomal recessiveNM_001042702.3NM_001042702.3:c.122delA, NM_001042702.3:c.420delT, NM_001042702.3:c.113dupT, NM_001042702.3:c.988delG, NM_001042702.3:c.726delT, NM_001042702.3:c.161C>T, NM_001042702.3:c.817_818insTAutosomal recessive nonsyndromic sensorineural deafness type DFNB59 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DFNB59 gene located on chromosomal region 2q31.2. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.600
DGUOKMitochondrial DNA depletion syndrome type 3NM_080916.2NM_080916.2:c.137A>G, NM_080916.2:c.707+2T>G, NM_080916.2:c.763G>T, NM_080916.2:c.425G>A, NM_080916.2:c.313C>T, NM_080916.2:c.494A>TMitochondrial DNA depletion syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DGUOK gene located on chromosomal region 2p13. The age of onset is neonatal/infantile. This disease is characterized by progressive liver failure, hypoglycemia and neurologic abnormalities including hypotonia, encephalopathy and peripheral neuropathy250,600
DHCR7Smith-Lemli-Opitz syndromeNM_001360.2NM_001360.2:c.1055G>A, NM_001360.2:c.1210C>T, NM_001360.2:c.1054C>T, NM_001360.2:c.461C>G, NM_001360.2:c.151C>T, NM_001360.2:c.1031G>A, NM_001360.2:c.453G>A, NM_001360.2:c.506C>T, NM_001360.2:c.356A>T, NM_001360.2:c.1228G>A, NM_001360.2:c.1A>G, NM_001360.2:c.976G>T, NM_001360.2:c.964-1G>C, NM_001360.2:c.682C>T, NM_001360.2:c.452G>A, NM_001360.2:c.1337G>A, NM_001360.2:c.1342G>A, NM_001360.2:c.730G>A, NM_001360.2:c.292C>T, NM_001360.2:c.904T>C, NM_001360.2:c.907G>A, NM_001360.2:c.841G>A, NM_001360.2:c.744G>T, NM_001360.2:c.724C>T, NM_001360.2:c.725G>A, NM_001360.2:c.866C>T, NM_001360.2:c.278C>T, NM_001360.2:c.839A>G, NM_001360.2:c.832-1G>CSmith-Lemli-Opitz syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHCR7 gene located on chromosomal region 11q13.4. The age of onset is neonatal/infantile. This disease is characterized by multiple congenital anomalies, intellectual deficit, and behavioral problems. The prevalence is 1/20,000 to 1/40,000 newborn.250,600
DHDDSRetinitis pigmentosa type 59NM_024887.3NM_024887.3:c.328delA, NM_024887.3:c.998C>G, NM_024887.3:c.124A>GRetinitis pigmentosa type 59 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHDDS gene located on chromosomal region 1p36.11. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000.600
DKC1Dyskeratosis congenita, X-linkedNM_001363.4NM_001363.4:c.91C>A, NM_001363.4:c.214_215delCTinsTA, NM_001363.4:c.194G>C, NM_001363.4:c.838A>C, NM_001363.4:c.91C>G, NM_001363.4:c.196A>GDyskeratosis congenital, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DKC1 gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by the mucocutaneous triad of abnormal skin pigmentation, nail dystrophy and mucosal leucoplakia. The prevalence is 1-9/1,000,000.600
DKC1Hoyeraal-Hreidarsson syndromeNM_001363.4NM_001363.4:c.200C>T, NM_001363.4:c.204C>AHoyeraal-Hreidarsson syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DKC1 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by intrauterine growth retardation, microcephaly, cerebellar hypoplasia, progressive combined immune deficiency and aplastic anemia. The prevalence is below 1/1,000,000.600
DLDDihydrolipoamide dehydrogenase deficiency E3NM_000108.4NM_000108.4:c.916_926delTGTGATGTACT, NM_000108.4:c.105_106insA, NM_000108.4:c.1483A>GDihydrolipoamide dehydrogenase deficiency E3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DLD gene located on chromosomal region 7q31-q32. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting and a maple syrup odor in the cerumen (and later in urine) noted soon after birth, followed by progressive encephalopathy and central respiratory failure if untreated. The prevalence is 1/1,000,000 to 9/1,000,000.600
DLL3Spondylocostal dysostosis type 1NM_016941.3NM_016941.3:c.231C>A, NM_016941.3:c.712C>TSpondylocostal dysostosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DLL3 gene located on chromosomal region 19q13. The age of onset is neonatal/infantile. This disease is associated with vertebral and rib segmentation defects and characterised by a short neck with limited mobility, winged scapulae, a short trunk, and short stature with multiple vertebral anomalies at all levels of the spine. The prevalence is below 1/1,000,000.600
DMDBecker muscular dystrophyNM_004006.2NM_004006.2:c.3432+3A>G, NM_004006.2:c.3432+1G>A, NM_004006.2:c.137A>TBecker muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/18,000 to 1/31,000 male newborns and the prevalence is 1/10,000 to 5/10,000.600
DMDBecker muscular dystrophy-insBecker, delBecker (Detection by MLPA)Becker muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/18,000 to 1/31,000 male newborns and the prevalence is 1/10,000 to 5/10,000.600
DMDDilated cardiomyopathy type 3BNM_004006.2NM_004006.2:c.5922+3G>CDilated cardiomyopathy type 3B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is variable. This disease is characterized by ventricular dilatation and impaired systolic function. Patients with DCM suffer from heart failure, arrhythmia, and are at risk of premature death. The incidence is 1/3,300 male newborns and the prevalence is 1/16,000 to 1/125,000.600
DMDDuchenne muscular dystrophyNM_004006.2NM_004006.2:c.1261C>T, NM_004006.2:c.1286C>A, NM_004006.2:c.1070delC, NM_004006.2:c.10086+1G>A, NM_004006.2:c.1886C>A, NM_004006.2:c.1900A>T, NM_004006.2:c.10774delA, NM_004006.2:c.204dupC, NM_004006.2:c.1900_1903dupAAGT, NM_004006.2:c.10141C>T, NM_004006.2:c.10033C>T, NM_004006.2:c.10453_10454delCT, NM_004006.2:c.1012G>T, NM_004006.2:c.1048G>T, NM_004006.2:c.2302C>T, NM_004006.2:c.1734delA, NM_004006.2:c.2380+1G>C, NM_004006.2:c.2380+2T>C, NM_004006.2:c.2479delG, NM_004006.2:c.2482T>G, NM_004006.2:c.2484T>G, NM_004006.2:c.251delT, NM_004006.2:c.2523delA, NM_004006.2:c.10446_10447delCT, NM_004006.2:c.2650C>T, NM_004006.2:c.10454delT, NM_004006.2:c.2294_2297delCCAT, NM_004006.2:c.2803+1G>A, NM_004006.2:c.2803+1G>T, NM_004006.2:c.2804-1G>A, NM_004006.2:c.2804-2A>T, NM_004006.2:c.2815_2816delTT, NM_004006.2:c.1306dupG, NM_004006.2:c.1332-9A>G, NM_004006.2:c.133C>T, NM_004006.2:c.1341_1342dupAG, NM_004006.2:c.2547delT, NM_004006.2:c.1371delG, NM_004006.2:c.2755A>T, NM_004006.2:c.2758C>T, NM_004006.2:c.1529_1530delTC, NM_004006.2:c.160_162delCTC, NM_004006.2:c.3295C>T, NM_004006.2:c.6182delC, NM_004006.2:c.6226G>T, NM_004006.2:c.3639dupA, NM_004006.2:c.199G>T, NM_004006.2:c.3747delG, NM_004006.2:c.2125delC, NM_004006.2:c.137_138dupAT, NM_004006.2:c.4117C>T, NM_004006.2:c.412_413delAA, NM_004006.2:c.2281_2285delGAAAA, NM_004006.2:c.4375C>T, NM_004006.2:c.4405C>T, NM_004006.2:c.2332C>T, NM_004006.2:c.4471_4472delAA, NM_004006.2:c.4486delG, NM_004006.2:c.4500delA, NM_004006.2:c.4518+5G>A, NM_004006.2:c.4735G>T, NM_004006.2:c.4806A>T, NM_004006.2:c.4843A>T, NM_004006.2:c.489G>A, NM_004006.2:c.5287C>T, NM_004006.2:c.530+1delG, NM_004006.2:c.5313dupT, NM_004006.2:c.5353C>T, NM_004006.2:c.5363C>G, NM_004006.2:c.5530C>T, NM_004006.2:c.5554C>T, NM_004006.2:c.5570_5571dupAA, NM_004006.2:c.5640T>A, NM_004006.2:c.5671A>T, NM_004006.2:c.5697delA, NM_004006.2:c.5773G>T, NM_004006.2:c.5807T>A, NM_004006.2:c.583C>T, NM_004006.2:c.8944C>T, NM_004006.2:c.1489C>T, NM_004006.2:c.6000T>A, NM_004006.2:c.6014_6017delCTCA, NM_004006.2:c.615T>A, NM_004006.2:c.9346C>T, NM_004006.2:c.9361+1G>A, NM_004006.2:c.6238delC, NM_004006.2:c.3697delC, NM_004006.2:c.6292C>T, NM_004006.2:c.3779_3785delCTTTGGAinsGG, NM_004006.2:c.4071G>C, NM_004006.2:c.6391_6392delCA, NM_004006.2:c.6392_6393insCA, NM_004006.2:c.433C>T, NM_004006.2:c.676_678delAAG, NM_004006.2:c.6834delT, NM_004006.2:c.4409_4412dupGTCT, NM_004006.2:c.6936delA, NM_004006.2:c.6943G>T, NM_004006.2:c.6964delG, NM_004006.2:c.6982A>T, NM_004006.2:c.6986dupA, NM_004006.2:c.7682G>A, NM_004006.2:c.7683G>A, NM_004006.2:c.7764dupT, NM_004006.2:c.7771G>T, NM_004006.2:c.7894C>T, NM_004006.2:c.7922delA, NM_004006.2:c.8064_8065delTA, NM_004006.2:c.8069T>G, NM_004006.2:c.8086delC, NM_004006.2:c.8358G>A, NM_004006.2:c.8374_8375delAA, NM_004006.2:c.8443C>T, NM_004006.2:c.8464C>T, NM_004006.2:c.8608C>T, NM_004006.2:c.8652_8653delCT, NM_004006.2:c.8656C>T, NM_004006.2:c.8668G>A, NM_004006.2:c.8713C>T, NM_004006.2:c.3121C>T, NM_004006.2:c.9164-1G>C, NM_004006.2:c.9164-1G>T, NM_004006.2:c.9337C>T, NM_004006.2:c.6906G>A, NM_004006.2:c.9361+1G>C, NM_004006.2:c.9380C>G, NM_004006.2:c.9564-1G>A, NM_004006.2:c.9568C>T, NM_004006.2:c.9612_9613ins341, NM_004006.2:c.9650-2A>G, NM_004006.2:c.9767dupG, NM_004006.2:c.9851G>A, NM_004006.2:c.9854_9863delTGAGACTGGA, NM_004006.2:c.9862G>T, NM_004006.2:c.3276+1G>A, NM_004006.2:c.2866C>T, NM_004006.2:c.2929dupC, NM_004006.2:c.3022A>T, NM_004006.2:c.2816T>A, NM_004006.2:c.3087G>A, NM_004006.2:c.5899C>T, NM_004006.2:c.3124A>T, NM_004006.2:c.3076G>T, NM_004006.2:c.6373C>T, NM_004006.2:c.627delA, NM_004006.2:c.2137C>T, NM_004006.2:c.3246_3247insTTTCTAAAAA, NM_004006.2:c.220delC, NM_004006.2:c.2169-3_2169-1delinsAA, NM_004006.2:c.6340A>T, NM_004006.2:c.6763-2A>GDuchenne muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/3,300 male newborns and the prevalence is 1/16,000 to 1/125,000.600
DMDDuchenne muscular dystrophy-insDuchenne, delDuchenne (Detection by MLPA)Duchenne muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/3,300 male newborns and the prevalence is 1/16,000 to 1/125,000.600
DMP1Hypophosphatemic rickets type 1, autosomal recessiveNM_004407.3NM_004407.3:c.1A>G, NM_004407.3:c.55-1G>C, NM_004407.3:c.31delT, NM_004407.3:c.362delCHypophosphatemic rickets type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DMP1 gene located on chromosomal region 4q21. The age of onset is variable. This disease is associated with vertebral and rib segmentation defects and characterised by hypophosphatemia, rickets and/or osteomalacia and slow growth. The prevalence is below 1/20,000 newborns.600
DNAJC19Dilated cardiomyopathy with ataxiaNM_145261.3NM_145261.3:c.300delADilated cardiomyopathy with ataxia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DNAJC19 gene located on chromosomal region 3q26.33. The age of onset is infantile. This disease is characterised by severe early onset (before the age of three years) dilated cardiomyopathy with conduction defects (long QT syndrome), non-progressive cerebellar ataxia, testicular dysgenesis, and 3-methylglutaconic aciduria.600
DPAGT1Congenital disorder of glycosylation type 1jNM_001382.3NM_001382.3:c.791T>G, NM_001382.3:c.358C>A, NM_001382.3:c.643+1G>A, NM_001382.3:c.902G>A, NM_001382.3:c.349G>A, NM_001382.3:c.980_981delCTCongenital disorder of glycosylation type 1j follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPAGT1 gene located on chromosomal region 11q23.3. The age of onset is neonatal/infantile. This disease is characterised by severe psychomotor delay, seizures, hypotonia and dysmorphism (microcephaly, ocular exotropia, micrognathia and clinodactyly). The prevalence is below 1,000,000.600
DPM1Congenital disorders of glycosylation type 1eNM_003859.1NM_003859.1:c.564-1G>A, NM_003859.1:c.628delC, NM_003859.1:c.274C>G, NM_003859.1:c.679-1G>T, NM_003859.1:c.742T>CCongenital disorder of glycosylation type 1e follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPM1 gene located on chromosomal region 20q13.13. The age of onset is neonatal/infantile. This disease is characterised by psychomotor delay, seizures, hypotonia, facial dysmorphism and microcephaly. The prevalence is below 1,000,000.600
DPYDDihydropyrimidine dehydrogenase deficiencyNM_000110.3NM_000110.3:c.775A>G, NM_000110.3:c.1679T>G, NM_000110.3:c.299_302delTCAT, NM_000110.3:c.703C>T, NM_000110.3:c.1109_1110delTA, NM_000110.3:c.1905+1G>A, NM_000110.3:c.257C>TDihydropyrimidine dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPYD gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterised by mental and motor retardation and convulsions.250,600
DSPCardiomyopathy, arrhythmogenicNM_004415.2NM_004415.2:c.7000C>T, NM_004415.2:c.88G>A, NM_004415.2:c.6370_6371delCT, NM_004415.2:c.7180_7181delAG, NM_004415.2:c.643G>A, NM_004415.2:c.3098delA, NM_004415.2:c.8188C>TCardiomyopathy, arrhythmogenic follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is a heart condition in which the heart muscle fibers are gradually replaced by fibrous or fibro-fatty tissue, causing abnormal heart electrical rhythms and heart failure. Consequently pumping blood to the body is weakened and sometimes leads to sudden cardiac death. The prevalence is below 1,000,000.250,600
DSPCardiomyopathy, dilated, with woolly hair and keratodermaNM_004415.2NM_004415.2:c.5513G>ACardiomyopathy, dilated, with woolly hair and keratoderma follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterized by a generalized striate keratoderma particularly affecting the palmoplantar epidermis, woolly hair, and dilated left ventricular cardiomyopathy. The prevalence is below 1,000,000.250,600
DSPLethal acantholytic epidermolysis bullosaNM_004415.2NM_004415.2:c.5800C>TLethal acantholytic epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterised by generalized oozing erosions, usually in the absence of blisters. The prevalence is below 1,000,000.250,600
DYSFDysferlinopathyNM_003494.3NM_003494.3:c.1398-2A>G, NM_003494.3:c.1392dupA, NM_003494.3:c.1398-1G>A, NM_003494.3:c.5266C>T, NM_003494.3:c.1620delA, NM_003494.3:c.1481-1G>A, NM_003494.3:c.3041A>G, NM_003494.3:c.3985C>G, NM_003494.3:c.4090C>T, NM_003494.3:c.5713C>T, NM_003494.3:c.1053+1G>A, NM_003494.3:c.200_201delTGinsAT, NM_003494.3:c.2869C>T, NM_003494.3:c.2870_2874delAGACC, NM_003494.3:c.458-390C>T, NM_003494.3:c.757C>T, NM_003494.3:c.3065G>A, NM_003494.3:c.393_394delCC, NM_003494.3:c.3859A>T, NM_003494.3:c.5429G>A, NM_003494.3:c.3130C>T, NM_003494.3:c.3444_3445delTGinsAA, NM_003494.3:c.1638+2T>A, NM_003494.3:c.4108_4109delGT, NM_003494.3:c.3641delC, NM_003494.3:c.1368C>A, NM_003494.3:c.4872_4876delGCCCGinsCCCC, NM_003494.3:c.5341-2A>C, NM_003494.3:c.509C>A, NM_003494.3:c.5836_5839delCAGC, NM_003494.3:c.5644C>T, NM_003494.3:c.1861G>C, NM_003494.3:c.5429+1G>T, NM_003494.3:c.3957delC, NM_003494.3:c.5998C>T, NM_003494.3:c.3724C>T, NM_003494.3:c.5525+1G>A, NM_003494.3:c.3477C>A, NM_003494.3:c.3708delA, NM_003494.3:c.5992G>T, NM_003494.3:c.3113G>C, NM_003494.3:c.1216T>C, NM_003494.3:c.3903delGDysferlinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. Dysferlinopathy includes a spectrum of muscle disease characterized by two main phenotypes: Miyoshi myopathy with primarily distal weakness and limb-girdle muscular dystrophy type 2B (LGMD2B) with primarily proximal weakness. Miyoshi myopathy (median age of onset 19 years) is characterized by muscle weakness and atrophy, most marked in the distal parts of the legs, especially the gastrocnemius and soleus muscles. Over a period of years, the weakness and atrophy spread to the thighs and gluteal muscles. The forearms may become mildly atrophic with decrease in grip strength; the small muscles of the hands are spared. LGMD2B is characterized by early weakness and atrophy of the pelvic and shoulder girdle muscles in adolescence or young adulthood, with slow progression. Other phenotypes are scapuloperoneal syndrome, distal myopathy with anterior tibial onset, elevated serum CK concentration only, and congenital muscular dystrophy. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
DYSFMiyoshi myopathyNM_003494.3NM_003494.3:c.1555G>A, NM_003494.3:c.5509G>A, NM_003494.3:c.5077C>T, NM_003494.3:c.5698_5699delAG, NM_003494.3:c.3892A>G, NM_003494.3:c.286A>C, NM_003494.3:c.1120G>C, NM_003494.3:c.1284+2T>C, NM_003494.3:c.5497G>T, NM_003494.3:c.3478C>T, NM_003494.3:c.2997G>T, NM_003494.3:c.3121C>T, NM_003494.3:c.1813C>T, NM_003494.3:c.3181_3182insAGGCGG, NM_003494.3:c.937+1G>A, NM_003494.3:c.3158T>G, NM_003494.3:c.1276G>A, NM_003494.3:c.701G>A, NM_003494.3:c.610C>T, NM_003494.3:c.5594delG, NM_003494.3:c.3112C>T, NM_003494.3:c.4199C>A, NM_003494.3:c.5999G>A, NM_003494.3:c.4756C>T, NM_003494.3:c.6124C>T, NM_003494.3:c.2966C>T, NM_003494.3:c.663+1G>C, NM_003494.3:c.3175-2A>T, NM_003494.3:c.895G>T, NM_003494.3:c.4985C>T, NM_003494.3:c.6203C>TMiyoshi myopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. This disease is characterised by weakness in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
DYSFMuscular dystrophy, limb girdle type 2BNM_003494.3NM_003494.3:c.5979dupA, NM_003494.3:c.565C>G, NM_003494.3:c.1663C>T, NM_003494.3:c.1873G>T, NM_003494.3:c.1834C>T, NM_003494.3:c.5201A>G, NM_003494.3:c.895G>A, NM_003494.3:c.3805G>T, NM_003494.3:c.4003G>A, NM_003494.3:c.4253G>AMuscular dystrophy, limb girdle type 2B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. This disease is characterised by limb-girdle weakness and atrophy mostly in the shoulder pelvic girdle. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
EDAHypohidrotic ectodermal dysplasia, X-linkedNM_001399.4NM_001399.4:c.206G>T, NM_001399.4:c.463C>T, NM_001399.4:c.187G>A, NM_001399.4:c.573_574insT, NM_001399.4:c.466C>T, NM_001399.4:c.826C>T, NM_001399.4:c.183C>G, NM_001399.4:c.181T>C, NM_001399.4:c.467G>A, NM_001399.4:c.671G>C, NM_001399.4:c.1045G>AHypohidrotic ectodermal dysplasia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EDA gene located on chromosomal region Xq12-q13.1. The age of onset is neonatal/infantile. This disease is characterized by malformation of ectodermal structures such as skin, hair, teeth and sweat glands. The prevalence is 1/5,000 to 1/10,000 newborns.250,600
EDN3Shah-Waardenburg syndrome type 4BNM_207034.1NM_207034.1:c.277C>G, NM_207034.1:c.568_569delGA, NM_207034.1:c.262_263delGCinsT, NM_207034.1:c.559_560insA, NM_207034.1:c.565_566insA, NM_207034.1:c.476G>TWaardenburg-Shah syndrome type 4B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EDN3 gene located on chromosomal region 20q13.2-q13.3. The age of onset is neonatal/infantile. This disease is characterised by the association of Waardenburg syndrome (sensorineural hearing loss and pigmentary abnormalities) and Hirschsprung disease (signs of intestinal obstruction). The prevalence is below 1/40,000.600
EDNRBShah-Waardenburg syndrome type 4ANM_000115.3NM_000115.3:c.914C>A, NM_000115.3:c.548C>G, NM_000115.3:c.828G>T, NM_000115.3:c.-51-946delCWaardenburg-Shah syndrome type 4A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EDNRB gene located on chromosomal region 13q22. The age of onset is neonatal/infantile. This disease is characterised by the association of Waardenburg syndrome (sensorineural hearing loss and pigmentary abnormalities) and Hirschsprung disease (signs of intestinal obstruction). The prevalence is below 1/1,000,000.600
EGR2Charcot-Marie-Tooth disease type 4ENM_000399.3NM_000399.3:c.803T>ACharcot-Marie-Tooth disease type 4E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EGR2 gene located on chromosomal region 10q21.1. The age of onset is neonatal/infantile. This disease is characterised by distal muscle weakness and atrophy associated with sensory loss and, frequently, pes cavus foot deformity. The prevalence is 15/100,000 to 20/100,000.600
EIF2AK3Wolcott-Rallison syndromeNM_004836.5NM_004836.5:c.994G>T, NM_004836.5:c.1763G>AWolcott-Rallison syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EIF2AK3 gene located on chromosomal region 2p12. The age of onset is neonatal/infantile. This disease is characterised by permanent neonatal diabetes mellitus with multiple epiphyseal dysplasia and other clinical manifestations, including recurrent episodes of acute liver failure. The prevalence is above 1/10,000 newborns.600
EMDEmery-Dreifuss muscular dystrophy type 1, X-linkedNM_000117.2NM_000117.2:c.547C>A, NM_000117.2:c.631_635delCGTGCEmery-Dreifuss muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EMD gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by muscular weakness and atrophy, with early joint contractures and cardiomyopathy. The prevalence is 1/100,000.600
ENO3Glycogen storage disease type 13NM_053013.3NM_053013.3:c.667+1G>T, NM_053013.3:c.1121G>A, NM_053013.3:c.953delA, NM_053013.3:c.692_707dupTCCAGGCGGCTGGTTA, NM_053013.3:c.467G>A, NM_053013.3:c.1303T>CGlycogen storage disease type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENO3 gene located on chromosomal region 17p13.2. The age of onset is adult. This disease is characterised by exercise intolerance and myalgia due to severe enolase deficiency in muscle. The prevalence is below 1/1,000,000.250,600
ENPP1Generalized arterial calcification of infancy and pseudoxanthoma elasticumNM_006208.2NM_006208.2:c.1612G>CIdiopathic infantile arterial calcification follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENPP1 gene located on chromosomal region 6q22-q23. The age of onset is neonatal/infancy. A severe autosomal recessive disorder characterized by calcification of the internal elastic lamina of muscular arteries and stenosis due to myointimal proliferation. The disorder is often fatal within the first 6 months of life because of myocardial ischemia resulting in refractory heart failure.600
ENPP1Hypophosphatemic rickets type 2, Autosomal recessiveNM_006208.2NM_006208.2:c.797G>T, NM_006208.2:c.2702A>CHypophosphatemic rickets type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENPP1 gene located on chromosomal region 6q22-q23. The age of onset is variable. This disease is characterised by hypophosphatemia, rickets and/or osteomalacia and slow growth.600
ENPP1Idiopathic infantile arterial calcificationNM_006208.2NM_006208.2:c.1112A>T, NM_006208.2:c.1025G>T, NM_006208.2:c.783C>G, NM_006208.2:c.2677G>T, NM_006208.2:c.913C>A, NM_006208.2:c.2230C>T, NM_006208.2:c.900G>AIdiopathic infantile arterial calcification follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENPP1 gene located on chromosomal region 6q22-q23. The age of onset is neonatal/infancy. A severe autosomal recessive disorder characterized by calcification of the internal elastic lamina of muscular arteries and stenosis due to myointimal proliferation. The disorder is often fatal within the first 6 months of life because of myocardial ischemia resulting in refractory heart failure.600
ERCC2TrichothiodystrophyNM_000400.3NM_000400.3:c.1972C>TTrichothiodystrophy is a heterogeneous group of disorders that follows an autosomal recessive pattern of inheritance. It is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.32. The age of onset is neonatal or infantile. This disease is characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. The abnormalities are usually obvious at birth, with variable clinical expression.250,600
ERCC2Xeroderma pigmentosum complementation group DNM_000400.3NM_000400.3:c.1308-1G>A, NM_000400.3:c.1454T>C, NM_000400.3:c.1621A>C, NM_000400.3:c.1703_1704delTT, NM_000400.3:c.1381C>G, NM_000400.3:c.719-1G>A, NM_000400.3:c.2230_2233dupCTAG, NM_000400.3:c.183+2T>A, NM_000400.3:c.567G>A, NM_000400.3:c.1354C>T, NM_000400.3:c.2047C>T, NM_000400.3:c.1304T>G, NM_000400.3:c.2176C>T, NM_000400.3:c.950-2A>G, NM_000400.3:c.949+1G>AXeroderma pigmentosum complementation group D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.3. The age of onset is variable. This disease is characterised by typical xeroderma pigmentosum manifestations (photosensitivity of skin with burning, freckling, and dryness of skin, skin cancers) associated with a spectrum of neurological anomalies (from no abnormality to severe neurological disease).250,600
ERCC3Xeroderma pigmentosum complementation group BNM_000122.1NM_000122.1:c.1633C>T, NM_000122.1:c.1757_1758delAG, NM_000122.1:c.296T>C, NM_000122.1:c.1273C>T, NM_000122.1:c.1757delA, NM_000122.1:c.1858delGXeroderma pigmentosum complementation group B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC3 gene located on chromosomal region 2q21. The age of onset is variable. This disease is characterised by classic xeroderma pigmentosum features of varying severity (photosensitivity of skin with burning and freckling, skin and eye tumors) and mild neurological abnormalities, or in other cases classical xeroderma pigmentosum features with systemic and neurological manifestations of Cockayne syndrome such as short stature, bilateral sensorineural hearing loss and hyperreflexia. The prevalence is 1/1,000,000.600
ERCC4Xeroderma pigmentosum complementation group FNM_005236.2NM_005236.2:c.49G>T, NM_005236.2:c.1467_1468insA, NM_005236.2:c.2281_2284delTTTG, NM_005236.2:c.2T>C, NM_005236.2:c.538_539delAG, NM_005236.2:c.706T>C, NM_005236.2:c.2395C>TXeroderma pigmentosum complementation group F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC4 gene located on chromosomal region 16p13.12. The age of onset is variable. This disease is characterised very mild skin symptoms and no ocular or neurological disease. The prevalence is 1/1,000,000.250,600
ERCC5Xeroderma pigmentosum complementation group GNM_000123.3NM_000123.3:c.2620G>A, NM_000123.3:c.463_464insA, NM_000123.3:c.526C>T, NM_000123.3:c.88+2T>C, NM_000123.3:c.2144dupA, NM_000123.3:c.2375C>T, NM_000123.3:c.381-2A>G, NM_000123.3:c.2573T>C, NM_000123.3:c.406C>T, NM_000123.3:c.215C>A, NM_000123.3:c.787C>T, NM_000123.3:c.2751delAXeroderma pigmentosum complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC5 gene located on chromosomal region 13q33. The age of onset is variable. This disease is characterised by variable clinical manifestations, as some patients present with a mild xeroderma pigmentosum phenotype (UV sensitivity, hyper- or hypo-pigmented skin lesions and increased incidence of skin cancer) and others combine symptoms of xeroderma pigmentosum with systemic and neurological manifestations of Cockayne syndrome. The prevalence is 1/1,000,000.250,600
ERCC6Cerebrooculofacioskeletal syndrome tipo 1NM_000124.3NM_000124.3:c.2047C>TCerebrooculofacioskeletal syndrome tipo 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterised by congenital microcephaly, congenital cataract and/or microphthalmia, arthrogryposis, severe psychomotor developmental delay, height-weight growth delay (principally postnatal) and facial dysmorphism (prominent metopic suture, micrognathism). The prevalence is below 1,000,000.250,600
ERCC6Cockayne syndrome type BNM_000124.3NM_000124.3:c.207_208insG, NM_000124.3:c.2203C>T, NM_000124.3:c.1357C>T, NM_000124.3:c.48_49delCT, NM_000124.3:c.3592_3593insGA, NM_000124.3:c.422+1G>A, NM_000124.3:c.1550G>A, NM_000124.3:c.3284C>G, NM_000124.3:c.2587C>T, NM_000124.3:c.3862C>TCockayne syndrome type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterised by growth failure at birth, with little or no postnatal neurologic development.250,600
ERCC8Cockayne syndrome type ANM_000082.3NM_000082.3:c.1103_1108delAGTTinsTTATATGAACCTTATATGAA, NM_000082.3:c.618-1G>A, NM_000082.3:c.593_594dupAT, NM_000082.3:c.613G>C, NM_000082.3:c.966C>A, NM_000082.3:c.37G>TCockayne syndrome type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC8 gene located on chromosomal region 5q12.1. The age of onset is variable. This disease is characterised by normal prenatal growth with the onset of growth and developmental abnormalities in the first two years. The prevalence is 2.7/1,000,000 newborns in Western Europe.600
ESCO2Roberts syndromeNM_001017420.2NM_001017420.2:c.1615T>G, NM_001017420.2:c.879_880delAG, NM_001017420.2:c.1597dupT, NM_001017420.2:c.505C>T, NM_001017420.2:c.291_292insGA, NM_001017420.2:c.308_309delAA, NM_001017420.2:c.876_879delCAGA, NM_001017420.2:c.874_877delGACARoberts syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESCO2 gene located on chromosomal region 8p21.1. The age of onset is neonatal/infantile. This disease is characterised by pre- and postnatal growth retardation, severe symmetric limb reduction defects, craniofacial anomalies and severe intellectual deficit.600
ESCO2SC Phocomelia syndromeNM_001017420.2NM_001017420.2:c.1269G>A, NM_001017420.2:c.604C>TSC phocomelia syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESCO2 gene located on chromosomal region 8p21.1. The age of onset is neonatal/infantile. This disease has a milder phenotype than Roberts syndrome, with a lesser degree of symmetric limb reduction and additionally includes flexion contractures of various joints, midfacial hemangioma, hypoplastic cartilage of ears and nose, scant silvery-blond hair, and cloudy corneae. Although microcephaly is present, mental retardation may be mild and survival into adulthood is common.600
ESPNDeafness type 36, autosomal recessiveNM_031475.2NM_031475.2:c.1988_1991delAGAG, NM_031475.2:c.2230G>A, NM_031475.2:c.2470_2473delTCAGAutosomal recessive nonsyndromic sensorineural deafness type DFNB36 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESPN gene located on chromosomal region 1p36.31. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.600
ESRRBDeafness type 35, autosomal recessiveNM_004452.3NM_004452.3:c.329C>TAutosomal recessive nonsyndromic sensorineural deafness type DFNB35 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESRRB gene located on chromosomal region 14q24.3. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.600
ETFAGlutaric acidemia type 2ANM_000126.3NM_000126.3:c.470T>G, NM_000126.3:c.797C>TGlutaric acidemia type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFA gene located on chromosomal region 15q23-q25. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.600
ETFBGlutaric acidemia type 2BNM_001985.2NM_001985.2:c.278_279insG, NM_001985.2:c.490C>T, NM_001985.2:c.491G>A, NM_001985.2:c.382G>A, NM_001985.2:c.58-53_58-52insG, NM_001985.2:c.61C>T, NM_001985.2:c.614_616delAGAGlutaric acidemia type 2B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFB gene located on chromosomal region 19q13.3. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.600
ETFDHGlutaric acidemia type 2CNM_004453.3NM_004453.3:c.1823delG, NM_004453.3:c.1570_1571delCT, NM_004453.3:c.2T>C, NM_004453.3:c.1234G>T, NM_004453.3:c.250G>A, NM_004453.3:c.1351G>C, NM_004453.3:c.1367C>T, NM_004453.3:c.524G>T, NM_004453.3:c.1001T>C, NM_004453.3:c.1773_1774delAT, NM_004453.3:c.1832G>A, NM_004453.3:c.508G>T, NM_004453.3:c.413T>G, NM_004453.3:c.643G>AGlutaric acidemia type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFDH gene located on chromosomal region 4q32-q35. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.600
ETHE1Ethylmalonic encephalopathyNM_014297.3NM_014297.3:c.487C>T, NM_014297.3:c.554T>G, NM_014297.3:c.440_450delACAGCATGGCC, NM_014297.3:c.604dupG, NM_014297.3:c.221dupA, NM_014297.3:c.488G>AEthylmalonic encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETHE1 gene located on chromosomal region 19q13.31. The age of onset is neonatal/infantile. This disease is characterised by elevated excretion of ethylmalonic acid with recurrent petechiae, orthostatic acrocyanosis and chronic diarrhoea associated with neurodevelopmental delay, psychomotor regression and hypotonia with brain magnetic resonance imaging abnormalities. The prevalence is below 1/1,000,000, with total of 30 cases of patients reported worldwide, mainly for Mediterranean and Arab populations.600
EYSRetinitis pigmentosa type 25NM_001142800.1NM_001142800.1:c.5044G>T, NM_001142800.1:c.9036delT, NM_001142800.1:c.490C>T, NM_001142800.1:c.5928-2A>G, NM_001142800.1:c.571dupA, NM_001142800.1:c.4597_4613delTCAAGCAACCAGAGACT, NM_001142800.1:c.7822C>T, NM_001142800.1:c.5857G>T, NM_001142800.1:c.6170delA, NM_001142800.1:c.8569G>T, NM_001142800.1:c.232delT, NM_001142800.1:c.6102_6103insT, NM_001142800.1:c.8834G>A, NM_001142800.1:c.1211_1212insA, NM_001142800.1:c.4350_4356delTATAGCT, NM_001142800.1:c.4469_4470insAGCCCCTC, NM_001142800.1:c.8648_8655delCATGCAGA, NM_001142800.1:c.4120C>T, NM_001142800.1:c.863-4_863-3insT, NM_001142800.1:c.8629_8632dupACAG, NM_001142800.1:c.9299_9302delCTCA, NM_001142800.1:c.103C>T, NM_001142800.1:c.2826_2827delAT, NM_001142800.1:c.4045C>T, NM_001142800.1:c.5757_5758insT, NM_001142800.1:c.8408dupA, NM_001142800.1:c.7095T>G, NM_001142800.1:c.3329C>G, NM_001142800.1:c.9405T>ARetinitis pigmentosa 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EYS gene located on chromosomal region 6q12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000.250,600
F11Factor 11 deficiencyNM_000128.3NM_000128.3:c.1613C>T, NM_000128.3:c.166T>C, NM_000128.3:c.403G>T, NM_000128.3:c.731A>G, NM_000128.3:c.809A>T, NM_000128.3:c.1693G>A, NM_000128.3:c.1211C>A, NM_000128.3:c.901T>C, NM_000128.3:c.595+3A>G, NM_000128.3:c.438C>AFactor 11 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F11 gene located on chromosomal region 4q35. The age of onset is variable. This disease is characterized by reduced levels and activity of factor XI resulting in moderate bleeding symptoms, usually occurring after trauma or surgery. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
F5Factor 5 deficiencyNM_000130.4NM_000130.4:c.4876delA, NM_000130.4:c.439G>T, NM_000130.4:c.6419G>A, NM_000130.4:c.2401C>T, NM_000130.4:c.5521G>A, NM_000130.4:c.1083G>A, NM_000130.4:c.5189A>G, NM_000130.4:c.3799delC, NM_000130.4:c.6304C>TFactor 5 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F5 gene located on chromosomal region 1q23. The age of onset is variable. This disease is characterized by mild to severe bleeding symptoms usually occurring after trauma or surgery. In severe forms of the disease, there can be a risk of intracranial, pulmonary or gastrointestinal bleedings. The severity of the bleeding manifestations correlates with the FV levels. The prevalence is 1/5,000.250,600
F5ThrombosisNM_000130.4NM_000130.4:c.1000A>GDeep venous thrombosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F5 gene located on chromosomal region 1q23. The age of onset is variable. This disease is characterized by a poor anticoagulant response to activated Protein C and an increased risk for venous thromboembolism. Deep venous thrombosis and pulmonary embolism are the most common manifestations, but thrombosis in unusual locations also occurs. The prevalence is 1/5,000.250,600
F8Hemophilia ANM_000132.3NM_000132.3:c.1075_1078delAATG, NM_000132.3:c.1042T>C, NM_000132.3:c.1078_1079delGA, NM_000132.3:c.120delC, NM_000132.3:c.1214T>G, NM_000132.3:c.1090G>A, NM_000132.3:c.1207C>G, NM_000132.3:c.1331_1332delAAinsT, NM_000132.3:c.1175C>A, NM_000132.3:c.1335dupC, NM_000132.3:c.1203G>A, NM_000132.3:c.128dupT, NM_000132.3:c.1331A>C, NM_000132.3:c.1301G>A, NM_000132.3:c.1234T>C, NM_000132.3:c.1316G>A, NM_000132.3:c.1293delG, NM_000132.3:c.1200_1201delTT, NM_000132.3:c.1310delG, NM_000132.3:c.1331_1332delAA, NM_000132.3:c.1410_1413delTTTA, NM_000132.3:c.1420G>T, NM_000132.3:c.143+1G>A, NM_000132.3:c.1432G>A, NM_000132.3:c.1438_1439delCT, NM_000132.3:c.1440_1441insA, NM_000132.3:c.144-11T>G, NM_000132.3:c.1442_1443dupTG, NM_000132.3:c.1175C>G, NM_000132.3:c.1324T>A, NM_000132.3:c.1324T>C, NM_000132.3:c.1325A>G, NM_000132.3:c.144-5C>G, NM_000132.3:c.1463C>G, NM_000132.3:c.1463C>T, NM_000132.3:c.1467_1472dupCAGACC, NM_000132.3:c.1477A>G, NM_000132.3:c.1538-1G>T, NM_000132.3:c.1538-2A>T, NM_000132.3:c.1560delT, NM_000132.3:c.1564_1565delATinsTA, NM_000132.3:c.1585A>G, NM_000132.3:c.1594T>G, NM_000132.3:c.1189_1190insC, NM_000132.3:c.1443+3A>C, NM_000132.3:c.1596G>A, NM_000132.3:c.1618C>A, NM_000132.3:c.1619C>G, NM_000132.3:c.1630G>A, NM_000132.3:c.1639T>C, NM_000132.3:c.1337G>A, NM_000132.3:c.1337G>C, NM_000132.3:c.1338delA, NM_000132.3:c.1348T>G, NM_000132.3:c.1357G>T, NM_000132.3:c.1390G>T, NM_000132.3:c.1595G>A, NM_000132.3:c.1596dupG, NM_000132.3:c.1400T>G, NM_000132.3:c.1406G>C, NM_000132.3:c.1736A>T, NM_000132.3:c.173delC, NM_000132.3:c.1752+5G>C, NM_000132.3:c.185C>G, NM_000132.3:c.1904-1G>A, NM_000132.3:c.1904-37G>A, NM_000132.3:c.1912G>A, NM_000132.3:c.1913G>A, NM_000132.3:c.1924_1927delGATA, NM_000132.3:c.1934A>C, NM_000132.3:c.1941_1944delAGTT, NM_000132.3:c.1943_1946delTTTG, NM_000132.3:c.1952A>C, NM_000132.3:c.195C>A, NM_000132.3:c.1985G>C, NM_000132.3:c.1988C>T, NM_000132.3:c.1990_1991delCA, NM_000132.3:c.1991A>C, NM_000132.3:c.199_200delAA, NM_000132.3:c.1992_1995dupGACT, NM_000132.3:c.1996_1999delGACT, NM_000132.3:c.1999delT, NM_000132.3:c.199A>G, NM_000132.3:c.1A>G, NM_000132.3:c.2009_2011delTCT, NM_000132.3:c.200A>C, NM_000132.3:c.201G>T, NM_000132.3:c.202_203insGA, NM_000132.3:c.202_207delACTCTG, NM_000132.3:c.2029T>C, NM_000132.3:c.2032A>T, NM_000132.3:c.203C>A, NM_000132.3:c.2057C>G, NM_000132.3:c.2058_2059delAC, NM_000132.3:c.2060T>C, NM_000132.3:c.2066T>G, NM_000132.3:c.1394C>G, NM_000132.3:c.1397G>A, NM_000132.3:c.2077_2078delTCinsCT, NM_000132.3:c.2088_2089delTG, NM_000132.3:c.2090T>A, NM_000132.3:c.2095A>C, NM_000132.3:c.2095A>G, NM_000132.3:c.2095A>T, NM_000132.3:c.1086G>A, NM_000132.3:c.2097G>A, NM_000132.3:c.1164delC, NM_000132.3:c.1172G>C, NM_000132.3:c.214G>A, NM_000132.3:c.217T>C, NM_000132.3:c.1187A>T, NM_000132.3:c.224delA, NM_000132.3:c.225T>A, NM_000132.3:c.1202G>A, NM_000132.3:c.2338delA, NM_000132.3:c.2360delA, NM_000132.3:c.2372dupG, NM_000132.3:c.2374delT, NM_000132.3:c.2383A>G, NM_000132.3:c.2384_2388delGAACA, NM_000132.3:c.2397delT, NM_000132.3:c.2404C>T, NM_000132.3:c.2409delT, NM_000132.3:c.2412_2421delCTCCTCTAGT, NM_000132.3:c.2419dupA, NM_000132.3:c.2462_2463delGG, NM_000132.3:c.250_255delAGGCCA, NM_000132.3:c.250A>G, NM_000132.3:c.253_255delCCA, NM_000132.3:c.265+1G>T, NM_000132.3:c.265G>A, NM_000132.3:c.3031A>T, NM_000132.3:c.3034G>C, NM_000132.3:c.3053delA, NM_000132.3:c.3150_3151insTC, NM_000132.3:c.3152delT, NM_000132.3:c.3168_3187delTGAGTTTAAAAAAGTGACAC, NM_000132.3:c.3196C>T, NM_000132.3:c.3202_3203delAG, NM_000132.3:c.3224delC, NM_000132.3:c.3251C>G, NM_000132.3:c.3255_3258delTAAA, NM_000132.3:c.3279G>A, NM_000132.3:c.3289C>T, NM_000132.3:c.3295delA, NM_000132.3:c.3298A>T, NM_000132.3:c.3302_3303delAG, NM_000132.3:c.3344delT, NM_000132.3:c.3371C>A, NM_000132.3:c.144-26A>T, NM_000132.3:c.1443+1G>A, NM_000132.3:c.1443+2T>C, NM_000132.3:c.3409_3410delCT, NM_000132.3:c.3416_3417delCT, NM_000132.3:c.3417dupT, NM_000132.3:c.3421C>T, NM_000132.3:c.3490delT, NM_000132.3:c.3493G>T, NM_000132.3:c.3496A>T, NM_000132.3:c.3500dupA, NM_000132.3:c.3505delG, NM_000132.3:c.3540delA, NM_000132.3:c.3548_3549delAA, NM_000132.3:c.3565dupA, NM_000132.3:c.3607G>T, NM_000132.3:c.3624delT, NM_000132.3:c.3631A>T, NM_000132.3:c.3651delA, NM_000132.3:c.3652delG, NM_000132.3:c.3710delC, NM_000132.3:c.3721_3739del19ins6, NM_000132.3:c.3735_3744delCCTTTTCTTAinsATTTCTTTTTCTTT, NM_000132.3:c.3736delC, NM_000132.3:c.3756delG, NM_000132.3:c.3766G>T, NM_000132.3:c.3771delT, NM_000132.3:c.3827C>G, NM_000132.3:c.3830delC, NM_000132.3:c.3833delA, NM_000132.3:c.3842_3844delAGAinsGG, NM_000132.3:c.3844A>T, NM_000132.3:c.3847_3848delCA, NM_000132.3:c.3858delT, NM_000132.3:c.3860delT, NM_000132.3:c.3863dupC, NM_000132.3:c.3870dupA, NM_000132.3:c.3886delT, NM_000132.3:c.3902delA, NM_000132.3:c.3907_3911delACCAA, NM_000132.3:c.3913C>T, NM_000132.3:c.3922G>T, NM_000132.3:c.3940A>C, NM_000132.3:c.3964C>T, NM_000132.3:c.3967C>T, NM_000132.3:c.3982C>T, NM_000132.3:c.3984dupA, NM_000132.3:c.3991_3992delAA, NM_000132.3:c.3994_3997delAGAG, NM_000132.3:c.4006C>T, NM_000132.3:c.4034delA, NM_000132.3:c.403G>A, NM_000132.3:c.4045delA, NM_000132.3:c.404A>G, NM_000132.3:c.405T>A, NM_000132.3:c.4072C>T, NM_000132.3:c.407A>C, NM_000132.3:c.4093_4099delCATTTGA, NM_000132.3:c.4100delC, NM_000132.3:c.4113_4153dup41, NM_000132.3:c.4156C>T, NM_000132.3:c.415C>T, NM_000132.3:c.4197delC, NM_000132.3:c.4201C>T, NM_000132.3:c.421G>T, NM_000132.3:c.4241C>A, NM_000132.3:c.4242dupA, NM_000132.3:c.4264_4265delTA, NM_000132.3:c.2071C>A, NM_000132.3:c.2072C>T, NM_000132.3:c.4293_4297delCTCTT, NM_000132.3:c.4296_4300delTTCTC, NM_000132.3:c.430G>T, NM_000132.3:c.4318delT, NM_000132.3:c.4336delG, NM_000132.3:c.4339dupG, NM_000132.3:c.2096T>A, NM_000132.3:c.4345delG, NM_000132.3:c.209T>C, NM_000132.3:c.2101_2105delATGGA, NM_000132.3:c.4363C>T, NM_000132.3:c.4382_4383delAC, NM_000132.3:c.223G>T, NM_000132.3:c.4408G>T, NM_000132.3:c.440T>A, NM_000132.3:c.230T>C, NM_000132.3:c.4424_4425delAA, NM_000132.3:c.4426_4427delAG, NM_000132.3:c.4429_4430delGA, NM_000132.3:c.4446dupG, NM_000132.3:c.4450delA, NM_000132.3:c.4458delA, NM_000132.3:c.446delC, NM_000132.3:c.4473C>A, NM_000132.3:c.4473C>G, NM_000132.3:c.4474A>T, NM_000132.3:c.4483delG, NM_000132.3:c.4483G>T, NM_000132.3:c.4491_4492delTG, NM_000132.3:c.4491_4495delTGTTC, NM_000132.3:c.4492_4496delGTTCT, NM_000132.3:c.4492delG, NM_000132.3:c.4512_4513ins32, NM_000132.3:c.4512delG, NM_000132.3:c.4513_4515delCCCinsGCAAAGTTGGTTTGCCAAAACCATGTTGCCG, NM_000132.3:c.4519delA, NM_000132.3:c.4531G>A, NM_000132.3:c.4542delT, NM_000132.3:c.4543_4544delCCinsA, NM_000132.3:c.4549_4550delGT, NM_000132.3:c.4561C>T, NM_000132.3:c.4619delT, NM_000132.3:c.4658delA, NM_000132.3:c.4662_4663delGA, NM_000132.3:c.4665_4688del24insAAGGAA, NM_000132.3:c.4672_4675delAACA, NM_000132.3:c.4683delA, NM_000132.3:c.4687delG, NM_000132.3:c.4694_4697delTTCT, NM_000132.3:c.4697_4701dupTGAGA, NM_000132.3:c.4710_4713delAGAA, NM_000132.3:c.3385delC, NM_000132.3:c.3388delA, NM_000132.3:c.3402delG, NM_000132.3:c.472C>T, NM_000132.3:c.476T>C, NM_000132.3:c.4770T>A, NM_000132.3:c.4794G>T, NM_000132.3:c.4798A>T, NM_000132.3:c.4805_4806delAA, NM_000132.3:c.4805delA, NM_000132.3:c.4814C>A, NM_000132.3:c.4825delA, NM_000132.3:c.4828G>T, NM_000132.3:c.4841delA, NM_000132.3:c.4848delC, NM_000132.3:c.4856delC, NM_000132.3:c.4858delC, NM_000132.3:c.4864G>A, NM_000132.3:c.4895delT, NM_000132.3:c.4895dupT, NM_000132.3:c.4899delT, NM_000132.3:c.489T>A, NM_000132.3:c.4918G>T, NM_000132.3:c.4922dupT, NM_000132.3:c.4925A>G, NM_000132.3:c.4926delA, NM_000132.3:c.4934G>A, NM_000132.3:c.4935G>A, NM_000132.3:c.493C>T, NM_000132.3:c.4942C>T, NM_000132.3:c.4969C>T, NM_000132.3:c.4979C>T, NM_000132.3:c.4987A>T, NM_000132.3:c.4996C>T, NM_000132.3:c.4999delC, NM_000132.3:c.5010delT, NM_000132.3:c.5012G>A, NM_000132.3:c.514_515insTCAAGATA, NM_000132.3:c.514T>C, NM_000132.3:c.515G>A, NM_000132.3:c.519_523delTACCT, NM_000132.3:c.5220-1G>A, NM_000132.3:c.5226_5227delGA, NM_000132.3:c.5243delA, NM_000132.3:c.5251A>T, NM_000132.3:c.5254delG, NM_000132.3:c.525C>A, NM_000132.3:c.5269delT, NM_000132.3:c.5269T>C, NM_000132.3:c.5291A>G, NM_000132.3:c.5301C>A, NM_000132.3:c.5308G>A, NM_000132.3:c.5321A>T, NM_000132.3:c.532C>G, NM_000132.3:c.5330T>C, NM_000132.3:c.5337delG, NM_000132.3:c.5339C>T, NM_000132.3:c.5343T>A, NM_000132.3:c.5345T>G, NM_000132.3:c.5348_5357delGAGCAGAAGT, NM_000132.3:c.535T>C, NM_000132.3:c.545A>T, NM_000132.3:c.553A>G, NM_000132.3:c.556G>A, NM_000132.3:c.557_559delACT, NM_000132.3:c.557A>G, NM_000132.3:c.560T>A, NM_000132.3:c.566C>A, NM_000132.3:c.5674G>A, NM_000132.3:c.5675dupT, NM_000132.3:c.5680G>A, NM_000132.3:c.5686G>C, NM_000132.3:c.5689_5690delCT, NM_000132.3:c.5696dupT, NM_000132.3:c.5697delC, NM_000132.3:c.5712G>C, NM_000132.3:c.5718dupA, NM_000132.3:c.5719A>T, NM_000132.3:c.571C>T, NM_000132.3:c.5721C>G, NM_000132.3:c.5722_5723delTGinsTCATCAAAGTACTTCAAAAA, NM_000132.3:c.5752delT, NM_000132.3:c.5766C>A, NM_000132.3:c.577G>A, NM_000132.3:c.5816-14delGTinsTA, NM_000132.3:c.5816C>A, NM_000132.3:c.5816C>T, NM_000132.3:c.5825G>T, NM_000132.3:c.5833A>G, NM_000132.3:c.5853A>C, NM_000132.3:c.5861_5866delCTCAGG, NM_000132.3:c.5869C>T, NM_000132.3:c.5879G>T, NM_000132.3:c.5881T>A, NM_000132.3:c.5884T>G, NM_000132.3:c.5888T>C, NM_000132.3:c.5891T>C, NM_000132.3:c.5894G>T, NM_000132.3:c.589_591delGTA, NM_000132.3:c.5914_5915delAT, NM_000132.3:c.5923dupA, NM_000132.3:c.5924T>A, NM_000132.3:c.5934T>G, NM_000132.3:c.5939A>C, NM_000132.3:c.5953delC, NM_000132.3:c.5954G>C, NM_000132.3:c.5955_5956delAA, NM_000132.3:c.5955delA, NM_000132.3:c.5964_5967dupGGAG, NM_000132.3:c.5999G>C, NM_000132.3:c.6016G>T, NM_000132.3:c.6037G>A, NM_000132.3:c.6046C>G, NM_000132.3:c.6070dupC, NM_000132.3:c.6078_6079delTG, NM_000132.3:c.6082delG, NM_000132.3:c.6089dupG, NM_000132.3:c.6094C>T, NM_000132.3:c.6099delT, NM_000132.3:c.6107A>G, NM_000132.3:c.6115+1G>A, NM_000132.3:c.6115+2T>C, NM_000132.3:c.6115+3G>T, NM_000132.3:c.6115+4A>G, NM_000132.3:c.6115+6T>A, NM_000132.3:c.6116-2A>G, NM_000132.3:c.6116_6117delAG, NM_000132.3:c.6120_6135delTCAGACTCCCCTGGGA, NM_000132.3:c.6120T>A, NM_000132.3:c.6127delC, NM_000132.3:c.6134G>T, NM_000132.3:c.6135dupA, NM_000132.3:c.6194G>A, NM_000132.3:c.6202_6257dup56, NM_000132.3:c.6213A>T, NM_000132.3:c.6239C>T, NM_000132.3:c.6242G>C, NM_000132.3:c.6243G>C, NM_000132.3:c.6250A>T, NM_000132.3:c.6253G>T, NM_000132.3:c.6263C>T, NM_000132.3:c.6269T>A, NM_000132.3:c.6273+1G>A, NM_000132.3:c.6430-3C>G, NM_000132.3:c.6449A>T, NM_000132.3:c.6464_6465delAA, NM_000132.3:c.6465delA, NM_000132.3:c.6467_6468delAC, NM_000132.3:c.6469_6470delAA, NM_000132.3:c.6473delT, NM_000132.3:c.6482C>A, NM_000132.3:c.6482C>T, NM_000132.3:c.6488T>G, NM_000132.3:c.6489delT, NM_000132.3:c.6494delC, NM_000132.3:c.6497delG, NM_000132.3:c.6501delC, NM_000132.3:c.6515C>G, NM_000132.3:c.6517_6519dupACT, NM_000132.3:c.6520C>G, NM_000132.3:c.6533G>A, NM_000132.3:c.6537C>G, NM_000132.3:c.6544C>G, NM_000132.3:c.6548T>G, NM_000132.3:c.6551A>T, NM_000132.3:c.6565_6566delGA, NM_000132.3:c.6574+1G>A, NM_000132.3:c.6574+1G>T, NM_000132.3:c.6574+3A>C, NM_000132.3:c.6574+5G>C, NM_000132.3:c.65G>C, NM_000132.3:c.6738delA, NM_000132.3:c.6739_6740delGA, NM_000132.3:c.6739G>T, NM_000132.3:c.6743G>C, NM_000132.3:c.6746T>G, NM_000132.3:c.6752T>A, NM_000132.3:c.6760C>T, NM_000132.3:c.6760delC, NM_000132.3:c.676A>T, NM_000132.3:c.6780_6788delAGGAGTAAC, NM_000132.3:c.6786_6787insCAA, NM_000132.3:c.6796G>A, NM_000132.3:c.6797delG, NM_000132.3:c.6797G>A, NM_000132.3:c.6804delA, NM_000132.3:c.680G>A, NM_000132.3:c.6825T>A, NM_000132.3:c.6827T>G, NM_000132.3:c.6836T>C, NM_000132.3:c.6836T>G, NM_000132.3:c.6839T>C, NM_000132.3:c.6842T>C, NM_000132.3:c.684_685delCT, NM_000132.3:c.6856_6866delGATGGCCATCA, NM_000132.3:c.6865C>T, NM_000132.3:c.6869G>T, NM_000132.3:c.6870G>A, NM_000132.3:c.687_688delAG, NM_000132.3:c.6886delA, NM_000132.3:c.6900+1G>A, NM_000132.3:c.6901-2A>G, NM_000132.3:c.6904T>G, NM_000132.3:c.6905T>C, NM_000132.3:c.6912_6916delAAATC, NM_000132.3:c.6915delT, NM_000132.3:c.6919_6920delGA, NM_000132.3:c.6921delC, NM_000132.3:c.693_696delAAAG, NM_000132.3:c.6969_6977delCTACCTTCG, NM_000132.3:c.6976C>G, NM_000132.3:c.6986C>T, NM_000132.3:c.6988delC, NM_000132.3:c.6995G>C, NM_000132.3:c.6996G>A, NM_000132.3:c.6997delG, NM_000132.3:c.7012delC, NM_000132.3:c.7016G>T, NM_000132.3:c.7021G>T, NM_000132.3:c.7030G>A, NM_000132.3:c.7030G>T, NM_000132.3:c.7031G>A, NM_000132.3:c.7033_7040delTGCGAGGC, NM_000132.3:c.7034G>A, NM_000132.3:c.709C>T, NM_000132.3:c.729delT, NM_000132.3:c.73delT, NM_000132.3:c.755C>A, NM_000132.3:c.760A>T, NM_000132.3:c.764G>A, NM_000132.3:c.770_771insCC, NM_000132.3:c.775A>T, NM_000132.3:c.779C>G, NM_000132.3:c.77T>C, NM_000132.3:c.787+2T>C, NM_000132.3:c.787G>C, NM_000132.3:c.788-1G>A, NM_000132.3:c.788-1G>C, NM_000132.3:c.788-1G>T, NM_000132.3:c.788-2A>T, NM_000132.3:c.796G>T, NM_000132.3:c.820T>C, NM_000132.3:c.822G>A, NM_000132.3:c.824A>G, NM_000132.3:c.832G>A, NM_000132.3:c.836T>A, NM_000132.3:c.849delT, NM_000132.3:c.850G>A, NM_000132.3:c.850G>T, NM_000132.3:c.86T>G, NM_000132.3:c.871G>T, NM_000132.3:c.872A>G, NM_000132.3:c.883T>C, NM_000132.3:c.886C>T, NM_000132.3:c.889delG, NM_000132.3:c.88G>A, NM_000132.3:c.899A>C, NM_000132.3:c.899A>T, NM_000132.3:c.902G>C, NM_000132.3:c.906delG, NM_000132.3:c.912C>T, NM_000132.3:c.918delA, NM_000132.3:c.920T>G, NM_000132.3:c.935delT, NM_000132.3:c.941C>T, NM_000132.3:c.943delG, NM_000132.3:c.948_951delAACA, NM_000132.3:c.967G>A, NM_000132.3:c.974_975delTT, NM_000132.3:c.97T>G, NM_000132.3:c.984delT, NM_000132.3:c.985dupT, NM_000132.3:c.986G>A, NM_000132.3:c.986G>C, NM_000132.3:c.986G>T, NM_000132.3:c.98G>A, NM_000132.3:c.1726G>T, NM_000132.3:c.4345G>T, NM_000132.3:c.435_436insTTT, NM_000132.3:c.433G>C, NM_000132.3:c.4719_4729delTGCAAAGACTC, NM_000132.3:c.439_447dupGTCTTCCCT, NM_000132.3:c.4720delG, NM_000132.3:c.1661G>A, NM_000132.3:c.4423C>T, NM_000132.3:c.1703G>T, NM_000132.3:c.1640G>A, NM_000132.3:c.1682A>C, NM_000132.3:c.1681G>A, NM_000132.3:c.1667T>A, NM_000132.3:c.4272delC, NM_000132.3:c.1653T>G, NM_000132.3:c.471G>A, NM_000132.3:c.1688C>G, NM_000132.3:c.4280delT, NM_000132.3:c.1675G>THemophilia A follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F8 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor VIII deficiency. The prevalence is 1/4,000 to 1/ 5,000 male newborns.600
F8Hemophilia A-Inv22 (Detection by PCR)Hemophilia A follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F8 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor VIII deficiency. The prevalence is 1/4,000 to 1/ 5,000 male newborns.600
F9Hemophilia BNM_000133.3NM_000133.3:c.1150C>T, NM_000133.3:c.52T>C, NM_000133.3:c.1031T>C, NM_000133.3:c.82T>C, NM_000133.3:c.1136G>A, NM_000133.3:c.79G>A, NM_000133.3:c.19A>T, NM_000133.3:c.80A>THemophilia B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F9 gene located on chromosomal region Xq27.1-q27.2. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor IX deficiency. The prevalence is 1/100,000 to 9/100,000.250,600
FAHTyrosinemia type 1NM_000137.2NM_000137.2:c.1141A>G, NM_000137.2:c.1069G>T, NM_000137.2:c.1090G>T, NM_000137.2:c.401C>A, NM_000137.2:c.456G>A, NM_000137.2:c.192G>T, NM_000137.2:c.607-6T>G, NM_000137.2:c.707-1G>A, NM_000137.2:c.939delC, NM_000137.2:c.103G>A, NM_000137.2:c.982C>T, NM_000137.2:c.837+1G>A, NM_000137.2:c.1009G>A, NM_000137.2:c.47A>T, NM_000137.2:c.554-1G>T, NM_000137.2:c.1027G>T, NM_000137.2:c.1062+5G>A, NM_000137.2:c.786G>A, NM_000137.2:c.1021C>T, NM_000137.2:c.782C>TTyrosinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAH gene located on chromosomal region 15q25.1. The age of onset is variable. This disease is characterized by progressive liver disease, renal tubular dysfunction, porphyria-like crises and a dramatic improvement in prognosis following treatment with nitisinone. The birth incidence is 1/100,000, notably in Québec, Canada, and the prevalence is 1/100,000 to 1/120,000 newborns.250,600
FAM126AHypomyelination and congenital cataractNM_032581.3NM_032581.3:c.191A>G, NM_032581.3:c.158T>CHypomyelination - congenital cataract follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAM126A gene located on chromosomal region 7p15.3. The age of onset is neonatal/infantile. This disease is characterized by the onset of cataract either at birth or in the first two months of life, delayed psychomotor development by the end of the first year of life and moderate intellectual deficit. The prevalence is below 1/1,000,000.600
FAM20COsteosclerotic bone dysplasiaNM_020223.3NM_020223.3:c.1093G>C, NM_020223.3:c.773T>A, NM_020223.3:c.1364-5C>T, NM_020223.3:c.1163T>G, NM_020223.3:c.838G>A, NM_020223.3:c.1351G>AOsteosclerotic bone dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAM20C gene located on chromosomal region 7p22.3. The age of onset is neonatal/infantile. This disease is characterized by generalized osteosclerosis with periosteal bone formation, characteristic facial dysmorphism, brain abnormalities including intracerebral calcifications, and neonatal lethal course. The prevalence is below 1/1,000,000.600
FANCAFanconi anemia, complementation group ANM_000135.2NM_000135.2:c.3788_3790delTCT, NM_000135.2:c.2303T>C, NM_000135.2:c.3558_3559insG, NM_000135.2:c.4130C>G, NM_000135.2:c.233_236delTTGA, NM_000135.2:c.3763G>T, NM_000135.2:c.1115_1118delTTGG, NM_000135.2:c.131_132insAFanconi anemia complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCA gene located on chromosomal region 16q24.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
FANCCFanconi anemia, complementation group CNM_000136.2NM_000136.2:c.1642C>T, NM_000136.2:c.37C>T, NM_000136.2:c.996+1G>T, NM_000136.2:c.67delG, NM_000136.2:c.416G>A, NM_000136.2:c.1015delA, NM_000136.2:c.1487T>G, NM_000136.2:c.1103_1104delTGFanconi anemia complementation group C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCC gene located on chromosomal region 9q22.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
FANCD2Fanconi anemia, complementation group D2NM_033084.3NM_033084.3:c.1278+1delG, NM_033084.3:c.2152C>T, NM_033084.3:c.2494+2T>C, NM_033084.3:c.958C>T, NM_033084.3:c.2444G>A, NM_033084.3:c.782A>T, NM_033084.3:c.904C>TFanconi anemia complementation group D2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCD2 gene located on chromosomal region 3p26. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
FANCEFanconi anemia, complementation group ENM_021922.2NM_021922.2:c.1501C>T, NM_021922.2:c.929_930insC, NM_021922.2:c.421C>T, NM_021922.2:c.1114-8G>A, NM_021922.2:c.922_923insC, NM_021922.2:c.355C>TFanconi anemia complementation group E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCE gene located on chromosomal region 6p22-p21. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.600
FANCGFanconi anemia, complementation group GNM_004629.1NM_004629.1:c.1795_1804delTGGATCCGTC, NM_004629.1:c.313G>T, NM_004629.1:c.637_643delTACCGCC, NM_004629.1:c.1480+1G>C, NM_004629.1:c.1852_1853delAA, NM_004629.1:c.510+1G>A, NM_004629.1:c.1077-2A>G, NM_004629.1:c.908_909insCTFanconi anemia complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCG gene located on chromosomal region 9p13. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
FANCIFanconi anemia, complementation group INM_001113378.1NM_001113378.1:c.3816+1G>A, NM_001113378.1:c.52C>T, NM_001113378.1:c.989_991delTAA, NM_001113378.1:c.2097C>G, NM_001113378.1:c.3466G>C, NM_001113378.1:c.2292-1G>A, NM_001113378.1:c.3492delG, NM_001113378.1:c.3853C>T, NM_001113378.1:c.3626_3627delGT, NM_001113378.1:c.3854G>AFanconi anemia complementation group I follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCI gene located on chromosomal region 15q26.1. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
FANCLFanconi anemia, complementation group LNM_018062.3NM_018062.3:c.1051_1052delAG, NM_018062.3:c.1066_1067delAG, NM_018062.3:c.1096_1099dupATTA, NM_018062.3:c.1099_1100insATTAFanconi anemia complementation group L follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCL gene located on chromosomal region 2p16.1. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
FANCMFanconi anemia, complementation group MNM_020937.2NM_020937.2:c.2171C>A, NM_020937.2:c.5766_5769delGACT, NM_020937.2:c.5101C>T, NM_020937.2:c.1072G>T, NM_020937.2:c.2996_2997insC, NM_020937.2:c.2586_2589delAAAA, NM_020937.2:c.5791C>T, NM_020937.2:c.624_625delAA, NM_020937.2:c.5569G>A, NM_020937.2:c.5764_5767delCTGAFanconi anemia complementation group M follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCM gene located on chromosomal region 14q21.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
FGACongenital fibrinogen deficiency (gene FGA)NM_021871.2NM_021871.2:c.1039C>T, NM_021871.2:c.1441delG, NM_021871.2:c.*675_*676insC, NM_021871.2:c.1359dupC, NM_021871.2:c.*1086delG, NM_021871.2:c.1906_1907insCCongenital fibrinogen deficiency (gene FGA) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGA gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000.600
FGBCongenital afibrinogenemiaNM_005141.4NM_005141.4:c.1289G>A, NM_005141.4:c.1148T>G, NM_005141.4:c.794C>TCongenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGB gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
FGD4Charcot-Marie-Tooth disease type 4HNM_139241.2NM_139241.2:c.1325G>A, NM_139241.2:c.893T>G, NM_139241.2:c.893T>C, NM_139241.2:c.670C>TCharcot-Marie-Tooth disease type 4H follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGD4 gene located on chromosomal region 12p11.21. The age of onset is neonatal/infantile. This disease is characterized by slowly progressive muscle weakness in the distal extremities, and other common features include delayed walking, an abnormal gait, scoliosis and pes equines with toe retraction. The prevalence is 1/3,300.600
FHFumaric aciduriaNM_000143.3NM_000143.3:c.1067T>A, NM_000143.3:c.697C>T, NM_000143.3:c.698G>A, NM_000143.3:c.1236+1G>C, NM_000143.3:c.901dupA, NM_000143.3:c.320A>C, NM_000143.3:c.760C>T, NM_000143.3:c.1431_1433dupAAA, NM_000143.3:c.521C>G, NM_000143.3:c.1093A>G, NM_000143.3:c.1189G>A, NM_000143.3:c.1200delT, NM_000143.3:c.1394A>G, NM_000143.3:c.1255T>C, NM_000143.3:c.793G>A, NM_000143.3:c.40_41insC, NM_000143.3:c.1446_1449delAAAG, NM_000143.3:c.1293delAFumaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FH gene located on chromosomal region 1q42.1. The age of onset is neonatal/infantile. This disease is characterized by hypotonia, severe psychomotor impairment, convulsions, respiratory distress, feeding difficulties and frequent cerebral malformations, along with a distinctive facies, although some patients present with only moderate intellectual impairment. The prevalence is below 1,000,000.600
FHL1Emery-Dreifuss muscular dystrophy type 6NM_001449.4NM_001449.4:c.625T>CEmery-Dreifuss muscular dystrophy tipe 6 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FHL1 gene located on chromosomal region Xq26. The age of onset is infantile. This disease is by muscular weakness and atrophy, with early joint contractures and cardiomyopathy. The prevalence is 1/1,000,000 to 9/1,000,000.600
FHL1Myopathy, reducing bodyNM_001449.4NM_001449.4:c.689-479G>A, NM_001449.4:c.310T>CReducing body myopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FH gene located on chromosomal region 1q42.1. The age of onset is neonatal/infantile. This disease is characterized by progressive muscle weakness and the presence of characteristic inclusion bodies in affected muscle fibres. The prevalence is below 1,000,000.600
FIG4Charcot-Marie-Tooth disease type 4JNM_014845.5NM_014845.5:c.592C>T, NM_014845.5:c.831_838delTAAATTTG, NM_014845.5:c.547C>T, NM_014845.5:c.501C>G, NM_014845.5:c.737G>A, NM_014845.5:c.122T>C, NM_014845.5:c.2296_2297insGCharcot-Marie-Tooth disease type 4J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by rapidly progressive, asymmetric motor neuron degeneration with slow nerve conduction velocities, weakness and paralysis, without sensory loss. The prevalence is 4/100,000 to 8/100,000.250,600
FIG4Yunis-Varon syndromeNM_014845.5NM_014845.5:c.311G>AYunis-Varon syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by skeletal defects, including cleidocranial dysplasia and digital anomalies, and severe neurologic involvement with neuronal loss. Enlarged cytoplasmic vacuoles are found in neurons, muscle, and cartilage. The disorder is usually lethal in infancy. The prevalence is 4/100,000 to 8/100,000.250,600
FKRPCongenital muscular dystrophy type 5BNM_024301.4NM_024301.4:c.235G>A, NM_024301.4:c.1343C>T, NM_024301.4:c.1387A>G, NM_024301.4:c.1154C>ACongenital muscular dystrophy type 5B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is neonatal/infantile. This disease is characterized by hypotonia, muscle wasting, weakness or delayed motor milestones. The prevalence is 1/14,500 to 1/123,000.250,600
FKRPLimb-girdle muscular dystrophy type 2I, autosomal recessiveNM_024301.4NM_024301.4:c.160C>TAutosomal recessive limb-girdle muscular dystrophy type 2I follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is infantile. This disease is characterized by proximal limb girdle weakness predominant in the legs, together with bilateral moderate scapulae winging, abdominal muscle weakness, waddling gait, calf hypertrophy, cardiomyopathy and respiratory insufficiency. The prevalence is 1/14,500 to 1/123,000.250,600
FKTNFukuyama congenital muscular dystrophyNM_001079802.1NM_001079802.1:c.1112A>G, NM_001079802.1:c.509C>A, NM_001079802.1:c.411C>A, NM_001079802.1:c.1167dupAFukuyama congenital muscular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKTN gene located on chromosomal region 9q31-q33. The age of onset is infantile. This disease is characterized by brain malformation (cobblestone lissencephaly), dystrophic changes in skeletal muscle, severe intellectual deficit, epilepsy and motor impairment. The annual incidence is 1/50,000 to 2:50,000 live births in Japans and the prevalence is 1:1,000,000- 9:1,000,000.600
FKTNMuscular dystrophy, limb girdle, type 2MNM_001079802.1NM_001079802.1:c.1380dupA, NM_001079802.1:c.766C>T, NM_001079802.1:c.527T>C, NM_001079802.1:c.340G>ALimb-girdle muscular dystrophy type 2M follows autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKTN gene located on chromosomal region 9q31-q33. The age of onset is from birth to early infancy. This disease is characterized by muscle weakness, joint contractures and spinal deformities. The prevalence is 1.92:100,000-3.68:100,000.600
FLNAFrontometaphyseal dysplasiaNM_001456.3NM_001456.3:c.4447_4448insAT, NM_001456.3:c.760G>A, NM_001456.3:c.3476A>C, NM_001456.3:c.3557C>TFronto-metaphyseal dysplasia (FMD) follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FLNA gene located on chromosomal region Xq28. The age of onset is neonatal/infancy This disease is characterized by a characteristic face (prominent supraorbital ridges, hypertelorism, downslanted palpebral fissures, broad nasal bridge, and micrognathia with anomalies of teeth) and skeletal anomalies (fusion of carpal bones, increased density of long bone diaphyses, flared metaphyses and scoliosis). The prevalence is <1 / 1,000,000.600
FLNAPeriventricular heterotopiaNM_001456.3NM_001456.3:c.4543C>T, NM_001456.3:c.7129C>T, NM_001456.3:c.7733-1G>C, NM_001456.3:c.7527_7528+6delAGGTGAGC, NM_001456.3:c.5108_5109delTCinsAA, NM_001456.3:c.2761C>T, NM_001456.3:c.4777_4778dupAAPeriventricular heterotopia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FLNA gene located on chromosomal region Xq28. The age of onset is neonatal/infancy This disease is a brain malformation, due to abnormal neuronal migration, in which a subset of neurons fails to migrate into the developing cerebral cortex and remains as nodules that line the ventricular surface. Classical form is a rare X-linked dominant disorder far more frequent in females who present normal intelligence to borderline intellectual deficit, epilepsy of variable severity and extra-central nervous system signs, especially cardiovascular defects or coagulopathy. The disorder is generally associated with prenatal lethality in males. The prevalence is <1 / 1,000,000.600
FLVCR1Ataxia, posterior column, with retinitis pigmentosaNM_014053.3NM_014053.3:c.361A>G, NM_014053.3:c.574T>C, NM_014053.3:c.739-2delAPosterior column ataxia - Retinitis pigmentosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FLVCR1 gene located on chromosomal region 1q32.3. The age of onset is childhood. This disease is characterized by sensory ataxia, proprioceptive loss and blindness. The prevalence is <1 / 1.000.000.600
FMR1Fragile X syndrome-(CGG)n pre-mutated allele (Detection by PCR and TP-PCR)Fragile X syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FMR1 gene located on chromosomal region Xq27.3. The symptoms are variable depending on the range of CGG triplet expansion. In complete mutation the onset is infantile in men and is characterized by intellectual disability, characteristic appearance (large head, long face, prominent forehead and chin, protruding ears) joint laxity and large testes after puberty. In carrier female, the symptoms are milder and include primary ovarian insufficiency. The prevalence is 1/2,500 (full mutation allele) to 1/4,000 (prevalence of symptomatic cases) for both genders.250,600
FOXN1T-cell immunodeficiency, congenital alopecia, and nail dystrophyNM_003593.2NM_003593.2:c.763C>TSevere T-cell immunodeficiency - congenital alopecia - nail dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FOXN1 gene located on chromosomal region 17q11.2. The age of onset is infantile. This disease is characterized by T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. The prevalence is <1:1,000,000.600
FRAS1Fraser syndromeNM_025074.6NM_025074.6:c.7813C>T, NM_025074.6:c.832_835delTGTG, NM_025074.6:c.11159_11166delAGCTGGAG, NM_025074.6:c.776T>G, NM_025074.6:c.6991_6992insGG, NM_025074.6:c.6433C>T, NM_025074.6:c.3799C>T, NM_025074.6:c.1071+1_1071+4delGTGA, NM_025074.6:c.4969+1_4969+2insTAGC, NM_025074.6:c.5605_5606insTFraser syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the genes FRAS1 (located on chromosomal region 4q21.21) and FREM2 (located on chromosomal region 13q13.3). The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000.250,600
FREM2Fraser syndromeNM_207361.5NM_207361.5:c.2361_2362insC, NM_207361.5:c.8409+1G>A, NM_207361.5:c.5914G>A, NM_207361.5:c.5920G>A, NM_207361.5:c.3792_3795delTTATFraser syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the genes FRAS1 (located on chromosomal region 4q21.21) and FREM2 (located on chromosomal region 13q13.3). The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000.600
FUCA1FucosidosisNM_000147.4NM_000147.4:c.244C>T, NM_000147.4:c.1279C>T, NM_000147.4:c.856C>T, NM_000147.4:c.648C>A, NM_000147.4:c.1229T>G, NM_000147.4:c.433T>CFucosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FUCA1 gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is characterized by facial dysmorphism, dysostosis multiplex, moderate hepatomegaly, severe intellectual deficit, deafness, and according to age, angiokeratomas. The prevalence is <1:1,000,000.600
FXNFriedreich ataxiaNM_000144.4NM_000144.4:c.389G>T, NM_000144.4:c.460A>T, NM_000144.4:c.385-2A>G, NM_000144.4:c.317T>GFriedreich ataxia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FXN gene located on chromosomal region 9q21.11. The age of onset is between age 10 and 15 years and usually before age 25 years. This disease is characterized by slowly progressive ataxia, dysarthria, muscle weakness, spasticity in the lower limbs, scoliosis, bladder dysfunction, absent lower limb reflexes, and loss of position and vibration sense. The prevalence is 2:100,000-4:100,000.600
G6PCGlycogen storage disease type 1aNM_000151.3NM_000151.3:c.508C>T, NM_000151.3:c.551G>A, NM_000151.3:c.447-1G>A, NM_000151.3:c.1039C>T, NM_000151.3:c.562G>C, NM_000151.3:c.380_381insTA, NM_000151.3:c.497T>G, NM_000151.3:c.247C>T, NM_000151.3:c.113A>T, NM_000151.3:c.229T>C, NM_000151.3:c.230+1G>C, NM_000151.3:c.47C>G, NM_000151.3:c.883C>T, NM_000151.3:c.370G>A, NM_000151.3:c.626A>G, NM_000151.3:c.248G>AGlycogen storage disease type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000.250,600
G6PC3Severe congenital neutropenia type 4NM_138387.3NM_138387.3:c.346A>G, NM_138387.3:c.141C>G, NM_138387.3:c.778G>C, NM_138387.3:c.758G>A, NM_138387.3:c.935_936insT, NM_138387.3:c.784G>CSevere congenital neutropenia type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC3 gene located on chromosomal region 17q21.31. This disease is characterized by familial pulmonary arterial hypertension, cardiac abnormalities including atrial septal defect, leukopenia including intermittent neutropenia, lymphopenia, monocytosis, and anemia. The prevalence is 1:100,000.600
GAAGlycogen storage disease type 2NM_000152.3NM_000152.3:c.118C>T, NM_000152.3:c.1316T>A, NM_000152.3:c.1799G>A, NM_000152.3:c.1827_1828insA, NM_000152.3:c.1846_1847insA, NM_000152.3:c.1115A>T, NM_000152.3:c.1552-3C>G, NM_000152.3:c.1445C>T, NM_000152.3:c.2238G>C, NM_000152.3:c.1327-2A>G, NM_000152.3:c.1650dupG, NM_000152.3:c.2238G>A, NM_000152.3:c.307T>G, NM_000152.3:c.230_240delCAGTGCCCACA, NM_000152.3:c.2512C>T, NM_000152.3:c.1431delT, NM_000152.3:c.1561G>A, NM_000152.3:c.1465G>A, NM_000152.3:c.1548G>A, NM_000152.3:c.546G>A, NM_000152.3:c.1064T>C, NM_000152.3:c.877G>A, NM_000152.3:c.925G>A, NM_000152.3:c.768_769insT, NM_000152.3:c.2560C>T, NM_000152.3:c.655G>A, NM_000152.3:c.1408_1410delAAC, NM_000152.3:c.953T>C, NM_000152.3:c.1933G>T, NM_000152.3:c.1935C>A, NM_000152.3:c.1585_1586delTCinsGT, NM_000152.3:c.1927G>A, NM_000152.3:c.2041-1G>A, NM_000152.3:c.2066_2070dupAGCCG, NM_000152.3:c.2105G>T, NM_000152.3:c.2237G>A, NM_000152.3:c.525delT, NM_000152.3:c.546+1_546+4delGTGG, NM_000152.3:c.2544delC, NM_000152.3:c.1912G>T, NM_000152.3:c.1634C>T, NM_000152.3:c.710C>T, NM_000152.3:c.2015G>A, NM_000152.3:c.546G>C, NM_000152.3:c.2012T>G, NM_000152.3:c.853C>T, NM_000152.3:c.697delAGlycogen storage disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAA gene located on chromosomal region 17q25.3. There are two forms: adult and infantile.The age of onset in this last form is before the age of three months. This disease is characterized by severe hypotonia, hypertrophic cardiomyopathy and progressive hepatomegaly. The incidence is 1/57,000 for the adult form and 1/138,000 for infantile form.250,600
GALCKrabbe diseaseNM_000153.3NM_000153.3:c.1591C>T, NM_000153.3:c.1161+2T>G, NM_000153.3:c.1586C>T, NM_000153.3:c.1592G>A, NM_000153.3:c.1489+1_1489+2delGT, NM_000153.3:c.582+1G>A, NM_000153.3:c.388G>A, NM_000153.3:c.430delA, NM_000153.3:c.1695delT, NM_000153.3:c.1472delA, NM_000153.3:c.1004A>G, NM_000153.3:c.1153G>T, NM_000153.3:c.658C>T, NM_000153.3:c.1543G>A, NM_000153.3:c.332G>A, NM_000153.3:c.334A>G, NM_000153.3:c.205C>T, NM_000153.3:c.1796T>G, NM_000153.3:c.1814dupA, NM_000153.3:c.1700A>C, NM_000153.3:c.1723_1724insT, NM_000153.3:c.1964delC, NM_000153.3:c.236G>A, NM_000153.3:c.1488_1489+2delTGGT, NM_000153.3:c.453G>A, NM_000153.3:c.1488_1489delTG, NM_000153.3:c.628A>T, NM_000153.3:c.655C>T, NM_000153.3:c.953C>G, NM_000153.3:c.2056T>CKrabbe disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALC gene located on chromosomal region 14q31.3. There are two forms of the disease: infantile form (2-6 months onset) more severe and adult form less severe. It is a degenerative disorder that affects the nervous system characterized by a muscle stiffness, blindness, deafness, and eventually death. The incidence is 1/100,000-1/250,000 and the prevalence is 1/100,000.250,600
GALTGalactosemiaNM_000155.3NM_000155.3:c.130G>A, NM_000155.3:c.132delG, NM_000155.3:c.118G>T, NM_000155.3:c.265T>G, NM_000155.3:c.289_291delAAC, NM_000155.3:c.1138T>C, NM_000155.3:c.113A>C, NM_000155.3:c.152G>A, NM_000155.3:c.1048delA, NM_000155.3:c.290A>G, NM_000155.3:c.221T>C, NM_000155.3:c.253-2A>G, NM_000155.3:c.425T>A, NM_000155.3:c.428C>T, NM_000155.3:c.442C>T, NM_000155.3:c.143G>C, NM_000155.3:c.443G>A, NM_000155.3:c.158G>A, NM_000155.3:c.18delC, NM_000155.3:c.199C>T, NM_000155.3:c.200G>A, NM_000155.3:c.203A>C, NM_000155.3:c.218_219delCT, NM_000155.3:c.512T>C, NM_000155.3:c.547C>A, NM_000155.3:c.552C>A, NM_000155.3:c.563A>G, NM_000155.3:c.565_578delGTATGGGCCAGCAG, NM_000155.3:c.568T>C, NM_000155.3:c.580T>C, NM_000155.3:c.584T>C, NM_000155.3:c.598delC, NM_000155.3:c.601C>T, NM_000155.3:c.602G>A, NM_000155.3:c.1030C>A, NM_000155.3:c.510C>A, NM_000155.3:c.617A>G, NM_000155.3:c.619C>T, NM_000155.3:c.626A>G, NM_000155.3:c.634C>T, NM_000155.3:c.688-2A>C, NM_000155.3:c.692G>A, NM_000155.3:c.292G>A, NM_000155.3:c.329-2A>C, NM_000155.3:c.367C>T, NM_000155.3:c.377+7A>C, NM_000155.3:c.386T>C, NM_000155.3:c.607G>A, NM_000155.3:c.610C>T, NM_000155.3:c.413C>T, NM_000155.3:c.416T>G, NM_000155.3:c.41delinsTT, NM_000155.3:c.904+1G>T, NM_000155.3:c.905-2A>G, NM_000155.3:c.907G>A, NM_000155.3:c.442G>A, NM_000155.3:c.947G>A, NM_000155.3:c.443G>C, NM_000155.3:c.445dupG, NM_000155.3:c.997C>G, NM_000155.3:c.997C>T, NM_000155.3:c.998G>A, NM_000155.3:c.793C>G, NM_000155.3:c.820+13A>G, NM_000155.3:c.1052delC, NM_000155.3:c.844C>G, NM_000155.3:c.855G>T, NM_000155.3:c.719_728delTAGTACTGGT, NM_000155.3:c.772C>T, NM_000155.3:c.939G>A, NM_000155.3:c.71_72insA, NM_000155.3:c.404C>T, NM_000155.3:c.508-1G>C, NM_000155.3:c.775C>T, NM_000155.3:c.400delT, NM_000155.3:c.502_504delGTG, NM_000155.3:c.957C>A, NM_000155.3:c.823C>G, NM_000155.3:c.505C>A, NM_000155.3:c.1006A>T, NM_000155.3:c.985T>C, NM_000155.3:c.790delC, NM_000155.3:c.790_792delinsTAGGalactosemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALT gene located on chromosomal region 9p13.3. The age of onset is neonatal. This disease is characterized by feeding difficulties, lethargy, and severe liver disease. Long-term complications appear including cognitive impairments, motor deficits, and ovarian dysfunction with reduced fertility in women and diminished bone density. The prevalence is 1/40,000-1/60,000.250,600
GAMTGuanidinoacetate methyltransferase deficiencyNM_000156.5NM_000156.5:c.506G>A, NM_000156.5:c.590T>CGuanidinoacetate methyltransferase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAMT gene located on chromosomal region 19p13.3. The age of onset is infantile. This disease is characterized by intellectual disability, seizures and behavioral problems, often in conjunction with pyramidal and/or extrapyramidal manifestations with muscular hypotony. Biochemical symptoms are also included with high urinary excretion of guanidinoacetate, low urinary excretion of creatinine and creatine depletion in brain and muscles.600
GANGiant axonal neuropathyNM_022041.3NM_022041.3:c.1447C>T, NM_022041.3:c.1456G>A, NM_022041.3:c.1684C>G, NM_022041.3:c.1429C>T, NM_022041.3:c.601C>T, NM_022041.3:c.413G>A, NM_022041.3:c.505G>A, NM_022041.3:c.1268T>CGiant axonal neuropathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAN gene located on chromosomal region 16q23.2. The age of onset is infantile. This disease is characterized by a progressive motor and sensitive peripheral and central nervous system neuropathy. Twenty families have been reported with this disease but the frequency is likely to be under-estimated.250,600
GBAGaucher diseaseNM_001005741.2NM_001005741.2:c.1093G>A, NM_001005741.2:c.1090G>A, NM_001005741.2:c.1043C>T, NM_001005741.2:c.1274dupA, NM_001005741.2:c.1098dupA, NM_001005741.2:c.1085C>T, NM_001005741.2:c.1102C>T, NM_001005741.2:c.1049A>G, NM_001005741.2:c.1240G>T, NM_001005741.2:c.1246G>A, NM_001005741.2:c.1301G>C, NM_001005741.2:c.1088T>C, NM_001005741.2:c.1348T>A, NM_001005741.2:c.1361C>G, NM_001005741.2:c.1342G>C, NM_001005741.2:c.1448T>C, NM_001005741.2:c.1448T>G, NM_001005741.2:c.1504C>T, NM_001005741.2:c.1447_1466delCTGGACGCAGTGGCACTGATinsTG, NM_001005741.2:c.254G>A, NM_001005741.2:c.259C>T, NM_001005741.2:c.1053G>T, NM_001005741.2:c.160G>T, NM_001005741.2:c.431T>G, NM_001005741.2:c.475C>T, NM_001005741.2:c.476G>A, NM_001005741.2:c.481C>T, NM_001005741.2:c.487delG, NM_001005741.2:c.497A>T, NM_001005741.2:c.508C>T, NM_001005741.2:c.1141T>G, NM_001005741.2:c.115+1G>A, NM_001005741.2:c.1171G>C, NM_001005741.2:c.1174C>G, NM_001005741.2:c.354G>C, NM_001005741.2:c.1060G>C, NM_001005741.2:c.1208G>C, NM_001005741.2:c.1228C>G, NM_001005741.2:c.123A>G, NM_001005741.2:c.1240G>C, NM_001005741.2:c.914delC, NM_001005741.2:c.517A>C, NM_001005741.2:c.1295G>T, NM_001005741.2:c.1307T>C, NM_001005741.2:c.1265_1319del, NM_001005741.2:c.1319C>T, NM_001005741.2:c.1309G>T, NM_001005741.2:c.1226A>G, NM_001005741.2:c.407C>A, NM_001005741.2:c.1343A>T, NM_001005741.2:c.84_85insG, NM_001005741.2:c.518C>T, NM_001005741.2:c.1391A>C, NM_001005741.2:c.509G>T, NM_001005741.2:c.1604G>A, NM_001005741.2:c.84dupG, NM_001005741.2:c.535G>C, NM_001005741.2:c.586A>C, NM_001005741.2:c.1297G>T, NM_001005741.2:c.1184C>T, NM_001005741.2:c.1192C>TGaucher disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBA gene located on chromosomal region 1q22. Gaucher disease encompasses a continuum of clinical findings from a perinatal lethal disorder to an asymptomatic type. There are three major clinical types (1, 2, and 3) and two other subtypes (perinatal-lethal and cardiovascular). Type 1 is characterized by the presence of clinical or radiographic evidence of bone disease, hepatosplenomegaly, anemia and thrombocytopenia, lung disease, and the absence of primary central nervous system disease. GD types 2 and 3 are characterized by the presence of primary neurologic disease. Type 2 has an onset before age two years, limited psychomotor development, and a rapidly progressive course with death by age two to four years. Type 3 may have onset before age two years, but often have a more slowly progressive course, with survival into the third or fourth decade. The perinatal-lethal form is associated with ichthyosiform or collodion skin abnormalities or with nonimmune hydrops fetalis. The cardiovascular form is characterized by calcification of the aortic and mitral valves, mild splenomegaly, corneal opacities, and supranuclear ophthalmoplegia. Cardiopulmonary complications have been described with all the clinical subtypes, although varying in frequency and severity. The incidence is 1/60,000 and the prevalence is approximately 1/100,000.250,600
GBE1Glycogen storage disease type 4NM_000158.3NM_000158.3:c.1571G>A, NM_000158.3:c.1570C>T, NM_000158.3:c.1774G>T, NM_000158.3:c.771T>A, NM_000158.3:c.1543C>T, NM_000158.3:c.1883A>G, NM_000158.3:c.2052+1G>A, NM_000158.3:c.986A>C, NM_000158.3:c.466_470delCGTAT, NM_000158.3:c.1604A>GGlycogen storage disease type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is infantile. This disease is characterized by failure to thrive; hepatomegaly, liver dysfunction, and progressive liver cirrhosis; hypotonia; cardiomyopathy and, finally, death.250,600
GBE1Polyglucosan body disease, adultNM_000158.3NM_000158.3:c.986A>GPolyglucosan body disease, adult form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is late-onset, slowly progressive disorder affecting the central and peripheral nervous systems. This disease is characterized by a variable combination of cognitive impairment, pyramidal tetraparesis, peripheral neuropathy, and neurogenic bladder. Other manifestations include cerebellar dysfunction and extrapyramidal signs.250,600
GCDHGlutaric acidemia type 1NM_000159.3NM_000159.3:c.1093G>A, NM_000159.3:c.1060G>C, NM_000159.3:c.542A>G, NM_000159.3:c.442G>A, NM_000159.3:c.1199dupT, NM_000159.3:c.572T>C, NM_000159.3:c.1060G>A, NM_000159.3:c.1247C>T, NM_000159.3:c.74C>A, NM_000159.3:c.947C>A, NM_000159.3:c.1168G>C, NM_000159.3:c.416C>T, NM_000159.3:c.1198G>A, NM_000159.3:c.636-1G>A, NM_000159.3:c.1204C>T, NM_000159.3:c.1244-2A>C, NM_000159.3:c.751C>T, NM_000159.3:c.1262C>T, NM_000159.3:c.1148G>A, NM_000159.3:c.680G>C, NM_000159.3:c.883T>C, NM_000159.3:c.1015A>G, NM_000159.3:c.764C>T, NM_000159.3:c.271+1G>A, NM_000159.3:c.743C>T, NM_000159.3:c.877G>A, NM_000159.3:c.914C>T, NM_000159.3:c.1002_1003delGA, NM_000159.3:c.383G>A, NM_000159.3:c.769C>TGlutaric acidemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCDH gene located on chromosomal region 19p13.2. The age of onset is infantile or neonatal. This disease is characterized by encephalopathic crises resulting in striatal injury and a severe dystonic dyskinetic movement disorder. The prevalence is 1 in 100,000 births.250,600
GCSHGlycine encephalopathy (GCSH)NM_004483.4NM_004483.4:c.337dupTGlycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCSH gene located on chromosomal region 16q23.2. The age of onset is neonatal. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures.600
GDAP1Charcot-Marie-Tooth disease type 4ANM_018972.2NM_018972.2:c.358C>T, NM_018972.2:c.487C>T, NM_018972.2:c.311-1G>A, NM_018972.2:c.844C>T, NM_018972.2:c.715C>T, NM_018972.2:c.92G>ACharcot-Marie-Tooth disease type 4A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GDAP1 gene located on chromosomal region 8q21.11. It is a severe, early-onset form of demyelinating CMT peripheral sensorimotor polyneuropathy characterized by severe motor retardation and progressive scoliosis. Vocal cord paresis may also occur.600
GFM1Combined oxidative phosphorylation deficiency type 1NM_024996.5NM_024996.5:c.1294_1297delACAG, NM_024996.5:c.748C>T, NM_024996.5:c.139C>T, NM_024996.5:c.1528_1529delAG, NM_024996.5:c.521A>GCombined oxidative phosphorylation deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GFM1 gene located on chromosomal region 3q25.32. The age of onset is from early infancy until adult. This disease is characterized by ptosis, external ophthalmoplegia, proximal myopathy and exercise intolerance, cardiomyopathy, sensorineural deafness, optic atrophy, pigmentary retinopathy, and diabetes mellitus.600
GJA1Oculodentodigital dysplasiaNM_000165.4NM_000165.4:c.227G>A, NM_000165.4:c.97C>TOculodentodigital dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJA1 gene located on chromosomal region 6q22.31. The age of onset is infantile. This disease is characterized by craniofacial, neurologic, limb and ocular abnormalities.600
GJB2Deafness type 1A, autosomal recessiveNM_004004.5NM_004004.5:c.176_191delGCTGCAAGAACGTGTG, NM_004004.5:c.169C>T, NM_004004.5:c.270dupA, NM_004004.5:c.239A>C, NM_004004.5:c.269T>C, NM_004004.5:c.427C>T, NM_004004.5:c.299_300delAT, NM_004004.5:c.250G>T, NM_004004.5:c.230G>A, NM_004004.5:c.516G>A, NM_004004.5:c.439G>A, NM_004004.5:c.465T>A, NM_004004.5:c.229T>C, NM_004004.5:c.241C>G, NM_004004.5:c.235delC, NM_004004.5:c.238C>T, NM_004004.5:c.557C>T, NM_004004.5:c.269_270insT, NM_004004.5:c.617A>G, NM_004004.5:c.231G>A, NM_004004.5:c.310_323delAGGAAGTTCATCAA, NM_004004.5:c.313_326delAAGTTCATCAAGGG, NM_004004.5:c.358_360delGAG, NM_004004.5:c.35delG, NM_004004.5:c.249C>G, NM_004004.5:c.334_335delAA, NM_004004.5:c.402delG, NM_004004.5:c.413G>A, NM_004004.5:c.416G>A, NM_004004.5:c.299A>T, NM_004004.5:c.250G>C, NM_004004.5:c.550C>T, NM_004004.5:c.551G>C, NM_004004.5:c.503A>G, NM_004004.5:c.227T>C, NM_004004.5:c.380G>A, NM_004004.5:c.132G>A, NM_004004.5:c.365A>T, NM_004004.5:c.139G>TDeafness, autosomal recessive type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 and GJB3 genes located on chromosomal regions 13q12.11 and 1p34.3 respectively. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.250,600
GJB3Deafness type 1A, autosomal recessiveNM_024009.2NM_024009.2:c.529T>G, NM_024009.2:c.580G>A, NM_024009.2:c.94C>TDeafness, autosomal recessive type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 and GJB3 genes located on chromosomal regions 13q12.11 and 1p34.3 respectively. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.250,600
GJB6Deafness type 1B, autosomal recessiveNM_006783.4NM_006783.4:c.261dupA, NM_006783.4:c.169C>T, NM_006783.4:c.485dupA, NM_006783.4:c.689dupA, NM_006783.4:c.14C>T, NM_006783.4:c.443delC, NM_006783.4:c.383_384delTA, NM_006783.4:c.689_690insANonsyndromic sensorineural deafness, autosomal recessive type DFNB1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB6 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.250,600
GJC2Pelizaeus-Merzbacher-like disease type 1NM_020435.3NM_020435.3:c.857T>C, NM_020435.3:c.814T>G, NM_020435.3:c.613C>T, NM_020435.3:c.787G>A, NM_020435.3:c.718C>T, NM_020435.3:c.268C>TPelizaeus-Merzbacher-like disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJC2 gene located on chromosomal region 1q42.13. It is an autosomal recessive leukodystrophy sharing identical clinical and radiological features as X-linked Pelizaeus-Merzbacher disease. The age of onset is early infantile. This disease is characterized by nystagmus, delayed motor milestones, ataxia, progressive spasticity, partial seizures, mild peripheral neuropathy, and diffuse leukodystrophy. The prevalence is <1.27:100,000.600
GLB1GM1 GangliosidosisNM_000404.2NM_000404.2:c.1369C>T, NM_000404.2:c.1370G>A, NM_000404.2:c.1452C>G, NM_000404.2:c.176G>A, NM_000404.2:c.276G>A, NM_000404.2:c.1733A>G, NM_000404.2:c.1355dupA, NM_000404.2:c.442C>A, NM_000404.2:c.202C>T, NM_000404.2:c.591_592insT, NM_000404.2:c.622C>T, NM_000404.2:c.1549G>T, NM_000404.2:c.442C>T, NM_000404.2:c.457+2T>C, NM_000404.2:c.947A>G, NM_000404.2:c.438_440delTCT, NM_000404.2:c.601C>T, NM_000404.2:c.602G>A, NM_000404.2:c.1068+1G>T, NM_000404.2:c.1174_1175delCT, NM_000404.2:c.1004C>T, NM_000404.2:c.1051C>T, NM_000404.2:c.171C>G, NM_000404.2:c.1321G>A, NM_000404.2:c.1325G>A, NM_000404.2:c.818G>T, NM_000404.2:c.152T>C, NM_000404.2:c.1456_1466dupGGTGCATATAT, NM_000404.2:c.145C>T, NM_000404.2:c.175C>T, NM_000404.2:c.901G>A, NM_000404.2:c.1646C>T, NM_000404.2:c.1577dupG, NM_000404.2:c.1310A>TGangliosidosis GM1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. Although the three types differ in severity, their features can overlap significantly. The age of onset in type 1 is infantile, in type 2 is late-infantile or juvenile and adult in type3. This disease is characterized by arrest/regression of neurological development, hypotonia, visceromegaly, macular cherry-red spots, dysostosis and coarse facial features. The prevalence is 1:100,000 a 200,000 newborn.250,600
GLB1Mucopolysaccharidosis type 4BNM_000404.2NM_000404.2:c.1444C>T, NM_000404.2:c.1313G>A, NM_000404.2:c.817T>C, NM_000404.2:c.1445G>A, NM_000404.2:c.1223A>CMucopolysaccharidosis type 4B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. The age of onset is variable infantile/juvenile. In addition to skeletal involvement, significant morbidity can result from respiratory compromise, obstructive sleep apnea, valvular heart disease, hearing impairment, corneal clouding, and spinal cord compression. The prevalence is 1:200,000-1:300,000.250,600
GLDCGlycine encephalopathyNM_000170.2NM_000170.2:c.322G>T, NM_000170.2:c.1229G>A, NM_000170.2:c.1545G>C, NM_000170.2:c.1691G>T, NM_000170.2:c.1166C>T, NM_000170.2:c.2113G>A, NM_000170.2:c.2284G>A, NM_000170.2:c.1705G>A, NM_000170.2:c.2216G>A, NM_000170.2:c.2405C>TGlycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMT and GLDC genes located on chromosomal regions 3p21.31 and 9p24.1 respectively. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000.250,600
GLE1Lethal arthrogryposis with anterior horn cell diseaseNM_001003722.1NM_001003722.1:c.2051T>C, NM_001003722.1:c.1412_1413delAG, NM_001003722.1:c.898-2A>G, NM_001003722.1:c.2069_2072delTTCT, NM_001003722.1:c.1807C>TLethal arthrogryposis with anterior horn cell disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLE1 gene located on chromosomal region 9q34.11. The age of onset is fetal. This disease is characterized by fetal akinesia, arthrogryposis and motor neuron loss. The fetus often survives delivery, but dies early as a result of respiratory failure. Neuropathological findings resemble those of lethal congenital contracture syndrome type 1, but are less severe.250,600
GM2AGM2 GangliosidosisNM_000405.4NM_000405.4:c.285delC, NM_000405.4:c.160G>T, NM_000405.4:c.506G>CGM2-gangliosidosis, AB variant follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GM2A gene located on chromosomal region 5q33.1. The age of onset is infantile. This disease is characterized by a group of neurodegenerative disorders: seizures, blindness, spasticity, eventual total incapacitation, and death. The prevalence is <1:100.000.600
GNEDistal myopathy Nonaka typeNM_005476.5NM_005476.5:c.2116T>C, NM_005476.5:c.2135T>C, NM_005476.5:c.2086G>A, NM_005476.5:c.478C>T, NM_005476.5:c.1844C>G, NM_005476.5:c.737G>A, NM_005476.5:c.385C>T, NM_005476.5:c.1714G>T, NM_005476.5:c.1798G>A, NM_005476.5:c.2086G>T, NM_005476.5:c.787C>T, NM_005476.5:c.2023T>C, NM_005476.5:c.1993G>A, NM_005476.5:c.673G>A, NM_005476.5:c.909T>A, NM_005476.5:c.1727G>ADistal myopathy, Nonaka type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNE gene located on chromosomal region 9p13.3. The age of onset is adult. This disease is characterized by progressive muscle weakness and joint deformity. The prevalence is 1:500-1:1,000.250,600
GNPTABMucolipidosis type 2/type 3NM_024312.4NM_024312.4:c.1931C>T, NM_024312.4:c.1799delC, NM_024312.4:c.3503_3504delTC, NM_024312.4:c.3173C>G, NM_024312.4:c.25C>T, NM_024312.4:c.3663delG, NM_024312.4:c.1906dupA, NM_024312.4:c.2383delG, NM_024312.4:c.732_733delAA, NM_024312.4:c.749dupA, NM_024312.4:c.2896delA, NM_024312.4:c.648_651delAGAA, NM_024312.4:c.3326dupA, NM_024312.4:c.3410T>A, NM_024312.4:c.10A>C, NM_024312.4:c.1000C>T, NM_024312.4:c.1196C>T, NM_024312.4:c.1759C>T, NM_024312.4:c.3565C>T, NM_024312.4:c.616_619delACAG, NM_024312.4:c.99delC, NM_024312.4:c.3598G>A, NM_024312.4:c.3560_3561delAGMucolipidosis type 2/type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNPTAB gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by growth retardation, skeletal abnormalities, facial dysmorphism, stiff skin, developmental delay and cardiomegaly and that is lethal in childhood. The prevalence is 1:123,500-1:625,500.250,600
GNSMucopolysaccharidosis type 3DNM_002076.3NM_002076.3:c.1063C>T, NM_002076.3:c.1226dupG, NM_002076.3:c.1169delA, NM_002076.3:c.1168C>T, NM_002076.3:c.413C>GMucolipidosis type 3D (Sanfilippo disease) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNS gene located on chromosomal region 12q14.3. The age of onset is infantile. This disease is characterized by joint stiffness and pain initially in the shoulders, hips, and fingers; and gradual mild coarsening of facial features, cardiorespiratory complications and mild cognitive impairment. The incidence is 1:70,000 newborn.600
GPR143Ocular albinism, X-linkedNM_000273.2NM_000273.2:c.992_993insCG, NM_000273.2:c.695C>AX-linked recessive ocular albinism follows an X-linked pattern of inheritance and is caused by pathogenic variants in the GPR143 gene located on chromosomal region Xp22.2. The age of onset is infantile. This disease is characterized by ocular hypopigmentation, foveal hypoplasia, nystagmus, photodysphoria, and reduced visual acuity. The prevalence is 1/60,000 to 1/150,000 live male births.600
GPR179Night blindness, congenital stationary type 1ENM_001004334.3NM_001004334.3:c.1784+1G>A, NM_001004334.3:c.1368delT, NM_001004334.3:c.3656_3657delCT, NM_001004334.3:c.6847_6848delCT, NM_001004334.3:c.984delC, NM_001004334.3:c.1807C>T, NM_001004334.3:c.278_279insC, NM_001004334.3:c.5693_5694insT, NM_001004334.3:c.278delC, NM_001004334.3:c.1236G>A, NM_001004334.3:c.376G>C, NM_001004334.3:c.3233_3234delCT, NM_001004334.3:c.5763_5764delGA, NM_001004334.3:c.839_842delATCA, NM_001004334.3:c.4699_4700delAGCongenital stationary night blindness type 1E follow an autosomal recessive, dominant or X-linked pattern of inheritance and is caused by pathogenic variants in the GPR179 gene located on chromosomal region 17q12. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity.250,600
GPR98Usher syndrome type 2CNM_032119.3NM_032119.3:c.11377G>T, NM_032119.3:c.8713_8716dupAACA, NM_032119.3:c.2864C>A, NM_032119.3:c.18131A>G, NM_032119.3:c.2258_2270delAAGTGCTGAAATC, NM_032119.3:c.6275-1G>A, NM_032119.3:c.2636C>T, NM_032119.3:c.14973-1G>C, NM_032119.3:c.17668_17669delAT, NM_032119.3:c.5357_5358delAA, NM_032119.3:c.5747C>T, NM_032119.3:c.15196_15199dupCAAA, NM_032119.3:c.3151G>T, NM_032119.3:c.6901C>T, NM_032119.3:c.8790delC, NM_032119.3:c.5830G>A, NM_032119.3:c.6311_6312insTUsher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR98 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32 respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000.250,600
GRHPRPrimary hyperoxaluria type 2NM_012203.1NM_012203.1:c.103delG, NM_012203.1:c.295C>T, NM_012203.1:c.755dupA, NM_012203.1:c.622C>T, NM_012203.1:c.435G>APrimary hyperoxaluria type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRHPR gene located on chromosomal region 9p13.2. The age of onset is infantile. This disease is characterized by recurrent nephrolithiasis, nephrocalcinosis and end-stage renal disease with subsequent systemic oxalosis.600
GRM6Night blindness, congenital stationary type 1BNM_000843.3NM_000843.3:c.2341G>A, NM_000843.3:c.727_728insG, NM_000843.3:c.2213_2219delCCAGAGG, NM_000843.3:c.1861C>T, NM_000843.3:c.2560C>T, NM_000843.3:c.712C>T, NM_000843.3:c.2122C>T, NM_000843.3:c.719_720insG, NM_000843.3:c.1214T>C, NM_000843.3:c.1336C>T, NM_000843.3:c.1258C>T, NM_000843.3:c.1565G>ACongenital stationary night blindness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRM6 gene located on chromosomal region 5q35.3. The age of onset is early infancy. This disease is characterized by hemeralopia with a moderate loss of visual acuity.250,600
GRXCR1Deafness type 25, autosomal recessiveNM_001080476.2NM_001080476.2:c.229C>T, NM_001080476.2:c.190G>A, NM_001080476.2:c.710_711delATAutosomal recessive nonsyndromic sensorineural deafness type DFNB25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRXCR1 gene located on chromosomal region 4p13. The age of onset is infantile. This disease is characterized by hearing loss which is not associated visible abnormalities of the external ear or any related medical problems.600
GSSGlutathione synthetase deficiencyNM_000178.2NM_000178.2:c.656A>G, NM_000178.2:c.847C>T, NM_000178.2:c.754C>T, NM_000178.2:c.799C>T, NM_000178.2:c.4delG, NM_000178.2:c.656A>C, NM_000178.2:c.491G>A, NM_000178.2:c.832C>TGlutathione synthetase deficiency with 5-oxoprolinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GSS gene located on chromosomal region 20q11.22. The severity and age of onset are variable. This disease is characterized by affectation of the neutrophil respiratory burst and can increase host susceptibility to infections, is associated with hemolytic anemia and intellectual disability. The prevalence is <1:1,000,000.600
GUCY2DLeber congenital amaurosis type 1NM_000180.3NM_000180.3:c.1694T>C, NM_000180.3:c.2735_2736delTT, NM_000180.3:c.456C>A, NM_000180.3:c.622delC, NM_000180.3:c.2734_2735delTT, NM_000180.3:c.2945delGLeber congenital amaurosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUCY2D gene located on chromosomal region 17p13.1. The age of onset is infantile. This disease is characterized by blindness, nystagmus, roving eye movement and severe visual impairment.600
GUSBMucopolysaccharidosis type 7NM_000181.3NM_000181.3:c.1065+1G>T, NM_000181.3:c.1084G>A, NM_000181.3:c.1144C>T, NM_000181.3:c.1337G>A, NM_000181.3:c.1222C>T, NM_000181.3:c.1730G>T, NM_000181.3:c.1831C>T, NM_000181.3:c.1856C>T, NM_000181.3:c.1881G>T, NM_000181.3:c.442C>T, NM_000181.3:c.499C>T, NM_000181.3:c.526C>T, NM_000181.3:c.646C>T, NM_000181.3:c.820_821delAC, NM_000181.3:c.1061C>T, NM_000181.3:c.1050G>C, NM_000181.3:c.1534G>A, NM_000181.3:c.1244C>T, NM_000181.3:c.1219_1220insC, NM_000181.3:c.866G>A, NM_000181.3:c.1244+1G>A, NM_000181.3:c.1521G>A, NM_000181.3:c.1429C>T, NM_000181.3:c.1618G>T, NM_000181.3:c.1338G>AMucopolysaccharidosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUSB gene located on chromosomal region 7q11.21. The age of onset is variable. There are prenatal forms with non-immune hydrops fetalis, and severe neonatal forms with dysmorphism, hernias, hepatosplenomegaly, club feet, dysostosis, severe hypotonia and neurological disorders that ultimately lead to profound intellectual deficit and small stature in patients that survive. Finally, there are also very mild cases that are discovered during adolescence or adulthood following presentation with thoracic kyphosis. The prevalence is 1:250,000 in newborn.250,600
HADHATrifunctional protein deficiencyNM_000182.4NM_000182.4:c.1918C>T, NM_000182.4:c.274_278delTCATC, NM_000182.4:c.2131C>A, NM_000182.4:c.1793_1794delAT, NM_000182.4:c.1620+2_1620+6delTAAGG, NM_000182.4:c.2027G>A, NM_000182.4:c.1678C>T, NM_000182.4:c.2132_2133insC, NM_000182.4:c.2146+1G>A, NM_000182.4:c.919-2A>G, NM_000182.4:c.1644delC, NM_000182.4:c.1132C>T, NM_000182.4:c.1528G>C, NM_000182.4:c.499delA, NM_000182.4:c.845T>A, NM_000182.4:c.1422dupTMitochondrial trifunctional protein deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA and HADHB genes located on chromosomal region 2p23.3. The age of onset is neonatal/infancy. It is characterized by a wide clinical spectrum ranging from severe neonatal manifestations including cardiomyopathy, hypoglycemia, metabolic acidosis, skeletal myopathy and neuropathy, liver disease and death to a mild phenotype with peripheral polyneuropathy, episodic rhabdomyolysis and pigmentary retinopathy. The prevalence is <1 / 1,000,000.250,600
HADHBTrifunctional protein deficiencyNM_000183.2NM_000183.2:c.788A>G, NM_000183.2:c.1364T>G, NM_000183.2:c.1331G>AMitochondrial trifunctional protein deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA and HADHB genes located on chromosomal region 2p23.3. The age of onset is neonatal/infancy. It is characterized by a wide clinical spectrum ranging from severe neonatal manifestations including cardiomyopathy, hypoglycemia, metabolic acidosis, skeletal myopathy and neuropathy, liver disease and death to a mild phenotype with peripheral polyneuropathy, episodic rhabdomyolysis and pigmentary retinopathy. The prevalence is <1 / 1,000,000.600
HALHistidinemiaNM_002108.3NM_002108.3:c.890_891insT, NM_002108.3:c.146_152delATGACGC, NM_002108.3:c.1287+2T>C, NM_002108.3:c.102_103insGC, NM_002108.3:c.903+1G>AHistidinemia follows a pattern of inheritance and is caused by pathogenic variants in the HAL gene located on chromosomal region 12q23.1. The age of onset is infantile ans is characterized by high concentration of Histidine in blood and urine. This disease seems to be benign in most of cases but 2/3 of the patients could show mild development delay.600
HBAAlpha-thalassemia---MED, --SEA, --THAI, -α4.2, -α3.7, --FIL, -(α)20.5 (Detection by PCR)Alpha-thalassemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBA gene located on chromosomal region 16p13.3. The age of onset is infantile. It is characterized by impaired synthesis of alpha-globin chains leading to a variable clinical picture depending on the number of affected alleles. The disease can be classified into clinical subtypes of increasing severity: silent alpha thalassemia, alpha thalassemia trait (or alpha thalassemia minor), hemoglobin H disease (HbH), and Hb Bart's hydrops fetalis (see these terms). A rare form called alpha-thalassemia-intellectual deficit syndrome has also been identified (see these terms). Alpha thalassemia trait causes microcytosis and hypochromia with absent or mild anemia (often detected on routine blood tests), generally with no other symptoms. HbH patients develop moderate hemolytic anemia with variable amounts of HbH along with occasionally severe splenomegaly, sometimes complicated by hypersplenism. Hb Bart's hydrops fetalis involves a severe deficiency in alpha-globin with serious developmental implications. Alpha-thalassemia-intellectual deficit syndrome is characterized by very mild to severe anemia associated with developmental abnormalities. The prevalence is 1:10,000-5:10,000.600
HBBBeta-thalassemiaNM_000518.4NM_000518.4:c.135delC, NM_000518.4:c.118C>T, NM_000518.4:c.217dupA, NM_000518.4:c.92+5G>C, NM_000518.4:c.208G>A, NM_000518.4:c.85_86insC, NM_000518.4:c.92+5G>A, NM_000518.4:c.27dupG, NM_000518.4:c.126_129delCTTT, NM_000518.4:c.93-23T>C, NM_000518.4:c.92+1G>A, NM_000518.4:c.-50-u32C>T, NM_000518.4:c.82G>T, NM_000518.4:c.315+1G>A, NM_000518.4:c.52A>T, NM_000518.4:c.380T>A, NM_000518.4:c.93-21G>A, NM_000518.4:c.79G>A, NM_000518.4:c.112delT, NM_000518.4:c.92+6T>C, NM_000518.4:c.59A>G, NM_000518.4:c.364G>ABeta-thalassemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBB gene located on chromosomal region 11p15.4. The age of onset is infantile. Three main types of BT have been described, thalassemia minor is usually asymptomatic, thalassemia major is associated with splenomegaly and microcytic and hypochromic anemia and thalassemia intermedia, in which the anemia is less severe. The incidence is 1/100,000.250,600
HBBSickle cell anaemiaNM_000518.4NM_000518.4:c.19G>A, NM_000518.4:c.20A>TSickle cell anemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBB gene located on chromosomal region 11p15.4. The age of onset is infantile. This disease is characterized by chronic severe anemia, bacterial infections, and ischemic vaso-occlusive accidents. This results in tissue ischemia leading to acute and chronic pain as well as organ damage that can affect any organ in the body, including the bones, lungs, liver, kidneys, brain, eyes, and joints. The highest frequency of sickle cell disease is found in tropical regions, particularly sub-Saharan Africa, India and the Middle-East.250,600
HESX1Combined pituitary hormone deficiencies, genetic formsNM_003865.2NM_003865.2:c.374A>G, NM_003865.2:c.77T>C, NM_003865.2:c.445G>A, NM_003865.2:c.450_451delCA, NM_003865.2:c.18G>CCombined pituitary hormone deficiencies, genetic forms follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the HESX1 gene located on chromosomal region 3p14.3. The age of onset is infantile. These diseases are characterized by short stature, cognitive alterations or delayed puberty. The incidence is 1:3,000 and 1:4,000 births.250,600
HEXATay-Sachs diseaseNM_000520.4NM_000520.4:c.1176G>A, NM_000520.4:c.1495C>T, NM_000520.4:c.1177C>T, NM_000520.4:c.116T>G, NM_000520.4:c.1510delC, NM_000520.4:c.1496G>A, NM_000520.4:c.1260G>C, NM_000520.4:c.1351C>G, NM_000520.4:c.1511G>A, NM_000520.4:c.1499delT, NM_000520.4:c.1510C>T, NM_000520.4:c.380T>G, NM_000520.4:c.459+5G>A, NM_000520.4:c.508C>T, NM_000520.4:c.509G>A, NM_000520.4:c.532C>T, NM_000520.4:c.533G>A, NM_000520.4:c.533G>T, NM_000520.4:c.1528C>T, NM_000520.4:c.173G>A, NM_000520.4:c.1A>G, NM_000520.4:c.1A>T, NM_000520.4:c.1444G>A, NM_000520.4:c.1453T>C, NM_000520.4:c.739C>T, NM_000520.4:c.745C>T, NM_000520.4:c.749G>A, NM_000520.4:c.759_774dupGCTTGCAGAGTTTGAC, NM_000520.4:c.772G>C, NM_000520.4:c.1214_1215delinsG, NM_000520.4:c.78G>A, NM_000520.4:c.538T>C, NM_000520.4:c.540C>G, NM_000520.4:c.805G>A, NM_000520.4:c.915_917delCTT, NM_000520.4:c.254-1G>C, NM_000520.4:c.2T>C, NM_000520.4:c.1537C>T, NM_000520.4:c.1490A>G, NM_000520.4:c.77G>A, NM_000520.4:c.1422G>C, NM_000520.4:c.805+1G>A, NM_000520.4:c.805+1G>C, NM_000520.4:c.672+1G>A, NM_000520.4:c.629C>T, NM_000520.4:c.987G>A, NM_000520.4:c.632T>C, NM_000520.4:c.1278_1279insTATC, NM_000520.4:c.1274_1277dupTATC, NM_000520.4:c.986+3A>G, NM_000520.4:c.611A>G, NM_000520.4:c.1277_1278insTATTay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births.250,600
HEXBSandhoff diseaseNM_000521.3NM_000521.3:c.1310_1311delCA, NM_000521.3:c.1380G>A, NM_000521.3:c.1367A>C, NM_000521.3:c.1238_1242delCAAAG, NM_000521.3:c.298delC, NM_000521.3:c.1345delT, NM_000521.3:c.797A>G, NM_000521.3:c.1539_1540delCT, NM_000521.3:c.1375G>T, NM_000521.3:c.508C>T, NM_000521.3:c.1517_1529dupCAAGTGCTGTTGG, NM_000521.3:c.841C>T, NM_000521.3:c.202_203insGG, NM_000521.3:c.1250C>T, NM_000521.3:c.1619_1620insTTCATGTTATCTACAGACGTG, NM_000521.3:c.1537_1538delCT, NM_000521.3:c.170delG, NM_000521.3:c.115delG, NM_000521.3:c.171delG, NM_000521.3:c.850C>TSandhoff disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXB gene located on chromosomal region 5q13.3. The age of onset is adult or infantile. This disease is characterized by central nervous system degeneration, with startle reactions, early blindness, progressive motor and mental deterioration, macrocephaly and cherry-red spots on the macula. The prevalence is 1/130.000.250,600
HFEHaemochromatosisNM_000410.3NM_000410.3:c.18G>C, NM_000410.3:c.252G>A, NM_000410.3:c.989G>T, NM_000410.3:c.314T>C, NM_000410.3:c.193A>T, NM_000410.3:c.829G>A, NM_000410.3:c.277G>CHemochromatosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HFE gene located on chromosomal region 6p22.2. The age of onset is adult. This disease is characterized by chronic fatigue, bronzed skin pigmentation and tissue damage in the liver, pancreas, joints, bone, endocrine glands, heart. The prevalence is 1/200 - 1/1.000.250,600
HGDAlkaptonuriaNM_000187.3NM_000187.3:c.140C>T, NM_000187.3:c.16-1G>A, NM_000187.3:c.342+1G>A, NM_000187.3:c.1111_1112insC, NM_000187.3:c.899T>G, NM_000187.3:c.1189-2A>G, NM_000187.3:c.674G>A, NM_000187.3:c.175delA, NM_000187.3:c.283-5delT, NM_000187.3:c.172A>T, NM_000187.3:c.873C>A, NM_000187.3:c.283-4C>T, NM_000187.3:c.808G>A, NM_000187.3:c.1102A>G, NM_000187.3:c.469+2T>C, NM_000187.3:c.688C>T, NM_000187.3:c.481G>AAlkaptonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGD gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by darkening of the urine when it is left exposed to air, grey-blue colouration of the eye sclerae and the ear helix (ochronosis), and a disabling joint disease involving both the axial and peripheral joints (ochronotic arthropathy). The prevalence is 1:250,000-1:1.000.000 newborn.250,600
HGFDeafness type 39, autosomal recessiveNM_000601.4NM_000601.4:c.2028delA, NM_000601.4:c.1597C>TAutosomal recessive nonsyndromic sensorineural deafness type DFNB239 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGF gene located on chromosomal region 7q21.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.600
HGSNATMucopolysaccharidosis type 3CNM_152419.2NM_152419.2:c.1378-1G>A, NM_152419.2:c.1843G>A, NM_152419.2:c.607C>T, NM_152419.2:c.1250+1G>A, NM_152419.2:c.848C>T, NM_152419.2:c.1464+1G>A, NM_152419.2:c.1501delA, NM_152419.2:c.1030C>T, NM_152419.2:c.1503delA, NM_152419.2:c.1553C>T, NM_152419.2:c.1622C>T, NM_152419.2:c.493+1G>AMucopolysaccharidosis type 3C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGSNAT gene located on chromosomal region 8p11.21. The age of onset is infantile. This disease is characterized by defective or missing enzymes to break down mucopolysaccharides are missing or are defective. The prevalence is <1:70.000 newborn.250,600
HIBCH3-Hydroxyisobutryl-CoA hydrolase deficiencyNM_014362.3NM_014362.3:c.1012A>T, NM_014362.3:c.79-3C>G, NM_014362.3:c.494_495delTT, NM_014362.3:c.365A>G, NM_014362.3:c.220-9T>G3-Hydroxyisobutryl-CoA hydrolase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HIBCH gene located on chromosomal region 2q32.2. The age of onset is infantile. This disease is characterized by delayed motor development, hypotonia and progressive neurodegeneration. The prevalence is <1:1,000,000.600
HMGCL3-hydroxy-3-methylglutaric aciduriaNM_000191.2NM_000191.2:c.835G>A, NM_000191.2:c.230delT, NM_000191.2:c.122G>A, NM_000191.2:c.698A>G, NM_000191.2:c.206_207delCT, NM_000191.2:c.505_506delTC3-hydroxy-3-methylglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HMGCL gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is is an organic aciduria, due to deficiency of 3-hydroxy-3-methylglutaryl-CoA-lyase (a key enzyme in ketogenesis and leucine metabolism) usually presenting in infancy with episodes of metabolic decompensation triggered by periods of fasting or infections, which when left untreated are life-threatening and may lead to neurological sequelae.600
HPDTyrosinemia type 3NM_002150.2NM_002150.2:c.600C>G, NM_002150.2:c.774T>G, NM_002150.2:c.1005C>G, NM_002150.2:c.987delATyrosinemia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPD gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by intellectual deficit and ataxia. The prevalence is 1:100,000-1:120,000 newborn.250,600
HPRT1Lesch-Nyhan syndromeNM_000194.2NM_000194.2:c.486-1G>A, NM_000194.2:c.508C>T, NM_000194.2:c.610-2A>G, NM_000194.2:c.532+2T>GLesch-Nyhan syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the HPRT1 gene located on chromosomal region Xq26.2-q26.3. The age of onset is infantile. This disease is characterized by acid overproduction, neurological troubles, and behavioral problems. The prevalence is 1:380,000.600
HPS1Hermansky-Pudlak syndrome type 1NM_000195.3NM_000195.3:c.972_973insC, NM_000195.3:c.972delC, NM_000195.3:c.1996G>T, NM_000195.3:c.398+5G>A, NM_000195.3:c.1472_1487dupCCAGCAGGGGAGGCCC, NM_000195.3:c.397G>THermansky-Pudlak syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPS1 gene located on chromosomal region 10q24.2. The age of onset is early childhood. This disease is characterized by oculocutaneous albinism, bleeding diathesis and, in some cases, neutropenia, pulmonary fibrosis, or granulomatous colitis. The prevalence is 1/500,000 - 1/1,000,000.600
HSD17B4D-bifunctional protein deficiencyNM_000414.3NM_000414.3:c.1369A>T, NM_000414.3:c.46G>A, NM_000414.3:c.972+1G>T, NM_000414.3:c.317G>CBifunctional enzyme deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSD17B4 gene located on chromosomal region 5q23. The age of onset is juvenile. This disease is characterized by slowly progressive cerebellar atrophy and ataxia, intellectual decline, hearing loss, hypogonadism, hyperreflexia, a demyelinating sensorimotor neuropathy.600
HSD17B4Perrault syndromeNM_000414.3NM_000414.3:c.650A>GPerrault syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSD17B4 gene located on chromosomal region 5q23.1. The age of onset is adult. This disease is characterized by ovarian dysgenesis in females with sensorineural hearing impairment and other neurological alterations. The prevalence is <1:1,000,000.600
HSPD1Leukodystrophy hypomyelinating type 4NM_002156.4NM_002156.4:c.1381C>G, NM_002156.4:c.292G>ALeukodystrophy hypomyelinating type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSPD1 gene located on chromosomal region 2q33.1. The age of onset is infantile. A severe autosomal recessive hypomyelinating leukodystrophy. Clinically characterized by infantile-onset rotary nystagmus, progressive spastic paraplegia, neurologic regression, motor impairment, profound mental retardation. Death usually occurs within the first two decades of life.600
HSPG2Schwartz-Jampel syndrome type 1NM_005529.6NM_005529.6:c.13075delC, NM_005529.6:c.1653_1654insT, NM_005529.6:c.10355G>A, NM_005529.6:c.1125C>A, NM_005529.6:c.9326delA, NM_005529.6:c.8464+4A>GSchwartz-Jampel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSPG2 gene located on chromosomal region 1p36.12. The age of onset is infantile. This disease is characterized by myotonia and osteoarticular abnormalities. The prevalence is <1:1,000,000.600
HTRA1CARASIL syndromeNM_002775.4NM_002775.4:c.1108C>T, NM_002775.4:c.883G>A, NM_002775.4:c.904C>T, NM_002775.4:c.754G>A, NM_002775.4:c.889G>ACerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy (CARASIL syndrome) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HTRA1 gene located on chromosomal region 10q26.13. The age of onset is adult. This disease is characterized by early-onset gait disturbances, premature scalp alopecia, ischemic stroke, acute mid to lower back pain and progressive cognitive disturbances leading to severe dementia. About 50 people diagnosed, mainly in Japan and China.600
HYLS1Hydrolethalus syndrome type 1NM_145014.2NM_145014.2:c.632A>G, NM_145014.2:c.724C>T, NM_145014.2:c.669G>AHydrolethalus syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HYLS1 gene located on chromosomal region 11q24.2. The age of onset is fetal. This disease is characterized by craniofacial dysmorphic features, central nervous system, cardiac, respiratory tract and limb abnormalities. The incidence is 1/20,000 in Finland and the prevalence is <1:1,000,000.600
IDH3BRetinitis pigmentosa type 46NM_006899.3NM_006899.3:c.395T>C, NM_006899.3:c.490C>T, NM_006899.3:c.589delARetinitis pigmentosa 46 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IDH3B gene located on chromosomal region 20p13. The age of onset is variable. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness. The prevalence is 1/3,000 to 1/5,000.600
IDSMucopolysaccharidosis type 2NM_000202.6NM_000202.6:c.1464G>T, NM_000202.6:c.1466G>C, NM_000202.6:c.1505G>C, NM_000202.6:c.283A>G, NM_000202.6:c.208dupC, NM_000202.6:c.596_599delAACA, NM_000202.6:c.597delA, NM_000202.6:c.683C>T, NM_000202.6:c.1148delC, NM_000202.6:c.880-8A>G, NM_000202.6:c.937C>T, NM_000202.6:c.998C>T, NM_000202.6:c.690_691insT, NM_000202.6:c.1122C>T, NM_000202.6:c.587T>C, NM_000202.6:c.314_317dupTCAA, NM_000202.6:c.278delC, NM_000202.6:c.514C>T, NM_000202.6:c.1508T>A, NM_000202.6:c.388_389insG, NM_000202.6:c.240+1G>A, NM_000202.6:c.404A>GMucopolysaccharidosis type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IDS gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by distinctive coarse facial features, short stature, cardio-respiratory involvement and skeletal abnormalities. The prevalence is 1:100,000-1:170,000 mannewborn.600
IFT80Short-rib thoracic dysplasia type 2 with or without polydactylyNM_020800.2NM_020800.2:c.701C>G, NM_020800.2:c.721G>C, NM_020800.2:c.315C>GShort-rib thoracic dysplasia type 2 with or without polydactyly an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IFT80 gene located on chromosomal region 3q25.33. The age of onset is antenatal/neonatal. This is, a group of autosomal recessive ciliopathies that are characterized by a constricted thoracic cage, short ribs, shortened tubular bones, and a trident appearance of the acetabular roof. Polydactyly is variably present. Non-skeletal involvement can include cleft lip/palate as well as anomalies of major organs such as the brain, eye, heart, kidneys, liver, pancreas, intestines, and genitalia. Some forms of the disease are lethal in the neonatal period due to respiratory insufficiency secondary to a severely restricted thoracic cage, whereas others are compatible with life. Disease spectrum encompasses Ellis-van Creveld syndrome, asphyxiating thoracic dystrophy (Jeune syndrome), Mainzer-Saldino syndrome, and short rib-polydactyly syndrome. The incidence is 1-5/500,000.600
IGF1Growth delay due to insulin-like growth factor type 1 deficiencyNM_000618.3NM_000618.3:c.274G>AGrowth delay due to insulin-like growth factor type 1 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGF1 gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by the association of intrauterine and postnatal growth retardation with sensorineural deafness and intellectual deficit, addition clinical features include microcephaly, adiposity, and insulin resistance. The prevalence is <1:1,000,000.600
IGHMBP2Spinal muscular atrophy, distal, type 1, autosomal recessiveNM_002180.2NM_002180.2:c.1488C>A, NM_002180.2:c.2611+1G>T, NM_002180.2:c.1540G>A, NM_002180.2:c.1738G>A, NM_002180.2:c.661delA, NM_002180.2:c.121C>T, NM_002180.2:c.1101_1116delCTACTTCGACGTGGTG, NM_002180.2:c.2922T>G, NM_002180.2:c.1107C>G, NM_002180.2:c.2362C>T, NM_002180.2:c.638A>GAutosomal recessive distal spinal muscular atrophy type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGHMBP2 gene located on chromosomal region 11q13.3. The age of onset is infantile. This disease is characterized by neuromuscular disorder characterized by progressive weakness and atrophy of the diaphragm and skeletal muscles, leading to death in childhood. The prevalence is 4:100,000-10:100,000.250,600
IKBKAPFamilial dysautonomiaNM_003640.3NM_003640.3:c.3332delC, NM_003640.3:c.1460+2T>C, NM_003640.3:c.2204+6T>C, NM_003640.3:c.2328delT, NM_003640.3:c.2741C>T, NM_003640.3:c.2087G>C, NM_003640.3:c.2087G>AFamilial dysautonomia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IKBKAP gene located on chromosomal region 9q31.3. The age of onset is infantile. This disease is characterized by sensory dysfunction and severe impairment of the autonomic nervous system activity, resulting in multisystem dysfunction. The prevalence is <1:1,000,000600
IL2RGSevere combined immunodeficiency T-B+; X-linkedNM_000206.2NM_000206.2:c.454+1G>A, NM_000206.2:c.452T>C, NM_000206.2:c.186T>A, NM_000206.2:c.664C>T, NM_000206.2:c.343T>C, NM_000206.2:c.854G>A, NM_000206.2:c.341G>A, NM_000206.2:c.355A>TT-B+ severe combined immunodeficiency, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IL2RG gene located on chromosomal region Xq13.1. The age of onset is infantile. This disease is characterized by absent or markedly reduced numbers of T cells, leading to recurrent infections. The prevalence is 1:50,000-1:100,000.600
IMPDH1Retinitis pigmentosa type 10NM_000883.3NM_000883.3:c.1057G>A, NM_000883.3:c.1390delC, NM_000883.3:c.931G>ARetinitis pigmentosa type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IMPDH1 gene located on chromosomal region 7q32.1. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades. The prevalence is 1/4,000.250,600
IMPG2Retinitis pigmentosa type 56NM_016247.3NM_016247.3:c.635C>G, NM_016247.3:c.3262C>T, NM_016247.3:c.502-1G>C, NM_016247.3:c.2890C>TRetinitis pigmentosa type 56 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IMPG2 gene located on chromosomal region 3q12.3. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades. The prevalence is 1/4.000.600
INPP5EJoubert syndrome type 1NM_019892.4NM_019892.4:c.1132C>T, NM_019892.4:c.855_856insCG, NM_019892.4:c.1688G>A, NM_019892.4:c.1543C>T, NM_019892.4:c.1304G>AJoubert syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized by congenital malformation of the brainstem and agenesis or hypoplasia of the cerebellar vermis leading to an abnormal respiratory pattern, nystagmus, hypotonia, ataxia, and delay in achieving motor milestones.. The prevalence is 1/100.000.250,600
INPP5EMORM syndromeNM_019892.4NM_019892.4:c.1879C>TMORM syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized by the association of intellectual deficit, truncal obesity, retinal dystrophy and micropenis. The prevalence is 1/100.000.250,600
INSRDiabetes mellitus, insulin-resistantNM_000208.2NM_000208.2:c.3079C>T, NM_000208.2:c.3680G>C, NM_000208.2:c.3034G>A, NM_000208.2:c.1114C>T, NM_000208.2:c.1378A>GDiabetes mellitus, insulin-resistant follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by the triad of hyperinsulinemia, acanthosis nigricans (skin lesions associated with insulin resistance), and signs of hyperandrogenism in females without lipodystrophy and who are not overweight. It is generally diagnosed in young women with marked signs of hyperandrogenism, but insulin resistance and acanthosis nigricans may be observed in men and in childhood. Acromegaloid facies or muscular cramps are sometimes associated. Hyperinsulinemia, a biological marker for insulin resistance, is often associated with glucose tolerance defects over the course of the disease, and diabetes progressively sets in. Hyperandrogenism (associated with polycystic ovarian syndrome (see this term) or ovarian hyperthecoses) leads to fertility problems. The prevalence is <1:1,000,000.250,600
INSRLeprechaunismNM_000208.2NM_000208.2:c.2668C>T, NM_000208.2:c.172G>ALeprechaunism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by intrauterine and mainly postnatal severe growth retardation, extreme insulin resistance. The prevalence is <1:1,000,000.250,600
IQCB1Senior-Loken syndrome type 5NM_001023570.2NM_001023570.2:c.1036G>T, NM_001023570.2:c.817G>T, NM_001023570.2:c.1381C>T, NM_001023570.2:c.1465C>T, NM_001023570.2:c.1090C>T, NM_001023570.2:c.1518_1519delCA, NM_001023570.2:c.1069C>TSenior-Loken syndrome type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IQCB1 gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by the association of nephronophthisis (NPHP), a chronic kidney disease, with retinal dystrophy. The prevalence is 1/1.000.000.600
ISCUMyopathy with deficiency of ISCUNM_213595.3NM_213595.3:c.338_339+2delCGGT, NM_213595.3:c.149G>AHereditary myopathy with lactic acidosis due to ISCU deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ISCU gene located on chromosomal region 12q23.3. The age of onset is infantile. This disease is characterized by myopathy with severe exercise intolerance.600
ITGA6Epidermolysis bullosa, junctional with pyloric atresiaNM_000210.2NM_000210.2:c.791delC, NM_000210.2:c.1255dupAJunctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGA6 and ITGB4 genes located on chromosomal regions 2q31.1 and 17q25.1 respectively. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract.600
ITGB4Epidermolysis bullosa, junctional with pyloric atresiaNM_001005731.1NM_001005731.1:c.112T>C, NM_001005731.1:c.1684T>C, NM_001005731.1:c.1150delG, NM_001005731.1:c.1544G>A, NM_001005731.1:c.3977-19T>A, NM_001005731.1:c.4410delG, NM_001005731.1:c.4433G>A, NM_001005731.1:c.5119+2T>C, NM_001005731.1:c.3321_3331delACTGGACCGGA, NM_001005731.1:c.4618C>T, NM_001005731.1:c.182G>A, NM_001005731.1:c.2607delC, NM_001005731.1:c.3801_3802insT, NM_001005731.1:c.3841C>T, NM_001005731.1:c.2608delC, NM_001005731.1:c.3793+1G>A, NM_001005731.1:c.1660C>T, NM_001005731.1:c.3674G>AJunctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGA6 and ITGB4 genes located on chromosomal regions 2q31.1 and 17q25.1 respectively. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract.250,600
ITGB4Epidermolysis bullosa, without pyloric atresiaNM_001005731.1NM_001005731.1:c.2792G>AJunctional epidermolysis bullosa with piloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGB4 gene located on chromosomal region 17q25.1. The age of onset is neonatal. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. More than 100 cases have been reported around the world.250,600
IVDIsovaleric acidemiaNM_002225.3NM_002225.3:c.158G>C, NM_002225.3:c.1208A>G, NM_002225.3:c.157C>T, NM_002225.3:c.1141T>C, NM_002225.3:c.243+1G>A, NM_002225.3:c.1147+1_1147+4delGTGA, NM_002225.3:c.367G>A, NM_002225.3:c.605G>T, NM_002225.3:c.1145_1147+4delTTGGTGA, NM_002225.3:c.559+1G>A, NM_002225.3:c.134T>C, NM_002225.3:c.941C>T, NM_002225.3:c.627delT, NM_002225.3:c.793+1G>A, NM_002225.3:c.2T>G, NM_002225.3:c.1183C>T, NM_002225.3:c.390delT, NM_002225.3:c.406_407delTG, NM_002225.3:c.158G>A, NM_002225.3:c.593G>A, NM_002225.3:c.507delG, NM_002225.3:c.1188delT, NM_002225.3:c.465+2T>C, NM_002225.3:c.434_437dupATGA, NM_002225.3:c.860G>A, NM_002225.3:c.994_995delAT, NM_002225.3:c.1192C>T, NM_002225.3:c.478_479insGTIsovaleric academia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IVD gene located on chromosomal region 15q15.1. The age of onset is neonatal. This disease is characterized by vomiting, dehydration, coma and abnormal movements. The prevalence is 1/100,000.250,600
JAK3Severe combined immunodeficiency T-B+NK-NM_000215.3NM_000215.3:c.452C>G, NM_000215.3:c.1765G>A, NM_000215.3:c.1333C>T, NM_000215.3:c.1172_1173insG, NM_000215.3:c.1837C>T, NM_000215.3:c.299A>G, NM_000215.3:c.1695C>ASevere combined immunodeficiency T-B+NK- follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the JAK3 gene located on chromosomal region 19p13.11. The age of onset is infantile. This disease is characterized by chronic diarrhea, failure to thrive, recurrent respiratory infections and/or generalized infections due to opportunistic pathogens. The incidence is 1/100,000 and 1/1,000,000.250,600
KCNJ1Bartter syndrome type 2NM_000220.4NM_000220.4:c.1012C>T, NM_000220.4:c.1070T>C, NM_000220.4:c.592G>A, NM_000220.4:c.322G>C, NM_000220.4:c.372T>A, NM_000220.4:c.500G>A, NM_000220.4:c.237C>G, NM_000220.4:c.1014delA, NM_000220.4:c.641C>T, NM_000220.4:c.657C>G, NM_000220.4:c.996_999delAAAG, NM_000220.4:c.942T>GBartter syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ1 gene located on chromosomal region 11q24.3. The age of onset is antenatal. This disease is characterized by severe polyhydramnios in mother leading to premature delivery, postnatally newborns suffer from recurrent episodes of severe dehydration and electrolyte imbalance which can lead to fatal outcome.250,600
KCNJ13Leber congenital amaurosis type 16NM_002242.4NM_002242.4:c.722T>CLeber congenital amaurosis type 16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ13 gene located on chromosomal region 2q37.1. The age of onset is early infantile. This disease is characterized by retinal dystrophy defined by blindness, nystagmus, roving eye movement, leading to severe visual impairment within the first year of life.600
KCNV2Retinal cone dystrophy type 3BNM_133497.3NM_133497.3:c.1016_1024delACCTGGTGG, NM_133497.3:c.1376G>A, NM_133497.3:c.427G>T, NM_133497.3:c.226C>T, NM_133497.3:c.325C>T, NM_133497.3:c.357_358insC, NM_133497.3:c.1480A>C, NM_133497.3:c.1132_1133insT, NM_133497.3:c.854T>G, NM_133497.3:c.491T>C, NM_133497.3:c.767C>G, NM_133497.3:c.916G>T, NM_133497.3:c.778A>T, NM_133497.3:c.442G>TRetinal cone dystrophy type 3B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNV2 gene located on 9p24.2. The age of onset is in the first or second decade of life. This disease is characterized by is characterized by onset in the first or second decade of life of very marked photophobia, myopia, reduced color vision along the red-green axis with relatively preserved tritan discrimination, and central scotomata with peripheral widespread sensitivity loss predominating in the superior visual field. Nyctalopia is a later feature of the disorder. There is often retinal pigment epithelium disturbance at the macula with a normal retinal periphery.250,600
KIF7Acrocallosal syndromeNM_198525.2NM_198525.2:c.2473G>T, NM_198525.2:c.687delG, NM_198525.2:c.3001C>T, NM_198525.2:c.460C>T, NM_198525.2:c.61C>T, NM_198525.2:c.2896_2897delGC, NM_198525.2:c.3778_3779insCAcrocallosal syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KIF7 gene located on chromosomal region 15q26.1. The age of onset is infantile. This disease is characterized by y agenesis of corpus callosum (CC), distal anomalies of limbs, minor craniofacial anomalies and intellectual deficit. The prevalence is <1:1,000,000.600
L1CAMMASA sindrome/hydrocephalusNM_000425.4NM_000425.4:c.3489_3490delTG, NM_000425.4:c.3201T>G, NM_000425.4:c.719C>T, NM_000425.4:c.3581C>T, NM_000425.4:c.2879delA, NM_000425.4:c.791G>A, NM_000425.4:c.2092G>A, NM_000425.4:c.924C>T, NM_000425.4:c.536T>G, NM_000425.4:c.23delT, NM_000425.4:c.2254G>A, NM_000425.4:c.800dupA, NM_000425.4:c.772C>T, NM_000425.4:c.1354G>A, NM_000425.4:c.551G>A, NM_000425.4:c.1792G>A, NM_000425.4:c.1108G>AMASA sindrome/hydrocephalus follows an X-linked pattern of inheritance and is caused by pathogenic variants in the L1CAM gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by adducted thumbs, hypotonia progressing to spasticity or spastic paraplegia, delayed development of speech, mild to moderate intellectual deficit, and mild to moderate distension of the cerebral ventricles. Hydrocephalus appears frequently. The prevalence is 1:25,000-1:60,000 male.600
LAMA2Congenital muscular dystrophy type 1ANM_000426.3NM_000426.3:c.184G>T, NM_000426.3:c.1612C>T, NM_000426.3:c.3718C>T, NM_000426.3:c.2750-1G>C, NM_000426.3:c.2049_2050delAG, NM_000426.3:c.5050G>T, NM_000426.3:c.1634T>A, NM_000426.3:c.2045_2046delAG, NM_000426.3:c.4645C>T, NM_000426.3:c.2962C>T, NM_000426.3:c.2098_2099delTT, NM_000426.3:c.4437-5T>A, NM_000426.3:c.2901C>A, NM_000426.3:c.112+1G>A, NM_000426.3:c.7732C>T, NM_000426.3:c.6038delT, NM_000426.3:c.7888C>T, NM_000426.3:c.825delC, NM_000426.3:c.8314delA, NM_000426.3:c.3976C>T, NM_000426.3:c.9101_9104dupAACA, NM_000426.3:c.9253C>T, NM_000426.3:c.2323-2A>T, NM_000426.3:c.8748delA, NM_000426.3:c.6334A>T, NM_000426.3:c.1050delT, NM_000426.3:c.7536delC, NM_000426.3:c.8705delT, NM_000426.3:c.9221delA, NM_000426.3:c.5227G>T, NM_000426.3:c.6429+1G>A, NM_000426.3:c.6617delT, NM_000426.3:c.2451-2A>G, NM_000426.3:c.6011delA, NM_000426.3:c.7810C>T, NM_000426.3:c.8684C>G, NM_000426.3:c.3630delT, NM_000426.3:c.3215delG, NM_000426.3:c.3623_3645delAGGGCATTGTTTTTCAACATCCA, NM_000426.3:c.6955C>T, NM_000426.3:c.7279_7280delCT, NM_000426.3:c.725G>A, NM_000426.3:c.7147C>T, NM_000426.3:c.3237C>ACongenital muscular dystrophy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMA2 gene located on chromosomal region 6q22.33. The age of onset is early infancy. This disease is characterized by hypotonia, muscle weakness and muscle wasting and motor development delayed. The prevalence is 1/30,000.250,600
LAMA3Epidermolysis bullosa, junctional 2A, intermediate;Epidermolysis bullosa, junctional 2B, severe;Epidermolysis bullosa, junctional 2C, laryngoonychocutaneousNM_000227.3NM_000227.3:c.-122061G>T, NM_000227.3:c.335delG, NM_000227.3:c.4878dupT, NM_000227.3:c.2116A>T, NM_000227.3:c.4135C>T, NM_000227.3:c.751G>T, NM_000227.3:c.1981C>T, NM_000227.3:c.3350+2T>G, NM_000227.3:c.1182delG, NM_000227.3:c.4335_4336insA, NM_000227.3:c.2662C>TJunctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 and LAMC2 genes located on chromosomal regions 1q32.2 and 1q25.3 respectively. The age of onset is infantile. It is a lethal form of junctional epidermolysis bullosa, a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement. In the Herlitz type, death occurs usually within the first six months of life. Occasionally, children survive to teens. It is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic.600
LAMB3Epidermolysis bullosa, junctionalNM_000228.2NM_000228.2:c.1587_1588delAG, NM_000228.2:c.124C>T, NM_000228.2:c.1438_1442delCCGTG, NM_000228.2:c.1830G>A, NM_000228.2:c.565-2A>G, NM_000228.2:c.2806C>T, NM_000228.2:c.904delT, NM_000228.2:c.1357delT, NM_000228.2:c.3228+1G>T, NM_000228.2:c.628+1delG, NM_000228.2:c.496C>T, NM_000228.2:c.1903C>T, NM_000228.2:c.628G>A, NM_000228.2:c.3228+1G>A, NM_000228.2:c.727C>TJunctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 and LAMC2 genes located on chromosomal regions 1q32.2 and 1q25.3 respectively. The age of onset is infantile. It is a lethal form of junctional epidermolysis bullosa, a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement. In the Herlitz type, death occurs usually within the first six months of life. Occasionally, children survive to teens. It is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic.250,600
LAMC2Epidermolysis bullosa, junctional 3A, intermediate;Epidermolysis bullosa, junctional 3B, severeNM_005562.2NM_005562.2:c.1659C>A, NM_005562.2:c.3069+1G>A, NM_005562.2:c.1782_1783delGC, NM_005562.2:c.2137_2143delCAGAACC, NM_005562.2:c.283C>T, NM_005562.2:c.343C>T, NM_005562.2:c.3512_3513insA, NM_005562.2:c.405-1G>A, NM_005562.2:c.3120_3121insAJunctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 and LAMC2 genes located on chromosomal regions 1q32.2 and 1q25.3 respectively. The age of onset is infantile. It is a lethal form of junctional epidermolysis bullosa, a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement. In the Herlitz type, death occurs usually within the first six months of life. Occasionally, children survive to teens. It is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic.600
LARGEMuscular dystrophy-dystroglycanopathy type 6NM_004737.4NM_004737.4:c.1102C>T, NM_004737.4:c.992C>T, NM_004737.4:c.1525G>A, NM_004737.4:c.1483T>CMuscular dystrophy-dystroglycanopathy type 6follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LARGE gene located on chromosomal region 22q12.3. The age of onset is infantile. There are two subtypes. Subtype 6A is associated with cobblestone lissencephaly and other brain anomalies, eye malformations, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Subtype 6B is associated with profound mental retardation, white matter changes and structural brain abnormalities. Skeletal muscle biopsies show reduced immunolabeling of alpha-dystroglycan. The prevalence is 1:100,000-9:100,000.600
LBRGreenberg skeletal dysplasiaNM_002296.3NM_002296.3:c.1748G>A, NM_002296.3:c.1402delT, NM_002296.3:c.1114C>T, NM_002296.3:c.32_35delTGGTGreenberg dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LBR gene located on chromosomal region 1q42.12. The age of onset is fetal. This disease is characterized by fetal hydrops, short limbs and abnormal chondro-osseous calcification. The prevalence is <1:1,000,000.600
LDHAGlycogen storage disease type 11NM_005566.3NM_005566.3:c.126+1_126+4delGTAA, NM_005566.3:c.126+1G>A, NM_005566.3:c.310G>T, NM_005566.3:c.126+1_126+4del, NM_005566.3:c.397G>T, NM_005566.3:c.213+1_213+4delGTAA, NM_005566.3:c.640_641delCTGlycogen storage disease type 11 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LDHA gene located on chromosomal region 11p15.1. The age of onset is infantile. This disease is characterized by hepatic glycogenosis and renal Fanconi syndrome.600
LEPRE1Osteogenesis imperfecta type 8NM_022356.3NM_022356.3:c.2055+13_2055+31del19, NM_022356.3:c.1656C>A, NM_022356.3:c.1365_1366delAGinsC, NM_022356.3:c.2068_2086delCGAGCGGGTGAGAGCAGCT, NM_022356.3:c.747delC, NM_022356.3:c.1102C>T, NM_022356.3:c.1473+1G>TOsteogenesis imperfecta type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LEPRE1 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by bone fragility, low bone mass and susceptibility to bone fractures. The prevalence is 6:100,000-7:100,000.600
LHFPL5Deafness type 67, autosomal recessiveNM_182548.3NM_182548.3:c.494C>T, NM_182548.3:c.476G>A, NM_182548.3:c.649delG, NM_182548.3:c.250delC, NM_182548.3:c.380A>GAutosomal recessive nonsyndromic sensorineural deafness type DFNB67 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LHFPL5 gene located on chromosomal region 6p21.31. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.600
LHX3Combined pituitary hormone deficiency type 3NM_014564.3NM_014564.3:c.687G>A, NM_014564.3:c.347A>GCombined pituitary hormone deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LHX3 gene located on chromosomal region 9q34.3. The age of onset is infantile, etc/. This disease is characterized by somatolactotroph, thyrotroph and gonadotroph deficiencies, limited head and neck rotation associated with spinal abnormalities. The prevalence is <1 /1,000,000.600
LIFRStuve-Wiedemann syndromeNM_002310.5NM_002310.5:c.2013_2014insT, NM_002310.5:c.653dupT, NM_002310.5:c.1018_1022delAATTG, NM_002310.5:c.2503G>T, NM_002310.5:c.171_174delTAAC, NM_002310.5:c.1789C>TStüve-Wiedemann syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LIFR gene located on chromosomal region 5p13.1. The age of onset is neonatal. This disease is characterized by small stature, congenital bowing of the long bones and campodactyly.600
LIG4LIG4 syndromeNM_002312.3NM_002312.3:c.1271_1275delAAAGA, NM_002312.3:c.833G>A, NM_002312.3:c.1738C>T, NM_002312.3:c.2440C>T, NM_002312.3:c.1406G>A, NM_002312.3:c.1455_1456delTG, NM_002312.3:c.1369_1372delGGAC, NM_002312.3:c.1512_1513delTCLIG4 syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LIG4 gene located on chromosomal region 10p13. The age of onset is infantile. It is associated with impaired DNA double-strand break repair mechanisms and characterized by microcephaly, unusual facial features (''bird-like''), growth and developmental delay, skin anomalies including photosensitivity and psoriatic-like lesions, and pancytopenia. The disease is associated with immunodeficiency. Some patients have been reported as having telangiectasias, leukemia, lymphoma, bone marrow abnormalities, and type 2 diabetes. The prevalence 1-9/1.000.000.600
LMNACardiomyopathy, dilated type 1ANM_170707.3NM_170707.3:c.1366A>C, NM_170707.3:c.1930C>T, NM_170707.3:c.1567G>A, NM_170707.3:c.1786G>ADilated cardiomyopathy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death.250,600
LMNAHutchinson-Gilford progeria syndromeNM_170707.3NM_170707.3:c.1579C>T, NM_170707.3:c.1411C>T, NM_170707.3:c.1824C>T, NM_170707.3:c.1626G>CHutchinson-Gilford progeria syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/infancy. It is characterized by growth reduction, failure to thrive, a typical facial appearance (prominent forehead, protuberant eyes, thin nose with a beaked tip, thin lips, micrognathia and protruding ears) and distinct dermatologic features (generalized alopecia, aged-looking skin, sclerotic and dimpled skin over the abdomen and extremities, prominent cutaneous vasculature, dyspigmentation, nail hypoplasia and loss of subcutaneous fat).250,600
LMNALipodystrophy, familial partial, type 2NM_170707.3NM_170707.3:c.1318G>ALipodystrophy, familial partial, type2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by the loss of subcutaneous adipose tissue in the lower parts of the body (limbs, buttocks, trunk). It is accompanied by an accumulation of adipose tissue in the face and neck causing a double chin, fat neck, or cushingoid appearance. Adipose tissue may also accumulate in the axillae, back, labia majora, and intraabdominal region. Affected patients are insulin-resistant and may develop glucose intolerance and diabetes mellitus after age 20 years,hypertriglyceridemia, and low levels of high density lipoprotein cholesterol.250,600
LMNAMandibuloacral dysplasiaNM_170707.3NM_170707.3:c.1586C>T, NM_170707.3:c.1580G>A, NM_170707.3:c.1585G>A, NM_170707.3:c.1228C>TMandibuloacral dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/. This disease is characterized by postnatal growth retardation, craniofacial anomalies, skeletal malformations, and mottled cutaneous pigmentation. The prevalence is 1:2,700-1:5,000.250,600
LMNAMuscular dystrophy, Emery-Dreifuss type 3NM_170707.3NM_170707.3:c.1072G>A, NM_170707.3:c.419T>C, NM_170707.3:c.1488+1G>A, NM_170707.3:c.1583C>AEmery-Dreifuss muscular dystrophy type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by weakness and atrophy of muscle without involvement of the nervous system, early contractures of the elbows, Achilles tendons and spine, and cardiomyopathy associated with cardiac conduction defects.250,600
LOXHD1Deafness type 77, autosomal recessiveNM_144612.6NM_144612.6:c.2008C>T, NM_144612.6:c.2T>A, NM_144612.6:c.3874C>T, NM_144612.6:c.4526G>A, NM_144612.6:c.3924C>A, NM_144612.6:c.512-1G>A, NM_144612.6:c.4524_4525delAG, NM_144612.6:c.4714C>T, NM_144612.6:c.457_461dupCGCCAAutosomal recessive nonsyndromic sensorineural deafness type DFNB77 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LOXHD1 gene located on chromosomal region 18q21.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.600
LRATLeber congenital amaurosis type 14NM_004744.3NM_004744.3:c.217_218delAT, NM_004744.3:c.588dupTLeber congenital amaurosis 14 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRAT gene located on chromosomal region 4q32.1. The age of onset is infantile. This disease is characterized by blindness, nystagmus, roving eye movement. The prevalence is 2:100,000-3:100,000 newborn.600
LRATRetinal dystrophy, early-onset severeNM_004744.3NM_004744.3:c.525T>ARetinal dystrophy, early-onset severe follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRAT gene located on chromosomal region 4q32.1. The age of onset is infantile. It is a mild form of Leber congenital amaurosis that is characterized by a severe night blindness, nystagmus, and sluggish pupil responses. A relatively good central vision well into the second decade of life and blindness by the age of 30 years is generally observed. The prevalence is 2:100,000-3:100,000 newborn.600
LRP2Donnai-Barrow syndromeNM_004525.2NM_004525.2:c.11469_11472delTTTG, NM_004525.2:c.2640-1G>A, NM_004525.2:c.13139_13140insC, NM_004525.2:c.1093C>T, NM_004525.2:c.11663G>A, NM_004525.2:c.7564T>C, NM_004525.2:c.8519_8522delATTT, NM_004525.2:c.1341+2T>G, NM_004525.2:c.10769-2A>G, NM_004525.2:c.9484_9485delGT, NM_004525.2:c.13388+2T>C, NM_004525.2:c.11636-1G>TDonnai-Barrow syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP2 gene located on chromosomal region 2q31.1. The age of onset is infantile. This disease is characterized by diaphragmatic hernia, ocular findings, hipertelorism, agenesis of the corpus callosum, hearing loss and facial dimorphism. The prevalence is <1:1,000,000.600
LRP5Exudative vitreoretinopathy type 4NM_002335.3NM_002335.3:c.2254C>G, NM_002335.3:c.518C>T, NM_002335.3:c.1709G>A, NM_002335.3:c.804_813delGGGGAAGAGG, NM_002335.3:c.4099G>AExudative vitreoretinopathy type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile or juvenile. This disease is characterized by abnormal or incomplete vascularization of the peripheral retina leading to variable clinical manifestations ranging from no effects to minor anomalies, or even retinal detachment with blindness.250,600
LRP5Isolated polycystic liver diseaseNM_002335.3NM_002335.3:c.4651G>AIsolated polycystic liver disease due to LRP5 gene located on chromosomal region 11q13.2 follows an autosomal recessive pattern of inheritance. The age of onset is variable. This disease is characterized by the appearance of numerous cysts spread throughout the liver.250,600
LRP5Osteoporosis-pseudoglioma syndromeNM_002335.3NM_002335.3:c.1481G>A, NM_002335.3:c.1453G>T, NM_002335.3:c.1468delG, NM_002335.3:c.2305delG, NM_002335.3:c.2202G>A, NM_002335.3:c.1708C>T, NM_002335.3:c.3107G>A, NM_002335.3:c.2557C>TOsteoporosis-pseudoglioma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by congenital or infancy-onset blindness and severe juvenile-onset osteoporosis and spontaneous fractures. The prevalence is 1:2,000,000.250,600
LRPPRCLeigh syndrome, French-Canadian typeNM_133259.3NM_133259.3:c.1061C>T, NM_133259.3:c.3830_3839delGTGGTGCAATinsAGFrench-Canadian type Leigh syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRPPRC gene located on chromosomal region 2p21. The age of onset is infantile. This disease is characterized by chronic metabolic acidosis, hypotonia, facial dysmorphism and delayed development. The prevalence is 1:2,000 newborn.600
LRTOMTDeafness type 63, utosomal recessiveNM_001145308.4NM_001145308.4:c.242G>AAutosomal recessive nonsyndromic sensorineural deafness type DFNB63 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRTOMT gene located on chromosomal region 11q13.4. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.600
MAKRetinitis pigmentosa type 62NM_001242957.1NM_001242957.1:c.37G>A, NM_001242957.1:c.719_720dupAG, NM_001242957.1:c.1087_1088delAG, NM_001242957.1:c.718C>T, NM_001242957.1:c.388A>CRetinitis pigmentosa type 62 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAK gene located on chromosomal region 6p24.2. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades.600
MAN2B1Alpha-mannosidosisNM_000528.3NM_000528.3:c.215A>T, NM_000528.3:c.2401G>T, NM_000528.3:c.2278C>T, NM_000528.3:c.2368C>T, NM_000528.3:c.2119C>T, NM_000528.3:c.2013delT, NM_000528.3:c.1A>G, NM_000528.3:c.1067C>G, NM_000528.3:c.384G>A, NM_000528.3:c.2398G>A, NM_000528.3:c.1915C>T, NM_000528.3:c.2426T>C, NM_000528.3:c.2436+2T>C, NM_000528.3:c.1259G>T, NM_000528.3:c.1780C>T, NM_000528.3:c.1929G>A, NM_000528.3:c.2686_2687delCTinsG, NM_000528.3:c.1830+1G>CAlpha-mannosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAN2B1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by immunodeficiency, facial and skeletal abnormalities, hearing impairment and intellectual disability. The prevalence is 1:1,000,000-9:1,000,000.250,600
MARVELD2Deafness type 49, autosomal recessiveNM_001038603.2NM_001038603.2:c.1363C>T, NM_001038603.2:c.1183-1G>AAutosomal recessive nonsyndromic sensorineural deafness type DFNB49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MARVELD2 gene located on chromosomal region 5q13.2. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.600
MAT1AMethionine adenosyltransferase deficiencyNM_000429.2NM_000429.2:c.1006G>A, NM_000429.2:c.1070C>T, NM_000429.2:c.595C>T, NM_000429.2:c.1043_1044delTG, NM_000429.2:c.790C>T, NM_000429.2:c.827_828insG, NM_000429.2:c.538_539insTG, NM_000429.2:c.914T>C, NM_000429.2:c.791G>A, NM_000429.2:c.966T>GMethionine adenosyltransferase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAT1A gene located on chromosomal region 10q23.1. This disease is characterized by brain demyelination (rarely leading to neurological disorders) and isolated hepatic hypermethioninemia. The prevalence is <1:1,000,000.600
MATN3Multiple epiphyseal dysplasia type 5NM_002381.4NM_002381.4:c.1405+2T>C, NM_002381.4:c.910T>A, NM_002381.4:c.1303G>A, NM_002381.4:c.693G>CMultiple epiphyseal dysplasia type 5 type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MATN3 gene located on chromosomal region 2p24.1. The age of onset is infantile. It is relatively mild and clinically variable. It is primarily characterized by delayed and irregular ossification of the epiphyses and early-onset osteoarthritis.The prevalence is <1:1,000,000.600
MBTPS2Ichthyosis follicularis-atrichia-photophobiaNM_015884.3NM_015884.3:c.1286G>A, NM_015884.3:c.1424T>C, NM_015884.3:c.677G>T, NM_015884.3:c.261G>AIchthyosis follicularis - alopecia – photophobia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the MBTPS2 gene located on chromosomal region Xp22.12-p22.11. The age of onset is infantile. This disease is characterized by the triad of ichthyosis follicularis, alopecia, and photophobia. The prevalence is 1:200,000.600
MCCC13-Methylcrotonyl-CoA carboxylase type 1 deficiencyNM_020166.4NM_020166.4:c.1155A>C, NM_020166.4:c.1930G>T, NM_020166.4:c.2079delA, NM_020166.4:c.388G>A, NM_020166.4:c.559T>C, NM_020166.4:c.343C>T, NM_020166.4:c.640-2A>G, NM_020166.4:c.1942G>A, NM_020166.4:c.1905delA, NM_020166.4:c.640-1G>A, NM_020166.4:c.1074delG, NM_020166.4:c.1114C>T, NM_020166.4:c.558delA, NM_020166.4:c.1277T>C, NM_020166.4:c.1526delG, NM_020166.4:c.1380T>G, NM_020166.4:c.310C>T, NM_020166.4:c.1310T>C3-methylcrotonyl-CoA carboxylase deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC1 gene located on chromosomal region 3q27.1. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn.600
MCCC23-Methylcrotonyl-CoA carboxylase 2 deficiency, type 2NM_022132.4NM_022132.4:c.295G>C, NM_022132.4:c.380C>G, NM_022132.4:c.1309A>G, NM_022132.4:c.515_516insT, NM_022132.4:c.1015G>A, NM_022132.4:c.464G>A, NM_022132.4:c.641delG, NM_022132.4:c.1576_1577insT, NM_022132.4:c.735_736insC, NM_022132.4:c.517_518insT, NM_022132.4:c.838G>T, NM_022132.4:c.499T>C, NM_022132.4:c.1367C>T, NM_022132.4:c.929C>G, NM_022132.4:c.1065A>T, NM_022132.4:c.1580G>A, NM_022132.4:c.994C>T, NM_022132.4:c.1072+1G>A3-methylcrotonyl-CoA carboxylase deficiency type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC2 gene located on chromosomal region 5q13.2. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn.250,600
MCEEMethylmalonic acidemia due to methylmalonyl-CoA epimerase deficiencyNM_032601.3NM_032601.3:c.178A>C, NM_032601.3:c.2T>C, NM_032601.3:c.139C>TMethylmalonic acidemia due to methylmalonyl-CoA epimerase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCEE gene located on chromosomal region 2p13.3. The age of onset is neonatal. This disease is characterized by lethargy, vomiting, hypotonia, hypothermia, respiratory distress, severe ketoacidosis, hyperammonemia, neutropenia, and thrombocytopenia. The prevalence is 1:50,000-1:80,000.600
MCOLN1Mucolipidosis type 4NM_020533.2NM_020533.2:c.1084G>T, NM_020533.2:c.304C>T, NM_020533.2:c.1207C>T, NM_020533.2:c.964C>TMucolipidosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCOLN1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismus. The prevalence is 1:40,000.600
MCPH1Microcephaly, primary, type 1, autosomal recessiveNM_024596.3NM_024596.3:c.1973+1G>A, NM_024596.3:c.2221C>T, NM_024596.3:c.427_428insA, NM_024596.3:c.1561G>T, NM_024596.3:c.1935+1G>T, NM_024596.3:c.215C>T, NM_024596.3:c.1249_1250insTAutosomal recessive primary microcephaly type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCPH1 gene located on chromosomal region 8p23.1. The age of onset is neonatal. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. The incidence is 1/1,000,000.600
MECP2Rett syndromeNM_004992.3NM_004992.3:c.1048_1050delAGC, NM_004992.3:c.215dupC, NM_004992.3:c.611C>G, NM_004992.3:c.1282G>A, NM_004992.3:c.916C>T, NM_004992.3:c.806delG, NM_004992.3:c.502C>T, NM_004992.3:c.880C>T, NM_004992.3:c.674C>T, NM_004992.3:c.964C>T, NM_004992.3:c.705G>A, NM_004992.3:c.808C>T, NM_004992.3:c.730C>T, NM_004992.3:c.683C>G, NM_004992.3:c.753delC, NM_004992.3:c.965C>T, NM_004992.3:c.763C>TRett syndrome an X -linked pattern of inheritance and is caused by pathogenic variants in the MECP2 gene located on chromosomal region Xq28. The age of onset is neonatal. An X-linked dominant neurodevelopmental disorder, and one of the most common causes of mental retardation in females. Patients appear to develop normally until 6 to 18 months of age, then gradually lose speech and purposeful hand movements, and develop microcephaly, seizures, autism, ataxia, mental retardation and stereotypic hand movements. After initial regression, the condition stabilizes and patients usually survive into adulthood. The prevalence is 1:8,500.600
MED12Ohdo syndromeNM_005120.2NM_005120.2:c.3493T>C, NM_005120.2:c.5185C>A, NM_005120.2:c.3443G>AOhdo syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the MED12 gene located on chromosomal region Xq13.1. The age of onset is infantile. It is characterized by mental retardation, feeding problems, and distinctive facial appearance with coarse facial features, severe blepharophimosis, ptosis, a bulbous nose, micrognathia and a small mouth. Dental hypoplasia and deafness can be considered as common manifestations of the syndrome. Male patients show cryptorchidism and scrotal hypoplasia.600
MED25Charcot-Marie-Tooth disease type 2B2NM_030973.3NM_030973.3:c.316delG, NM_030973.3:c.1366C>T, NM_030973.3:c.1004C>TCharcot-Marie-Tooth disease type 2B2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MED25 gene located on chromosomal region 19q13.33. The age of onset is adult. This disease is characterized by symmetric moderate to severe weakness of the distal muscles, predominantly affecting the lower extremities. Marked sensory deficits were also reported.250,600
MEFVFamilial mediterranean feverNM_000243.2NM_000243.2:c.163_164insA, NM_000243.2:c.1437C>G, NM_000243.2:c.2282G>A, NM_000243.2:c.163dupA, NM_000243.2:c.2076_2078delAAT, NM_000243.2:c.1958G>A, NM_000243.2:c.443A>T, NM_000243.2:c.656_657insG, NM_000243.2:c.688G>A, NM_000243.2:c.800C>T, NM_000243.2:c.1223G>A, NM_000243.2:c.501G>C, NM_000243.2:c.2040G>A, NM_000243.2:c.2040G>C, NM_000243.2:c.2084A>G, NM_000243.2:c.1141C>T, NM_000243.2:c.1016C>T, NM_000243.2:c.2177T>C, NM_000243.2:c.1772T>C, NM_000243.2:c.2080A>G, NM_000243.2:c.2082G>A, NM_000243.2:c.2230G>TFamilial Mediterranean fever follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MEFV gene located on chromosomal region 16p13.3. The age of onset is infantile or adult (before the age of 30). This disease is characterized by recurrent short episodes of fever and serositis resulting in pain in the abdomen, chest, joints and muscles. The prevalence is 1:10,000-5:10,000.250,600
MERTKRetinitis pigmentosa type 38NM_006343.2NM_006343.2:c.2189+1G>T, NM_006343.2:c.1605-2A>G, NM_006343.2:c.2070_2074delAGGAC, NM_006343.2:c.2784_2785insTA, NM_006343.2:c.2785_2786dupTA, NM_006343.2:c.2323C>T, NM_006343.2:c.2207_2210delCTGTRetinitis pigmentosa type 38 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MERTK gene located on chromosomal region 2q13. The age of onset is infantile. This disease is characterized by. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness.250,600
MFRPMicrophthalmia - Retinitis pigmentosa - foveoschisis - optic disc drusenNM_031433.3NM_031433.3:c.498delC, NM_031433.3:c.523C>T, NM_031433.3:c.629G>T, NM_031433.3:c.1150_1151insC, NM_031433.3:c.545T>C, NM_031433.3:c.1124+1G>TMicrophthalmia - Retinitis pigmentosa - foveoschisis - optic disc drusen follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFRP gene located on chromosomal region 11q23.3. The age of onset is infantile. This disease is characterized by posterior microphthalmos, retinitis pigmentosa, foveoschisis, and optic disk drusen.250,600
MFSD8Ceroid lipofuscinosis, neuronal, type 7NM_152778.2NM_152778.2:c.1286G>A, NM_152778.2:c.999-2A>G, NM_152778.2:c.1235C>T, NM_152778.2:c.1090delA, NM_152778.2:c.362A>G, NM_152778.2:c.881C>A, NM_152778.2:c.929G>A, NM_152778.2:c.1525_1526delCT, NM_152778.2:c.894T>GNeuronal ceroid lipofuscinosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFSD8 gene located on chromosomal region 4q28.2. The age of onset is late infantile. This disease is characterized by decline of mental and motor capacities, epilepsy, and vision loss through retinal degeneration. The prevalence is 0.56:100,000-3.9:100,000.600
MGAT2Congenital disorders of glycosylation 2a typeNM_002408.3NM_002408.3:c.869C>T, NM_002408.3:c.785A>G, NM_002408.3:c.1017T>ACongenital disorder of glycosylation type 2a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MGAT2 gene located on chromosomal region 14q21.3. The age of onset is infantile. This disease is characterized by severe psychomotor delay, postnatal growth retardation, facial dysmorphology and bleeding tendency. It has been described in four children.600
MKKSBardet-Biedl/McKusick-Kaufman syndromeNM_018848.3NM_018848.3:c.353delGBardet-Biedl syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. McKusick-Kaufman syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is fetal. This disease is characterized by hydrometrocolpos, post-axial polydactyly, and to a lesser extent cardiac defects.250,600
MKKSBardet-Biedl syndrome type 6NM_018848.3NM_018848.3:c.830T>C, NM_018848.3:c.1436C>GBardet-Biedl syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.250,600
MKKSMcKusick-Kaufman syndromeNM_018848.3NM_018848.3:c.250C>T, NM_018848.3:c.1225_1226delGG, NM_018848.3:c.724G>TMcKusick-Kaufman syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is fetal. This disease is characterized by hydrometrocolpos, post-axial polydactyly, and to a lesser extent cardiac defects.250,600
MKS1Bardet-Biedl syndrome type 13NM_017777.3NM_017777.3:c.1349T>CBardet-Biedl syndrome type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.250,600
MKS1Meckel type 1/Bardet-Biedl syndromeNM_017777.3NM_017777.3:c.1024+1G>A, NM_017777.3:c.857A>G, NM_017777.3:c.1319T>C, NM_017777.3:c.814G>C, NM_017777.3:c.508C>T, NM_017777.3:c.1319G>CMeckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is infantile, etc/. This disease is characterized by a combination of renal cysts and variably associated features, including developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and cysts, and polydactyly.. The prevalence is 1:1,000,000-9:1,000,000. Bardet-Biedl syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.250,600
MLC1Megalencephalic leukoencephalopathy with subcortical cysts 1NM_015166.3NM_015166.3:c.135_136insC, NM_015166.3:c.206C>T, NM_015166.3:c.278C>T, NM_015166.3:c.424-2A>C, NM_015166.3:c.422A>G, NM_015166.3:c.274C>T, NM_015166.3:c.839C>T, NM_015166.3:c.423C>A, NM_015166.3:c.33_34insCMegalencephalic leukoencephalopathy with subcortical cysts follows an autosomal recessive patternof inheritance and is caused by pathogenic variants in the MLC1 gene located on chromosomal region 22q13.33. The age of onset is infantile. This disease is characterized by ataxia followed by progressive signs of pyramidal tract involvement and mental deterioration.600
MLYCDMalonyl-CoA decarboxylase deficiencyNM_012213.2NM_012213.2:c.758delT, NM_012213.2:c.679delinsATGAAGC, NM_012213.2:c.560C>GMalonyl-CoA decarboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MLYCD gene located on chromosomal region 16q23.3. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000.600
MMAAVitamin B12-responsive methylmalonic acidemia type cblANM_172250.2NM_172250.2:c.1034delT, NM_172250.2:c.283C>T, NM_172250.2:c.440G>A, NM_172250.2:c.451delC, NM_172250.2:c.592_595delCTGA, NM_172250.2:c.503delC, NM_172250.2:c.450_451insG, NM_172250.2:c.811G>T, NM_172250.2:c.586C>T, NM_172250.2:c.387C>A, NM_172250.2:c.620A>GVitamin B12-responsive methylmalonic acidemia type cblA follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAA gene located on chromosomal region 4q31.21. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000.600
MMABVitamin B12-responsive methylmalonic acidemia type cblBNM_052845.3NM_052845.3:c.557G>A, NM_052845.3:c.556C>T, NM_052845.3:c.569G>A, NM_052845.3:c.568C>T, NM_052845.3:c.577G>A, NM_052845.3:c.197-1G>T, NM_052845.3:c.700C>T, NM_052845.3:c.548A>T, NM_052845.3:c.220G>T, NM_052845.3:c.197-1G>AVitamin B12-responsive methylmalonic acidemia type cbl B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAB gene located on chromosomal region 12q24.31. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000.600
MMACHCMethylmalonic aciduria cblC type, with homocystinuriaNM_015506.2NM_015506.2:c.389A>G, NM_015506.2:c.388T>C, NM_015506.2:c.482G>A, NM_015506.2:c.609G>A, NM_015506.2:c.688C>T, NM_015506.2:c.394C>T, NM_015506.2:c.440G>C, NM_015506.2:c.608G>A, NM_015506.2:c.481C>T, NM_015506.2:c.619_620insG, NM_015506.2:c.547_548delGT, NM_015506.2:c.347T>C, NM_015506.2:c.658_660delAAG, NM_015506.2:c.388_390delTAC, NM_015506.2:c.615C>A, NM_015506.2:c.331C>T, NM_015506.2:c.616C>T, NM_015506.2:c.270_271insA, NM_015506.2:c.271dupA, NM_015506.2:c.615C>GMethylmalonic acidemia with homocystinuria, type cblC follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMACHC gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by failure to thrive, acute neurological deterioration, intellectual deficit, lethargy, seizures, microcephaly, a salt-and-pepper retinopathy, and signs of megaloblastic anemia. The prevalence is <1:1,000,000.250,600
MMADHCmethylmalonic aciduria cblD type, with homocystinuriaNM_015702.2NM_015702.2:c.545C>A, NM_015702.2:c.746A>G, NM_015702.2:c.419dupA, NM_015702.2:c.748C>T, NM_015702.2:c.795_796insT, NM_015702.2:c.57_64delCTCTTTAG, NM_015702.2:c.737A>G, NM_015702.2:c.776T>C, NM_015702.2:c.478+1G>TMethylmalonic acidemia with homocystinuria, type cblD follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMADHC gene located on chromosomal region 2q23.2. The age of onset is variable (infantile to adult). This disease is characterized by developmental delay, severe learning difficulties, seizures, movement and gait abnormalities, behavioral problems and signs of megaloblastic anemia (pallor, fatigue, anorexia). The prevalence is 1:50,000-1:80,000.600
MOCS1Molybdenum cofactor deficiency type ANM_005943.5NM_005943.5:c.218G>A, NM_005943.5:c.397_406delCCGGACGTGG, NM_005943.5:c.217C>T, NM_005943.5:c.956G>A, NM_005943.5:c.1027C>TMolybdenum cofactor deficiency type A (gene MOCS1) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS1 gene located on chromosomal region 6p21.2. The age of onset is infantile. This disease is characterized by severe neurological abnormalities, dislocated ocular early death.600
MOCS2Molybdenum cofactor deficiency type BNM_176806.3NM_176806.3:c.106_107delAT, NM_176806.3:c.*297+1G>A, NM_176806.3:c.58delT, NM_176806.3:c.245delT, NM_176806.3:c.190G>A, NM_176806.3:c.16C>T, NM_176806.3:c.*487A>C, NM_176806.3:c.*422G>A, NM_176806.3:c.*26_*27delAT, NM_176806.3:c.539_540delAA, NM_176806.3:c.*459_*460delAAMolybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death.250,600
MPICongenital disorders of glycosylation type 1bNM_002435.2NM_002435.2:c.305C>T, NM_002435.2:c.656G>A, NM_002435.2:c.982C>T, NM_002435.2:c.413T>C, NM_002435.2:c.884G>A, NM_002435.2:c.1016_1019delACCCCongenital disorder of glycosylation type 1b follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MPI gene located on chromosomal region 15q24.1. The age of onset is infantile. This disease is characterized by hepatic-intestinal manifestations (diarrhoea, vomiting, and hepatomegaly associated with hepatic fibrosis).600
MPV17Mitochondrial DNA depletion syndrome type 6NM_002437.4NM_002437.4:c.263_265delAGA, NM_002437.4:c.148C>T, NM_002437.4:c.149G>A, NM_002437.4:c.263A>T, NM_002437.4:c.284_285insG, NM_002437.4:c.498C>A, NM_002437.4:c.462-2A>C, NM_002437.4:c.70G>T, NM_002437.4:c.359G>AMitochondrial DNA depletion syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MPV17 gene located on chromosomal region 2p23.3. The age of onset is infantile. It is a disease due to mitochondrial dysfunction. It is characterized by infantile onset of progressive liver failure, often leading to death in the first year of life, peripheral neuropathy, corneal scarring, acral ulceration and osteomyelitis leading to autoamputation, cerebral leukoencephalopathy, failure to thrive, and recurrent metabolic acidosis with intercurrent infections.600
MPZDejerine-Sottas syndrome (MPZ)NM_000530.6NM_000530.6:c.661G>A, NM_000530.6:c.380G>A, NM_000530.6:c.123_125delTGT, NM_000530.6:c.407T>A, NM_000530.6:c.560_563dupAGGC, NM_000530.6:c.355_356insTCTACT, NM_000530.6:c.661_662dupGC, NM_000530.6:c.411C>T, NM_000530.6:c.188C>G, NM_000530.6:c.506delT, NM_000530.6:c.190_192delTTC, NM_000530.6:c.496_499delCTCGinsTCC, NM_000530.6:c.372_377delGTTCAC, NM_000530.6:c.89T>C, NM_000530.6:c.499G>C, NM_000530.6:c.368G>ADejerine-Sottas syndrome follows autosomal recessive and dominant patterns of inheritance and is caused by pathogenic variants in the MPZ gene located on chromosomal region 1q23.3. The age of onset is infantile. A severe degenerating neuropathy of the demyelinating Charcot-Marie-Tooth disease category, with onset by age 2 years. It is characterized by motor and sensory neuropathy with very slow nerve conduction velocities, increased cerebrospinal fluid protein concentrations, hypertrophic nerve changes, and delayed age of walking as well as areflexia.600
MPZNeuropathy, congenital hypomyelinating or amyelinatingNM_000530.6NM_000530.6:c.588dupT, NM_000530.6:c.626_630delCGTCG, NM_000530.6:c.392A>G, NM_000530.6:c.578G>A, NM_000530.6:c.397C>T, NM_000530.6:c.164G>T, NM_000530.6:c.150C>G, NM_000530.6:c.142C>G, NM_000530.6:c.130_137delTCCCGGGT, NM_000530.6:c.128G>T, NM_000530.6:c.549dupG, NM_000530.6:c.106A>G, NM_000530.6:c.410G>C, NM_000530.6:c.332C>T, NM_000530.6:c.371C>A, NM_000530.6:c.368_382delGCACGTTCACTTGTG, NM_000530.6:c.382G>A, NM_000530.6:c.393C>A, NM_000530.6:c.103G>T, NM_000530.6:c.88A>T, NM_000530.6:c.106A>T, NM_000530.6:c.419C>GNeuropathy, congenital hypomyelinating or amyelinating follows an autosomal recessive or dominant patterns of inheritance and is caused by pathogenic variants in the MPZ gene located on chromosomal region 1q23.3. The age of onset is infantile. A severe degenerating neuropathy that results from a congenital impairment in myelin formation. It is clinically characterized by early onset of hypotonia, areflexia, distal muscle weakness, and very slow nerve conduction velocities (as low as 3m/s). Some patients manifest nearly complete absence of spontaneous limb movements, respiratory distress at birth, and complete absence of myelin shown by electron microscopy of peripheral nerves.600
MRPS16Combined oxidative phosphorylation deficiency type 2NM_016065.3NM_016065.3:c.2T>C, NM_016065.3:c.331C>TCombined oxidative phosphorylation defect type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MRPS16 gene located on chromosomal region 10q22.2. The age of onset is infantile. This disease is characterized by agenesis of corpus callosum, dismorphism and fatal lactic acidosis.600
MRPS22Combined oxidative phosphorylation deficiency type 5NM_020191.2NM_020191.2:c.509G>A, NM_020191.2:c.644T>C, NM_020191.2:c.40_41insACombined oxidative phosphorylation defect type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MRPS22 gene located on chromosomal region 3q23. The age of onset is infantile. This disease is characterized by evere hypotonia, lactic academia and congenital hyperammonaemia.600
MTHFRHomocystinuria due to MTHFR deficiencyNM_005957.4NM_005957.4:c.1743G>A, NM_005957.4:c.3G>A, NM_005957.4:c.547C>T, NM_005957.4:c.1129C>T, NM_005957.4:c.1768delC, NM_005957.4:c.968T>C, NM_005957.4:c.971A>G, NM_005957.4:c.439C>THomocystinuria due to methylene tetrahydrofolate reductase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTHFR gene located on chromosomal region 1p36.22. There are some forms with onset during childhood, adolescence, or adulthood beginning with mental regression, ataxia, and, most often, common psychiatric disorders of the schizophrenic type that may be linked to cerebrovascular accidents. Other symptoms are recurrent apnoea, microcephaly and convulsions.600
MTM1Myotubular myopathy, X-linkedNM_000252.2NM_000252.2:c.1415_1416delGT, NM_000252.2:c.1357_1358delCC, NM_000252.2:c.461T>G, NM_000252.2:c.420C>G, NM_000252.2:c.595_599delCCTGC, NM_000252.2:c.1261-10A>G, NM_000252.2:c.780T>A, NM_000252.2:c.670C>T, NM_000252.2:c.1306_1310dupCCTAT, NM_000252.2:c.969delA, NM_000252.2:c.721C>T, NM_000252.2:c.70C>T, NM_000252.2:c.969dupAX-linked centronuclear myopathy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the MTM1 gene located on chromosomal region Xq28. The age of onset is infantile, etc/. This disease is characterized by severe phenotype in males presenting at birth with marked weakness, hypotonia and respiratory failure. The incidence is 1/50,000 newborn man.600
MTMR2Charcot-Marie-Tooth disease type 4B1NM_016156.5NM_016156.5:c.88C>T, NM_016156.5:c.304C>T, NM_016156.5:c.1276C>T, NM_016156.5:c.88A>TCharcot-Marie-Tooth disease type 4B1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTMR2 gene located on chromosomal region 11q21. The age of onset is early infantile. This disease is characterized by distal and proximal muscular weakness starting in the lower extremities, sensory loss and cranial nerve involvement, foot deformities and diaphragmatic and facial involvement.600
MTTPAbetalipoproteinemiaNM_000253.3NM_000253.3:c.1769G>T, NM_000253.3:c.2030delC, NM_000253.3:c.1619G>A, NM_000253.3:c.2593G>T, NM_000253.3:c.708_709delCA, NM_000253.3:c.1867+1G>A, NM_000253.3:c.703_704delACAbetalipoproteinemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTP gene located on chromosomal region 4q23. The age of onset is infantile. This disease is characterized by growth delay, malabsorption, hepatomegaly, and neurological and neuromuscular manifestations. The prevalence is <1:1,000,000.250,600
MUTMethylmalonic acidemiaNM_000255.3NM_000255.3:c.1420C>T, NM_000255.3:c.1445-2A>G, NM_000255.3:c.2080C>T, NM_000255.3:c.1867G>A, NM_000255.3:c.607G>A, NM_000255.3:c.1658delT, NM_000255.3:c.1280G>A, NM_000255.3:c.1399C>T, NM_000255.3:c.914T>C, NM_000255.3:c.643G>A, NM_000255.3:c.655A>T, NM_000255.3:c.1741C>T, NM_000255.3:c.1106G>A, NM_000255.3:c.1871A>G, NM_000255.3:c.1924G>C, NM_000255.3:c.682C>T, NM_000255.3:c.572C>A, NM_000255.3:c.313T>C, NM_000255.3:c.1181T>A, NM_000255.3:c.278G>A, NM_000255.3:c.678_679insAATTTATG, NM_000255.3:c.794dupT, NM_000255.3:c.671_678dupAATTTATG, NM_000255.3:c.2150G>T, NM_000255.3:c.280G>A, NM_000255.3:c.91C>T, NM_000255.3:c.1207C>TMethylmalonic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MUT gene located on chromosomal region 6p12.3. The age of onset is very early infantile. This disease is characterized by recurrent ketoacidotic comas or transient vomiting, dehydration, hypotonia and intellectual deficit, which does not respond to administration of vitamin B12.250,600
MVKHyper-IgD syndromeNM_000431.3NM_000431.3:c.829C>T, NM_000431.3:c.803T>C, NM_000431.3:c.185G>A, NM_000431.3:c.494C>T, NM_000431.3:c.59A>C, NM_000431.3:c.1129G>AHyper IgD syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by periodic attacks of fever and a systemic inflammatory reaction (cervical lymphadenopathy, abdominal pain, vomiting, diarrhea, arthralgias and skin signs).250,600
MVKMevalonic aciduriaNM_000431.3NM_000431.3:c.1000G>A, NM_000431.3:c.902A>C, NM_000431.3:c.928G>AMevalonic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by psychomotor retardation, failure to thrive, progressive cerebellar ataxia, dysmorphic features, progressive visual impairment and recurrent febrile crises. The prevalence is <1:1,000,000.250,600
MYO15ADeafness type 3, autosomal recessiveNM_016239.3NM_016239.3:c.3385C>T, NM_016239.3:c.6003delG, NM_016239.3:c.6004delG, NM_016239.3:c.10573delA, NM_016239.3:c.3313G>T, NM_016239.3:c.3336delG, NM_016239.3:c.755dupA, NM_016239.3:c.5492G>T, NM_016239.3:c.4351G>A, NM_016239.3:c.6864_6874delGGACCTGGAGC, NM_016239.3:c.4751_4752dupTC, NM_016239.3:c.625G>T, NM_016239.3:c.3693-2A>G, NM_016239.3:c.6614C>T, NM_016239.3:c.6743C>T, NM_016239.3:c.6046+2T>G, NM_016239.3:c.5326C>T, NM_016239.3:c.3756+1G>T, NM_016239.3:c.8410A>T, NM_016239.3:c.8429_8447delGCGGGCAGCTGCGGGTCCT, NM_016239.3:c.8148G>T, NM_016239.3:c.9958_9961delGACT, NM_016239.3:c.4750_4751insTC, NM_016239.3:c.8548C>TDeafness autosomal recessive type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO15A gene located on chromosomal region 17p11.2. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.250,600
MYO3ADeafness type 30, autosomal recessiveNM_017433.4NM_017433.4:c.1086T>G, NM_017433.4:c.2793+2T>A, NM_017433.4:c.4586+2T>G, NM_017433.4:c.4730+1G>A, NM_017433.4:c.1A>G, NM_017433.4:c.2506-1G>A, NM_017433.4:c.1777-12G>A, NM_017433.4:c.1952delC, NM_017433.4:c.1193C>A, NM_017433.4:c.770C>G, NM_017433.4:c.3154C>T, NM_017433.4:c.585+5G>C, NM_017433.4:c.2243delA, NM_017433.4:c.3112-2A>G, NM_017433.4:c.732-2A>GDeafness autosomal recessive type 30 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO3A gene located on chromosomal region 10p12.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.250,600
MYO5AGriscelli syndrome type 1NM_000259.3NM_000259.3:c.1145delC, NM_000259.3:c.2332C>TGriscelli disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO5A gene located on chromosomal region 15q21.2. The age of onset is infantile. This disease is characterized by is characterised by silvery gray sheen of the hair and hypopigmentation of the skin which can be associated to neurological impairment. The prevalence is <1:1,000,000.600
MYO6Deafness type 37, autosomal recessiveNM_004999.3NM_004999.3:c.2897_2899delAAG, NM_004999.3:c.2840G>A, NM_004999.3:c.647A>T, NM_004999.3:c.3496C>T, NM_004999.3:c.3808C>T, NM_004999.3:c.1446_1447insTDeafness autosomal recessive type 37 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO6 gene located on chromosomal region 6q14.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.250,600
MYO7ADeafness type 2, autosomal recessiveNM_000260.3NM_000260.3:c.1797G>A, NM_000260.3:c.2023C>T, NM_000260.3:c.731G>C, NM_000260.3:c.3596dupT, NM_000260.3:c.1184G>A, NM_000260.3:c.133-2A>GDeafness autosomal recessive type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.250,600
MYO7AUsher syndrome type 1BNM_000260.3NM_000260.3:c.1996C>T, NM_000260.3:c.1884C>A, NM_000260.3:c.448C>T, NM_000260.3:c.2476G>A, NM_000260.3:c.4024delT, NM_000260.3:c.2617C>T, NM_000260.3:c.5227C>T, NM_000260.3:c.1344-1G>A, NM_000260.3:c.5507T>G, NM_000260.3:c.5886_5889delCTTT, NM_000260.3:c.3504-1G>C, NM_000260.3:c.3508G>A, NM_000260.3:c.4018G>A, NM_000260.3:c.5392C>T, NM_000260.3:c.640G>A, NM_000260.3:c.3134T>C, NM_000260.3:c.5824G>T, NM_000260.3:c.3G>A, NM_000260.3:c.494C>T, NM_000260.3:c.5618G>A, NM_000260.3:c.5884_5887delTTCT, NM_000260.3:c.634C>T, NM_000260.3:c.3719G>A, NM_000260.3:c.5967C>G, NM_000260.3:c.3763delA, NM_000260.3:c.635G>A, NM_000260.3:c.6025delGUsher syndrome type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 1:100,000-9:100,000.250,600
NAGASchindler diseaseNM_000262.2NM_000262.2:c.973G>A, NM_000262.2:c.985C>T, NM_000262.2:c.986G>A, NM_000262.2:c.577G>TSchindler disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGA gene located on chromosomal region 22q13.2. The age of onset is infantile. This disease is characterized by early-onset neuroaxonal dystrophy and neurological signs (convulsion during fever, epilepsy, psychomotor retardation and hypotonia). NAGA deficiency is typically classified in three main phenotypes: NAGA deficiency type I (Schindler disease or Schindler disease type I) with severe manifestations; NAGA deficiency type II (Kanzazi disease or Schindler disease type II) which is mild; NAGA deficiency type III (Schindler disease type III) characterized by mild-to-moderate neurologic manifestations. NAGA deficiency results in the increased urinary excretion of glycopeptides and oligosaccharides containing alpha-N-acetylgalactosaminyl moieties.250,600
NAGSHyperammonemia due to N-acetylglutamate synthetase deficiencyNM_153006.2NM_153006.2:c.971G>A, NM_153006.2:c.1289T>C, NM_153006.2:c.1025delG, NM_153006.2:c.916-2A>T, NM_153006.2:c.1307dupT, NM_153006.2:c.1299G>CHyperammonemia due to N-acetylglutamate synthetase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGS gene located on chromosomal region 17q21.31. The age of onset is infantile, etc/. This disease is characterized by vomiting, hyperactivity or lethargy, diarrhoea, poor feeding, seizures, hypotonia, delayed psychomotor development and respiratory distress. The prevalence is <1:1,000,000.600
NDRG1Charcot-Marie-Tooth disease, type 4DNM_006096.3NM_006096.3:c.16C>T, NM_006096.3:c.-18-2_-18-1delAG, NM_006096.3:c.538-1G>A, NM_006096.3:c.-18-2_-18-1del1, NM_006096.3:c.928C>T, NM_006096.3:c.442C>TCharcot-Marie-Tooth disease type 4D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NDRG1 gene located on chromosomal region 8q24.22. The age of onset is infantile, etc/. This disease is characterized by demyelination and hearing loss.600
NEBNemaline myopathy type 2NM_004543.4NM_004543.4:c.11474_11475delTG, NM_004543.4:c.19119_19120delGA, NM_004543.4:c.19306-1G>A, NM_004543.4:c.19606G>T, NM_004543.4:c.6105dupT, NM_004543.4:c.3191A>G, NM_004543.4:c.18318_18319delAG, NM_004543.4:c.11473_11474delAT, NM_004543.4:c.2173G>T, NM_004543.4:c.19097_19098delTT, NM_004543.4:c.19836+1_19836+2insATGGA, NM_004543.4:c.18825+1370C>T, NM_004543.4:c.5567G>A, NM_004543.4:c.6105_6106insT, NM_004543.4:c.16842+1G>A, NM_004543.4:c.843T>G, NM_004543.4:c.8031_8041delAAATAAACGAG, NM_004543.4:c.14182_14183delGCinsAA, NM_004543.4:c.15973C>TNemaline myopathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEB gene located on chromosomal region 2q23.3. The age of onset is infantile or adult. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:100,000-9:100,000 and the incidence is 1/50.000 newborn.250,600
NEFLCharcot-Marie-Tooth disease type 1FNM_006158.3NM_006158.3:c.418G>T, NM_006158.3:c.628G>T, NM_006158.3:c.361G>TCharcot-Marie-Tooth disease type 1F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEFL gene located on chromosomal region 8p21.2. The age of onset is infantile. This disease is characterized by a progressive peripheral motor and sensory neuropathy with variable clinical, distal weakness and wasting of the muscles of the lower limbs. The prevalence is 15:100,000-20:100,000.600
NEUROG3Diarrhea type 4, malabsorptive, congenitalNM_020999.3NM_020999.3:c.319C>A, NM_020999.3:c.278G>TCongenital malabsorptive diarrhea type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEUROG3 gene located on chromosomal region 10q22.1. The age of onset is early infantile. This disease is characterized by generalized malabsorption, a paucity of enteroendocrine cells, those symptoms lead to vomiting, diarrhea, dehydration, and a severe hyperchloremic metabolic acidosis after the ingestion of standard cow's milk-based formula. The prevalence is <1:1,000,000.600
NHP2Dyskeratosis congenita type 2, autosomal recessiveNM_017838.3NM_017838.3:c.415T>C, NM_017838.3:c.460T>A, NM_017838.3:c.289_290delATDyskeratosis congenita 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NHP2 gene located on chromosomal region 5q35.3. The age of onset is variable from infancy to adult. It is a multisystem disorder caused by defective telomere maintenance. Clinical manifestations include mucocutaneous abnormalities, bone marrow failure, and an increased predisposition to cancer, among other variable features.600
NMNAT1Leber congenital amaurosis type 9NM_022787.3NM_022787.3:c.451G>T, NM_022787.3:c.25G>A, NM_022787.3:c.457C>G, NM_022787.3:c.507G>A, NM_022787.3:c.710G>T, NM_022787.3:c.619C>T, NM_022787.3:c.769G>ALeber congenital amaurosis type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NMNAT1 gene located on chromosomal region 1p36.22. The age of onset is early infantile. This disease is characterized by blindness, nystagmus, roving eye movement, leading to severe visual impairment.250,600
NOP10Dyskeratosis congenita type 1, autosomal recessiveNM_018648.3NM_018648.3:c.34G>C, NM_018648.3:c.100C>TDyskeratosis congenita autosomal recessive type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NOP10 gene located on chromosomal region 15q14. The age of onset is infantile. This disease is characterized by the mucocutaneous triad of abnormal skin pigmentation, nail dystrophy and mucosal leucoplakia. The prevalence is 1:1,000,000.600
NPC1Niemann-Pick disease type C1NM_000271.4NM_000271.4:c.1042C>T, NM_000271.4:c.2842G>A, NM_000271.4:c.1628C>T, NM_000271.4:c.2974G>T, NM_000271.4:c.3019C>G, NM_000271.4:c.1211G>A, NM_000271.4:c.2072C>T, NM_000271.4:c.2324A>C, NM_000271.4:c.337T>C, NM_000271.4:c.3107C>T, NM_000271.4:c.530G>A, NM_000271.4:c.743G>T, NM_000271.4:c.3611_3614delTTAC, NM_000271.4:c.813_815delCAT, NM_000271.4:c.2932C>T, NM_000271.4:c.3425T>C, NM_000271.4:c.2761C>T, NM_000271.4:c.3104C>T, NM_000271.4:c.3662delT, NM_000271.4:c.2972_2973delAG, NM_000271.4:c.2974G>A, NM_000271.4:c.2873G>A, NM_000271.4:c.352_353delAG, NM_000271.4:c.3182T>C, NM_000271.4:c.3467A>G, NM_000271.4:c.3175C>T, NM_000271.4:c.2861C>T, NM_000271.4:c.2848G>ANiemann-Pick disease type C1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC1 gene located on chromosomal region 18q11.2. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000.250,600
NPC2Niemann-Pick disease type C2NM_006432.3NM_006432.3:c.115G>A, NM_006432.3:c.190+5G>A, NM_006432.3:c.27delG, NM_006432.3:c.352G>T, NM_006432.3:c.58G>T, NM_006432.3:c.358C>T, NM_006432.3:c.295T>C, NM_006432.3:c.441+1G>A, NM_006432.3:c.436C>TNiemann-Pick disease type C2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC2 gene located on chromosomal region 14q24.3. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000.250,600
NPHP1Nephronophthisis type 1NM_000272.3NM_000272.3:c.80T>A, NM_000272.3:c.1delA, NM_000272.3:c.555_556insA, NM_000272.3:c.829C>T, NM_000272.3:c.455C>G, NM_000272.3:c.1884+1G>T, NM_000272.3:c.1184dupCNephronophthisis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP1 gene located on chromosomal region 2q13. The age of onset is juvenile. This disease is characterized by anemia, polyuria, polydipsia, isosthenuria and death in uremia. Symmetrical destruction of the kidneys involving both tubules and glomeruli occurs. The underlying pathology is a chronic tubulo-interstitial nephropathy with characteristic tubular basement membrane thickening and medullary cyst formation. Associations with extrarenal symptoms, especially ocular lesions, are frequent.600
NPHP3Nephronophthisis type 3NM_153240.4NM_153240.4:c.1817G>A, NM_153240.4:c.434_437delAAAG, NM_153240.4:c.1119-2A>G, NM_153240.4:c.1729C>T, NM_153240.4:c.2694-2A>G, NM_153240.4:c.1985+5G>A, NM_153240.4:c.3406C>T, NM_153240.4:c.3373C>T, NM_153240.4:c.1381G>T, NM_153240.4:c.2694-2_2694-1delAG, NM_153240.4:c.1157A>G, NM_153240.4:c.2369T>C, NM_153240.4:c.3550G>A, NM_153240.4:c.2541delG, NM_153240.4:c.2570+1G>T, NM_153240.4:c.3156_3157insA, NM_153240.4:c.3662C>TNephronophthisis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP3 gene located on chromosomal region 3q22.1. The age of onset is adult. This disease is characterized by polyuria, polydipsia, anemia. Onset of terminal renal failure occur significantly later (median age, 19 years) than in juvenile nephronophthisis. Renal pathology is characterized by alterations of tubular basement membranes, tubular atrophy and dilation, sclerosing tubulointerstitial nephropathy, and renal cyst development predominantly at the corticomedullary junction. The prevalence is <1:1,000,000.250,600
NPHP4Nephronophthisis type 4NM_015102.4NM_015102.4:c.4179T>A, NM_015102.4:c.3767_3768insAA, NM_015102.4:c.3674C>T, NM_015102.4:c.556_557insT, NM_015102.4:c.2940_2944dupGCTCC, NM_015102.4:c.3231+1G>C, NM_015102.4:c.517C>T, NM_015102.4:c.2335C>T, NM_015102.4:c.2219G>A, NM_015102.4:c.7G>T, NM_015102.4:c.1972C>T, NM_015102.4:c.1120-1G>CNephronophthisis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP4 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease results in end-stage renal disease at age ranging between 6 and 35 years. It is a progressive tubulo-interstitial kidney disorder characterized by polydipsia, polyuria, anemia and growth retardation. The prevalence is 1:1,000,000-9:1,000,000.250,600
NPHS1Nephrotic syndrome type 1NM_004646.3NM_004646.3:c.59-5C>G, NM_004646.3:c.3109+1G>A, NM_004646.3:c.3478C>T, NM_004646.3:c.121_122delCT, NM_004646.3:c.1481delC, NM_004646.3:c.2456A>T, NM_004646.3:c.2491C>T, NM_004646.3:c.2464G>A, NM_004646.3:c.1307_1308dupAC, NM_004646.3:c.3250delG, NM_004646.3:c.3325C>T, NM_004646.3:c.2928G>T, NM_004646.3:c.3250_3251insG, NM_004646.3:c.2746G>T, NM_004646.3:c.1715G>ANephrotic syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHS1 gene located on chromosomal region 19q13.12. The age of onset is fetal- infantile. This disease is characterized by fetal proteinuria and nephritic infantile syndrome. The prevalence is 1 in 8 200 births.250,600
NR0B1Cytomegalic congenital adrenal hypoplasiaNM_000475.4NM_000475.4:c.513G>A, NM_000475.4:c.591C>A, NM_000475.4:c.315G>C, NM_000475.4:c.873G>C, NM_000475.4:c.800G>C, NM_000475.4:c.788T>A, NM_000475.4:c.704G>A, NM_000475.4:c.1319A>T, NM_000475.4:c.388_389delTA, NM_000475.4:c.273C>A, NM_000475.4:c.813C>G, NM_000475.4:c.847C>T, NM_000475.4:c.1107G>A, NM_000475.4:c.890T>C, NM_000475.4:c.1316T>GCytomegalic congenital adrenal hypoplasia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the NR0B1 gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by adrenal insufficiency with vomiting, feeding difficulty, dehydration, and shock caused by a salt-wasting episode and hypoglycemia.600
NR2E3Enhaced S-Cone SyndromeNM_014249.3NM_014249.3:c.119-2A>C, NM_014249.3:c.297_298delGT, NM_014249.3:c.932G>A, NM_014249.3:c.226C>T, NM_014249.3:c.361G>A, NM_014249.3:c.227G>A, NM_014249.3:c.1034_1038delTGCAGEnhaced S-Cone Syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NR2E3 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by night blindness, reduced bilateral visual acuity, and typical fundus findings (progressive pigmentary degenerative changes, macular edema, retinoschisis).250,600
NTRK1Hereditary sensory and autonomic neuropathy type 4NM_001012331.1NM_001012331.1:c.1076A>G, NM_001012331.1:c.1711G>C, NM_001012331.1:c.1741A>G, NM_001012331.1:c.1908_1909insT, NM_001012331.1:c.1709delT, NM_001012331.1:c.1942C>T, NM_001012331.1:c.1852C>T, NM_001012331.1:c.1456G>A, NM_001012331.1:c.2321G>C, NM_001012331.1:c.2066C>THereditary sensory and autonomic neuropathy type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NTRK1 gene located on chromosomal region 1q23.1. The age of onset is infantile. This disease is characterized by anhidrosis, insensitivity to pain, self-mutilating behavior and episodes of fever.600
NUP62Infantile striatal degenerationNM_153719.3NM_153719.3:c.1172A>CInfantile striatal degeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NUP62 gene located on chromosomal region 19q13.33. The age of onset is infantile. This disease is characterized by choreoathetosis, dystonia, rigidity, spasticity, dysphagia, optic atrophy, intellectual deficit, developmental regression of motor and verbal skills, failure to thrive, myoclonus, quadriparesis, cerebellar ataxia and nystagmus. The prevalence is <1:1,000,000.600
NYXNight blindness, congenital stationary , type 1A, X-linkedNM_022567.2NM_022567.2:c.1049G>ACongenital stationary night blindness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NYX gene located on chromosomal region Xp11.4. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity.600
OATGyrate atrophy of choroid and retina with or without ornithinemiaNM_000274.3NM_000274.3:c.1250C>T, NM_000274.3:c.159delC, NM_000274.3:c.1205T>C, NM_000274.3:c.901-2A>G, NM_000274.3:c.533G>A, NM_000274.3:c.1276C>T, NM_000274.3:c.824G>A, NM_000274.3:c.268C>G, NM_000274.3:c.952delG, NM_000274.3:c.994G>A, NM_000274.3:c.955C>T, NM_000274.3:c.677C>T, NM_000274.3:c.278G>T, NM_000274.3:c.627T>A, NM_000274.3:c.812G>A, NM_000274.3:c.952G>A, NM_000274.3:c.539G>C, NM_000274.3:c.596C>AGyrate atrophy of choroid and retina follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OAT gene located on chromosomal region 10q26.13. The age of onset is infantile. This disease is characterized by gyrate atrophy of the choroid and retina that begins during childhood with myopia and night blindness, followed by concentric shrinking of the visual field (tunnel vision) and a peculiar aspect of retinopathy on the funduscopy.600
OCA2Oculocutaneous albinism type 2NM_000275.2NM_000275.2:c.1610A>G, NM_000275.2:c.1960delG, NM_000275.2:c.2359G>A, NM_000275.2:c.819_822delCTGGinsGGTC, NM_000275.2:c.2228C>T, NM_000275.2:c.1025A>G, NM_000275.2:c.1842+1G>T, NM_000275.2:c.157delA, NM_000275.2:c.1182G>A, NM_000275.2:c.1182+2T>C, NM_000275.2:c.1441G>A, NM_000275.2:c.79G>A, NM_000275.2:c.1465A>G, NM_000275.2:c.1327G>A, NM_000275.2:c.1364+1G>TOculocutaneous albinism type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OCA2 gene located on chromosomal region 15q12-q13. The age of onset is infantile. This disease is characterized by variable hypopigmentation of the skin and hair, numerous characteristic ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1/38,000-1/40,000250,600
OCRLLowe syndromeNM_000276.3NM_000276.3:c.2299C>T, NM_000276.3:c.909_910delAG, NM_000276.3:c.2535delA, NM_000276.3:c.2403dupA, NM_000276.3:c.1499G>A, NM_000276.3:c.2530C>TLowe syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the OCRL gene located on chromosomal region Xq25-q26. The age of onset is infantile. This disease is characterized by proximal tubule dysfunction, hypercalcinuria, mild intellectual impairment, hypotonia and sub-clinical cataract. The prevalence is 1:100,000-10:100,000 newborn.600
OFD1Joubert syndrome type 10NM_003611.2NM_003611.2:c.2582dupT, NM_003611.2:c.2321_2322insT, NM_003611.2:c.277G>TJoubert syndrome type 10 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the OFD1 gene located on chromosomal region Xp22.2. The age of onset is early. A disorder presenting with cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy and renal disease.600
OFD1Orofaciodigital syndrome type 1NM_003611.2NM_003611.2:c.43_44delAG, NM_003611.2:c.52G>T, NM_003611.2:c.65dupA, NM_003611.2:c.221C>T, NM_003611.2:c.274T>C, NM_003611.2:c.616_617delGA, NM_003611.2:c.260A>G, NM_003611.2:c.13-10T>A, NM_003611.2:c.312+1delG, NM_003611.2:c.224A>C, NM_003611.2:c.294_312delTGGTTTGGCAAAAGAAAAG, NM_003611.2:c.62_63insT, NM_003611.2:c.275_276delCT, NM_003611.2:c.614_617delGAGA, NM_003611.2:c.225C>G, NM_003611.2:c.602delA, NM_003611.2:c.628C>T, NM_003611.2:c.653delA, NM_003611.2:c.1365_1368delACAA, NM_003611.2:c.619_624delATAGAA, NM_003611.2:c.1303A>C, NM_003611.2:c.1318delC, NM_003611.2:c.654+2_654+3delTA, NM_003611.2:c.1268_1272delAAAAC, NM_003611.2:c.1323_1326delAGAA, NM_003611.2:c.1360_1363delCTTA, NM_003611.2:c.1358T>A, NM_003611.2:c.1840delG, NM_003611.2:c.1612C>T, NM_003611.2:c.1757delG, NM_003611.2:c.1821delG, NM_003611.2:c.1319delT, NM_003611.2:c.1859_1860delCCinsG, NM_003611.2:c.2261-1G>T, NM_003611.2:c.235G>A, NM_003611.2:c.607_610delTATA, NM_003611.2:c.594_598delAAAGC, NM_003611.2:c.247C>T, NM_003611.2:c.2387+1G>C, NM_003611.2:c.290A>G, NM_003611.2:c.454C>T, NM_003611.2:c.312+2_312+7delTAAAGT, NM_003611.2:c.413-10T>G, NM_003611.2:c.2349delC, NM_003611.2:c.518-1G>A, NM_003611.2:c.1322_1326delAAGAA, NM_003611.2:c.541dupG, NM_003611.2:c.243C>G, NM_003611.2:c.241C>GOrofaciodigital syndrome type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the OFD1 gene located on chromosomal region Xp22.2. It is a group of heterogeneous disorders characterized by abnormalities in the oral cavity, face, and digits and associated phenotypic abnormalities that lead to the delineation of various subtypes. OFD1 is X-linked dominant syndrome, lethal in males. Craniofacial findings consist of facial asymmetry, hypertelorism, median cleft, or pseudocleft of the upper lip, hypoplasia of the alae nasi, oral clefts and abnormal frenulea, tongue anomalies (clefting, cysts, hamartoma), and anomalous dentition involving missing or extra teeth. Asymmetric brachydactyly and/or syndactyly of the fingers and toes occur frequently. Approximately 50% of OFD1 females have some degree of intellectual disability. Some patients have structural central nervous system anomalies such as agenesis of the corpus callosum, cerebellar agenesis, or a Dandy-Walker malformation. Patients with OFD1 can develop fibrocystic disease of the liver and pancreas, in addition to polycystic kidneys.600
OPA33-methylglutaconic aciduria type 3NM_025136.3NM_025136.3:c.*24136delG, NM_025136.3:c.221delG3-methylglutaconic aciduria type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OPA3 gene located on chromosomal region 19q13.32. The age of onset is infantile. This disease is characterized by the association of optic atrophy and choreoathetosis with 3-methylglutaconic aciduria. The prevalence is 1:10,000-5:10,000.600
OSTM1Osteopetrosis type 5, autosomal recessiveNM_014028.3NM_014028.3:c.415_416delAGOsteopetrosis, autosomal recessive type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OSTM1 gene located on chromosomal region 6p21. The age of onset is infantile. This disease is characterized by osteopetrosis, agenesis del cuerpo calloso, atrofia cerebral e hipocampo pequeño.600
OTCOrnithine transcarbamylase deficiencyNM_000531.5NM_000531.5:c.119G>A, NM_000531.5:c.259G>A, NM_000531.5:c.118C>T, NM_000531.5:c.617T>G, NM_000531.5:c.646C>G, NM_000531.5:c.148G>T, NM_000531.5:c.589G>T, NM_000531.5:c.77G>A, NM_000531.5:c.829C>T, NM_000531.5:c.674C>T, NM_000531.5:c.717+2T>C, NM_000531.5:c.563G>T, NM_000531.5:c.275G>A, NM_000531.5:c.245T>G, NM_000531.5:c.460G>T, NM_000531.5:c.134T>C, NM_000531.5:c.332T>C, NM_000531.5:c.238A>G, NM_000531.5:c.421C>TOrnithine transcarbamylase deficiency follows an X-linked pattern of inheritance and is caused by pathogenic variants in the OTC gene located on chromosomal region Xp11.4. The age of onset is infantile. This disease is characterized by severe neonatal hyperammonemic coma that generally proves to be fatal, in males. Females may be also affected by symptoms with various degrees of intensity, ranging from dislike for proteins to chronic vomiting, growth retardation, hypotonia, psychomotor retardation, hyperammonemic coma, or psychiatric disorders. The prevalence is 1:80,000.600
OTOADeafness type 22, autosomal recessiveNM_144672.3NM_144672.3:c.2301+1G>T, NM_144672.3:c.2359G>T, NM_144672.3:c.121-1G>A, NM_144672.3:c.827delT, NM_144672.3:c.1725_1726delCADeafness, autosomal recessive type 22 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOA gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems.250,600
OTOFDeaffness type 9, autosomal recessiveNM_194248.2NM_194248.2:c.149G>A, NM_194248.2:c.1867G>A, NM_194248.2:c.1669G>A, NM_194248.2:c.2381G>A, NM_194248.2:c.1498C>T, NM_194248.2:c.1544T>C, NM_194248.2:c.5473C>G, NM_194248.2:c.1150G>A, NM_194248.2:c.1778delT, NM_194248.2:c.5103+2T>A, NM_194248.2:c.227+2T>C, NM_194248.2:c.5474_5475delCC, NM_194248.2:c.5332G>A, NM_194248.2:c.584-1G>C, NM_194248.2:c.98G>A, NM_194248.2:c.2348delG, NM_194248.2:c.3032T>C, NM_194248.2:c.4559G>A, NM_194248.2:c.4491T>A, NM_194248.2:c.5816G>A, NM_194248.2:c.766-2A>G, NM_194248.2:c.2485C>T, NM_194248.2:c.2401G>TDeaffness, autosomal recessive type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems.250,600
PAHPhenylketonuriaNM_000277.1NM_000277.1:c.1139C>T, NM_000277.1:c.1066-3C>T, NM_000277.1:c.117C>G, NM_000277.1:c.1166delC, NM_000277.1:c.1068C>A, NM_000277.1:c.1315+1G>A, NM_000277.1:c.1162G>A, NM_000277.1:c.143T>C, NM_000277.1:c.1243G>A, NM_000277.1:c.1169A>G, NM_000277.1:c.136G>A, NM_000277.1:c.1184C>A, NM_000277.1:c.194T>C, NM_000277.1:c.1199+17G>A, NM_000277.1:c.232G>A, NM_000277.1:c.1045T>C, NM_000277.1:c.1197A>T, NM_000277.1:c.441+1G>A, NM_000277.1:c.442-1G>A, NM_000277.1:c.442-5C>G, NM_000277.1:c.450_451insA, NM_000277.1:c.472C>T, NM_000277.1:c.204A>T, NM_000277.1:c.482T>C, NM_000277.1:c.250G>T, NM_000277.1:c.261C>A, NM_000277.1:c.1030G>A, NM_000277.1:c.1199+1G>A, NM_000277.1:c.1238G>C, NM_000277.1:c.1241A>G, NM_000277.1:c.673C>G, NM_000277.1:c.688G>A, NM_000277.1:c.721C>T, NM_000277.1:c.722delG, NM_000277.1:c.722G>A, NM_000277.1:c.727C>T, NM_000277.1:c.728G>A, NM_000277.1:c.733G>C, NM_000277.1:c.734T>C, NM_000277.1:c.737C>A, NM_000277.1:c.745C>T, NM_000277.1:c.1042C>G, NM_000277.1:c.638T>C, NM_000277.1:c.764T>C, NM_000277.1:c.782G>A, NM_000277.1:c.806delT, NM_000277.1:c.809G>A, NM_000277.1:c.814G>T, NM_000277.1:c.818C>T, NM_000277.1:c.823C>T, NM_000277.1:c.829T>G, NM_000277.1:c.898G>T, NM_000277.1:c.912+1G>A, NM_000277.1:c.284_286delTCA, NM_000277.1:c.754C>T, NM_000277.1:c.755G>A, NM_000277.1:c.357delC, NM_000277.1:c.1217T>C, NM_000277.1:c.1222C>T, NM_000277.1:c.157C>T, NM_000277.1:c.158G>A, NM_000277.1:c.165T>G, NM_000277.1:c.473G>A, NM_000277.1:c.490A>G, NM_000277.1:c.503delA, NM_000277.1:c.508C>G, NM_000277.1:c.533A>G, NM_000277.1:c.665A>G, NM_000277.1:c.838G>A, NM_000277.1:c.842+5G>A, NM_000277.1:c.896T>G, NM_000277.1:c.320A>G, NM_000277.1:c.441+5G>T, NM_000277.1:c.311C>A, NM_000277.1:c.527G>T, NM_000277.1:c.529G>A, NM_000277.1:c.47_48delCT, NM_000277.1:c.1208C>T, NM_000277.1:c.331C>T, NM_000277.1:c.926C>T, NM_000277.1:c.955G>T, NM_000277.1:c.926C>A, NM_000277.1:c.509+1G>A, NM_000277.1:c.1033G>T, NM_000277.1:c.611A>G, NM_000277.1:c.1066-11G>A, NM_000277.1:c.569T>CPhenylketonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAH gene located on chromosomal region 12q23.2. The age of onset is neonatal. This disease is characterized by gradual developmental delay, stunted growth, microcephaly, seizures, tremors, eczema, vomiting, and musty odor. Untreated patients subsequently develop intellectual disability, behavioral disorders (hyperactivity) and motor disorders. The prevalence is 1:2,600-1:200,000.250,600
PALB2Fanconi anemia, complementation group NNM_024675.3NM_024675.3:c.1882_1890delAAGTCCTGC, NM_024675.3:c.2962C>T, NM_024675.3:c.50T>G, NM_024675.3:c.3116delA, NM_024675.3:c.3287A>G, NM_024675.3:c.3549C>G, NM_024675.3:c.3113G>A, NM_024675.3:c.2816T>G, NM_024675.3:c.1240C>T, NM_024675.3:c.557_558insAFanconi anemia, complementation group N follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PALB2 gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:1,000,000-9:1,000,000.250,600
PANK2Pantothenate kinase-associated neurodegenerationNM_153638.2NM_153638.2:c.1561G>A, NM_153638.2:c.688G>A, NM_153638.2:c.790C>T, NM_153638.2:c.821_822delCT, NM_153638.2:c.1583C>T, NM_153638.2:c.1211A>TPantothenate kinase-associated neurodegeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PANK2 gene located on chromosomal region 20p13. The age of onset is infantile. This disease is characterized by progressive extrapyramidal dysfunction (dystonia, rigidity, choreoathetosis), iron accumulation on the brain and axonal spheroids in the central nervous system. The prevalence is 1-2/1,000,000.250,600
PAX3Waardenburg syndrome type 3NM_181457.3NM_181457.3:c.268T>C, NM_181457.3:c.251C>TWaardenburg syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAX3 gene located on chromosomal region 2q36.1. The age of onset is infantile. This disease is characterized by limb anomalies in association with congenital hearing loss, minor defects in structures arising from neural crest resulting in pigmentation anomalies of eyes, hair, and skin.600
PAX6AniridiaNM_000280.4NM_000280.4:c.1032+3A>T, NM_000280.4:c.978_979delCA, NM_000280.4:c.949C>T, NM_000280.4:c.1124C>A, NM_000280.4:c.1032+3_1032+6delAAGT, NM_000280.4:c.917-2A>T, NM_000280.4:c.1000_1001insTGGCATATAACCT, NM_000280.4:c.891delA, NM_000280.4:c.889dupC, NM_000280.4:c.890_905delAACCAATTCCACAACC, NM_000280.4:c.921_924dupCTCC, NM_000280.4:c.888C>G, NM_000280.4:c.887dupA, NM_000280.4:c.889C>T, NM_000280.4:c.888C>A, NM_000280.4:c.868_871dupAGTT, NM_000280.4:c.847_854dupAGTCATAT, NM_000280.4:c.879dupC, NM_000280.4:c.875G>T, NM_000280.4:c.839delA, NM_000280.4:c.829C>T, NM_000280.4:c.818delA, NM_000280.4:c.844_845delCC, NM_000280.4:c.812_813delTG, NM_000280.4:c.808A>T, NM_000280.4:c.799A>T, NM_000280.4:c.818dupA, NM_000280.4:c.794G>A, NM_000280.4:c.781C>T, NM_000280.4:c.775dupT, NM_000280.4:c.795G>A, NM_000280.4:c.1031A>G, NM_000280.4:c.1016_1019delATAA, NM_000280.4:c.1017delT, NM_000280.4:c.766-1G>C, NM_000280.4:c.766-2delA, NM_000280.4:c.760_765+9delATACAGGTACCGAGA, NM_000280.4:c.765G>C, NM_000280.4:c.765G>T, NM_000280.4:c.763C>T, NM_000280.4:c.742_752delGATCTACCTGA, NM_000280.4:c.745delC, NM_000280.4:c.916+2T>G, NM_000280.4:c.847_848dupAG, NM_000280.4:c.916+1G>C, NM_000280.4:c.689delA, NM_000280.4:c.683-2A>C, NM_000280.4:c.683-5_683-4delTTinsAAC, NM_000280.4:c.683-6T>A, NM_000280.4:c.683-9C>G, NM_000280.4:c.682+2T>A, NM_000280.4:c.673delC, NM_000280.4:c.668delA, NM_000280.4:c.656_665delAAGAGCAAAT, NM_000280.4:c.661C>T, NM_000280.4:c.658G>T, NM_000280.4:c.655C>T, NM_000280.4:c.646T>C, NM_000280.4:c.642A>C, NM_000280.4:c.639_640delTA, NM_000280.4:c.640A>G, NM_000280.4:c.640A>T, NM_000280.4:c.631C>T, NM_000280.4:c.623G>A, NM_000280.4:c.622C>T, NM_000280.4:c.613C>T, NM_000280.4:c.607C>T, NM_000280.4:c.601C>T, NM_000280.4:c.595G>T, NM_000280.4:c.580G>T, NM_000280.4:c.773T>C, NM_000280.4:c.771G>A, NM_000280.4:c.770G>A, NM_000280.4:c.766-1G>A, NM_000280.4:c.535C>T, NM_000280.4:c.534G>T, NM_000280.4:c.532C>T, NM_000280.4:c.524-2A>G, NM_000280.4:c.520C>T, NM_000280.4:c.500_501delCGinsGA, NM_000280.4:c.490_500delCCGGGGACTTCinsTCGGTA, NM_000280.4:c.500C>A, NM_000280.4:c.495delG, NM_000280.4:c.491delC, NM_000280.4:c.489T>G, NM_000280.4:c.480delT, NM_000280.4:c.475delC, NM_000280.4:c.470delG, NM_000280.4:c.468G>A, NM_000280.4:c.467G>A, NM_000280.4:c.464delG, NM_000280.4:c.459dupC, NM_000280.4:c.454C>T, NM_000280.4:c.450delC, NM_000280.4:c.432dupT, NM_000280.4:c.428_431delATGA, NM_000280.4:c.406C>T, NM_000280.4:c.403C>T, NM_000280.4:c.402delG, NM_000280.4:c.397G>T, NM_000280.4:c.383G>C, NM_000280.4:c.382C>T, NM_000280.4:c.366_379delAATAAACAGAGTTC, NM_000280.4:c.377T>A, NM_000280.4:c.375_376delAG, NM_000280.4:c.370_373delAACA, NM_000280.4:c.371delA, NM_000280.4:c.362_368dupCATCAAT, NM_000280.4:c.365C>A, NM_000280.4:c.362C>T, NM_000280.4:c.361T>C, NM_000280.4:c.358-1G>A, NM_000280.4:c.358-1G>C, NM_000280.4:c.357_357+5delCGTAAG, NM_000280.4:c.357+5G>A, NM_000280.4:c.357+2dupT, NM_000280.4:c.357+1G>A, NM_000280.4:c.357+1G>C, NM_000280.4:c.357+1G>T, NM_000280.4:c.349_357delATACCAAGC, NM_000280.4:c.339_357dupCAACGATAACATACCAAGC, NM_000280.4:c.353_357dupCAAGC, NM_000280.4:c.357C>G, NM_000280.4:c.357C>A, NM_000280.4:c.343_356dupGATAACATACCAAG, NM_000280.4:c.342_355delCGATAACATACCAA, NM_000280.4:c.350_354dupTACCA, NM_000280.4:c.353C>G, NM_000280.4:c.353C>A, NM_000280.4:c.348delC, NM_000280.4:c.344delA, NM_000280.4:c.331delG, NM_000280.4:c.331dupG, NM_000280.4:c.316_326delTTACTGTCCGA, NM_000280.4:c.316_326delTTACTGTCCGAinsCCCCCCGTT, NM_000280.4:c.325_326delGAinsCAG, NM_000280.4:c.325G>T, NM_000280.4:c.317T>A, NM_000280.4:c.307C>T, NM_000280.4:c.301delG, NM_000280.4:c.300G>A, NM_000280.4:c.299G>A, NM_000280.4:c.295G>C, NM_000280.4:c.284dupC, NM_000280.4:c.277G>A, NM_000280.4:c.277G>T, NM_000280.4:c.270delT, NM_000280.4:c.265dupC, NM_000280.4:c.265C>T, NM_000280.4:c.260T>G, NM_000280.4:c.260T>A, NM_000280.4:c.251dupT, NM_000280.4:c.236_244delCGACTCCAGinsTTGTAAGCAA, NM_000280.4:c.235_238dupGCGA, NM_000280.4:c.236_237delCGinsTTTGCTTACA, NM_000280.4:c.236C>A, NM_000280.4:c.233T>C, NM_000280.4:c.215_228delGTGGTAGTAAACCG, NM_000280.4:c.222_228dupTAAACCG, NM_000280.4:c.227C>G, NM_000280.4:c.220A>G, NM_000280.4:c.218G>A, NM_000280.4:c.215dupG, NM_000280.4:c.214G>A, NM_000280.4:c.210_213delAATCinsGGTAGTACACCCAG, NM_000280.4:c.202C>T, NM_000280.4:c.199A>T, NM_000280.4:c.191G>T, NM_000280.4:c.181_189delTACGAGACTinsCA, NM_000280.4:c.184_188dupGAGAC, NM_000280.4:c.187A>C, NM_000280.4:c.183delC, NM_000280.4:c.183C>A, NM_000280.4:c.177delG, NM_000280.4:c.175delA, NM_000280.4:c.170_174delTGGGC, NM_000280.4:c.164_170delAAATTCT, NM_000280.4:c.168delT, NM_000280.4:c.167T>C, NM_000280.4:c.164A>G, NM_000280.4:c.158_159delTG, NM_000280.4:c.157G>C, NM_000280.4:c.154T>C, NM_000280.4:c.142-1_153dupGGTGTCCAACGGA, NM_000280.4:c.152G>C, NM_000280.4:c.152G>T, NM_000280.4:c.151G>A, NM_000280.4:c.146C>T, NM_000280.4:c.143T>A, NM_000280.4:c.142delG, NM_000280.4:c.142-1G>T, NM_000280.4:c.555_556delGA, NM_000280.4:c.541G>T, NM_000280.4:c.539delA, NM_000280.4:c.538C>T, NM_000280.4:c.10+5G>C, NM_000280.4:c.10+3_10+4delAAinsGC, NM_000280.4:c.4delC, NM_000280.4:c.4C>T, NM_000280.4:c.3delG, NM_000280.4:c.1_2delATinsCA, NM_000280.4:c.2T>A, NM_000280.4:c.2T>G, NM_000280.4:c.1A>G, NM_000280.4:c.917-1G>C, NM_000280.4:c.736A>T, NM_000280.4:c.916+1G>A, NM_000280.4:c.711_712delGT, NM_000280.4:c.142-99A>G, NM_000280.4:c.901C>T, NM_000280.4:c.924delC, NM_000280.4:c.1032+2T>A, NM_000280.4:c.917-1G>A, NM_000280.4:c.142-3C>G, NM_000280.4:c.142-117T>A, NM_000280.4:c.1032+1G>A, NM_000280.4:c.718C>T, NM_000280.4:c.142-2A>GAniridia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAX6 gene located on chromosomal region 11p13. The age of onset is infantile. A congenital, bilateral, panocular disorder characterized by complete absence of the iris or extreme iris hypoplasia. Aniridia is not just an isolated defect in iris development but it is associated with macular and optic nerve hypoplasia, cataract, corneal changes, nystagmus. Visual acuity is generally low but is unrelated to the degree of iris hypoplasia. Glaucoma is a secondary problem causing additional visual loss over time.600
PCPyruvate carboxylase deficiencyNM_000920.3NM_000920.3:c.434T>C, NM_000920.3:c.1748G>T, NM_000920.3:c.496G>APyruvate carboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PC gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by metabolic acidosis, failure to thrive, developmental delay, and recurrent seizures. The prevalence is 1:250,000.250,600
PCCAPropionic acidemia type 1NM_000282.3NM_000282.3:c.1598_1601delTTGT, NM_000282.3:c.412G>A, NM_000282.3:c.1226_1227delTT, NM_000282.3:c.1891G>C, NM_000282.3:c.1899+1_1899+4delGTAA, NM_000282.3:c.1284+1G>A, NM_000282.3:c.229C>T, NM_000282.3:c.1023dupT, NM_000282.3:c.600+1G>A, NM_000282.3:c.261_262insT, NM_000282.3:c.1118T>A, NM_000282.3:c.862A>TPropionic acidemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCA gene located on chromosomal region 13q32.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000.250,600
PCCBPropionic acidemia type 2NM_000532.4NM_000532.4:c.1279_1291delGTTCCCinsAA, NM_000532.4:c.1283C>T, NM_000532.4:c.337C>T, NM_000532.4:c.1538_1540dupCCC, NM_000532.4:c.990dupT, NM_000532.4:c.1304A>G, NM_000532.4:c.1228C>T, NM_000532.4:c.1229_1230insT, NM_000532.4:c.1606A>G, NM_000532.4:c.1223_1226delTCAT, NM_000532.4:c.1490C>T, NM_000532.4:c.1534C>T, NM_000532.4:c.1173_1174insT, NM_000532.4:c.1540_1541insCCC, NM_000532.4:c.331C>T, NM_000532.4:c.683C>T, NM_000532.4:c.797G>T, NM_000532.4:c.737G>T, NM_000532.4:c.1218_1231delinsTAGAGCACAGGA, NM_000532.4:c.502G>A, NM_000532.4:c.562G>A, NM_000532.4:c.1219_1224delGGCATCinsAAPropionic acidemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCB gene located on chromosomal region 3q22.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy.. The prevalence is 1:100,000.250,600
PCDH15Usher syndrome type 1FNM_033056.3NM_033056.3:c.1583T>A, NM_033056.3:c.4885delA, NM_033056.3:c.4961_4962insTGAT, NM_033056.3:c.5659A>T, NM_033056.3:c.4937_4940dupTGAT, NM_033056.3:c.785G>A, NM_033056.3:c.5622_5624delAAC, NM_033056.3:c.400C>T, NM_033056.3:c.5724_5755delACGCACAAATGTTTCAGAACTTCAAACTATGT, NM_033056.3:c.4864delA, NM_033056.3:c.1737C>G, NM_033056.3:c.1021C>T, NM_033056.3:c.1088delT, NM_033056.3:c.1006C>T, NM_033056.3:c.1940C>G, NM_033056.3:c.400C>G, NM_033056.3:c.3718-2A>G, NM_033056.3:c.4548_4551dupATCT, NM_033056.3:c.7C>T, NM_033056.3:c.2645_2646delATUsher syndrome type 1F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCDH15 gene located on chromosomal region 10q21.1. The age of onset is early. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 4.4:100,000.250,600
PDE6ARetinitis pigmentosa type 43NM_000440.2NM_000440.2:c.1683G>A, NM_000440.2:c.1113+1G>T, NM_000440.2:c.718-4_718-3insT, NM_000440.2:c.1749C>G, NM_000440.2:c.2053G>A, NM_000440.2:c.1560_1561insA, NM_000440.2:c.304C>A, NM_000440.2:c.1040C>T, NM_000440.2:c.1113+1G>ARetinitis pigmentosa 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.250,600
PDE6BRetinitis pigmentosa type 43NM_000283.3NM_000283.3:c.1580T>C, NM_000283.3:c.655T>C, NM_000283.3:c.1540delC, NM_000283.3:c.1572delC, NM_000283.3:c.1920+2T>C, NM_000283.3:c.1669C>T, NM_000283.3:c.892C>TRetinitis pigmentosa 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.250,600
PDE6CCone dystrophy type 4NM_006204.3NM_006204.3:c.1682dupA, NM_006204.3:c.1805A>T, NM_006204.3:c.2283+1G>C, NM_006204.3:c.256_257insAG, NM_006204.3:c.1066G>T, NM_006204.3:c.881G>A, NM_006204.3:c.481-12T>A, NM_006204.3:c.1363A>G, NM_006204.3:c.2457T>A, NM_006204.3:c.826C>T, NM_006204.3:c.633G>C, NM_006204.3:c.2036+1G>T, NM_006204.3:c.85C>T, NM_006204.3:c.180_186delCCTGTGCProgressive cone dystrophy 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6C gene located on chromosomal region 10q23.33. The age of onset is infantile. This disease is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, eccentric fixation, and reduced or complete loss of color discrimination.600
PDE6GRetinitis pigmentosa type 57NM_002602.3NM_002602.3:c.187+1G>TRetinitis pigmentosa type 57 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6G gene located on chromosomal region 17q25.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife.600
PDHA1Pyruvate dehydrogenase E1-alpha deficiencyNM_000284.3NM_000284.3:c.262C>T, NM_000284.3:c.787C>G, NM_000284.3:c.871G>A, NM_000284.3:c.773A>CPyruvate dehydrogenase E1-alpha deficiency follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PDHA1 gene located on chromosomal region Xp22.12. The age of onset is variable. This disease is characterized by primary lactic acidosis in children. It is associated with a broad clinical spectrum ranging from fatal lactic acidosis in the newborn to chronic neurologic dysfunction with structural abnormalities in the central nervous system without systemic acidosis.The prevalence is >1:40,000 newborn.600
PDP1Pyruvate dehydrogenase phosphatase deficiencyNM_018444.3NM_018444.3:c.597_601delCTTTA, NM_018444.3:c.1606C>T, NM_018444.3:c.277G>T, NM_018444.3:c.803delC, NM_018444.3:c.669_673delTTACT, NM_018444.3:c.672_676delCTTTA, NM_018444.3:c.878delC, NM_018444.3:c.851_853delTTCPyruvate dehydrogenase phosphatase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDP1 gene located on chromosomal region 8q22.1. The age of onset is neonatal. This disease is characterized by lactic acidosis and hypotonia.600
PDSS1Coenzyme Q10 deficiency, primary, type 2NM_014317.3NM_014317.3:c.319dupT, NM_014317.3:c.924T>GCoenzyme Q10 deficiency, primary, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDSS1 gene located on chromosome 10p12.1. The age of onset is neonatal/infantile. This disease is characterized by multisystem disorder with early-onset deafness, optic atrophy, mild mental retardation, peripheral neuropathy, obesity and cardiac valvulopathy.600
PDSS2Coenzyme Q10 deficiency, primary, type 3NM_020381.3NM_020381.3:c.964C>T, NM_020381.3:c.129_130insC, NM_020381.3:c.1145C>TCoenzyme Q10 deficiency, primary, type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDSS2 gene located on chromosomal region 6q21. The age of onset is infantile. This disease is characterized by onset of symptoms typically between age three and 12 months, often following a viral infection. Neurologic features include hypotonia, spasticity, movement disorders, cerebellar ataxia, and peripheral neuropathy.600
PDX1Pancreatic agenesisNM_000209.3NM_000209.3:c.532G>A, NM_000209.3:c.533A>G, NM_000209.3:c.492G>TPancreatic agenesis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDX1 gene located on chromosomal region 13q12.1. The age of onset is infantile. This disease is characterized by the congenital absence of a critical mass of pancreatic tissue, pancreaticobiliary duct anomalies, leading to acute or chronic pancreatitis, hyperglycemia (50% of cases) and polysplenia.600
PDZD7Usher syndrome type 2CNM_001195263.1NM_001195263.1:c.1543C>T, NM_001195263.1:c.166_167insC, NM_001195263.1:c.2107delA, NM_001195263.1:c.144_145insAUsher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR98 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32 respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000.600
PEX1Peroxisome biogenesis disorder type 1ANM_000466.2NM_000466.2:c.2097dupT, NM_000466.2:c.2916delA, NM_000466.2:c.1842delA, NM_000466.2:c.1991T>C, NM_000466.2:c.1239+1G>TPeroxisome biogenesis disorder type 1A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. The age of onset is early. This disease is characterized by neuronal migration defects in the brain, dysmorphic craniofacial features, profound hypotonia, neonatal seizures, and liver dysfunction. The prevalence is 1:1,000,000.250,600
PEX1Peroxisome biogenesis disorder type 1BNM_000466.2NM_000466.2:c.2097_2098insT, NM_000466.2:c.1952_1960dupCAGTGTGGA, NM_000466.2:c.877C>T, NM_000466.2:c.3505_3517delCAGTTGTTTTCAC, NM_000466.2:c.2528G>APeroxisome biogenesis disorder type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. The age of onset is early. This disease includes neonatal adrenoleukodystrophy and infantile Refsum disease, two milder manifestations of the Zellweger disease spectrum. The clinical course of patients is variable and may include developmental delay, hypotonia, liver dysfunction, sensorineural hearing loss, retinal dystrophy and vision impairment.250,600
PEX12Peroxisome biogenesis disorder complementation group 6NM_000286.2NM_000286.2:c.959C>T, NM_000286.2:c.894delC, NM_000286.2:c.888_889delCT, NM_000286.2:c.538C>T, NM_000286.2:c.455_459dupGGAAA, NM_000286.2:c.771delCPeroxisome biogenesis disorder complementation group 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX12 gene located on chromosomal region 17q12. The age of onset is early. This is a peroxisomal disorder arising from a failure of protein import into the peroxisomal membrane or matrix. The peroxisome biogenesis disorders are genetically heterogeneous with at least 14 distinct genetic groups as concluded from complementation studies. Include disorders are: Zellweger syndrome, neonatal adrenoleukodystrophy, infantile Refsum disease, and classical rhizomelic chondrodysplasia punctata.600
PEX2Peroxisome biogenesis disorder complementation group 5NM_000318.2NM_000318.2:c.163G>A, NM_000318.2:c.789_790delCTPeroxisome biogenesis disorder complementation group 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX2 gene located on chromosomal region 8q21.11. The age of onset is early. This is a peroxisomal disorder arising from a failure of protein import into the peroxisomal membrane or matrix. The peroxisome biogenesis disorders are genetically heterogeneous with at least 14 distinct genetic groups as concluded from complementation studies. Include disorders are: Zellweger syndrome, neonatal adrenoleukodystrophy, infantile Refsum disease, and classical rhizomelic chondrodysplasia punctata.600
PEX26Peroxisome biogenesis disorder type 7NM_017929.5NM_017929.5:c.292C>T, NM_017929.5:c.254dupT, NM_017929.5:c.265G>A, NM_017929.5:c.353C>GPeroxisome biogenesis disorder complementation group 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX26 gene located on chromosomal region 22q11.21. The age of onset is early. This is a peroxisomal disorder arising from a failure of protein import into the peroxisomal membrane or matrix. The peroxisome biogenesis disorders are genetically heterogeneous with at least 14 distinct genetic groups as concluded from complementation studies. Include disorders are: Zellweger syndrome, neonatal adrenoleukodystrophy, infantile Refsum disease, and classical rhizomelic chondrodysplasia punctata. The prevalence is 1:1,000,000.600
PEX5Peroxisome biogenesis disorder type 2NM_001131025.1NM_001131025.1:c.1578T>G, NM_001131025.1:c.1279C>T, NM_001131025.1:c.*20G>CPeroxisome biogenesis disorder complementation group 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX26 gene located on chromosomal region 22q11.21. The age of onset is early. This is a peroxisomal disorder arising from a failure of protein import into the peroxisomal membrane or matrix. The peroxisome biogenesis disorders are genetically heterogeneous with at least 14 distinct genetic groups as concluded from complementation studies. Include disorders are: Zellweger syndrome, neonatal adrenoleukodystrophy, infantile Refsum disease, and classical rhizomelic chondrodysplasia punctata. The prevalence is 1:1,000,000.600
PEX7Rhizomelic chondrodysplasia punctata type 1NM_000288.3NM_000288.3:c.694C>T, NM_000288.3:c.649G>A, NM_000288.3:c.618G>A, NM_000288.3:c.722A>T, NM_000288.3:c.875T>A, NM_000288.3:c.653C>T, NM_000288.3:c.854A>G, NM_000288.3:c.532C>T, NM_000288.3:c.903+1G>CRhizomelic chondrodysplasia punctata type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX7 gene located on chromosomal region 6q23.3. The age of onset is early. This disease is characterized by proximal shortening of the humerus and to a lesser degree the femur (rhizomelia), punctate calcifications in cartilage with epiphyseal and metaphyseal abnormalities (chondrodysplasia punctata), coronal clefts of the vertebral bodies, cataracts, postnatal growth deficiency is profound, intellectual disability is severe, seizures. The prevalence is <1:100,000.250,600
PGM1Congenital disorder of glycosylation, type 1TNM_002633.2NM_002633.2:c.343A>G, NM_002633.2:c.361G>C, NM_002633.2:c.1507C>T, NM_002633.2:c.300+1G>A, NM_002633.2:c.787G>TCongenital disorder of glycosylation, type 1T follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PGM1 gene located on chromosomal region 1p31.3. The age of onset is infantile. It is a multisystem disorder caused by a defect in glycoprotein biosynthesis and characterized by under-glycosylated serum glycoproteins. Congenital disorders of glycosylation result in a wide variety of clinical features, such as defects in the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. The prevalence is <1:1,000,000.600
PHKG2Glycogen storage disease type 9CNM_000294.2NM_000294.2:c.958C>T, NM_000294.2:c.553C>T, NM_000294.2:c.130C>T, NM_000294.2:c.393-2A>GGlycogen storage disease type 9C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHKG2 gene located on chromosomal region 16p12.1-p11.2. The age of onset is infantile. This disease is characterized by hepatomegaly, growth retardation, and mild delay in motor development during childhood. The incidence is <1:100.000 births.600
PHYHRefsum diseaseNM_006214.3NM_006214.3:c.135-2A>G, NM_006214.3:c.497-2A>G, NM_006214.3:c.135-1G>C, NM_006214.3:c.805A>C, NM_006214.3:c.678+5G>T, NM_006214.3:c.823C>T, NM_006214.3:c.530A>G, NM_006214.3:c.164delT, NM_006214.3:c.678+2T>G, NM_006214.3:c.824G>ARefsum disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHYH gene located on chromosomal region 10p13. The age of onset is variable. This disease is characterized by hemeralopia (loss of vision in the dark), followed by episods of chronic distal motor polyneuropathy. Other associated signs include perceptive deafness, anosmia, cerebellous ataxia and sometimes, severe intellectual deficiency. Over the course of time cutaneous signs appear (ichtyosis), along with polyepiphyseal dysplasia, myocardiopathy, elevated protein in cerebrospinal fluid, and pigmentary retinitis that may result in blindness. The prevalence is 1:1.000,000-9:1.000,000.250,600
PKHD1Polycystic kidney disease, autosomal recessiveNM_138694.3NM_138694.3:c.10515C>A, NM_138694.3:c.11363_11372delCTTCCCTGGA, NM_138694.3:c.10585G>C, NM_138694.3:c.107C>T, NM_138694.3:c.10452dupT, NM_138694.3:c.2452C>T, NM_138694.3:c.2747A>C, NM_138694.3:c.12027C>G, NM_138694.3:c.11284C>A, NM_138694.3:c.3367G>A, NM_138694.3:c.353delG, NM_138694.3:c.2827_2828delGA, NM_138694.3:c.2854G>A, NM_138694.3:c.1342G>C, NM_138694.3:c.1409G>A, NM_138694.3:c.11611T>C, NM_138694.3:c.3761_3762delCCinsG, NM_138694.3:c.2414C>T, NM_138694.3:c.5895_5896insA, NM_138694.3:c.5895dupA, NM_138694.3:c.6499C>T, NM_138694.3:c.664A>G, NM_138694.3:c.682A>G, NM_138694.3:c.6854G>A, NM_138694.3:c.370C>T, NM_138694.3:c.8407T>C, NM_138694.3:c.3766delC, NM_138694.3:c.3940delA, NM_138694.3:c.1486C>T, NM_138694.3:c.2341C>T, NM_138694.3:c.10219C>T, NM_138694.3:c.9107T>G, NM_138694.3:c.930delC, NM_138694.3:c.9370C>T, NM_138694.3:c.9530T>C, NM_138694.3:c.9689delA, NM_138694.3:c.982C>T, NM_138694.3:c.9866G>T, NM_138694.3:c.10036T>C, NM_138694.3:c.3229-2A>C, NM_138694.3:c.4870C>T, NM_138694.3:c.4165C>A, NM_138694.3:c.9719G>A, NM_138694.3:c.5325_5326delAG, NM_138694.3:c.5498C>T, NM_138694.3:c.8824C>T, NM_138694.3:c.85G>T, NM_138694.3:c.10412T>G, NM_138694.3:c.8518C>T, NM_138694.3:c.8408G>A, NM_138694.3:c.8317G>T, NM_138694.3:c.8870T>CAutosomal recessive polycystic kidney disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKHD1 gene located on chromosomal region 6p12.3-p12.2. The age of onset is early. This disease is characterized by the development of cysts affecting the collecting ducts. It is frequently associated with hepatic involvement. After birth, in addition to nephromegaly, arterial hypertension and urinary tract infections are common and often severe. The prevalence is 1:10,000-1:40,000.250,600
PKLRHemolytic anemia due to red cell pyruvate kinase deficiencyNM_000298.5NM_000298.5:c.1151C>T, NM_000298.5:c.1706G>A, NM_000298.5:c.1529G>A, NM_000298.5:c.1528C>T, NM_000298.5:c.1595G>A, NM_000298.5:c.721G>T, NM_000298.5:c.1076G>A, NM_000298.5:c.1675C>T, NM_000298.5:c.1261C>A, NM_000298.5:c.1436G>A, NM_000298.5:c.1456C>THemolytic anemia due to red cell pyruvate kinase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKLR gene located on chromosomal region 1q22. The age of onset is early. This disease is characterized by highly variable degree of chronic hemolysis, with severe neonatal jaundice and fatal anemia at birth, severe transfusion-dependent chronic hemolysis, and moderate hemolysis with exacerbation during infection. The prevalence is 1:20,000.250,600
PLA2G6Infantile neuroaxonal dystrophyNM_003560.2NM_003560.2:c.1634A>C, NM_003560.2:c.238G>A, NM_003560.2:c.1903C>T, NM_003560.2:c.109C>T, NM_003560.2:c.1612C>T, NM_003560.2:c.2370T>G, NM_003560.2:c.929T>A, NM_003560.2:c.1894C>T, NM_003560.2:c.2239C>TInfantile neuroaxonal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLA2G6 gene located on chromosomal region 22q13.1. The age of onset is infantile. This disease is a type of neurodegeneration with brain iron accumulation characterized by psychomotor delay and regression, increasing neurological involvement with symmetrical pyramidal tract signs and spastic tetraplegia. INAD may be classic or atypical and patients present with symptoms anywhere along a continuum between the two.600
PLCE1Nephrotic syndrome type 3NM_016341.3NM_016341.3:c.3346C>T, NM_016341.3:c.4808delA, NM_016341.3:c.3846delG, NM_016341.3:c.3736C>T, NM_016341.3:c.5560C>T, NM_016341.3:c.4451C>T, NM_016341.3:c.5669C>T, NM_016341.3:c.961C>TNephrotic syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLCE1 gene located on chromosomal region 10q23.33. The age of onset is variable. This disease is characterized by low blood protein levels, high cholesterol levels, high triglyceride levels, and presence of protein in the urine. The prevalence is 2:100,000-7:100,000 Children; 3:100,000 adults.250,600
PLECEpidermolysis bullosa simplex with muscular dystrophyNM_000445.4NM_000445.4:c.6955C>T, NM_000445.4:c.9250_9251delCT, NM_000445.4:c.10971_10972delGA, NM_000445.4:c.2493+1G>CEpidermolysis bullosa simplex with muscular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLEC gene located on chromosomal region 8q24. The age of onset is early. This disease is characterized by generalized blistering associated with muscular dystrophy, dystrophic nails, and focal keratoderma of the palms and soles. The prevalence is 1:30,000-1:50,000.600
PLECEpidermolysis bullosa simplex with pyloric atresiaNM_000445.4NM_000445.4:c.9085C>T, NM_000445.4:c.913C>T, NM_000445.4:c.906+1G>A, NM_000445.4:c.12043_12044insG, NM_000445.4:c.11446G>TEpidermolysis bullosa simplex with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLEC gene located on chromosomal region 8q24. The age of onset is early. This disease is characterized by generalized severe blistering with widespread congenital absence of skin and pyloric atresia. The prevalence is <1:1,000,000.600
PLEKHG5Charcot-Marie-Tooth disease, intermediate type CNM_020631.4NM_020631.4:c.440-2A>G, NM_020631.4:c.3166C>T, NM_020631.4:c.1940T>C, NM_020631.4:c.2935C>TCharcot-Marie-Tooth disease, intermediate type C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLEKHG5 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease is a disorder of the peripheral nervous system, characterized by progressive weakness and atrophy, initially of the peroneal muscles and later of the distal muscles of the arms. Recessive intermediate forms of Charcot-Marie-Tooth disease are characterized by clinical and pathologic features intermediate between demyelinating and axonal peripheral neuropathies, and motor median nerve conduction velocities ranging from 25 to 45 m/sec.600
PLGCongenital plasminogen deficiency type 1NM_000301.3NM_000301.3:c.704G>A, NM_000301.3:c.1848G>A, NM_000301.3:c.1435G>T, NM_000301.3:c.693_695delGAA, NM_000301.3:c.1120G>T, NM_000301.3:c.112A>GPlasminogen deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLG gene located on chromosomal region 6q26. The age of onset is infantile.This disease is characterized by markedly impaired extracellular fibrinolysis leading to the formation of ligneous (fibrin-rich) pseudomembranes on mucosae during wound healing. The prevalence is 1:1,000,000-9:1,000,000.250,600
PLOD1Ehlers-Danlos syndrome, type 6NM_000302.3NM_000302.3:c.955C>T, NM_000302.3:c.2032G>A, NM_000302.3:c.1533C>G, NM_000302.3:c.1836G>C, NM_000302.3:c.2008C>T, NM_000302.3:c.466+1G>AEhlers-Danlos syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLOD1 gene located on chromosomal region 1p36. The age of onset is early. This disease is characterized by progressive scoliosis from birth, severe muscle hypotonia, hyperextensible joints and fragile eyeballs. The weakness can lead to ocular retinal hemorrhage, glaucoma, coloring of the sclera or even to rupture of the globe. The prevalence is <1:5,000.600
PLP1Pelizaeus-Merzbacher diseaseNM_000533.3NM_000533.3:c.128C>T, NM_000533.3:c.593delG, NM_000533.3:c.231_232insC, NM_000533.3:c.3G>A, NM_000533.3:c.487T>C, NM_000533.3:c.725C>T, NM_000533.3:c.737G>C, NM_000533.3:c.169G>TPelizaeus-Merzbacher disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PLP1 gene located on chromosomal region Xq22.2. The age of onset is infantile. It is a hypomyelinative leukodystrophy in which myelin is not formed properly in the central nervous system. It is characterized clinically by nystagmus, spastic quadriplegia, ataxia, and developmental delay.600
PLP1Spastic paraplegia type 2, X-linkedNM_000533.3NM_000533.3:c.409C>TSpastic paraplegia type 2, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PLP1 gene located on chromosomal region Xq22.2. The age of onset is infantile. This disease is characterized by spastic gait and autonomic dysfunction.600
PMM2Congenital disorders of glycosylation type 1aNM_000303.2NM_000303.2:c.349G>C, NM_000303.2:c.357C>A, NM_000303.2:c.255+2T>C, NM_000303.2:c.127G>C, NM_000303.2:c.395T>C, NM_000303.2:c.415G>A, NM_000303.2:c.368G>A, NM_000303.2:c.385G>A, NM_000303.2:c.470T>C, NM_000303.2:c.484C>T, NM_000303.2:c.422G>A, NM_000303.2:c.442G>A, NM_000303.2:c.623G>C, NM_000303.2:c.647A>T, NM_000303.2:c.652C>G, NM_000303.2:c.323C>T, NM_000303.2:c.677C>G, NM_000303.2:c.691G>A, NM_000303.2:c.710C>G, NM_000303.2:c.669C>G, NM_000303.2:c.95_96delTAinsGC, NM_000303.2:c.95T>G, NM_000303.2:c.53C>G, NM_000303.2:c.710C>T, NM_000303.2:c.620T>C, NM_000303.2:c.97C>T, NM_000303.2:c.193G>T, NM_000303.2:c.338C>T, NM_000303.2:c.563A>G, NM_000303.2:c.131T>C, NM_000303.2:c.26G>A, NM_000303.2:c.109C>T, NM_000303.2:c.317A>T, NM_000303.2:c.190delT, NM_000303.2:c.256-1G>CCongenital disorder of glycosylation type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PMM2 gene located on chromosomal region 16p13.2. The age of onset is infantile. This disease is characterized by highly variable clinical manifestations that may include feeding problems, vomiting, and diarrhea with failure to thrive in infants, and severe encephalopathy with axial hypotonia, abnormal eye movement, marked psychomotor retardation, peripheral neuropathy, cerebellar hypoplasia, stroke-like episodes, and retinitis pigmentosa in late infancy, childhood or adulthood.250,600
PNPOPNPO deficiencyNM_018129.3NM_018129.3:c.685C>T, NM_018129.3:c.674G>APNPO deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PNPO gene located on chromosomal region 17q21.32. The age of onset is early. This disease is characterized by onset of severe seizures within hours of birth that are not responsive to anticonvulsants.600
POLGMitochondrial DNA depletion syndrome, Alpers typeNM_002693.2NM_002693.2:c.2617G>T, NM_002693.2:c.1120C>T, NM_002693.2:c.830A>T, NM_002693.2:c.3218C>T, NM_002693.2:c.3630dupCMitochondrial DNA depletion syndrome, Alpers type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by the clinical triad of psychomotor regression, seizures, and liver disease. The prevalence is 1:1,600 newborn.250,600
POLGProgressive external ophthalmoplegiaNM_002693.2NM_002693.2:c.1437C>G, NM_002693.2:c.2591A>G, NM_002693.2:c.1754G>A, NM_002693.2:c.1399G>A, NM_002693.2:c.1491G>C, NM_002693.2:c.3151G>C, NM_002693.2:c.803G>C, NM_002693.2:c.3286C>T, NM_002693.2:c.2794C>T, NM_002693.2:c.752C>T, NM_002693.2:c.3644-1G>A, NM_002693.2:c.1879C>T, NM_002693.2:c.2605C>T, NM_002693.2:c.911T>G, NM_002693.2:c.1760C>T, NM_002693.2:c.2542G>A, NM_002693.2:c.1550G>T, NM_002693.2:c.2557C>T, NM_002693.2:c.2207A>G, NM_002693.2:c.2243G>C, NM_002693.2:c.2209G>CProgressive external ophthalmoplegia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by ptosis, paralysis of the extraocular muscles, oropharyngeal weakness, and variably severe proximal limb weakness.250,600
POMGNT1Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3NM_017739.3NM_017739.3:c.1425G>A, NM_017739.3:c.1545delC, NM_017739.3:c.1274G>C, NM_017739.3:c.1864delC, NM_017739.3:c.1411A>T, NM_017739.3:c.1469G>A, NM_017739.3:c.1539+1G>A, NM_017739.3:c.92dupA, NM_017739.3:c.1539+1G>T, NM_017739.3:c.932G>A, NM_017739.3:c.794G>A, NM_017739.3:c.880-1G>A, NM_017739.3:c.652+1G>A, NM_017739.3:c.931C>T, NM_017739.3:c.1666G>A, NM_017739.3:c.1814G>C, NM_017739.3:c.636C>T, NM_017739.3:c.187C>TMuscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3 which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMGNT1 gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent psychomotor development, eye involvement and seizures. The prevalence is 1-9:100,000.250,600
POMT1Congenital muscular dystrophy with intellectual disability type B1NM_007171.3NM_007171.3:c.598G>C, NM_007171.3:c.193G>A, NM_007171.3:c.1770G>C, NM_007171.3:c.2005G>A, NM_007171.3:c.2163C>A, NM_007171.3:c.1746G>C, NM_007171.3:c.793C>TCongenital muscular dystrophy with intellectual disability type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 gene located on chromosomal region 9q34.13. The age of onset is early. This disease is associated with mental retardation and mild structural brain abnormalities.250,600
POMT1Walker-Warburg syndromeNM_007171.3NM_007171.3:c.1540C>T, NM_007171.3:c.226G>A, NM_007171.3:c.1611C>G, NM_007171.3:c.1242-2A>G, NM_007171.3:c.907C>T, NM_007171.3:c.2163_2164insG, NM_007171.3:c.2167dupG, NM_007171.3:c.1153C>T, NM_007171.3:c.1261_1262insC, NM_007171.3:c.831C>G, NM_007171.3:c.1545C>G, NM_007171.3:c.1280_1281delAGinsTCWalker-Warburg syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 and POMT2 genes located on chromosomal regions 9q34.13 and 14q24.3 respectively. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent or very poor psychomotor development, eye involvement and seizures. The prevalence is 1:100,000-9:100,000.250,600
POMT2Congenital muscular dystrophy with intellectual disability type A2NM_013382.5NM_013382.5:c.2243G>C, NM_013382.5:c.1997A>G, NM_013382.5:c.2242T>C, NM_013382.5:c.1445G>T, NM_013382.5:c.2177G>A, NM_013382.5:c.1238G>C, NM_013382.5:c.1941G>A, NM_013382.5:c.1057G>A, NM_013382.5:c.551C>TCongenital muscular dystrophy with intellectual disability type A2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT2 gene located on chromosomal region 14q24.3. The age of onset is early. This disorder characterized by congenital muscular dystrophy associated with cobblestone lissencephaly and other brain anomalies, eye malformations, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease.250,600
POMT2Walker-Warburg syndromeNM_013382.5NM_013382.5:c.1726-2A>G, NM_013382.5:c.1417C>T, NM_013382.5:c.1912C>T, NM_013382.5:c.1608_1609delCA, NM_013382.5:c.1045_1052delinsGWalker-Warburg syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 and POMT2 genes located on chromosomal regions 9q34.13 and 14q24.3 respectively. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent or very poor psychomotor development, eye involvement and seizures. The prevalence is 1:100,000-9:100,000.250,600
POU1F1Pituitary hormone deficiency, combined, type 1NM_000306.3NM_000306.3:c.472G>C, NM_000306.3:c.428G>A, NM_000306.3:c.577T>C, NM_000306.3:c.514C>T, NM_000306.3:c.515G>A, NM_000306.3:c.71C>T, NM_000306.3:c.433A>T, NM_000306.3:c.715C>T, NM_000306.3:c.515G>C, NM_000306.3:c.391G>T, NM_000306.3:c.688G>A, NM_000306.3:c.793C>T, NM_000306.3:c.748G>T, NM_000306.3:c.811C>T, NM_000306.3:c.404T>GPituitary hormone deficiency, combined, type 1. Genetic forms follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POU1F1 gene located on chromosomal region 3p11.2. The age of onset is early. This disease is characterized by short stature, cognitive alterations or delayed puberty. The prevalence is 1:8,000.600
POU3F4Deafness type 2, X-linkedNM_000307.4NM_000307.4:c.604A>T, NM_000307.4:c.499C>TX-linked deafness type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the POU3F4 gene located on chromosomal region Xq21.1. The age of onset is infantile. This disease is characterized by both conductive hearing loss resulting from stapes (perilymphatic gusher) fixation, and progressive sensorineural deafness.600
PPT1Neuronal ceroid-lipofuscinoses type 1NM_000310.3NM_000310.3:c.29T>A, NM_000310.3:c.223A>C, NM_000310.3:c.627+1G>T, NM_000310.3:c.169_170insA, NM_000310.3:c.451C>T, NM_000310.3:c.541G>T, NM_000310.3:c.840_841insANeuronal ceroid lipofuscinoses, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PPT1 gene located on chromosomal region 1p32. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 1.5:1,000,000-9:1,000,000.250,600
PRCDRetinitis pigmentosa 36NM_001077620.2NM_001077620.2:c.64C>T, NM_001077620.2:c.52C>TRetinitis pigmentosa 36 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRCD gene located on chromosomal region 17q25.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife.600
PRKRADystonia tipo 16NM_003690.4NM_003690.4:c.665C>TDystonia 16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRKRA gene located on chromosomal region 2q31.2. The age of onset is early. This disease is characterized by progressive limb dystonia, laryngeal and oromandibular dystonia and parkinsonism.600
PRODHHyperprolinemia type 1NM_016335.4NM_016335.4:c.865T>A, NM_016335.4:c.1331G>AHyperprolinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRODH gene located on chromosomal region 22q11.2. The age of onset is variable. This disease is characterized by benign symptoms, but associations with renal abnormalities, epileptic seizures, and other neurological manifestations, as well as certain forms of schizophrenia have been reported.250,600
PROM1Retinitis pigmentosa type 41NM_006017.2NM_006017.2:c.1841delG, NM_006017.2:c.1354_1355insT, NM_006017.2:c.1726C>T, NM_006017.2:c.199C>T, NM_006017.2:c.2490-2A>G, NM_006017.2:c.1177_1178delATRetinitis pigmentosa 41 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROM1 gene located on chromosomal region 4p15.32. The age of onset is early. This disease is characterized by night blindness often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 19:100,000-27:100,000.250,600
PROP1Pituitary hormone deficiency, combined, type 2NM_006261.4NM_006261.4:c.2T>C, NM_006261.4:c.150delA, NM_006261.4:c.349T>A, NM_006261.4:c.112_124delTCGAGTGCTCCAC, NM_006261.4:c.310delC, NM_006261.4:c.343-11C>G, NM_006261.4:c.217C>T, NM_006261.4:c.218G>A, NM_006261.4:c.373C>T, NM_006261.4:c.157delA, NM_006261.4:c.295C>T, NM_006261.4:c.469_470insT, NM_006261.4:c.301_302delAG, NM_006261.4:c.358C>T, NM_006261.4:c.247C>T, NM_006261.4:c.263T>C, NM_006261.4:c.4delGPituitary hormone deficiency, combined, type 2, genetic forms follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROP1 gene located on chromosomal region 5q35.3. The age of onset is early. This disease is characterized by short stature, cognitive alterations or delayed puberty.600
PRPS1Charcot-Marie-Tooth disease type 5, X-linked recessiveNM_002764.3NM_002764.3:c.344T>CX-linked Charcot-Marie-Tooth disease type 5 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PRPS1 gene located on chromosomal region Xq22.3. The age of onset is infantile. This disease is characterized by peripheral neuropathy, early-onset (prelingual) bilateral profound sensorineural hearing loss, and optic neuropathy. The prevalence is <1:1,000,000.600
PRPS1Deafness, X-linkedNM_002764.3NM_002764.3:c.916G>A, NM_002764.3:c.869T>CSensorineural deafness, nonsyndromic, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PRPS1 gene located on chromosomal region Xq22.1-q24. The age of onset is early. This is a form of deafness characterized by progressive, severe-to-profound sensorineural hearing loss in males. Females manifest mild to moderate hearing loss.600
PRPS1Phosphoribosylpyrophosphate synthetase superactivityNM_002764.3NM_002764.3:c.398A>C, NM_002764.3:c.455T>CPhosphoribosylpyrophosphate synthetase superactivity follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PRPS1 gene located on chromosomal region Xq22.1-q24. This disease is characterized by excessive purine production, gout and uric acid urolithiasis.600
PRPS1Sensorineural deafness, nonsyndromic, X-linkedNM_002764.3NM_002764.3:c.193G>ASensorineural deafness, nonsyndromic, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PRPS1 gene located on chromosomal region Xq22.1-q24. The age of onset is early. This is a form of deafness characterized by progressive, severe-to-profound sensorineural hearing loss in males. Females manifest mild to moderate hearing loss.600
PRXCharcot-Marie-Tooth disease type 4FNM_181882.2NM_181882.2:c.2553_2556delTCTC, NM_181882.2:c.1362delA, NM_181882.2:c.1951G>A, NM_181882.2:c.3208C>T, NM_181882.2:c.2145T>A, NM_181882.2:c.2098delGCharcot-Marie-Tooth disease, type 4F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRX gene located on chromosomal region 19q13.2. The age of onset is infantile. This disease is characterized by delayed motor milestones, and proximal and distal muscle weakness. The prevalence is <1:1,000,000.600
PRXDejerine-Sottas syndrome (PRX)NM_181882.2NM_181882.2:c.247delC, NM_181882.2:c.1102C>T, NM_181882.2:c.2857C>TThere are both autosomal dominant and autosomal recessive forms of Dejerine-Sottas syndrome. Autosomal recessive form is caused by pathogenic variants in the PRX gene located on chromosomal region 19q13.2. The age of onset is infantile. This disease is characterized by motor and sensory neuropathy with very slow nerve conduction velocities, increased cerebrospinal fluid protein concentrations, hypertrophic nerve changes, and delayed age of walking as well as areflexia. The prevalence is <1:1,000,000.600
PSAPAtypical Gaucher disease due to saposin C deficiencyNM_002778.2NM_002778.2:c.643A>C, NM_002778.2:c.607C>T, NM_002778.2:c.1A>T, NM_002778.2:c.1046T>C, NM_002778.2:c.1288C>TGaucher disease, atypical, due to saposin C deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PSAP gene located on chromosomal region 10q21. The age of onset is early. This disease is characterized by marked glucosylceramide accumulation in the spleen without having a deficiency of glucosylceramide-beta glucosidase characteristic of classic Gaucher disease. Gaucher disease is a lysosomal storage disorder characterized by skeletal deterioration, hepatosplenomegaly, and organ dysfunction. There are several subtypes based on the presence and severity of neurological involvement.600
PSAT1Phosphoserine aminotransferase deficiencyNM_058179.3NM_058179.3:c.1029_1030delCT, NM_058179.3:c.299A>CPhosphoserine aminotransferase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PSAT1 gene located on chromosomal region 9q21.2. The age of onset is early. This disease is characterized by acquired microcephaly, psychomotor retardation, intractable seizures and hypertonia. The prevalence is <1:1,000,000.600
PYGMMcArdle diseaseNM_005609.2NM_005609.2:c.1628A>C, NM_005609.2:c.1466C>G, NM_005609.2:c.1094C>T, NM_005609.2:c.1827G>A, NM_005609.2:c.13_14delCT, NM_005609.2:c.1A>G, NM_005609.2:c.2009C>T, NM_005609.2:c.2128_2130delTTC, NM_005609.2:c.393delG, NM_005609.2:c.2392T>C, NM_005609.2:c.148C>T, NM_005609.2:c.1621G>T, NM_005609.2:c.613G>A, NM_005609.2:c.1963G>A, NM_005609.2:c.2262delA, NM_005609.2:c.1722T>G, NM_005609.2:c.255C>A, NM_005609.2:c.280C>T, NM_005609.2:c.1768+1G>A, NM_005609.2:c.501dupT, NM_005609.2:c.481C>T, NM_005609.2:c.1726C>TMcArdle disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PYGM gene located on chromosomal region 11q13.1. The age of onset is infantile. This disease is characterized by muscular exercise intolerance with myalgia, cramps, fatigue, and muscle weakness.250,600
RAB23Carpenter syndromeNM_183227.2NM_183227.2:c.407dupC, NM_183227.2:c.434T>ACarpenter syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB23 gene located on chromosomal region 6p11.2. The age of onset is early. This disease is characterized by acrocephaly, peculiar facies, brachydactyly and syndactyly in the hands, and preaxial polydactyly and syndactyly of the toes. The prevalence is <1:1,000,000.600
RAB27AGriscelli syndrome, type 2NM_004580.4NM_004580.4:c.259G>C, NM_004580.4:c.382dupA, NM_004580.4:c.217T>G, NM_004580.4:c.352C>T, NM_004580.4:c.389T>C, NM_004580.4:c.454G>CGriscelli disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB27A gene located on chromosome 15q15-q21.1. The age of onset is infantile. This disease is characterized by immune system abnormalities in addition to having hypopigmented skin and hair. Affected individuals are prone to recurrent infections. They also develop an immune condition called hemophagocytic lymphohistiocytosis, in which the immune system produces too many activated immune cells called T-lymphocytes and macrophages (histiocytes).600
RAB3GAP1Warburg micro syndrome type 1NM_012233.2NM_012233.2:c.1734G>A, NM_012233.2:c.496_497delTT, NM_012233.2:c.937dupA, NM_012233.2:c.1393_1396delTGTA, NM_012233.2:c.1410C>A, NM_012233.2:c.899+1G>A, NM_012233.2:c.2011C>T, NM_012233.2:c.748+1G>AWarburg micro syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB3GAP1 gene located on chromosomal region 2q21.3. The age of onset is infantile. This disease is characterized by microcephaly, microphthalmia, microcornia, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. The prevalence is <1:1,000,000.600
RAB3GAP2Warburg micro syndrome type 2NM_012414.3NM_012414.3:c.1648C>T, NM_012414.3:c.1485C>A, NM_012414.3:c.325_328delAAAG, NM_012414.3:c.1276C>TWarburg micro syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB3GAP2 gene located on chromosomal region 1q41. The age of onset is early. This disease is characterized by microcephaly, microphthalmia, microcornia, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. The prevalence is <1:1,000,000.600
RAD51CFanconi anemia, complementation group ONM_058216.2NM_058216.2:c.706-2A>G, NM_058216.2:c.838-2A>T, NM_058216.2:c.133G>A, NM_058216.2:c.773G>AFanconi anemia complementation group O follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAD51C gene located on chromosomal region 17q22. The age of onset is early. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:360,000 newborn.600
RAG1Immunodeficiency severe combined B cell-negativeNM_000448.2NM_000448.2:c.2333G>A, NM_000448.2:c.2320G>T, NM_000448.2:c.2164G>A, NM_000448.2:c.940C>T, NM_000448.2:c.2814T>G, NM_000448.2:c.2923C>T, NM_000448.2:c.2326C>TSevere combined immunodeficiency, autosomal recessive, T cell-negative, B cell negative, NK cell positive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 gene located on chromosomal region 11p13. The age of onset is early. This disease is characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development.250,600
RAG1Omenn syndromeNM_000448.2NM_000448.2:c.983G>A, NM_000448.2:c.3016A>G, NM_000448.2:c.256_257delAA, NM_000448.2:c.1682G>A, NM_000448.2:c.1681C>TOmenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency.250,600
RAG2Combined immunodeficiency with skin granulomasNM_000536.3NM_000536.3:c.115A>G, NM_000536.3:c.686G>A, NM_000536.3:c.283G>A, NM_000536.3:c.601C>T, NM_000536.3:c.230C>A, NM_000536.3:c.1352G>CCombined immunodeficiency with skin granulomas follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG2 gene located on chromosome 11p13. This disease is characterized by severe infections, hypogammaglobulinemia and defective T-cell function, multiple facial papulonodular.600
RAG2Omenn syndromeNM_000536.3NM_000536.3:c.685C>T, NM_000536.3:c.1504A>GOmenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency.600
RAPSNCongenital myasthenic syndromeNM_005055.4NM_005055.4:c.484G>A, NM_005055.4:c.264C>A, NM_005055.4:c.807C>A, NM_005055.4:c.848T>C, NM_005055.4:c.490C>T, NM_005055.4:c.603C>ACongenital myasthenic syndromes follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by fatigable weakness of skeletal muscle (e.g., ocular, bulbar, limb muscles) with onset at or shortly after birth or in early childhood; rarely, symptoms may not manifest until later in childhood. Cardiac and smooth muscle are not involved. Severity and course of disease are highly variable, ranging from minor symptoms to progressive disabling weakness. The prevalence is 1:3,000.250,600
RAPSNFetal akinesia deformation sequenceNM_005055.4NM_005055.4:c.416T>C, NM_005055.4:c.566C>TFetal akinesia deformation sequence follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by multiple joint contractures, facial anomalies and pulmonary hypoplasia. The prevalence is 1:3,000.250,600
RAXIsolated microphthalmia type 3NM_013435.2NM_013435.2:c.909C>G, NM_013435.2:c.18C>A, NM_013435.2:c.197G>C, NM_013435.2:c.439C>T, NM_013435.2:c.383_384delAGIsolated microphthalmia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAX gene located on chromosomal region 18q21.32. Microphthalmia designates a heterogeneous group of ocular malformations with a more or less evident reduction in the size of the eyeball. Additional features include high hypermetropia and a short axial length.250,600
RDH12Leber congenital amaurosis type 13NM_152443.2NM_152443.2:c.184C>T, NM_152443.2:c.146C>T, NM_152443.2:c.152T>A, NM_152443.2:c.451C>A, NM_152443.2:c.295C>A, NM_152443.2:c.377C>T, NM_152443.2:c.379G>T, NM_152443.2:c.565C>T, NM_152443.2:c.677A>G, NM_152443.2:c.805_809delGCCCT, NM_152443.2:c.164C>T, NM_152443.2:c.210dupC, NM_152443.2:c.448+1_448+4delGTAA, NM_152443.2:c.451C>G, NM_152443.2:c.464C>T, NM_152443.2:c.523T>CLeber congenital amaurosis type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDH12 gene located on chromosomal region 14q24.1. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.250,600
RDXDeafness type 24, autosomal recessiveNM_002906.3NM_002906.3:c.1405dupG, NM_002906.3:c.342_346delGATATAutosomal recessive nonsyndromic sensorineural deafness type DFNB24 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDX gene located on chromosomal region 11q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.600
RELNLissencephaly syndrome, Norman-Roberts typeNM_005045.3NM_005045.3:c.6646C>T, NM_005045.3:c.5615-1G>ALissencephaly syndrome, Norman-Roberts type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RELN gene located on chromosomal region 7q22. The age of onset is early. This disease is characterized by craniofacial anomalies (severe microcephaly, a low sloping forehead, a broad and prominent nasal bridge and widely set eyes) and postnatal growth retardation, severe intellectual deficit, spasticity and epilepsy. The prevalence is 1:1,000,000-9:1,000,000.600
RENRenal tubular dysgenesisNM_000537.3NM_000537.3:c.404C>A, NM_000537.3:c.127C>T, NM_000537.3:c.145C>TRenal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.600
RGRRetinitis pigmentosa type 44NM_001012720.1NM_001012720.1:c.196A>C, NM_001012720.1:c.249_250insGGCTCGGA, NM_001012720.1:c.261_262insGGCTCGGA, NM_001012720.1:c.454C>A, NM_001012720.1:c.865C>T, NM_001012720.1:c.877C>TRetinitis pigmentosa type 44 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RGR gene located on chromosomal region 10q23.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.250,600
RHORetinitis pigmentosa type 4NM_000539.3NM_000539.3:c.152G>C, NM_000539.3:c.173C>T, NM_000539.3:c.448G>A, NM_000539.3:c.620T>G, NM_000539.3:c.670G>A, NM_000539.3:c.745G>T, NM_000539.3:c.659T>GRetinitis pigmentosa type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RHO gene located on chromosomal region 3q22.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.250,600
RLBP1Retinitis punctata albescensNM_000326.4NM_000326.4:c.333T>G, NM_000326.4:c.452G>A, NM_000326.4:c.700C>T, NM_000326.4:c.875C>TRetinitis punctata albescens follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RLBP1 gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by night blindness from early childhood, delay in the regeneration of cone and rod photopigments in young adults, followed by macular degeneration and a decrease in visual acuity that led to legal blindness in early adulthood.250,600
RP2Retinitis pigmentosa type 2NM_006915.2NM_006915.2:c.235delG, NM_006915.2:c.305_306insT, NM_006915.2:c.352delC, NM_006915.2:c.353G>A, NM_006915.2:c.353G>T, NM_006915.2:c.358C>T, NM_006915.2:c.453C>G, NM_006915.2:c.453delC, NM_006915.2:c.631delCRetinitis pigmentosa type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the RP2 gene located on chromosomal region Xp11.23. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.600
RPE65Leber congenital amaurosis type 2NM_000329.2NM_000329.2:c.1067delA, NM_000329.2:c.1301C>T, NM_000329.2:c.1292A>G, NM_000329.2:c.272G>A, NM_000329.2:c.907A>T, NM_000329.2:c.514_515delGTLeber congenital amaurosis 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus.250,600
RPE65Retinitis pigmentosa type 20NM_000329.2NM_000329.2:c.1022T>C, NM_000329.2:c.1087C>A, NM_000329.2:c.1102T>C, NM_000329.2:c.271C>T, NM_000329.2:c.1355T>G, NM_000329.2:c.1543C>T, NM_000329.2:c.394G>A, NM_000329.2:c.881A>CRetinitis pigmentosa type 20 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.250,600
RPGRRetinitis pigmentosa type 3NM_001034853.1NM_001034853.1:c.155-2A>G, NM_001034853.1:c.173_174insA, NM_001034853.1:c.179G>T, NM_001034853.1:c.296C>A, NM_001034853.1:c.389T>G, NM_001034853.1:c.505G>T, NM_001034853.1:c.517G>C, NM_001034853.1:c.642_656delTGGAGAACCTGAGAAinsC, NM_001034853.1:c.654_655delGA, NM_001034853.1:c.674_675delCC, NM_001034853.1:c.703C>T, NM_001034853.1:c.806G>A, NM_001034853.1:c.823G>A, NM_001034853.1:c.846_847delAARetinitis pigmentosa type 3 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the RPGR gene located on chromosomal region Xp11.4. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.600
RPGRIP1LJoubert syndrome type 7NM_015272.2NM_015272.2:c.1177G>A, NM_015272.2:c.1326_1329delAAAA, NM_015272.2:c.1329_1330insA, NM_015272.2:c.1843A>C, NM_015272.2:c.1975T>C, NM_015272.2:c.2030C>T, NM_015272.2:c.2050C>T, NM_015272.2:c.2413C>T, NM_015272.2:c.757C>T, NM_015272.2:c.3548C>G, NM_015272.2:c.697A>T, NM_015272.2:c.3634_3637delGAAA, NM_015272.2:c.776+1G>A, NM_015272.2:c.2794_2795delTTJoubert syndrome type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. This disease is characterized by cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy and renal disease.250,600
RPGRIP1LMeckel syndrome type 5NM_015272.2NM_015272.2:c.394A>T, NM_015272.2:c.3706C>T, NM_015272.2:c.2614C>TMeckel syndrome, type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. This disease is characterized by a combination of renal cysts and variably associated features, including developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and cysts, and polydactyly. The prevalence is <1:1,000,000.250,600
RYR1Central core diseaseNM_000540.2NM_000540.2:c.1021G>A, NM_000540.2:c.10343C>T, NM_000540.2:c.10579C>T, NM_000540.2:c.10616G>A, NM_000540.2:c.11798A>G, NM_000540.2:c.1205T>C, NM_000540.2:c.13480G>T, NM_000540.2:c.13513G>C, NM_000540.2:c.14365-2A>T, NM_000540.2:c.14511+1_14511+2delGT, NM_000540.2:c.14545G>A, NM_000540.2:c.1739_1742dupATCA, NM_000540.2:c.1841G>T, NM_000540.2:c.325C>T, NM_000540.2:c.4076delG, NM_000540.2:c.4178A>G, NM_000540.2:c.4405C>T, NM_000540.2:c.487C>T, NM_000540.2:c.5036G>A, NM_000540.2:c.5333C>A, NM_000540.2:c.5726_5727delAG, NM_000540.2:c.6082C>T, NM_000540.2:c.6104A>T, NM_000540.2:c.631+2T>C, NM_000540.2:c.6961A>G, NM_000540.2:c.7025A>G, NM_000540.2:c.7268T>A, NM_000540.2:c.7300G>A, NM_000540.2:c.7360C>T, NM_000540.2:c.7373G>A, NM_000540.2:c.738T>G, NM_000540.2:c.7463_7475delCAAAGATGTCAGC, NM_000540.2:c.9000+1G>T, NM_000540.2:c.14126C>T, NM_000540.2:c.1655G>A, NM_000540.2:c.4729G>A, NM_000540.2:c.7781C>A, NM_000540.2:c.7836-1G>A, NM_000540.2:c.8360C>G, NM_000540.2:c.9868G>A, NM_000540.2:c.9905_9906insC, NM_000540.2:c.1186G>T, NM_000540.2:c.6721C>TCentral core disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RYR1 gene located on chromosomal region 19q13.2. Typical central core disease is a relatively mild congenital myopathy, usually characterized by motor developmental delay and signs of mild proximal weakness most pronounced in the hip girdle musculature. Orthopedic complications, particularly congenital dislocation of the hips and scoliosis, are common, and patients are at risk of having malignant hyperthermia. Onset is usually in childhood, although adult onset has also been reported.250,600
SACSSpastic ataxia, Charlevoix-Saguenay typeNM_014363.5NM_014363.5:c.10907G>A, NM_014363.5:c.10954C>A, NM_014363.5:c.11624G>A, NM_014363.5:c.12160C>T, NM_014363.5:c.517C>T, NM_014363.5:c.6355C>T, NM_014363.5:c.6781C>A, NM_014363.5:c.7504C>T, NM_014363.5:c.8107C>T, NM_014363.5:c.8844delT, NM_014363.5:c.994A>T, NM_014363.5:c.13237C>T, NM_014363.5:c.3198T>A, NM_014363.5:c.4933C>T, NM_014363.5:c.5618_5619delAT, NM_014363.5:c.6563T>ASpastic ataxia, Charlevoix-Saguenay type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SACS gene located on chromosomal region 13q11. The age of onset is early. This disease is characterized by early-onset cerebellar ataxia with spasticity, a pyramidal syndrome and peripheral neuropathy. The prevalence is 1:1,500-1:2,000.250,600
SAGOguchi diseaseNM_000541.4NM_000541.4:c.293_294insG, NM_000541.4:c.523C>T, NM_000541.4:c.577C>T, NM_000541.4:c.874C>T, NM_000541.4:c.916G>T, NM_000541.4:c.926delA, NM_000541.4:c.993C>GOguchi disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SAG gene located on chromosomal region 2q37. The age of onset is infantile. This disease is characterized by congenital stationary night blindness and the Mizuo-Nakamura phenomenon which is a unique morphological and functional abnormality of the retina that presents with a typical golden-yellow or silver-gray discoloration of the fundus in the presence of light that disappears after dark-adaptation and appears again after the onset of light.250,600
SBDSShwachman-Diamond syndromeNM_016038.2NM_016038.2:c.120delG, NM_016038.2:c.127G>T, NM_016038.2:c.183_184delTAinsCT, NM_016038.2:c.184A>T, NM_016038.2:c.377G>C, NM_016038.2:c.505C>T, NM_016038.2:c.652C>T, NM_016038.2:c.258+2T>CShwachman-Diamond syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBDS gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by chronic and usually mild neutropenia, pancreatic exocrine insufficiency associated with steatorrhea and growth failure, skeletal dysplasia with short stature, and an increased risk of bone marrow aplasia or leukemic transformation, cutaneous (eczema or ichthyosis) and dental anomalies, and psychomotor retardation. The prevalence is 1:76,000 newborn.250,600
SBF2Charcot-Marie-Tooth disease type 4B2NM_030962.3NM_030962.3:c.1459C>T, NM_030962.3:c.2875C>T, NM_030962.3:c.3586C>T, NM_030962.3:c.3154A>T, NM_030962.3:c.5539_5540insATCTCharcot-Marie-Tooth disease, type 4B2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBF2 gene located on chromosomal region 11p15.4. The age of onset is infantile. This disease is characterized by muscle weakness, sensory loss, reduced nerve conduction velocities, characteristic myelin outfoldings and a severe disease course.600
SC5DLathosterolosisNM_006918.4NM_006918.4:c.86G>ALathosterolosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SC5D gene located on chromosomal region 11q23.3. The age of onset is early. This disease is characterized by malformations, intellectual deficit and liver disease. The prevalence is <1:1,000,000.600
SCNN1APseudohypoaldosteronism, type 1NM_001038.5NM_001038.5:c.1305delC, NM_001038.5:c.1482delC, NM_001038.5:c.1522C>T, NM_001038.5:c.1765C>T, NM_001038.5:c.1834C>T, NM_001038.5:c.203_204delTC, NM_001038.5:c.340G>APseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.600
SCNN1BPseudohypoaldosteronism, type 1NM_000336.2NM_000336.2:c.109G>APseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.250,600
SCNN1GPseudohypoaldosteronism, type 1NM_001039.3NM_001039.3:c.1373+2T>C, NM_001039.3:c.1570-1G>A, NM_001039.3:c.1627delG, NM_001039.3:c.598_599insAPseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.250,600
SEMA4ARetinitis pigmentosa type 35NM_022367.3NM_022367.3:c.1033G>C, NM_022367.3:c.1049T>GRetinitis pigmentosa type 35 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SEMA4A gene located on chromosomal region 1q22. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife.600
SEPN1Muscular dystrophy, rigid spine, type 1NM_020451.2NM_020451.2:c.1315C>T, NM_020451.2:c.818G>A, NM_020451.2:c.883G>A, NM_020451.2:c.943G>A, NM_020451.2:c.943G>C, NM_020451.2:c.1384T>G, NM_020451.2:c.713_714insA, NM_020451.2:c.871C>TRigid spine syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SEPN1 gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is characterized by contractures of the spinal extensor muscles associated with abnormal posture (limitation of neck and trunk flexure), progressive scoliosis of the spine, early marked cervico-axial muscle weakness with relatively preserved strength and function of the extremities and progressive respiratory insufficiency. The prevalence is 3.5:100,000–5:100,000.600
SERPINA1Alpha1-antitrypsin deficiencyNM_000295.4NM_000295.4:c.1177C>T, NM_000295.4:c.187C>T, NM_000295.4:c.194T>C, NM_000295.4:c.230C>T, NM_000295.4:c.250G>A, NM_000295.4:c.272G>A, NM_000295.4:c.347T>A, NM_000295.4:c.415G>A, NM_000295.4:c.514G>A, NM_000295.4:c.514G>T, NM_000295.4:c.739C>T, NM_000295.4:c.839A>T, NM_000295.4:c.1093G>A, NM_000295.4:c.848A>TAlpha-1-antitrypsin deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SERPINA1 gene located on chromosomal region 14q32.13. The age of onset is variable. This disease is characterized by emphysema, which becomes evident by the third to fourth decade. A less common manifestation of the deficiency is liver disease, which occurs in children and adults, and may result in cirrhosis and liver failure. Environmental factors, particularly cigarette smoking, greatly increase the risk of emphysema at an earlier age. The prevalence is 1:1,500-1:3,500 in European.250,600
SETXSpinocerebellar ataxia with axonal neuropathy type 2NM_015046.5NM_015046.5:c.1027G>T, NM_015046.5:c.1166T>C, NM_015046.5:c.1807A>G, NM_015046.5:c.2602C>T, NM_015046.5:c.3880C>T, NM_015046.5:c.4087C>T, NM_015046.5:c.5630delG, NM_015046.5:c.5927T>G, NM_015046.5:c.6848_6851delCAGA, NM_015046.5:c.994C>T, NM_015046.5:c.5308_5311delGAGA, NM_015046.5:c.5549-1G>T, NM_015046.5:c.6834_6839delAACAAASpinocerebellar ataxia with axonal neuropathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SETX gene located on chromosomal region 9q34.13. The age of onset is infantile. This disease is characterized by progressive cerebellar ataxia, axonal sensorimotor neuropathy with oculomotor apraxia, fixation instability, extrapyramidal features and an elevated serum alpha-fetoprotein level. The prevalence is 4:100,000-8:100,000.250,600
SGCALimb-girdle muscular dystrophy type 2DNM_000023.2NM_000023.2:c.101G>A, NM_000023.2:c.229C>T, NM_000023.2:c.371T>C, NM_000023.2:c.518T>C, NM_000023.2:c.574C>T, NM_000023.2:c.850C>T, NM_000023.2:c.662G>A, NM_000023.2:c.739G>A, NM_000023.2:c.904_905insCCAutosomal recessive limb-girdle muscular dystrophy type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCA gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness and calf pseudohypertrophy. The prevalence is 1:1,000,000-9:1,000,000.250,600
SGCBMuscular dystrophy, limb-girdle, type 2ENM_000232.4NM_000232.4:c.272G>C, NM_000232.4:c.272G>T, NM_000232.4:c.299T>A, NM_000232.4:c.323T>G, NM_000232.4:c.341C>T, NM_000232.4:c.452C>G, NM_000232.4:c.552T>GAutosomal recessive limb-girdle muscular dystrophy type 2E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCB gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness, particularly of the pelvic girdle muscles.600
SGCGLimb-girdle muscular dystrophy type 2CNM_000231.2NM_000231.2:c.195+4_195+7delAGTA, NM_000231.2:c.505+1G>A, NM_000231.2:c.787G>A, NM_000231.2:c.848G>A, NM_000231.2:c.88delG, NM_000231.2:c.521delTAutosomal recessive limb-girdle muscular dystrophy type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCG gene located on chromosomal region 13q12.12. The age of onset is variable. This disease is characterized by limb-girdle weakness, calf hypertrophy, diaphragmatic weakness, and variable cardiac abnormalities.250,600
SGSHMucopolysaccharidosis type 3A (Sanfilippo disease type A)NM_000199.3NM_000199.3:c.1167C>A, NM_000199.3:c.1298G>A, NM_000199.3:c.130G>A, NM_000199.3:c.1339G>A, NM_000199.3:c.1380delT, NM_000199.3:c.197C>G, NM_000199.3:c.220C>T, NM_000199.3:c.235A>C, NM_000199.3:c.320delT, NM_000199.3:c.337_345delinsGCACAGGTGAG, NM_000199.3:c.364G>A, NM_000199.3:c.383C>T, NM_000199.3:c.416C>T, NM_000199.3:c.449G>A, NM_000199.3:c.466A>T, NM_000199.3:c.617G>C, NM_000199.3:c.752G>C, NM_000199.3:c.757delG, NM_000199.3:c.877C>T, NM_000199.3:c.892T>CMucopolysaccharidosis type 3A (Sanfilippo syndrome type A) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGSH gene located on chromosomal region 17q25.3. The age of onset is infantile. This disease is characterized by behavioural disorders (hyperkinesia, aggressiveness) and intellectual deterioration, sleep disorders and very mild dysmorphism. The prevalence is >1:70,000 newborn.250,600
SH2D1ALymphoproliferative syndrome type 1, X-linkedNM_002351.4NM_002351.4:c.163C>T, NM_002351.4:c.164G>T, NM_002351.4:c.172C>T, NM_002351.4:c.203C>T, NM_002351.4:c.302C>T, NM_002351.4:c.3G>T, NM_002351.4:c.95G>CX-linked lymphoproliferative disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the SH2D1A gene located on chromosomal region Xq25. The age of onset is infantile. This disease is characterized by an inadequate immune response to infection with the Epstein-Barr virus: fulminant infectious mononucleosis, macrophage-activation syndrome or hemophagocytic lymphohistiocytosis (HLH) (see these terms), and/or progressive hypogammaglobulinemia and/or lymphomas. The prevalence is 1:1, 000,000 men.600
SH3TC2Charcot-Marie-Tooth disease type 4CNM_024577.3NM_024577.3:c.1586G>A, NM_024577.3:c.1747_1748delAG, NM_024577.3:c.1969G>A, NM_024577.3:c.1972C>T, NM_024577.3:c.1982T>C, NM_024577.3:c.217_227delGCTGCTCGGAGinsCCAGTAA, NM_024577.3:c.2191delG, NM_024577.3:c.2491_2492delAG, NM_024577.3:c.2710C>T, NM_024577.3:c.2829T>G, NM_024577.3:c.2860C>T, NM_024577.3:c.28delG, NM_024577.3:c.2993_2994insC, NM_024577.3:c.3325C>T, NM_024577.3:c.3326G>C, NM_024577.3:c.3341delC, NM_024577.3:c.3601C>T, NM_024577.3:c.3686A>T, NM_024577.3:c.505T>C, NM_024577.3:c.52+1delG, NM_024577.3:c.530-2A>G, NM_024577.3:c.735G>A, NM_024577.3:c.920G>A, NM_024577.3:c.3676-1G>A, NM_024577.3:c.1724T>A, NM_024577.3:c.53-1G>CCharcot-Marie-Tooth disease, type 4C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SH3TC2 gene located on chromosomal region 5q32. The age of onset is infantile. This disease is characterized by scoliosis or kyphoscoliosis, neuropathy, foot deformities, respiratory insufficiency, hypoacousis and deafness.250,600
SIL1Marinesco-Sjögren syndromeNM_022464.4NM_022464.4:c.1312C>T, NM_022464.4:c.274C>T, NM_022464.4:c.331C>TMarinesco-Sjögren syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SIL1 gene located on chromosomal region 5q31.2. The age of onset is infantile. This disease is characterized by dysarthria, nystagmus, muscle weakness and hypotonia. The prevalence is <1:1,000,000.600
SIX6Anophthalmia or microphthalmia, isolatedNM_007374.2NM_007374.2:c.493A>G, NM_007374.2:c.532_536delAACCG, NM_007374.2:c.635C>T, NM_007374.2:c.725G>TAnophthalmia or microphthalmia, isolated follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SIX6 gene located on chromosomal region 14q23.1. The age of onset is infantile. A disorder of eye formation, ranging from small size of a single eye to complete bilateral absence of ocular tissues. Ocular abnormalities like opacities of the cornea and lens, scarring of the retina and choroid, and other abnormalities may also be present.600
SLC12A1Bartter syndrome type 1NM_000338.2NM_000338.2:c.1875G>A, NM_000338.2:c.1942G>A, NM_000338.2:c.2805_2806insA, NM_000338.2:c.347G>A, NM_000338.2:c.611T>C, NM_000338.2:c.628+2T>C, NM_000338.2:c.814G>T, NM_000338.2:c.223C>T, NM_000338.2:c.2952_2955delCAAABartter syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A1 gene located on chromosomal region 15q15-21. The age of onset is infantile. This disease is characterized by polyhydramnios, premature delivery, polyuria, dehydration, hypercalciuria and nephrocalcinosis. The prevalence is 1:1,000,000.250,600
SLC12A6Agenesis of the corpus callosum with neuropathyNM_133647.1NM_133647.1:c.1584_1585delCTinsG, NM_133647.1:c.2023C>T, NM_133647.1:c.3031C>T, NM_133647.1:c.619C>T, NM_133647.1:c.316+1G>A, NM_133647.1:c.366T>GCorpus callosum agenesis with neuronopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A6 gene located on chromosomal region 15q13-q14. The age of onset is early. This disease is characterized by a delay in developmental milestones, a severe sensory-motor polyneuropathy with areflexia, a variable degree of agenesis of the corpus callosum, amyotrophy, hypotonia, and cognitive impairment. The prevalence is 1:2,117.600
SLC17A5Sialic acid storage diseaseNM_012434.4NM_012434.4:c.115C>T, NM_012434.4:c.406A>G, NM_012434.4:c.43G>T, NM_012434.4:c.918T>G, NM_012434.4:c.1259+1G>A, NM_012434.4:c.500T>CSialic acid storage diseases, follow an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC17A5 gene located on chromosomal region 6q13. The age of onset is from infantile to adult forms. The main symptoms are hypotonia, cerebellar ataxia, and mental retardation; visceromegaly and coarse features are also present in the infantile cases.250,600
SLC24A1Night blindness, congenital stationary type 1DNM_004727.2NM_004727.2:c.1963C>TNight blindness, congenital stationary type 1D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC24A1 gene located on chromosomal region 15q22.31. The age of onset is early. This disease is characterized by hemeralopia with a moderate loss of visual acuity.250,600
SLC25A13Citrullinemia type 2NM_014251.2NM_014251.2:c.1078C>T, NM_014251.2:c.1177+1G>A, NM_014251.2:c.1311+1G>A, NM_014251.2:c.1592G>A, NM_014251.2:c.1799dupA, NM_014251.2:c.1801G>A, NM_014251.2:c.1801G>T, NM_014251.2:c.1813C>T, NM_014251.2:c.615+1G>C, NM_014251.2:c.615+5G>A, NM_014251.2:c.674C>A, NM_014251.2:c.674C>T, NM_014251.2:c.852_855delTATG, NM_014251.2:c.1231-1G>A, NM_014251.2:c.1411_1412delCTCitrullinemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A13 gene located on chromosomal region 7q21.3. The age of onset is early. This disease is characterized by hyperammonemia and associated neuropsychiatric symptoms such as nocturnal delirium, confusion, restlessness, disorientation, drowsiness, memory loss, abnormal behavior (aggression, irritability, and hyperactivity), seizures, and coma. The prevalence is 1:17,000-1:230,000.600
SLC25A15Hyperornithinemia - hyperammonemia - homocitrullinuria syndromeNM_014252.3NM_014252.3:c.110T>G, NM_014252.3:c.212T>A, NM_014252.3:c.535C>T, NM_014252.3:c.538G>A, NM_014252.3:c.562_564delTTC, NM_014252.3:c.569G>A, NM_014252.3:c.658G>A, NM_014252.3:c.815C>T, NM_014252.3:c.824G>A, NM_014252.3:c.44C>THyperornithinemia-hyperammonemia-homocitrullinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A15 gene located on chromosomal region 13q14.11. The age of onset is early. This disease is characterized by coma due to hyperammonemia, convulsions, and hypotonia. The prevalence is 1:5,500.600
SLC25A22Epileptic encephalopathy, early infantile, type 3NM_024698.5NM_024698.5:c.617C>T, NM_024698.5:c.706G>TEarly infantile epileptic encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A22 gene located on chromosomal region 11p15.5. The age of onset is early. This disease is characterized by the onset of tonic spasms within the first 3 months of life leading to psychomotor impairment and death. The prevalence is <1:1,000,000.600
SLC26A2Achondrogenesis type 1BNM_000112.3NM_000112.3:c.1020_1022delTGT, NM_000112.3:c.1273A>G, NM_000112.3:c.532C>T, NM_000112.3:c.2033G>TAchondrogenesis type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by severe micromelia with very short fingers and toes, a flat face, a short neck, thickened soft tissue around the neck, hypoplasia of the thorax, protuberant abdomen, a hydropic fetal appearance and distinctive histological features of the cartilage. The prevalence is 1:20,000.250,600
SLC26A2Atelosteogenesis type 2NM_000112.3NM_000112.3:c.1535C>A, NM_000112.3:c.835C>TAtelosteogenesis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by limb shortening, normal sized skull with cleft palate, hitchhiker thumbs, distinctive facial dysmorphism and radiographic skeletal features. The prevalence is 1:20,000.250,600
SLC26A2Diastrophic dysplasiaNM_000112.3NM_000112.3:c.1724delA, NM_000112.3:c.1878delG, NM_000112.3:c.1361A>C, NM_000112.3:c.767T>C, NM_000112.3:c.833delC, NM_000112.3:c.496G>A, NM_000112.3:c.1957T>ADiastrophic dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by short stature with short extremities (final adult height is 120cm), and joint malformations leading to multiple joint contractures (principally involving the shoulders, elbows, interphalangeal joints and hips). The prevalence is 1:20,000.250,600
SLC26A4Deafness type 4, autosomal recessiveNM_000441.1NM_000441.1:c.1001G>T, NM_000441.1:c.1034T>A, NM_000441.1:c.2162C>T, NM_000441.1:c.1975G>C, NM_000441.1:c.1174A>T, NM_000441.1:c.2131G>A, NM_000441.1:c.1454C>T, NM_000441.1:c.1468A>C, NM_000441.1:c.2211G>C, NM_000441.1:c.269C>T, NM_000441.1:c.916dupG, NM_000441.1:c.281C>T, NM_000441.1:c.1634T>G, NM_000441.1:c.1707+5G>A, NM_000441.1:c.1489G>A, NM_000441.1:c.961A>T, NM_000441.1:c.2048T>C, NM_000441.1:c.898A>C, NM_000441.1:c.918+2T>C, NM_000441.1:c.1001+1G>T, NM_000441.1:c.970A>T, NM_000441.1:c.563T>CAutosomal recessive nonsyndromic sensorineural deafness type DFNB4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.250,600
SLC26A4Pendred syndromeNM_000441.1NM_000441.1:c.1246A>C, NM_000441.1:c.1826T>G, NM_000441.1:c.1229C>T, NM_000441.1:c.1263+1G>A, NM_000441.1:c.1061T>C, NM_000441.1:c.1790T>C, NM_000441.1:c.2168A>G, NM_000441.1:c.1151A>G, NM_000441.1:c.1226G>A, NM_000441.1:c.1003T>C, NM_000441.1:c.919-2A>G, NM_000441.1:c.554G>C, NM_000441.1:c.626G>T, NM_000441.1:c.1334T>G, NM_000441.1:c.1198delT, NM_000441.1:c.412G>T, NM_000441.1:c.707T>CPendred syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. The main presenting clinical sign is prelingual sensorineural deafness, although occasionally the hearing loss develops later in childhood. The degree of hearing loss is variable: it can be mild-to-moderate and progressive in some patients, and severe-to-profound in others. Fluctuations in hearing are also common and may be associated with or preceded by vertigo. The onset and presentation of euthyroid goiter (75%) is highly variable within and between families, with thyroid enlargement usually developing in late childhood or early adulthood. The thyromegaly reflects a defect in iodide transport from the thyrocyte to the colloid, although organification itself is not impaired. Hypothyroidism may develop if nutritional iodide intake is low.250,600
SLC26A5Deafness type 61, autosomal recessiveNM_198999.2NM_198999.2:c.209G>A, NM_198999.2:c.390A>C, NM_198999.2:c.152+1G>A, NM_198999.2:c.1A>GAutosomal recessive nonsyndromic sensorineural deafness type DFNB16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A5 gene located on chromosomal region 7q22.1. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.600
SLC35A1Congenital disorder of glycosylation type 2FNM_006416.4NM_006416.4:c.277_280delGTGCinsTGCongenital disorder of glycosylation type 2F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35A1 gene located on chromosomal region 6q15. The age of onset is early. This disease is characterized by repeated hemorrhagic incidents, including severe pulmonary hemorrhage.600
SLC35C1Congenital disorder of glycosylation 2cNM_018389.4NM_018389.4:c.439C>T, NM_018389.4:c.91G>T, NM_018389.4:c.923C>G, NM_018389.4:c.290dupG, NM_018389.4:c.503_505delTCTCongenital disorder of glycosylation type 2c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35C1 gene located on chromosomal region 11p11.2. The age of onset is infantile. This disease is characterized by recurrent bacterial infections, severe growth delay and severe intellectual deficit.600
SLC35D1Schneckenbecken dysplasiaNM_015139.2NM_015139.2:c.319C>T, NM_015139.2:c.932G>ASchneckenbecken dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35D1 gene located on chromosomal region 1p31.3. The age of onset is fetal. This disease is characterized by nail-like configuration of the hypoplastic iliac bone, flattened hypoplastic vertebral bodies, short ribs, short and wide fibulae, short and broad long bones with a dumbbell-like appearance, and precocious ossification of the tarsus.600
SLC37A4Glycogen storage disease types 1b, 1c and 1dNM_001164278.1NM_001164278.1:c.1042_1043delCT, NM_001164278.1:c.1081G>T, NM_001164278.1:c.1082G>A, NM_001164278.1:c.1108_1109delCT, NM_001164278.1:c.1129G>T, NM_001164278.1:c.1190-2_1190-1delAG, NM_001164278.1:c.1309C>T, NM_001164278.1:c.287G>A, NM_001164278.1:c.352T>C, NM_001164278.1:c.593A>T, NM_001164278.1:c.706_708delGTG, NM_001164278.1:c.83G>A, NM_001164278.1:c.899G>AGlycogen storage disease due to glucose-6-phosphatase deficiency types 1b, 1c and 1d follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC37A4 gene located on chromosomal region 11q23. The age of onset is early. This disease is characterized by impairment of terminal steps of glycogenolysis and gluconeogenesis. Patients manifest a wide range of clinical symptoms and biochemical abnormalities, including hypoglycemia, severe hepatomegaly due to excessive accumulation of glycogen, kidney enlargement, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. Glycogen storage disease type 1B patients also present a tendency towards infections associated with neutropenia, relapsing aphthous gingivostomatitis, and inflammatory bowel disease. The incidence is 1:100,000.250,600
SLC45A2Albinism, oculocutaneous, type 4NM_016180.3NM_016180.3:c.1121delT, NM_016180.3:c.469G>A, NM_016180.3:c.986delCOculocutaneous albinism type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC45A2 gene located on chromosomal region 5p13.2. The age of onset is early. This disease is characterized by skin and hair hypopigmentation, numerous ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1:100.000.600
SLC4A11Congenital hereditary endothelial dystrophy type 2NM_032034.3NM_032034.3:c.1038_1039insA, NM_032034.3:c.1391G>A, NM_032034.3:c.2318C>T, NM_032034.3:c.1466C>T, NM_032034.3:c.1813C>T, NM_032034.3:c.2264G>A, NM_032034.3:c.2605C>T, NM_032034.3:c.2399C>T, NM_032034.3:c.554_561delGCTTCGCC, NM_032034.3:c.2606G>ACongenital hereditary endothelial dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by a diffuse ground-glass appearance of the corneas and marked corneal thickening from birth with nystagmus, and blurred vision.250,600
SLC4A11Corneal dystrophy and perceptive deafnessNM_032034.3NM_032034.3:c.2528T>C, NM_032034.3:c.1463G>A, NM_032034.3:c.473_480delGCTTCGCC, NM_032034.3:c.2566A>G, NM_032034.3:c.637T>C, NM_032034.3:c.625C>T, NM_032034.3:c.2224G>A, NM_032034.3:c.2240_2240+1insTATGACACCorneal dystrophy - perceptive deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by the association of congenital hereditary endothelial dystrophy with progressive, postlingual sensorineural hearing loss.250,600
SLC6A8Cerebral creatine deficiency syndrome type 1NM_005629.3NM_005629.3:c.1011C>G, NM_005629.3:c.1141G>C, NM_005629.3:c.1222_1224delTTC, NM_005629.3:c.1540C>T, NM_005629.3:c.321_323delCTT, NM_005629.3:c.395G>TX-linked creatine transporter deficiency follows an X-linked pattern of inheritance and is caused by pathogenic variants in the SLC6A8 gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by intellectual deficit, seizures, severe speech delay and sometimes midface hypoplasia, microcephaly, long, thin face, and prominent chin in the cases of affected male patients reported to date. The prevalence is 11:1,000.600
SLX4Fanconi anemia, complementation group PNM_032444.2NM_032444.2:c.1093delC, NM_032444.2:c.286delA, NM_032444.2:c.4921_4922insG, NM_032444.2:c.5097_5098delTC, NM_032444.2:c.5408_5409insAC, NM_032444.2:c.4739+1G>T, NM_032444.2:c.2808_2809delAGFanconi anemia complementation group P follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLX4 gene located on chromosomal region 16p13.3. The age of onset is early. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:160,000.250,600
SMN1Spinal muscular atrophy-del ex7, del ex7-8, del ex8 (Detection by MLPA)Spinal muscular atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMN1 gene located on chromosomal region 5q13.2. The age of onset is variable. This disease comprise a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. Autosomal recessive forms are classified according to the age of onset, the maximum muscular activity achieved, and survivorship. The severity of the disease is mainly determined by the copy number of SMN2, a copy gene which predominantly produces exon 7-skipped transcripts and only low amount of full-length transcripts that encode for a protein identical to SMN1. Only about 4% of patients bear one SMN1 copy with an intragenic mutation. Type 1 is a severe form, with onset before 6 months of age. Patients never achieve the ability to sit. Type 2 has intermediate severity, with onset between 6 and 18 months. Patients do not reach the motor milestone of standing, and survive into adulthood. Type 3 onset is after 18 months. Patients develop ability to stand and walk and survive into adulthood. Type 4 onset is in adulthood, disease progression is slow, and patients can stand and walk. The incidence is 1:10,000 and the prevalence is 1:80,000.250,600
SMPD1Niemann-Pick diseaseNM_000543.4NM_000543.4:c.103_118delCTGGTGCTGGCGCTGG, NM_000543.4:c.103_119delCTGGTGCTGGCGCTGGC, NM_000543.4:c.103_107delCTGGT, NM_000543.4:c.103_113delCTGGTGCTGGCGinsCTGGTG, NM_000543.4:c.1092-1G>C, NM_000543.4:c.1117C>T, NM_000543.4:c.106delG, NM_000543.4:c.108_124delGCTGGCGCTGGCGCTGGC, NM_000543.4:c.1267C>T, NM_000543.4:c.1299T>G, NM_000543.4:c.1327C>T, NM_000543.4:c.1420_1421delCT, NM_000543.4:c.1426C>T, NM_000543.4:c.1624C>T, NM_000543.4:c.1630delA, NM_000543.4:c.1805G>A, NM_000543.4:c.354delC, NM_000543.4:c.475T>C, NM_000543.4:c.551C>T, NM_000543.4:c.557C>T, NM_000543.4:c.558_559insC, NM_000543.4:c.558_574delGCCCCCCAAACCCCCTA, NM_000543.4:c.564delC, NM_000543.4:c.573delT, NM_000543.4:c.689G>A, NM_000543.4:c.730G>A, NM_000543.4:c.739G>A, NM_000543.4:c.740delG, NM_000543.4:c.742G>A, NM_000543.4:c.757G>C, NM_000543.4:c.785_807delTGTTGAGTGGGCTGGGCCCAGCC, NM_000543.4:c.788T>A, NM_000543.4:c.842_849dupTCCCCGCA, NM_000543.4:c.911T>C, NM_000543.4:c.940G>A, NM_000543.4:c.96G>A, NM_000543.4:c.996delC, NM_000543.4:c.688C>T, NM_000543.4:c.995C>G, NM_000543.4:c.1829_1831delGCC, NM_000543.4:c.1264-1G>T, NM_000543.4:c.1152G>ANiemann-Pick disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMPD1 gene located on chromosomal region 11p15.4. The clinical phenotype ranges from a severe infantile form with neurologic degeneration resulting in death usually by 3 years of age (type A) to a later-onset nonneurologic form (type B) that is compatible with survival into adulthood.250,600
SNAI2Waardenburg syndrome type 2NM_003068.4NM_003068.4:c.357C>AWaardenburg syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SNAI2 gene located on chromosome 8q11.21. The age of onset is early. This disease is characterized by pigmentary abnormalities of the hair, skin, and eyes, congenital sensorineural hearing loss and the lateral displacement of the inner canthus of each eye. The prevalence is 1:100,000-9:100,000.600
SNAP29Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndromeNM_004782.3NM_004782.3:c.487dupACerebral dysgenesis-neuropathy-ichthyosis-palmoplantar keratoderma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SNAP29 gene located on chromosomal region 22q11.2. The age of onset is early. This disease is characterized by severe developmental abnormalities of the nervous system and aberrant differentiation of the epidermis. The prevalence is <1:1,000,000.600
SPG11Spastic paraplegia type 11NM_025137.3NM_025137.3:c.118C>T, NM_025137.3:c.529_533delATATT, NM_025137.3:c.5623C>T, NM_025137.3:c.1339_1342dupGGCT, NM_025137.3:c.342delT, NM_025137.3:c.7152-1G>C, NM_025137.3:c.733_734delAT, NM_025137.3:c.6805_6806delCT, NM_025137.3:c.1736-1G>C, NM_025137.3:c.6100C>T, NM_025137.3:c.6848_6849insTCSpastic paraplegia type 11 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG11 gene located on chromosomal region 13q13.3. The age of onset is infantile. This disease is characterized by progressive spasticity and weakness of the lower limbs frequently associated with the following: mild intellectual disability with learning difficulties in childhood and/or progressive cognitive decline; peripheral neuropathy; pseudobulbar involvement; and increased reflexes in the upper limbs. The prevalence is 5:100.000.250,600
SPG20Spastic paraplegia type 20, autosomal recessiveNM_015087.4NM_015087.4:c.1110delA, NM_015087.4:c.364_365delATAutosomal recessive spastic paraplegia type 20 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG20 gene located on chromosomal region 13q13.3. The age of onset is infantile. This disease is characterized by progressive spastic paraparesis, dysarthria, and pseudobulbar palsy; distal amyotrophy; motor and cognitive delays; short stature; and subtle skeletal abnormalities.600
SPG7Spastic paraplegia type 7NM_003119.3NM_003119.3:c.1457G>A, NM_003119.3:c.1529C>T, NM_003119.3:c.2075G>C, NM_003119.3:c.233T>A, NM_003119.3:c.1676delA, NM_003119.3:c.1749G>C, NM_003119.3:c.773_774delTG, NM_003119.3:c.1045G>A, NM_003119.3:c.1124delG, NM_003119.3:c.679C>T, NM_003119.3:c.758+2T>C, NM_003119.3:c.286+1G>TSpastic paraplegia type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG7 gene located on chromosomal region 16q24.3. The age of onset is adult. This disease is characterized by insidiously progressive bilateral lower limb weakness and spasticity. The prevalence is 1:100,000-9:100,000.250,600
STARLipoid adrenal hyperplasiaNM_000349.2NM_000349.2:c.545G>T, NM_000349.2:c.559G>A, NM_000349.2:c.545G>A, NM_000349.2:c.749G>A, NM_000349.2:c.772C>T, NM_000349.2:c.562C>T, NM_000349.2:c.577C>TCongenital lipoid adrenal hyperplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STAR gene located on chromosomal region 8p11.23. The age of onset is early. This disease is characterized by severe adrenal insufficiency and sex reversal in males. The prevalence is 1:300,000.600
STILMicrocephaly primary, type 7, autosomal recessiveNM_003035.2NM_003035.2:c.3655delG, NM_003035.2:c.3715C>T, NM_003035.2:c.3843_3846delACAG, NM_003035.2:c.2392T>G, NM_003035.2:c.2826+1G>AAutosomal recessive primary microcephaly type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STIL gene located on chromosomal region 1p33. The age of onset is early. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. The incidence is 1:1,000,000.600
STRA6Syndromic microphthalmia type 9NM_022369.3NM_022369.3:c.1678G>C, NM_022369.3:c.1699C>T, NM_022369.3:c.147delC, NM_022369.3:c.1521-1G>A, NM_022369.3:c.1964G>A, NM_022369.3:c.277_278insCC, NM_022369.3:c.1931C>T, NM_022369.3:c.1963C>T, NM_022369.3:c.69G>A, NM_022369.3:c.878C>T, NM_022369.3:c.910_911delGGinsAA, NM_022369.3:c.52_53delTAinsC, NM_022369.3:c.527_528insGSyndromic microphthalmia type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRA6 gene located on chromosomal region 15q24.1. The age of onset is early. This disease is characterized by anophthalmia or severe microphthalmia, and pulmonary hypoplasia or aplasia. The prevalence is 1:10,000.600
STRCDeafness type 16, autosomal recessiveNM_153700.2NM_153700.2:c.4561_4562insC, NM_153700.2:c.5188C>T, NM_153700.2:c.3556C>T, NM_153700.2:c.5168_5171delTTCT, NM_153700.2:c.5185C>T, NM_153700.2:c.4545+1G>CAutosomal recessive nonsyndromic sensorineural deafness type DFNB16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRC gene located on chromosomal region 15q15.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.250,600
SUCLG1Fatal infantile lactic acidosis with methylmalonic aciduriaNM_003849.3NM_003849.3:c.152_153delAT, NM_003849.3:c.626C>AFatal infantile lactic acidosis with methylmalonic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SUCLG1 gene located on chromosomal region 2p11.2. The age of onset is early. This disease is characterized by polypnea, severe hypotonia, lethargy, and vomiting, after a silent period during which the children were considered as normal. Facial dysmorphism and cerebral malformations may be noted, as well as diverse organ involvement such as hypertrophic myocardiopathy, tubulopathy, or liver insufficiency.600
SUOXSulfocysteinuriaNM_000456.2NM_000456.2:c.37C>T, NM_000456.2:c.894_895delCT, NM_000456.2:c.650G>A, NM_000456.2:c.794C>ASulfocysteinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SUOX gene located on chromosome 12q13.13. The age of onset is early. This disease is characterized by seizures, reduced muscle tone, psychomotor retardation, lens dislocation.600
TAF1Dystonia-Parkinsonism, X-linkedNM_004606.4NM_004606.4:c.417_418insCATAATCTATGATAATGATAATX-linked dystonia-parkinsonism follows an X-linked pattern of inheritance and is caused by pathogenic variants in the TAF1 gene located on chromosomal region Xq13.1. The age of onset is adult. This disease is characterized by adult-onset Parkinsonism that is frequently accompanied by focal dystonia, which becomes generalized over time, and that has a highly variable clinical course. The prevalence is 1:300,000.600
TATTyrosinemia type 2NM_000353.2NM_000353.2:c.1249C>T, NM_000353.2:c.236-5A>G, NM_000353.2:c.668C>G, NM_000353.2:c.1297C>T, NM_000353.2:c.169C>TTyrosinemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TAT gene located on chromosomal region 16q22.1. The age of onset is early. This disease is characterized by hypertyrosinemia with oculocutaneous manifestations and, in some cases, intellectual deficit. The prevalence is 1:100,000-1:120,000 newborn.600
TBCEHypoparathyroidism-retardation-dysmorphism syndromeNM_003193.4NM_003193.4:c.1491_1492insGTAAAHypoparathyroidism - retardation - dysmorphism syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TBCE gene located on chromosomal region 1q42.3. The age of onset is early. This disease is characterized by congenital hypoparathyroidism, growth retardation, intellectual deficit, seizures, and dysmorphic features including microcephaly, facial, ocular and dental abnormalities, and short hands and feet.600
TCAPCardiomyopathy, hypertrophic, type 25NM_003673.3NM_003673.3:c.260G>A, NM_003673.3:c.316C>TCardiomyopathy, hypertrophic, type 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by dyspnea, syncope, collapse, palpitations, and chest pain. They can be readily provoked by exercise. The disorder has inter- and intrafamilial variability ranging from benign to malignant forms with high risk of cardiac failure and sudden cardiac death.250,600
TCAPLimb-girdle muscular dystrophy type 2GNM_003673.3NM_003673.3:c.157C>TAutosomal recessive limb-girdle muscular dystrophy type 2G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by muscle weakness in the four limbs, mild scapular winging, severe atrophy of the quadriceps and anterior tibialis muscles, calf hypertrophy, and lack of respiratory and cardiac involvement.250,600
TCIRG1Osteopetrosis type 1, autosomal recessiveNM_006019.3NM_006019.3:c.1331G>T, NM_006019.3:c.1674-1G>A, NM_006019.3:c.179A>G, NM_006019.3:c.2236+1G>A, NM_006019.3:c.2415-3C>G, NM_006019.3:c.112_113delAG, NM_006019.3:c.1213G>AAutosomal recessive osteopetrosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCIRG1 gene located on chromosomal region 11q13.2. The age of onset is early. This disease is characterized by bone marrow failure, fractures and visual impairment. The incidence is 1:200.000 live births and the prevalence is 1:250,000.250,600
TECTADeafness type 21, autosomal recessiveNM_005422.2NM_005422.2:c.2428C>T, NM_005422.2:c.2941+1G>A, NM_005422.2:c.651_652insC, NM_005422.2:c.4370_4371insTCAGTGCGACCCGC, NM_005422.2:c.4601G>AAutosomal recessive nonsyndromic sensorineural deafness type DFNB21 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TECTA gene located on chromosomal region 11q23.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.600
TERTDyskeratosis congenita, autosomal recessiveNM_198253.2NM_198253.2:c.1234C>T, NM_198253.2:c.835G>A, NM_198253.2:c.2701C>T, NM_198253.2:c.2431C>TDyskeratosis congenita, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TERT gene located on chromosomal region 5p15.33. The age of onset is early. This disease has a wide phenotypic spectrum and age onset. It usually manifests during childhood with the triad of dysplastic nails, lacy reticular pigmentation and atrophy of the skin at the level of the neck and upper chest, and oral leukoplakia. Patients show an increased risk for progressive bone marrow failure and may develop myelodysplastic syndrome or acute myelogenous leukemia at any age (the risk increasing with age). There is also an increased risk for solid tumors, typically squamous cell carcinoma of head and neck (see this term) or anogenital cancer. Various additional clinical findings have been reported and may include: developmental delay, short stature, microcephaly, blepharitis, epiphora, periodontal disease, taurodontism, decreased teeth/root ratio, esophageal stenosis, liver disease, urethral stenosis, osteoporosis, avascular necrosis of femur and/or humerus, premature hair greying/alopecia, or abnormal eyelashes. Individuals with DC are at high risk of pulmonary fibrosis. The prevalence is 1:1.000.000.250,600
TFR2Hemochromatosis, type 3NM_003227.3NM_003227.3:c.1330G>A, NM_003227.3:c.1403G>A, NM_003227.3:c.1469T>G, NM_003227.3:c.1235_1237delACA, NM_003227.3:c.1861_1872delGCCGTGGCCCAG, NM_003227.3:c.2343G>A, NM_003227.3:c.313C>T, NM_003227.3:c.1665delC, NM_003227.3:c.750C>G, NM_003227.3:c.840C>G, NM_003227.3:c.949C>T, NM_003227.3:c.515T>A, NM_003227.3:c.1632_1633delGA, NM_003227.3:c.2014C>T, NM_003227.3:c.2374G>A, NM_003227.3:c.1473+1G>A, NM_003227.3:c.1186C>THemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000.250,600
THSegawa syndrome, autosomal recessiveNM_000360.3NM_000360.3:c.1141C>A, NM_000360.3:c.614T>C, NM_000360.3:c.733A>C, NM_000360.3:c.1388C>T, NM_000360.3:c.605G>A, NM_000360.3:c.917G>ASegawa syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TH gene located on chromosomal region 11p15.5. This disease is characterized by dystonia presenting in infancy or early childhood. Dystonia is defined by the presence of sustained involuntary muscle contractions, often leading to abnormal postures. Some cases present with parkinsonian symptoms in infancy. Unlike all other forms of dystonia, it is an eminently treatable condition, due to a favorable response to L-DOPA. The prevalence is 1:1,000,000-9:1,000,000.600
TIMM8AMohr-Tranebjaerg syndromeNM_004085.3NM_004085.3:c.198C>G, NM_004085.3:c.238C>T, NM_004085.3:c.112C>TMohr-Tranebjaerg syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the TIMM8A gene located on chromosomal region Xq22. The age of onset is infantile. This disease is characterized by hearing loss, followed by adolescent onset progressive dystonia or ataxia, visual impairment from early adulthood onwards and dementia from the 4th decade onwards. The prevalence is <1:1,000,000.600
TK2Mitochondrial DNA depletion syndrome type 2NM_004614.4NM_004614.4:c.323C>T, NM_004614.4:c.361C>A, NM_004614.4:c.373C>T, NM_004614.4:c.500G>A, NM_004614.4:c.604_606delAAG, NM_004614.4:c.635T>A, NM_004614.4:c.623A>G, NM_004614.4:c.159C>G, NM_004614.4:c.268C>TMitochondrial DNA depletion syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TK2 gene located on chromosomal region 16q21. The age of onset is infantile. This disease is characterized by generalized hypotonia, proximal muscle weakness, loss of previously acquired motor skills, poor feeding, and respiratory difficulties leading to respiratory failure and death within a few years after diagnosis. The prevalence is 1.2:100,000.250,600
TMC1Deafness type 7, autosomal recessiveNM_138691.2NM_138691.2:c.1763+3A>G, NM_138691.2:c.1842G>A, NM_138691.2:c.100C>T, NM_138691.2:c.1165C>T, NM_138691.2:c.425G>A, NM_138691.2:c.454-1G>C, NM_138691.2:c.1960A>GAutosomal recessive nonsyndromic sensorineural deafness type DFNB7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMC1 gene located on chromosomal region 9q21.13. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.600
TMEM216Joubert syndrome type 2NM_001173990.2NM_001173990.2:c.218G>T, NM_001173990.2:c.218G>A, NM_001173990.2:c.79_82delAACGJoubert syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM216 gene located on chromosomal region 11q12.2. The age of onset is early. This disease is characterized by the neurological features associated with both renal and ocular disease; retinal involvement (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:80,000-1:100,000.600
TMEM216Meckel syndrome type 2NM_001173990.2NM_001173990.2:c.230G>C, NM_001173990.2:c.253C>T, NM_001173990.2:c.341T>GMeckel syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM216 gene located on chromosomal region 11q12.2. The age of onset is antenatal. It is a disorder characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically encephalocele), hepatic ductal dysplasia and cysts, and polydactyly. The prevalence is 1:80,000-1:100,000.600
TMEM67COACH syndromeNM_153704.5NM_153704.5:c.1769T>C, NM_153704.5:c.2498T>CCOACH syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is variable. This disease is characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable.250,600
TMEM67Joubert syndrome type 6NM_153704.5NM_153704.5:c.130C>T, NM_153704.5:c.148_149insTAAT, NM_153704.5:c.1538A>GJoubert syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is infantile. This disease is characterized by an irregular breathing pattern (episodic tachypnea and/or apnea), and nystagmus. During infancy, hypotonia may appear. Cerebellar ataxia (staggering gait and imbalance) may develop later. Delayed acquisition of motor milestones is common. Cognitive abilities are variable, ranging from severe intellectual deficit to normal intelligence. Neuro-ophthalmologic examination may show oculomotor apraxia. In some cases, seizures occur. Careful examination of the face shows a characteristic appearance: large head, prominent forehead, high rounded eyebrows, epicanthal folds, ptosis (occasionally), an upturned nose with prominent nostrils, an open mouth (which tends to have an oval shape early on, a 'rhomboid' appearance later, and finally can appear triangular with downturned angles), tongue protrusion and rhythmic tongue motions, and occasionally low-set and tilted ears. Other features sometimes present in Joubert syndrome include retinal dystrophy, nephronophthisis, and polydactyly. The prevalence is 1:80,000-1:100,000.250,600
TMEM67Meckel syndrome type 3NM_153704.5NM_153704.5:c.1309C>G, NM_153704.5:c.755T>C, NM_153704.5:c.1046T>C, NM_153704.5:c.653G>C, NM_153704.5:c.406+1402_406+1403insTAAT, NM_153704.5:c.622A>TMeckel syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is variable. This disease is characterized multiple congenital anomaly disorder characterized by the triad of brain malformation mainly occipital encephalocele (see this term), large polycystic kidneys, and polydactyly as well as associated abnormalities that may include cleft lip/palate (see these terms), cardiac and genital anomalies, central nervous system (CNS) malformations, liver fibrosis, and bone dysplasia.250,600
TMIEDeafness type 6, autosomal recessiveNM_147196.2NM_147196.2:c.241C>T, NM_147196.2:c.250C>T, NM_147196.2:c.170G>A, NM_147196.2:c.257G>AAutosomal recessive nonsyndromic sensorineural deafness type DFNB6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMIE gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness.600
TMPRSS3Deafness types 8/10, autosomal recessiveNM_024022.2NM_024022.2:c.1211C>T, NM_024022.2:c.1276G>A, NM_024022.2:c.1159G>A, NM_024022.2:c.413C>A, NM_024022.2:c.446+1G>T, NM_024022.2:c.647G>T, NM_024022.2:c.753G>C, NM_024022.2:c.646C>T, NM_024022.2:c.208delC, NM_024022.2:c.242C>GAutosomal recessive nonsyndromic sensorineural deafness type DFNB10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMPRSS3 gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness.250,600
TNNT1Nemaline myopathy type 5NM_003283.5NM_003283.5:c.538G>TNemaline myopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TNNT1 gene located on chromosomal region 19q13.4. The age of onset is from birth to adulthood. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:50,000 newborn.600
TPP1Neuronal ceroid-lipofuscinoses type 2NM_000391.3NM_000391.3:c.1093T>C, NM_000391.3:c.616C>T, NM_000391.3:c.622C>T, NM_000391.3:c.1340G>A, NM_000391.3:c.141_144delGAGT, NM_000391.3:c.827A>T, NM_000391.3:c.509-1G>C, NM_000391.3:c.851G>TNeuronal ceroid lipofuscinosis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPP1 gene located on chromosomal region 11p15.4. Age of onset is infantile. This disease is characterized by epilepsy, followed by regression of developmental milestones, myoclonic ataxia, and pyramidal signs. Visual impairment typically appears at age four to six years and rapidly progresses to light/dark awareness only. Life expectancy ranges from age six years to early teenage. The prevalence is 1.5:1,000,000-9:1,000,000.250,600
TPRNDeafness type 79, autosomal recessiveNM_001128228.2NM_001128228.2:c.1427delC, NM_001128228.2:c.1239G>AAutosomal recessive nonsyndromic sensorineural deafness type DFNB79 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPRN gene located on chromosomal region 9q34.3. The age of onset is early. This disease is characterized by hearing loss and deafness.600
TREX1Aicardi-Goutieres syndrome type 1NM_033629.4NM_033629.4:c.341G>A, NM_033629.4:c.144_145insC, NM_033629.4:c.490C>T, NM_033629.4:c.506G>AAicardi-Goutières syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TREX1 gene located on chromosomal region 3p21.31. The age of onset is early. This disease is characterized by subacute encephalopathy (feeding problems, irritability and psychomotor regression or delay) associated with epilepsy (53% of cases), chilblain skin lesions on the extremities (43% of cases) and episodes of aseptic febrile illness (40% of cases). The prevalence is <1:1,000,000.600
TRIM32Limb-girdle muscular dystrophy type 2HNM_012210.3NM_012210.3:c.1459G>A, NM_012210.3:c.1560delCAutosomal recessive limb-girdle muscular dystrophy type 2H follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIM32 gene located on chromosomal region 9q31-q33. The age of onset is variable. This disease is characterized by proximal muscle weakness and facial muscle wasting.600
TRIM37Mulibrey nanismNM_015294.3NM_015294.3:c.1346_1347insA, NM_015294.3:c.1411C>T, NM_015294.3:c.1037_1040dupAGAT, NM_015294.3:c.2056C>T, NM_015294.3:c.2212delG, NM_015294.3:c.227T>C, NM_015294.3:c.326G>C, NM_015294.3:c.496_500delAGGAA, NM_015294.3:c.745C>T, NM_015294.3:c.965G>T, NM_015294.3:c.1478_1479delAG, NM_015294.3:c.1668-1G>CMulibrey nanism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIM37 gene located on chromosomal region 17q22. The age of onset is prenatal. This disease is characterized by pre- and postnatal growth restriction, characteristic craniofacial features with scaphocephaly, triangular face, high and broad forehead, low nasal bridge and yellowish dots in retinal mid peripheral region. The prevalence is <1:1,000,000.600
TRIOBPDeafness type 28, autosomal recessiveNM_001039141.2NM_001039141.2:c.2362C>T, NM_001039141.2:c.3194delT, NM_001039141.2:c.1039C>T, NM_001039141.2:c.1741C>T, NM_001039141.2:c.4577C>G, NM_001039141.2:c.2639_2640insTCAC, NM_001039141.2:c.5316G>A, NM_001039141.2:c.3202C>T, NM_001039141.2:c.4429_4430insGDeafness autosomal recessive type 28 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIOBP gene located on chromosomal region 22q13.1. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.250,600
TSEN54Pontocerebellar hypoplasiaNM_207346.2NM_207346.2:c.670_671delAA, NM_207346.2:c.736C>T, NM_207346.2:c.1027C>T, NM_207346.2:c.1039A>T, NM_207346.2:c.887G>A, NM_207346.2:c.919G>TPontocerebellar hypoplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSEN54 gene located on chromosomal region 17q25.1. Pontocerebellar hypoplasia (PCH) refers to a group of severe neurodegenerative disorders affecting growth and function of the brainstem and cerebellum, resulting in little or no development. Different types were classified based on the clinical picture and the spectrum of pathologic changes. 250,600
TSFMCombined oxidative phosphorylation deficiency type 3NM_001172696.1NM_001172696.1:c.1_2delAT, NM_001172696.1:c.580delC, NM_001172696.1:c.919C>T, NM_001172696.1:c.21_22delGCCombined oxidative phosphorylation deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSFM gene located on chromosomal region 12q14.1. The age of onset is early. This disease is characterized by hypotonia, lactic acidosis, and hepatic insufficiency, with progressive encephalomyopathy or hypertrophic cardiomyopathy.250,600
TSHBIsolated thyroid-stimulating hormone deficiencyNM_000549.4NM_000549.4:c.94G>T, NM_000549.4:c.205C>T, NM_000549.4:c.145G>AIsolated thyroid-stimulating hormone deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSHB gene located on chromosomal region 1p13. The age of onset is early. This disease is characterized by decreased activity and increased sleep, feeding difficulty and constipation, prolonged jaundice, myxedematous facies, large fontanels (especially posterior), macroglossia, a distended abdomen with umbilical hernia and hypotonia. Slow linear growth and developmental delay are usually apparent by 4-6 months of age.600
TSHRHypothyroidismNM_000369.2NM_000369.2:c.100G>A, NM_000369.2:c.1170T>G, NM_000369.2:c.484C>G, NM_000369.2:c.500T>A, NM_000369.2:c.122G>C, NM_000369.2:c.326G>A, NM_000369.2:c.1741_1742insC, NM_000369.2:c.202C>THypothyroidism due to TSH receptor mutations follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSHR gene located on chromosomal region 14q31. The age of onset is early. This disease is characterized by decreased activity and increased sleep, feeding difficulty and constipation, prolonged jaundice, myxedematous facies, large fontanels (especially posterior), macroglossia, a distended abdomen with umbilical hernia, and hypotonia. Slow linear growth and developmental delay are usually apparent by 4-6 months of age. Without treatment CH results in severe intellectual deficit and short stature. The prevalence is 1:3,000-1:4,000 newborn.250,600
TTNCardiomyopathy, dilated/Tibial muscular dystrophyNM_133378.4NM_133378.4:c.13149C>A, NM_133378.4:c.22246G>A, NM_133378.4:c.31780G>A, NM_133378.4:c.40211dupT, NM_133378.4:c.44668delG, NM_133378.4:c.52977dupT, NM_133378.4:c.61640C>G, NM_133378.4:c.84669_84675delTGAATTC, NM_133378.4:c.94567C>T, NM_133378.4:c.96388C>T, NM_133378.4:c.96388delC, NM_133378.4:c.98366_98367delAT, NM_133378.4:c.12064C>T, NM_133378.4:c.28739-1G>A, NM_133378.4:c.3165-1G>T, NM_133378.4:c.4724_4728delTGAAA, NM_133378.4:c.48944-1G>A, NM_133378.4:c.91114_91117delTCCA, NM_133378.4:c.100185delA, NM_133378.4:c.40549delA, NM_133378.4:c.24568_24571delAGCACardiomyopathy, dilated/Tibial muscular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTN gene located on chromosomal region 2q31.2. The age of onset is variable. This disease is characterized by slowly progressive weakness and atrophy of the anterior tibial muscles with decreased dorsiflexion. Sometimes it could be companied by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death. The prevalence is >9:100,000.250,600
TTPAAtaxia with vitamin E deficiencyNM_000370.3NM_000370.3:c.661C>T, NM_000370.3:c.744delA, NM_000370.3:c.575G>AAtaxia with vitamin E deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTPA gene located on chromosomal region 8q13. The age of onset is variable. This disease is characterized by progressive spino-cerebellar ataxia, loss of proprioception, areflexia, and is associated with a marked deficiency in vitamin E. The prevalence is 0.56:1,000,000-3.5:1,000,000.250,600
TULP1Leber congenital amaurosis type 15NM_003322.4NM_003322.4:c.1198C>T, NM_003322.4:c.1204G>TLeber congenital amaurosis 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TULP1 gene located on chromosomal region 6p21.31. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.600
TULP1Retinitis pigmentosa type 14NM_003322.4NM_003322.4:c.1259G>C, NM_003322.4:c.1318C>T, NM_003322.4:c.1471T>C, NM_003322.4:c.1511_1521delTGCAGTTCGGC, NM_003322.4:c.1376T>A, NM_003322.4:c.1444C>TRetinitis pigmentosa type 14 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TULP1 gene located on chromosomal region 6p21.31. The age of onset is early. This disease is characterized by night blindness often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1/4,000.600
TYROculocutaneous albinism type 1NM_000372.4NM_000372.4:c.1012_1013insC, NM_000372.4:c.1146C>A, NM_000372.4:c.1164delT, NM_000372.4:c.1177delG, NM_000372.4:c.1147G>A, NM_000372.4:c.115T>G, NM_000372.4:c.1255G>A, NM_000372.4:c.1265G>A, NM_000372.4:c.1209G>T, NM_000372.4:c.1217C>T, NM_000372.4:c.140G>A, NM_000372.4:c.1467dupT, NM_000372.4:c.1501dupC, NM_000372.4:c.164G>A, NM_000372.4:c.1A>G, NM_000372.4:c.230G>A, NM_000372.4:c.242C>T, NM_000372.4:c.265T>C, NM_000372.4:c.272G>A, NM_000372.4:c.286dupA, NM_000372.4:c.533G>A, NM_000372.4:c.1336G>A, NM_000372.4:c.1342G>A, NM_000372.4:c.646T>A, NM_000372.4:c.650G>A, NM_000372.4:c.823G>T, NM_000372.4:c.896G>A, NM_000372.4:c.1111A>G, NM_000372.4:c.1118C>A, NM_000372.4:c.325G>A, NM_000372.4:c.572delG, NM_000372.4:c.616G>AOculocutaneous albinism type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYR gene located on chromosomal region 11q14.2. The age of onset is early. This disease is characterized by white hair and skin, blue, fully translucent irises, nystagmus and misrouting of the optic nerves.250,600
TYRP1Oculocutaneous albinism type 3NM_000550.2NM_000550.2:c.107delT, NM_000550.2:c.1103delA, NM_000550.2:c.1057_1060delAACA, NM_000550.2:c.1067G>A, NM_000550.2:c.1557T>G, NM_000550.2:c.176C>G, NM_000550.2:c.497C>G, NM_000550.2:c.1120C>T, NM_000550.2:c.1369_1370insCAGAType 3 oculocutaneous albinism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYRP1 gene located on chromosomal region 9p23. The age of onset is early. This disease is characterized by rufous or brown albinism and occurring mainly in the African population. The prevalence is of 1/8,500 individuals in Africa.250,600
UBA1Spinal muscular atrophy type 2, X-linkedNM_003334.3NM_003334.3:c.1731C>TX-linked spinal muscular atrophy type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the UBA1 gene located on chromosomal region Xp11.23. The age of onset is infantile. This disease is characterized by congenital hypotonia and areflexia and evidence of degeneration and loss of anterior horn cells (i.e., lower motor neurons) in the spinal cord and brain stem. Often congenital contractures and/or fractures are present. Life span is shortened because of progressive ventilatory insufficiency resulting from chest muscle involvement.600
UBR1Johanson-Blizzard syndromeNM_174916.2NM_174916.2:c.869C>G, NM_174916.2:c.4254G>A, NM_174916.2:c.1281+1G>T, NM_174916.2:c.1537C>TJohanson-Blizzard syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UBR1 gene located on chromosomal region 15q15.2. The age of onset is early. This disease is characterized by congenital exocrine pancreatic insufficiency and aplasia/hypoplasia of alae nasi, together with a variety of other abnormalities including aplasia cutis, anorectal anomalies and failure to thrive. The prevalence is <1:1,000,000.600
UGT1A1Crigler-Najjar syndrome type 1NM_000463.2NM_000463.2:c.1021C>T, NM_000463.2:c.1070A>GCrigler-Najjar syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by severe neonatal unconjugated hyperbilirubinemia, persistent jaundice and bilirubin encephalopathy manifesting as hypotonia, deafness, oculomotor palsy and lethargy. Neurologic defects can occur, generally associated with intellectual and motor impairment.250,600
UGT1A1Crigler-Najjar syndrome type 2NM_000463.2NM_000463.2:c.1207C>T, NM_000463.2:c.674T>G, NM_000463.2:c.1130G>T, NM_000463.2:c.524T>A, NM_000463.2:c.44T>GCrigler-Najjar syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by unconjugated hyperbilirubinemia due to reduced and inducible activity of hepatic bilirubin glucuronosyltransferase with pigmented bile that contains bilirubin glucuronides, and generally do not present neurologic or intellectual impairment. Bilirubin encephalopathy may develop in later life when patients experience a superimposed infection or stress.250,600
UGT1A1Gilbert syndromeNM_000463.2NM_000463.2:c.1211T>C, NM_000463.2:c.1456T>GGilbert syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by jaundice due to unconjugated hyperbilirubinemia, resulting a partial deficiency in hepatic bilirubin glucuronosyltransferase activity.250,600
UQCRBMitochondrial complex III deficiency, nuclear type 3NM_006294.4NM_006294.4:c.306_309delAAAAMitochondrial complex III deficiency, nuclear type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UQCRB gene located on chromosomal region 8q22.1. The age of onset is infantile. This disease is characterized by a highly variable phenotype depending on which tissues are affected. Clinical features include mitochondrial encephalopathy, psychomotor retardation, ataxia, severe failure to thrive, liver dysfunction, renal tubulopathy, muscle weakness and exercise intolerance.600
UQCRQMitochondrial complex III deficiency, nuclear type 4NM_014402.4NM_014402.4:c.134C>TMitochondrial complex III deficiency, nuclear type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UQCRQ gene located on chromosomal region 5q31.1. The age of onset is infantile. This disease is characterized by severe psychomotor retardation and extrapyramidal signs. Neurologic features included dystonia, athetoid movements, ataxia, mild axial hypotonia, increased tone, hyperreflexia, and inability to walk unsupported.600
USH1CUsher syndrome type 1CNM_153676.3NM_153676.3:c.216G>A, NM_153676.3:c.2362G>A, NM_153676.3:c.2622_2623delCA, NM_153676.3:c.2688_2695dupAATTCACC, NM_153676.3:c.238_239insC, NM_153676.3:c.238delC, NM_153676.3:c.2547-1G>T, NM_153676.3:c.2695_2696insAATTCACC, NM_153676.3:c.388G>AUsher syndrome type 1C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1C gene located on chromosomal region 11p15.1. The age of onset is infantile. This disease is characterized by the association of sensorineural deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 3:100,000-4:100,000.250,600
USH1GUsher syndrome type 1GNM_173477.4NM_173477.4:c.186_187delCA, NM_173477.4:c.394_395insG, NM_173477.4:c.832_851delTCGGACGAGGACAGCGTCTC, NM_173477.4:c.649C>T, NM_173477.4:c.805C>TUsher syndrome type 1G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1G gene located on chromosomal region 17q25.1. The age of onset is infantile. This disease is characterized by the association of sensorineural deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 4.4:100,000.600
USH2ARetinitis pigmentosa type 39NM_206933.2NM_206933.2:c.10073G>A, NM_206933.2:c.2296T>C, NM_206933.2:c.14519T>C, NM_206933.2:c.7364G>A, NM_206933.2:c.12574C>T, NM_206933.2:c.2276G>TRetinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 39 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.250,600
USH2AUsher syndrome type 2ANM_206933.2NM_206933.2:c.10636G>A, NM_206933.2:c.10561T>C, NM_206933.2:c.15371delT, NM_206933.2:c.2167+5G>A, NM_206933.2:c.11864G>A, NM_206933.2:c.14803C>T, NM_206933.2:c.2898delG, NM_206933.2:c.3491_3492delCT, NM_206933.2:c.11549-5_11549-4insT, NM_206933.2:c.2299delG, NM_206933.2:c.5975A>G, NM_206933.2:c.6670G>T, NM_206933.2:c.6862G>T, NM_206933.2:c.5743_5744delAG, NM_206933.2:c.779T>G, NM_206933.2:c.820C>T, NM_206933.2:c.8981G>A, NM_206933.2:c.956G>A, NM_206933.2:c.9799T>C, NM_206933.2:c.15089C>A, NM_206933.2:c.2135delC, NM_206933.2:c.4338_4339delCT, NM_206933.2:c.5573-2A>G, NM_206933.2:c.920_923dupGCCA, NM_206933.2:c.13709delG, NM_206933.2:c.14926G>A, NM_206933.2:c.15520-1G>A, NM_206933.2:c.8431C>A, NM_206933.2:c.12234_12235delGA, NM_206933.2:c.14442C>AUsher syndrome type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. The age of onset is infantile. This disease is characterized by the association of sensorineural deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 3:100,000-4:100,000.250,600
VDRRickets, vitamin D-resistant, type 2ANM_001017535.1NM_001017535.1:c.137G>A, NM_001017535.1:c.149G>A, NM_001017535.1:c.885C>A, NM_001017535.1:c.88C>T, NM_001017535.1:c.239G>A, NM_001017535.1:c.821G>T, NM_001017535.1:c.88C>G, NM_001017535.1:c.915C>G, NM_001017535.1:c.985G>AVitamin D-dependent rickets type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VDR gene located on chromosomal region 12q13.11. The age of onset is early. This disease is characterized by hypocalcemia, severe rickets and in many cases alopecia. The prevalence is 1:10,000-5:10,000.600
VLDLRCerebellar ataxia, mental retardation, and dysequilibrium syndrome type 1NM_003383.3NM_003383.3:c.2339delT, NM_003383.3:c.2302_2303delGA, NM_003383.3:c.844C>T, NM_003383.3:c.769C>TCerebellar ataxia - intellectual deficit - dysequilibrium syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VLDLR gene located on chromosomal region 9p24.2. The age of onset is early. This disease is characterized by non-progressive congenital ataxia that is predominantly truncal and results in delayed ambulation, moderate-to-profound intellectual disability, dysarthria, strabismus, and seizures. The prevalence is 1:100,000-9:100,000.600
VPS13AChoreoacanthocytosisNM_033305.2NM_033305.2:c.622C>T, NM_033305.2:c.9109C>T, NM_033305.2:c.2898T>G, NM_033305.2:c.3091delG, NM_033305.2:c.9275+1G>TChorea-acanthocytosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VPS13A gene located on chromosomal region 9q21. The age of onset is adult. This disease is characterized by progressive neurological symptoms including movement disorders, psychiatric manifestations and cognitive disturbances.600
VPS33BArthrogryposis-renal dysfunction-cholestasis type 1NM_018668.4NM_018668.4:c.1246C>T, NM_018668.4:c.1312C>T, NM_018668.4:c.1498G>A, NM_018668.4:c.440_449delCTCTTGATGT, NM_018668.4:c.1594C>T, NM_018668.4:c.1480-1G>T, NM_018668.4:c.603+2T>AArthrogryposis - renal dysfunction – cholestasis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VPS33B gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by neurogenic arthrogryposis multiplex congenita, renal tubular dysfunction and neonatal cholestasis. The prevalence is <1:1,000,000.600
WASNeutropenia, severe congenital, X-linkedNM_000377.2NM_000377.2:c.881T>C, NM_000377.2:c.809T>C, NM_000377.2:c.814T>CX-linked severe congenital neutropenia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the WAS gene located on chromosomal region Xp11.23. The age of onset is early. This disease is characterized by recurrent major bacterial infections, severe congenital neutropenia, and monocytopenia. The prevalence is <1:1,000,000.600
WASThrombocytopaenia type 1NM_000377.2NM_000377.2:c.167C>T, NM_000377.2:c.173C>G, NM_000377.2:c.1442T>AThrombocytopaenia type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the WAS gene located on chromosomal region Xp11.23. The age of onset is early. Thrombocytopenia is defined by a decrease in the number of platelets in circulating blood, resulting in the potential for increased bleeding and decreased ability for clotting. The prevalence is <1:1,000,000.600
WASWiskott-Aldrich syndromeNM_000377.2NM_000377.2:c.134C>TWiskott-Aldrich síndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the WAS gene located on chromosomal region Xp11.23. The age of onset is infantile. This disease is characterized by microthrombocytopenia, eczema, infections and an increased risk for autoimmune manifestations and malignancies. The incidence is less than 1 in 100,000 live births and the prevalence is 1:1,000,000-10:1,000,000 men.600
WDR62Microcephaly primary, type 2, autosomal recessiveNM_001083961.1NM_001083961.1:c.1313G>A, NM_001083961.1:c.3514+1delG, NM_001083961.1:c.3574delA, NM_001083961.1:c.1408C>T, NM_001083961.1:c.193G>A, NM_001083961.1:c.702dupG, NM_001083961.1:c.671G>C, NM_001083961.1:c.557G>AAutosomal recessive primary microcephalyc type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WDR62 gene located on chromosomal region 19q13.12. The age of onset is early. This disease is characterized by reduced head circumference at birth without gross anomalies of brain architecture and variable degrees of intellectual impairment. The incidence is 1:1,000,000.600
WFS1Wolfram syndromeNM_006005.3NM_006005.3:c.1234_1237delGTCT, NM_006005.3:c.1511C>T, NM_006005.3:c.2168T>C, NM_006005.3:c.2171C>T, NM_006005.3:c.1944G>A, NM_006005.3:c.2084G>T, NM_006005.3:c.577A>C, NM_006005.3:c.676C>T, NM_006005.3:c.2327A>T, NM_006005.3:c.407_408insGGGCCGTCGCGAGGCT, NM_006005.3:c.2576G>A, NM_006005.3:c.2643_2644delCT, NM_006005.3:c.616C>T, NM_006005.3:c.1060_1062delTTC, NM_006005.3:c.400G>A, NM_006005.3:c.1943G>A, NM_006005.3:c.1230_1233delCTCTWolfram syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WFS1 gene located on chromosomal region 4p16.1. The age of onset is infantile. This disease is characterized by diabetes mellitus type I, diabetes insipidus, optical atrophy and neurological signs. The prevalence is 1:1,000,000-9:1,000,000.250,600
WNT10AHypohidrotic ectodermal dysplasia, autosomal recessiveNM_025216.2NM_025216.2:c.347T>C, NM_025216.2:c.383G>A, NM_025216.2:c.321C>AHypohidrotic ectodermal displasia, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by sparse hair (atrichosis or hypotrichosis), abnormal or missing teeth and the inability to sweat due to the absence of sweat glands. The prevalence is <1:1,000,000.250,600
WNT10AOdontoonychodermal dysplasiaNM_025216.2NM_025216.2:c.697G>TOdonto-onycho-dermal dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by hyperkeratosis and hyperhidrosis of the palms and soles, atrophic malar patches, hypodontia, conical teeth, onychodysplasia, and dry and sparse hair. The prevalence is <1:1,000,000.250,600
WNT7AFuhrmann syndromeNM_004625.3NM_004625.3:c.874C>TFuhrmann syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT7A gene located on chromosomal region 3p25.1. The age of onset is neonatal/infancy. This disease is characterized by bowing of the femora, aplasia or hypoplasia of the fibulae and poly-, oligo-, and syndactyly. Most of the patients also have a hypoplastic pelvis and hypoplasia of the fingers and fingernails. Some had congenital dislocation of the hip, absence or fusion of tarsal bones, absence of various metatarsals, and hypoplasia and aplasia of the toes. The prevalence is <1:1,000,000.600
WNT7AUlna and fibula, absence of, with sever limb deficiencyNM_004625.3NM_004625.3:c.325G>AAplasia/hypoplasia of limbs and pelvis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT7A gene located on chromosomal region 3p25.1. The age of onset is early. This disease is characterized by intercalary limb deficiencies (phocomelia sometimes combined with polydactyly, oligodactyly or ectrodactyly), absent or hypoplastic pelvic bones (including sacral agenesis or hypoplasia), skull defects (frequently a defect of the occipital bone with or without meningocele)600
XPAXeroderma pigmentosum Group ANM_000380.3NM_000380.3:c.323G>T, NM_000380.3:c.619C>T, NM_000380.3:c.727C>T, NM_000380.3:c.731A>G, NM_000380.3:c.348T>A, NM_000380.3:c.501delGXeroderma pigmentosum complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the gene XPA located on chromosomal region 9q22.33. The age of onset is variable. This disease is characterized by photosensitivity of skin with burning, freckling, and skin cancers. It is associated with a spectrum of mild to severe neurological anomalies (e.g. cognitive deterioration, dysarthria, balance disturbance, areflexia) and sometimes delay of growth and sexual development. The prevalence is 1:1,000,000.600
ZFYVE26Spastic paraplegia type 15, autosomal recessiveNM_015346.3NM_015346.3:c.3206G>A, NM_015346.3:c.3642_3643insCCACACTTAG, NM_015346.3:c.1477C>T, NM_015346.3:c.2887G>C, NM_015346.3:c.5422C>T, NM_015346.3:c.5485-1G>A, NM_015346.3:c.4312C>T, NM_015346.3:c.4936C>T, NM_015346.3:c.3182delT, NM_015346.3:c.2114_2115insCSpastic paraplegia type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZFYVE26 gene located on chromosomal region 14q24.1. The age of onset is infancy. This disease is characterized by progressive spasticity primarily affecting the lower limbs. It is a complex form of spastic paraplegia, associated with other neurologic dysfunction, including variable mental retardation, hearing and visual defects, and thin corpus callosum. The prevalence is <1 / 1,000,000.250,600
ZMPSTE24Mandibuloacral dysplasia with type B lipodystrophyNM_005857.4NM_005857.4:c.121C>T, NM_005857.4:c.1263dupT, NM_005857.4:c.1018T>C, NM_005857.4:c.955-1G>A, NM_005857.4:c.1349G>AMandibuloacral dysplasia with type B lipodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZMPSTE24 gene located on chromosomal region 1p34.2. The age of onset is early. This disease is characterized by postnatal growth retardation, craniofacial anomalies and skeletal malformations, such as mandibular and clavicular hypoplasia; mottled cutaneous pigmentation and generalized lipoatrophy.600
ZMPSTE24Restrictive dermopathy, lethalNM_005857.4NM_005857.4:c.1076_1077insT, NM_005857.4:c.54dupT, NM_005857.4:c.1085_1086insTLethal restrictive dermopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZMPSTE24 gene located on chromosomal region 1p34.2. The age of onset is early. This disease is characterized by the skin being drawn tightly over the face causing a narrow, pinched nose, small mouth, limited jaw mobility, and entropion. Ears are malformed, with the auricle attached to the skin of scalp. Most infants die after a few hours from pulmonary distress. The prevalence is <1:1,000,000.600
ZNF469Brittle cornea syndromeNM_001127464.1NM_001127464.1:c.6673delC, NM_001127464.1:c.11452_11453insC, NM_001127464.1:c.4174G>TBrittle cornea syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZNF469 gene located on chromosomal region 16q24.2. The age of onset is infantile. This disease is characterized by severe ocular manifestations due to extreme corneal thinning and fragility with rupture in the absence of significant trauma. BCS generally progresses to blindness. The prevalence is <1:1,000,000.600
GeneDiseaseTranscriptMutationsDisease.descriptionproducts
ABCA4Stargardt disease type 1; Cone-rod dystrophy type 3NM_000350.2NM_000350.2:c.6449G>A, NM_000350.2:c.6394G>T, NM_000350.2:c.6320G>A, NM_000350.2:c.6118C>T, NM_000350.2:c.6089G>A, NM_000350.2:c.5912T>G, NM_000350.2:c.5882G>A, NM_000350.2:c.5881G>A, NM_000350.2:c.5819T>C, NM_000350.2:c.5714+5G>A, NM_000350.2:c.5512delC, NM_000350.2:c.5461-10T>C, NM_000350.2:c.5338C>G, NM_000350.2:c.4793C>A, NM_000350.2:c.4469G>A, NM_000350.2:c.4457C>T, NM_000350.2:c.4429C>T, NM_000350.2:c.4139C>T, NM_000350.2:c.3970delG, NM_000350.2:c.3364G>A, NM_000350.2:c.3322C>T, NM_000350.2:c.3210_3211dupGT, NM_000350.2:c.3106G>A, NM_000350.2:c.3083C>T, NM_000350.2:c.2791G>A, NM_000350.2:c.2616_2617delCT, NM_000350.2:c.2588G>C, NM_000350.2:c.2300T>A, NM_000350.2:c.2160+1G>T, NM_000350.2:c.1964T>G, NM_000350.2:c.1938-1G>A, NM_000350.2:c.1848delA, NM_000350.2:c.1804C>T, NM_000350.2:c.1771delT, NM_000350.2:c.1755delA, NM_000350.2:c.1622T>C, NM_000350.2:c.1225delA, NM_000350.2:c.1222C>T, NM_000350.2:c.1018T>G, NM_000350.2:c.763C>T, NM_000350.2:c.634C>T, NM_000350.2:c.286A>G, NM_000350.2:c.67-2A>G, NM_000350.2:c.52C>TStargardt disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by progressive central vision loss, mild loss of color vision, delayed dark adaptation and macular atrophy with or without paramacular flecks and degeneration of the underlying retinal pigment ephitelium. The estimated prevalence is 1:8,000-10,000. Mutations in the ABCA4 gene account also for 30 to 60 percent of cases of cone-rod dystrophy that are inherited in an autosomal recessive pattern. The problems associated with this condition include a loss of visual sharpness (acuity), an increased sensitivity to light (photophobia), and impaired color vision. These vision problems worsen over time.600,25
ABCB7X-linked sideroblastic anemia and ataxia (XLSA/A)NM_004299.4NM_004299.4:c.1300G>A, NM_004299.4:c.1234G>C, NM_004299.4:c.1203T>GXLSA/A is caused by pathogenic variants in the ABCB7 gene located on chromosomal region Xq13.3. The age of onset is neonatal/infantile. XLSA/A is a rare condition characterized by a blood disorder called sideroblastic anemia and movement problems known as ataxia. This condition occurs only in males. People with X-linked sideroblastic anemia and ataxia have mature red blood cells that are smaller than normal (microcytic) and appear pale (hypochromic) because of the shortage of hemoglobin. This disorder also leads to an abnormal accumulation of iron in red blood cells but does not cause a potentially dangerous buildup of iron in the body. The anemia is typically mild and usually does not cause any symptoms. The prevalence is very rare, estimated at <1:1,000,000.600
ACAD9Mitochondrial complex I deficiency due to ACAD9NM_014049.4NM_014049.4:c.23delT, NM_014049.4:c.130T>A, NM_014049.4:c.359delT, NM_014049.4:c.453+1G>A, NM_014049.4:c.797G>A, NM_014049.4:c.976G>C, NM_014049.4:c.1240C>T, NM_014049.4:c.1249C>T, NM_014049.4:c.1594C>TMitochondrial complex I deficiency due to ACAD9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAD9 gene located on chromosomal region 3q21.3. The age of onset is neonatal/infantile. This disease is a multisystem disorder characterized by infantile onset of acute metabolic acidosis, hypertrophic cardiomyopathy, and muscle weakness associated with a deficiency of mitochondrial complex I activity in muscle, liver, and fibroblasts (summary by Haack et al., 2010).600,25
ACADMMedium-chain acyl-CoA dehydrogenase deficiencyNM_001286043.1NM_001286043.1:c.250C>T, NM_001286043.1:c.386-2A>G, NM_001286043.1:c.461C>T, NM_001286043.1:c.548_551delCTGA, NM_001286043.1:c.546G>A, NM_001286043.1:c.715C>T, NM_001286043.1:c.716G>A, NM_001286043.1:c.833C>T, NM_001286043.1:c.896A>G, NM_001286043.1:c.898G>A, NM_001286043.1:c.916_928delGCAATGGGAGCTT, NM_001286043.1:c.1083delG, NM_001286043.1:c.1084A>G, NM_001286043.1:c.1201_1204delTTAGMedium-chain acyl-CoA dehydrogenase (MCAD) deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADM gene located on chromosomal region 1p31. Inherited deficiency of MCAD is a condition that prevents the body from converting certain fats to energy, particularly during periods without food (fasting). Signs and symptoms of MCAD deficiency typically appear during infancy or early childhood and can include vomiting, lack of energy (lethargy), and low blood sugar (hypoglycemia). Individuals with MCAD deficiency are at risk of serious complications such as seizures, breathing difficulties, liver problems, brain damage, coma, and sudden death. The estimated prevalence is 1:4,900-1:27,000 in Caucasian populations and 1:14,600 in worldwide populations.600,25
ACADSShort-chain acyl-CoA dehydrogenase deficiencyNM_000017.3NM_000017.3:c.136C>T, NM_000017.3:c.319C>T, NM_000017.3:c.417G>C, NM_000017.3:c.529T>C, NM_000017.3:c.561_568delCAATGCCT, NM_000017.3:c.1095G>T, NM_000017.3:c.1147C>TShort-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADS gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by seizures, developmental delay, failure to grow with poor feeding, and usually muscle weakness and hypotonia. The prevalence is <1:50,000.600,25
ACADSBShort/branched-chain acyl-CoA dehydrogenase deficiencyNM_001609.3NM_001609.3:c.303+1G>A, NM_001609.3:c.443C>T, NM_001609.3:c.621G>A, NM_001609.3:c.763C>TShort/branched-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADSB gene located on chromosomal region 10q26.3. The age of onset is neonatal/infantile. This disease is characterized by muscle hypotonia, cerebral palsy, developmental delay, lethargy, hypoglycemia, and metabolic acidosis. The prevalence is <1:1,000,000.600,25
ACADVLVery long-chain acyl-CoA dehydrogenase deficiencyNM_001270447.1NM_001270447.1:c.347-1G>A, NM_001270447.1:c.367_368delCA, NM_001270447.1:c.412delG, NM_001270447.1:c.469C>T, NM_001270447.1:c.546+1G>C, NM_001270447.1:c.589G>A, NM_001270447.1:c.754C>T, NM_001270447.1:c.822-2A>C, NM_001270447.1:c.917T>C, NM_001270447.1:c.965_967delAGA, NM_001270447.1:c.1165C>T, NM_001270447.1:c.1166G>A, NM_001270447.1:c.1175T>C, NM_001270447.1:c.1210_1212delGAG, NM_001270447.1:c.1251+1G>A, NM_001270447.1:c.1426C>T, NM_001270447.1:c.1444dupC, NM_001270447.1:c.1458dupG, NM_001270447.1:c.1475G>A, NM_001270447.1:c.1537G>C, NM_001270447.1:c.1601+1G>A, NM_001270447.1:c.1906C>T, NM_001270447.1:c.1912C>T, NM_001270447.1:c.1951delCVery long-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADVL gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by cardiomyopathy, hypoketotic hypoglycemia, liver disease, exercise intolerance and rhabdomyolysis. The prevalence is 1:100,000-9:100,000.600,25
ACAT1Alpha-methylacetoacetic aciduriaNM_000019.3NM_000019.3:c.2T>A, NM_000019.3:c.412_419delCAAAGTCT, NM_000019.3:c.547G>A, NM_000019.3:c.622C>T, NM_000019.3:c.905delA, NM_000019.3:c.1035_1037delAGA, NM_000019.3:c.1083dupA, NM_000019.3:c.1136G>T, NM_000019.3:c.1138G>AAlpha-methylacetoacetic aciduria, also known as 3-ketothiolase deficiency, is an inborn error of isoleucine catabolism characterized by urinary excretion of 2-methyl-3-hydroxybutyric acid, 2-methylacetoacetic acid, tiglylglycine, and 2-butanone. This deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAT1 gene located on chromosomal region 11q22.3. The age of onset is neonatal/infantile. This disease is characterized by normal early development followed by a progressive loss of mental and motor skills. The prevalence is < 1:1,000,000.600
ACERenal tubular dysgenesisNM_000789.3NM_000789.3:c.798C>G, NM_000789.3:c.1319_1322delTGGA, NM_000789.3:c.1486C>T, NM_000789.3:c.1511delC, NM_000789.3:c.1587-2A>G, NM_000789.3:c.2371C>TRenal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and the most common cause are pathogenic variants in the ACE (chromosomal region 17q23.3). The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.600,25
ACOX1Peroxisomal acyl-CoA oxidase deficiencyNM_004035.6NM_004035.6:c.832A>G, NM_004035.6:c.591delG, NM_004035.6:c.532G>TPeroxisomal acyl-CoA oxidase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACOX1 gene located on chromosomal region 17q25.1. The age of onset is neonatal/infantile. This disease is characterized by hypotonia and seizures in the neonatal period and neurological regression in early infancy. The prevalence is < 1:1,000,000.600
ADAAdenosine deaminase deficiency / Severe combined immunodeficiency due to ADA deficiencyNM_000022.3NM_000022.3:c.986C>T, NM_000022.3:c.956_960delAAGAG, NM_000022.3:c.890C>A, NM_000022.3:c.872C>T, NM_000022.3:c.632G>A, NM_000022.3:c.320T>CAdenosine deaminase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADA gene located on chromosomal region 20q13.12. The age of onset is neonatal/infantile. This disease is characterized by profound lymphopenia and very low immunoglobulin levels of all isotypes resulting in severe and recurrent opportunistic infections. The annual incidence is 1:200,000-1:1,000,000. The prevalence is 1:100,000-9:100,000.600,25
ADAMTS2Ehlers-Danlos syndrome, dermatosparaxis typeNM_014244.4NM_014244.4:c.2384G>AEhlers-Danlos syndrome dermatosparaxis type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADAMTS2 gene located on chromosomal region 5q35.3. The age of onset is neonatal/infantile. This disease is characterized by extremely fragile tissues, hyperextensible skin and easy bruising. The prevalence is <1:1,000,000.600
ADAMTSL2Geleophysic dysplasia type 1NM_001145320.1NM_001145320.1:c.338G>A, NM_001145320.1:c.340G>A, NM_001145320.1:c.440C>T, NM_001145320.1:c.661C>TGeleophysic dysplasia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADAMTSL2 gene located on chromosomal region 9q34.2. The age of onset is infantile. This disease is characterized by extremely by short stature, prominent abnormalities in hands and feet, and a characteristic facial appearance. The prevalence is <1:1,000,000.600
ADGRV1Usher syndrome, type 2CNM_032119.3NM_032119.3:c.2258_2270delAAGTGCTGAAATC, NM_032119.3:c.2864C>A, NM_032119.3:c.5357_5358delAA, NM_032119.3:c.6275-1G>A, NM_032119.3:c.6312dupT, NM_032119.3:c.6901C>T, NM_032119.3:c.8713_8716dupAACA, NM_032119.3:c.8790delC, NM_032119.3:c.11377G>T, NM_032119.3:c.14973-1G>C, NM_032119.3:c.15196_15199dupCAAA, NM_032119.3:c.17668_17669delAT, NM_032119.3:c.18131A>GUsher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADGRV1 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32 respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000.600,25
AGAAspartylglucosaminuriaNM_000027.3NM_000027.3:c.904G>A, NM_000027.3:c.800dupT, NM_000027.3:c.755G>A, NM_000027.3:c.488G>C, NM_000027.3:c.302C>T, NM_000027.3:c.214T>CAspartylglucosaminuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGA gene located on chromosomal region 4q34.3. The age of onset is infantile. This disease is characterized by slowly developping mental retardation, beginning with clumsiness, late speech, and hyperkinesia, mild facial dysmorphism, and slight kyphoscoliosis.600
AGLGlycogen storage disease type 3NM_000028.2NM_000028.2:c.16C>T, NM_000028.2:c.18_19delGA, NM_000028.2:c.294-2A>T, NM_000028.2:c.1222C>T, NM_000028.2:c.1485delT, NM_000028.2:c.1783C>T, NM_000028.2:c.1999delC, NM_000028.2:c.2039G>A, NM_000028.2:c.2590C>T, NM_000028.2:c.3216_3217delGA, NM_000028.2:c.3980G>A, NM_000028.2:c.4260-12A>G, NM_000028.2:c.4260-1G>T, NM_000028.2:c.4342G>C, NM_000028.2:c.4456delT, NM_000028.2:c.4529dupAGlycogen storage disease (GSD) type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGL gene located on chromosomal region 1p21.2. The age of onset is infantile. This metabolic disorder is caused by deficiency of the glycogen debrancher enzyme and is associated with an accumulation of abnormal glycogen with short outer chains. Most patients are enzyme-deficient in both liver and muscle (IIIa), but about 15% are enzyme-deficient in liver only (IIIb) (Shen et al., 1996). These subtypes have been explained by differences in tissue expression of the deficient enzyme (Endo et al., 2006). In rare cases, selective loss of only 1 of the 2 debranching activities, glucosidase or transferase, results in type IIIc or IIId, respectively (Van Hoof and Hers, 1967; Ding et al., 1990). Clinically, patients with GSD type 3 present in infancy or early childhood with hepatomegaly, hypoglycemia, and growth retardation. Muscle weakness in those with IIIa is minimal in childhood but can become more severe in adults; some patients develop cardiomyopathy (Shen et al., 1996). 600,25
AGPSRhizomelic chondrodysplasia punctata, type 3NM_003659.3NM_003659.3:c.926C>T, NM_003659.3:c.1256G>A, NM_003659.3:c.1406T>C, NM_003659.3:c.1703C>TRhizomelic chondrodysplasia punctata type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGPS gene located on chromosomal region 2q31.2. The age of onset is neonatal/infantile. This disease is characterized by shortness of the femur and humerus, vertebral disorders, cataract, cutaneous lesions and severe intellectual deficit. The prevalence is 1:100,000-9:100,000.600
AGTRenal tubular dysgenesisNM_000029.3NM_000029.3:c.1290dupT, NM_000029.3:c.1290delT, NM_000029.3:c.1124G>A, NM_000029.3:c.604C>TRenal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.600
AGTR1Renal tubular dysgenesisNM_004835.4NM_004835.4:c.215dupT, NM_004835.4:c.259dupG, NM_004835.4:c.481delC, NM_004835.4:c.481C>TRenal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.600
AGXTHyperoxaluria, primary, type 1NM_000030.2NM_000030.2:c.33dupC, NM_000030.2:c.121G>A, NM_000030.2:c.166-2A>G, NM_000030.2:c.245G>A, NM_000030.2:c.248A>G, NM_000030.2:c.322T>C, NM_000030.2:c.454T>A, NM_000030.2:c.466G>A, NM_000030.2:c.508G>A, NM_000030.2:c.560C>T, NM_000030.2:c.613T>C, NM_000030.2:c.697C>T, NM_000030.2:c.698G>A, NM_000030.2:c.731T>C, NM_000030.2:c.738G>APrimary hyperoxaluria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGXT gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by variable clinical presentation, ranging from occasional symptomatic nephrolithiasis to nephrocalcinosis and end-stage renal disease with systemic involvement. The prevalence is 1:1,000,000-9:1,000,000.600,25
AHI1Joubert syndrome type 3NM_001134830.1NM_001134830.1:c.3263_3264delGG, NM_001134830.1:c.2295dupA, NM_001134830.1:c.2168G>A, NM_001134830.1:c.1484G>A, NM_001134830.1:c.1303C>T, NM_001134830.1:c.1052G>T, NM_001134830.1:c.1051C>T, NM_001134830.1:c.985C>TJoubert syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AHI1 gene located on chromosomal region 6q23.3. The age of onset is variable. This disease is characterized by the neurological features of Joubert syndrome (neonatal hypotonia, developmental delay, mild to severe intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia and primary position nystagmus) associated with retinal dystrophy.600,25
AIPL1Leber congenital amaurosis type 4NM_014336.4NM_014336.4:c.1053_1064delTGCAGAGCCACC, NM_014336.4:c.834G>A, NM_014336.4:c.715T>C, NM_014336.4:c.589G>CLeber congenital amaurosis type 4 (LCA4) is a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus. Mutations in the AIPL1 gene may cause approximately 20% of recessive LCA. Other conditions caused by pathogenic variants in the AIPL1 gene are cone rod dystrophy and the less agressive form, juvenile retinitis pigmentosa. Cone-rod dystropy is characterized by decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness.600,25
ALAS2X-linked sideroblastic anemia, type 1 (XLSA or SIDBA1)NM_000032.4NM_000032.4:c.1706_1709delAGTG, NM_000032.4:c.1699_1700delAT, NM_000032.4:c.1354C>TX-linked sideroblastic anemia type 1 is caused by pathogenic variants in the ALAS2 gene, located on chromosomal region Xp11.21. This disease is characterized by clinical features of anemia and/or iron overload such as pallor, fatigue, weakness, and more rarely breathlessness, mild splenomegaly, cardiac problems, abnormal liver function, hyperglycemia, glucose intolerance and skin hyperpigmentation. The age of clinical onset of the disorder can vary from in utero to the ninth decade. Whereas males are preferentially affected, females may present with clinically severe anemia. More commonly, female carriers of the disease have an increased red blood cell distribution width and sometimes erythrocyte dimorphism.600
ALDH4A1Hyperprolinemia, type 2NM_003748.3NM_003748.3:c.1055C>THyperprolinemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDH4A1 gene located on chromosomal region 1p36. The age of onset is variable. This disease is characterized by seizures, intellectual deficit and mild developmental delay.600
ALDH5A1Succinic semialdehyde dehydrogenase deficiencyNM_170740.1NM_170740.1:c.612G>A, NM_170740.1:c.842G>A, NM_170740.1:c.1265G>A, NM_170740.1:c.1273C>T, NM_170740.1:c.1579C>TSuccinic semialdehyde dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDH451 gene located on chromosomal region 6p22. The age of onset is infantile. This disease is characterized by psychomotor retardation, delayed speech development, hypotonia and ataxia. It is a rare disease with around 350 cases reported.600
ALDOAGlycogen storage disease type 12NM_001243177.1NM_001243177.1:c.548A>G, NM_001243177.1:c.781G>AGlycogen storage disease type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOA gene located on chromosomal region 16p11.2. The age of onset is neonatal/infantile. This disease is characterized by myopathy with exercise intolerance and rhabdomyolysis associated with hemolytic anaemia.ﾠ600
ALDOBFructose intolerance, hereditaryNM_000035.3NM_000035.3:c.1067C>A, NM_000035.3:c.1013C>T, NM_000035.3:c.1005C>G, NM_000035.3:c.720C>A, NM_000035.3:c.612T>A, NM_000035.3:c.524C>A, NM_000035.3:c.448G>C, NM_000035.3:c.442T>C, NM_000035.3:c.360_363delCAAA, NM_000035.3:c.178C>T, NM_000035.3:c.113-1_115delGGTA, NM_000035.3:c.10C>T, NM_000035.3:c.2T>CHereditary fructose intolerance follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOB gene located on chromosomal region 9q21.3-q22.2. The age of onset is neonatal/infantile. This disease is characterized by severe abdominal pain, vomiting, and hypoglycemia following ingestion of fructose or other sugars metabolised through fructose-1-phosphate. The prevalence is 1:100,000-9:100,000.600,25
ALG1Congenital disorder of glycosylation, type 1kNM_019109.4NM_019109.4:c.434G>A, NM_019109.4:c.450C>G, NM_019109.4:c.773C>T, NM_019109.4:c.1079C>T, NM_019109.4:c.1129A>G, NM_019109.4:c.1187+1G>ACongenital disorder of glycosylation type 1k follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG1 gene located on chromosomal region 16p13.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay, seizures, microcephaly and coagulation anomalies. The prevalence is <1:1,000,000.600
ALG6Congenital disorder of glycosylation, type 1cNM_013339.3NM_013339.3:c.316C>T, NM_013339.3:c.897_899delAAT, NM_013339.3:c.998C>T, NM_013339.3:c.1432T>CCongenital disorder of glycosylation type 1c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG6 gene located on chromosomal region 1p31.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay and muscular hypotonia, and possible coagulation anomalies, hormonal abnormalities and seizures. The prevalence is <1:1,000,000.600,25
ALMS1Alstr�m syndromeNM_015120.4NM_015120.4:c.2323C>T, NM_015120.4:c.4246delC, NM_015120.4:c.5584C>T, NM_015120.4:c.8383C>T, NM_015120.4:c.9614_9618delCAGAA, NM_015120.4:c.11443C>T, NM_015120.4:c.11453dupA, NM_015120.4:c.11612_11613delCT, NM_015120.4:c.12439C>T, NM_015120.4:c.12445C>TAlstr�m syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALMS1 gene located on chromosomal region 2p13.1. The age of onset is neonatal/infantile. This disease is characterized by cone-rod dystrophy, hearing loss, obesity, insulin resistance and hyperinsulinemia, type 2 diabetes mellitus, dilated cardiomyopathy and progressive hepatic and renal dysfunction. The prevalence is 1:10,000-1:1,000,000.600,25
ALPLHypophosphatasia, childhood/infantileNM_000478.5NM_000478.5:c.98C>T, NM_000478.5:c.211C>T, NM_000478.5:c.212G>C, NM_000478.5:c.323C>T, NM_000478.5:c.346G>A, NM_000478.5:c.407G>A, NM_000478.5:c.526G>A, NM_000478.5:c.535G>A, NM_000478.5:c.571G>A, NM_000478.5:c.620A>C, NM_000478.5:c.814C>T, NM_000478.5:c.881A>C, NM_000478.5:c.892G>A, NM_000478.5:c.1001G>A, NM_000478.5:c.1133A>T, NM_000478.5:c.1250A>G, NM_000478.5:c.1306T>C, NM_000478.5:c.1366G>AChildhood-onset hypophosphatasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALPL gene located on chromosomal region 1p36.12. The age of onset is infantile. This inborn error of metabolism is characterized clinically by defective bone mineralization ranging from stillbirth without mineralized bone to pathologic fractures of the lower extremities in later adulthood; biochemically is characterized by deficient activity of the tissue-nonspecific isoenzyme of alkaline phosphatase.600
AMTGlycine encephalopathyNM_000481.3NM_000481.3:c.959G>A, NM_000481.3:c.826G>C, NM_000481.3:c.806G>A, NM_000481.3:c.574C>T, NM_000481.3:c.259-1G>C, NM_000481.3:c.125A>GGlycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMT and GLDC genes located on chromosomal regions 3p21.31 and 9p24.1 respectively. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000.600
ANO5Limb-girdle muscular dystrophy type 12 (LGMDR12; formerly LGMD2L)NM_213599.2NM_213599.2:c.172C>T, NM_213599.2:c.191dupA, NM_213599.2:c.206_207delAT, NM_213599.2:c.692G>T, NM_213599.2:c.1210C>T, NM_213599.2:c.1295C>G, NM_213599.2:c.1407+5G>A, NM_213599.2:c.1627dupA, NM_213599.2:c.1733T>C, NM_213599.2:c.1887delA, NM_213599.2:c.1898+1G>A, NM_213599.2:c.1914G>ALimb-girdle muscular dystrophy type 12 (LGMDR12, formerly LGMD2L) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ANO5 gene located on chromosomal region 11p14.3. This disease is characterized by weakness and wasting restricted to the limb musculature. Most often is characterized by an adult onset (but ranging from 11 to 51 years) of mainly proximal lower limb weakness, with difficulties standing on tiptoes being one of the initial signs. Proximal upper limb and distal lower limb weakness is also common, as well as atrophy of the quadriceps (most commonly), biceps brachii, and lower leg muscles. Calf hypertrophy has also been reported in some cases. LGMDR12 progresses slowly, with most patients remaining ambulatory until late adulthood. The estimated prevalence is <1:1,000,000.600,25
APTXAtaxia, early-onset, with oculomotor apraxia and hypoalbuminemiaNM_001195248.1NM_001195248.1:c.917-1G>A, NM_001195248.1:c.879G>A, NM_001195248.1:c.830T>G, NM_001195248.1:c.659C>T, NM_001195248.1:c.362delC, NM_001195248.1:c.209delT, NM_001195248.1:c.176-2A>G, NM_001195248.1:c.166C>TAtaxia, early-onset, with oculomotor apraxia and hipoalbuminemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the APTX gene located on chromosomal region 9p13.1. Ataxia-oculomotor apraxia syndrome is an early-onset autosomal recessive, progressive, cerebellar ataxia with peripheral axonal neuropathy, oculomotor apraxia (defined as the limitation of ocular movements on command), and hypoalbuminemia. The prevalence is unknown.600,25
ARAndrogen insensitivity syndrome, completeNM_000044.3NM_000044.3:c.340C>T, NM_000044.3:c.1771A>T, NM_000044.3:c.2323C>T, NM_000044.3:c.2391G>A, NM_000044.3:c.2395C>G, NM_000044.3:c.2567G>A, NM_000044.3:c.2650A>TThe complete androgen insensitivity syndrome (CAIS) follows an X-linked pattern of inheritance and is caused by pathogenic variants in the AR gene located on chromosomal region Xq12. Affected males have female external genitalia, female breast development, blind vagina, absent uterus and female adnexa, and abdominal or inguinal testes, despite a normal male 46,XY karyotype. There is unresponsiveness to age-appropriate levels of androgens. There is also a partial androgen insensitivity syndrome (PAIS; OMIM 312300) caused by mutations in the AR gene, called Reifenstein syndrome, which results in hypospadias and micropenis with gynecomastia. Note: A specific type of mutation in the AR gene (a CAG repeat expansion) also cause a rare condition known as Spinal and bulbar muscular atrophy or Kennedy disease; this mutation is not tested by this carrier test. 600,25
ARG1ArgininemiaNM_001244438.1NM_001244438.1:c.32T>C, NM_001244438.1:c.61C>T, NM_001244438.1:c.389G>A, NM_001244438.1:c.437G>T, NM_001244438.1:c.727G>C, NM_001244438.1:c.895C>TArgininemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARG1 gene located on chromosomal region 6q23. The age of onset is neonatal/infantile. This disease is characterized by variable degrees of hyperammonemia, developing from about 3 years of age, and leading to progressive loss of developmental milestones and spasticity in the absence of treatment. The prevalence is 1:350,000-1:1,000,000.600
ARL13BJoubert syndrome type 8NM_001174150.1NM_001174150.1:c.246G>A, NM_001174150.1:c.598C>T, NM_001174150.1:c.1252C>TJoubert syndrome type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL13B gene located on chromosomal region 3q11.1. The age of onset is neonatal/infantile. This disease is characterized by congenital malformation of the brainstem and agenesis or hypoplasia of the cerebellar vermis leading to an abnormal respiratory pattern, nystagmus, hypotonia, ataxia and delay in achieving motor milestones. The prevalence is 1/80,000 to 1/100,000.600
ARL6Bardet-Biedl syndrome type 3NM_001323513.1NM_001323513.1:c.4G>T, NM_001323513.1:c.92C>G, NM_001323513.1:c.92C>T, NM_001323513.1:c.266C>T, NM_001323513.1:c.281T>C, NM_001323513.1:c.364C>TBardet-Biedl syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL6 gene located on chromosomal region 3q11.2. The age of onset is early. A syndrome characterized by usually severe pigmentary retinopathy, early-onset obesity, polydactyly, hypogenitalism, renal malformation and mental retardation. Secondary features include diabetes mellitus, hypertension and congenital heart disease.600
ARSAMetachromatic leukodystrophyNM_000487.5NM_000487.5:c.1408_1418delGCAGCTGTGAC, NM_000487.5:c.1401_1411delGTTAGACGCAG, NM_000487.5:c.1283C>T, NM_000487.5:c.1241delC, NM_000487.5:c.1232C>T, NM_000487.5:c.1210+1G>A, NM_000487.5:c.1175G>A, NM_000487.5:c.1174C>T, NM_000487.5:c.1150G>A, NM_000487.5:c.1125_1126delCT, NM_000487.5:c.1108-2A>G, NM_000487.5:c.991G>T, NM_000487.5:c.986C>T, NM_000487.5:c.979G>A, NM_000487.5:c.938G>A, NM_000487.5:c.937C>T, NM_000487.5:c.931G>A, NM_000487.5:c.899T>C, NM_000487.5:c.883G>A, NM_000487.5:c.869G>A, NM_000487.5:c.854+1G>A, NM_000487.5:c.827C>T, NM_000487.5:c.763G>A, NM_000487.5:c.739G>A, NM_000487.5:c.737G>A, NM_000487.5:c.641C>T, NM_000487.5:c.583delT, NM_000487.5:c.582delC, NM_000487.5:c.542dupT, NM_000487.5:c.542T>G, NM_000487.5:c.465+1G>A, NM_000487.5:c.346C>T, NM_000487.5:c.302G>A, NM_000487.5:c.293C>T, NM_000487.5:c.257G>A, NM_000487.5:c.195delC, NM_000487.5:c.34delGMetachromatic leukodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSA gene located on chromosomal region 22q13.33. The age of onset is variable. This disease is characterized by hypotonia, walking difficulties, optic atrophy and motor regression preceding mental impairment in the late infantile form, arrested intellectual development, followed by motor regression, epileptic seizures and ataxia in the juvenile form, and motor or psychiatric disorders, but with slow progression in the adult form. The incidence is 0.5:5,000-1:50,000ﾠand the prevalence is 1:10,000 -5/10,000.600,25
ARSBMucopolysaccharidosis type 6 (Maroteaux-Lamy)NM_000046.3NM_000046.3:c.1438dupG, NM_000046.3:c.1366C>T, NM_000046.3:c.1214G>A, NM_000046.3:c.1178A>C, NM_000046.3:c.1161dupC, NM_000046.3:c.1143-1G>C, NM_000046.3:c.1143-8T>G, NM_000046.3:c.979C>T, NM_000046.3:c.971G>T, NM_000046.3:c.944G>A, NM_000046.3:c.937C>G, NM_000046.3:c.921delA, NM_000046.3:c.753C>G, NM_000046.3:c.629A>G, NM_000046.3:c.589C>T, NM_000046.3:c.571C>T, NM_000046.3:c.427delG, NM_000046.3:c.349T>CMucopolysaccharidosis type 6 (Maroteaux-Lamy) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSB gene located on chromosomal region 5q14.1. The age of onset is infantile. This lysosomal storage disorder resulting from a deficiency of arylsulfatase B is characterized by educed pulmonary function, hepatosplenomegaly, hearing loss, sleep apnea, corneal clouding, carpal tunnel disease and occasionally central nervous system findings may include cervical cord compression caused by cervical spinal instability, meningeal thickening and/or bony stenosis, communicating hydrocephalus, optic nerve atrophy and blindness. The prevalence is 1:250,000-1:600,000 newborns.600,25
ARSEChondrodysplasia punctata, X-linked recessiveNM_001282628.1NM_001282628.1:c.1807C>T, NM_001282628.1:c.1517C>T, NM_001282628.1:c.1504delG, NM_001282628.1:c.485G>T, NM_001282628.1:c.194T>G, NM_001282628.1:c.99-1G>AX-linked chondrodysplasia punctata follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARSE gene located on chromosomal region Xp22.33. The age of onset is neonatal. Thisﾠis a disorder of cartilage and bone development that occurs almost exclusively in males. Include short stature and unusually short fingertips and ends of the toes. This condition is also associated with distinctive facial features, particularly a flattened-appearing nose with crescent-shaped nostrils and a flat nasal bridge. People with X-linked chondrodysplasia punctata 1 typically have normal intelligence and a normal life expectancy. However, some affected individuals have had serious or life-threatening complications including abnormal thickening (stenosis) of the cartilage that makes up the airways, which restricts breathing. Also, abnormalities of spinal bones in the neck can lead to pinching (compression) of the spinal cord, which can cause pain, numbness, and weakness. Other, less common features of X-linked chondrodysplasia punctata 1 include delayed development, hearing loss, vision abnormalities, and heart defects. The prevalence is 1:500,000.600,25
ARXEpileptic encephalopathy, early infantile, type 1; ARX-related developmental disordersNM_139058.2NM_139058.2:c.1058C>T, NM_139058.2:c.980_983delAACAEarly infantile epileptic encephalopathy type 1 (EIEE1) follows an X-linked recessive pattern of inheritance and is caused by pathogenic variants in the ARX gene located on chromosomal region Xp21.3. The age of onset is early. This severe disease is characterized by the onset of tonic spasms within the first 3 months of life leading to psychomotor impairment and death. Particularly,it is characterized by frequent tonic seizures or spasms beginning in infancy with a specific EEG finding of suppression-burst patterns, with high-voltage bursts alternating with almost flat suppression phases. Approximately 75% of EIEE patients progress to 'West syndrome,' which is characterized by tonic spasms with clustering, arrest of psychomotor development, and hypsarrhythmia on EEG (Kato et al., 2007). EIEE1 is part of a phenotypic spectrum of disorders caused by mutation in the ARX gene comprising a nearly continuous series of developmental disorders ranging from lissencephaly (LISX2; 300215) to Proud syndrome (300004) to infantile spasms without brain malformations (EIEE1) to syndromic (Partington syndrome; 309510) and nonsyndromic (Mental retardation, X-linked type 29; 300419) mental retardation. Although males with ARX mutations are often more severely affected, female mutation carriers may also be affected (Kato et al., 2004; Wallerstein et al., 2008). The prevalence is <1:1,000,000. 600
ASLArgininosuccinic aciduriaNM_000048.3NM_000048.3:c.35G>A, NM_000048.3:c.337C>T, NM_000048.3:c.346C>T, NM_000048.3:c.446+1G>A, NM_000048.3:c.525-2A>T, NM_000048.3:c.532G>A, NM_000048.3:c.539T>G, NM_000048.3:c.544C>T, NM_000048.3:c.578G>A, NM_000048.3:c.602+1G>A, NM_000048.3:c.857A>G, NM_000048.3:c.1045_1057delGTCATCTCTACGC, NM_000048.3:c.1060C>T, NM_000048.3:c.1135C>T, NM_000048.3:c.1144-2A>G, NM_000048.3:c.1153C>T, NM_000048.3:c.1255_1256delCT, NM_000048.3:c.1369dupGArgininosuccinic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASL gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by severe hyperammonemic coma, hypotonia, growth failure, anorexia and chronic vomiting or behavioral disorders during childhood, and hyperammonemic coma or behavioral disorders that simulate psychiatric disorders later in life. The prevalence is 1:70,000 newborns.600,25
ASPACanavan diseaseNM_000049.2NM_000049.2:c.212G>A, NM_000049.2:c.433-2A>G, NM_000049.2:c.654C>A, NM_000049.2:c.693C>A, NM_000049.2:c.854A>C, NM_000049.2:c.914C>ACanavan disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPA gene located on chromosomal region 17p13.3. The age of onset is neonatal/infantile. This disease is characterized by a variable spectrum between severe forms with leukodystrophy, macrocephaly and severe developmental delay, and a very rare mild/juvenile form characterized by mild developmental delay. The prevalence is 1:6,400- 1:13,500 in Askenazis Jewis.600,25
ASPMPrimary microcephaly type 5, autosomal recessiveNM_018136.4NM_018136.4:c.10059C>A, NM_018136.4:c.9789T>A, NM_018136.4:c.9754delA, NM_018136.4:c.9747_9748delCT, NM_018136.4:c.9730C>T, NM_018136.4:c.9697C>T, NM_018136.4:c.9685delA, NM_018136.4:c.9677dupG, NM_018136.4:c.9557C>G, NM_018136.4:c.9492T>G, NM_018136.4:c.9319C>T, NM_018136.4:c.9238A>T, NM_018136.4:c.9190C>T, NM_018136.4:c.9178C>T, NM_018136.4:c.9159delA, NM_018136.4:c.9115_9118dupCATT, NM_018136.4:c.8844delC, NM_018136.4:c.8711_8712delAA, NM_018136.4:c.8668C>T, NM_018136.4:c.8508_8509delGA, NM_018136.4:c.8378delT, NM_018136.4:c.8230dupA, NM_018136.4:c.8131_8132delAA, NM_018136.4:c.7894C>T, NM_018136.4:c.7860_7861delGA, NM_018136.4:c.7782_7783delGA, NM_018136.4:c.7761T>G, NM_018136.4:c.7491_7495delTATTA, NM_018136.4:c.6732delA, NM_018136.4:c.6337_6338delAT, NM_018136.4:c.6232C>T, NM_018136.4:c.6189T>G, NM_018136.4:c.6073delG, NM_018136.4:c.5439_5440delAG, NM_018136.4:c.5149delA, NM_018136.4:c.5136C>A, NM_018136.4:c.4858_4859delAT, NM_018136.4:c.4795C>T, NM_018136.4:c.4583delA, NM_018136.4:c.4195dupA, NM_018136.4:c.3979C>T, NM_018136.4:c.3978G>A, NM_018136.4:c.3811C>T, NM_018136.4:c.3796G>T, NM_018136.4:c.3710C>G, NM_018136.4:c.3663delG, NM_018136.4:c.3527C>G, NM_018136.4:c.3477_3481delCGCTA, NM_018136.4:c.3188T>G, NM_018136.4:c.3082G>A, NM_018136.4:c.3055C>T, NM_018136.4:c.2967G>A, NM_018136.4:c.2389C>T, NM_018136.4:c.1990C>T, NM_018136.4:c.1959_1962delCAAA, NM_018136.4:c.1729_1730delAG, NM_018136.4:c.1590delA, NM_018136.4:c.1406_1413delATCCTAAA, NM_018136.4:c.1366G>T, NM_018136.4:c.1260_1266delTCAAGTC, NM_018136.4:c.1179delT, NM_018136.4:c.1154_1155delAG, NM_018136.4:c.1002delA, NM_018136.4:c.719_720delCT, NM_018136.4:c.577C>T, NM_018136.4:c.349C>TPrimary autosomal recessive microcephaly type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPM gene located on chromosomal region 1q31. The age of onset is neonatal/infantile. This disease is characterized by a reduction in head circumference at birth, mild to moderate non-progressive intellectual impairment and delay in early motor milestones, speech delay and hyperactive behavior are common.ﾠThe annual incidence is 1:1,000,000.600,25
ASS1Citrullinemia type 1NM_000050.4NM_000050.4:c.40G>A, NM_000050.4:c.256C>T, NM_000050.4:c.257G>A, NM_000050.4:c.349G>A, NM_000050.4:c.421-2A>G, NM_000050.4:c.470G>A, NM_000050.4:c.496-2A>G, NM_000050.4:c.535T>C, NM_000050.4:c.539G>A, NM_000050.4:c.571G>A, NM_000050.4:c.787G>A, NM_000050.4:c.793C>T, NM_000050.4:c.794G>A, NM_000050.4:c.805G>A, NM_000050.4:c.814C>T, NM_000050.4:c.835C>T, NM_000050.4:c.836G>A, NM_000050.4:c.910C>T, NM_000050.4:c.919C>T, NM_000050.4:c.970G>A, NM_000050.4:c.970+5G>A, NM_000050.4:c.1085G>T, NM_000050.4:c.1087C>T, NM_000050.4:c.1088G>A, NM_000050.4:c.1168G>A, NM_000050.4:c.1194-1G>CCitrullinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASS1 gene located on chromosomal region 9q34.1. The age of onset is variable. This disease is characterized by hyperammonemia, progressive lethargy, poor feeding and vomiting in the neonatal form and by variable hyperammonemia in the later-onset form. The prevalence is 1:100,000-9:100,000.600,25
ATICAICA-ribosiduria due to ATIC deficiencyNM_004044.6NM_004044.6:c.1277A>GAICA-ribosiduria due to ATIC deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATIC gene located on chromosomal region 2q35. The age of onset is neonatal/infantile. This disease is characterized by profound intellectual deficit, epilepsy, dysmorphic features of the knees, elbows, and shoulders and congenital blindness. The prevalence is <1:1,000,000.600,25
ATP7AMenkes diseaseNM_000052.6NM_000052.6:c.1639C>T, NM_000052.6:c.1974_1977dupGTTT, NM_000052.6:c.2938C>T, NM_000052.6:c.2981C>T, NM_000052.6:c.3257_3258delAC, NM_000052.6:c.3294+2T>G, NM_000052.6:c.3911A>G, NM_000052.6:c.3915_3921delCTCCCCAMenkes disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ATP7A gene located on chromosomal region Xq21.1. The age of onset is neonatal/infantile. This disease is characterized by progressive neurodegeneration and marked connective tissue anomalies as well as typical sparse abnormal steely hair. The birth incidence is 1:300,000 in Europe, 1:360,000 in Japan and 1:50,000-1:100,000 in Australia, and the prevalence is 1:100,000 newborns. Mutations in the ATP7A can also cause Occipital horn syndrome, which is considered a mild form of Menkes syndrome.600
ATP7BWilson diseaseNM_000053.3NM_000053.3:c.4088C>T, NM_000053.3:c.4058G>A, NM_000053.3:c.3990_3993delTTAT, NM_000053.3:c.3955C>T, NM_000053.3:c.3809A>G, NM_000053.3:c.3796G>A, NM_000053.3:c.3694A>C, NM_000053.3:c.3359T>A, NM_000053.3:c.3207C>A, NM_000053.3:c.3083delA, NM_000053.3:c.2975C>T, NM_000053.3:c.2972C>T, NM_000053.3:c.2930C>T, NM_000053.3:c.2906G>A, NM_000053.3:c.2807T>A, NM_000053.3:c.2804C>T, NM_000053.3:c.2795C>A, NM_000053.3:c.2755C>T, NM_000053.3:c.2755C>G, NM_000053.3:c.2621C>T, NM_000053.3:c.2605G>A, NM_000053.3:c.2532delA, NM_000053.3:c.2356-2A>G, NM_000053.3:c.2305A>G, NM_000053.3:c.2297C>G, NM_000053.3:c.2123T>C, NM_000053.3:c.2071G>A, NM_000053.3:c.1934T>G, NM_000053.3:c.1846C>T, NM_000053.3:c.1745_1746delTA, NM_000053.3:c.1512dupT, NM_000053.3:c.1145_1151delCCCAACT, NM_000053.3:c.915T>A, NM_000053.3:c.562C>T, NM_000053.3:c.19_20delCAWilson disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATP7B gene located on chromosomal region 13q14.3. The age of onset is infantile. This disease is characterized by the toxic accumulation of copper, mainly in the liver and central nervous system, and symptomatic patients may present with hepatic, neurologic or psychiatric forms. The birth incidence is 1:30,000-1:100,000 in France and The prevalence is 1:10,000-1:30,000.600,25
ATRSeckel syndrome type 1NM_001184.3NM_001184.3:c.6488delT, NM_001184.3:c.6037dupA, NM_001184.3:c.5645delA, NM_001184.3:c.5635G>T, NM_001184.3:c.2341+1G>A, NM_001184.3:c.975_976delCTSeckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATR gene located on chromosomal region 3q23. The age of onset is neonatal/infantile. This disease is characterized by a proportionate dwarfism of prenatal onset, a severe microcephaly with a bird-headed like appearance and mental retardation.ﾠThe prevalence is <1:1,000,000.600,25
AUH3-methylglutaconic aciduria, type 1NM_001698.2NM_001698.2:c.991A>T, NM_001698.2:c.943-2A>G, NM_001698.2:c.895-1G>A, NM_001698.2:c.656-2A>G, NM_001698.2:c.650G>A, NM_001698.2:c.589C>T, NM_001698.2:c.559G>A, NM_001698.2:c.471delT3-Methylglutaconic aciduria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AUH gene located on chromosomal region 9q22.31. The age of onset is neonatal/infantile. This disease is characterized by a variable clinical phenotype ranging from mildly delayed speech to psychomotor retardation, coma, failure to thrive, metabolic acidosis and dystonia.ﾠThe prevalence is <1:1,000,000.600
B4GALT1Congenital disorder of glycosylation, type 2dNM_001497.3NM_001497.3:c.1031dupCCongenital disorder of glycosylation type 2d follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the B4GALT1 gene located on chromosomal region 9p13. The age of onset is neonatal/infantile. This disease is characterized by macrocephaly, hydrocephaly, hypotonia, myopathy and coagulation anomalies. The prevalence is <1:1,000,000.600
B9D2Joubert syndrome type 34; Meckel syndrome type 10NM_030578.3NM_030578.3:c.301A>CJoubert syndrome (JBTS) 34 is an autosomal recessive disorder presenting with cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy, renal disease, liver fibrosis, and polydactyly. On the other side, Meckel syndrome (MKS) type 10 (MKS10) is a very rare autosomal-recessive disorder resulting in perinatal lethality and characterized by renal cysts, hepatic ductal plate malformation, and central nervous system defects, such as occipital encephalocele. JBST34 and MKS10 are caused by pathogenic variants in the B9D2 gene located on chromosomal region 19q13.2.600
BCKDHAMaple syrup urine disease, type 1aNM_000709.3NM_000709.3:c.14delT, NM_000709.3:c.632C>T, NM_000709.3:c.659C>T, NM_000709.3:c.741dupT, NM_000709.3:c.797delA, NM_000709.3:c.853G>C, NM_000709.3:c.868G>A, NM_000709.3:c.905A>C, NM_000709.3:c.909_910delGT, NM_000709.3:c.917delT, NM_000709.3:c.929C>G, NM_000709.3:c.964C>T, NM_000709.3:c.979G>A, NM_000709.3:c.1036C>T, NM_000709.3:c.1037G>A, NM_000709.3:c.1234G>AMaple syrup urine disease type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHA gene located on chromosomal region 19q13.1-13.2. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:1,000,000-9:1,000,000.600,25
BCKDHBMaple syrup urine disease, type 1bNM_000056.4NM_000056.4:c.302G>A, NM_000056.4:c.342T>G, NM_000056.4:c.344-1G>A, NM_000056.4:c.356T>G, NM_000056.4:c.479T>G, NM_000056.4:c.488A>T, NM_000056.4:c.508C>A, NM_000056.4:c.508C>G, NM_000056.4:c.508C>T, NM_000056.4:c.509G>A, NM_000056.4:c.526A>T, NM_000056.4:c.547C>T, NM_000056.4:c.548G>C, NM_000056.4:c.748G>T, NM_000056.4:c.752T>C, NM_000056.4:c.799C>T, NM_000056.4:c.832G>A, NM_000056.4:c.853C>T, NM_000056.4:c.885delT, NM_000056.4:c.902T>G, NM_000056.4:c.952-1G>A, NM_000056.4:c.970C>T, NM_000056.4:c.1046G>A, NM_000056.4:c.1114G>TMaple syrup urine disease type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHB gene located on chromosomal region 6q14.1. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:10,000-5:10,000.600
BCS1LBCS1L-related disorders, including Leigh syndromeNM_001079866.1NM_001079866.1:c.103G>C, NM_001079866.1:c.133C>T, NM_001079866.1:c.148A>G, NM_001079866.1:c.166C>T, NM_001079866.1:c.232A>G, NM_001079866.1:c.547C>T, NM_001079866.1:c.548G>A, NM_001079866.1:c.550C>T, NM_001079866.1:c.696delT, NM_001079866.1:c.830G>A, NM_001079866.1:c.1057G>ALeigh syndrome caused by mutations in the BCS1L gene -located on chromosomal region 2q35- follows an autosomal recessive pattern of inheritance. Leigh syndrome is a clinically and genetically heterogeneous disorder resulting from defective mitochondrial energy generation; It presents extensive genetic heterogeneity (more than 75 different genes) with mutations identified in both nuclear- and mitochondrial-encoded genes involved in energy metabolism, including mitochondrial respiratory chain complexes I, II, III, IV, and V. It most commonly presents as a progressive and severe neurodegenerative disorder with onset within the first months or years of life, and may result in early death. Affected individuals usually show global developmental delay or developmental regression, hypotonia, ataxia, dystonia, and ophthalmologic abnormalities, such as nystagmus or optic atrophy. The BCS1L protein is critical for the formation of mitochondrial complex III. This syndrome affects at least 1 in 40,000 newborns. 600,25
BEST1Bestrophinopathy, ARNM_001139443.1NM_001139443.1:c.242G>A, NM_001139443.1:c.341_342delTG, NM_001139443.1:c.344delG, NM_001139443.1:c.418C>T, NM_001139443.1:c.434T>C, NM_001139443.1:c.502G>A, NM_001139443.1:c.754G>A, NM_001139443.1:c.769G>A, NM_001139443.1:c.1129_1130insCCAAAGA, NM_001139443.1:c.1203_1204insGCCTTGATGGA, NM_001139443.1:c.1311_1317dupCAAAGACBestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram. Genetic heterogeneity: Mutations in this gene may cause dominant phenotypes like Macular dystrophy, vitelliform, 2 ( OMIM 153700) and Vitreoretinochoroidopathy (193220).600,25
BEST1Bestrophinopathy, ARNM_004183.3NM_004183.3:c.122T>CBestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram. Genetic heterogeneity: Mutations in this gene may cause dominant phenotypes like Macular dystrophy, vitelliform, 2 ( OMIM 153700) and Vitreoretinochoroidopathy (193220).600,25
BSCL2Congenital generalized lipodystrophy, type 2; Encephalopathy, progressive, with or without lipodystrophyNM_001122955.3NM_001122955.3:c.1166_1167insG, NM_001122955.3:c.1015C>T, NM_001122955.3:c.985C>T, NM_001122955.3:c.974dupG, NM_001122955.3:c.864-3C>G, NM_001122955.3:c.863+5G>A, NM_001122955.3:c.826G>C, NM_001122955.3:c.604C>TCongenital generalized lipodystrophy (also called Berardinelli-Seip congenital lipodystrophy) type 2 is a rare condition caused by pathogenic variants in the BSCL2 gene located on chromosomal region 11q12.3. Its characterized by an almost total absence of adipose tissue and a very muscular appearance. A shortage of adipose tissue leads to multiple health problems, including high levels of fats called triglycerides circulating in the bloodstream (hypertriglyceridemia) and diabetes mellitus. In some cases, this form of the condition is also associated with intellectual disability, which is usually mild to moderate. Progressive encephalopathy follows an autosomal recessive pattern of inheritance and is also caused by pathogenic variants in the BSCL2 gene. This is a severe neurodegenerative disorder characterized by developmental regression of motor and cognitive skills in the first years of life, often leading to death in the first decade. Patients may show a mild or typical lipodystrophic appearance.600
BSNDBartter syndrome, type 4aNM_057176.2NM_057176.2:c.1A>T, NM_057176.2:c.3G>A, NM_057176.2:c.10G>T, NM_057176.2:c.22C>T, NM_057176.2:c.23G>T, NM_057176.2:c.35T>C, NM_057176.2:c.139G>ABartter syndrome type 4A with deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSND gene located on chromosomal region 1p32.3. The age of onset is neonatal/infantile. This disease is characterized by maternal polyhydramnios, premature delivery, polyuria, sensorineural deafness and is associated with hypokalemic alkalosis, increased levels of plasma renin and aldosterone, low blood pressure, and vascular resistance to angiotensin II.600,25
BTDBiotinidase deficiencyNM_001281723.2NM_001281723.2:c.190G>A, NM_001281723.2:c.241C>T, NM_001281723.2:c.340G>C, NM_001281723.2:c.449G>A, NM_001281723.2:c.517G>A, NM_001281723.2:c.534G>T, NM_001281723.2:c.563G>A, NM_001281723.2:c.589A>G, NM_001281723.2:c.601G>A, NM_001281723.2:c.635A>G, NM_001281723.2:c.637C>T, NM_001281723.2:c.649C>T, NM_001281723.2:c.670G>A, NM_001281723.2:c.761A>G, NM_001281723.2:c.800A>T, NM_001281723.2:c.939delT, NM_001281723.2:c.1330delG, NM_001281723.2:c.1345C>T, NM_001281723.2:c.1358G>A, NM_001281723.2:c.1374A>C, NM_001281723.2:c.1495C>T, NM_001281723.2:c.1514_1518delGGATG, NM_001281723.2:c.1601C>T, NM_001281723.2:c.1618C>TBiotinidase deficiency an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BTD gene located on chromosomal region 3p25. The age of onset is neonatal/infantile. This disease is characterized by seizures, breathing difficulties, hypotonia, skin rash, alopecia, hearing loss and delayed development.600,25
BTKAgammaglobulinemia X-linked, type 1NM_001287344.1NM_001287344.1:c.2008G>T, NM_001287344.1:c.1991T>A, NM_001287344.1:c.1940G>A, NM_001287344.1:c.1922C>A, NM_001287344.1:c.1875C>A, NM_001287344.1:c.1868A>G, NM_001287344.1:c.1661G>A, NM_001287344.1:c.1660C>T, NM_001287344.1:c.1618T>C, NM_001287344.1:c.1608C>A, NM_001287344.1:c.1390A>G, NM_001287344.1:c.1377C>A, NM_001287344.1:c.1325T>C, NM_001287344.1:c.1227T>G, NM_001287344.1:c.1184A>G, NM_001287344.1:c.1103A>C, NM_001287344.1:c.1021A>G, NM_001287344.1:c.964C>T, NM_001287344.1:c.865C>T, NM_001287344.1:c.857G>A, NM_001287344.1:c.820G>T, NM_001287344.1:c.440T>AAgammaglobulinemia X-linked (XLA), type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the BTK gene located on chromosomal region Xq21.33-q22. The age of onset is neonatal. Individuals with XLA are more susceptible to infections because their body makes very few antibodies. In children with XLA, infections generally take longer to get better and then they come back again, even with antibiotic medications. The most common bacterial infections that occur in people with XLA are lung infections (pneumonia and bronchitis), ear infections (otitis), pink eye (conjunctivitis), and sinus infections (sinusitis). Infections that cause chronic diarrhea are also common. Recurrent infections can lead to organ damage. The X-linked form accounts for approximately 85 to 90% of cases of agammaglobulinemia. The prevalence is 3:1,000,000-6:1,000,000 men.600
C3Complement C3 deficiencyNM_000064.3NM_000064.3:c.4851-1G>A, NM_000064.3:c.3627_3628insGGGGCCC, NM_000064.3:c.3116dupT, NM_000064.3:c.2562C>G, NM_000064.3:c.2354+1G>A, NM_000064.3:c.1119+1G>T, NM_000064.3:c.1004-2A>TC3 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C3 gene located on chromosomal region 19p13.3-p13.2. The age of onset is infantile. It is a rare defect of the complement classical pathway. The main clinical manifestation of primary C3 deficiency is childhood-onset of recurrent bacterial infections, mainly caused by gram-negative bacteria, such as Neisseria meningitidis, Enterobacter aerogenes, Haemophilus influenzae, and Escherichia coli; infections with gram-positive bacteria also occur. Infections in the upper and lower respiratory tract, including pneumonia, episodes of sinusitis, tonsillitis, and otitis, are the most frequent consequence of the C3 deficiency. Approximately 26% of patients with C3 deficiency develop immune complex-mediated autoimmune diseases resembling systemic lupus erythematosus, and about 26% of patients develop mesangiocapillary or membranoproliferative glomerulonephritis, resulting in renal failure (summary by Reis et al., 2006). The prevalence is <1:1.000.000. 600
CA2Osteopetrosis, autosomal recessive type 3NM_000067.2NM_000067.2:c.120T>G, NM_000067.2:c.319C>T, NM_000067.2:c.663+2T>COsteopetrosis, autosomal recessive, type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CA2 gene located on chromosomal region 8q22. The age of onset is neonatal/infantile. This disease is characterized by osteopetrosis, renal tubular acidosis, and neurological disorders related to cerebral calcifications. The prevalence is <1:1.000.000.600
CAPN3Limb-girdle muscular dystrophy type 1 (LGMDR1; formerly LGMD2A)NM_000070.2NM_000070.2:c.133G>A, NM_000070.2:c.223dupT, NM_000070.2:c.257C>T, NM_000070.2:c.328C>T, NM_000070.2:c.550delA, NM_000070.2:c.580delT, NM_000070.2:c.598_612delTTCTGGAGTGCTCTG, NM_000070.2:c.855_864dupGTTGATTGCA, NM_000070.2:c.956C>T, NM_000070.2:c.1322delG, NM_000070.2:c.1466G>A, NM_000070.2:c.1468C>T, NM_000070.2:c.1469G>A, NM_000070.2:c.1599_1602delGAGC, NM_000070.2:c.1715G>A, NM_000070.2:c.1795dupA, NM_000070.2:c.1838delA, NM_000070.2:c.2120A>G, NM_000070.2:c.2212C>T, NM_000070.2:c.2243G>A, NM_000070.2:c.2251_2254dupGTCA, NM_000070.2:c.2306G>A, NM_000070.2:c.2362_2363delAGinsTCATCTLimb-girdle muscular dystrophy type 1 (LGMDR1; formerly LGMD2A) follows an autosomal recessive pattern of inheritance and is caused by biallelic pathogenic variants in the CAPN3 gene located on chromosomal region 15q15.1. The age of onset is variable. This disease is characterized by a variable age of onset of progressive, typically symmetrical and selective weakness and atrophy of proximal shoulder- and pelvic-girdle muscles (gluteus maximus, thigh adductors, and muscles of the posterior compartment of the limbs are most commonly affected) without cardiac or facial involvement. Clinical manifestations include exercise intolerance, a waddling gait, scapular winging and calf pseudo-hypertrophy.The prevalence is 1:100,000- 9:100,000. Genetic heterogeneity: Heterozygous mutation in the CAPN3 gene can cause autosomal dominant limb-girdle muscular dystrophy-4 (LGMDD4; OMIM 618129), which has a later onset and milder features.600,25
CBSHomocystinuria, B6-responsive and nonresponsive typesNM_000071.2NM_000071.2:c.1330G>A, NM_000071.2:c.1280C>T, NM_000071.2:c.1150A>G, NM_000071.2:c.1136G>A, NM_000071.2:c.1058C>T, NM_000071.2:c.1006C>T, NM_000071.2:c.992C>A, NM_000071.2:c.969G>A, NM_000071.2:c.959T>C, NM_000071.2:c.919G>A, NM_000071.2:c.833T>C, NM_000071.2:c.797G>A, NM_000071.2:c.689delT, NM_000071.2:c.676G>A, NM_000071.2:c.572C>T, NM_000071.2:c.526G>T, NM_000071.2:c.502G>A, NM_000071.2:c.434C>T, NM_000071.2:c.430G>A, NM_000071.2:c.415G>A, NM_000071.2:c.393G>C, NM_000071.2:c.374G>A, NM_000071.2:c.341C>T, NM_000071.2:c.325T>C, NM_000071.2:c.162G>A, NM_000071.2:c.146C>THomocystinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CBS gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by the multiple involvement of the eye, skeleton, central nervous system and vascular system. The prevalence is 1:200,000-1:335,000.600,25
CC2D2AJoubert syndrome type 9; Meckel syndrome type 6NM_001080522.2NM_001080522.2:c.2486+1G>C, NM_001080522.2:c.2848C>T, NM_001080522.2:c.3145C>T, NM_001080522.2:c.3289delG, NM_001080522.2:c.3364C>T, NM_001080522.2:c.3594+1G>A, NM_001080522.2:c.4179+1delG, NM_001080522.2:c.4181delG, NM_001080522.2:c.4333C>T, NM_001080522.2:c.4582C>T, NM_001080522.2:c.4667A>TJoubert syndrome type 9 defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized neonatal hypotonia, developmental delay, intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia, primary position nystagmus and congenital hepatic fibrosis.600,25
CD40LGImmunodeficiency, X-linked, with hyper-IgMNM_000074.2NM_000074.2:c.107T>G, NM_000074.2:c.368C>AImmunodeficiency, X-linked, with hyper-IgM follows an X-linked pattern of inheritance and is caused by pathogenic variants in the CD40LG gene located on chromosomal region Xq26. The age of onset is neonatal/infantile. This disease is characterized by lower-respiratory tract bacterial infections, opportunistic infections, recurrent or protracted diarrhea associated with failure to thrive, neutropenia, thrombocytopenia and anemia. The prevalence is 2:1,000,000 male newborns.600
CDH23Usher syndrome, type 1DNM_022124.5NM_022124.5:c.146-2A>G, NM_022124.5:c.193delC, NM_022124.5:c.288+1G>A, NM_022124.5:c.1858+2T>G, NM_022124.5:c.3141C>A, NM_022124.5:c.3516_3519delATCC, NM_022124.5:c.3579+2T>C, NM_022124.5:c.4504C>T, NM_022124.5:c.5237G>A, NM_022124.5:c.5663T>C, NM_022124.5:c.6050-9G>A, NM_022124.5:c.6393delC, NM_022124.5:c.6442G>ANon-syndromic autosomal recessive deafness type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.600,25
CDH3Ectodermal dysplasia, ectrodactyly, and macular dystrophyNM_001793.5NM_001793.5:c.461dupC, NM_001793.5:c.830delG, NM_001793.5:c.965A>T, NM_001793.5:c.981delG, NM_001793.5:c.1508G>AEctodermal dysplasia, ectrodactyly, and macular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH3 gene located on chromosomal region 16q22.1. The age of onset is neonatal/infantile. This disease is characterized by the association of ectodermal dysplasia, ectrodactyly, and macular dystrophy. The prevalence is <1:1,000,000.600
CDHR1Cone-rod dystrophy, type 15NM_033100.3NM_033100.3:c.338delG, NM_033100.3:c.524dupA, NM_033100.3:c.640delG, NM_033100.3:c.1112delC, NM_033100.3:c.1463delG, NM_033100.3:c.1485+2T>C, NM_033100.3:c.1485+2T>GCone-rod dystrophy, type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDHR1 gene located on chromosomal region 10q23.1. This disease is characterized by decreased visual acuity and sensitivity in the central visual field, followed by loss of peripheral vision. The overall prevalence of all types of cone-rod dystrophy is 1-9:100,000.600,25
CDK5RAP2Primary microcephaly type 3, autosomal recessiveNM_018249.5NM_018249.5:c.4672C>T, NM_018249.5:c.4658_4661dupTATT, NM_018249.5:c.4546G>T, NM_018249.5:c.700G>T, NM_018249.5:c.524_528delAGGCA, NM_018249.5:c.246T>A, NM_018249.5:c.127+1G>CPrimary autosomal recessive microcephaly type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDK5RAP2 gene located on chromosomal region 9q33.2. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.600
CENPJPrimary microcephaly type 6, autosomal recessiveNM_018451.4NM_018451.4:c.3842_3843dupTA, NM_018451.4:c.3704A>T, NM_018451.4:c.3699_3702dupAATA, NM_018451.4:c.3568_3571dupGTCA, NM_018451.4:c.3415G>T, NM_018451.4:c.3243_3246delTCAG, NM_018451.4:c.2968_2972delAAAAA, NM_018451.4:c.2614delT, NM_018451.4:c.2460_2463delGACG, NM_018451.4:c.1949_1952dupAGTG, NM_018451.4:c.757_760delGTCT, NM_018451.4:c.289dupA, NM_018451.4:c.232_236delCAGAA, NM_018451.4:c.40C>TPrimary autosomal recessive microcephaly type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CENPJ gene located on chromosomal region 13q12.12.ﾠThe age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.600,25
CEP152Primary microcephaly type 9, autosomal recessiveNM_001194998.1NM_001194998.1:c.2034T>G, NM_001194998.1:c.1578-1G>A, NM_001194998.1:c.794A>C, NM_001194998.1:c.749_750delGAPrimary autosomal recessive microcephaly type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP152 gene located on chromosomal region 15q21.1. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.600
CEP290Meckel syndrome type 4; Joubert syndrome type 5NM_025114.3NM_025114.3:c.7341dupA, NM_025114.3:c.7341delA, NM_025114.3:c.7324G>T, NM_025114.3:c.6798G>A, NM_025114.3:c.6645+1G>A, NM_025114.3:c.6624delG, NM_025114.3:c.6448_6455delCAGTTGAA, NM_025114.3:c.5668G>T, NM_025114.3:c.5611_5614delCAAA, NM_025114.3:c.4962_4963delAA, NM_025114.3:c.4916C>A, NM_025114.3:c.4723A>T, NM_025114.3:c.4705-1G>T, NM_025114.3:c.4656delA, NM_025114.3:c.4393C>T, NM_025114.3:c.3185delT, NM_025114.3:c.2249T>G, NM_025114.3:c.1681C>T, NM_025114.3:c.1665_1666delAA, NM_025114.3:c.1501G>T, NM_025114.3:c.613C>T, NM_025114.3:c.384_387delTAGA, NM_025114.3:c.164_167delCTCA, NM_025114.3:c.21G>TMeckel syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is neonatal. This disease is characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically occipital encephalocele), hepatic ductal dysplasia and cysts, and postaxial polydactyly. The prevalence is <1/1,000,000.600,25
CERKLRetinitis pigmentosa type 26NM_001030311.2NM_001030311.2:c.1090C>T, NM_001030311.2:c.858delT, NM_001030311.2:c.847C>T, NM_001030311.2:c.312delARetinitis pigmentosa 26 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CERKL gene located on chromosomal region 2q31.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.600,25
CFHComplement factor H deficiencyNM_000186.3NM_000186.3:c.380G>T, NM_000186.3:c.1606T>C, NM_000186.3:c.2876G>AComplement factor H deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFH gene located on chromosomal region 1q32. This disease is characterized by increased susceptibility to recurrent, usually severe, infections (particularly by Neisseria meningitidis, Escherichia coli, and Haemophilus influenzae), renal impairment and/or autoimmune diseases.600,25
CFTRCystic fibrosisNM_000492.3NM_000492.3:c.1A>G, NM_000492.3:c.4C>T, NM_000492.3:c.11C>A, NM_000492.3:c.50delT, NM_000492.3:c.44T>C, NM_000492.3:c.53+1G>T, NM_000492.3:c.57G>A, NM_000492.3:c.79G>T, NM_000492.3:c.88C>T, NM_000492.3:c.115C>T, NM_000492.3:c.137C>A, NM_000492.3:c.164+1G>A, NM_000492.3:c.164+1G>T, NM_000492.3:c.164+2T>C, NM_000492.3:c.164+4dupT, NM_000492.3:c.165-3C>T, NM_000492.3:c.165-1G>A, NM_000492.3:c.166G>A, NM_000492.3:c.169T>G, NM_000492.3:c.170G>A, NM_000492.3:c.171G>A, NM_000492.3:c.174_177delTAGA, NM_000492.3:c.175dupA, NM_000492.3:c.178G>A, NM_000492.3:c.178G>T, NM_000492.3:c.200C>T, NM_000492.3:c.223C>T, NM_000492.3:c.233dupT, NM_000492.3:c.254G>A, NM_000492.3:c.262_263delTT, NM_000492.3:c.263T>A, NM_000492.3:c.263T>G, NM_000492.3:c.271G>A, NM_000492.3:c.273+1G>A, NM_000492.3:c.273+3A>C, NM_000492.3:c.274-2A>G, NM_000492.3:c.274-1G>A, NM_000492.3:c.274G>A, NM_000492.3:c.274G>T, NM_000492.3:c.292C>T, NM_000492.3:c.305T>G, NM_000492.3:c.310delA, NM_000492.3:c.313delA, NM_000492.3:c.325_327delTATinsG, NM_000492.3:c.328G>C, NM_000492.3:c.328G>T, NM_000492.3:c.349C>T, NM_000492.3:c.350G>A, NM_000492.3:c.350G>T, NM_000492.3:c.366T>A, NM_000492.3:c.409delC, NM_000492.3:c.413_415dupTAC, NM_000492.3:c.416A>G, NM_000492.3:c.442delA, NM_000492.3:c.445G>A, NM_000492.3:c.445G>T, NM_000492.3:c.446G>T, NM_000492.3:c.489+1G>T, NM_000492.3:c.531delT, NM_000492.3:c.532G>A, NM_000492.3:c.543_546delTAGT, NM_000492.3:c.571T>G, NM_000492.3:c.577G>T, NM_000492.3:c.579+1G>T, NM_000492.3:c.579+3A>G, NM_000492.3:c.579+5G>A, NM_000492.3:c.580-1G>T, NM_000492.3:c.595C>T, NM_000492.3:c.613C>T, NM_000492.3:c.617T>G, NM_000492.3:c.647G>A, NM_000492.3:c.658C>T, NM_000492.3:c.680T>G, NM_000492.3:c.695T>A, NM_000492.3:c.708delT, NM_000492.3:c.717delG, NM_000492.3:c.803delA, NM_000492.3:c.825C>G, NM_000492.3:c.828C>A, NM_000492.3:c.850dupA, NM_000492.3:c.861_865delCTTAA, NM_000492.3:c.935_937delTCT, NM_000492.3:c.933C>G, NM_000492.3:c.948delT, NM_000492.3:c.987delA, NM_000492.3:c.988G>T, NM_000492.3:c.1000C>T, NM_000492.3:c.1001G>T, NM_000492.3:c.1006_1007insG, NM_000492.3:c.1007T>A, NM_000492.3:c.1013C>T, NM_000492.3:c.1021_1022dupTC, NM_000492.3:c.1021T>C, NM_000492.3:c.1029delC, NM_000492.3:c.1037T>C, NM_000492.3:c.1040G>A, NM_000492.3:c.1040G>C, NM_000492.3:c.1055G>A, NM_000492.3:c.1075C>A, NM_000492.3:c.1079C>A, NM_000492.3:c.1081delT, NM_000492.3:c.1116+1G>A, NM_000492.3:c.1117-1G>A, NM_000492.3:c.1130dupA, NM_000492.3:c.1155_1156dupTA, NM_000492.3:c.1202G>A, NM_000492.3:c.1203G>A, NM_000492.3:c.1209+1G>A, NM_000492.3:c.1211delG, NM_000492.3:c.1240C>T, NM_000492.3:c.1301_1307delCACTTCT, NM_000492.3:c.1327_1330dupGATA, NM_000492.3:c.1340delA, NM_000492.3:c.1364C>A, NM_000492.3:c.1365_1366delGG, NM_000492.3:c.1393-2A>G, NM_000492.3:c.1393-1G>A, NM_000492.3:c.1397C>A, NM_000492.3:c.1397C>G, NM_000492.3:c.1400T>C, NM_000492.3:c.1418delG, NM_000492.3:c.1420G>A, NM_000492.3:c.1438G>T, NM_000492.3:c.1466C>A, NM_000492.3:c.1475C>T, NM_000492.3:c.1477_1478delCA, NM_000492.3:c.1477C>T, NM_000492.3:c.1487G>A, NM_000492.3:c.1505T>C, NM_000492.3:c.1519_1521delATC, NM_000492.3:c.1516A>G, NM_000492.3:c.1519A>G, NM_000492.3:c.1521_1523delCTT, NM_000492.3:c.1523T>G, NM_000492.3:c.1538A>G, NM_000492.3:c.1545_1546delTA, NM_000492.3:c.1558G>T, NM_000492.3:c.1572C>A, NM_000492.3:c.1573C>T, NM_000492.3:c.1584+1G>A, NM_000492.3:c.1585-8G>A, NM_000492.3:c.1585-1G>A, NM_000492.3:c.1624G>T, NM_000492.3:c.1645A>C, NM_000492.3:c.1646G>A, NM_000492.3:c.1647T>G, NM_000492.3:c.1648G>T, NM_000492.3:c.1650delA, NM_000492.3:c.1651G>A, NM_000492.3:c.1652G>A, NM_000492.3:c.1654C>T, NM_000492.3:c.1657C>T, NM_000492.3:c.1670delC, NM_000492.3:c.1673T>C, NM_000492.3:c.1675G>A, NM_000492.3:c.1679G>A, NM_000492.3:c.1679G>C, NM_000492.3:c.1679+1G>A, NM_000492.3:c.1679+1G>C, NM_000492.3:c.1680-886A>G, NM_000492.3:c.1680-1G>A, NM_000492.3:c.1682C>A, NM_000492.3:c.1692delA, NM_000492.3:c.1703delT, NM_000492.3:c.1705T>G, NM_000492.3:c.1721C>A, NM_000492.3:c.1753G>T, NM_000492.3:c.1766+1G>A, NM_000492.3:c.1766+1G>C, NM_000492.3:c.1766+1G>T, NM_000492.3:c.1766+3A>G, NM_000492.3:c.1766+5G>T, NM_000492.3:c.1792_1798delAAAACTA, NM_000492.3:c.1826A>G, NM_000492.3:c.1882G>C, NM_000492.3:c.1923_1931delCTCAAAACTinsA, NM_000492.3:c.1973_1985delGAAATTCAATCCTinsAGAAA, NM_000492.3:c.1986_1989delAACT, NM_000492.3:c.2012delT, NM_000492.3:c.2017G>T, NM_000492.3:c.2052dupA, NM_000492.3:c.2052delA, NM_000492.3:c.2051_2052delAAinsG, NM_000492.3:c.2053dupC, NM_000492.3:c.2053C>T, NM_000492.3:c.2125C>T, NM_000492.3:c.2128A>T, NM_000492.3:c.2143C>T, NM_000492.3:c.2158C>T, NM_000492.3:c.2175dupA, NM_000492.3:c.2195T>G, NM_000492.3:c.2215delG, NM_000492.3:c.2241_2248delGATACTGC, NM_000492.3:c.2290C>T, NM_000492.3:c.2353C>T, NM_000492.3:c.2374C>T, NM_000492.3:c.2423_2424dupAT, NM_000492.3:c.2453delT, NM_000492.3:c.2463_2464delTG, NM_000492.3:c.2464G>T, NM_000492.3:c.2490+1G>A, NM_000492.3:c.2491G>T, NM_000492.3:c.2537G>A, NM_000492.3:c.2538G>A, NM_000492.3:c.2547C>A, NM_000492.3:c.2551C>T, NM_000492.3:c.2583delT, NM_000492.3:c.2589_2599delAATTTGGTGCT, NM_000492.3:c.2601dupA, NM_000492.3:c.2645G>A, NM_000492.3:c.2657+5G>A, NM_000492.3:c.2658-1G>C, NM_000492.3:c.2668C>T, NM_000492.3:c.2735C>A, NM_000492.3:c.2737_2738insG, NM_000492.3:c.2739T>A, NM_000492.3:c.2763_2764dupAG, NM_000492.3:c.2780T>C, NM_000492.3:c.2810dupT, NM_000492.3:c.2825delT, NM_000492.3:c.2834C>T, NM_000492.3:c.2869_2870insG, NM_000492.3:c.2875delG, NM_000492.3:c.2896delA, NM_000492.3:c.2908G>C, NM_000492.3:c.2930C>T, NM_000492.3:c.2936A>T, NM_000492.3:c.2988G>A, NM_000492.3:c.2988+1G>A, NM_000492.3:c.2989-2A>G, NM_000492.3:c.2989-1G>A, NM_000492.3:c.3002_3003delTG, NM_000492.3:c.3011_3019delCTATAGCAG, NM_000492.3:c.3017C>A, NM_000492.3:c.3039dupC, NM_000492.3:c.3039delC, NM_000492.3:c.3067_3072delATAGTG, NM_000492.3:c.3080T>C, NM_000492.3:c.3107C>A, NM_000492.3:c.3124C>T, NM_000492.3:c.3139_3139+1delGG, NM_000492.3:c.3140-26A>G, NM_000492.3:c.3160C>G, NM_000492.3:c.3181G>C, NM_000492.3:c.3194T>C, NM_000492.3:c.3196C>T, NM_000492.3:c.3197G>A, NM_000492.3:c.3205G>A, NM_000492.3:c.3209G>A, NM_000492.3:c.3230T>C, NM_000492.3:c.3266G>A, NM_000492.3:c.3276C>A, NM_000492.3:c.3276C>G, NM_000492.3:c.3292T>C, NM_000492.3:c.3293G>A, NM_000492.3:c.3294G>A, NM_000492.3:c.3294G>C, NM_000492.3:c.3294G>T, NM_000492.3:c.3302T>A, NM_000492.3:c.3302T>G, NM_000492.3:c.3304A>T, NM_000492.3:c.3310G>T, NM_000492.3:c.3353C>T, NM_000492.3:c.3368-2A>G, NM_000492.3:c.3435G>A, NM_000492.3:c.3454G>C, NM_000492.3:c.3468G>A, NM_000492.3:c.3468+5G>A, NM_000492.3:c.3472C>T, NM_000492.3:c.3484C>T, NM_000492.3:c.3528delC, NM_000492.3:c.3532_3535dupTCAA, NM_000492.3:c.3536_3539delCCAA, NM_000492.3:c.3587C>G, NM_000492.3:c.3605delA, NM_000492.3:c.3611G>A, NM_000492.3:c.3612G>A, NM_000492.3:c.3659delC, NM_000492.3:c.3691delT, NM_000492.3:c.3700A>G, NM_000492.3:c.3717+4A>G, NM_000492.3:c.3717+5G>A, NM_000492.3:c.3717+40A>G, NM_000492.3:c.3718-2477C>T, NM_000492.3:c.3718-3T>G, NM_000492.3:c.3718-1G>A, NM_000492.3:c.3719T>G, NM_000492.3:c.3731G>A, NM_000492.3:c.3744delA, NM_000492.3:c.3747delG, NM_000492.3:c.3752G>A, NM_000492.3:c.3761T>G, NM_000492.3:c.3763T>C, NM_000492.3:c.3764C>A, NM_000492.3:c.3773dupT, NM_000492.3:c.3846G>A, NM_000492.3:c.3848G>T, NM_000492.3:c.3873+1G>A, NM_000492.3:c.3873+2T>C, NM_000492.3:c.3883_3886delATTT, NM_000492.3:c.3883delA, NM_000492.3:c.3889dupT, NM_000492.3:c.3891dupT, NM_000492.3:c.3908delA, NM_000492.3:c.3909C>G, NM_000492.3:c.3937C>T, NM_000492.3:c.3971T>C, NM_000492.3:c.4036_4042delCTAAGCC, NM_000492.3:c.4046G>A, NM_000492.3:c.4077_4080delTGTTinsAA, NM_000492.3:c.4086dupT, NM_000492.3:c.4111G>T, NM_000492.3:c.4127_4131delTGGAT, NM_000492.3:c.4144C>T, NM_000492.3:c.4147dupA, NM_000492.3:c.4197_4198delCT, NM_000492.3:c.4231C>T, NM_000492.3:c.4234C>T, NM_000492.3:c.4242+1G>A, NM_000492.3:c.4242+1G>T, NM_000492.3:c.4251delA, NM_000492.3:c.4300_4301dupAG, NM_000492.3:c.4426C>TCystic fibrosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFTR gene located on chromosomal region 7q31.2. The age of onset of severe form is neonatal or infantile but there are also variants associated with moderate clinical or late onset. This disease is characterized by the production of sweat with a high salt content, mucus secretions with an abnormal viscosity, chronic bronchitis, pancreatic insufficiency, adolescent diabetes and, more rarely, stercoral obstruction and cirrhosis. Male sterility is a constant feature. Late-onset forms, which are usually only mild or monosymptomatic. The prevalence is 1:10,000-9:10,000.600,25
CHST6Macular corneal dystrophyNM_021615.4NM_021615.4:c.853delC, NM_021615.4:c.820G>T, NM_021615.4:c.392C>A, NM_021615.4:c.327_328delCTMacular corneal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CHST6 gene located on chromosomal region 16q22. The age of onset is variable. This disease is characterized by bilateral ill-defined cloudy regions within a hazy stroma, and eventually severe visual impairment. The prevalence is 1:100,000-9:100,000.600,25
CLCN1Myotonia congenita, recessiveNM_000083.2NM_000083.2:c.180+3A>T, NM_000083.2:c.225dupC, NM_000083.2:c.409T>G, NM_000083.2:c.871G>A, NM_000083.2:c.1238T>G, NM_000083.2:c.1453A>G, NM_000083.2:c.2680C>TMyotonia congenita follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN1 gene located on chromosomal region 7q35. The age of onset is neonatal/infantile. This is a nondystrophic skeletal muscle disorder characterized by muscle stiffness and an inability of the muscle to relax after voluntary contraction. Most patients have symptom onset in the legs, which later progresses to the arms, neck, and facial muscles. Many patients show marked hypertrophy of the lower limb muscles. The prevalence is 1:100,000.600,25
CLCN7Osteopetrosis, autosomal recessive type 4NM_001287.5NM_001287.5:c.781A>T, NM_001287.5:c.622C>TOsteopetrosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN7 gene located on chromosomal region 16p13. The age of onset is neonatal/infantile. This disease is characterized bone marrow failure, fractures and visual impairment. The incidence is 1:200,000 live births and the prevalence is 1:100,000.600
CLDN14Deafness type 29, autosomal recessiveNM_001146077.1NM_001146077.1:c.398delT, NM_001146077.1:c.301G>A, NM_001146077.1:c.254T>ADeafness type 29, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN14 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.600
CLDN19Rena hypomagnesemia type 5, with ocular involvementNM_148960.2NM_148960.2:c.425_437delCCCTGGTGACCCA, NM_148960.2:c.269T>C, NM_148960.2:c.169C>G, NM_148960.2:c.59G>ARenal hypomagnesemia type 5, with ocular involvement follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN19 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by excessive magnesium and calcium renal wasting, bilateral nephrocalcinosis, progressive renal failure and severe ocular abnormalities. The prevalence is <1:1,000,000.600,25
CLN3Ceroid lipofuscinosis, neuronal, type 3NM_000086.2NM_000086.2:c.1272delG, NM_000086.2:c.883G>A, NM_000086.2:c.622dupT, NM_000086.2:c.597C>AJuvenile neuronal ceroid lipofuscinosis 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN3 gene located on chromosomal region 16p12.1. The age of onset is infantile. This disease is characterized by onset at early school age with vision loss due to retinopathy, seizures and the decline of mental and motor capacities. The annual birth incidence is 1:217,000-1:450,000 in Sweden and 1:143,000 in Germany, and the prevalence is 1.5:1,000,000-9:1,000,000.600
CLN5Ceroid lipofuscinosis, neuronal, type 5NM_006493.2NM_006493.2:c.335G>C, NM_006493.2:c.377G>A, NM_006493.2:c.433C>T, NM_006493.2:c.524T>G, NM_006493.2:c.526dupA, NM_006493.2:c.565C>T, NM_006493.2:c.575A>G, NM_006493.2:c.593T>C, NM_006493.2:c.595C>T, NM_006493.2:c.613C>T, NM_006493.2:c.620G>C, NM_006493.2:c.669dupC, NM_006493.2:c.835G>A, NM_006493.2:c.919delA, NM_006493.2:c.924_925delAT, NM_006493.2:c.1026C>ANeuronal ceroid lipofuscinosis type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN5 gene located on chromosomal region 3q21.1-q32. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy and vision loss through retinal degeneration. The prevalence is <1:1,000,000.600
CLN6Ceroid lipofuscinosis, neuronal, type 6NM_017882.2NM_017882.2:c.663C>G, NM_017882.2:c.214G>T, NM_017882.2:c.200T>CNeuronal ceroid lipofuscinosis 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN6 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy and vision loss through retinal degeneration. The prevalence is <1:1,000,000.600
CLN8Ceroid lipofuscinosis, neuronal, type 8NM_018941.3NM_018941.3:c.88delG, NM_018941.3:c.88G>C, NM_018941.3:c.610C>T, NM_018941.3:c.789G>CNeuronal ceroid lipofuscinosis 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN8 gene located on chromosomal region 8p23.3. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy, and vision loss through retinal degeneration. The prevalence is <1:1,000,000.600
CLRN1Usher syndrome, type 3ANM_001195794.1NM_001195794.1:c.669_670insT, NM_001195794.1:c.630dupT, NM_001195794.1:c.189C>A, NM_001195794.1:c.144T>G, NM_001195794.1:c.118T>G, NM_001195794.1:c.92C>TUsher syndrome type 3A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1 gene located on chromosomal region 3q25.1. The age of onset is neonatal/infantile. This disease is characterized by the association of sensorineural deafness with retinitis pigmentosa and progressive vision loss. The prevalence is 1:1.000.000- 9/1.000.000.600,25
CNGA1Retinitis pigmentosa type 49NM_001142564.1NM_001142564.1:c.2179delA, NM_001142564.1:c.2134C>T, NM_001142564.1:c.1747C>T, NM_001142564.1:c.1166C>T, NM_001142564.1:c.1001G>A, NM_001142564.1:c.656+2T>C, NM_001142564.1:c.445G>T, NM_001142564.1:c.304dupARetinitis pigmentosa 49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGA1 gene located on chromosomal region 4p12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.600,25
CNGB1Retinitis pigmentosa type 45NM_001297.4NM_001297.4:c.3462+1G>A, NM_001297.4:c.3425delT, NM_001297.4:c.3150delG, NM_001297.4:c.2762_2765delACGA, NM_001297.4:c.2653delG, NM_001297.4:c.2492+2T>G, NM_001297.4:c.1958-1G>A, NM_001297.4:c.1122-2A>T, NM_001297.4:c.952C>T, NM_001297.4:c.413-1G>A, NM_001297.4:c.218-2A>GRetinitis pigmentosa 45 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB1 gene located on chromosomal region 16q13. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000 to 5:10,000.600,25
CNGB3Achromatopsia type 3NM_019098.4NM_019098.4:c.2048_2049delCA, NM_019098.4:c.2011G>T, NM_019098.4:c.1148delC, NM_019098.4:c.1063C>T, NM_019098.4:c.893_897delCAAAA, NM_019098.4:c.887_896delCTTCTACAAA, NM_019098.4:c.886_890delACTTC, NM_019098.4:c.819_826delCAGACTCC, NM_019098.4:c.446_447insTAchromatopsia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is neonatal/Infantile. This disease is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, and reduced or complete loss of color discrimination. Most individuals have complete form, with total lack of function in all three types of cones. Rarely, individuals have incomplete form, with similar, but generally less severe symptoms. The prevalence is 1/30,000-1/50,000.600,25
COL11A1Fibrochondrogenesis type 1NM_080629.2NM_080629.2:c.3745-1G>A, NM_080629.2:c.2386G>C, NM_080629.2:c.1786dupGFibrochondrogenesis type 1 (FBCG1) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL11A1 gene located on chromosomal region 1p21. The age of onset is neonatal. Fibrochondrogenesis is a severe short-limbed skeletal dysplasia clinically characterized by a flat midface with a small nose and anteverted nares, significant shortening of all limb segments but relatively normal hands and feet, and a small bell-shaped thorax with a protuberant abdomen. Radiographically, the long bones are short and have broad metaphyseal ends, giving them a dumb-bell shape. The vertebral bodies are flat and, on lateral view, have a distinctive pinched appearance, with a hypoplastic posterior end and a rounded anterior end. The ribs are typically short and wide and have metaphyseal cupping at both ends (Tompson et al., 2010). Genetic heterogeneity: Fibrochondrogenesis type 2 (FBCG2; OMIM 614524) is caused by mutations in the COL11A2 gene on chromosome 6p21.3.600
COL17A1Epidermolysis bullosa, junctional, non-Herlitz typeNM_000494.3NM_000494.3:c.4319dupC, NM_000494.3:c.4003_4004delGG, NM_000494.3:c.3908G>A, NM_000494.3:c.3897_3900delATCT, NM_000494.3:c.3827dupC, NM_000494.3:c.3795delC, NM_000494.3:c.3676C>T, NM_000494.3:c.3277+1G>A, NM_000494.3:c.3067C>T, NM_000494.3:c.3043C>T, NM_000494.3:c.2965delA, NM_000494.3:c.2944_2947+1delGAAGG, NM_000494.3:c.2564T>G, NM_000494.3:c.2551+1G>T, NM_000494.3:c.2430_2431insCCGA, NM_000494.3:c.2383C>T, NM_000494.3:c.2336-1G>T, NM_000494.3:c.2336-2A>G, NM_000494.3:c.2228-3_2235delCAGGTCCTGCTinsTTG, NM_000494.3:c.1898G>A, NM_000494.3:c.1706delC, NM_000494.3:c.520_521delAG, NM_000494.3:c.433C>TEpidermolysis bullosa, junctional, non-Herlitz type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL17A1 gene located on chromosomal region 10q24.3. The age of onset is neonatal/infantile. This disease is characterized by a generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.600,25
COL18A1Knobloch syndrome, type 1NM_130444.2NM_130444.2:c.1700_1701insGACGTGAAAGAGGGG, NM_130444.2:c.2240_2241insGACGTGAAAGAGGGG, NM_130444.2:c.3294_3295delAG, NM_130444.2:c.3502C>T, NM_130444.2:c.4072_4084delCCCCCAGGCCCAC, NM_130444.2:c.4214_4223delCAGGGCCCCC, NM_130444.2:c.4222_4223delCC, NM_130444.2:c.4323_4323+1delGG, NM_130444.2:c.4759_4760delCT, NM_130444.2:c.5168dupGKnobloch syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL18A1 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by vitreoretinal and macular degeneration, and occipital encephalocele.ﾠThe prevalence is <1:1,000,000.600,25
COL1A2Ehlers-Danlos syndrome, cardiac valvular typeNM_000089.3NM_000089.3:c.133-1G>A, NM_000089.3:c.241_248delTATGATGG, NM_000089.3:c.293dupC, NM_000089.3:c.1404+1G>A, NM_000089.3:c.1404+1G>C, NM_000089.3:c.3601G>TEhlers-Danlos syndrome, cardiac valvular type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL1A2 gene located on chromosomal region 7q22.1. The age of onset is neonatal/infantile. This disease is characterized by joint hypermobility, skin hyperextensibility and cardiac valvular defects.ﾠThe prevalence is 6/100,000 to 7/100,000.600
COL4A3Alport syndrome 3B, autosomal recessiveNM_000091.4NM_000091.4:c.345delG, NM_000091.4:c.898G>A, NM_000091.4:c.2083G>A, NM_000091.4:c.2111delC, NM_000091.4:c.2954G>T, NM_000091.4:c.4420_4424delCTTTT, NM_000091.4:c.4441C>T, NM_000091.4:c.4571C>GAlport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.600,25
COL4A4Alport syndrome, autosomal recessiveNM_000092.4NM_000092.4:c.4923C>A, NM_000092.4:c.4129C>T, NM_000092.4:c.3713C>A, NM_000092.4:c.3601G>A, NM_000092.4:c.2312delG, NM_000092.4:c.71+1G>AAlport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.600,25
COL7A1Epidermolysis bullosa dystrophica, ARNM_000094.3NM_000094.3:c.8524_8527+10delGAAGGTGAGGACAG, NM_000094.3:c.8479C>T, NM_000094.3:c.8440C>T, NM_000094.3:c.8393T>A, NM_000094.3:c.8245G>A, NM_000094.3:c.7957G>A, NM_000094.3:c.7930-1G>C, NM_000094.3:c.7912G>T, NM_000094.3:c.7411C>T, NM_000094.3:c.7345-1G>A, NM_000094.3:c.6946G>A, NM_000094.3:c.6859G>A, NM_000094.3:c.6752G>A, NM_000094.3:c.6670G>T, NM_000094.3:c.6573+1G>T, NM_000094.3:c.6527dupC, NM_000094.3:c.6205C>T, NM_000094.3:c.6187C>T, NM_000094.3:c.6091G>A, NM_000094.3:c.5821-1G>A, NM_000094.3:c.5532+1G>A, NM_000094.3:c.5287C>T, NM_000094.3:c.5096C>T, NM_000094.3:c.5052+1G>A, NM_000094.3:c.4888C>T, NM_000094.3:c.4783G>C, NM_000094.3:c.4373C>T, NM_000094.3:c.4119+1G>T, NM_000094.3:c.4039G>C, NM_000094.3:c.3831+1G>T, NM_000094.3:c.2471dupG, NM_000094.3:c.933C>A, NM_000094.3:c.887delG, NM_000094.3:c.706C>T, NM_000094.3:c.425A>G, NM_000094.3:c.336C>GEpidermolysis bullosa dystrophica follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL7A1 gene located on chromosomal region 3p21.1. The age of onset is neonatal/infantile. This disease is characterized by generalized cutaneous and mucosal blistering and scarring associated with severe deformities and major extracutaneous involvement. The prevalence is <1:1,000,000.600,25
COL9A1Stickler syndrome, type 4NM_001851.4NM_001851.4:c.883C>T, NM_001851.4:c.706C>TStickler syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL9A1 gene located on chromosomal region 6q13. The age of onset is infantile. This disease is characterized by opthalmological (myopia, retinal detachment and cataracts), orofacial (micrognathia, midface hypoplasia and cleft palate) auditory (sensorineural hearing loss) and articular (epiphyseal dysplasia) symptoms. The prevalence is <1:1,000,000.600
COQ2Primary coenzyme Q10 deficiency, type 1NM_015697.7NM_015697.7:c.1197delT, NM_015697.7:c.890A>G, NM_015697.7:c.723delT, NM_015697.7:c.683A>G, NM_015697.7:c.590G>APrimary coenzyme Q10 deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ2 gene located on chromosomal region 4q21.23. The age of onset is neonatal/infantile. The phenotypes include an encephalomyopathic form with seizures and ataxia; a multisystem infantile form with encephalopathy, cardiomyopathy and renal failure; a predominantly cerebellar form with ataxia and cerebellar atrophy; Leigh syndrome with growth retardation; and an isolated myopathic form.600,25
COQ8APrimary coenzyme Q10 deficiency, type 4NM_020247.4NM_020247.4:c.589-3C>G, NM_020247.4:c.637C>T, NM_020247.4:c.815G>A, NM_020247.4:c.815G>T, NM_020247.4:c.911C>T, NM_020247.4:c.1541A>G, NM_020247.4:c.1645G>A, NM_020247.4:c.1651G>A, NM_020247.4:c.1750_1752delACC, NM_020247.4:c.1813dupGPrimary coenzyme Q10 deficiency type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ8A gene located on chromosomal region 1q42.13. The age of onset is infantile. This disease is characterized by progressive ataxia, cerebellar atrophy, and often exercise intolerance with elevated lactate levels and mild intellectual deficit.600,25
CPS1Carbamoylphosphate synthetase 1 deficiencyNM_001122633.2NM_001122633.2:c.1649C>T, NM_001122633.2:c.1930C>T, NM_001122633.2:c.3574delACarbamoylphosphate synthetase deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPS1 gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by congenital hyperammonemia and defective citrulline synthesis. The prevalence is 1:800,000 newborn in Japan.600
CPT1ACarnitine palmitoyltransferase type 1A deficiency, hepaticNM_001876.3NM_001876.3:c.1436C>T, NM_001876.3:c.1393G>T, NM_001876.3:c.1361A>G, NM_001876.3:c.1241C>T, NM_001876.3:c.1216C>T, NM_001876.3:c.1079A>G, NM_001876.3:c.335_336delCC, NM_001876.3:c.298C>T, NM_001876.3:c.281+1G>A, NM_001876.3:c.222C>ACarnitine palmitoyl transferase 1A deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT1A gene located on chromosomal region 11q13.2. The age of onset is neonatal/infantile. This disease is characterized by recurrent attacks of fasting-induced hypoketotic hypoglycemia and risk of liver failure. The prevalence is 1.3:1,000 newborn.600
CPT2Carnitine palmitoyltransferase type 2 deficiency, lethal neonatalNM_000098.2NM_000098.2:c.149C>A, NM_000098.2:c.338C>T, NM_000098.2:c.359A>G, NM_000098.2:c.370C>T, NM_000098.2:c.452G>A, NM_000098.2:c.464dupT, NM_000098.2:c.520G>A, NM_000098.2:c.638A>G, NM_000098.2:c.680C>T, NM_000098.2:c.725_726delAC, NM_000098.2:c.886C>T, NM_000098.2:c.1148T>A, NM_000098.2:c.1237C>T, NM_000098.2:c.1239_1240delGA, NM_000098.2:c.1369A>T, NM_000098.2:c.1437C>G, NM_000098.2:c.1784delC, NM_000098.2:c.1883A>C, NM_000098.2:c.1891C>TCarnitine palmitoyltransferase deficiency, type 2, lethal neonatal form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT2 gene located on chromosomal region 1p32. The age of onset is neonatal/infantile. This disease is characterized by a severe fasting intolerance leading to metabolic derangements of hypoketotic hypoglycemia, resulting in coma and seizures, and hepatic encephalopathy leading to liver failure.ﾠThe prevalence is <1:1,000,000.600,25
CRB1Retinitis pigmentosa type 12, AR; Leber congenital amaurosis type 8NM_201253.2NM_201253.2:c.498_506delAATTGATGG, NM_201253.2:c.613_619delATAGGAA, NM_201253.2:c.2290C>T, NM_201253.2:c.2401A>T, NM_201253.2:c.2416G>T, NM_201253.2:c.2688T>A, NM_201253.2:c.2983G>T, NM_201253.2:c.3055_3059dupTATAT, NM_201253.2:c.3122T>C, NM_201253.2:c.3299T>C, NM_201253.2:c.3299T>G, NM_201253.2:c.3383delT, NM_201253.2:c.3419T>A, NM_201253.2:c.3997G>TRetinitis pigmentosa type 12 and leber congenital amaurosis type 8 follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. Retinitis pigmentosa type 12 is characterized by night blindness, peripheral visual field impairment and over time loss of central visionm, and its prevalence is 1-5:10,000. Leber congenital amaurosis, with a neonatal/infantile age of onset, comprises a group of early-onset childhood retinal dystrophies characterized by vision loss, nystagmus, and severe retinal dysfunction. Patients usually present at birth with profound vision loss and pendular nystagmus. Other clinical findings of this disease may include high hypermetropia, photodysphoria, oculodigital sign, keratoconus, cataracts, and a variable appearance to the fundus.600,25
CRLF1Cold-induced sweating syndrome type 1NM_004750.4NM_004750.4:c.1137C>G, NM_004750.4:c.1125delG, NM_004750.4:c.935G>A, NM_004750.4:c.856-1G>A, NM_004750.4:c.852G>T, NM_004750.4:c.845_846delTG, NM_004750.4:c.829C>T, NM_004750.4:c.713dupC, NM_004750.4:c.708_709delCCinsT, NM_004750.4:c.676dupA, NM_004750.4:c.538C>T, NM_004750.4:c.527+5G>A, NM_004750.4:c.413C>T, NM_004750.4:c.397+1G>A, NM_004750.4:c.303delC, NM_004750.4:c.226T>GCold-induced sweating syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRLF1 gene located on chromosomal region 19p12. The age of onset is infantile. This disease is characterized by profuse sweating (involving the chest, face, arms and trunk) induced by cold ambient temperature kyphoscoliosis, a high-arched palate, depressed nasal bridge and impaired peripheral sensitivity to pain and temperature. The prevalence is <1:1,000,000.600
CRTAPOsteogenesis imperfecta, type 7NM_006371.4NM_006371.4:c.180G>A, NM_006371.4:c.561T>G, NM_006371.4:c.634C>T, NM_006371.4:c.826C>TOsteogenesis imperfecta type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRTAP gene located on chromosomal region 3p22.3. The age of onset is variable. This disease is characterized by increased bone fragility, low bone mass, and susceptibility to bone fractures with variable severity. The prevalence is 6:100,000-7:100,000.600
CSTBEpilepsy, progressive myoclonic type 1A (Unverricht and Lundborg)NM_000100.3NM_000100.3:c.212A>C, NM_000100.3:c.202C>TProgressive myoclonic epilepsy type 1A (Unverricht and Lundborg) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CSTB gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by severe, stimulus-sensitive myoclonus and tonic-clonic seizures. The onset, occurring between 6 and 13 years of age, is characterized by convulsions. Myoclonus begins 1 to 5 years later. The twitchings occur predominantly in the proximal muscles of the extremities and are bilaterally symmetrical, although asynchronous. At first small, they become late in the clinical course so violent that the victim is thrown to the floor. Mental deterioration and eventually dementia develop. The prevalence is 1:20,000 newborn.600
CTNSCystinosis (atypical/juvenile/ocular) nephropathicNM_001031681.2NM_001031681.2:c.283G>T, NM_001031681.2:c.329G>T, NM_001031681.2:c.357_360delCAGC, NM_001031681.2:c.397_398delAT, NM_001031681.2:c.414G>A, NM_001031681.2:c.416C>T, NM_001031681.2:c.506G>A, NM_001031681.2:c.589G>A, NM_001031681.2:c.646dupA, NM_001031681.2:c.853-3C>G, NM_001031681.2:c.1015G>ANephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. This disease is characterized by hypothyroidism, insulin-dependent diabetes, hepatosplenomegaly with portal hypertension, and muscle, cerebral and ocular involvement, caused by cystine deposits in various organs. The prevalence is 1:100,000-1:200,000.600,25
CTSDCeroid lipofuscinosis, neuronal, type 10NM_001909.4NM_001909.4:c.1149G>C, NM_001909.4:c.685T>ANeuronal ceroid lipofuscinosis type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSD gene located on chromosomal region 11p15.5. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 2:100,000-4:100,000 newborn.600
CTSKPycnodysostosisNM_000396.3NM_000396.3:c.926T>C, NM_000396.3:c.721C>T, NM_000396.3:c.436G>C, NM_000396.3:c.236G>A, NM_000396.3:c.154A>TPycnodysostosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSK gene located on chromosomal region 1q21. The age of onset is variable. This disease is characterized by osteosclerosis, short stature or dwarfism, acroosteolysis of the distal phalanges, fragile bones associated with spontaneous fractures and dysplasia of the clavicles. The prevalence is 1/1,000,000 to 9/1,000,000.600,25
CYP21A2Congenital adrenal hyperplasia due to 21-hydroxylase deficiency-0NM_000500.7:c.92C>T, NM_000500.7:c.293-13A/C>G, NM_000500.7:c.332_339del, NM_000500.7:c.518T>A, NM_000500.7:c.[710T>A;713T>A;719T>A], NM_000500.7:c.710T>A, NM_000500.7:c.713T>A, NM_000500.7:c.844G>T, NM_000500.7:c.923_924insT, NM_000500.7:c.955C>T, NM_000500.7:c.1069C>T, NM_000500.7:c.1360C>T, NM_000500.7:c.[710T>A;713T>A], NM_000500.7:c.[710T>A;719T>A], NM_000500.7:c.[713T>A;719T>A], Abnormal CNV, Large gene conversion, NM_000500.7:c.955C>T+CYP21A2dupClassic congenital adrenal hyperplasia due to 21-hydroxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP21A2 gene located on chromosomal region 6p21.3. The age of onset is neonatal/infantile. This disease is characterized by simple virilizing or salt wasting forms that can manifest with genital ambiguity in females, and in both sexes with adrenal insufficiency with dehydration during the neonatal period, life threatening hypoglycemia and hyperandrogenia. The prevalence is 1/100,000 to 9/100,000. There is a common milder form of congenital adrenal hyperplasia (Nonclassic) characterized by a later onset of androgen excess symptoms seen in females and precocious pseudopuberty in both sexes. Cortisol and aldosterone levels are normal but there is an increased amount of androgens. Nonclassic form onset occurs in adolescence with variable degrees of postnatal androgen excess (precocious pubarche, hirsutism, acne, alopecia, anovulation and menstrual irregularies and in the post-pubertal period it can mimic polycystic ovary syndrome. It is also sometimes asymptomatic. The prevalence ranges from 1/1,000-1/500 in the general Caucasian population, but up to 1-2% among inbred populations, such as Eastern European (Ashkenazi) Jews.600
CYP4V2Bietti crystalline corneoretinal dystrophyNM_207352.3NM_207352.3:c.130T>A, NM_207352.3:c.327+1G>A, NM_207352.3:c.332T>C, NM_207352.3:c.1523G>ABietti crystalline corneoretinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP4V2 gene located on chromosomal region 4q35.2. The age of onset is adult. This disease is characterized by nightblindness, decreased vision, paracentral scotoma, and, in the end stages of the disease, legal blindness.600,25
CYP7B1Spastic paraplegia type 5A, autosomal recessiveNM_004820.4NM_004820.4:c.1460dupT, NM_004820.4:c.1456C>T, NM_004820.4:c.1162C>T, NM_004820.4:c.889A>G, NM_004820.4:c.825T>A, NM_004820.4:c.321_324delACAA, NM_004820.4:c.187C>TSpastic paraplegia type 5A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. The prevalence is below 1,000,000.600,25
D2HGDHD-2-hydroxyglutaric aciduriaNM_152783.4NM_152783.4:c.440T>G, NM_152783.4:c.1123G>T, NM_152783.4:c.1315A>G, NM_152783.4:c.1331T>C, NM_152783.4:c.1333_1334delACD-2-Hydroxyglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the D2HGDH gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by extremely variable clinical manifestations, with severe cases characterized by neonatal or early infantile-onset epileptic encephalopathy, and marked hypotonia, and cerebral visual failure, developmental delay, seizures, involuntary movements, and cardiomyopathy are also common in these cases. The prevalence is below 1,000,000.600,25
DBTMaple syrup urine disease, type 2NM_001918.3NM_001918.3:c.1281+1G>A, NM_001918.3:c.939G>C, NM_001918.3:c.901C>T, NM_001918.3:c.871C>T, NM_001918.3:c.827T>G, NM_001918.3:c.772+1G>A, NM_001918.3:c.670G>T, NM_001918.3:c.581C>G, NM_001918.3:c.294C>G, NM_001918.3:c.272_275delCAGT, NM_001918.3:c.126T>GMaple syrup urine disease, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DBT gene located on chromosomal region 1p21.2. The age of onset in neonatal/infantil. This disease is characterized by a maple syrup odor to the urine, deficient diet, lethargy and focal dystonia, followed by progressive encephalopathy and central respiratory failure if not treated. The prevalence is 1-5/10,000.600,25
DCLRE1COmenn syndrome; Severe combined immunodeficiency, Athabascan typeNM_001033855.2NM_001033855.2:c.1639G>T, NM_001033855.2:c.1558dupA, NM_001033855.2:c.780+1delG, NM_001033855.2:c.597C>A, NM_001033855.2:c.2T>COmenn syndrome and Athabascan type severe combined immunodeficiency follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the DCLRE1C gene located on chromosomal region 10p13. Omenn syndrome has an early age of onset and it is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. The age of onset of Athabascan type severe combined immunodeficiency is neonatal/infantile and it is characterized by severe and recurrent infections, diarrhea, failure to thrive, and cell sensitivity to ionizing radiation. The prevalence is 1-9/1,000,000.600,25
DDB2Xeroderma pigmentosum, group ENM_000107.2NM_000107.2:c.730A>G, NM_000107.2:c.818G>A, NM_000107.2:c.919G>T, NM_000107.2:c.937C>TXeroderma pigmentosum complementation group E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DDB2 gene located on chromosomal region 11p12-p11. The age of onset is variable. This disease is characterized by mild xeroderma pigmentosum symptoms and no neurological abnormalities. The prevalence is 1/1,000,000.600
DDCAromatic L-amino acid decarboxylase deficiencyNM_000790.3NM_000790.3:c.1040G>A, NM_000790.3:c.823G>A, NM_000790.3:c.749C>T, NM_000790.3:c.304G>A, NM_000790.3:c.272C>T, NM_000790.3:c.100delGAromatic L-amino acid decarboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DDC gene located on chromosomal region 7p12.2. The age of onset is neonatal/infantile. This disease is characterized by severe developmental delay, weak muscle tone (hypotonia), muscle stiffness, difficulty moving, and involuntary writhing movements of the limbs (athetosis). The prevalence is below 1,000,000.600
DGUOKDGUOK-related mitochondrial DNA depletion syndromeNM_080916.2NM_080916.2:c.137A>G, NM_080916.2:c.313C>T, NM_080916.2:c.425G>A, NM_080916.2:c.494A>T, NM_080916.2:c.707+2T>G, NM_080916.2:c.763G>TMitochondrial DNA depletion syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DGUOK gene located on chromosomal region 2p13. The age of onset is neonatal/infantile. This disease is characterized by progressive liver failure, hypoglycemia and neurologic abnormalities including hypotonia, encephalopathy and peripheral neuropathy600,25
DHCR7Smith-Lemli-Opitz syndromeNM_001163817.1NM_001163817.1:c.1342G>A, NM_001163817.1:c.1337G>A, NM_001163817.1:c.1228G>A, NM_001163817.1:c.1210C>T, NM_001163817.1:c.1055G>A, NM_001163817.1:c.1054C>T, NM_001163817.1:c.976G>T, NM_001163817.1:c.964-1G>C, NM_001163817.1:c.907G>A, NM_001163817.1:c.866C>T, NM_001163817.1:c.841G>A, NM_001163817.1:c.839A>G, NM_001163817.1:c.832-1G>C, NM_001163817.1:c.744G>T, NM_001163817.1:c.730G>A, NM_001163817.1:c.725G>A, NM_001163817.1:c.724C>T, NM_001163817.1:c.506C>T, NM_001163817.1:c.461C>G, NM_001163817.1:c.453G>A, NM_001163817.1:c.452G>A, NM_001163817.1:c.356A>T, NM_001163817.1:c.292C>T, NM_001163817.1:c.278C>T, NM_001163817.1:c.151C>T, NM_001163817.1:c.1A>GSmith-Lemli-Opitz syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHCR7 gene located on chromosomal region 11q13.4. The age of onset is neonatal/infantile. This disease is characterized by multiple congenital anomalies, intellectual deficit, and behavioral problems.ﾠThe prevalence is 1/20,000 to 1/40,000 newborn.600,25
DHDDSRetinitis pigmentosa type 59NM_024887.3NM_024887.3:c.124A>G, NM_024887.3:c.330delA, NM_024887.3:c.998C>GRetinitis pigmentosa type 59 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHDDS gene located on chromosomal region 1p36.11. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000.600
DKC1Dyskeratosis congenita, X-linkedNM_001363.4NM_001363.4:c.91C>A, NM_001363.4:c.91C>G, NM_001363.4:c.194G>C, NM_001363.4:c.196A>G, NM_001363.4:c.200C>T, NM_001363.4:c.204C>A, NM_001363.4:c.214_215delCTinsTAX-linked dyskeratosis congenita follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DKC1 gene located on chromosomal region Xq28. Tha age of onset is infantile. This disease is classically defined by the triad of abnormal skin pigmentation, nail dystrophy, and leukoplakia of the oral mucosa. Progressive bone marrow failure occurs in over 80% of cases and is the main cause of early mortality. The phenotype is highly variable, and affected individuals may have multiple additional features.600
DLDDihydrolipoamide dehydrogenase deficiencyNM_000108.4NM_000108.4:c.105_106insA, NM_000108.4:c.916_926delTGTGATGTACT, NM_000108.4:c.1483A>GDihydrolipoamide dehydrogenase deficiency E3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DLD gene located on chromosomal region 7q31-q32. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting and a maple syrup odor in the cerumen (and later in urine) noted soon after birth, followed by progressive encephalopathy and central respiratory failure if untreated. The prevalence is 1/1,000,000 to 9/1,000,000.600
DLL3Spondylocostal dysostosis type 1NM_016941.3NM_016941.3:c.231C>A, NM_016941.3:c.712C>TSpondylocostal dysostosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DLL3 gene located on chromosomal region 19q13. The age of onset is neonatal/infantile. This disease is associated with vertebral and rib segmentation defects and characterised by a short neck with limited mobility, winged scapulae, a short trunk, and short stature with multiple vertebral anomalies at all levels of the spine. The prevalence is below 1/1,000,000.600
DMDDuchenne/Becker muscular dystrophy-0NM_004006.2:c.10774delA, NM_004006.2:c.10454delT, NM_004006.2:c.10453_10454delCT, NM_004006.2:c.10447_10448delTC, NM_004006.2:c.10141C>T, NM_004006.2:c.10086+1G>A, NM_004006.2:c.10033C>T, NM_004006.2:c.9854_9863delTGAGACTGGA, NM_004006.2:c.9862G>T, NM_004006.2:c.9851G>A, NM_004006.2:c.9767dupG, NM_004006.2:c.9650-2A>G, NM_004006.2:c.9568C>T, NM_004006.2:c.9564-1G>A, NM_004006.2:c.9380C>G, NM_004006.2:c.9361+1G>C, NM_004006.2:c.9361+1G>A, NM_004006.2:c.9346C>T, NM_004006.2:c.9337C>T, NM_004006.2:c.9164-1G>T, NM_004006.2:c.9164-1G>C, NM_004006.2:c.8944C>T, NM_004006.2:c.8713C>T, NM_004006.2:c.8656C>T, NM_004006.2:c.8652_8653delCT, NM_004006.2:c.8608C>T, NM_004006.2:c.8464C>T, NM_004006.2:c.8443C>T, NM_004006.2:c.8374_8375delAA, NM_004006.2:c.8358G>A, NM_004006.2:c.8086delC, NM_004006.2:c.8069T>G, NM_004006.2:c.8064_8065delTA, NM_004006.2:c.7922delA, NM_004006.2:c.7894C>T, NM_004006.2:c.7771G>T, NM_004006.2:c.7764dupT, NM_004006.2:c.7683G>A, NM_004006.2:c.7682G>A, NM_004006.2:c.6986dupA, NM_004006.2:c.6982A>T, NM_004006.2:c.6964delG, NM_004006.2:c.6943G>T, NM_004006.2:c.6936delA, NM_004006.2:c.6906G>A, NM_004006.2:c.6834delT, NM_004006.2:c.6763-2A>G, NM_004006.2:c.6391_6392dupCA, NM_004006.2:c.6391_6392delCA, NM_004006.2:c.6373C>T, NM_004006.2:c.6340A>T, NM_004006.2:c.6292C>T, NM_004006.2:c.6238delC, NM_004006.2:c.6226G>T, NM_004006.2:c.6182delC, NM_004006.2:c.6014_6017delCTCA, NM_004006.2:c.6000T>A, NM_004006.2:c.5899C>T, NM_004006.2:c.5807T>A, NM_004006.2:c.5773G>T, NM_004006.2:c.5697delA, NM_004006.2:c.5671A>T, NM_004006.2:c.5640T>A, NM_004006.2:c.5570_5571dupAA, NM_004006.2:c.5554C>T, NM_004006.2:c.5530C>T, NM_004006.2:c.5363C>G, NM_004006.2:c.5353C>T, NM_004006.2:c.5313dupT, NM_004006.2:c.5287C>T, NM_004006.2:c.4843A>T, NM_004006.2:c.4735G>T, NM_004006.2:c.4518+5G>A, NM_004006.2:c.4500delA, NM_004006.2:c.4486delG, NM_004006.2:c.4471_4472delAA, NM_004006.2:c.4409_4412dupGTCT, NM_004006.2:c.4405C>T, NM_004006.2:c.4375C>T, NM_004006.2:c.4117C>T, NM_004006.2:c.3779_3785delCTTTGGAinsGG, NM_004006.2:c.3747delG, NM_004006.2:c.3697delC, NM_004006.2:c.3639dupA, NM_004006.2:c.3432+3A>G, NM_004006.2:c.3432+1G>A, NM_004006.2:c.3295C>T, NM_004006.2:c.3276+1G>A, NM_004006.2:c.3246_3247insTTTCTAAAAA, NM_004006.2:c.3124A>T, NM_004006.2:c.3121C>T, NM_004006.2:c.3087G>A, NM_004006.2:c.3076G>T, NM_004006.2:c.3022A>T, NM_004006.2:c.2929dupC, NM_004006.2:c.2866C>T, NM_004006.2:c.2815_2816delTT, NM_004006.2:c.2816T>A, NM_004006.2:c.2804-1G>A, NM_004006.2:c.2804-2A>T, NM_004006.2:c.2803+1G>T, NM_004006.2:c.2803+1G>A, NM_004006.2:c.2758C>T, NM_004006.2:c.2755A>T, NM_004006.2:c.2650C>T, NM_004006.2:c.2547delT, NM_004006.2:c.2523delA, NM_004006.2:c.2484T>G, NM_004006.2:c.2479delG, NM_004006.2:c.2380+2T>C, NM_004006.2:c.2380+1G>C, NM_004006.2:c.2332C>T, NM_004006.2:c.2302C>T, NM_004006.2:c.2294_2297delCCAT, NM_004006.2:c.2281_2285delGAAAA, NM_004006.2:c.2137C>T, NM_004006.2:c.2125delC, NM_004006.2:c.1900_1903dupAAGT, NM_004006.2:c.1900A>T, NM_004006.2:c.1886C>A, NM_004006.2:c.1734delA, NM_004006.2:c.1529_1530delTC, NM_004006.2:c.1489C>T, NM_004006.2:c.1371delG, NM_004006.2:c.1341_1342dupAG, NM_004006.2:c.1332-9A>G, NM_004006.2:c.1306dupG, NM_004006.2:c.1286C>A, NM_004006.2:c.1261C>T, NM_004006.2:c.1070delC, NM_004006.2:c.1048G>T, NM_004006.2:c.1012G>T, NM_004006.2:c.676_678delAAG, NM_004006.2:c.627delA, NM_004006.2:c.615T>A, NM_004006.2:c.583C>T, NM_004006.2:c.530+1delG, NM_004006.2:c.489G>A, NM_004006.2:c.433C>T, NM_004006.2:c.412_413delAA, NM_004006.2:c.251delT, NM_004006.2:c.220delC, NM_004006.2:c.204dupC, NM_004006.2:c.199G>T, NM_004006.2:c.160_162delCTC, NM_004006.2:c.137_138dupAT, NM_004006.2:c.133C>T, delDuchenne, insDuchenne, delBecker, insBeckerDuchenne muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/3,300 male newborns and the prevalence is 1/16,000 to 1/125,000. Becker muscular dystrophy is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/18,000 to 1/31,000 male newborns and the prevalence is 1/10,000 to 5/10,000.600
DMP1Hypophosphatemic rickets, autosomal recessiveNM_004407.3NM_004407.3:c.1A>G, NM_004407.3:c.31delT, NM_004407.3:c.55-1G>C, NM_004407.3:c.362delCHypophosphatemic rickets follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DMP1 gene located on chromosomal region 4q21. The age of onset is variable. This disease is associated with vertebral and rib segmentation defects and characterised by hypophosphatemia, rickets and/or osteomalacia and slow growth. The prevalence is below 1/20,000 newborns.600
DNAJC193-methylglutaconic aciduria, type 5NM_145261.3NM_145261.3:c.300delA3-methylglutaconic aciduria, type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DNAJC19 gene located on chromosomal region 3q26.33. The age of onset is infantile. This disease is characterized by severe early onset (before the age of three years) dilated cardiomyopathy with conduction defects (long QT syndrome), non-progressive cerebellar ataxia, testicular dysgenesis, and 3-methylglutaconic aciduria.600
DPAGT1Congenital disorder of glycosylation, type 1jNM_001382.3NM_001382.3:c.980_981delCT, NM_001382.3:c.791T>G, NM_001382.3:c.643+1G>A, NM_001382.3:c.358C>A, NM_001382.3:c.349G>ACongenital disorder of glycosylation, type 1j follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPAGT1 gene located on chromosomal region 11q23.3. The age of onset is neonatal/infantile. This disease is characterized by severe psychomotor delay, seizures, hypotonia and dysmorphism (microcephaly, ocular exotropia, micrognathia and clinodactyly). The prevalence is below 1,000,000.600
DPM1Congenital disorder of glycosylation, type 1eNM_001317034.1NM_001317034.1:c.847T>C, NM_001317034.1:c.784-1G>T, NM_001317034.1:c.733delC, NM_001317034.1:c.669-1G>A, NM_001317034.1:c.274C>GCongenital disorder of glycosylation, type 1e follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPM1 gene located on chromosomal region 20q13.13. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay, seizures, hypotonia, facial dysmorphism and microcephaly. The prevalence is below 1,000,000.600
DPYDDihydropyrimidine dehydrogenase deficiencyNM_000110.3NM_000110.3:c.1905+1G>A, NM_000110.3:c.1679T>G, NM_000110.3:c.1109_1110delTA, NM_000110.3:c.299_302delTCATDihydropyrimidine dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPYD gene located on chromosomal region 1p22. This disease shows large phenotypic variability, ranging from no symptoms to a convulsive disorder with motor and mental retardation in homozygous patients. In people with severe dihydropyrimidine dehydrogenase deficiency, the disorder becomes apparent in infancy. These affected individuals have recurrent seizures (epilepsy), intellectual disability, a small head size (microcephaly), increased muscle tone (hypertonia), delayed development of motor skills such as walking, and autistic behaviors that affect communication and social interaction. The prevalence is unknow.
In addition, homozygous and heterozygous mutation carriers can develop severe toxicity after the administration of the antineoplastic drug 5-fluorouracil (5FU).		600,25
DSPCardiomyopathy, dilated, with woolly hair and keratoderma; Epidermolysis bullosa, lethal acantholyticNM_004415.3NM_004415.3:c.3098delA, NM_004415.3:c.5800C>T, NM_004415.3:c.6370_6371delCT, NM_004415.3:c.7000C>T, NM_004415.3:c.7180_7181delAG, NM_004415.3:c.8188C>TDilated cardiomyopathy with woolly hair and keratoderma, known as Carvajal syndrome, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterized by woolly hair is present at birth and the palmoplantar keratoderma appears during the first year of life. The cardiac anomaly presents during childhood and is marked by dilation of the left ventricle accompanied by alterations in muscle contractility. The dilated cardiomyopathy may lead to life-threatening congestive heart failure and death. The prevalence is below 1,000,000. Furthermore, mutations in the DSP gene have been identified in people with an autosomal recessive disorder called lethal acantholytic epidermolysis bullosa. Features of this condition include very fragile skin that blisters and detaches easily, a complete absence of hair (alopecia), abnormal or missing fingernails, teeth that are present from birth (neonatal teeth), and abnormalities of the heart muscle (cardiomyopathy). The skin abnormalities lead to a severe loss of fluids and death in early infancy.600,25
DYSFMiyoshi muscular dystrophy, type 1; Muscular dystrophy, limb-girdle, autosomal recessive, type 2 NM_001130978.1NM_001130978.1:c.1481-1G>AMiyoshi muscular dystrophy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is young adulthood. This disease is characterized by weakness and atrophy in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000. Mutations in the DYSF gene can also cause muscular dystrophy, limb-girdle, autosomal recessive, type 2. This disease is characterized by an onset in late adolescence or early adulthood of slowly progressive, proximal weakness and atrophy of shoulder and pelvic girdle muscles. Cardiac and respiratory muscles are not involved. Hypertrophy of the calf muscles and highly elevated serum creatine kinase levels are frequently observed.600,25
DYSFMiyoshi muscular dystrophy, type 1; Muscular dystrophy, limb-girdle, autosomal recessive, type 2 NM_001130987.1NM_001130987.1:c.203_204delTGinsAT, NM_001130987.1:c.396_397delCC, NM_001130987.1:c.706C>T, NM_001130987.1:c.759+1G>C, NM_001130987.1:c.797G>A, NM_001130987.1:c.853C>T, NM_001130987.1:c.991G>A, NM_001130987.1:c.991G>T, NM_001130987.1:c.1033+1G>A, NM_001130987.1:c.1149+1G>A, NM_001130987.1:c.1372G>A, NM_001130987.1:c.1380+2T>C, NM_001130987.1:c.1464C>A, NM_001130987.1:c.1488dupA, NM_001130987.1:c.1494-2A>G, NM_001130987.1:c.1494-1G>A, NM_001130987.1:c.1609G>A, NM_001130987.1:c.1674delA, NM_001130987.1:c.1692+2T>A, NM_001130987.1:c.1717C>T, NM_001130987.1:c.1867C>T, NM_001130987.1:c.1888C>T, NM_001130987.1:c.1927G>T, NM_001130987.1:c.2924_2928delAGACC, NM_001130987.1:c.2923C>T, NM_001130987.1:c.3051G>T, NM_001130987.1:c.3095A>G, NM_001130987.1:c.3166C>T, NM_001130987.1:c.3229-2A>T, NM_001130987.1:c.3498_3499delTGinsAA, NM_001130987.1:c.3531C>A, NM_001130987.1:c.3532C>T, NM_001130987.1:c.3695delC, NM_001130987.1:c.3762delA, NM_001130987.1:c.3859G>T, NM_001130987.1:c.3957+1delG, NM_001130987.1:c.4011delC, NM_001130987.1:c.4144C>T, NM_001130987.1:c.4162_4163delGT, NM_001130987.1:c.4307G>A, NM_001130987.1:c.4873C>T, NM_001130987.1:c.4989_4993delGCCCGinsCCCC, NM_001130987.1:c.5194C>T, NM_001130987.1:c.5318A>G, NM_001130987.1:c.5383C>T, NM_001130987.1:c.5458-2A>C, NM_001130987.1:c.5546G>A, NM_001130987.1:c.5546+1G>T, NM_001130987.1:c.5614G>T, NM_001130987.1:c.5626G>A, NM_001130987.1:c.5642+1G>A, NM_001130987.1:c.5711delG, NM_001130987.1:c.5761C>T, NM_001130987.1:c.5815_5816delAG, NM_001130987.1:c.5830C>T, NM_001130987.1:c.5953_5956delCAGC, NM_001130987.1:c.6096dupA, NM_001130987.1:c.6109G>T, NM_001130987.1:c.6241C>TMiyoshi muscular dystrophy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is young adulthood. This disease is characterized by weakness and atrophy in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000. Mutations in the DYSF gene can also cause muscular dystrophy, limb-girdle, autosomal recessive, type 2. This disease is characterized by an onset in late adolescence or early adulthood of slowly progressive, proximal weakness and atrophy of shoulder and pelvic girdle muscles. Cardiac and respiratory muscles are not involved. Hypertrophy of the calf muscles and highly elevated serum creatine kinase levels are frequently observed.600,25
EDAEctodermal dysplasia, type 1, hypohidrotic, X-linkedNM_001399.4NM_001399.4:c.181T>C, NM_001399.4:c.183C>G, NM_001399.4:c.187G>A, NM_001399.4:c.463C>T, NM_001399.4:c.466C>T, NM_001399.4:c.467G>A, NM_001399.4:c.573_574insT, NM_001399.4:c.671G>C, NM_001399.4:c.826C>T, NM_001399.4:c.1045G>AHypohidrotic ectodermal dysplasia, type 1, hypohidrotic, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EDA gene located on chromosomal region Xq12-q13.1. The age of onset is neonatal/infantile. This disease is characterized by malformation of ectodermal structures such as skin, hair, teeth and sweat glands. The prevalence is 1/5,000 to 1/10,000 newborns.600,25
EDN3Waardenburg syndrome, type 4BNM_207034.2NM_207034.2:c.262_263delGCinsT, NM_207034.2:c.277C>G, NM_207034.2:c.476G>T, NM_207034.2:c.568_569delGAWaardenburg-Shah syndrome, type 4B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EDN3 gene located on chromosomal region 20q13.2-q13.3. The age of onset is neonatal/infantile. This disease is characterized by the association of Waardenburg syndrome (sensorineural hearing loss and pigmentary abnormalities) and Hirschsprung disease (signs of intestinal obstruction). The prevalence is below 1/40,000.600
EDNRBABCD syndromeNM_001201397.1NM_001201397.1:c.1098G>T, NM_001201397.1:c.818C>G, NM_001201397.1:c.46delCABCD syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EDNRB gene located on chromosomal region 13q22.3. This disease is characterized by albinism, black lock at temporal occipital region, bilateral deafness, aganglionosis of the large intestine and total absence of neurocytes and nerve fibers in the small intestine. ABCD syndrome is not a separate entity, but rather an expression of Shah-Waardenburg syndrome (WS4)600
EIF2AK3Wolcott-Rallison syndromeNM_004836.6NM_004836.6:c.1763G>A, NM_004836.6:c.994G>TWolcott-Rallison syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EIF2AK3 gene located on chromosomal region 2p12. The age of onset is neonatal/infantile. This disease is characterized by permanent neonatal diabetes mellitus with multiple epiphyseal dysplasia and other clinical manifestations, including recurrent episodes of acute liver failure. The prevalence is above 1/10,000 newborns.600
ELP1Dysautonomia, familialNM_003640.4NM_003640.4:c.3332delC, NM_003640.4:c.2741C>T, NM_003640.4:c.2328delT, NM_003640.4:c.2204+6T>C, NM_003640.4:c.2087G>C, NM_003640.4:c.1460+2T>CFamilial dysautonomia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ELP1 gene located on chromosomal region 9q31.3. The age of onset is infantile. This disease is characterized by sensory dysfunction and severe impairment of the autonomic nervous system activity, resulting in multisystem dysfunction. The prevalence is <1:1,000,000600
EMDEmery-Dreifuss muscular dystrophy, type 1, X-linkedNM_000117.2NM_000117.2:c.547C>A, NM_000117.2:c.631_635delCGTGCEmery-Dreifuss muscular dystrophy, type 1, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EMD gene located on chromosomal region Xq28. ﾠThis is a condition that primarily affects muscles used for movement (skeletalﾠmuscles) and the heart (cardiac muscle). Among the earliest features of this disorder are joint deformities called contractures. Contractures restrict the movement of certain joints, most often the elbows, ankles, and neck, and usually become noticeable in early childhood. Most affected individuals also experience muscle weakness andﾠwastingﾠthat worsen slowly over time, beginning in muscles of the upper arms and lower legs and later also affecting muscles in the shoulders and hips. Almost all people with Emery-Dreifuss muscular dystrophy develop heart problems by adulthood. The X-linked type of this disorder affects an estimated 1 in 100,000 people.600
ENPP1Arterial calcification, generalized, of infancy, type 1NM_006208.2NM_006208.2:c.783C>G, NM_006208.2:c.797G>T, NM_006208.2:c.900G>A, NM_006208.2:c.913C>A, NM_006208.2:c.1025G>T, NM_006208.2:c.1112A>T, NM_006208.2:c.1612G>C, NM_006208.2:c.2230C>T, NM_006208.2:c.2677G>T, NM_006208.2:c.2702A>CArterial calcification, generalized, of infancy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENPP1 gene located on chromosomal region 6q22-q23. The age of onset is neonatal/infancy. A severe autosomal recessive disorder characterized by calcification of the internal elastic lamina of muscular arteries and stenosis due to myointimal proliferation. The disorder is often fatal within the first 6 months of life because of myocardial ischemia resulting in refractory heart failure.600
ERCC2Trichothiodystrophy, type 1NM_000400.3NM_000400.3:c.2230_2233dupCTAG, NM_000400.3:c.2176C>T, NM_000400.3:c.2047C>T, NM_000400.3:c.1972C>T, NM_000400.3:c.1703_1704delTT, NM_000400.3:c.1621A>C, NM_000400.3:c.1454T>C, NM_000400.3:c.1381C>G, NM_000400.3:c.1354C>T, NM_000400.3:c.1308-1G>A, NM_000400.3:c.950-2A>G, NM_000400.3:c.949+1G>A, NM_000400.3:c.719-1G>A, NM_000400.3:c.567G>A, NM_000400.3:c.183+2T>ATrichothiodystrophy (TTD), type 1 is a heterogeneous group of disorders that follows an autosomal recessive pattern of inheritance. It is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.32. The age of onset is neonatal or infantile. This disease, with variable clinical expression, is characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. About half of the patients with TTD exhibit marked photosensitivity.600,25
ERCC3Trichothiodystrophy, type 2NM_000122.1NM_000122.1:c.1858delG, NM_000122.1:c.1757_1758delAG, NM_000122.1:c.1757delA, NM_000122.1:c.1633C>T, NM_000122.1:c.1273C>T, NM_000122.1:c.296T>CTrichothiodystrophy (TTD), type 2 is a heterogeneous group of disorders that follows an autosomal recessive pattern of inheritance. It is caused by pathogenic variants in the ERCC3 gene located on chromosomal region 2q14.3. The age of onset is neonatal or infantile. This disease, with variable clinical expression, is characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. About half of the patients with TTD exhibit marked photosensitivity.600
ERCC5Cerebrooculofacioskeletal syndrome, type 3NM_000123.3NM_000123.3:c.88+2T>C, NM_000123.3:c.215C>A, NM_000123.3:c.381-2A>G, NM_000123.3:c.406C>T, NM_000123.3:c.464dupA, NM_000123.3:c.526C>T, NM_000123.3:c.787C>T, NM_000123.3:c.2144dupA, NM_000123.3:c.2375C>T, NM_000123.3:c.2573T>C, NM_000123.3:c.2751delACerebrooculofacioskeletal syndrome type 3, also known as COFS syndrome, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC5 gene located on chromosomal region 13q33.1. COFS syndrome is characterized by prenatal onset of arthrogryposis, microcephaly and growth failure. Postnatal features include severe developmental delay, congenital cataracts (in some), and marked UV sensitivity of the skin. Survival beyond 6 years of age is rare. The prevalence is below 1/1,000,000.600,25
ERCC6Cockayne syndrome, type B; Cerebrooculofacioskeletal syndrome, type 1NM_000124.3NM_000124.3:c.3862C>T, NM_000124.3:c.3591_3592dupGA, NM_000124.3:c.2587C>T, NM_000124.3:c.2203C>T, NM_000124.3:c.2047C>T, NM_000124.3:c.1550G>A, NM_000124.3:c.1357C>T, NM_000124.3:c.422+1G>A, NM_000124.3:c.207dupG, NM_000124.3:c.48_49delCTCockayne syndrome (CS), type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterized by short stature, a characteristic facial appearance, premature aging, photosensitivity, progressive neurological dysfunction, and intellectual deficit. Mutations in the ERRC6 gene have been also found in patients with COFS syndrome type 1, an extreme prenatal form of the CS clinical spectrum. This autosomal recessive progressive neurodegenerative disorder is characterized by microcephaly, congenital cataracts, severe mental retardation, facial dysmorphism, and arthrogryposis.600,25
ERCC8Cockayne syndrome, type ANM_000082.3NM_000082.3:c.966C>A, NM_000082.3:c.618-1G>A, NM_000082.3:c.593_594dupAT, NM_000082.3:c.37G>TCockayne syndrome, type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC8 gene located on chromosomal region 5q12.1. The age of onset is variable. This disease is characterized by short stature, a characteristic facial appearance, premature aging, photosensitivity, progressive neurological dysfunction, and intellectual deficit. The prevalence is 2.7/1,000,000 newborns in Western Europe.600
ESCO2Roberts syndromeNM_001017420.2NM_001017420.2:c.296_297dupGA, NM_001017420.2:c.308_309delAA, NM_001017420.2:c.505C>T, NM_001017420.2:c.604C>T, NM_001017420.2:c.876_879delCAGA, NM_001017420.2:c.879_880delAG, NM_001017420.2:c.1269G>A, NM_001017420.2:c.1597dupT, NM_001017420.2:c.1615T>GRoberts syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESCO2 gene located on chromosomal region 8p21.1. The age of onset is neonatal/infantile. This disease is characterized by pre- and postnatal growth retardation, severe symmetric limb reduction defects, craniofacial anomalies and severe intellectual deficit.600
ESPNDeafness, autosomal recessive, type 36NM_031475.2NM_031475.2:c.1988_1991delAGAG, NM_031475.2:c.2470_2473delTCAGAutosomal recessive nonsyndromic sensorineural deafness type 36 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESPN gene located on chromosomal region 1p36.31. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.600
ESRRBDeafness, autosomal recessive, type 35NM_004452.3NM_004452.3:c.329C>TAutosomal recessive nonsyndromic sensorineural deafness type 35 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESRRB gene located on chromosomal region 14q24.3. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.600
ETFAGlutaric acidemia, type 2ANM_000126.3NM_000126.3:c.797C>T, NM_000126.3:c.470T>GGlutaric acidemia, type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFA gene located on chromosomal region 15q23-q25. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.600
ETFBGlutaric acidemia, type 2BNM_001014763.1NM_001014763.1:c.887_889delAGA, NM_001014763.1:c.764G>A, NM_001014763.1:c.655G>A, NM_001014763.1:c.551_552insG, NM_001014763.1:c.334C>T, NM_001014763.1:c.278_279insGGlutaric acidemia, type 2B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFB gene located on chromosomal region 19q13.3. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.600
ETFDHGlutaric acidemia, type 2CNM_004453.3NM_004453.3:c.2T>C, NM_004453.3:c.250G>A, NM_004453.3:c.413T>G, NM_004453.3:c.524G>T, NM_004453.3:c.1001T>C, NM_004453.3:c.1234G>T, NM_004453.3:c.1367C>T, NM_004453.3:c.1570_1571delCT, NM_004453.3:c.1823delG, NM_004453.3:c.1832G>AGlutaric acidemia, type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFDH gene located on chromosomal region 4q32-q35. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.600
ETHE1Ethylmalonic encephalopathyNM_014297.4NM_014297.4:c.604dupG, NM_014297.4:c.554T>G, NM_014297.4:c.488G>A, NM_014297.4:c.487C>T, NM_014297.4:c.440_450delACAGCATGGCC, NM_014297.4:c.221dupAEthylmalonic encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETHE1 gene located on chromosomal region 19q13.31. The age of onset is neonatal/infantile. This disease is characterized by elevated excretion of ethylmalonic acid with recurrent petechiae, orthostatic acrocyanosis and chronic diarrhoea associated with neurodevelopmental delay, psychomotor regression and hypotonia with brain magnetic resonance imaging abnormalities. The prevalence is below 1/1,000,000, with total of 30 cases of patients reported worldwide, mainly for Mediterranean and Arab populations.600
EYSRetinitis pigmentosa, type 25NM_001292009.1NM_001292009.1:c.9468T>A, NM_001292009.1:c.9362_9365delCTCA, NM_001292009.1:c.9099delT, NM_001292009.1:c.8711_8718delCATGCAGA, NM_001292009.1:c.8692_8695dupACAG, NM_001292009.1:c.8632G>T, NM_001292009.1:c.8471dupA, NM_001292009.1:c.7822C>T, NM_001292009.1:c.7095T>G, NM_001292009.1:c.6170delA, NM_001292009.1:c.6102dupT, NM_001292009.1:c.5928-2A>G, NM_001292009.1:c.5857G>T, NM_001292009.1:c.5757dupT, NM_001292009.1:c.4462_4469dupAGCCCCTC, NM_001292009.1:c.4350_4356delTATAGCT, NM_001292009.1:c.4120C>T, NM_001292009.1:c.4045C>T, NM_001292009.1:c.2826_2827delAT, NM_001292009.1:c.1211dupA, NM_001292009.1:c.571dupA, NM_001292009.1:c.490C>T, NM_001292009.1:c.232delT, NM_001292009.1:c.103C>TRetinitis pigmentosa, type 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EYS gene located on chromosomal region 6q12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000.600,25
F11Factor XI deficiency, autosomal recessiveNM_000128.3NM_000128.3:c.166T>C, NM_000128.3:c.403G>T, NM_000128.3:c.438C>A, NM_000128.3:c.595+3A>G, NM_000128.3:c.901T>C, NM_000128.3:c.1211C>A, NM_000128.3:c.1613C>T, NM_000128.3:c.1693G>AFactor XI deficiency, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F11 gene located on chromosomal region 4q35. The age of onset is variable. This disease is characterized by reduced levels and activity of factor XI resulting in moderate bleeding symptoms, usually occurring after trauma or surgery. The prevalence is 1/1,000,000 to 9/1,000,000.600,25
F8Hemophilia A-0Inv22Hemophilia A follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F8 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor VIII deficiency. The prevalence is 1/4,000 to 1/ 5,000 male newborns.600
F8Hemophilia ANM_000132.3NM_000132.3:c.7033_7040delTGCGAGGC, NM_000132.3:c.7034G>A, NM_000132.3:c.7031G>A, NM_000132.3:c.7030G>T, NM_000132.3:c.7030G>A, NM_000132.3:c.7021G>T, NM_000132.3:c.7016G>T, NM_000132.3:c.7012delC, NM_000132.3:c.6997delG, NM_000132.3:c.6996G>A, NM_000132.3:c.6995G>C, NM_000132.3:c.6988delC, NM_000132.3:c.6986C>T, NM_000132.3:c.6976C>G, NM_000132.3:c.6914_6918delATCAA, NM_000132.3:c.6915delT, NM_000132.3:c.6905T>C, NM_000132.3:c.6904T>G, NM_000132.3:c.6901-2A>G, NM_000132.3:c.6900+1G>A, NM_000132.3:c.6887delA, NM_000132.3:c.6870G>A, NM_000132.3:c.6869G>T, NM_000132.3:c.6857_6867delATGGCCATCAG, NM_000132.3:c.6865C>T, NM_000132.3:c.6842T>C, NM_000132.3:c.6839T>C, NM_000132.3:c.6836T>G, NM_000132.3:c.6836T>C, NM_000132.3:c.6825T>A, NM_000132.3:c.6804delA, NM_000132.3:c.6797delG, NM_000132.3:c.6797G>A, NM_000132.3:c.6796G>A, NM_000132.3:c.6780_6788delAGGAGTAAC, NM_000132.3:c.6786_6787insCAA, NM_000132.3:c.6760delC, NM_000132.3:c.6760C>T, NM_000132.3:c.6752T>A, NM_000132.3:c.6746T>G, NM_000132.3:c.6743G>C, NM_000132.3:c.6740_6741delAG, NM_000132.3:c.6739G>T, NM_000132.3:c.6738delA, NM_000132.3:c.6574+5G>C, NM_000132.3:c.6574+3A>C, NM_000132.3:c.6574+1G>T, NM_000132.3:c.6574+1G>A, NM_000132.3:c.6565_6566delGA, NM_000132.3:c.6551A>T, NM_000132.3:c.6548T>G, NM_000132.3:c.6544C>G, NM_000132.3:c.6537C>G, NM_000132.3:c.6533G>A, NM_000132.3:c.6520C>G, NM_000132.3:c.6515C>G, NM_000132.3:c.6501delC, NM_000132.3:c.6497delG, NM_000132.3:c.6494delC, NM_000132.3:c.6489delT, NM_000132.3:c.6488T>G, NM_000132.3:c.6482C>T, NM_000132.3:c.6482C>A, NM_000132.3:c.6477delT, NM_000132.3:c.6469_6470delAA, NM_000132.3:c.6465delA, NM_000132.3:c.6464_6465delAA, NM_000132.3:c.6449A>T, NM_000132.3:c.6430-3C>G, NM_000132.3:c.6273+1G>A, NM_000132.3:c.6269T>A, NM_000132.3:c.6263C>T, NM_000132.3:c.6253G>T, NM_000132.3:c.6250A>T, NM_000132.3:c.6243G>C, NM_000132.3:c.6242G>C, NM_000132.3:c.6239C>T, NM_000132.3:c.6213A>T, NM_000132.3:c.6194G>A, NM_000132.3:c.6136dupA, NM_000132.3:c.6134G>T, NM_000132.3:c.6130delC, NM_000132.3:c.6120T>A, NM_000132.3:c.6116-2A>G, NM_000132.3:c.6115+6T>A, NM_000132.3:c.6115+4A>G, NM_000132.3:c.6115+3G>T, NM_000132.3:c.6115+2T>C, NM_000132.3:c.6115+1G>A, NM_000132.3:c.6107A>G, NM_000132.3:c.6099delT, NM_000132.3:c.6089dupG, NM_000132.3:c.6084delG, NM_000132.3:c.6078_6079delTG, NM_000132.3:c.6070dupC, NM_000132.3:c.6046C>G, NM_000132.3:c.6037G>A, NM_000132.3:c.6016G>T, NM_000132.3:c.5999G>C, NM_000132.3:c.5964_5967dupGGAG, NM_000132.3:c.5961delA, NM_000132.3:c.5960_5961delAA, NM_000132.3:c.5954G>C, NM_000132.3:c.5953delC, NM_000132.3:c.5939A>C, NM_000132.3:c.5934T>G, NM_000132.3:c.5923dupA, NM_000132.3:c.5924T>A, NM_000132.3:c.5914_5915delAT, NM_000132.3:c.5894G>T, NM_000132.3:c.5888T>C, NM_000132.3:c.5884T>G, NM_000132.3:c.5881T>A, NM_000132.3:c.5879G>T, NM_000132.3:c.5869C>T, NM_000132.3:c.5861_5866delCTCAGG, NM_000132.3:c.5853A>C, NM_000132.3:c.5833A>G, NM_000132.3:c.5825G>T, NM_000132.3:c.5816C>A, NM_000132.3:c.5766C>A, NM_000132.3:c.5752delT, NM_000132.3:c.5721C>G, NM_000132.3:c.5719dupA, NM_000132.3:c.5719A>T, NM_000132.3:c.5712G>C, NM_000132.3:c.5697delC, NM_000132.3:c.5696dupT, NM_000132.3:c.5689_5690delCT, NM_000132.3:c.5686G>C, NM_000132.3:c.5680G>A, NM_000132.3:c.5675dupT, NM_000132.3:c.5674G>A, NM_000132.3:c.5348_5357delGAGCAGAAGT, NM_000132.3:c.5345T>G, NM_000132.3:c.5343T>A, NM_000132.3:c.5339C>T, NM_000132.3:c.5337delG, NM_000132.3:c.5330T>C, NM_000132.3:c.5321A>T, NM_000132.3:c.5308G>A, NM_000132.3:c.5301C>A, NM_000132.3:c.5291A>G, NM_000132.3:c.5269delT, NM_000132.3:c.5269T>C, NM_000132.3:c.5254delG, NM_000132.3:c.5251A>T, NM_000132.3:c.5243delA, NM_000132.3:c.5227_5228delAG, NM_000132.3:c.5220-1G>A, NM_000132.3:c.5012G>A, NM_000132.3:c.5010delT, NM_000132.3:c.4999delC, NM_000132.3:c.4996C>T, NM_000132.3:c.4987A>T, NM_000132.3:c.4979C>T, NM_000132.3:c.4969C>T, NM_000132.3:c.4942C>T, NM_000132.3:c.4935G>A, NM_000132.3:c.4934G>A, NM_000132.3:c.4926delA, NM_000132.3:c.4922dupT, NM_000132.3:c.4918G>T, NM_000132.3:c.4899delT, NM_000132.3:c.4895dupT, NM_000132.3:c.4895delT, NM_000132.3:c.4864G>A, NM_000132.3:c.4858delC, NM_000132.3:c.4848delC, NM_000132.3:c.4841delA, NM_000132.3:c.4828G>T, NM_000132.3:c.4825delA, NM_000132.3:c.4814C>A, NM_000132.3:c.4806delA, NM_000132.3:c.4805_4806delAA, NM_000132.3:c.4798A>T, NM_000132.3:c.4794G>T, NM_000132.3:c.4770T>A, NM_000132.3:c.4719_4729delTGCAAAGACTC, NM_000132.3:c.4720delG, NM_000132.3:c.4712_4715delAAAG, NM_000132.3:c.4694_4697delTTCT, NM_000132.3:c.4687delG, NM_000132.3:c.4686delA, NM_000132.3:c.4662_4663delGA, NM_000132.3:c.4658delA, NM_000132.3:c.4619delT, NM_000132.3:c.4561C>T, NM_000132.3:c.4542delT, NM_000132.3:c.4519delA, NM_000132.3:c.4512delG, NM_000132.3:c.4492_4496delGTTCT, NM_000132.3:c.4492_4493delGT, NM_000132.3:c.4492delG, NM_000132.3:c.4483delG, NM_000132.3:c.4483G>T, NM_000132.3:c.4474A>T, NM_000132.3:c.4473C>G, NM_000132.3:c.4473C>A, NM_000132.3:c.4460delA, NM_000132.3:c.4450delA, NM_000132.3:c.4446dupG, NM_000132.3:c.4430_4431delAG, NM_000132.3:c.4425_4426delAA, NM_000132.3:c.4423C>T, NM_000132.3:c.4408G>T, NM_000132.3:c.4382_4383delAC, NM_000132.3:c.4363C>T, NM_000132.3:c.4345G>T, NM_000132.3:c.4339dupG, NM_000132.3:c.4339delG, NM_000132.3:c.4318delT, NM_000132.3:c.4296_4300delTTCTC, NM_000132.3:c.4280delT, NM_000132.3:c.4272delC, NM_000132.3:c.4265_4266delAT, NM_000132.3:c.4242dupA, NM_000132.3:c.4241C>A, NM_000132.3:c.4201C>T, NM_000132.3:c.4199delC, NM_000132.3:c.4156C>T, NM_000132.3:c.4103delC, NM_000132.3:c.4094_4100delATTTGAC, NM_000132.3:c.4072C>T, NM_000132.3:c.4045delA, NM_000132.3:c.4035delA, NM_000132.3:c.4006C>T, NM_000132.3:c.3994_3997delAGAG, NM_000132.3:c.3991_3992delAA, NM_000132.3:c.3984dupA, NM_000132.3:c.3982C>T, NM_000132.3:c.3967C>T, NM_000132.3:c.3964C>T, NM_000132.3:c.3922G>T, NM_000132.3:c.3913C>T, NM_000132.3:c.3907_3911delACCAA, NM_000132.3:c.3902delA, NM_000132.3:c.3870dupA, NM_000132.3:c.3863dupC, NM_000132.3:c.3860delT, NM_000132.3:c.3851_3852delCA, NM_000132.3:c.3844A>T, NM_000132.3:c.3842_3844delAGAinsGG, NM_000132.3:c.3833delA, NM_000132.3:c.3830delC, NM_000132.3:c.3827C>G, NM_000132.3:c.3772delT, NM_000132.3:c.3766G>T, NM_000132.3:c.3756delG, NM_000132.3:c.3735_3744delCCTTTTCTTAinsATTTCTTTTTCTTT, NM_000132.3:c.3736delC, NM_000132.3:c.3710delC, NM_000132.3:c.3652delG, NM_000132.3:c.3631A>T, NM_000132.3:c.3624delT, NM_000132.3:c.3607G>T, NM_000132.3:c.3565dupA, NM_000132.3:c.3548_3549delAA, NM_000132.3:c.3500dupA, NM_000132.3:c.3496A>T, NM_000132.3:c.3493G>T, NM_000132.3:c.3490delT, NM_000132.3:c.3421C>T, NM_000132.3:c.3417dupT, NM_000132.3:c.3416_3417delCT, NM_000132.3:c.3409_3410delCT, NM_000132.3:c.3388delA, NM_000132.3:c.3385delC, NM_000132.3:c.3371C>A, NM_000132.3:c.3344delT, NM_000132.3:c.3302_3303delAG, NM_000132.3:c.3300delA, NM_000132.3:c.3298A>T, NM_000132.3:c.3289C>T, NM_000132.3:c.3251C>G, NM_000132.3:c.3224delC, NM_000132.3:c.3203_3204delGA, NM_000132.3:c.3196C>T, NM_000132.3:c.3152delT, NM_000132.3:c.3150_3151insTC, NM_000132.3:c.3053delA, NM_000132.3:c.3034G>C, NM_000132.3:c.3031A>T, NM_000132.3:c.2412_2421delCTCCTCTAGT, NM_000132.3:c.2419dupA, NM_000132.3:c.2409delT, NM_000132.3:c.2404C>T, NM_000132.3:c.2397delT, NM_000132.3:c.2384_2388delGAACA, NM_000132.3:c.2373dupG, NM_000132.3:c.2360delA, NM_000132.3:c.2102_2106delTGGAA, NM_000132.3:c.2097G>A, NM_000132.3:c.2096T>A, NM_000132.3:c.2095A>T, NM_000132.3:c.2095A>G, NM_000132.3:c.2095A>C, NM_000132.3:c.2089_2090delGT, NM_000132.3:c.2090T>A, NM_000132.3:c.2066T>G, NM_000132.3:c.2060T>C, NM_000132.3:c.2058_2059delAC, NM_000132.3:c.2057C>G, NM_000132.3:c.2032A>T, NM_000132.3:c.2029T>C, NM_000132.3:c.2015_2017delTCT, NM_000132.3:c.2000delT, NM_000132.3:c.1996_1999dupGACT, NM_000132.3:c.1996_1999delGACT, NM_000132.3:c.1990_1991delCA, NM_000132.3:c.1991A>C, NM_000132.3:c.1988C>T, NM_000132.3:c.1985G>C, NM_000132.3:c.1952A>C, NM_000132.3:c.1947_1950delTTTG, NM_000132.3:c.1941_1944delAGTT, NM_000132.3:c.1934A>C, NM_000132.3:c.1913G>A, NM_000132.3:c.1912G>A, NM_000132.3:c.1904-1G>A, NM_000132.3:c.1904-37G>A, NM_000132.3:c.1752+5G>C, NM_000132.3:c.1736A>T, NM_000132.3:c.1726G>T, NM_000132.3:c.1703G>T, NM_000132.3:c.1688C>G, NM_000132.3:c.1682A>C, NM_000132.3:c.1681G>A, NM_000132.3:c.1675G>T, NM_000132.3:c.1667T>A, NM_000132.3:c.1661G>A, NM_000132.3:c.1653T>G, NM_000132.3:c.1640G>A, NM_000132.3:c.1639T>C, NM_000132.3:c.1630G>A, NM_000132.3:c.1619C>G, NM_000132.3:c.1618C>A, NM_000132.3:c.1596dupG, NM_000132.3:c.1596G>A, NM_000132.3:c.1595G>A, NM_000132.3:c.1594T>G, NM_000132.3:c.1585A>G, NM_000132.3:c.1560delT, NM_000132.3:c.1538-1G>T, NM_000132.3:c.1538-2A>T, NM_000132.3:c.1477A>G, NM_000132.3:c.1463C>T, NM_000132.3:c.1463C>G, NM_000132.3:c.1443+3A>C, NM_000132.3:c.1443+2T>C, NM_000132.3:c.1442_1443dupTG, NM_000132.3:c.1443+1G>A, NM_000132.3:c.1432G>A, NM_000132.3:c.1420G>T, NM_000132.3:c.1410_1413delTTTA, NM_000132.3:c.1406G>C, NM_000132.3:c.1400T>G, NM_000132.3:c.1397G>A, NM_000132.3:c.1394C>G, NM_000132.3:c.1390G>T, NM_000132.3:c.1357G>T, NM_000132.3:c.1348T>G, NM_000132.3:c.1338delA, NM_000132.3:c.1336dupC, NM_000132.3:c.1337G>C, NM_000132.3:c.1337G>A, NM_000132.3:c.1331_1332delAA, NM_000132.3:c.1331_1332delAAinsT, NM_000132.3:c.1331A>C, NM_000132.3:c.1325A>G, NM_000132.3:c.1324T>C, NM_000132.3:c.1324T>A, NM_000132.3:c.1316G>A, NM_000132.3:c.1311delG, NM_000132.3:c.1301G>A, NM_000132.3:c.1293delG, NM_000132.3:c.1234T>C, NM_000132.3:c.1214T>G, NM_000132.3:c.1207C>G, NM_000132.3:c.1203G>A, NM_000132.3:c.1202G>A, NM_000132.3:c.1200_1201delTT, NM_000132.3:c.1189dupC, NM_000132.3:c.1175C>G, NM_000132.3:c.1175C>A, NM_000132.3:c.1172G>C, NM_000132.3:c.1165delC, NM_000132.3:c.1077_1080delTGAA, NM_000132.3:c.1078_1079delGA, NM_000132.3:c.1042T>C, NM_000132.3:c.986G>T, NM_000132.3:c.985dupT, NM_000132.3:c.986G>C, NM_000132.3:c.986G>A, NM_000132.3:c.984delT, NM_000132.3:c.974_975delTT, NM_000132.3:c.967G>A, NM_000132.3:c.948_951delAACA, NM_000132.3:c.943delG, NM_000132.3:c.941C>T, NM_000132.3:c.935delT, NM_000132.3:c.920T>G, NM_000132.3:c.919delA, NM_000132.3:c.907delG, NM_000132.3:c.902G>C, NM_000132.3:c.899A>T, NM_000132.3:c.899A>C, NM_000132.3:c.889delG, NM_000132.3:c.886C>T, NM_000132.3:c.883T>C, NM_000132.3:c.872A>G, NM_000132.3:c.871G>T, NM_000132.3:c.850G>T, NM_000132.3:c.850G>A, NM_000132.3:c.849delT, NM_000132.3:c.836T>A, NM_000132.3:c.832G>A, NM_000132.3:c.824A>G, NM_000132.3:c.822G>A, NM_000132.3:c.796G>T, NM_000132.3:c.788-1G>T, NM_000132.3:c.788-1G>C, NM_000132.3:c.788-1G>A, NM_000132.3:c.788-2A>T, NM_000132.3:c.787+2T>C, NM_000132.3:c.787G>C, NM_000132.3:c.779C>G, NM_000132.3:c.775A>T, NM_000132.3:c.770_771insCC, NM_000132.3:c.764G>A, NM_000132.3:c.760A>T, NM_000132.3:c.755C>A, NM_000132.3:c.729delT, NM_000132.3:c.709C>T, NM_000132.3:c.695_698delAGAA, NM_000132.3:c.688_689delGA, NM_000132.3:c.685_686delTC, NM_000132.3:c.680G>A, NM_000132.3:c.676A>T, NM_000132.3:c.577G>A, NM_000132.3:c.571C>T, NM_000132.3:c.566C>A, NM_000132.3:c.560T>A, NM_000132.3:c.557A>G, NM_000132.3:c.556G>A, NM_000132.3:c.553A>G, NM_000132.3:c.545A>T, NM_000132.3:c.535T>C, NM_000132.3:c.532C>G, NM_000132.3:c.525C>A, NM_000132.3:c.519_523delTACCT, NM_000132.3:c.514_515insTCAAGATA, NM_000132.3:c.515G>A, NM_000132.3:c.514T>C, NM_000132.3:c.493C>T, NM_000132.3:c.489T>A, NM_000132.3:c.476T>C, NM_000132.3:c.472C>T, NM_000132.3:c.471G>A, NM_000132.3:c.446delC, NM_000132.3:c.440T>A, NM_000132.3:c.435_436insTTT, NM_000132.3:c.433G>C, NM_000132.3:c.430G>T, NM_000132.3:c.421G>T, NM_000132.3:c.415C>T, NM_000132.3:c.407A>C, NM_000132.3:c.405T>A, NM_000132.3:c.404A>G, NM_000132.3:c.403G>A, NM_000132.3:c.265+1G>T, NM_000132.3:c.265G>A, NM_000132.3:c.255_257delACC, NM_000132.3:c.250A>G, NM_000132.3:c.230T>C, NM_000132.3:c.225T>A, NM_000132.3:c.224delA, NM_000132.3:c.223G>T, NM_000132.3:c.217T>C, NM_000132.3:c.214G>A, NM_000132.3:c.209T>C, NM_000132.3:c.201_202dupGA, NM_000132.3:c.203C>A, NM_000132.3:c.201G>T, NM_000132.3:c.199_200delAA, NM_000132.3:c.200A>C, NM_000132.3:c.199A>G, NM_000132.3:c.195C>A, NM_000132.3:c.185C>G, NM_000132.3:c.173delC, NM_000132.3:c.144-5C>G, NM_000132.3:c.144-11T>G, NM_000132.3:c.144-26A>T, NM_000132.3:c.143+1G>A, NM_000132.3:c.120delC, NM_000132.3:c.98G>A, NM_000132.3:c.97T>G, NM_000132.3:c.88G>A, NM_000132.3:c.86T>G, NM_000132.3:c.77T>C, NM_000132.3:c.65G>C, NM_000132.3:c.1A>GHemophilia A follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F8 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor VIII deficiency. The prevalence is 1/4,000 to 1/ 5,000 male newborns.600
F9Hemophilia BNM_000133.3NM_000133.3:c.82T>C, NM_000133.3:c.1031T>C, NM_000133.3:c.1136G>A, NM_000133.3:c.1150C>THemophilia B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F9 gene located on chromosomal region Xq27.1-q27.2. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor IX deficiency. The prevalence is 1/100,000 to 9/100,000.600,25
FAHTyrosinemia, type 1NM_000137.2NM_000137.2:c.47A>T, NM_000137.2:c.192G>T, NM_000137.2:c.401C>A, NM_000137.2:c.456G>A, NM_000137.2:c.554-1G>T, NM_000137.2:c.707-1G>A, NM_000137.2:c.782C>T, NM_000137.2:c.786G>A, NM_000137.2:c.837+1G>A, NM_000137.2:c.939delC, NM_000137.2:c.982C>T, NM_000137.2:c.1009G>A, NM_000137.2:c.1027G>T, NM_000137.2:c.1062+5G>A, NM_000137.2:c.1069G>T, NM_000137.2:c.1090G>T, NM_000137.2:c.1141A>GTyrosinemia, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAH gene located on chromosomal region 15q25.1. The age of onset is variable. This disease is characterized by progressive liver disease, renal tubular dysfunction, porphyria-like crises and a dramatic improvement in prognosis following treatment with nitisinone. The birth incidence is 1/100,000, notably in Qu�bec, Canada, and the prevalence is 1/100,000 to 1/120,000 newborns.600,25
FAM126AHypomyelinating leukodystrophy, type 5NM_032581.3NM_032581.3:c.158T>CHypomyelinating leukodystrophy, type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAM126A gene located on chromosomal region 7p15.3. The age of onset is neonatal/infantile. This disease is characterized by the onset of cataract either at birth or in the first two months of life, delayed psychomotor development by the end of the first year of life and moderate intellectual deficit. The prevalence is below 1/1,000,000.600
FAM20CRaine syndromeNM_020223.3NM_020223.3:c.1093G>C, NM_020223.3:c.1163T>GRaine syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAM20C gene located on chromosomal region 7p22.3. The age of onset is neonatal/infantile. This disease is characterized by generalized osteosclerosis with periosteal bone formation, characteristic facial dysmorphism, brain abnormalities including intracerebral calcifications, and neonatal lethal course. The prevalence is below 1/1,000,000.600
FANCAFanconi anemia, complementation group ANM_000135.2NM_000135.2:c.4130C>G, NM_000135.2:c.3788_3790delTCT, NM_000135.2:c.3763G>T, NM_000135.2:c.3558dupG, NM_000135.2:c.2303T>C, NM_000135.2:c.1115_1118delTTGG, NM_000135.2:c.233_236delTTGA, NM_000135.2:c.131dupAFanconi anemia, complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCA gene located on chromosomal region 16q24.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.600,25
FANCCFanconi anemia, complementation group CNM_000136.2NM_000136.2:c.1642C>T, NM_000136.2:c.1487T>G, NM_000136.2:c.1103_1104delTG, NM_000136.2:c.1015delA, NM_000136.2:c.996+1G>T, NM_000136.2:c.67delG, NM_000136.2:c.37C>TFanconi anemia, complementation group C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCC gene located on chromosomal region 9q22.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.600,25
FANCGFanconi anemia, complementation group GNM_004629.1NM_004629.1:c.1852_1853delAA, NM_004629.1:c.1795_1804delTGGATCCGTC, NM_004629.1:c.1480+1G>C, NM_004629.1:c.1077-2A>G, NM_004629.1:c.907_908dupCT, NM_004629.1:c.637_643delTACCGCC, NM_004629.1:c.510+1G>A, NM_004629.1:c.313G>TFanconi anemia, complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCG gene located on chromosomal region 9p13. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.600,25
FGAAfibrinogenemia, congenitalNM_000508.4NM_000508.4:c.1441delG, NM_000508.4:c.1359dupC, NM_000508.4:c.1039C>TCongenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGA gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000.600
FGAAfibrinogenemia, congenitalNM_021871.3NM_021871.3:c.1906dupCCongenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGA gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000.600
FGBCongenital afibrinogenemiaNM_005141.4NM_005141.4:c.1148T>G, NM_005141.4:c.1289G>ACongenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGB gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000.600,25
FGD4Charcot-Marie-Tooth disease, type 4HNM_001304480.1NM_001304480.1:c.1006C>T, NM_001304480.1:c.1229T>C, NM_001304480.1:c.1229T>G, NM_001304480.1:c.1661G>ACharcot-Marie-Tooth disease, type 4H follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGD4 gene located on chromosomal region 12p11.21. The age of onset is neonatal/infantile. This disease is characterized by slowly progressive muscle weakness in the distal extremities, and other common features include delayed walking, an abnormal gait, scoliosis and pes equines with toe retraction. The prevalence is 1/3,300.600
FHFumarase deficiencyNM_000143.3NM_000143.3:c.1446_1449delAAAG, NM_000143.3:c.1431_1433dupAAA, NM_000143.3:c.1394A>G, NM_000143.3:c.1293delA, NM_000143.3:c.1255T>C, NM_000143.3:c.1236+1G>C, NM_000143.3:c.1200delT, NM_000143.3:c.1189G>A, NM_000143.3:c.1093A>G, NM_000143.3:c.1067T>A, NM_000143.3:c.901dupA, NM_000143.3:c.793G>A, NM_000143.3:c.760C>T, NM_000143.3:c.698G>A, NM_000143.3:c.697C>T, NM_000143.3:c.521C>G, NM_000143.3:c.320A>C, NM_000143.3:c.40dupCFumarase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FH gene located on chromosomal region 1q42.1. The age of onset is neonatal/infantile. This disease is characterized byﾠhypotonia, severe psychomotor impairment, convulsions, respiratory distress, feeding difficulties and frequent cerebral malformations, along with a distinctive facies, although some patients present with only moderate intellectual impairment. The prevalence is below 1,000,000.600
FHL1Emery-Dreifuss muscular dystrophy, type 6, X-linkedNM_001159702.2NM_001159702.2:c.310T>C, NM_001159702.2:c.625T>C, NM_001159702.2:c.838G>AEmery-Dreifuss muscular dystrophy, type 6, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FHL1 gene located on chromosomal region Xq26. ﾠThis is a condition that primarily affects muscles used for movement (skeletalﾠmuscles) and the heart (cardiac muscle). Among the earliest features of this disorder are joint deformities called contractures. Contractures restrict the movement of certain joints, most often the elbows, ankles, and neck, and usually become noticeable in early childhood. Most affected individuals also experience muscle weakness andﾠwastingﾠthat worsen slowly over time, beginning in muscles of the upper arms and lower legs and later also affecting muscles in the shoulders and hips. Almost all people with Emery-Dreifuss muscular dystrophy develop heart problems by adulthood. The X-linked type of this disorder affects an estimated 1 in 100,000 people.600
FIG4Charcot-Marie-Tooth disease, type 4J; Yunis-Varon syndromeNM_014845.5NM_014845.5:c.122T>C, NM_014845.5:c.311G>A, NM_014845.5:c.501C>G, NM_014845.5:c.547C>T, NM_014845.5:c.592C>T, NM_014845.5:c.737G>A, NM_014845.5:c.831_838delTAAATTTG, NM_014845.5:c.2299dupGCharcot-Marie-Tooth disease, type 4J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by rapidly progressive, asymmetric motor neuron degeneration with slow nerve conduction velocities, weakness and paralysis, without sensory loss. The prevalence is 4/100,000 to 8/100,000. Mutations in the FIG4 gene have been also found in patient with Yunis-Varon syndrome. This disease is a severe autosomal recessive disorder characterized by skeletal defects, including cleidocranial dysplasia and digital anomalies, and severe neurologic involvement with neuronal loss. Enlarged cytoplasmic vacuoles are found in neurons, muscle, and cartilage. The disorder is usually lethal in infancy.600,25
FKRPMuscular dystrophy-dystroglycanopathy, type 5A, 5B and 5CNM_001039885.2NM_001039885.2:c.160C>T, NM_001039885.2:c.1154C>A, NM_001039885.2:c.1343C>T, NM_001039885.2:c.1387A>GMuscular dystrophy-dystroglycanopathy type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is neonatal or early infancy. There are three subtypes of dystroglycanopathies related to FKRP gene: subtype 5A, 5B and 5C. Subtype 5A is the most severe phenotype and is associated with congenital brain and eye anomalies, cobblestone lissencephaly, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Subtype 5B represents an intermediate phenotype with or without congenital mental retardation, white matter changes and structural brain abnormalities. Finally, subtype 5C is the less severe phenotype characterized by limb-girdle muscular dystrophy, variable age at onset, normal cognition, and no structural brain changes.600,25
FKTNMuscular dystrophy-dystroglycanopathy, type 4A, 4B and 4CNM_001079802.1NM_001079802.1:c.411C>A, NM_001079802.1:c.509C>A, NM_001079802.1:c.527T>C, NM_001079802.1:c.766C>T, NM_001079802.1:c.1112A>G, NM_001079802.1:c.1167dupA, NM_001079802.1:c.1380dupAMuscular dystrophy-dystroglycanopathy type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKTN gene located on chromosomal region 9q31.2. The age of onset is neonatal or early infancy. There are three subtypes of dystroglycanopathies related to FKTN gene: subtype 4A, 4B and 4C. Subtype 4A is the most severe phenotype and is associated with congenital brain and eye anomalies, seizures, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Subtype 4B represents an intermediate phenotype and congenital mental retardation is not a feature. Finally, subtype 4C is the less severe phenotype characterized by limb-girdle muscular dystrophy, onset in early childhood and cognition and brain structure are usually normal.600
FLNAFLNA-related disordersNM_001110556.1NM_001110556.1:c.7757-1G>C, NM_001110556.1:c.7551_7552+6delAGGTGAGC, NM_001110556.1:c.7153C>T, NM_001110556.1:c.5132_5133delTCinsAA, NM_001110556.1:c.4777_4778dupAA, NM_001110556.1:c.4543C>T, NM_001110556.1:c.4446_4447dupAT, NM_001110556.1:c.3557C>T, NM_001110556.1:c.3476A>C, NM_001110556.1:c.2761C>T, NM_001110556.1:c.760G>AMutation in FLNA causes a wide spectrum of disease including skeletal dysplasia, neuronal migration abnormality, cardiovascular malformation, intellectual disability and intestinal obstruction. FLNA-related disorders can be X-linked recessive (XLR) or X-linked dominant (XLD). Frontometaphyseal dysplasia-1 (FMD1;XLR) is 1 of 4 otopalatodigital syndromes caused by mutations in the FLNA gene. The disorders, which include otopalatodigital syndrome-1 (OPD1; XLD; OMIMﾠ311300), otopalatodigital syndrome-2 (OPD2; XLD;ﾠ304120), and Melnick-Needles syndrome (MNS; XLD;ﾠ309350), constitute a phenotypic spectrum. At the mild end of the spectrum, males with OPD1 have cleft palate and mild skeletal anomalies with conductive deafness caused by ossicular anomalies. FMD1 is characterized by a generalized skeletal dysplasia, deafness, and urogenital defects. Males with OPD2 have disabling skeletal anomalies in addition to variable malformations in the hindbrain, heart, intestines, and kidneys that frequently lead to perinatal death. The most severe phenotype, MNS, is characterized by a skeletal dysplasia in the heterozygote. Affected males exhibit severe malformations similar to those observed in individuals with OPD2, resulting in prenatal lethality or death in the first few months of life (review byﾠRobertson, 2005).ﾠVerloes et al. (2000)ﾠsuggested that these disorders constitute a single entity, which they termed 'frontootopalatodigital osteodysplasia.' Other studies confirm an association between FLNA gene mutation and lung disease, seen in more than 80% of patients with cerebral periventricular nodular heterotopia (PVNH; XLD; 300049); FLNA mutation also cause cardiac valvular dysplasia (XLR; 314400). De novo mutations and mosaic cases have been described.600
FLVCR1Posterior column ataxia-retinitis pigmentosa syndromeNM_014053.3NM_014053.3:c.361A>G, NM_014053.3:c.574T>C, NM_014053.3:c.739-2delAPosterior column ataxia-retinitis pigmentosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FLVCR1 gene located on chromosomal region 1q32.3. The age of onset is childhood. This disease is characterized by sensory ataxia, proprioceptive loss and blindness. The prevalence is <1 / 1.000.000.600
FMR1Fragile X syndrome-0(CGG)n pre-mutated alleleFragile X syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FMR1 gene located on chromosomal region Xq27.3. The symptoms are variable depending on the range of CGG triplet expansion. In complete mutation the onset is infantile in men and is characterized by intellectual disability, characteristic appearance (large head, long face, prominent forehead and chin, protruding ears) joint laxity and large testes after puberty. In carrier female, the symptoms are milder and include primary ovarian insufficiency. The prevalence is 1/2,500 (full mutation allele) to 1/4,000 (prevalence of symptomatic cases) for both genders.600,25
FOXN1T-cell immunodeficiency, congenital alopecia and nail dystrophyNM_003593.2NM_003593.2:c.763C>TT-cell immunodeficiency, congenital alopecia and nail dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FOXN1 gene located on chromosomal region 17q11.2. The age of onset is infantile. This disease is characterized by T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. The prevalence is <1:1,000,000.600
FRAS1Fraser syndrome, type 1NM_025074.6NM_025074.6:c.835_838delGTGT, NM_025074.6:c.3799C>T, NM_025074.6:c.5605_5606insT, NM_025074.6:c.6433C>T, NM_025074.6:c.6991_6992insGG, NM_025074.6:c.7813C>T, NM_025074.6:c.11160_11167delGCTGGAGAFraser syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the gene FRAS1 located on chromosomal region 4q21.21. The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000.600,25
FREM2Fraser syndrome, type 2NM_207361.5NM_207361.5:c.2366dupC, NM_207361.5:c.3792_3795delTTAT, NM_207361.5:c.5920G>A, NM_207361.5:c.8409+1G>AFraser syndrome, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the gene FREM2 located on chromosomal region 13q13.3. The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000.600
FUCA1FucosidosisNM_000147.4NM_000147.4:c.1279C>T, NM_000147.4:c.1229T>G, NM_000147.4:c.856C>T, NM_000147.4:c.648C>A, NM_000147.4:c.244C>TFucosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FUCA1 gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is characterized by facial dysmorphism, dysostosis multiplex, moderate hepatomegaly, severe intellectual deficit, deafness, and according to age, angiokeratomas. The prevalence is <1:1,000,000.600
G6PCGlycogen storage disease, type 1ANM_000151.3NM_000151.3:c.113A>T, NM_000151.3:c.229T>C, NM_000151.3:c.230+1G>C, NM_000151.3:c.247C>T, NM_000151.3:c.248G>A, NM_000151.3:c.370G>A, NM_000151.3:c.379_380dupTA, NM_000151.3:c.447-1G>A, NM_000151.3:c.497T>G, NM_000151.3:c.508C>T, NM_000151.3:c.562G>C, NM_000151.3:c.883C>T, NM_000151.3:c.1039C>TGlycogen storage disease, type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000.600,25
G6PCGlycogen storage disease, type 1ANM_001270397.1NM_001270397.1:c.474G>AGlycogen storage disease, type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000.600,25
G6PC3Dursun syndromeNM_138387.3NM_138387.3:c.141C>G, NM_138387.3:c.346A>G, NM_138387.3:c.758G>A, NM_138387.3:c.778G>C, NM_138387.3:c.784G>C, NM_138387.3:c.935dupTDursun syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC3 gene located on chromosomal region 17q21.31. This disease is characterized by familial pulmonary arterial hypertension, cardiac abnormalities including atrial septal defect, leukopenia including intermittent neutropenia, lymphopenia, monocytosis, and anemia. The prevalence is 1:100,000.600
GAAGlycogen storage disease 2NM_000152.4NM_000152.4:c.118C>T, NM_000152.4:c.236_246delCCACACAGTGC, NM_000152.4:c.307T>G, NM_000152.4:c.525delT, NM_000152.4:c.546+2_546+5delTGGG, NM_000152.4:c.546G>A, NM_000152.4:c.546G>C, NM_000152.4:c.655G>A, NM_000152.4:c.698delA, NM_000152.4:c.768dupT, NM_000152.4:c.853C>T, NM_000152.4:c.877G>A, NM_000152.4:c.925G>A, NM_000152.4:c.1064T>C, NM_000152.4:c.1115A>T, NM_000152.4:c.1316T>A, NM_000152.4:c.1327-2A>G, NM_000152.4:c.1431delT, NM_000152.4:c.1465G>A, NM_000152.4:c.1548G>A, NM_000152.4:c.1552-3C>G, NM_000152.4:c.1561G>A, NM_000152.4:c.1585_1586delTCinsGT, NM_000152.4:c.1634C>T, NM_000152.4:c.1650dupG, NM_000152.4:c.1799G>A, NM_000152.4:c.1827_1828insA, NM_000152.4:c.1847dupA, NM_000152.4:c.1912G>T, NM_000152.4:c.1927G>A, NM_000152.4:c.1933G>T, NM_000152.4:c.1935C>A, NM_000152.4:c.2012T>G, NM_000152.4:c.2015G>A, NM_000152.4:c.2041-1G>A, NM_000152.4:c.2066_2070dupAGCCG, NM_000152.4:c.2105G>T, NM_000152.4:c.2237G>A, NM_000152.4:c.2238G>A, NM_000152.4:c.2238G>C, NM_000152.4:c.2512C>T, NM_000152.4:c.2544delC, NM_000152.4:c.2560C>TGlycogen storage disease, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAA gene located on chromosomal region 17q25.3. There are two forms: adult and infantile.The age of onset in this last form is before the age of three months. This disease is characterized by severe hypotonia, hypertrophic cardiomyopathy and progressive hepatomegaly. The incidence is 1/57,000 for the adult form and 1/138,000 for infantile form.600,25
GALCKrabbe diseaseNM_000153.3NM_000153.3:c.2056T>C, NM_000153.3:c.1964delC, NM_000153.3:c.1814dupA, NM_000153.3:c.1796T>G, NM_000153.3:c.1723_1724insT, NM_000153.3:c.1700A>C, NM_000153.3:c.1695delT, NM_000153.3:c.1592G>A, NM_000153.3:c.1591C>T, NM_000153.3:c.1586C>T, NM_000153.3:c.1543G>A, NM_000153.3:c.1489+1_1489+2delGT, NM_000153.3:c.1488_1489+2delTGGT, NM_000153.3:c.1488_1489delTG, NM_000153.3:c.1472delA, NM_000153.3:c.1161+2T>G, NM_000153.3:c.1153G>T, NM_000153.3:c.953C>G, NM_000153.3:c.658C>T, NM_000153.3:c.655C>T, NM_000153.3:c.628A>T, NM_000153.3:c.582+1G>A, NM_000153.3:c.453G>A, NM_000153.3:c.430delA, NM_000153.3:c.388G>A, NM_000153.3:c.205C>TKrabbe disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALC gene located on chromosomal region 14q31.3. There are two forms of the disease: infantile form (2-6 months onset) more severe and adult form less severe. It is a degenerative disorder that affects the nervous system characterized by a muscle stiffness, blindness, deafness, and eventually death. The incidence is 1/100,000-1/250,000 and the prevalence is 1/100,000.600,25
GALTGalactosemiaNM_000155.3NM_000155.3:c.18delC, NM_000155.3:c.41delCinsTT, NM_000155.3:c.71_72insA, NM_000155.3:c.113A>C, NM_000155.3:c.118G>T, NM_000155.3:c.130G>A, NM_000155.3:c.132delG, NM_000155.3:c.152G>A, NM_000155.3:c.158G>A, NM_000155.3:c.199C>T, NM_000155.3:c.203A>C, NM_000155.3:c.220_221delCT, NM_000155.3:c.221T>C, NM_000155.3:c.253-2A>G, NM_000155.3:c.265T>G, NM_000155.3:c.289_291delAAC, NM_000155.3:c.290A>G, NM_000155.3:c.292G>A, NM_000155.3:c.329-2A>C, NM_000155.3:c.367C>T, NM_000155.3:c.386T>C, NM_000155.3:c.400delT, NM_000155.3:c.404C>T, NM_000155.3:c.413C>T, NM_000155.3:c.425T>A, NM_000155.3:c.428C>T, NM_000155.3:c.445dupG, NM_000155.3:c.442C>T, NM_000155.3:c.443G>A, NM_000155.3:c.502_504delGTG, NM_000155.3:c.505C>A, NM_000155.3:c.508-1G>C, NM_000155.3:c.512T>C, NM_000155.3:c.547C>A, NM_000155.3:c.552C>A, NM_000155.3:c.563A>G, NM_000155.3:c.565_578delGTATGGGCCAGCAG, NM_000155.3:c.568T>C, NM_000155.3:c.580T>C, NM_000155.3:c.584T>C, NM_000155.3:c.598delC, NM_000155.3:c.601C>T, NM_000155.3:c.602G>A, NM_000155.3:c.607G>A, NM_000155.3:c.610C>T, NM_000155.3:c.619C>T, NM_000155.3:c.626A>G, NM_000155.3:c.634C>T, NM_000155.3:c.688-2A>C, NM_000155.3:c.692G>A, NM_000155.3:c.719_728delTAGTACTGGT, NM_000155.3:c.772C>T, NM_000155.3:c.775C>T, NM_000155.3:c.790delC, NM_000155.3:c.790_792delCTAinsTAG, NM_000155.3:c.820+13A>G, NM_000155.3:c.844C>G, NM_000155.3:c.855G>T, NM_000155.3:c.904+1G>T, NM_000155.3:c.905-2A>G, NM_000155.3:c.939G>A, NM_000155.3:c.947G>A, NM_000155.3:c.957C>A, NM_000155.3:c.985T>C, NM_000155.3:c.997C>G, NM_000155.3:c.997C>T, NM_000155.3:c.998G>A, NM_000155.3:c.1006A>T, NM_000155.3:c.1030C>A, NM_000155.3:c.1048delA, NM_000155.3:c.1052delC, NM_000155.3:c.1138T>CGalactosemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALT gene located on chromosomal region 9p13.3. The age of onset is neonatal. This disease is characterized by feeding difficulties, lethargy, and severe liver disease. Long-term complications appear including cognitive impairments, motor deficits, and ovarian dysfunction with reduced fertility in women and diminished bone density. The prevalence is 1/40,000-1/60,000.600,25
GAMTCerebral creatine deficiency syndrome type 2NM_138924.2NM_138924.2:c.506G>ACerebral creatine deficiency syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAMT gene located on chromosomal region 19p13.3. The age of onset is infantile. This disease is characterized by intellectual disability, seizures and behavioral problems, often in conjunction with pyramidal and/or extrapyramidal manifestations with muscular hypotony. Biochemical symptoms are also included with high urinary excretion of guanidinoacetate, low urinary excretion of creatinine and creatine depletion in brain and muscles.600
GANGiant axonal neuropathy, type 1NM_022041.3NM_022041.3:c.413G>A, NM_022041.3:c.505G>A, NM_022041.3:c.601C>T, NM_022041.3:c.1268T>C, NM_022041.3:c.1429C>T, NM_022041.3:c.1447C>T, NM_022041.3:c.1456G>AGiant axonal neuropathy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAN gene located on chromosomal region 16q23.2. The age of onset is infantile. This disease is characterized by a progressive motor and sensitive peripheral and central nervous system neuropathy. Twenty families have been reported with this disease but the frequency is likely to be under-estimated.600,25
GBAGaucher diseaseNM_000157.3NM_000157.3:c.1604G>A, NM_000157.3:c.1504C>T, NM_000157.3:c.1448T>G, NM_000157.3:c.1448T>C, NM_000157.3:c.1361C>G, NM_000157.3:c.1348T>A, NM_000157.3:c.1343A>T, NM_000157.3:c.1342G>C, NM_000157.3:c.1319C>T, NM_000157.3:c.1309G>T, NM_000157.3:c.1307T>C, NM_000157.3:c.1301G>C, NM_000157.3:c.1297G>T, NM_000157.3:c.1295G>T, NM_000157.3:c.1274dupA, NM_000157.3:c.1246G>A, NM_000157.3:c.1240G>T, NM_000157.3:c.1240G>C, NM_000157.3:c.1228C>G, NM_000157.3:c.1226A>G, NM_000157.3:c.1208G>C, NM_000157.3:c.1192C>T, NM_000157.3:c.1184C>T, NM_000157.3:c.1174C>G, NM_000157.3:c.1171G>C, NM_000157.3:c.1141T>G, NM_000157.3:c.1098dupA, NM_000157.3:c.1090G>A, NM_000157.3:c.1085C>T, NM_000157.3:c.1060G>C, NM_000157.3:c.1053G>T, NM_000157.3:c.1049A>G, NM_000157.3:c.1043C>T, NM_000157.3:c.914delC, NM_000157.3:c.586A>C, NM_000157.3:c.509G>T, NM_000157.3:c.508C>T, NM_000157.3:c.487delG, NM_000157.3:c.481C>T, NM_000157.3:c.476G>A, NM_000157.3:c.475C>T, NM_000157.3:c.431T>G, NM_000157.3:c.407C>A, NM_000157.3:c.354G>C, NM_000157.3:c.259C>T, NM_000157.3:c.254G>A, NM_000157.3:c.160G>T, NM_000157.3:c.115+1G>A, NM_000157.3:c.84dupGGaucher disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBA gene located on chromosomal region 1q22. Gaucher disease encompasses a continuum of clinical findings from a perinatal lethal disorder to an asymptomatic type. There are three major clinical types (1, 2, and 3) and two other subtypes (perinatal-lethal and cardiovascular). Type 1 is characterized by the presence of clinical or radiographic evidence of bone disease, hepatosplenomegaly, anemia and thrombocytopenia, lung disease, and the absence of primary central nervous system disease. GD types 2 and 3 are characterized by the presence of primary neurologic disease. Type 2 has an onset before age two years, limited psychomotor development, and a rapidly progressive course with death by age two to four years. Type 3 may have onset before age two years, but often have a more slowly progressive course, with survival into the third or fourth decade. The perinatal-lethal form is associated with ichthyosiform or collodion skin abnormalities or with nonimmune hydrops fetalis. The cardiovascular form is characterized by calcification of the aortic and mitral valves, mild splenomegaly, corneal opacities, and supranuclear ophthalmoplegia. Cardiopulmonary complications have been described with all the clinical subtypes, although varying in frequency and severity. The incidence is 1/60,000 and the prevalence is approximately 1/100,000.600,25
GBE1Glycogen storage disease, type 4NM_000158.3NM_000158.3:c.2052+1G>A, NM_000158.3:c.1883A>G, NM_000158.3:c.1774G>T, NM_000158.3:c.1604A>G, NM_000158.3:c.1571G>A, NM_000158.3:c.1570C>T, NM_000158.3:c.1543C>T, NM_000158.3:c.986A>C, NM_000158.3:c.771T>A, NM_000158.3:c.466_470delCGTATGlycogen storage disease, type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is infantile. This disease is characterized by failure to thrive; hepatomegaly, liver dysfunction, and progressive liver cirrhosis; hypotonia; cardiomyopathy and, finally, death.600,25
GCDHGlutaricaciduria, type 1NM_000159.3NM_000159.3:c.74C>A, NM_000159.3:c.271+1G>A, NM_000159.3:c.383G>A, NM_000159.3:c.416C>T, NM_000159.3:c.542A>G, NM_000159.3:c.572T>C, NM_000159.3:c.636-1G>A, NM_000159.3:c.680G>C, NM_000159.3:c.743C>T, NM_000159.3:c.751C>T, NM_000159.3:c.764C>T, NM_000159.3:c.769C>T, NM_000159.3:c.877G>A, NM_000159.3:c.883T>C, NM_000159.3:c.914C>T, NM_000159.3:c.1002_1003delGA, NM_000159.3:c.1060G>A, NM_000159.3:c.1093G>A, NM_000159.3:c.1168G>C, NM_000159.3:c.1198G>A, NM_000159.3:c.1199dupT, NM_000159.3:c.1204C>T, NM_000159.3:c.1244-2A>C, NM_000159.3:c.1247C>T, NM_000159.3:c.1262C>TGlutaricaciduria, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCDH gene located on chromosomal region 19p13.2. The age of onset is infantile or neonatal. This disease is characterized by encephalopathic crises resulting in striatal injury and a severe dystonic dyskinetic movement disorder. The prevalence is 1 in 100,000 births.600,25
GDAP1Charcot-Marie-Tooth disease, recessive intermediate, type ANM_018972.2NM_018972.2:c.92G>A, NM_018972.2:c.311-1G>A, NM_018972.2:c.358C>T, NM_018972.2:c.487C>T, NM_018972.2:c.715C>T, NM_018972.2:c.844C>TAutosomal recessive intermediate Charcot-Marie-Tooth disease type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GDAP1 gene located on chromosomal region 8q21.11. The age of onset is usually in early childhood. This disease is characterized by by distal sensory impairment predominantly affecting the lower limbs and resulting in walking difficulties due to muscle weakness and atrophy. The upper limbs may also be affected. The prevalence is below 1/1,000,000.600
GFM1Combined oxidative phosphorylation deficiency, type 1NM_001308164.1NM_001308164.1:c.139C>T, NM_001308164.1:c.521A>G, NM_001308164.1:c.805C>T, NM_001308164.1:c.1354_1357delGACA, NM_001308164.1:c.1589_1590delAGCombined oxidative phosphorylation deficiency, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GFM1 gene located on chromosomal region 3q25.32. The age of onset is from early infancy until adult. This disease is characterized by ptosis, external ophthalmoplegia, proximal myopathy and exercise intolerance, cardiomyopathy, sensorineural deafness, optic atrophy, pigmentary retinopathy, and diabetes mellitus.600
GJA1Craniometaphyseal dysplasia, autosomal recessiveNM_000165.4NM_000165.4:c.97C>T, NM_000165.4:c.227G>ACraniometaphyseal dysplasia, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJA1 gene located on chromosomal region 6q22.31. The age of onset is infantile. This disease is characterized by hyperostosis and sclerosis of the craniofacial bones associated with abnormal modeling of the metaphyses. Sclerosis of the skull may lead to asymmetry of the mandible, as well as to cranial nerve compression, that may finally result in hearing loss and facial pals. The prevalence is below 1/1,000,000.600
GJB2Deafness, autosomal recessive, type 1ANM_004004.5NM_004004.5:c.617A>G, NM_004004.5:c.551G>C, NM_004004.5:c.550C>T, NM_004004.5:c.516G>A, NM_004004.5:c.465T>A, NM_004004.5:c.439G>A, NM_004004.5:c.427C>T, NM_004004.5:c.416G>A, NM_004004.5:c.402delG, NM_004004.5:c.365A>T, NM_004004.5:c.358_360delGAG, NM_004004.5:c.334_335delAA, NM_004004.5:c.313_326delAAGTTCATCAAGGG, NM_004004.5:c.310_323delAGGAAGTTCATCAA, NM_004004.5:c.299_300delAT, NM_004004.5:c.299A>T, NM_004004.5:c.270dupA, NM_004004.5:c.269dupT, NM_004004.5:c.269T>C, NM_004004.5:c.250G>T, NM_004004.5:c.250G>C, NM_004004.5:c.239A>C, NM_004004.5:c.238C>T, NM_004004.5:c.235delC, NM_004004.5:c.231G>A, NM_004004.5:c.230G>A, NM_004004.5:c.229T>C, NM_004004.5:c.169C>T, NM_004004.5:c.139G>T, NM_004004.5:c.132G>A, NM_004004.5:c.35delGAutosomal recessive nonsyndromic sensorineural deafness type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.600,25
GJB6Deafness, autosomal recessive, type 1BNM_001110219.2NM_001110219.2:c.485dupA, NM_001110219.2:c.443delC, NM_001110219.2:c.383_384delTA, NM_001110219.2:c.261dupA, NM_001110219.2:c.169C>T, NM_001110219.2:c.14C>TAutosomal recessive nonsyndromic sensorineural deafness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB6 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.600,25
GJC2Spastic paraplegia, type 44, autosomal recessiveNM_020435.3NM_020435.3:c.268C>T, NM_020435.3:c.613C>T, NM_020435.3:c.718C>T, NM_020435.3:c.787G>A, NM_020435.3:c.814T>G, NM_020435.3:c.857T>CAutosomal recessive spastic paraplegia type 44 (SPG44) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJC2 gene located on chromosomal region 1q42.13. This disease is characterized by a late-onset, slowly progressive spastic paraplegia associated with mild ataxia and dysarthria, upper extremity involvement (i.e. loss of finger dexterity, dysmetria), and mild cognitive impairment, without the presence of nystagmus. A hypomyelinating leukodystrophy and thin corpus callosum is observed in all cases and psychomotor development is normal or near normal. The prevalence is below 1/1,000,000.600
GLB1GM1-gangliosidosis, type 1NM_001317040.1NM_001317040.1:c.1877A>G, NM_001317040.1:c.1790C>T, NM_001317040.1:c.1721dupG, NM_001317040.1:c.1693G>T, NM_001317040.1:c.1600_1610dupGGTGCATATAT, NM_001317040.1:c.1589G>A, NM_001317040.1:c.1514G>A, NM_001317040.1:c.1513C>T, NM_001317040.1:c.1499dupA, NM_001317040.1:c.1469G>A, NM_001317040.1:c.1465G>A, NM_001317040.1:c.1457G>A, NM_001317040.1:c.1318_1319delCT, NM_001317040.1:c.1212+1G>T, NM_001317040.1:c.1195C>T, NM_001317040.1:c.1148C>T, NM_001317040.1:c.1091A>G, NM_001317040.1:c.1045G>A, NM_001317040.1:c.962G>T, NM_001317040.1:c.766C>T, NM_001317040.1:c.746G>A, NM_001317040.1:c.745C>T, NM_001317040.1:c.735dupT, NM_001317040.1:c.601+2T>C, NM_001317040.1:c.586C>T, NM_001317040.1:c.586C>A, NM_001317040.1:c.582_584delTCT, NM_001317040.1:c.420G>A, NM_001317040.1:c.346C>T, NM_001317040.1:c.320G>A, NM_001317040.1:c.319C>T, NM_001317040.1:c.315C>G, NM_001317040.1:c.296T>C, NM_001317040.1:c.289C>TGangliosidosis GM1, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. Although the three types differ in severity, their features can overlap significantly. The age of onset in type 1 is infantile, in type 2 is late-infantile or juvenile and adult in type3. This disease is characterized by arrest/regression of neurological development, hypotonia, visceromegaly, macular cherry-red spots, dysostosis and coarse facial features. The prevalence is 1:100,000 a 200,000 newborn.600,25
GLDCGlycine encephalopathyNM_000170.2NM_000170.2:c.2405C>T, NM_000170.2:c.2284G>A, NM_000170.2:c.2216G>A, NM_000170.2:c.1691G>T, NM_000170.2:c.1545G>C, NM_000170.2:c.1166C>T, NM_000170.2:c.322G>TGlycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in GLDC gene located on chromosomal region 9p24.1. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000.600,25
GLE1Lethal congenital contracture syndrome, type 1NM_001003722.1NM_001003722.1:c.898-2A>G, NM_001003722.1:c.1412_1413delAG, NM_001003722.1:c.2051T>C, NM_001003722.1:c.2069_2072delTTCTLethal congenital contracture syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLE1 gene located on chromosomal region 9q34.11. The age of onset is neonatal. This disease is characterized by total fetal akinesia (detectable since the 13th week of gestation) accompanied by hydrops, micrognathia, pulmonary hypoplasia, pterygia and multiple joint contractures (usually flexion contractures in the elbows and extension in the knees), leading invariably to death before the 32nd week of gestation. Lack of anterior horn motoneurons, severe atrophy of the ventral spinal cord and severe skeletal muscle hypoplasia are characteristic neuropathological findings, with no evidence of other organ structural anomalies.600,25
GM2AGM2-gangliosidosis, AB variantNM_000405.4NM_000405.4:c.160G>T, NM_000405.4:c.285delC, NM_000405.4:c.506G>CGM2-gangliosidosis, AB variant follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GM2A gene located on chromosomal region 5q33.1. The age of onset is infantile. This disease is characterized by a group of neurodegenerative disorders: seizures, blindness, spasticity, eventual total incapacitation, and death. The prevalence is <1:100.000.600
GNEInclusion body myopathy, type 2 (Nonaka myopathy)NM_001128227.2NM_001128227.2:c.2228T>C, NM_001128227.2:c.2179G>A, NM_001128227.2:c.1937C>G, NM_001128227.2:c.1891G>A, NM_001128227.2:c.1820G>A, NM_001128227.2:c.1002T>A, NM_001128227.2:c.880C>T, NM_001128227.2:c.830G>A, NM_001128227.2:c.478C>TInclusion body myopathy, type 2 (Nonaka myopathy) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNE gene located on chromosomal region 9p13.3. The age of onset is adult. This disease is characterized by progressive muscle weakness and joint deformity. The prevalence is 1:500-1:1,000.600,25
GNPTABMucolipidosis 2 alpha/betaNM_024312.4NM_024312.4:c.3663delG, NM_024312.4:c.3565C>T, NM_024312.4:c.3560_3561delAG, NM_024312.4:c.3503_3504delTC, NM_024312.4:c.3410T>A, NM_024312.4:c.3326dupA, NM_024312.4:c.3173C>G, NM_024312.4:c.2896delA, NM_024312.4:c.2383delG, NM_024312.4:c.1906dupA, NM_024312.4:c.1759C>T, NM_024312.4:c.1196C>T, NM_024312.4:c.1000C>T, NM_024312.4:c.749dupA, NM_024312.4:c.732_733delAA, NM_024312.4:c.648_651delAGAA, NM_024312.4:c.616_619delACAG, NM_024312.4:c.99delC, NM_024312.4:c.25C>T, NM_024312.4:c.10A>CMucolipidosis type 2 alpha/beta follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNPTAB gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by growth retardation, short stature, skeletal abnormalities, facial dysmorphism, stiff skin, developmental delay and cardiomegaly and that is lethal in childhood. The prevalence is 1:123,500-1:625,500.600,25
GNSMucopolysaccharidosis, type 3D (Sanfilippo D)NM_002076.3NM_002076.3:c.1226dupG, NM_002076.3:c.1169delA, NM_002076.3:c.1168C>T, NM_002076.3:c.1063C>T, NM_002076.3:c.413C>GMucolipidosis type 3D (Sanfilippo disease) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNS gene located on chromosomal region 12q14.3. The age of onset is infantile. This disease is characterized by joint stiffness and pain initially in the shoulders, hips, and fingers; and gradual mild coarsening of facial features, cardiorespiratory complications and mild cognitive impairment. The incidence is 1:70,000 newborn.600
GPR143Ocular albinism, type 1 (Nettleship-Falls type)NM_000273.2NM_000273.2:c.992_993insCG, NM_000273.2:c.695C>AX-linked recessive ocular albinism follows an X-linked pattern of inheritance and is caused by pathogenic variants in the GPR143 gene located on chromosomal region Xp22.2. The age of onset is infantile. This condition reduces the coloring (pigmentation) of the iris, which is the colored part of the eye, and the retina, which is the light-sensitive tissue at the back of the eye. Pigmentation in the eye is essential for normal vision. Ocular albinism type I (OA1) is the most common form of ocular albinism. Clinical presentation of OA1 in Caucasians is characterized by nystagmus, impaired visual acuity, iris hypopigmentation with translucency, albinotic fundus, macular hypoplasia, and normally pigmented skin and hair. Carrier females usually have punctate iris translucency and a mottled pattern of fundus pigmentation. In contrast to Caucasian patients, black or Japanese patients with OA1 often have brown irides with little or no translucency and varying degrees of fundus hypopigmentation, the so-called 'nonalbinotic fundus' (summary by Xiao and Zhang, 2009). The prevalence is 1/60,000 to 1/150,000 live male births.600
GPR179Night blindness, congenital stationary (complete), type 1E, autosomal recessiveNM_001004334.3NM_001004334.3:c.6847_6848delCT, NM_001004334.3:c.5763_5764delGA, NM_001004334.3:c.5693dupT, NM_001004334.3:c.4699_4700delAG, NM_001004334.3:c.3233_3234delCT, NM_001004334.3:c.1807C>T, NM_001004334.3:c.1784+1G>A, NM_001004334.3:c.1368delT, NM_001004334.3:c.1236G>A, NM_001004334.3:c.984delC, NM_001004334.3:c.839_842delATCA, NM_001004334.3:c.278dupC, NM_001004334.3:c.278delCCongenital stationary night blindness type 1E follow an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR179 gene located on chromosomal region 17q12. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity.600,25
GRHPRHyperoxaluria, primary, type 2NM_012203.1NM_012203.1:c.103delG, NM_012203.1:c.295C>T, NM_012203.1:c.435G>A, NM_012203.1:c.622C>T, NM_012203.1:c.755dupAPrimary hyperoxaluria, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRHPR gene located on chromosomal region 9p13.2. The age of onset is infantile. This disease is characterized by recurrent nephrolithiasis, nephrocalcinosis and end-stage renal disease with subsequent systemic oxalosis.600
GRM6Night blindness, congenital stationary (complete), type 1B, autosomal recessiveNM_000843.3NM_000843.3:c.2560C>T, NM_000843.3:c.2341G>A, NM_000843.3:c.2213_2219delCCAGAGG, NM_000843.3:c.2122C>T, NM_000843.3:c.1861C>T, NM_000843.3:c.1565G>A, NM_000843.3:c.1336C>T, NM_000843.3:c.1258C>T, NM_000843.3:c.1214T>C, NM_000843.3:c.727dupG, NM_000843.3:c.719_720insG, NM_000843.3:c.712C>TCongenital stationary night blindness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRM6 gene located on chromosomal region 5q35.3. The age of onset is early infancy. This disease is characterized by hemeralopia with a moderate loss of visual acuity.600,25
GRXCR1Deafness, autosomal recessive, type 25NM_001080476.2NM_001080476.2:c.229C>T, NM_001080476.2:c.710_711delATAutosomal recessive nonsyndromic sensorineural deafness type 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRXCR1 gene located on chromosomal region 4p13. The age of onset is infantile. This disease is characterized by hearing loss which is not associated visible abnormalities of the external ear or any related medical problems.600
GSSGlutathione synthetase deficiencyNM_000178.3NM_000178.3:c.847C>T, NM_000178.3:c.832C>T, NM_000178.3:c.799C>T, NM_000178.3:c.754C>T, NM_000178.3:c.656A>G, NM_000178.3:c.656A>C, NM_000178.3:c.491G>AGlutathione synthetase deficiency with 5-oxoprolinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GSS gene located on chromosomal region 20q11.22. The severity and age of onset are variable. This disease is characterized by affectation of the neutrophil respiratory burst and can increase host susceptibility to infections, is associated with hemolytic anemia and intellectual disability. The prevalence is <1:1,000,000.600
GUCY2DLeber congenital amaurosis, type 1NM_000180.3NM_000180.3:c.456C>A, NM_000180.3:c.622delC, NM_000180.3:c.1694T>C, NM_000180.3:c.2735_2736delTT, NM_000180.3:c.2945delGLeber congenital amaurosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUCY2D gene located on chromosomal region 17p13.1. The age of onset is infantile. This disease is characterized by blindness, nystagmus, roving eye movement and severe visual impairment.600
GUSBMucopolysaccharidosis, type 7NM_000181.3NM_000181.3:c.1881G>T, NM_000181.3:c.1856C>T, NM_000181.3:c.1831C>T, NM_000181.3:c.1730G>T, NM_000181.3:c.1618G>T, NM_000181.3:c.1534G>A, NM_000181.3:c.1521G>A, NM_000181.3:c.1429C>T, NM_000181.3:c.1338G>A, NM_000181.3:c.1337G>A, NM_000181.3:c.1244+1G>A, NM_000181.3:c.1219_1220insC, NM_000181.3:c.1144C>T, NM_000181.3:c.1084G>A, NM_000181.3:c.1065+1G>T, NM_000181.3:c.1061C>T, NM_000181.3:c.1050G>C, NM_000181.3:c.866G>A, NM_000181.3:c.820_821delAC, NM_000181.3:c.646C>T, NM_000181.3:c.526C>T, NM_000181.3:c.499C>T, NM_000181.3:c.442C>TMucopolysaccharidosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUSB gene located on chromosomal region 7q11.21. The age of onset is variable. There are prenatal forms with non-immune hydrops fetalis, and severe neonatal forms with dysmorphism, hernias, hepatosplenomegaly, club feet, dysostosis, severe hypotonia and neurological disorders that ultimately lead to profound intellectual deficit and small stature in patients that survive. Finally, there are also very mild cases that are discovered during adolescence or adulthood following presentation with thoracic kyphosis. The prevalence is 1:250,000 in newborn.600,25
HADHALCHAD deficiencyNM_000182.4NM_000182.4:c.2146+1G>A, NM_000182.4:c.2132dupC, NM_000182.4:c.1918C>T, NM_000182.4:c.1793_1794delAT, NM_000182.4:c.1678C>T, NM_000182.4:c.1644delC, NM_000182.4:c.1620+2_1620+6delTAAGG, NM_000182.4:c.1528G>C, NM_000182.4:c.1422dupT, NM_000182.4:c.1132C>T, NM_000182.4:c.919-2A>G, NM_000182.4:c.845T>A, NM_000182.4:c.499delA, NM_000182.4:c.274_278delTCATCIsolated deficiency of long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD deficiency) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA gene located on chromosomal region 2p23.3. This disease is characterized in infancy/early childhood of hypoketotic hypoglycemia, metabolic acidosis, liver disease, hypotonia and, frequently, cardiac involvement with arrhythmias and/or cardiomyopathy. The prevalence is 1/250,000.600,25
HADHBTrifunctional protein deficiencyNM_000183.2NM_000183.2:c.788A>G, NM_000183.2:c.1331G>A, NM_000183.2:c.1364T>GMitochondrial trifunctional protein deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in HADHB gene located on chromosomal region 2p23.3. The age of onset is neonatal/infancy. It is characterized by a wide clinical spectrum ranging from severe neonatal manifestations including cardiomyopathy, hypoglycemia, metabolic acidosis, skeletal myopathy and neuropathy, liver disease and death to a mild phenotype with peripheral polyneuropathy, episodic rhabdomyolysis and pigmentary retinopathy. The prevalence is <1 / 1,000,000.600
HBA1/HBA2Thalassemia, alpha--0-?3.7, -?4.2, -(?)20.5, --SEA, --MED, --FIL, --THAIAlpha-thalassemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBA1 gene located on chromosomal region 16p13.3. The age of onset is infantile. It is characterized by impaired synthesis of alpha-globin chains leading to a variable clinical picture depending on the number of affected alleles. The disease can be classified into clinical subtypes of increasing severity: silent alpha thalassemia, alpha thalassemia trait (or alpha thalassemia minor), hemoglobin H disease (HbH), and Hb Bart's hydrops fetalis (see these terms). A rare form called alpha-thalassemia-intellectual deficit syndrome has also been identified (see these terms). Alpha thalassemia trait causes microcytosis and hypochromia with absent or mild anemia (often detected on routine blood tests), generally with no other symptoms. HbH patients develop moderate hemolytic anemia with variable amounts of HbH along with occasionally severe splenomegaly, sometimes complicated by hypersplenism. Hb Bart's hydrops fetalis involves a severe deficiency in alpha-globin with serious developmental implications. Alpha-thalassemia-intellectual deficit syndrome is characterized by very mild to severe anemia associated with developmental abnormalities. The prevalence is 1:10,000-5:10,000.600
HBBHBB-related hemoglobinopathyNM_000518.4NM_000518.4:c.*110T>C, NM_000518.4:c.440_441dupAC, NM_000518.4:c.440A>T, NM_000518.4:c.440A>C, NM_000518.4:c.439C>G, NM_000518.4:c.438T>A, NM_000518.4:c.437A>G, NM_000518.4:c.436T>C, NM_000518.4:c.435G>C, NM_000518.4:c.431A>C, NM_000518.4:c.428C>A, NM_000518.4:c.421G>A, NM_000518.4:c.383A>C, NM_000518.4:c.371_378delCCCCACCA, NM_000518.4:c.364G>T, NM_000518.4:c.364G>A, NM_000518.4:c.347C>A, NM_000518.4:c.344T>C, NM_000518.4:c.343_344delCTinsG, NM_000518.4:c.341T>A, NM_000518.4:c.332T>C, NM_000518.4:c.328delG, NM_000518.4:c.328G>A, NM_000518.4:c.323dupG, NM_000518.4:c.320T>G, NM_000518.4:c.316-1G>T, NM_000518.4:c.316-1G>A, NM_000518.4:c.316-2A>G, NM_000518.4:c.316-2A>C, NM_000518.4:c.316-3C>A, NM_000518.4:c.316-106C>G, NM_000518.4:c.316-146T>G, NM_000518.4:c.316-197C>T, NM_000518.4:c.315+2T>G, NM_000518.4:c.315+1G>C, NM_000518.4:c.315+1G>A, NM_000518.4:c.312C>G, NM_000518.4:c.306G>C, NM_000518.4:c.305A>G, NM_000518.4:c.304G>A, NM_000518.4:c.302C>T, NM_000518.4:c.299A>T, NM_000518.4:c.299A>G, NM_000518.4:c.299A>C, NM_000518.4:c.298G>T, NM_000518.4:c.298G>C, NM_000518.4:c.298G>A, NM_000518.4:c.295G>A, NM_000518.4:c.293A>T, NM_000518.4:c.287dupA, NM_000518.4:c.282_283dupTG, NM_000518.4:c.283G>C, NM_000518.4:c.277C>T, NM_000518.4:c.277C>A, NM_000518.4:c.275T>C, NM_000518.4:c.271G>T, NM_000518.4:c.269G>A, NM_000518.4:c.268A>C, NM_000518.4:c.257T>C, NM_000518.4:c.251delG, NM_000518.4:c.248A>T, NM_000518.4:c.248A>C, NM_000518.4:c.247A>G, NM_000518.4:c.230delC, NM_000518.4:c.226delC, NM_000518.4:c.217_221delAGTGAinsT, NM_000518.4:c.217dupA, NM_000518.4:c.216dupT, NM_000518.4:c.208G>A, NM_000518.4:c.206T>A, NM_000518.4:c.203_204delTG, NM_000518.4:c.201delA, NM_000518.4:c.199A>G, NM_000518.4:c.194delG, NM_000518.4:c.190C>T, NM_000518.4:c.184A>T, NM_000518.4:c.182T>A, NM_000518.4:c.179A>C, NM_000518.4:c.176C>G, NM_000518.4:c.162delT, NM_000518.4:c.143_146dupATCT, NM_000518.4:c.143dupA, NM_000518.4:c.135delC, NM_000518.4:c.134C>G, NM_000518.4:c.130G>T, NM_000518.4:c.126_129delCTTT, NM_000518.4:c.128T>C, NM_000518.4:c.127T>G, NM_000518.4:c.127T>C, NM_000518.4:c.114_120delGACCCAG, NM_000518.4:c.117_118delCC, NM_000518.4:c.118C>T, NM_000518.4:c.114G>A, NM_000518.4:c.113G>A, NM_000518.4:c.112delT, NM_000518.4:c.110delC, NM_000518.4:c.108C>A, NM_000518.4:c.103G>T, NM_000518.4:c.93G>T, NM_000518.4:c.93-1G>C, NM_000518.4:c.93-1G>A, NM_000518.4:c.93-2A>C, NM_000518.4:c.93-21G>A, NM_000518.4:c.92+6T>C, NM_000518.4:c.92+5G>T, NM_000518.4:c.92+5G>C, NM_000518.4:c.92+5G>A, NM_000518.4:c.92+2T>C, NM_000518.4:c.92+2T>A, NM_000518.4:c.92+1G>T, NM_000518.4:c.92+1G>A, NM_000518.4:c.92G>C, NM_000518.4:c.92G>A, NM_000518.4:c.91A>C, NM_000518.4:c.90C>T, NM_000518.4:c.86T>A, NM_000518.4:c.85dupC, NM_000518.4:c.82G>T, NM_000518.4:c.80A>G, NM_000518.4:c.79_80insT, NM_000518.4:c.79G>T, NM_000518.4:c.79G>A, NM_000518.4:c.75T>A, NM_000518.4:c.68_74delAAGTTGG, NM_000518.4:c.64dupG, NM_000518.4:c.59A>G, NM_000518.4:c.52A>T, NM_000518.4:c.51delC, NM_000518.4:c.48G>A, NM_000518.4:c.47G>A, NM_000518.4:c.46delT, NM_000518.4:c.45dupG, NM_000518.4:c.36delT, NM_000518.4:c.27dupG, NM_000518.4:c.25_26delAA, NM_000518.4:c.20delA, NM_000518.4:c.20A>T, NM_000518.4:c.19G>A, NM_000518.4:c.17_18delCT, NM_000518.4:c.8A>C, NM_000518.4:c.4delG, NM_000518.4:c.4G>T, NM_000518.4:c.3G>A, NM_000518.4:c.2T>G, NM_000518.4:c.2T>C, NM_000518.4:c.2T>A, NM_000518.4:c.1A>G, NM_000518.4:c.-50A>C, NM_000518.4:c.-75G>C, NM_000518.4:c.-78A>G, NM_000518.4:c.-78A>C, NM_000518.4:c.-79A>G, NM_000518.4:c.-80T>A, NM_000518.4:c.-137C>G, NM_000518.4:c.-137C>A, NM_000518.4:c.-138C>T, NM_000518.4:c.-151C>TDNA variations in the HBB gene result in the production of different versions of beta-globin. Some of these variations may affect a person's health while other variations cause no noticeable signs or symptoms. Two of the most common HBB-related conditions are beta-thalassemia and sickle cell anemia (SCA). Beta thalassemia is caused by HBB gene mutations that prevent or decrease beta-globin production, subunits that make up hemoglobin. A lack of hemoglobin disrupts the normal development of red blood cells. A shortage of mature red blood cells can reduce the amount of oxygen that is delivered to tissues to below what is needed to satisfy the body's energy needs. A lack of oxygen in the body's tissues can lead to poor growth, organ damage, and other health problems associated with beta thalassemia. SCA is a multisystem disease associated with episodes of acute illness and progressive organ damage. SCA-associated mutations cause red blood cells assuming an abnormal, rigid, sickle shape promoting cell break down prematurely, which can lead to anemia. Anemia can cause shortness of breath, fatigue, and delayed growth and development in children.600,25
HESX1Growth hormone deficiency with pituitary anomaliesNM_003865.2NM_003865.2:c.450_451delCA, NM_003865.2:c.445G>A, NM_003865.2:c.77T>C, NM_003865.2:c.18G>CGrowth hormone deficiency with pituitary anomalies follows an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the HESX1 gene located on chromosomal region 3p14.3. The age of onset is infantile. These diseases are characterized by short stature, cognitive alterations or delayed puberty. The incidence is 1:3,000 and 1:4,000 births.600,25
HEXATay-Sachs diseaseNM_000520.5NM_000520.5:c.254-1G>CTay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births.600,25
HEXATay-Sachs diseaseNM_001318825.1NM_001318825.1:c.1570C>T, NM_001318825.1:c.1561C>T, NM_001318825.1:c.1544G>A, NM_001318825.1:c.1543delC, NM_001318825.1:c.1543C>T, NM_001318825.1:c.1532delT, NM_001318825.1:c.1529G>A, NM_001318825.1:c.1528C>T, NM_001318825.1:c.1477G>A, NM_001318825.1:c.1455G>C, NM_001318825.1:c.1311_1312insTATC, NM_001318825.1:c.1307_1310dupTATC, NM_001318825.1:c.1293G>C, NM_001318825.1:c.1247_1248delAAinsG, NM_001318825.1:c.1210C>T, NM_001318825.1:c.1209G>A, NM_001318825.1:c.1020G>A, NM_001318825.1:c.1019+3A>G, NM_001318825.1:c.948_950delCTT, NM_001318825.1:c.838+1G>C, NM_001318825.1:c.838+1G>A, NM_001318825.1:c.838G>A, NM_001318825.1:c.805G>C, NM_001318825.1:c.782G>A, NM_001318825.1:c.705+1G>A, NM_001318825.1:c.665T>C, NM_001318825.1:c.662C>T, NM_001318825.1:c.573C>G, NM_001318825.1:c.571T>C, NM_001318825.1:c.566G>T, NM_001318825.1:c.566G>A, NM_001318825.1:c.565C>T, NM_001318825.1:c.542G>A, NM_001318825.1:c.541C>T, NM_001318825.1:c.492+5G>A, NM_001318825.1:c.413T>G, NM_001318825.1:c.173G>A, NM_001318825.1:c.116T>G, NM_001318825.1:c.78G>A, NM_001318825.1:c.77G>A, NM_001318825.1:c.2T>C, NM_001318825.1:c.1A>T, NM_001318825.1:c.1A>GTay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births.600,25
HEXBSandhoff disease, infantile, juvenile, and adult formsNM_000521.3NM_000521.3:c.115delG, NM_000521.3:c.171delG, NM_000521.3:c.202_203insGG, NM_000521.3:c.298delC, NM_000521.3:c.508C>T, NM_000521.3:c.797A>G, NM_000521.3:c.841C>T, NM_000521.3:c.850C>T, NM_000521.3:c.1238_1242delCAAAG, NM_000521.3:c.1250C>T, NM_000521.3:c.1310_1311delCA, NM_000521.3:c.1345delT, NM_000521.3:c.1375G>T, NM_000521.3:c.1380G>A, NM_000521.3:c.1517_1529dupCAAGTGCTGTTGG, NM_000521.3:c.1539_1540delCTSandhoff disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXB gene located on chromosomal region 5q13.3. The age of onset is adult or infantile. This disease is characterized by central nervous system degeneration, with startle reactions, early blindness, progressive motor and mental deterioration, macrocephaly and cherry-red spots on the macula. The prevalence is 1/130.000.600,25
HGDAlkaptonuriaNM_000187.3NM_000187.3:c.1189-2A>G, NM_000187.3:c.1111dupC, NM_000187.3:c.1102A>G, NM_000187.3:c.899T>G, NM_000187.3:c.808G>A, NM_000187.3:c.688C>T, NM_000187.3:c.674G>A, NM_000187.3:c.481G>A, NM_000187.3:c.469+2T>C, NM_000187.3:c.342+1G>A, NM_000187.3:c.175delA, NM_000187.3:c.172A>T, NM_000187.3:c.140C>T, NM_000187.3:c.16-1G>AAlkaptonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGD gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by darkening of the urine when it is left exposed to air, grey-blue colouration of the eye sclerae and the ear helix (ochronosis), and a disabling joint disease involving both the axial and peripheral joints (ochronotic arthropathy). The prevalence is 1:250,000-1:1.000.000 newborn.600,25
HGFDeafness, autosomal recessive, type 39NM_000601.5NM_000601.5:c.2028delA, NM_000601.5:c.1597C>TAutosomal recessive nonsyndromic sensorineural deafness type 39 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGF gene located on chromosomal region 7q21.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.600
HGSNATMucopolysaccharidosis type 3C (Sanfilippo C)NM_152419.2NM_152419.2:c.493+1G>A, NM_152419.2:c.607C>T, NM_152419.2:c.848C>T, NM_152419.2:c.1030C>T, NM_152419.2:c.1250+1G>A, NM_152419.2:c.1378-1G>A, NM_152419.2:c.1464+1G>A, NM_152419.2:c.1503delA, NM_152419.2:c.1553C>T, NM_152419.2:c.1622C>TMucopolysaccharidosis type 3C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGSNAT gene located on chromosomal region 8p11.21. The age of onset is infantile. This disease is characterized by defective or missing enzymes to break down mucopolysaccharides are missing or are defective. The prevalence is <1:70.000 newborn.600,25
HIBCH3-hydroxyisobutryl-CoA hydrolase deficiencyNM_014362.3NM_014362.3:c.1012A>T, NM_014362.3:c.494_495delTT, NM_014362.3:c.365A>G, NM_014362.3:c.220-9T>G, NM_014362.3:c.79-3C>G3-Hydroxyisobutryl-CoA hydrolase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HIBCH gene located on chromosomal region 2q32.2. The age of onset is infantile. This disease is characterized by delayed motor development, hypotonia and progressive neurodegeneration. The prevalence is <1:1,000,000.600
HMGCLHMG-CoA lyase deficiencyNM_000191.2NM_000191.2:c.835G>A, NM_000191.2:c.698A>G, NM_000191.2:c.505_506delTC, NM_000191.2:c.230delT, NM_000191.2:c.206_207delCT, NM_000191.2:c.122G>A3-hydroxy-3-methylglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HMGCL gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is is an organic aciduria, due to deficiency of 3-hydroxy-3-methylglutaryl-CoA-lyase (a key enzyme in ketogenesis and leucine metabolism) usually presenting in infancy with episodes of metabolic decompensation triggered by periods of fasting or infections, which when left untreated are life-threatening and may lead to neurological sequelae.600
HPDTyrosinemia, type 3NM_002150.2NM_002150.2:c.987delA, NM_002150.2:c.774T>G, NM_002150.2:c.600C>GTyrosinemia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPD gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by intellectual deficit and ataxia. The prevalence is 1:100,000-1:120,000 newborn.600,25
HPRT1Lesch-Nyhan syndromeNM_000194.2NM_000194.2:c.486-1G>A, NM_000194.2:c.508C>T, NM_000194.2:c.532+2T>G, NM_000194.2:c.610-2A>GLesch-Nyhan syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the HPRT1 gene located on chromosomal region Xq26.2-q26.3. The age of onset is infantile. This disease is characterized by acid overproduction, neurological troubles, and behavioral problems. The prevalence is 1:380,000.600
HPS1Hermansky-Pudlak syndrome, type 1NM_000195.4NM_000195.4:c.1996G>T, NM_000195.4:c.972dupC, NM_000195.4:c.972delC, NM_000195.4:c.398+5G>A, NM_000195.4:c.397G>THermansky-Pudlak syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPS1 gene located on chromosomal region 10q24.2. The age of onset is early childhood. This disease is characterized by oculocutaneous albinism, bleeding diathesis and, in some cases, neutropenia, pulmonary fibrosis, or granulomatous colitis. The prevalence is 1/500,000 - 1/1,000,000.600
HSD17B4D-bifunctional protein deficiencyNM_000414.3NM_000414.3:c.46G>ABifunctional enzyme deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSD17B4 gene located on chromosomal region 5q23. The age of onset is juvenile. This disease is characterized by slowly progressive cerebellar atrophy and ataxia, intellectual decline, hearing loss, hypogonadism, hyperreflexia, a demyelinating sensorimotor neuropathy.600
HSD17B4D-bifunctional protein deficiencyNM_001199291.2NM_001199291.2:c.392G>C, NM_001199291.2:c.725A>G, NM_001199291.2:c.1047+1G>T, NM_001199291.2:c.1444A>TBifunctional enzyme deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSD17B4 gene located on chromosomal region 5q23. The age of onset is juvenile. This disease is characterized by slowly progressive cerebellar atrophy and ataxia, intellectual decline, hearing loss, hypogonadism, hyperreflexia, a demyelinating sensorimotor neuropathy.600
HSPD1Leukodystrophy, hypomyelinating, type 4NM_002156.4NM_002156.4:c.292G>ALeukodystrophy hypomyelinating, type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSPD1 gene located on chromosomal region 2q33.1. The age of onset is infantile. A severe autosomal recessive hypomyelinating leukodystrophy. Clinically characterized by infantile-onset rotary nystagmus, progressive spastic paraplegia, neurologic regression, motor impairment, profound mental retardation. Death usually occurs within the first two decades of life.600
HSPG2Dyssegmental dysplasia, Silverman-Handmaker typeNM_001291860.1NM_001291860.1:c.13078delC, NM_001291860.1:c.9329delA, NM_001291860.1:c.8467+4A>G, NM_001291860.1:c.1656_1657insT, NM_001291860.1:c.1125C>ADyssegmental dysplasia, Silverman-Handmaker type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSPG2 gene located on chromosomal region 1p36.12. The age of onset is prenatal/neonatal. This disease is characterized by anisospondyly, severe short stature and limb shortening, metaphyseal flaring and distinct dysmorphic features (i.e. flat facial appearance, abnormal ears, short neck, narrow thorax). Additional features may include other skeletal findings (e.g. joint contractures, bowed limbs, talipes equinovarus) and urogenital and cardiovascular abnormalities. The prevalence is below 1/1,000,000.600
HTRA1CARASIL syndromeNM_002775.4NM_002775.4:c.754G>A, NM_002775.4:c.883G>A, NM_002775.4:c.889G>A, NM_002775.4:c.904C>T, NM_002775.4:c.1108C>TCerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy (CARASIL syndrome) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HTRA1 gene located on chromosomal region 10q26.13. The age of onset is adult. This disease is characterized by early-onset gait disturbances, premature scalp alopecia, ischemic stroke, acute mid to lower back pain and progressive cognitive disturbances leading to severe dementia. About 50 people diagnosed, mainly in Japan and China.600
HYLS1Hydrolethalus syndromeNM_001134793.1NM_001134793.1:c.632A>G, NM_001134793.1:c.669G>A, NM_001134793.1:c.724C>THydrolethalus syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HYLS1 gene located on chromosomal region 11q24.2. The age of onset is fetal. This disease is characterized by craniofacial dysmorphic features, central nervous system, cardiac, respiratory tract and limb abnormalities. The incidence is 1/20,000 in Finland and the prevalence is <1:1,000,000.600
IDH3BRetinitis pigmentosa, type 46NM_006899.4NM_006899.4:c.589delA, NM_006899.4:c.490C>T, NM_006899.4:c.395T>CRetinitis pigmentosa, type 46 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IDH3B gene located on chromosomal region 20p13. The age of onset is variable. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness. The prevalence is 1/3,000 to 1/5,000.600
IDSMucopolysaccharidosis, type 2NM_000202.7NM_000202.7:c.1508T>A, NM_000202.7:c.1505G>C, NM_000202.7:c.1148delC, NM_000202.7:c.1122C>T, NM_000202.7:c.998C>T, NM_000202.7:c.880-8A>G, NM_000202.7:c.690_691insT, NM_000202.7:c.683C>T, NM_000202.7:c.596_599delAACA, NM_000202.7:c.597delA, NM_000202.7:c.587T>C, NM_000202.7:c.514C>T, NM_000202.7:c.404A>G, NM_000202.7:c.388_389insG, NM_000202.7:c.314_317dupTCAA, NM_000202.7:c.278delC, NM_000202.7:c.240+1G>A, NM_000202.7:c.208dupCMucopolysaccharidosis, type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IDS gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by distinctive coarse facial features, short stature, cardio-respiratory involvement and skeletal abnormalities. The prevalence is 1:100,000-1:170,000 mannewborn.600
IDSMucopolysaccharidosis, type 2NM_001166550.3NM_001166550.3:c.15-2A>GMucopolysaccharidosis, type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IDS gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by distinctive coarse facial features, short stature, cardio-respiratory involvement and skeletal abnormalities. The prevalence is 1:100,000-1:170,000 mannewborn.600
IFT80Short-rib thoracic dysplasia, type 2, with or without polydactylyNM_020800.2NM_020800.2:c.701C>G, NM_020800.2:c.315C>GShort-rib thoracic dysplasia type 2 with or without polydactyly an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IFT80 gene located on chromosomal region 3q25.33. The age of onset is antenatal/neonatal. This is, a group of autosomal recessive ciliopathies that are characterized by a constricted thoracic cage, short ribs, shortened tubular bones, and a trident appearance of the acetabular roof. Polydactyly is variably present. Non-skeletal involvement can include cleft lip/palate as well as anomalies of major organs such as the brain, eye, heart, kidneys, liver, pancreas, intestines, and genitalia. Some forms of the disease are lethal in the neonatal period due to respiratory insufficiency secondary to a severely restricted thoracic cage, whereas others are compatible with life. Disease spectrum encompasses Ellis-van Creveld syndrome, asphyxiating thoracic dystrophy (Jeune syndrome), Mainzer-Saldino syndrome, and short rib-polydactyly syndrome. The incidence is 1-5/500,000.600
IGF1Growth retardation with deafness and mental retardation due to IGF1 deficiencyNM_001111285.2NM_001111285.2:c.274G>AGrowth retardation with deafness and mental retardation due to IGF1 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGF1 gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by the association of intrauterine and postnatal growth retardation with sensorineural deafness and intellectual deficit, addition clinical features include microcephaly, adiposity, and insulin resistance. The prevalence is <1:1,000,000.600
IGHMBP2Charcot-Marie-Tooth disease, axonal, type 2SNM_002180.2NM_002180.2:c.121C>T, NM_002180.2:c.638A>G, NM_002180.2:c.661delA, NM_002180.2:c.1107C>G, NM_002180.2:c.1488C>A, NM_002180.2:c.1540G>A, NM_002180.2:c.1738G>A, NM_002180.2:c.2362C>T, NM_002180.2:c.2611+1G>TCharcot-Marie-Tooth disease, axonal, type 2S follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGHMBP2 gene located on chromosomal region 11q13.3. The age of onset can be infancy, childhood, adult or adolescent. This disease is characterized by progressive distal muscle weakness and atrophy of both the lower and upper limbs, absent or reduced deep tendon reflexes, mild sensory loss, foot drop, and pes cavus leading eventually to wheelchair dependence. Some patients present with early hypotonia and delayed motor development. Scoliosis and variable autonomic disturbances may be associated. The prevalence is below 1/1,000,000.600,25
IL2RGSevere combined immunodeficiency, X-linkedNM_000206.2NM_000206.2:c.854G>A, NM_000206.2:c.664C>T, NM_000206.2:c.454+1G>A, NM_000206.2:c.452T>C, NM_000206.2:c.355A>T, NM_000206.2:c.343T>C, NM_000206.2:c.341G>A, NM_000206.2:c.186T>ASevere combined immunodeficiency, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IL2RG gene located on chromosomal region Xq13.1. The age of onset is infantile. This disease is characterized by absent or markedly reduced numbers of T cells, leading to recurrent infections. The prevalence is 1:50,000-1:100,000.600
IMPG2Retinitis pigmentosa, type 56NM_016247.3NM_016247.3:c.3262C>T, NM_016247.3:c.2890C>T, NM_016247.3:c.635C>G, NM_016247.3:c.502-1G>CRetinitis pigmentosa type 56 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IMPG2 gene located on chromosomal region 3q12.3. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades. The prevalence is 1/4.000.600
INPP5EJoubert syndrome, type 1NM_019892.5NM_019892.5:c.1879C>T, NM_019892.5:c.1688G>A, NM_019892.5:c.1543C>T, NM_019892.5:c.1304G>A, NM_019892.5:c.1132C>T, NM_019892.5:c.855_856insCGJoubert syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:100,000.600,25
INSRDiabetes mellitus, insulin-resistant, with acanthosis nigricans, type ANM_000208.3NM_000208.3:c.3680G>C, NM_000208.3:c.3079C>T, NM_000208.3:c.2668C>T, NM_000208.3:c.1114C>T, NM_000208.3:c.172G>ADiabetes mellitus, insulin-resistant, with acanthosis nigricans type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by the triad of hyperinsulinemia, acanthosis nigricans (skin lesions associated with insulin resistance), and signs of hyperandrogenism in females without lipodystrophy and who are not overweight. It is generally diagnosed in young women with marked signs of hyperandrogenism, but insulin resistance and acanthosis nigricans may be observed in men and in childhood. Acromegaloid facies or muscular cramps are sometimes associated. Hyperinsulinemia, a biological marker for insulin resistance, is often associated with glucose tolerance defects over the course of the disease, and diabetes progressively sets in. Hyperandrogenism (associated with polycystic ovarian syndrome (see this term) or ovarian hyperthecoses) leads to fertility problems. The prevalence is <1:1,000,000.600,25
IQCB1Senior-Loken syndrome, type 5NM_001023570.3NM_001023570.3:c.1518_1519delCA, NM_001023570.3:c.1465C>T, NM_001023570.3:c.1381C>T, NM_001023570.3:c.1090C>T, NM_001023570.3:c.1069C>T, NM_001023570.3:c.1036G>T, NM_001023570.3:c.817G>TSenior-Loken syndrome, type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IQCB1 gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by the association of nephronophthisis (NPHP), a chronic kidney disease, with retinal dystrophy. The prevalence is 1/1.000.000.600
ISCUMyopathy with lactic acidosis, hereditaryNM_213595.3NM_213595.3:c.149G>A, NM_213595.3:c.338_339+2delCGGTHereditary myopathy with lactic acidosis due to ISCU deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ISCU gene located on chromosomal region 12q23.3. The age of onset is infantile. This disease is characterized by myopathy with severe exercise intolerance.600
ITGA6Epidermolysis bullosa, junctional, with pyloric stenosisNM_001079818.2NM_001079818.2:c.791delC, NM_001079818.2:c.1255dupAJunctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGA6 gene located on chromosomal region 2q31.1 . The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract.600
ITGB4Epidermolysis bullosa, junctional, with pyloric atresiaNM_000213.4NM_000213.4:c.112T>C, NM_000213.4:c.182G>A, NM_000213.4:c.1150delG, NM_000213.4:c.1660C>T, NM_000213.4:c.1684T>C, NM_000213.4:c.2608delC, NM_000213.4:c.2792G>A, NM_000213.4:c.3321_3331delACTGGACCGGA, NM_000213.4:c.3674G>A, NM_000213.4:c.3793+1G>A, NM_000213.4:c.3801dupT, NM_000213.4:c.3841C>T, NM_000213.4:c.4620delG, NM_000213.4:c.4643G>A, NM_000213.4:c.4828C>T, NM_000213.4:c.5329+2T>CJunctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGB4 gene located on chromosomal region 17q25.1. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. More than 100 cases have been reported around the world.600,25
IVDIsovaleric acidemiaNM_002225.3NM_002225.3:c.2T>G, NM_002225.3:c.134T>C, NM_002225.3:c.157C>T, NM_002225.3:c.158G>A, NM_002225.3:c.158G>C, NM_002225.3:c.243+1G>A, NM_002225.3:c.367G>A, NM_002225.3:c.390delT, NM_002225.3:c.406_407delTG, NM_002225.3:c.434_437dupATGA, NM_002225.3:c.465+2T>C, NM_002225.3:c.478_479insGT, NM_002225.3:c.507delG, NM_002225.3:c.559+1G>A, NM_002225.3:c.593G>A, NM_002225.3:c.605G>T, NM_002225.3:c.627delT, NM_002225.3:c.793+1G>A, NM_002225.3:c.941C>T, NM_002225.3:c.994_995delAT, NM_002225.3:c.1141T>C, NM_002225.3:c.1145_1147+4delTTGGTGA, NM_002225.3:c.1183C>T, NM_002225.3:c.1188delT, NM_002225.3:c.1192C>T, NM_002225.3:c.1208A>GIsovaleric academia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IVD gene located on chromosomal region 15q15.1. The age of onset is neonatal. This disease is characterized by vomiting, dehydration, coma and abnormal movements. The prevalence is 1/100,000.600,25
JAK3Severe Combined Immunodeficiency, autosomal recessive, T-negative/B-positive typeNM_000215.3NM_000215.3:c.1837C>T, NM_000215.3:c.1765G>A, NM_000215.3:c.1695C>A, NM_000215.3:c.1333C>T, NM_000215.3:c.1172_1173insG, NM_000215.3:c.299A>GSevere combined immunodeficiency, T-B+ type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the JAK3 gene located on chromosomal region 19p13.11. The age of onset is infantile. This disease is characterized by chronic diarrhea, failure to thrive, recurrent respiratory infections and/or generalized infections due to opportunistic pathogens. The incidence is 1/100,000 and 1/1,000,000.600,25
KCNJ1Bartter syndrome, type 2NM_000220.4NM_000220.4:c.1014delA, NM_000220.4:c.1012C>T, NM_000220.4:c.996_999delAAAG, NM_000220.4:c.942T>G, NM_000220.4:c.657C>G, NM_000220.4:c.641C>T, NM_000220.4:c.592G>A, NM_000220.4:c.500G>A, NM_000220.4:c.372T>A, NM_000220.4:c.322G>C, NM_000220.4:c.237C>GBartter syndrome, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ1 gene located on chromosomal region 11q24.3. The age of onset is antenatal. This disease is characterized by severe polyhydramnios in mother leading to premature delivery, postnatally newborns suffer from recurrent episodes of severe dehydration and electrolyte imbalance which can lead to fatal outcome.600,25
KCNJ13Leber congenital amaurosis, type 16NM_002242.4NM_002242.4:c.722T>CLeber congenital amaurosis, type 16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ13 gene located on chromosomal region 2q37.1. The age of onset is early infantile. This disease is characterized by retinal dystrophy defined by blindness, nystagmus, roving eye movement, leading to severe visual impairment within the first year of life.600
KCNV2Retinal cone dystrophy, type 3BNM_133497.3NM_133497.3:c.226C>T, NM_133497.3:c.325C>T, NM_133497.3:c.357dupC, NM_133497.3:c.427G>T, NM_133497.3:c.442G>T, NM_133497.3:c.491T>C, NM_133497.3:c.767C>G, NM_133497.3:c.778A>T, NM_133497.3:c.916G>T, NM_133497.3:c.1016_1024delACCTGGTGG, NM_133497.3:c.1133dupT, NM_133497.3:c.1376G>ARetinal cone dystrophy, type 3B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNV2 gene located on 9p24.2. The age of onset is in the first or second decade of life. This disease is characterized by is characterized by onset in the first or second decade of life of very marked photophobia, myopia, reduced color vision along the red-green axis with relatively preserved tritan discrimination, and central scotomata with peripheral widespread sensitivity loss predominating in the superior visual field. Nyctalopia is a later feature of the disorder. There is often retinal pigment epithelium disturbance at the macula with a normal retinal periphery.600,25
KIF7Acrocallosal syndrome; Joubert syndrome, type 12NM_198525.2NM_198525.2:c.3772_3773insC, NM_198525.2:c.3001C>T, NM_198525.2:c.2896_2897delGC, NM_198525.2:c.2473G>T, NM_198525.2:c.687delG, NM_198525.2:c.460C>T, NM_198525.2:c.61C>TAcrocallosal syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KIF7 gene located on chromosomal region 15q26.1. The age of onset is infantile. This disease is considered a ciliopathy and is characterized by mental retardation, brain abnormalities such as corpus callosum agenesis and/or Dandy-Walker malformation as well as dysmorphic features, postaxial polydactyly of the hands, and preaxial polydactyly of the feet. The prevalence is below 1/1,000,000.
Mutations in KIF7 gene are also associated with Joubert syndrome type 12, a disorder with an acrocallosal syndrome overlapping phenotype characterized by the hallmark finding of the molar tooth sign (MTS) on brain MRI.		600
L1CAML1 SyndromeNM_000425.4NM_000425.4:c.3581C>T, NM_000425.4:c.3489_3490delTG, NM_000425.4:c.3201T>G, NM_000425.4:c.2879delA, NM_000425.4:c.2254G>A, NM_000425.4:c.2092G>A, NM_000425.4:c.1792G>A, NM_000425.4:c.1354G>A, NM_000425.4:c.1108G>A, NM_000425.4:c.924C>T, NM_000425.4:c.800dupA, NM_000425.4:c.791G>A, NM_000425.4:c.772C>T, NM_000425.4:c.719C>T, NM_000425.4:c.551G>A, NM_000425.4:c.536T>G, NM_000425.4:c.23delTL1 syndromeﾠdescribes a group of conditions that primarily affect the nervous system and occur almost exclusively in males. These conditions vary in severity and include, from most severe to least, X-linked hydrocephalus with stenosis of the aqueduct of Sylvius (HSAS), MASA syndrome, spastic paraplegia type 1, and X-linked complicated corpus callosum agenesis. HSAS is an acronym for the characteristic features of the condition: fluid in the brain (hydrocephalus), muscle stiffness (spasticity), thumbs that are permanently bent toward the palms (adducted thumbs), and narrowing (stenosis) of the aqueduct of Sylvius in the brain. Individuals with HSAS often have severe intellectual disability and may have seizures. MASA syndrome include intellectual disability (mental retardation), mild to moderate, delayed speech (aphasia), spasticity, and adducted thumbs. Individuals with MASA syndrome may have mild enlargement of the ventricles. Spastic paraplegia type 1 is characterized by progressive muscle stiffness (spasticity) and the development of paralysis of the limbs (paraplegia). Affected individuals also have mild to moderate intellectual disability. X-linked complicated corpus callosum agenesis is defined by underdevelopment (hypoplasia) or absence (agenesis) of the tissue that connects the left and right halves of the brain (the corpus callosum). The life expectancy of individuals with L1 syndrome varies depending on the severity of the signs and symptoms.600
LAMA2LAMA2-related muscular dystrophyNM_000426.3NM_000426.3:c.112+1G>A, NM_000426.3:c.184G>T, NM_000426.3:c.825delC, NM_000426.3:c.1050delT, NM_000426.3:c.1612C>T, NM_000426.3:c.2049_2050delAG, NM_000426.3:c.2098_2099delTT, NM_000426.3:c.2323-2A>T, NM_000426.3:c.2451-2A>G, NM_000426.3:c.2750-1G>C, NM_000426.3:c.2901C>A, NM_000426.3:c.2962C>T, NM_000426.3:c.3215delG, NM_000426.3:c.3237C>A, NM_000426.3:c.3630delT, NM_000426.3:c.3718C>T, NM_000426.3:c.3976C>T, NM_000426.3:c.4645C>T, NM_000426.3:c.5050G>T, NM_000426.3:c.5227G>T, NM_000426.3:c.6011delA, NM_000426.3:c.6038delT, NM_000426.3:c.6334A>T, NM_000426.3:c.6429+1G>A, NM_000426.3:c.6617delT, NM_000426.3:c.6955C>T, NM_000426.3:c.7147C>T, NM_000426.3:c.7279_7280delCT, NM_000426.3:c.7536delC, NM_000426.3:c.7732C>T, NM_000426.3:c.7810C>T, NM_000426.3:c.7888C>T, NM_000426.3:c.8314delA, NM_000426.3:c.8705delT, NM_000426.3:c.8748delA, NM_000426.3:c.9101_9104dupAACA, NM_000426.3:c.9221delA, NM_000426.3:c.9253C>TLAMA2-related muscular dystrophy 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMA2 gene located on chromosomal region 6q22.33. LAMA2-related muscular dystrophy is a disorder that causes weakness and atrophy of skeletal muscles. This condition varies in severity, from a severe, early-onset type to a milder, late-onset form. Early-onset LAMA2-related muscular dystrophy is apparent at birth or within the first few months of life, called merosin-deficient congenital muscular dystrophy type 1A (607855). Patients show hypotonia, poor suck and cry, and delayed motor development; most never achieve independent ambulation. Most patients also have periventricular white matter abnormalities on brain imaging, but mental retardation and/or seizures occur only rarely. Symptoms of late-onset LAMA2-related muscular dystrophy become evident later in childhood or adulthood, and are similar to those of a group of muscle disorders classified as autosomal recessive limb-girdle muscular dystrophies, type 23. This group is characterized by slowly progressive proximal muscle weakness primarily affecting the lower limbs and resulting in gait difficulties. Additional features include white matter abnormalities on brain imaging, increased serum creatine kinase, and dystrophic features, with partial LAMA2 deficiency on muscle biopsy. Some patients may have additional neurologic features, including executive deficits, seizures, and peripheral neuropathy. Patients remain ambulatory well into adulthood. The prevalence is 1/30,000. 600,25
LAMA3
Epidermolysis bullosa, junctional 2A, intermediate;Epidermolysis bullosa, junctional 2B, severe;Epidermolysis bullosa, junctional 2C, laryngoonychocutaneous		NM_198129.2NM_198129.2:c.5162delG, NM_198129.2:c.6009delG, NM_198129.2:c.6808C>T, NM_198129.2:c.6943A>T, NM_198129.2:c.7489C>T, NM_198129.2:c.8177+2T>G, NM_198129.2:c.8962C>T, NM_198129.2:c.9162dupA, NM_198129.2:c.9705dupTJunctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMA3 gene located on chromosomal region 18q11.2. The age of onset is neonatal/infancy. Junctional epidermolysis bullosa (JEB) is a group of genetic conditions that cause the skin to be very fragile and to blister easily. Blisters and skin erosions form in response to minor injury or friction, such as rubbing or scratching. Researchers classify junctional epidermolysis bullosa into two main types based on severity: Herlitz JEB and non-Herlitz JEB. Herlitz type is more severe phenotype characterized by blisters and erosions, localized to the skin and mucous membranes and often results in early death. More than 30 mutations in the LAMA3 gene have been identified in people with Herlitz JEB. Other LAMA3 gene mutations cause the milder form non-Herlitz JEB, phenotype characterized by generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.600
LAMB3Junctional epidermolysis bullosa, Herlitz and non-Herlitz typeNM_000228.2NM_000228.2:c.3228+1G>T, NM_000228.2:c.3228+1G>A, NM_000228.2:c.2806C>T, NM_000228.2:c.1903C>T, NM_000228.2:c.1830G>A, NM_000228.2:c.1587_1588delAG, NM_000228.2:c.1438_1442delCCGTG, NM_000228.2:c.1357delT, NM_000228.2:c.904delT, NM_000228.2:c.727C>T, NM_000228.2:c.628+1delG, NM_000228.2:c.628G>A, NM_000228.2:c.565-2A>G, NM_000228.2:c.496C>T, NM_000228.2:c.124C>TJunctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 gene located on chromosomal region 1q32.2. The age of onset is neonatal/infancy. Junctional epidermolysis bullosa (JEB) is a group of genetic conditions that cause the skin to be very fragile and to blister easily. Blisters and skin erosions form in response to minor injury or friction, such as rubbing or scratching. Researchers classify junctional epidermolysis bullosa into two main types based on severity: Herlitz JEB and non-Herlitz JEB. Herlitz type is more severe phenotype characterized by blisters and erosions, localized to the skin and mucous membranes and often results in early death. More than 80 mutations in the LAMB3 gene have been identified in people with Herlitz JEB. Other LAMB3 gene mutations cause the milder form non-Herlitz JEB, disease characterized by generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.600,25
LAMC2
Epidermolysis bullosa, junctional 3A, intermediate;Epidermolysis bullosa, junctional 3B, severe		NM_005562.2NM_005562.2:c.283C>T, NM_005562.2:c.343C>T, NM_005562.2:c.405-1G>A, NM_005562.2:c.1659C>A, NM_005562.2:c.1782_1783delGC, NM_005562.2:c.2137_2143delCAGAACC, NM_005562.2:c.3069+1G>A, NM_005562.2:c.3120_3121insA, NM_005562.2:c.3512dupAJunctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMC2 gene located on chromosomal region 1q25.3. The age of onset is neonatal/infancy. Junctional epidermolysis bullosa (JEB) is a group of genetic conditions that cause the skin to be very fragile and to blister easily. Blisters and skin erosions form in response to minor injury or friction, such as rubbing or scratching. Researchers classify junctional epidermolysis bullosa into two main types based on severity: Herlitz JEB and non-Herlitz JEB. Herlitz type is more severe phenotype characterized by blisters and erosions, localized to the skin and mucous membranes and often results in early death. More than 30 mutations in the LAMC2 gene have been identified in people with Herlitz JEB. Other LAMC2 gene mutations cause the milder form non-Herlitz JEB, disease characterized by generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.600
LARGE1Muscular dystrophy-dystroglycanopathy, type 6A and 6BNM_004737.4NM_004737.4:c.1525G>A, NM_004737.4:c.1483T>C, NM_004737.4:c.1102C>T, NM_004737.4:c.992C>TMuscular dystrophy-dystroglycanopathy, type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LARGE1 gene located on chromosomal region 22q12.3. The age of onset is infantile. There are two subtypes of dystroglycanopathies related to LARGE1 gene: subtype 6A and 6B. Subtype 6A is the most severe phenotype and is associated with congenital brain and eye anomalies, cobblestone lissencephaly, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Subtype 6B represents an intermediate phenotype with or without congenital mental retardation, white matter changes and structural brain abnormalities. The prevalence is 1:100,000-9:100,000.600
LBRGreenberg skeletal dysplasiaNM_002296.3NM_002296.3:c.1748G>A, NM_002296.3:c.1402delT, NM_002296.3:c.1114C>T, NM_002296.3:c.32_35delTGGTGreenberg dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LBR gene located on chromosomal region 1q42.12. The age of onset is fetal. This disease is characterized by fetal hydrops, short limbs and abnormal chondro-osseous calcification. The prevalence is <1:1,000,000.600
LDHAGlycogen storage disease type 11NM_001165414.1NM_001165414.1:c.213+1G>A, NM_001165414.1:c.727_728delCTGlycogen storage disease type 11 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LDHA gene located on chromosomal region 11p15.1. The age of onset is infantile. This disease is characterized by hepatic glycogenosis and renal Fanconi syndrome.600
LHFPL5Deafness, autosomal recessive type 67NM_182548.3NM_182548.3:c.250delC, NM_182548.3:c.380A>G, NM_182548.3:c.494C>T, NM_182548.3:c.649+1delGAutosomal recessive nonsyndromic sensorineural deafness type 67 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LHFPL5 gene located on chromosomal region 6p21.31. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.600
LHX3Pituitary hormone deficiency, combined, type 3NM_014564.4NM_014564.4:c.687G>A, NM_014564.4:c.347A>GCombined pituitary hormone deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LHX3 gene located on chromosomal region 9q34.3. The age of onset is infantile, etc/. This disease is characterized by somatolactotroph, thyrotroph and gonadotroph deficiencies, limited head and neck rotation associated with spinal abnormalities. The prevalence is <1 /1,000,000.600
LIFRStuve-Wiedemann syndrome / Schwartz-Jampel type 2 syndromeNM_001127671.1NM_001127671.1:c.2503G>T, NM_001127671.1:c.2013dupT, NM_001127671.1:c.1789C>T, NM_001127671.1:c.1018_1022delAATTG, NM_001127671.1:c.653dupT, NM_001127671.1:c.171_174delTAACSt�ve-Wiedemann syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LIFR gene located on chromosomal region 5p13.1. The age of onset is neonatal. This disease is characterized by small stature, congenital bowing of the long bones and campodactyly.600
LIG4LIG4 syndromeNM_001098268.1NM_001098268.1:c.2440C>T, NM_001098268.1:c.1738C>T, NM_001098268.1:c.1512_1513delTC, NM_001098268.1:c.1455_1456delTG, NM_001098268.1:c.1406G>A, NM_001098268.1:c.1369_1372delGGAC, NM_001098268.1:c.1271_1275delAAAGA, NM_001098268.1:c.833G>ALIG4 syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LIG4 gene located on chromosomal region 10p13. The age of onset is infantile. It is associated with impaired DNA double-strand break repair mechanisms and characterized by microcephaly, unusual facial features (''bird-like''), growth and developmental delay, skin anomalies including photosensitivity and psoriatic-like lesions, and pancytopenia. The disease is associated with immunodeficiency. Some patients have been reported as having telangiectasias, leukemia, lymphoma, bone marrow abnormalities, and type 2 diabetes. The prevalence 1-9/1.000.000.600
LMNALMNA-related disorders, autosomal recessiveNM_001282626.1NM_001282626.1:c.1818+6C>TLMNA-related disorders, autosomal recessive, are caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22, and include Charcot-Marie-Tooth disease, type 2B1, Emery-Dreifuss muscular dystrophy type 3, mandibuloacral dysplasia, lethal restrictive dermopathy among others. Charcot-Marie-Tooth disease constitutes a clinically and genetically heterogeneous group of hereditary motor and sensory neuropathies. Emery-Dreifuss muscular dystrophy is characterized classically by the triad of weakness of the shoulder and pelvic girdle muscles, contractures of the elbows, neck, and Achilles tendon, and cardiac involvement, most commonly arrhythmias. Mandibuloacral dysplasia is characterized by growth retardation, craniofacial anomalies with mandibular hypoplasia, skeletal abnormalities with progressive osteolysis of the distal phalanges and clavicles, and pigmentary skin changes. Restrictive dermopathy is a rare, lethal genodermatosis characterized by thin, tightly adherent translucent skin with erosions at flexure sites, superficial vessels, typical facial dysmorphism, and generalized joint ankylosis.600,25
LMNALMNA-related disorders, autosomal recessiveNM_170707.3NM_170707.3:c.419T>C, NM_170707.3:c.1072G>A, NM_170707.3:c.1228C>T, NM_170707.3:c.1366A>C, NM_170707.3:c.1411C>T, NM_170707.3:c.1488+1G>A, NM_170707.3:c.1579C>T, NM_170707.3:c.1580G>A, NM_170707.3:c.1583C>A, NM_170707.3:c.1585G>A, NM_170707.3:c.1586C>T, NM_170707.3:c.1626G>CLMNA-related disorders, autosomal recessive, are caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22, and include Charcot-Marie-Tooth disease, type 2B1, Emery-Dreifuss muscular dystrophy type 3, mandibuloacral dysplasia, lethal restrictive dermopathy among others. Charcot-Marie-Tooth disease constitutes a clinically and genetically heterogeneous group of hereditary motor and sensory neuropathies. Emery-Dreifuss muscular dystrophy is characterized classically by the triad of weakness of the shoulder and pelvic girdle muscles, contractures of the elbows, neck, and Achilles tendon, and cardiac involvement, most commonly arrhythmias. Mandibuloacral dysplasia is characterized by growth retardation, craniofacial anomalies with mandibular hypoplasia, skeletal abnormalities with progressive osteolysis of the distal phalanges and clavicles, and pigmentary skin changes. Restrictive dermopathy is a rare, lethal genodermatosis characterized by thin, tightly adherent translucent skin with erosions at flexure sites, superficial vessels, typical facial dysmorphism, and generalized joint ankylosis.600,25
LOXHD1Deafness, autosomal recessive type 77NM_144612.6NM_144612.6:c.4714C>T, NM_144612.6:c.4524_4525delAG, NM_144612.6:c.3924C>A, NM_144612.6:c.2008C>T, NM_144612.6:c.512-1G>A, NM_144612.6:c.457_461dupCGCCAAutosomal recessive nonsyndromic sensorineural deafness type 77 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LOXHD1 gene located on chromosomal region 18q21.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.600
LRATLeber congenital amaurosis type 14NM_001301645.1NM_001301645.1:c.217_218delAT, NM_001301645.1:c.525T>A, NM_001301645.1:c.588dupTLeber congenital amaurosis type 14 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRAT gene located on chromosomal region 4q32.1. The age of onset is infantile. This disease is characterized by blindness, nystagmus, roving eye movement. The prevalence is 2:100,000-3:100,000 newborn.600
LRP2Donnai-Barrow syndromeNM_004525.2NM_004525.2:c.13388+2T>C, NM_004525.2:c.13139dupC, NM_004525.2:c.11636-1G>T, NM_004525.2:c.11469_11472delTTTG, NM_004525.2:c.10769-2A>G, NM_004525.2:c.9484_9485delGT, NM_004525.2:c.8519_8522delATTT, NM_004525.2:c.7564T>C, NM_004525.2:c.2640-1G>A, NM_004525.2:c.1341+2T>G, NM_004525.2:c.1093C>TDonnai-Barrow syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP2 gene located on chromosomal region 2q31.1. The age of onset is infantile. This disease is characterized by diaphragmatic hernia, ocular findings, hipertelorism, agenesis of the corpus callosum, hearing loss and facial dimorphism. The prevalence is <1:1,000,000.600
LRP5Osteoporosis-pseudoglioma syndromeNM_002335.3NM_002335.3:c.804_813delGGGGAAGAGG, NM_002335.3:c.1453G>T, NM_002335.3:c.1468delG, NM_002335.3:c.1481G>A, NM_002335.3:c.1708C>T, NM_002335.3:c.1709G>A, NM_002335.3:c.2202G>A, NM_002335.3:c.2254C>G, NM_002335.3:c.2305delG, NM_002335.3:c.2557C>T, NM_002335.3:c.4099G>A, NM_002335.3:c.4651G>AOsteoporosis-pseudoglioma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by congenital or infancy-onset blindness and severe juvenile-onset osteoporosis and spontaneous fractures. The prevalence is 1:2,000,000.600,25
LRPPRCLeigh syndrome, French-Canadian typeNM_133259.3NM_133259.3:c.3830_3839delGTGGTGCAATinsAG, NM_133259.3:c.1061C>TFrench-Canadian type Leigh syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRPPRC gene located on chromosomal region 2p21. The age of onset is infantile. This disease is characterized by chronic metabolic acidosis, hypotonia, facial dysmorphism and delayed development. The prevalence is 1:2,000 newborn.600
LRTOMTDeafness, autosomal recessive type 63NM_001145308.4NM_001145308.4:c.242G>AAutosomal recessive nonsyndromic sensorineural deafness type 63 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRTOMT gene located on chromosomal region 11q13.4. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.600
MAKRetinitis pigmentosa type 62NM_001242957.2NM_001242957.2:c.1087_1088delAG, NM_001242957.2:c.719_720dupAG, NM_001242957.2:c.718C>T, NM_001242957.2:c.388A>C, NM_001242957.2:c.37G>ARetinitis pigmentosa type 62 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAK gene located on chromosomal region 6p24.2. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades.600
MAN2B1Mannosidosis, alpha-, types I and IINM_000528.3NM_000528.3:c.2686_2687delCTinsG, NM_000528.3:c.2436+2T>C, NM_000528.3:c.2426T>C, NM_000528.3:c.2398G>A, NM_000528.3:c.2368C>T, NM_000528.3:c.2278C>T, NM_000528.3:c.2119C>T, NM_000528.3:c.2013delT, NM_000528.3:c.1929G>A, NM_000528.3:c.1915C>T, NM_000528.3:c.1830+1G>C, NM_000528.3:c.1780C>T, NM_000528.3:c.384G>A, NM_000528.3:c.1A>GAlpha-mannosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAN2B1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by immunodeficiency, facial and skeletal abnormalities, hearing impairment and intellectual disability. The prevalence is 1:1,000,000-9:1,000,000.600,25
MARVELD2Deafness, autosomal recessive type 49NM_001038603.2NM_001038603.2:c.1183-1G>A, NM_001038603.2:c.1363C>TAutosomal recessive nonsyndromic sensorineural deafness type 49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MARVELD2 gene located on chromosomal region 5q13.2. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.600
MAT1AMethionine adenosyltransferase deficiency, autosomal recessiveNM_000429.2NM_000429.2:c.1070C>T, NM_000429.2:c.1043_1044delTG, NM_000429.2:c.1006G>A, NM_000429.2:c.966T>G, NM_000429.2:c.914T>C, NM_000429.2:c.827_828insG, NM_000429.2:c.791G>A, NM_000429.2:c.790C>T, NM_000429.2:c.538_539insTGMethionine adenosyltransferase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAT1A gene located on chromosomal region 10q23.1. This disease is characterized by brain demyelination (rarely leading to neurological disorders) and isolated hepatic hypermethioninemia. The prevalence is <1:1,000,000.600
MBTPS2IFAP/BRESHECK syndrome; Osteogenesis imperfecta, type 19NM_015884.3NM_015884.3:c.261G>A, NM_015884.3:c.677G>T, NM_015884.3:c.1286G>A, NM_015884.3:c.1424T>CIFAP/BRESHECK syndrome and Osteogenesis imperfecta, type 19 follow an X-linked pattern of inheritance and are caused by pathogenic variants in the MBTPS2 gene located on chromosomal region Xp22.12-p22.11. IFAP/ BRESHECK syndrome's age of onset is infantile and it is characterized by the triad of ichthyosis follicularis, alopecia, and photophobia. Some patients have additional features, including mental retardation, brain anomalies, Hirschsprung disease, corneal opacifications, kidney dysplasia, cryptorchidism, cleft palate, and skeletal malformations, which constitutes BRESHECK syndrom . The prevalence of this syndrome is 1:200,000. Osteogenesis imperfecta type 19 is characterized by prenatal fractures and generalized osteopenia, with severe short stature in adulthood, as well as variable scoliosis and pectal deformity, and marked anterior angulation of the tibia.600
MCCC13-Methylcrotonyl-CoA carboxylase type 1 deficiencyNM_020166.4NM_020166.4:c.2079delA, NM_020166.4:c.1930G>T, NM_020166.4:c.1905delA, NM_020166.4:c.1526delG, NM_020166.4:c.1380T>G, NM_020166.4:c.1310T>C, NM_020166.4:c.1277T>C, NM_020166.4:c.1155A>C, NM_020166.4:c.1114C>T, NM_020166.4:c.1074delG, NM_020166.4:c.640-1G>A, NM_020166.4:c.640-2A>G, NM_020166.4:c.558delA, NM_020166.4:c.343C>T, NM_020166.4:c.310C>T3-methylcrotonyl-CoA carboxylase deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC1 gene located on chromosomal region 3q27.1. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn.600
MCCC23-Methylcrotonyl-CoA carboxylase type 2, deficiencyNM_022132.4NM_022132.4:c.295G>C, NM_022132.4:c.380C>G, NM_022132.4:c.464G>A, NM_022132.4:c.499T>C, NM_022132.4:c.517dupT, NM_022132.4:c.641delG, NM_022132.4:c.735dupC, NM_022132.4:c.838G>T, NM_022132.4:c.929C>G, NM_022132.4:c.994C>T, NM_022132.4:c.1015G>A, NM_022132.4:c.1065A>T, NM_022132.4:c.1072+1G>A, NM_022132.4:c.1577dupT, NM_022132.4:c.1580G>A3-methylcrotonyl-CoA carboxylase deficiency type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC2 gene located on chromosomal region 5q13.2. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn.600,25
MCEEMethylmalonyl-CoA epimerase deficiencyNM_032601.3NM_032601.3:c.139C>T, NM_032601.3:c.2T>CMethylmalonic acidemia due to methylmalonyl-CoA epimerase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCEE gene located on chromosomal region 2p13.3. The age of onset is neonatal. This disease is characterized by lethargy, vomiting, hypotonia, hypothermia, respiratory distress, severe ketoacidosis, hyperammonemia, neutropenia, and thrombocytopenia. The prevalence is 1:50,000-1:80,000.600
MCOLN1Mucolipidosis type 4NM_020533.2NM_020533.2:c.304C>T, NM_020533.2:c.964C>T, NM_020533.2:c.1084G>T, NM_020533.2:c.1207C>TMucolipidosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCOLN1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismus. The prevalence is 1:40,000.600
MCPH1Microcephaly type 1, primary, autosomal recessiveNM_001322042.1NM_001322042.1:c.215C>T, NM_001322042.1:c.427dupA, NM_001322042.1:c.1249dupT, NM_001322042.1:c.1935+1G>T, NM_001322042.1:c.1973+1G>A, NM_001322042.1:c.2221C>TAutosomal recessive primary microcephaly type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCPH1 gene located on chromosomal region 8p23.1. The age of onset is neonatal. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. The incidence is 1/1,000,000.600
MECP2Encephalopathy, neonatal severeNM_001110792.1NM_001110792.1:c.1001C>T, NM_001110792.1:c.1000C>T, NM_001110792.1:c.952C>T, NM_001110792.1:c.916C>T, NM_001110792.1:c.844C>T, NM_001110792.1:c.842delG, NM_001110792.1:c.799C>T, NM_001110792.1:c.789delC, NM_001110792.1:c.766C>T, NM_001110792.1:c.710C>T, NM_001110792.1:c.647C>G, NM_001110792.1:c.538C>T, NM_001110792.1:c.251dupCEncephalopathy, neonatal severe follows an X -linked pattern of inheritance and is caused by pathogenic variants in the MECP2 gene located on chromosomal region Xq28. The age of onset is neonatal. This neurological disorder primarily affects males and causes brain dysfunction (encephalopathy). Affected males have microcephaly, poor muscle tone (hypotonia), movement disorders, rigidity, and seizures. Individuals with MECP2-related severe neonatal encephalopathy have severe to profound intellectual disability. Genetic heterogeneity: Many of the mutations causing male's phenotype also cause Rett syndrome, a severe neurodevelopmental disorder that almost always occurs in females. Most severe neonatal encephalopathy cases are surviving male sibs of patients with Rett syndrome. Males with non-Rett syndrome mutations in the MECP2 gene can demonstrate a wide variety of phenotypes. Note: other conditions are also associated to the MECP2 gene, like MECP2 duplication syndrome, a condition characterized by intellectual disability, delayed development, and seizures. It is caused by a duplication of the MECP2 gene and surrounding DNA; this duplication is not tested in the CGT analysis.600
MED12Lujan-Fryns syndromeNM_005120.2NM_005120.2:c.3443G>A, NM_005120.2:c.3493T>C, NM_005120.2:c.5185C>ALujan-Fryns syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the MED12 gene located on chromosomal region Xq13.1. The age of onset is neonatal. It is characterized by mild to moderate intellectual disability, behavioral problems (such as hyperactivity, aggressiveness, extreme shyness, and excessive attention-seeking), and certain physical features such as tall, thin body and an unusually large head (macrocephaly). Almost all people with this condition have weak muscle tone (hypotonia).600
MED25Basel-Vanagait-Smirin-Yosef syndromeNM_030973.3NM_030973.3:c.320delG, NM_030973.3:c.1366C>TBasel-Vanagait-Smirin-Yosef syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MED25 gene located on chromosomal region 19q13.33. The age of onset neonatal/infantile. This syndrome is characterized by eye, brain, cardiac and palatal abnormalities as well as growth retardation, microcephaly and severe intellectual disability.600,25
MEFVFamilial Mediterranean fever, ARNM_000243.2NM_000243.2:c.2282G>A, NM_000243.2:c.2230G>T, NM_000243.2:c.2177T>C, NM_000243.2:c.2084A>G, NM_000243.2:c.2082G>A, NM_000243.2:c.2080A>G, NM_000243.2:c.2076_2078delAAT, NM_000243.2:c.2040G>C, NM_000243.2:c.2040G>A, NM_000243.2:c.1958G>A, NM_000243.2:c.1437C>G, NM_000243.2:c.1141C>T, NM_000243.2:c.656dupG, NM_000243.2:c.501G>C, NM_000243.2:c.163dupAFamilial Mediterranean fever follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MEFV gene located on chromosomal region 16p13.3. The age of onset is infantile or adult (before the age of 30). This disease is characterized by recurrent short episodes of fever and serositis resulting in pain in the abdomen, chest, joints and muscles. The prevalence is 1:10,000-5:10,000.600,25
MERTKRetinitis pigmentosa type 38NM_006343.2NM_006343.2:c.1605-2A>G, NM_006343.2:c.2070_2074delAGGAC, NM_006343.2:c.2189+1G>T, NM_006343.2:c.2211_2214delCTGT, NM_006343.2:c.2323C>T, NM_006343.2:c.2785_2786dupTARetinitis pigmentosa type 38 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MERTK gene located on chromosomal region 2q13. The age of onset is infantile. This disease is characterized by. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness.600,25
MFRPMicrophthalmia, isolated type 5NM_031433.3NM_031433.3:c.1149dupC, NM_031433.3:c.1124+1G>T, NM_031433.3:c.545T>C, NM_031433.3:c.523C>T, NM_031433.3:c.498delCMicrophthalmia, isolated type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFRP gene located on chromosomal region 11q23.3. The age of onset is infantile. This disease is characterized by posterior microphthalmos, retinitis pigmentosa, foveoschisis, and optic disk drusen.600,25
MFSD8Ceroid lipofuscinosis, neuronal, type 7NM_152778.2NM_152778.2:c.1525_1526delCT, NM_152778.2:c.1286G>A, NM_152778.2:c.1235C>T, NM_152778.2:c.1090delA, NM_152778.2:c.999-2A>G, NM_152778.2:c.929G>A, NM_152778.2:c.894T>G, NM_152778.2:c.881C>A, NM_152778.2:c.362A>GNeuronal ceroid lipofuscinosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFSD8 gene located on chromosomal region 4q28.2. The age of onset is late infantile. This disease is characterized by decline of mental and motor capacities, epilepsy, and vision loss through retinal degeneration. The prevalence is 0.56:100,000-3.9:100,000.600
MGAT2Congenital disorder of glycosylation, type 2aNM_002408.3NM_002408.3:c.785A>G, NM_002408.3:c.869C>T, NM_002408.3:c.1017T>ACongenital disorder of glycosylation type 2a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MGAT2 gene located on chromosomal region 14q21.3. The age of onset is infantile. This disease is characterized by severe psychomotor delay, postnatal growth retardation, facial dysmorphology and bleeding tendency. It has been described in four children.600
MKKSBardet-Biedl syndrome type 6NM_018848.3NM_018848.3:c.1436C>G, NM_018848.3:c.1225_1226delGG, NM_018848.3:c.830T>C, NM_018848.3:c.353delGBardet-Biedl syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.600,25
MKS1Bardet-Biedl syndrome type 13NM_001321269.1NM_001321269.1:c.1024+1G>A, NM_001321269.1:c.508C>TBardet-Biedl syndrome type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.600,25
MLC1Megalencephalic leukoencephalopathy with subcortical cystsNM_015166.3NM_015166.3:c.424-2A>C, NM_015166.3:c.423C>A, NM_015166.3:c.422A>G, NM_015166.3:c.278C>T, NM_015166.3:c.274C>T, NM_015166.3:c.206C>T, NM_015166.3:c.135dupC, NM_015166.3:c.33dupCMegalencephalic leukoencephalopathy with subcortical cysts follows an autosomal recessive patternof inheritance and is caused by pathogenic variants in the MLC1 gene located on chromosomal region 22q13.33. The age of onset is infantile. This disease is characterized by ataxia followed by progressive signs of pyramidal tract involvement and mental deterioration.600
MLYCDMalonyl-CoA decarboxylase deficiencyNM_012213.2NM_012213.2:c.560C>G, NM_012213.2:c.680_685dupTGAAGC, NM_012213.2:c.758delTMalonyl-CoA decarboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MLYCD gene located on chromosomal region 16q23.3. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000.600
MMAAMethylmalonic aciduria, vitamin B12-responsiveNM_172250.2NM_172250.2:c.283C>T, NM_172250.2:c.387C>A, NM_172250.2:c.450dupG, NM_172250.2:c.455delC, NM_172250.2:c.503delC, NM_172250.2:c.586C>T, NM_172250.2:c.620A>G, NM_172250.2:c.811G>T, NM_172250.2:c.1034delTVitamin B12-responsive methylmalonic acidemia type cblA follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAA gene located on chromosomal region 4q31.21. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000.600
MMABMethylmalonic aciduria, vitamin B12-responsive, type cblBNM_052845.3NM_052845.3:c.700C>T, NM_052845.3:c.569G>A, NM_052845.3:c.568C>T, NM_052845.3:c.556C>T, NM_052845.3:c.220G>T, NM_052845.3:c.197-1G>T, NM_052845.3:c.197-1G>AVitamin B12-responsive methylmalonic acidemia type cbl B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAB gene located on chromosomal region 12q24.31. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000.600
MMACHCMethylmalonic aciduria and homocystinuria, cblC typeNM_015506.2NM_015506.2:c.271dupA, NM_015506.2:c.331C>T, NM_015506.2:c.347T>C, NM_015506.2:c.388_390delTAC, NM_015506.2:c.394C>T, NM_015506.2:c.440G>C, NM_015506.2:c.481C>T, NM_015506.2:c.482G>A, NM_015506.2:c.547_548delGT, NM_015506.2:c.608G>A, NM_015506.2:c.609G>A, NM_015506.2:c.615C>A, NM_015506.2:c.615C>G, NM_015506.2:c.619dupG, NM_015506.2:c.616C>T, NM_015506.2:c.658_660delAAG, NM_015506.2:c.688C>TVitamin B12-responsive methylmalonic acidemia type cbl B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAB gene located on chromosomal region 12q24.31. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000.600,25
MMADHCHomocystinuria, cblD type, variant 1NM_015702.2NM_015702.2:c.795dupT, NM_015702.2:c.776T>C, NM_015702.2:c.748C>T, NM_015702.2:c.746A>G, NM_015702.2:c.545C>A, NM_015702.2:c.478+1G>T, NM_015702.2:c.419dupA, NM_015702.2:c.57_64delCTCTTTAGHomocystinuria, cblD type, variant 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMADHC gene located on chromosomal region 2q23.2. The age of onset is variable (infantile to adult). This disease is characterized by developmental delay, severe learning difficulties, seizures, movement and gait abnormalities, behavioral problems and signs of megaloblastic anemia (pallor, fatigue, anorexia). The prevalence is 1:50,000-1:80,000.600
MOCS1Molybdenum cofactor deficiency ANM_001075098.3NM_001075098.3:c.1027C>T, NM_001075098.3:c.956G>A, NM_001075098.3:c.397_406delCCGGACGTGG, NM_001075098.3:c.217C>TMolybdenum cofactor deficiency type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS1 gene located on chromosomal region 6p21.2. The age of onset is infantile. This disease is characterized by severe neurological abnormalities, dislocated ocular early death.600
MOCS2Molybdenum cofactor deficiency BNM_004531.4NM_004531.4:c.567A>C, NM_004531.4:c.539_540delAA, NM_004531.4:c.502G>A, NM_004531.4:c.377+1G>A, NM_004531.4:c.106_107delAT, NM_004531.4:c.58delT, NM_004531.4:c.3G>AMolybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death.600,25
MOCS2Molybdenum cofactor deficiency BNM_176806.3NM_176806.3:c.16C>TMolybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death.600,25
MPICongenital disorder of glycosylation, type 1bNM_002435.2NM_002435.2:c.305C>T, NM_002435.2:c.413T>C, NM_002435.2:c.656G>A, NM_002435.2:c.884G>A, NM_002435.2:c.1016_1019delACCCCongenital disorder of glycosylation type 1b follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MPI gene located on chromosomal region 15q24.1. The age of onset is infantile. This disease is characterized by hepatic-intestinal manifestations (diarrhoea, vomiting, and hepatomegaly associated with hepatic fibrosis).600
MPV17Mitochondrial DNA depletion syndrome type 6 (hepatocerebral)NM_002437.4NM_002437.4:c.498C>A, NM_002437.4:c.462-2A>C, NM_002437.4:c.359G>A, NM_002437.4:c.284dupG, NM_002437.4:c.263_265delAGA, NM_002437.4:c.149G>A, NM_002437.4:c.148C>T, NM_002437.4:c.70G>TMitochondrial DNA depletion syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MPV17 gene located on chromosomal region 2p23.3. The age of onset is infantile. It is a disease due to mitochondrial dysfunction. It is characterized by infantile onset of progressive liver failure, often leading to death in the first year of life, peripheral neuropathy, corneal scarring, acral ulceration and osteomyelitis leading to autoamputation, cerebral leukoencephalopathy, failure to thrive, and recurrent metabolic acidosis with intercurrent infections.600
MRPS16Combined oxidative phosphorylation deficiency 2NM_016065.3NM_016065.3:c.331C>T, NM_016065.3:c.2T>CCombined oxidative phosphorylation defect type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MRPS16 gene located on chromosomal region 10q22.2. The age of onset is infantile. This disease is characterized by agenesis of corpus callosum, dismorphism and fatal lactic acidosis.600
MRPS22Combined oxidative phosphorylation deficiency type 5NM_020191.2NM_020191.2:c.40_41insA, NM_020191.2:c.509G>A, NM_020191.2:c.644T>CCombined oxidative phosphorylation defect type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MRPS22 gene located on chromosomal region 3q23. The age of onset is infantile. This disease is characterized by evere hypotonia, lactic academia and congenital hyperammonaemia.600
MTM1Myotubular myopathy, X-linkedNM_000252.2NM_000252.2:c.70C>T, NM_000252.2:c.420C>G, NM_000252.2:c.461T>G, NM_000252.2:c.595_599delCCTGC, NM_000252.2:c.670C>T, NM_000252.2:c.721C>T, NM_000252.2:c.780T>A, NM_000252.2:c.969dupA, NM_000252.2:c.969delA, NM_000252.2:c.1261-10A>G, NM_000252.2:c.1306_1310dupCCTAT, NM_000252.2:c.1357_1358delCC, NM_000252.2:c.1415_1416delGTX-linked centronuclear myopathy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the MTM1 gene located on chromosomal region Xq28. The age of onset is infantile, etc/. This disease is characterized by severe phenotype in males presenting at birth with marked weakness, hypotonia and respiratory failure. The incidence is 1/50,000 newborn man.600
MTMR2Charcot-Marie-Tooth disease, type 4B1NM_016156.5NM_016156.5:c.1276C>T, NM_016156.5:c.304C>TCharcot-Marie-Tooth disease type 4B1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTMR2 gene located on chromosomal region 11q21. The age of onset is early infantile. This disease is characterized by distal and proximal muscular weakness starting in the lower extremities, sensory loss and cranial nerve involvement, foot deformities and diaphragmatic and facial involvement.600
MTTPAbetalipoproteinemiaNM_001300785.1NM_001300785.1:c.789_790delCA, NM_001300785.1:c.1700G>A, NM_001300785.1:c.1850G>T, NM_001300785.1:c.1948+1G>A, NM_001300785.1:c.2112delC, NM_001300785.1:c.2674G>TAbetalipoproteinemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTTP gene located on chromosomal region 4q23. The age of onset is infantile. This disease is characterized by growth delay, malabsorption, hepatomegaly, and neurological and neuromuscular manifestations. The prevalence is <1:1,000,000.600,25
MUTMethylmalonic aciduria, mut(0) typeNM_000255.3NM_000255.3:c.2150G>T, NM_000255.3:c.2080C>T, NM_000255.3:c.1924G>C, NM_000255.3:c.1871A>G, NM_000255.3:c.1867G>A, NM_000255.3:c.1741C>T, NM_000255.3:c.1658delT, NM_000255.3:c.1445-2A>G, NM_000255.3:c.1420C>T, NM_000255.3:c.1399C>T, NM_000255.3:c.1280G>A, NM_000255.3:c.1207C>T, NM_000255.3:c.1181T>A, NM_000255.3:c.1106G>A, NM_000255.3:c.914T>C, NM_000255.3:c.682C>T, NM_000255.3:c.671_678dupAATTTATG, NM_000255.3:c.655A>T, NM_000255.3:c.643G>A, NM_000255.3:c.607G>A, NM_000255.3:c.572C>A, NM_000255.3:c.313T>C, NM_000255.3:c.280G>A, NM_000255.3:c.278G>A, NM_000255.3:c.91C>TMethylmalonic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MUT gene located on chromosomal region 6p12.3. The age of onset is very early infantile. This disease is characterized by recurrent ketoacidotic comas or transient vomiting, dehydration, hypotonia and intellectual deficit, which does not respond to administration of vitamin B12.600,25
MVKMevalonic aciduriaNM_000431.3NM_000431.3:c.59A>C, NM_000431.3:c.185G>A, NM_000431.3:c.494C>T, NM_000431.3:c.803T>C, NM_000431.3:c.902A>C, NM_000431.3:c.928G>A, NM_000431.3:c.1000G>A, NM_000431.3:c.1129G>AMevalonic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by psychomotor retardation, failure to thrive, progressive cerebellar ataxia, dysmorphic features, progressive visual impairment and recurrent febrile crises. The prevalence is <1:1,000,000.600,25
MYO15ADeafness, autosomal recessive type 3NM_016239.3NM_016239.3:c.625G>T, NM_016239.3:c.755dupA, NM_016239.3:c.3313G>T, NM_016239.3:c.3336delG, NM_016239.3:c.3385C>T, NM_016239.3:c.3693-2A>G, NM_016239.3:c.3756+1G>T, NM_016239.3:c.4751_4752dupTC, NM_016239.3:c.5326C>T, NM_016239.3:c.5492G>T, NM_016239.3:c.6004delG, NM_016239.3:c.6864_6874delGGACCTGGAGC, NM_016239.3:c.8148G>T, NM_016239.3:c.8410A>T, NM_016239.3:c.8548C>T, NM_016239.3:c.9958_9961delGACT, NM_016239.3:c.10573delADeafness autosomal recessive type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO15A gene located on chromosomal region 17p11.2. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.600,25
MYO3ADeafness, autosomal recessive type 30NM_017433.4NM_017433.4:c.1A>G, NM_017433.4:c.732-2A>G, NM_017433.4:c.770C>G, NM_017433.4:c.1086T>G, NM_017433.4:c.1193C>A, NM_017433.4:c.1777-12G>A, NM_017433.4:c.1953delC, NM_017433.4:c.2243delA, NM_017433.4:c.2506-1G>A, NM_017433.4:c.2793+2T>A, NM_017433.4:c.3112-2A>G, NM_017433.4:c.3154C>T, NM_017433.4:c.4586+2T>G, NM_017433.4:c.4730+1G>ADeafness autosomal recessive type 30 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO3A gene located on chromosomal region 10p12.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.600,25
MYO5AGriscelli syndrome, type 1NM_000259.3NM_000259.3:c.2332C>T, NM_000259.3:c.1145delCGriscelli disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO5A gene located on chromosomal region 15q21.2. The age of onset is infantile. This disease is characterized by is characterised by silvery gray sheen of the hair and hypopigmentation of the skin which can be associated to neurological impairment. The prevalence is <1:1,000,000.600
MYO6Deafness, autosomal recessive type 37NM_004999.3NM_004999.3:c.1452dupT, NM_004999.3:c.2907_2909delAGA, NM_004999.3:c.3496C>T, NM_004999.3:c.3808C>TDeafness autosomal recessive type 37 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO6 gene located on chromosomal region 6q14.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.600,25
MYO7AUsher syndrome, type 1BNM_000260.3NM_000260.3:c.3G>A, NM_000260.3:c.133-2A>G, NM_000260.3:c.448C>T, NM_000260.3:c.494C>T, NM_000260.3:c.634C>T, NM_000260.3:c.635G>A, NM_000260.3:c.640G>A, NM_000260.3:c.731G>C, NM_000260.3:c.1184G>A, NM_000260.3:c.1344-1G>A, NM_000260.3:c.1797G>A, NM_000260.3:c.1884C>A, NM_000260.3:c.1996C>T, NM_000260.3:c.2476G>A, NM_000260.3:c.3504-1G>C, NM_000260.3:c.3508G>A, NM_000260.3:c.3596dupT, NM_000260.3:c.3719G>A, NM_000260.3:c.3764delA, NM_000260.3:c.4024delT, NM_000260.3:c.5392C>T, NM_000260.3:c.5618G>A, NM_000260.3:c.5824G>T, NM_000260.3:c.5886_5889delCTTT, NM_000260.3:c.5967C>G, NM_000260.3:c.6025delGUsher syndrome type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 1:100,000-9:100,000.600,25
NAGASchindler disease, type INM_000262.2NM_000262.2:c.986G>A, NM_000262.2:c.985C>T, NM_000262.2:c.973G>A, NM_000262.2:c.577G>TSchindler disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGA gene located on chromosomal region 22q13.2. The age of onset is infantile. This disease is characterized by early-onset neuroaxonal dystrophy and neurological signs (convulsion during fever, epilepsy, psychomotor retardation and hypotonia). NAGA deficiency is typically classified in three main phenotypes: NAGA deficiency type I (Schindler disease or Schindler disease type I) with severe manifestations; NAGA deficiency type II (Kanzazi disease or Schindler disease type II) which is mild; NAGA deficiency type III (Schindler disease type III) characterized by mild-to-moderate neurologic manifestations. NAGA deficiency results in the increased urinary excretion of glycopeptides and oligosaccharides containing alpha-N-acetylgalactosaminyl moieties.600,25
NAGSN-acetylglutamate synthase deficiencyNM_153006.2NM_153006.2:c.916-2A>T, NM_153006.2:c.971G>A, NM_153006.2:c.1025delG, NM_153006.2:c.1289T>C, NM_153006.2:c.1299G>C, NM_153006.2:c.1307dupTN-acetylglutamate synthetase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGS gene located on chromosomal region 17q21.31. The age of onset is infantile, etc/. This disease is characterized by hyperammonemia, vomiting, hyperactivity or lethargy, diarrhoea, poor feeding, seizures, hypotonia, delayed psychomotor development and respiratory distress. The prevalence is <1:1,000,000.600
NDRG1Charcot-Marie-Tooth disease, type 4DNM_001135242.1NM_001135242.1:c.928C>T, NM_001135242.1:c.538-1G>A, NM_001135242.1:c.442C>T, NM_001135242.1:c.16C>TCharcot-Marie-Tooth disease type 4D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NDRG1 gene located on chromosomal region 8q24.22. The age of onset is infantile, etc/. This disease is characterized by demyelination and hearing loss.600
NEBNemaline myopathy type 2, autosomal recessiveNM_001271208.1NM_001271208.1:c.12238_12239delAT, NM_001271208.1:c.8031_8041delAAATAAACGAG, NM_001271208.1:c.6105dupT, NM_001271208.1:c.2173G>T, NM_001271208.1:c.843T>GNemaline myopathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEB gene located on chromosomal region 2q23.3. The age of onset is infantile or adult. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:100,000-9:100,000 and the incidence is 1/50.000 newborn.600,25
NEFLCharcot-Marie-Tooth disease, type 1FNM_006158.4NM_006158.4:c.628G>T, NM_006158.4:c.418G>T, NM_006158.4:c.361G>TCharcot-Marie-Tooth disease type 1F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEFL gene located on chromosomal region 8p21.2. The age of onset is infantile. This disease is characterized by a progressive peripheral motor and sensory neuropathy with variable clinical, distal weakness and wasting of the muscles of the lower limbs. The prevalence is 15:100,000-20:100,000.600
NEUROG3Diarrhea type 4, malabsorptive, congenitalNM_020999.3NM_020999.3:c.319C>A, NM_020999.3:c.278G>TCongenital malabsorptive diarrhea type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEUROG3 gene located on chromosomal region 10q22.1. The age of onset is early infantile. This disease is characterized by severe, life-threatening watery diarrhea associated with generalized malabsorption and a paucity of enteroendocrine cells. The prevalence is <1:1,000,000.600
NHP2Dyskeratosis congenita, autosomal recessive type 2NM_017838.3NM_017838.3:c.460T>A, NM_017838.3:c.415T>C, NM_017838.3:c.289_290delATDyskeratosis congenita type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NHP2 gene located on chromosomal region 5q35.3. The age of onset is variable from infancy to adult. It is a multisystem disorder caused by defective telomere maintenance. Clinical manifestations include mucocutaneous abnormalities, bone marrow failure, and an increased predisposition to cancer, among other variable features.600
NMNAT1Leber congenital amaurosis type 9NM_001297778.1NM_001297778.1:c.25G>A, NM_001297778.1:c.451G>T, NM_001297778.1:c.457C>G, NM_001297778.1:c.507G>A, NM_001297778.1:c.619C>T, NM_001297778.1:c.710G>T, NM_001297778.1:c.769G>ALeber congenital amaurosis type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NMNAT1 gene located on chromosomal region 1p36.22. The age of onset is early infantile. This disease is characterized by blindness, nystagmus, roving eye movement, leading to severe visual impairment.600,25
NOP10Dyskeratosis congenita, autosomal recessive type 1NM_018648.3NM_018648.3:c.100C>TDyskeratosis congenita autosomal recessive type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NOP10 gene located on chromosomal region 15q14. The age of onset is infantile. This disease is characterized by the mucocutaneous triad of abnormal skin pigmentation, nail dystrophy and mucosal leucoplakia. The prevalence is 1:1,000,000.600
NPC1Niemann-Pick disease, type C1NM_000271.4NM_000271.4:c.3662delT, NM_000271.4:c.3611_3614delTTAC, NM_000271.4:c.3467A>G, NM_000271.4:c.3425T>C, NM_000271.4:c.3182T>C, NM_000271.4:c.3175C>T, NM_000271.4:c.3107C>T, NM_000271.4:c.3104C>T, NM_000271.4:c.3019C>G, NM_000271.4:c.2974G>T, NM_000271.4:c.2974G>A, NM_000271.4:c.2972_2973delAG, NM_000271.4:c.2932C>T, NM_000271.4:c.2873G>A, NM_000271.4:c.2861C>T, NM_000271.4:c.2848G>A, NM_000271.4:c.2842G>A, NM_000271.4:c.2761C>T, NM_000271.4:c.2324A>C, NM_000271.4:c.2072C>T, NM_000271.4:c.1628C>T, NM_000271.4:c.1211G>A, NM_000271.4:c.1042C>T, NM_000271.4:c.813_815delCAT, NM_000271.4:c.530G>A, NM_000271.4:c.352_353delAG, NM_000271.4:c.337T>CNiemann-Pick disease type C1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC1 gene located on chromosomal region 18q11.2. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000.600,25
NPC2Niemann-pick disease, type C2NM_006432.3NM_006432.3:c.436C>T, NM_006432.3:c.358C>T, NM_006432.3:c.352G>T, NM_006432.3:c.295T>C, NM_006432.3:c.190+5G>A, NM_006432.3:c.115G>A, NM_006432.3:c.58G>T, NM_006432.3:c.27delGNiemann-Pick disease type C2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC2 gene located on chromosomal region 14q24.3. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000.600,25
NPHP1Joubert syndrome type 4NM_000272.3NM_000272.3:c.1884+1G>T, NM_000272.3:c.1184dupC, NM_000272.3:c.829C>T, NM_000272.3:c.555dupA, NM_000272.3:c.455C>G, NM_000272.3:c.80T>A, NM_000272.3:c.1delAJoubert syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP1 gene located on chromosomal region 2q13. This is a disorder presenting with cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Additional variable features include retinal dystrophy and renal disease. Joubert syndrome type 4 is a phenotypically mild form.600
NPHP3Meckel syndrome type 7NM_153240.4NM_153240.4:c.3406C>T, NM_153240.4:c.3373C>T, NM_153240.4:c.3156dupA, NM_153240.4:c.2694-2_2694-1delAG, NM_153240.4:c.2694-2A>G, NM_153240.4:c.2570+1G>T, NM_153240.4:c.2541delG, NM_153240.4:c.2369T>C, NM_153240.4:c.1985+5G>A, NM_153240.4:c.1817G>A, NM_153240.4:c.1729C>T, NM_153240.4:c.1381G>T, NM_153240.4:c.1119-2A>G, NM_153240.4:c.434_437delAAAGMeckel syndrome type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP3 gene located on chromosomal region 3q22.1. The age of onset is infantile. This is a disorder characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically encephalocele), hepatic ductal dysplasia and cysts, and polydactyly.600,25
NPHP4Nephronophthisis type 4NM_015102.4NM_015102.4:c.3767_3768insAA, NM_015102.4:c.3231+1G>C, NM_015102.4:c.2940_2944dupGCTCC, NM_015102.4:c.2335C>T, NM_015102.4:c.1972C>T, NM_015102.4:c.1120-1G>C, NM_015102.4:c.556_557insT, NM_015102.4:c.517C>TNephronophthisis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP4 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease results in end-stage renal disease at age ranging between 6 and 35 years. It is a progressive tubulo-interstitial kidney disorder characterized by polydipsia, polyuria, anemia and growth retardation. The prevalence is 1:1,000,000-9:1,000,000.600,25
NPHS1Nephrotic syndrome, type 1NM_004646.3NM_004646.3:c.3478C>T, NM_004646.3:c.3325C>T, NM_004646.3:c.3250dupG, NM_004646.3:c.3250delG, NM_004646.3:c.3109+1G>A, NM_004646.3:c.2928G>T, NM_004646.3:c.2491C>T, NM_004646.3:c.1715G>A, NM_004646.3:c.1481delC, NM_004646.3:c.1307_1308dupAC, NM_004646.3:c.121_122delCTNephrotic syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHS1 gene located on chromosomal region 19q13.12. The age of onset is fetal- infantile. This disease is characterized by fetal proteinuria and nephritic infantile syndrome. The prevalence is 1 in 8 200 births.600,25
NR0B1Adrenal hypoplasia, congenitalNM_000475.4NM_000475.4:c.1319A>T, NM_000475.4:c.1316T>G, NM_000475.4:c.1107G>A, NM_000475.4:c.890T>C, NM_000475.4:c.873G>C, NM_000475.4:c.847C>T, NM_000475.4:c.813C>G, NM_000475.4:c.800G>C, NM_000475.4:c.788T>A, NM_000475.4:c.704G>A, NM_000475.4:c.591C>A, NM_000475.4:c.513G>A, NM_000475.4:c.388_389delTA, NM_000475.4:c.273C>ACongenital adrenal hypoplasia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the NR0B1 gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by adrenal insufficiency with vomiting, feeding difficulty, dehydration, and shock caused by a salt-wasting episode and hypoglycemia.600
NR2E3Enhanced S-cone syndromeNM_014249.3NM_014249.3:c.119-2A>C, NM_014249.3:c.226C>T, NM_014249.3:c.298_299delTG, NM_014249.3:c.932G>A, NM_014249.3:c.1034_1038delTGCAGEnhaced S-Cone Syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NR2E3 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by night blindness, reduced bilateral visual acuity, and typical fundus findings (progressive pigmentary degenerative changes, macular edema, retinoschisis).600,25
NTRK1Insensitivity to pain, congenital, with anhidrosisNM_002529.3NM_002529.3:c.1076A>G, NM_002529.3:c.1727delT, NM_002529.3:c.1729G>C, NM_002529.3:c.1759A>G, NM_002529.3:c.1926_1927insT, NM_002529.3:c.2084C>T, NM_002529.3:c.2339G>CInsensitivity to pain, congenital, with anhidrosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NTRK1 gene located on chromosomal region 1q23.1. The age of onset is infantile. This disease is characterized by anhidrosis, insensitivity to pain, self-mutilating behavior and episodes of fever.600
NUP62Striatonigral degeneration, infantileNM_001193357.1NM_001193357.1:c.1172A>CInfantile striatal degeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NUP62 gene located on chromosomal region 19q13.33. The age of onset is infantile. This disease is characterized by choreoathetosis, dystonia, rigidity, spasticity, dysphagia, optic atrophy, intellectual deficit, developmental regression of motor and verbal skills, failure to thrive, myoclonus, quadriparesis, cerebellar ataxia and nystagmus. The prevalence is <1:1,000,000.600
NYXNight blindness, congenital stationary (complete), type 1A, X-linkedNM_022567.2NM_022567.2:c.1049G>ACongenital stationary night blindness follows an X-linked pattern of inheritance and is caused by pathogenic variants in the NYX gene located on chromosomal region Xp11.4. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity.600
OATGyrate atrophy of choroid and retinaNM_000274.3NM_000274.3:c.1276C>T, NM_000274.3:c.1250C>T, NM_000274.3:c.1205T>C, NM_000274.3:c.994G>A, NM_000274.3:c.955C>T, NM_000274.3:c.952delG, NM_000274.3:c.952G>A, NM_000274.3:c.901-2A>G, NM_000274.3:c.824G>A, NM_000274.3:c.812G>A, NM_000274.3:c.677C>T, NM_000274.3:c.627T>A, NM_000274.3:c.596C>A, NM_000274.3:c.539G>C, NM_000274.3:c.533G>A, NM_000274.3:c.278G>T, NM_000274.3:c.268C>G, NM_000274.3:c.159delCGyrate atrophy of choroid and retina follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OAT gene located on chromosomal region 10q26.13. The age of onset is infantile. This disease is characterized by gyrate atrophy of the choroid and retina that begins during childhood with myopia and night blindness, followed by concentric shrinking of the visual field (tunnel vision) and a peculiar aspect of retinopathy on the funduscopy. Patients can also present with ornithinemia.600
OCA2Oculocutaneous albinism type 2NM_000275.2NM_000275.2:c.2228C>T, NM_000275.2:c.1960delG, NM_000275.2:c.1842+1G>T, NM_000275.2:c.1465A>G, NM_000275.2:c.1364+1G>T, NM_000275.2:c.1327G>A, NM_000275.2:c.1182+2T>C, NM_000275.2:c.1182G>A, NM_000275.2:c.1025A>G, NM_000275.2:c.819_822delCTGGinsGGTC, NM_000275.2:c.157delA, NM_000275.2:c.79G>AOculocutaneous albinism type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OCA2 gene located on chromosomal region 15q12-q13. The age of onset is infantile. This disease is characterized by variable hypopigmentation of the skin and hair, numerous characteristic ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1/38,000-1/40,000600,25
OCRLLowe Syndrome; Dent disease type 2NM_001318784.1NM_001318784.1:c.912_913delAG, NM_001318784.1:c.1502G>A, NM_001318784.1:c.2302C>T, NM_001318784.1:c.2406dupA, NM_001318784.1:c.2533C>T, NM_001318784.1:c.2538delADent disease type 2 and Lowe syndrome follow an X-linked pattern of inheritance and are caused by pathogenic variants in the OCRL gene located on chromosomal region Xq25-q26. Dent disease type 2 is a type of Dent disease in which patients have the manifestations of Dent disease type 1 associated with extra-renal features: hypercalciuria and low-molecular-weight (LMW) proteinuria. In addition, these patients may also have nephrocalcinosis, nephrolithiasis, hematuria, hypophosphatemia and/or renal insufficiency. The features of Lowe syndrome are hydrophthalmia, cataract, mental retardation, vitamin D-resistant rickets, amino aciduria, and reduced ammonia production by the kidney.600
OFD1Joubert syndrome type 10; Orofaciodigital syndrome type 1NM_003611.2NM_003611.2:c.43_44delAG, NM_003611.2:c.52G>T, NM_003611.2:c.65dupA, NM_003611.2:c.62_63insT, NM_003611.2:c.221C>T, NM_003611.2:c.224A>C, NM_003611.2:c.235G>A, NM_003611.2:c.241C>G, NM_003611.2:c.243C>G, NM_003611.2:c.247C>T, NM_003611.2:c.260A>G, NM_003611.2:c.275_276delCT, NM_003611.2:c.274T>C, NM_003611.2:c.277G>T, NM_003611.2:c.290A>G, NM_003611.2:c.312+1delG, NM_003611.2:c.312+2_312+7delTAAAGT, NM_003611.2:c.413-10T>G, NM_003611.2:c.454C>T, NM_003611.2:c.518-1G>A, NM_003611.2:c.541dupG, NM_003611.2:c.594_598delAAAGC, NM_003611.2:c.602delA, NM_003611.2:c.607_610delTATA, NM_003611.2:c.616_617delGA, NM_003611.2:c.614_617delGAGA, NM_003611.2:c.619_624delATAGAA, NM_003611.2:c.628C>T, NM_003611.2:c.653delA, NM_003611.2:c.654+2_654+3delTA, NM_003611.2:c.1268_1272delAAAAC, NM_003611.2:c.1303A>C, NM_003611.2:c.1318delC, NM_003611.2:c.1319delT, NM_003611.2:c.1322_1326delAAGAA, NM_003611.2:c.1323_1326delAGAA, NM_003611.2:c.1360_1363delCTTA, NM_003611.2:c.1358T>A, NM_003611.2:c.1365_1368delACAA, NM_003611.2:c.1612C>T, NM_003611.2:c.1757delG, NM_003611.2:c.1821delG, NM_003611.2:c.1840delG, NM_003611.2:c.1859_1860delCCinsG, NM_003611.2:c.2261-1G>T, NM_003611.2:c.2321_2322insT, NM_003611.2:c.2349delC, NM_003611.2:c.2387+1G>C, NM_003611.2:c.2582dupTJoubert syndrome type 10 and Orofaciodigital syndrome type 1 follow an X-linked pattern of inheritance and are caused by pathogenic variants in the OFD1 gene located on chromosomal region Xp22.2. Joubert syndrome type 10 is a disorder presenting with cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy and renal disease. Orofaciodigital syndrome type 1 is characterized by malformations of the face, oral cavity, and digits and is transmitted as an X-linked dominant condition with lethality in males. The central nervous system may also be involved in as many as 40% of cases.600
OPA33-methylglutaconic aciduria, type 3NM_001017989.2NM_001017989.2:c.221delG3-methylglutaconic aciduria type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OPA3 gene located on chromosomal region 19q13.32. The age of onset is infantile. This disease is characterized by the association of optic atrophy and choreoathetosis with 3-methylglutaconic aciduria. The prevalence is 1:10,000-5:10,000.600
OSTM1Osteopetrosis, autosomal recessive type 5NM_014028.3NM_014028.3:c.415_416delAGOsteopetrosis, autosomal recessive type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OSTM1 gene located on chromosomal region 6p21. The age of onset is infantile. This disease is characterized by osteopetrosis, agenesis del cuerpo calloso, atrofia cerebral e hipocampo peque�o.600
OTCOrnithine transcarbamylase deficiencyNM_000531.5NM_000531.5:c.77G>A, NM_000531.5:c.118C>T, NM_000531.5:c.119G>A, NM_000531.5:c.134T>C, NM_000531.5:c.148G>T, NM_000531.5:c.238A>G, NM_000531.5:c.245T>G, NM_000531.5:c.259G>A, NM_000531.5:c.275G>A, NM_000531.5:c.332T>C, NM_000531.5:c.421C>T, NM_000531.5:c.460G>T, NM_000531.5:c.563G>T, NM_000531.5:c.589G>T, NM_000531.5:c.617T>G, NM_000531.5:c.646C>G, NM_000531.5:c.674C>T, NM_000531.5:c.717+2T>C, NM_000531.5:c.829C>TOrnithine transcarbamylase deficiency follows an X-linked pattern of inheritance and is caused by pathogenic variants in the OTC gene located on chromosomal region Xp11.4. The age of onset is infantile. This disease is characterized by severe neonatal hyperammonemic coma that generally proves to be fatal, in males. Females may be also affected by symptoms with various degrees of intensity, ranging from dislike for proteins to chronic vomiting, growth retardation, hypotonia, psychomotor retardation, hyperammonemic coma, or psychiatric disorders. The prevalence is 1:80,000.600
OTOADeafness, autosomal recessive type 22NM_144672.3NM_144672.3:c.121-1G>A, NM_144672.3:c.828delT, NM_144672.3:c.1725_1726delCADeafness, autosomal recessive type 22 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOA gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems.600,25
OTOFAuditory neuropathy, autosomal recessive, type 1NM_001287489.1NM_001287489.1:c.5474_5475delCC, NM_001287489.1:c.5473C>G, NM_001287489.1:c.5103+2T>A, NM_001287489.1:c.4559G>A, NM_001287489.1:c.4491T>A, NM_001287489.1:c.3032T>C, NM_001287489.1:c.2485C>T, NM_001287489.1:c.2348delG, NM_001287489.1:c.1778delT, NM_001287489.1:c.1544T>C, NM_001287489.1:c.1498C>T, NM_001287489.1:c.766-2A>G, NM_001287489.1:c.584-1G>C, NM_001287489.1:c.227+2T>C, NM_001287489.1:c.149G>AAuditory neuropathy, autosomal recessive type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. Patients can have varying degrees of hearing loss with poor speech reception out of proportion to the degree of hearing loss.600,25
OTOFAuditory neuropathy, autosomal recessive, type 1NM_004802.3NM_004802.3:c.3515G>AAuditory neuropathy, autosomal recessive type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. Patients can have varying degrees of hearing loss with poor speech reception out of proportion to the degree of hearing loss.600,25
P3H1Osteogenesis imperfecta, type 8NM_001243246.1NM_001243246.1:c.1656C>A, NM_001243246.1:c.1473+1G>T, NM_001243246.1:c.1365_1366delAGinsC, NM_001243246.1:c.1102C>T, NM_001243246.1:c.747delCOsteogenesis imperfecta type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the P3H1 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by bone fragility, low bone mass and susceptibility to bone fractures. The prevalence is 6:100,000-7:100,000.600
PAHPhenylketonuriaNM_000277.1NM_000277.1:c.1315+1G>A, NM_000277.1:c.1243G>A, NM_000277.1:c.1241A>G, NM_000277.1:c.1238G>C, NM_000277.1:c.1222C>T, NM_000277.1:c.1217T>C, NM_000277.1:c.1208C>T, NM_000277.1:c.1199+17G>A, NM_000277.1:c.1199+1G>A, NM_000277.1:c.1197A>T, NM_000277.1:c.1184C>A, NM_000277.1:c.1169A>G, NM_000277.1:c.1166delC, NM_000277.1:c.1162G>A, NM_000277.1:c.1139C>T, NM_000277.1:c.1068C>A, NM_000277.1:c.1066-3C>T, NM_000277.1:c.1066-11G>A, NM_000277.1:c.1045T>C, NM_000277.1:c.1042C>G, NM_000277.1:c.1033G>T, NM_000277.1:c.1030G>A, NM_000277.1:c.955G>T, NM_000277.1:c.926C>T, NM_000277.1:c.926C>A, NM_000277.1:c.912+1G>A, NM_000277.1:c.898G>T, NM_000277.1:c.896T>G, NM_000277.1:c.842+5G>A, NM_000277.1:c.838G>A, NM_000277.1:c.829T>G, NM_000277.1:c.823C>T, NM_000277.1:c.818C>T, NM_000277.1:c.814G>T, NM_000277.1:c.809G>A, NM_000277.1:c.806delT, NM_000277.1:c.782G>A, NM_000277.1:c.764T>C, NM_000277.1:c.755G>A, NM_000277.1:c.754C>T, NM_000277.1:c.745C>T, NM_000277.1:c.737C>A, NM_000277.1:c.734T>C, NM_000277.1:c.733G>C, NM_000277.1:c.728G>A, NM_000277.1:c.727C>T, NM_000277.1:c.722delG, NM_000277.1:c.722G>A, NM_000277.1:c.721C>T, NM_000277.1:c.688G>A, NM_000277.1:c.673C>G, NM_000277.1:c.665A>G, NM_000277.1:c.638T>C, NM_000277.1:c.611A>G, NM_000277.1:c.569T>C, NM_000277.1:c.533A>G, NM_000277.1:c.529G>A, NM_000277.1:c.527G>T, NM_000277.1:c.509+1G>A, NM_000277.1:c.508C>G, NM_000277.1:c.503delA, NM_000277.1:c.490A>G, NM_000277.1:c.482T>C, NM_000277.1:c.473G>A, NM_000277.1:c.472C>T, NM_000277.1:c.450dupA, NM_000277.1:c.442-1G>A, NM_000277.1:c.442-5C>G, NM_000277.1:c.441+5G>T, NM_000277.1:c.441+1G>A, NM_000277.1:c.357delC, NM_000277.1:c.331C>T, NM_000277.1:c.320A>G, NM_000277.1:c.311C>A, NM_000277.1:c.284_286delTCA, NM_000277.1:c.261C>A, NM_000277.1:c.250G>T, NM_000277.1:c.204A>T, NM_000277.1:c.194T>C, NM_000277.1:c.165T>G, NM_000277.1:c.143T>C, NM_000277.1:c.136G>A, NM_000277.1:c.117C>G, NM_000277.1:c.47_48delCTPhenylketonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAH gene located on chromosomal region 12q23.2. The age of onset is neonatal. This disease is characterized by gradual developmental delay, stunted growth, microcephaly, seizures, tremors, eczema, vomiting, and musty odor. Untreated patients subsequently develop intellectual disability, behavioral disorders (hyperactivity) and motor disorders. The prevalence is 1:2,600-1:200,000.600,25
PANK2Neurodegeneration with brain iron accumulation type 1NM_153638.3NM_153638.3:c.790C>T, NM_153638.3:c.823_824delCT, NM_153638.3:c.1561G>A, NM_153638.3:c.1583C>TNeurodegeneration with brain iron accumulation type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PANK2 gene located on chromosomal region 20p13. The age of onset is infantile. This disease is characterized by progressive extrapyramidal dysfunction (dystonia, rigidity, choreoathetosis), iron accumulation on the brain and axonal spheroids in the central nervous system. The prevalence is 1-2/1,000,000.600,25
PCPyruvate carboxylase deficiencyNM_000920.3NM_000920.3:c.1748G>T, NM_000920.3:c.434T>CPyruvate carboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PC gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by metabolic acidosis, failure to thrive, developmental delay, and recurrent seizures. The prevalence is 1:250,000.600,25
PCCAPropionic acidemiaNM_000282.3NM_000282.3:c.229C>T, NM_000282.3:c.261dupT, NM_000282.3:c.412G>A, NM_000282.3:c.600+1G>A, NM_000282.3:c.862A>T, NM_000282.3:c.1023dupT, NM_000282.3:c.1118T>A, NM_000282.3:c.1226_1227delTT, NM_000282.3:c.1284+1G>A, NM_000282.3:c.1598_1601delTTGT, NM_000282.3:c.1891G>C, NM_000282.3:c.1899+4_1899+7delAGTAPropionic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCA gene located on chromosomal region 13q32.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000.600,25
PCCBPropionic acidemiaNM_001178014.1NM_001178014.1:c.331C>T, NM_001178014.1:c.337C>T, NM_001178014.1:c.562G>A, NM_001178014.1:c.622G>A, NM_001178014.1:c.743C>T, NM_001178014.1:c.1050dupT, NM_001178014.1:c.1233dupT, NM_001178014.1:c.1278_1291delGGGCATCATCCGGCinsTAGAGCACAGGA, NM_001178014.1:c.1279_1284delGGCATCinsAA, NM_001178014.1:c.1283_1286delTCAT, NM_001178014.1:c.1288C>T, NM_001178014.1:c.1289_1290insT, NM_001178014.1:c.1343C>T, NM_001178014.1:c.1364A>G, NM_001178014.1:c.1594C>T, NM_001178014.1:c.1598_1600dupCCC, NM_001178014.1:c.1666A>GPropionic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCB gene located on chromosomal region 3q22.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000.600,25
PCDH15Deafness, autosomal recessive type 23NM_001142763.1NM_001142763.1:c.5680A>T, NM_001142763.1:c.4982_4983insTGAT, NM_001142763.1:c.4958_4961dupTGAT, NM_001142763.1:c.4885delA, NM_001142763.1:c.4569_4572dupATCT, NM_001142763.1:c.3733-2A>G, NM_001142763.1:c.2660_2661delAT, NM_001142763.1:c.1955C>G, NM_001142763.1:c.1752C>G, NM_001142763.1:c.1598T>A, NM_001142763.1:c.1103delT, NM_001142763.1:c.1021C>T, NM_001142763.1:c.800G>A, NM_001142763.1:c.415C>T, NM_001142763.1:c.415C>G, NM_001142763.1:c.7C>TDeafness, autosomal recessive 23 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCDH15 gene located on chromosomal region 10q21.1. This is a form of non-syndromic sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.600,25
PDE6ARetinitis pigmentosa type 43NM_000440.2NM_000440.2:c.2053G>A, NM_000440.2:c.1749C>G, NM_000440.2:c.1683G>A, NM_000440.2:c.1560dupA, NM_000440.2:c.1113+1G>T, NM_000440.2:c.1113+1G>ARetinitis pigmentosa type 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.600,25
PDE6BRetinitis pigmentosa type 40NM_000283.3NM_000283.3:c.892C>T, NM_000283.3:c.1540delC, NM_000283.3:c.1572delC, NM_000283.3:c.1580T>C, NM_000283.3:c.1669C>T, NM_000283.3:c.1920+2T>CRetinitis pigmentosa 40 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6B gene located on chromosomal region 4p16.3. The age of onset is variable. Retinitis pigmentosa 40 is a retinal dystrophy belonging to the group of pigmentary retinopathies.This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness.600,25
PDE6CCone dystrophy type 4NM_006204.3NM_006204.3:c.85C>T, NM_006204.3:c.180_186delCCTGTGC, NM_006204.3:c.256_257insAG, NM_006204.3:c.481-12T>A, NM_006204.3:c.633G>C, NM_006204.3:c.826C>T, NM_006204.3:c.881G>A, NM_006204.3:c.1066G>T, NM_006204.3:c.1363A>G, NM_006204.3:c.1682dupA, NM_006204.3:c.1805A>T, NM_006204.3:c.2036+1G>T, NM_006204.3:c.2283+1G>C, NM_006204.3:c.2457T>ACone dystrophy type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6C gene located on chromosomal region 10q23.33. The age of onset is infantile. This disease is characterized by reduced visual acuity, achromatopsia, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, eccentric fixation, and reduced or complete loss of color discrimination.600
PDE6GRetinitis pigmentosa type 57NM_002602.3NM_002602.3:c.187+1G>TRetinitis pigmentosa type 57 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6G gene located on chromosomal region 17q25.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife.600
PDHA1Pyruvate dehydrogenase E1-alpha deficiencyNM_001173454.1NM_001173454.1:c.887A>C, NM_001173454.1:c.901C>GPyruvate dehydrogenase E1-alpha deficiency follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PDHA1 gene located on chromosomal region Xp22.12. The age of onset is variable. This disease is characterized by primary lactic acidosis in children. It is associated with a broad clinical spectrum ranging from fatal lactic acidosis in the newborn to chronic neurologic dysfunction with structural abnormalities in the central nervous system without systemic acidosis.The prevalence is >1:40,000 newborn.600
PDP1Pyruvate dehydrogenase phosphatase deficiencyNM_001161779.1NM_001161779.1:c.352G>T, NM_001161779.1:c.672_676delCTTTA, NM_001161779.1:c.878delC, NM_001161779.1:c.926_928delTTC, NM_001161779.1:c.1681C>TPyruvate dehydrogenase phosphatase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDP1 gene located on chromosomal region 8q22.1. The age of onset is neonatal. This disease is characterized by lactic acidosis and hypotonia.600
PDSS1Coenzyme Q10 deficiency, primary, type 2NM_014317.4NM_014317.4:c.319dupT, NM_014317.4:c.924T>GCoenzyme Q10 deficiency, primary, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDSS1 gene located on chromosome 10p12.1. The age of onset is neonatal/infantile. This disease is characterized by multisystem disorder with early-onset deafness, optic atrophy, mild mental retardation, peripheral neuropathy, obesity and cardiac valvulopathy.600
PDSS2Coenzyme Q10 deficiency, primary, type 3NM_020381.3NM_020381.3:c.1145C>T, NM_020381.3:c.964C>T, NM_020381.3:c.129dupCCoenzyme Q10 deficiency, primary, type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDSS2 gene located on chromosomal region 6q21. The age of onset is infantile. This disease is characterized by onset of symptoms typically between age three and 12 months, often following a viral infection. Neurologic features include hypotonia, spasticity, movement disorders, cerebellar ataxia, and peripheral neuropathy.600
PDX1Pancreatic agenesis type 1NM_000209.3NM_000209.3:c.492G>T, NM_000209.3:c.532G>A, NM_000209.3:c.533A>GPancreatic agenesis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDX1 gene located on chromosomal region 13q12.1. The age of onset is infantile. This disease is characterized by isolated hypoplasia or agenesis of the pancreas, pancreatic beta-cell failure resulting in neonatal insulin-dependent diabetes mellitus, and exocrine pancreatic insufficiency.600
PDZD7Usher syndrome, type 2C, GPR98/PDZD7 digenicNM_001195263.1NM_001195263.1:c.2107delA, NM_001195263.1:c.1543C>T, NM_001195263.1:c.166dupC, NM_001195263.1:c.144dupAUsher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR98 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32, respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000.600
PEX1Heimler syndrome type 1NM_000466.2NM_000466.2:c.3505_3517delCAGTTGTTTTCAC, NM_000466.2:c.2916delA, NM_000466.2:c.2528G>A, NM_000466.2:c.2097dupT, NM_000466.2:c.1991T>C, NM_000466.2:c.1952_1960dupCAGTGTGGA, NM_000466.2:c.1842delA, NM_000466.2:c.1239+1G>T, NM_000466.2:c.877C>THeimler syndrome 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. This disease is characterized by sensorineural hearing loss, enamel hyoplasia of the secondary dentition, and nail abnormalities.600,25
PEX12Peroxisome biogenesis disorder type 3A (Zellweger)NM_000286.2NM_000286.2:c.959C>T, NM_000286.2:c.894delC, NM_000286.2:c.888_889delCT, NM_000286.2:c.771delC, NM_000286.2:c.538C>T, NM_000286.2:c.455_459dupGGAAAPeroxisome biogenesis disorder 3A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX12 gene located on chromosomal region 17q12. The peroxisomal biogenesis disorder (PBD) Zellweger syndrome (ZS) is an autosomal recessive multiple congenital anomaly syndrome resulting from disordered peroxisome biogenesis. Affected children present in the newborn period with profound hypotonia, seizures, and inability to feed. Characteristic craniofacial anomalies, eye abnormalities, neuronal migration defects, hepatomegaly, and chondrodysplasia punctata are present. Children with this condition do not show any significant development and usually die in the first year of lifeﾠ600
PEX2Peroxisome biogenesis disorder type 5A (Zellweger)NM_000318.2NM_000318.2:c.789_790delCT, NM_000318.2:c.163G>APeroxisome biogenesis disorder 5A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX2 gene located on chromosomal region 8q21.13. The peroxisomal biogenesis disorder (PBD) Zellweger syndrome (ZS) is an autosomal recessive multiple congenital anomaly syndrome resulting from disordered peroxisome biogenesis. Affected children present in the newborn period with profound hypotonia, seizures, and inability to feed. Characteristic craniofacial anomalies, eye abnormalities, neuronal migration defects, hepatomegaly, and chondrodysplasia punctata are present. Children with this condition do not show any significant development and usually die in the first year of lifeﾠ600
PEX26Peroxisome biogenesis disorder type 7A (Zellweger)NM_001127649.2NM_001127649.2:c.254dupT, NM_001127649.2:c.265G>A, NM_001127649.2:c.292C>TPeroxisome biogenesis disorder 7A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX26 gene located on chromosomal region 22q11.21. The peroxisomal biogenesis disorder (PBD) Zellweger syndrome (ZS) is an autosomal recessive multiple congenital anomaly syndrome resulting from disordered peroxisome biogenesis. Affected children present in the newborn period with profound hypotonia, seizures, and inability to feed. Characteristic craniofacial anomalies, eye abnormalities, neuronal migration defects, hepatomegaly, and chondrodysplasia punctata are present. Children with this condition do not show any significant development and usually die in the first year of lifeﾠ600
PEX5Peroxisome biogenesis disorder type 2A (Zellweger)NM_001300789.1NM_001300789.1:c.1342C>T, NM_001300789.1:c.1641T>GPeroxisome biogenesis disorder 2A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX5 gene located on chromosomal region 12p13.31. The peroxisomal biogenesis disorder (PBD) Zellweger syndrome (ZS) is an autosomal recessive multiple congenital anomaly syndrome resulting from disordered peroxisome biogenesis. Affected children present in the newborn period with profound hypotonia, seizures, and inability to feed. Characteristic craniofacial anomalies, eye abnormalities, neuronal migration defects, hepatomegaly, and chondrodysplasia punctata are present. Children with this condition do not show any significant development and usually die in the first year of lifeﾠ600
PEX7Rhizomelic chondrodysplasia punctata, type 1NM_000288.3NM_000288.3:c.532C>T, NM_000288.3:c.618G>A, NM_000288.3:c.649G>A, NM_000288.3:c.653C>T, NM_000288.3:c.694C>T, NM_000288.3:c.854A>G, NM_000288.3:c.875T>A, NM_000288.3:c.903+1G>CRhizomelic chondrodysplasia punctata type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX7 gene located on chromosomal region 6q23.3. The age of onset is early. This disease is characterized by proximal shortening of the humerus and to a lesser degree the femur (rhizomelia), punctate calcifications in cartilage with epiphyseal and metaphyseal abnormalities (chondrodysplasia punctata), coronal clefts of the vertebral bodies, cataracts, postnatal growth deficiency is profound, intellectual disability is severe, seizures. The prevalence is <1:100,000.600,25
PGM1Congenital disorder of glycosylation, type 1tNM_001172818.1NM_001172818.1:c.397A>G, NM_001172818.1:c.415G>C, NM_001172818.1:c.841G>T, NM_001172818.1:c.1561C>TCongenital disorder of glycosylation, type 1T follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PGM1 gene located on chromosomal region 1p31.3. The age of onset is infantile. It is a multisystem disorder caused by a defect in glycoprotein biosynthesis and characterized by under-glycosylated serum glycoproteins. Congenital disorders of glycosylation result in a wide variety of clinical features, such as defects in the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. The prevalence is <1:1,000,000.600
PHKG2Glycogen storage disease type 9cNM_000294.2NM_000294.2:c.130C>T, NM_000294.2:c.393-2A>G, NM_000294.2:c.553C>T, NM_000294.2:c.958C>TGlycogen storage disease type 9C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHKG2 gene located on chromosomal region 16p12.1-p11.2. The age of onset is infantile. This disease is characterized by hepatomegaly, growth retardation, and mild delay in motor development during childhood. The incidence is <1:100.000 births.600
PHYHRefsum diseaseNM_001323082.1NM_001323082.1:c.830G>A, NM_001323082.1:c.829C>T, NM_001323082.1:c.811A>C, NM_001323082.1:c.684+5G>T, NM_001323082.1:c.684+2T>G, NM_001323082.1:c.503-2A>G, NM_001323082.1:c.164delT, NM_001323082.1:c.135-1G>C, NM_001323082.1:c.135-2A>GRefsum disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHYH gene located on chromosomal region 10p13. The age of onset is variable. This disease is characterized by hemeralopia (loss of vision in the dark), followed by episods of chronic distal motor polyneuropathy. Other associated signs include perceptive deafness, anosmia, cerebellous ataxia and sometimes, severe intellectual deficiency. Over the course of time cutaneous signs appear (ichtyosis), along with polyepiphyseal dysplasia, myocardiopathy, elevated protein in cerebrospinal fluid, and pigmentary retinitis that may result in blindness. The prevalence is 1:1.000,000-9:1.000,000.600,25
PJVKDeafness, autosomal recessive type 59NM_001042702.3NM_001042702.3:c.113dupT, NM_001042702.3:c.122delA, NM_001042702.3:c.161C>T, NM_001042702.3:c.420delT, NM_001042702.3:c.726delT, NM_001042702.3:c.823dupT, NM_001042702.3:c.988delGAutosomal recessive nonsyndromic sensorineural deafness type 59 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PJVK gene located on chromosomal region 2q31.2. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.600
PKHD1Polycystic kidney disease type 4NM_138694.3NM_138694.3:c.12027C>G, NM_138694.3:c.11363_11372delCTTCCCTGGA, NM_138694.3:c.10452dupT, NM_138694.3:c.10412T>G, NM_138694.3:c.10219C>T, NM_138694.3:c.9719G>A, NM_138694.3:c.9689delA, NM_138694.3:c.9530T>C, NM_138694.3:c.9370C>T, NM_138694.3:c.8870T>C, NM_138694.3:c.8824C>T, NM_138694.3:c.8408G>A, NM_138694.3:c.8407T>C, NM_138694.3:c.8317G>T, NM_138694.3:c.6499C>T, NM_138694.3:c.5895dupA, NM_138694.3:c.5325_5326delAG, NM_138694.3:c.4870C>T, NM_138694.3:c.3940delA, NM_138694.3:c.3766delC, NM_138694.3:c.3761_3762delCCinsG, NM_138694.3:c.3367G>A, NM_138694.3:c.3229-2A>C, NM_138694.3:c.2854G>A, NM_138694.3:c.2827_2828delGA, NM_138694.3:c.2452C>T, NM_138694.3:c.2414C>T, NM_138694.3:c.2341C>T, NM_138694.3:c.1486C>T, NM_138694.3:c.982C>T, NM_138694.3:c.930delC, NM_138694.3:c.682A>G, NM_138694.3:c.664A>G, NM_138694.3:c.370C>T, NM_138694.3:c.353delG, NM_138694.3:c.107C>T, NM_138694.3:c.85G>TPolycystic kidney disease type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKHD1 gene located on chromosomal region 6p12.3-p12.2. The age of onset is early. This disease is a severe form of polycystic kidney disease affecting the kidneys and, in some cases, the hepatic biliary tract. Up to 50% of the affected neonates die shortly after birth, as a result of severe pulmonary hypoplasia and secondary respiratory insufficiency. In the subset that survives the perinatal period, morbidity and mortality are mainly related to severe systemic hypertension, renal insufficiency, and portal hypertension due to portal-tract fibrosis.600,25
PKLRPyruvate kinase deficiencyNM_000298.5NM_000298.5:c.1675C>T, NM_000298.5:c.1529G>A, NM_000298.5:c.1528C>T, NM_000298.5:c.1456C>T, NM_000298.5:c.1436G>A, NM_000298.5:c.1261C>A, NM_000298.5:c.1151C>T, NM_000298.5:c.721G>TPyruvate kinase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKLR gene located on chromosomal region 1q22. The age of onset is early. This disease is characterized by highly variable degree of chronic hemolysis, with severe neonatal jaundice and fatal anemia at birth, severe transfusion-dependent chronic hemolysis, and moderate hemolysis with exacerbation during infection. The prevalence is 1:20,000.600,25
PLA2G6Infantile neuroaxonal dystrophy type 1NM_003560.2NM_003560.2:c.2370T>G, NM_003560.2:c.2239C>T, NM_003560.2:c.1903C>T, NM_003560.2:c.1894C>T, NM_003560.2:c.1634A>C, NM_003560.2:c.1612C>T, NM_003560.2:c.929T>A, NM_003560.2:c.109C>TInfantile neuroaxonal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLA2G6 gene located on chromosomal region 22q13.1. The age of onset is infantile. This disease is a type of neurodegeneration with brain iron accumulation characterized by psychomotor delay and regression, increasing neurological involvement with symmetrical pyramidal tract signs and spastic tetraplegia. INAD may be classic or atypical and patients present with symptoms anywhere along a continuum between the two.600
PLCE1Nephrotic syndrome, type 3NM_016341.3NM_016341.3:c.961C>T, NM_016341.3:c.3346C>T, NM_016341.3:c.3736C>T, NM_016341.3:c.3846delG, NM_016341.3:c.4451C>T, NM_016341.3:c.4809delA, NM_016341.3:c.5560C>TNephrotic syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLCE1 gene located on chromosomal region 10q23.33. The age of onset is variable. This disease is characterized by low blood protein levels, high cholesterol levels, high triglyceride levels, and presence of protein in the urine. The prevalence is 2:100,000-7:100,000 Children; 3:100,000 adults.600,25
PLECEpidermolysis bullosa simplex with muscular dystrophyNM_201380.3NM_201380.3:c.12373dupG, NM_201380.3:c.11776G>T, NM_201380.3:c.11301_11302delGA, NM_201380.3:c.9580_9581delCT, NM_201380.3:c.9415C>T, NM_201380.3:c.7285C>T, NM_201380.3:c.1243C>T, NM_201380.3:c.1236+1G>AEpidermolysis bullosa simplex with muscular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLEC gene located on chromosomal region 8q24. The age of onset is early. This disease is characterized by generalized blistering associated with muscular dystrophy, dystrophic nails, and focal keratoderma of the palms and soles. The prevalence is 1:30,000-1:50,000.600
PLEKHG5Charcot-Marie-Tooth disease, recessive intermediate CNM_001265592.1NM_001265592.1:c.3172C>T, NM_001265592.1:c.2177T>CCharcot-Marie-Tooth disease, intermediate type C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLEKHG5 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease is a disorder of the peripheral nervous system, characterized by progressive weakness and atrophy, initially of the peroneal muscles and later of the distal muscles of the arms. Recessive intermediate forms of Charcot-Marie-Tooth disease are characterized by clinical and pathologic features intermediate between demyelinating and axonal peripheral neuropathies, and motor median nerve conduction velocities ranging from 25 to 45 m/sec.600
PLGPlasminogen deficiency, type INM_000301.3NM_000301.3:c.112A>G, NM_000301.3:c.693_695delGAA, NM_000301.3:c.704G>A, NM_000301.3:c.1120G>T, NM_000301.3:c.1435G>T, NM_000301.3:c.1848G>APlasminogen deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLG gene located on chromosomal region 6q26. The age of onset is infantile.This disease is characterized by markedly impaired extracellular fibrinolysis leading to the formation of ligneous (fibrin-rich) pseudomembranes on mucosae during wound healing. The prevalence is 1:1,000,000-9:1,000,000.600,25
PLOD1Ehlers-Danlos syndrome, kyphoscoliotic type, 1NM_001316320.1NM_001316320.1:c.607+1G>A, NM_001316320.1:c.1096C>T, NM_001316320.1:c.1674C>G, NM_001316320.1:c.1977G>C, NM_001316320.1:c.2149C>T, NM_001316320.1:c.2173G>AEhlers-Danlos syndrome kyphoscoliotic type, 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLOD1 gene located on chromosomal region 1p36. The age of onset is early. This disease is characterized by progressive scoliosis from birth, severe muscle hypotonia, hyperextensible joints and fragile eyeballs. The weakness can lead to ocular retinal hemorrhage, glaucoma, coloring of the sclera or even to rupture of the globe. The prevalence is <1:5,000.600
PLP1Pelizaeus-Merzbacher diseaseNM_000533.4NM_000533.4:c.3G>A, NM_000533.4:c.128C>T, NM_000533.4:c.231_232insC, NM_000533.4:c.487T>C, NM_000533.4:c.593delG, NM_000533.4:c.725C>T, NM_000533.4:c.737G>CPelizaeus-Merzbacher disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PLP1 gene located on chromosomal region Xq22.2. The age of onset is infantile. It is a hypomyelinative leukodystrophy in which myelin is not formed properly in the central nervous system. It is characterized clinically by nystagmus, spastic quadriplegia, ataxia, and developmental delay.600
PLP1Pelizaeus-Merzbacher diseaseNM_001305004.1NM_001305004.1:c.5-1G>TPelizaeus-Merzbacher disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PLP1 gene located on chromosomal region Xq22.2. The age of onset is infantile. It is a hypomyelinative leukodystrophy in which myelin is not formed properly in the central nervous system. It is characterized clinically by nystagmus, spastic quadriplegia, ataxia, and developmental delay.600
PMM2Congenital disorder of glycosylation, type 1aNM_000303.2NM_000303.2:c.26G>A, NM_000303.2:c.53C>G, NM_000303.2:c.95T>G, NM_000303.2:c.95_96delTAinsGC, NM_000303.2:c.97C>T, NM_000303.2:c.109C>T, NM_000303.2:c.131T>C, NM_000303.2:c.190delT, NM_000303.2:c.193G>T, NM_000303.2:c.255+2T>C, NM_000303.2:c.256-1G>C, NM_000303.2:c.323C>T, NM_000303.2:c.338C>T, NM_000303.2:c.349G>C, NM_000303.2:c.357C>A, NM_000303.2:c.368G>A, NM_000303.2:c.385G>A, NM_000303.2:c.395T>C, NM_000303.2:c.415G>A, NM_000303.2:c.422G>A, NM_000303.2:c.442G>A, NM_000303.2:c.470T>C, NM_000303.2:c.484C>T, NM_000303.2:c.563A>G, NM_000303.2:c.620T>C, NM_000303.2:c.623G>C, NM_000303.2:c.647A>T, NM_000303.2:c.652C>G, NM_000303.2:c.669C>G, NM_000303.2:c.677C>G, NM_000303.2:c.691G>A, NM_000303.2:c.710C>G, NM_000303.2:c.710C>TCongenital disorder of glycosylation type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PMM2 gene located on chromosomal region 16p13.2. The age of onset is infantile. This disease is characterized by highly variable clinical manifestations that may include feeding problems, vomiting, and diarrhea with failure to thrive in infants, and severe encephalopathy with axial hypotonia, abnormal eye movement, marked psychomotor retardation, peripheral neuropathy, cerebellar hypoplasia, stroke-like episodes, and retinitis pigmentosa in late infancy, childhood or adulthood.600,25
PNPOPyridoxamine 5'-phosphate oxidase deficiencyNM_018129.3NM_018129.3:c.674G>A, NM_018129.3:c.685C>TPyridoxamine 5'-phosphate oxidase (PNPO) deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PNPO gene located on chromosomal region 17q21.32. The age of onset is early. This disease is characterized by onset of severe seizures within hours of birth that are not responsive to anticonvulsants.600
POLGMitochondrial DNA depletion syndrome 4A (Alpers type)NM_001126131.1NM_001126131.1:c.3644-1G>A, NM_001126131.1:c.3630dupC, NM_001126131.1:c.3286C>T, NM_001126131.1:c.3218C>T, NM_001126131.1:c.3151G>C, NM_001126131.1:c.2794C>T, NM_001126131.1:c.2617G>T, NM_001126131.1:c.2605C>T, NM_001126131.1:c.2591A>G, NM_001126131.1:c.2557C>T, NM_001126131.1:c.2542G>A, NM_001126131.1:c.2243G>C, NM_001126131.1:c.2209G>C, NM_001126131.1:c.1879C>T, NM_001126131.1:c.1760C>T, NM_001126131.1:c.1754G>A, NM_001126131.1:c.1437C>G, NM_001126131.1:c.1399G>A, NM_001126131.1:c.1120C>T, NM_001126131.1:c.911T>G, NM_001126131.1:c.752C>TMitochondrial DNA depletion syndrome, Alpers type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by the clinical triad of psychomotor regression, seizures, and liver disease. The prevalence is 1:1,600 newborn.600,25
POMGNT1Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3NM_001243766.1NM_001243766.1:c.1864delC, NM_001243766.1:c.1814G>C, NM_001243766.1:c.1545delC, NM_001243766.1:c.1539+1G>T, NM_001243766.1:c.1539+1G>A, NM_001243766.1:c.1469G>A, NM_001243766.1:c.1425G>A, NM_001243766.1:c.1411A>T, NM_001243766.1:c.1274G>C, NM_001243766.1:c.932G>A, NM_001243766.1:c.931C>T, NM_001243766.1:c.880-1G>A, NM_001243766.1:c.652+1G>A, NM_001243766.1:c.636C>T, NM_001243766.1:c.187C>T, NM_001243766.1:c.92dupAMuscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3 which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMGNT1 gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent psychomotor development, eye involvement and seizures. The prevalence is 1-9:100,000.600,25
POMT1Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1NM_007171.3NM_007171.3:c.193G>A, NM_007171.3:c.226G>A, NM_007171.3:c.598G>C, NM_007171.3:c.793C>T, NM_007171.3:c.831C>G, NM_007171.3:c.907C>T, NM_007171.3:c.1153C>T, NM_007171.3:c.1242-2A>G, NM_007171.3:c.1261dupC, NM_007171.3:c.1280_1281delAGinsTC, NM_007171.3:c.1540C>T, NM_007171.3:c.1545C>G, NM_007171.3:c.1746G>C, NM_007171.3:c.1770G>C, NM_007171.3:c.2005G>A, NM_007171.3:c.2163C>A, NM_007171.3:c.2167dupGMuscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 gene located on chromosomal region 9q34.13. Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies (type A), which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), is a genetically heterogeneous disorder with characteristic brain and eye malformations, profound mental retardation, congenital muscular dystrophy, and early death. The phenotype commonly includes cobblestone (type II) lissencephaly, cerebellar malformations, and retinal malformations.600,25
POMT2Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2NM_013382.5NM_013382.5:c.2243G>C, NM_013382.5:c.2177G>A, NM_013382.5:c.1997A>G, NM_013382.5:c.1941G>A, NM_013382.5:c.1912C>T, NM_013382.5:c.1726-2A>G, NM_013382.5:c.1608_1609delCA, NM_013382.5:c.1445G>T, NM_013382.5:c.1417C>T, NM_013382.5:c.1057G>A, NM_013382.5:c.1045_1052delCGGATGGCinsG, NM_013382.5:c.551C>TMuscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT2 gene located on chromosomal region 14q24.3. Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies (type A), which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), is a genetically heterogeneous disorder with characteristic brain and eye malformations, profound mental retardation, congenital muscular dystrophy, and early death. The phenotype commonly includes cobblestone (type II) lissencephaly, cerebellar malformations, and retinal malformations.600,25
POU1F1Pituitary hormone deficiency, combined, type 1NM_001122757.2NM_001122757.2:c.826G>T, NM_001122757.2:c.793C>T, NM_001122757.2:c.766G>A, NM_001122757.2:c.655T>C, NM_001122757.2:c.593G>A, NM_001122757.2:c.592C>T, NM_001122757.2:c.550G>C, NM_001122757.2:c.511A>T, NM_001122757.2:c.506G>A, NM_001122757.2:c.482T>G, NM_001122757.2:c.469G>T, NM_001122757.2:c.71C>TPituitary hormone deficiency, combined, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POU1F1 gene located on chromosomal region 3p11.2. The age of onset is early. This disease is characterized by short stature, cognitive alterations or delayed puberty. The prevalence is 1:8,000.600
POU3F4Deafness, X-linked type 2 (DFNX2)NM_000307.4NM_000307.4:c.499C>T, NM_000307.4:c.604A>TX-linked deafness type 2 (DFNX2, also known as DFN3) follows an X-linked pattern of inheritance and is caused by pathogenic variants in the POU3F4 gene located on chromosomal region Xq21.1. The age of onset is infantile. This disease is characterized by progressive conductive and sensorineural hearing loss and a pathognomonic temporal bone deformity that includes dilatation of the inner auditory canal and a fistulous connection between the internal auditory canal and the cochlear basal turn, resulting in a perilymphatic fluid 'gusher' during stapes surgery (summary by de Kok et al., 1995 and Song et al., 2010). Note: Choroideremia, deafness, and mental retardation (OMIM 303110), is caused by a contiguous gene deletion syndrome involving the POU3F4 and CHM genes on Xq21. This deletion is not detected by this CGT test.600
PPT1Ceroid lipofuscinosis, neuronal, type 1NM_000310.3NM_000310.3:c.840dupA, NM_000310.3:c.627+1G>T, NM_000310.3:c.541G>T, NM_000310.3:c.451C>T, NM_000310.3:c.223A>C, NM_000310.3:c.169dupA, NM_000310.3:c.29T>ANeuronal ceroid lipofuscinoses, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PPT1 gene located on chromosomal region 1p32. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 1.5:1,000,000-9:1,000,000.600,25
PRCDRetinitis pigmentosa, type 36NM_001077620.2NM_001077620.2:c.52C>T, NM_001077620.2:c.64C>TRetinitis pigmentosa, type 36 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRCD gene located on chromosomal region 17q25.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife.600
PRKRADystonia, type 16NM_003690.4NM_003690.4:c.665C>TDystonia, type 16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRKRA gene located on chromosomal region 2q31.2. The age of onset is early. This disease is characterized by progressive limb dystonia, laryngeal and oromandibular dystonia and parkinsonism.600
PROM1Retinitis pigmentosa, type 41NM_006017.2NM_006017.2:c.2490-2A>G, NM_006017.2:c.1841delG, NM_006017.2:c.1726C>T, NM_006017.2:c.1354dupT, NM_006017.2:c.1177_1178delAT, NM_006017.2:c.199C>TRetinitis pigmentosa, type 41 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROM1 gene located on chromosomal region 4p15.32. The age of onset is early. This disease is characterized by night blindness often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 19:100,000-27:100,000.600,25
PROP1Pituitary hormone deficiency, combined, type 2NM_006261.4NM_006261.4:c.469dupT, NM_006261.4:c.358C>T, NM_006261.4:c.349T>A, NM_006261.4:c.310delC, NM_006261.4:c.301_302delAG, NM_006261.4:c.295C>T, NM_006261.4:c.263T>C, NM_006261.4:c.247C>T, NM_006261.4:c.218G>A, NM_006261.4:c.217C>T, NM_006261.4:c.157delA, NM_006261.4:c.150delA, NM_006261.4:c.112_124delTCGAGTGCTCCAC, NM_006261.4:c.4delG, NM_006261.4:c.2T>CPituitary hormone deficiency, combined, type 2, genetic forms follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROP1 gene located on chromosomal region 5q35.3. The age of onset is early. This disease is characterized by short stature, cognitive alterations or delayed puberty.600
PRPS1Deafness, X-linked 1 (DFNX1); Arts syndrome; PRPS1-related disordersNM_002764.3NM_002764.3:c.193G>A, NM_002764.3:c.344T>C, NM_002764.3:c.398A>C, NM_002764.3:c.869T>C, NM_002764.3:c.916G>AThe DFNX1 locus (PRPS1 gene) is associated with phenotypically heterogeneous non-syndromic hearing loss. In general, hearing impairment in male patients with PRPS1 mutations is bilateral, moderate to profound, and can be pre- or post-lingual, progressive or non-progressive. Female carriers may also be affected by unilateral or bilateral hearing impairment. Mutations in PRPS1 might also result in a spectrum of syndromic conditions, including PRS-I superactivity (OMIM #300661), Charcot-Marie Tooth neuropathy type X-5 (CMTX5 or Rosenberg-Chutorian syndrome, OMIM #311070) and Arts syndrome. Arts syndrome is an X-linked disorder characterized by mental retardation, early-onset hypotonia, ataxia, delayed motor development, hearing impairment, and optic atrophy (de Brouwer et al., 2007). In the Arts syndrome, susceptibility to infections, especially of the upper respiratory tract, can result in early death.600
PRXCharcot-Marie-Tooth disease, type 4FNM_181882.2NM_181882.2:c.3208C>T, NM_181882.2:c.2857C>T, NM_181882.2:c.2553_2556delTCTC, NM_181882.2:c.2145T>A, NM_181882.2:c.2098delG, NM_181882.2:c.1362delA, NM_181882.2:c.1102C>T, NM_181882.2:c.247delCCharcot-Marie-Tooth disease, type 4F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRX gene located on chromosomal region 19q13.2. The age of onset is infantile. This disease is characterized by delayed motor milestones, and proximal and distal muscle weakness. The prevalence is <1:1,000,000.600
PSAPCombined SAP deficiencyNM_001042465.2NM_001042465.2:c.1297C>T, NM_001042465.2:c.1055T>C, NM_001042465.2:c.643A>C, NM_001042465.2:c.607C>TCombined saposin (SAP) deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PSAP gene located on chromosomal region 10q22.1. The age of onset is neonatal/infancy. This disease is characterized by hypotonia, massive myoclonic bursts, abnormal ocular movements and dystonia. Grand mal seizures and seizures triggered by tactile stimuli have been described. Patients also develop hepatosplenomegaly. Death between 1 and 4 months usually occurs from respiratory failure following repeated pulmonary infections. The prevalence is below 1/1,000,000.600
PSAPCombined SAP deficiencyNM_002778.3NM_002778.3:c.1A>TCombined saposin (SAP) deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PSAP gene located on chromosomal region 10q22.1. The age of onset is neonatal/infancy. This disease is characterized by hypotonia, massive myoclonic bursts, abnormal ocular movements and dystonia. Grand mal seizures and seizures triggered by tactile stimuli have been described. Patients also develop hepatosplenomegaly. Death between 1 and 4 months usually occurs from respiratory failure following repeated pulmonary infections. The prevalence is below 1/1,000,000.600
PSAT1Neu-Laxova syndrome, type 2NM_058179.3NM_058179.3:c.299A>C, NM_058179.3:c.1033_1034delCTNeu-Laxova syndrome, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PSAT1 gene located on chromosomal region 9q21.2. The age of onset is prenatal. This disease is characterized by severe congenital malformations leading to prenatal or early postnatal lethality. Affected patients have abnormal craniofacial features, microcephaly, intrauterine growth retardation, ichthyosis, flexion deformities, limb malformations, and edema of the hands and feet. Some patients have malformations of the central nervous system. The prevalence is below 1/1,000,000.600
PYGMMcArdle diseaseNM_005609.3NM_005609.3:c.2392T>C, NM_005609.3:c.2262delA, NM_005609.3:c.2128_2130delTTC, NM_005609.3:c.1963G>A, NM_005609.3:c.1827G>A, NM_005609.3:c.1768+1G>A, NM_005609.3:c.1726C>T, NM_005609.3:c.1722T>G, NM_005609.3:c.1628A>C, NM_005609.3:c.1621G>T, NM_005609.3:c.1466C>G, NM_005609.3:c.613G>A, NM_005609.3:c.501dupT, NM_005609.3:c.393delG, NM_005609.3:c.280C>T, NM_005609.3:c.255C>A, NM_005609.3:c.148C>T, NM_005609.3:c.13_14delCT, NM_005609.3:c.1A>GMcArdle disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PYGM gene located on chromosomal region 11q13.1. The age of onset is infantile. This disease is characterized by muscular exercise intolerance with myalgia, cramps, fatigue, and muscle weakness.600,25
RAB23Carpenter syndromeNM_001278666.1NM_001278666.1:c.434T>A, NM_001278666.1:c.407dupCCarpenter syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB23 gene located on chromosomal region 6p11.2. The age of onset is early. This disease is characterized by acrocephaly, peculiar facies, brachydactyly and syndactyly in the hands, and preaxial polydactyly and syndactyly of the toes. The prevalence is <1:1,000,000.600
RAB27AGriscelli syndrome, type 2NM_004580.4NM_004580.4:c.454G>C, NM_004580.4:c.389T>C, NM_004580.4:c.382dupA, NM_004580.4:c.352C>T, NM_004580.4:c.259G>C, NM_004580.4:c.217T>GGriscelli disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB27A gene located on chromosome 15q15-q21.1. The age of onset is infantile. This disease is characterized by immune system abnormalities in addition to having hypopigmented skin and hair. Affected individuals are prone to recurrent infections. They also develop an immune condition called hemophagocytic lymphohistiocytosis, in which the immune system produces too many activated immune cells called T-lymphocytes and macrophages (histiocytes).600
RAB3GAP1Warburg micro syndrome, type 1NM_001172435.1NM_001172435.1:c.497_498delTT, NM_001172435.1:c.748+1G>A, NM_001172435.1:c.899+1G>A, NM_001172435.1:c.937dupA, NM_001172435.1:c.1395_1398delTATG, NM_001172435.1:c.1410C>A, NM_001172435.1:c.1734G>A, NM_001172435.1:c.2011C>TWarburg micro syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB3GAP1 gene located on chromosomal region 2q21.3. The age of onset is infantile. This disease is characterized by microcephaly, microphthalmia, microcornia, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. The prevalence is <1:1,000,000.600
RAB3GAP2Martsolf syndromeNM_012414.3NM_012414.3:c.1648C>T, NM_012414.3:c.1485C>A, NM_012414.3:c.1276C>T, NM_012414.3:c.325_328delAAAGWarburg micro syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB3GAP2 gene located on chromosomal region 1q41. The age of onset is early. This disease is characterized by microcephaly, microphthalmia, microcornia, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. The prevalence is <1:1,000,000.600
RAG1Omenn syndrome; Severe combined immunodeficiency, B cell-negativeNM_000448.2NM_000448.2:c.256_257delAA, NM_000448.2:c.940C>T, NM_000448.2:c.983G>A, NM_000448.2:c.1681C>T, NM_000448.2:c.1682G>A, NM_000448.2:c.2164G>A, NM_000448.2:c.2320G>T, NM_000448.2:c.2326C>T, NM_000448.2:c.2333G>A, NM_000448.2:c.2814T>G, NM_000448.2:c.2923C>TOmenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency.
Severe combined immunodeficiency, autosomal recessive, T cell-negative (T-), B cell negative (B-), NK cell positive (NK+) is also caused by mutation in the RAG1 and RAG2 genes. This disease is characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development. Without treatment, patients usually die within the first year of life.		600,25
RAG2Omenn syndrome; Severe combined immunodeficiency, B cell-negativeNM_000536.3NM_000536.3:c.1352G>C, NM_000536.3:c.601C>T, NM_000536.3:c.283G>A, NM_000536.3:c.230C>A, NM_000536.3:c.115A>GOmenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency.
Severe combined immunodeficiency, autosomal recessive, T cell-negative (T-), B cell negative (B-), NK cell positive (NK+) is also caused by mutation in the RAG1 and RAG2 genes. This disease is characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development. Without treatment, patients usually die within the first year of life.		600
RAPSNFetal akinesia deformation sequenceNM_005055.4NM_005055.4:c.848T>C, NM_005055.4:c.807C>A, NM_005055.4:c.566C>T, NM_005055.4:c.490C>T, NM_005055.4:c.484G>A, NM_005055.4:c.416T>C, NM_005055.4:c.264C>AFetal akinesia deformation sequence follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by multiple joint contractures, facial anomalies and pulmonary hypoplasia. The prevalence is 1:3,000.600,25
RAXIsolated microphthalmia, type 3NM_013435.2NM_013435.2:c.909C>G, NM_013435.2:c.439C>T, NM_013435.2:c.383_384delAG, NM_013435.2:c.18C>AIsolated microphthalmia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAX gene located on chromosomal region 18q21.32. Microphthalmia designates a heterogeneous group of ocular malformations with a more or less evident reduction in the size of the eyeball. Additional features include high hypermetropia and a short axial length.600,25
RDH12Leber congenital amaurosis, type 13NM_152443.2NM_152443.2:c.146C>T, NM_152443.2:c.152T>A, NM_152443.2:c.184C>T, NM_152443.2:c.210dupC, NM_152443.2:c.295C>A, NM_152443.2:c.377C>T, NM_152443.2:c.379G>T, NM_152443.2:c.451C>A, NM_152443.2:c.451C>G, NM_152443.2:c.464C>T, NM_152443.2:c.523T>C, NM_152443.2:c.565C>T, NM_152443.2:c.677A>G, NM_152443.2:c.806_810delCCCTGLeber congenital amaurosis type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDH12 gene located on chromosomal region 14q24.1. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.600,25
RDXDeafness, autosomal recessive, type 24NM_001260492.1NM_001260492.1:c.1405dupG, NM_001260492.1:c.342_346delGATATAutosomal recessive nonsyndromic sensorineural deafness type DFNB24 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDX gene located on chromosomal region 11q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.600
RELNLissencephaly 2 (Norman-Roberts type)NM_005045.3NM_005045.3:c.6646C>T, NM_005045.3:c.5615-1G>ALissencephaly syndrome 2, Norman-Roberts type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RELN gene located on chromosomal region 7q22. The age of onset is early. This disease is characterized by craniofacial anomalies (severe microcephaly, a low sloping forehead, a broad and prominent nasal bridge and widely set eyes) and postnatal growth retardation, severe intellectual deficit, spasticity and epilepsy. The prevalence is 1:1,000,000-9:1,000,000.600
RENRenal tubular dysgenesisNM_000537.3NM_000537.3:c.404C>A, NM_000537.3:c.145C>T, NM_000537.3:c.127C>TRenal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in REN gene located on chromosomal region 1q32.1. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.600
RGRRetinitis pigmentosa, type 44NM_002921.3NM_002921.3:c.262_269dupGGCTCGGA, NM_002921.3:c.273_274insGGCTCGGA, NM_002921.3:c.877C>TRetinitis pigmentosa type 44 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RGR gene located on chromosomal region 10q23.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.600,25
RHORetinitis pigmentosa, type 4, autosomal recessiveNM_000539.3NM_000539.3:c.173C>T, NM_000539.3:c.448G>A, NM_000539.3:c.620T>G, NM_000539.3:c.745G>TRetinitis pigmentosa type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RHO gene located on chromosomal region 3q22.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.600,25
RLBP1Bothnia retinal dystrophyNM_000326.4NM_000326.4:c.700C>T, NM_000326.4:c.452G>A, NM_000326.4:c.333T>GBothnia retinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RLBP1 gene located on chromosomal region 15q26.1. This disease is characterized by night blindness from early childhood with features consistent with retinitis punctata albescens and macular degeneration. The prevalence is unknown.600,25
RP2Retinitis pigmentosa, type 2, X-linkedNM_006915.2NM_006915.2:c.235delG, NM_006915.2:c.305dupT, NM_006915.2:c.352delC, NM_006915.2:c.353G>A, NM_006915.2:c.353G>T, NM_006915.2:c.358C>T, NM_006915.2:c.453delC, NM_006915.2:c.453C>G, NM_006915.2:c.631delCRetinitis pigmentosa type 2 (RP2) follows an X-linked (XLRP) pattern of inheritance and is caused by pathogenic variants in the RP2 gene located on chromosomal region Xp11.23. The age of onset is variable. This condition primarily affects males, causing night blindness in early childhood followed by progressive daytime vision loss. RP2 gene mutations account for 10 to 15 percent of all cases of X-linked retinitis pigmentosa. A gradual loss of photoreceptors underlies the progressive vision loss characteristic of retinitis pigmentosa (RP). The prevalence of RP2 is 1:3,500.600
RPE65Leber congenital amaurosis, type 2NM_000329.2NM_000329.2:c.1543C>T, NM_000329.2:c.1355T>G, NM_000329.2:c.1292A>G, NM_000329.2:c.1102T>C, NM_000329.2:c.1087C>A, NM_000329.2:c.1067delA, NM_000329.2:c.1022T>C, NM_000329.2:c.907A>T, NM_000329.2:c.514_515delGT, NM_000329.2:c.271C>TLeber congenital amaurosis 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus.600,25
RPGRRetinitis pigmentosa, type 3, X-linkedNM_001034853.1NM_001034853.1:c.846_847delAA, NM_001034853.1:c.823G>A, NM_001034853.1:c.806G>A, NM_001034853.1:c.703C>T, NM_001034853.1:c.674_675delCC, NM_001034853.1:c.654_655delGA, NM_001034853.1:c.642_656delTGGAGAACCTGAGAAinsC, NM_001034853.1:c.517G>C, NM_001034853.1:c.505G>T, NM_001034853.1:c.389T>G, NM_001034853.1:c.296C>A, NM_001034853.1:c.179G>T, NM_001034853.1:c.173_174insA, NM_001034853.1:c.155-2A>GRetinitis pigmentosa type 3 (RP3) follows an X-linked (XLRP) pattern of inheritance and is caused by pathogenic variants in the RPGR gene located on chromosomal region Xp11.4. XLRP are severe forms of inherited retinal degeneration that primarily affects the rod photoreceptors (Demirci et al., 2002). It typically causes an early-onset night blindness and loss of peripheral vision, often causing patients to become legally blind by the age of 30 to 40 years. Mutation in the RPGR gene is believed to account for approximately 70% of XLRP (RP3)(Vervoort et al., 2000). In RP3, affected males have a severe phenotype, and carrier females show a wide spectrum of clinical features ranging from completely asymptomatic to severe RP (Jin et al., 2007). Mutations in the RPGR gene can also cause X-linked cone-rod dystrophy (CORDX1; 304020) and a syndromic form of retinitis pigmentosa (RP) with deafness and sinorespiratory infections (300455). Cone-rod dystrophy is a group of related [to RP] eye disorders that causes vision loss, which becomes more severe over time. These disorders affect the retina, which is the layer of light-sensitive tissue at the back of the eye. In people with cone-rod dystrophy, vision loss occurs as the light-sensing cells of the retina gradually deteriorate. X-linked cone-rod dystrophy is a rare, progressive visual disorder primarily affecting cone photoreceptors (Demirci et al., 2002). Affected individuals, essentially all of whom are males, present with decreased visual acuity, myopia, photophobia, abnormal color vision, full peripheral visual fields, decreased photopic electroretinographic responses, and granularity of the macular retinal pigment epithelium. The degree of rod photoreceptor involvement is variable, with increasing degeneration. Although penetrance appears to be nearly 100%, there is variable expressivity with respect to age at onset, severity of symptoms, and findings (Hong et al., 1994). 600
RPGRIP1LJoubert syndrome, type 7; Meckel syndrome, type 5; COACH syndromeNM_015272.4NM_015272.4:c.3634_3637delGAAA, NM_015272.4:c.2794_2795delTT, NM_015272.4:c.2614C>T, NM_015272.4:c.2413C>T, NM_015272.4:c.2050C>T, NM_015272.4:c.1975T>C, NM_015272.4:c.1843A>C, NM_015272.4:c.1329dupA, NM_015272.4:c.1326_1329delAAAA, NM_015272.4:c.776+1G>A, NM_015272.4:c.757C>T, NM_015272.4:c.697A>T, NM_015272.4:c.394A>TJoubert syndrome (JBTS) type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. JBTS is characterized by congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (less common in JBTS7) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. RPGRIP1L gene is also associated with Meckel syndrome type 5, a rare, autosomal recessive lethal condition characterized by central nervous system malformations, postaxial, polydactyly, multicystic kidney dysplasia, and ductal proliferation in the portal area of the liver. Other phenotype associated is COACH syndrome, an autosomal recessive disorder characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable. COACH syndrome is considered by some to be a subtype of Joubert syndrome with congenital hepatic fibrosis.600,25
RYR1Minicore myopathy with external ophthalmoplegiaNM_000540.2NM_000540.2:c.325C>T, NM_000540.2:c.487C>T, NM_000540.2:c.631+2T>C, NM_000540.2:c.738T>G, NM_000540.2:c.1021G>A, NM_000540.2:c.1186G>T, NM_000540.2:c.1205T>C, NM_000540.2:c.1739_1742dupATCA, NM_000540.2:c.1841G>T, NM_000540.2:c.4076delG, NM_000540.2:c.4405C>T, NM_000540.2:c.5333C>A, NM_000540.2:c.5726_5727delAG, NM_000540.2:c.6082C>T, NM_000540.2:c.6104A>T, NM_000540.2:c.6721C>T, NM_000540.2:c.7268T>A, NM_000540.2:c.7300G>A, NM_000540.2:c.7360C>T, NM_000540.2:c.7373G>A, NM_000540.2:c.7463_7475delCAAAGATGTCAGC, NM_000540.2:c.7781C>A, NM_000540.2:c.7836-1G>A, NM_000540.2:c.9000+1G>T, NM_000540.2:c.9905dupC, NM_000540.2:c.10343C>T, NM_000540.2:c.10579C>T, NM_000540.2:c.13480G>T, NM_000540.2:c.14126C>T, NM_000540.2:c.14365-2A>T, NM_000540.2:c.14545G>AMultiminicore disease (MMD) is an inherited neuromuscular disorder defined pathologically by the presence of multiple areas of reduced mitochondrial oxidative activity running along a limited extent of the longitudinal axis of the muscle fiber, so-called 'minicores.' These regions show sarcomere disorganization and mitochondria depletion. Typically, no dystrophic signs, such as muscle fiber necrosis or regeneration or significant endomysial fibrosis, are present. MMD is a pathologic diagnosis and shows clinical and genetic heterogeneity. Affected individuals have clinical features of a congenital myopathy, including neonatal hypotonia, delayed motor development, and generalized muscle weakness and amyotrophy, which may progress slowly or remain stable (Ferreiro and Fardeau, 2002).Patients with recessive mutations in the RYR1 gene typically show severe congenital muscular dystrophy with ophthalmoplegia, although there is phenotypic variability. Some patients may present in utero with fetal akinesia, arthrogryposis, and lung hypoplasia resulting in fetal or perinatal death (McKie et al., 2014). Skeletal muscle biopsy of patients with recessive RYR1 mutations show variable features, including central cores (Jungbluth et al., 2007), congenital fiber-type disproportion (CFTD) (Monnier et al., 2009), and centronuclear myopathy (Wilmshurst et al., 2010).600,25
SACSSpastic ataxia, Charlevoix-Saguenay, typeNM_014363.5NM_014363.5:c.13237C>T, NM_014363.5:c.12160C>T, NM_014363.5:c.8844delT, NM_014363.5:c.7504C>T, NM_014363.5:c.6563T>A, NM_014363.5:c.6355C>T, NM_014363.5:c.5618_5619delAT, NM_014363.5:c.4933C>T, NM_014363.5:c.3198T>A, NM_014363.5:c.994A>T, NM_014363.5:c.517C>TSpastic ataxia, Charlevoix-Saguenay type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SACS gene located on chromosomal region 13q11. The age of onset is early. This disease is characterized by early-onset cerebellar ataxia with spasticity, a pyramidal syndrome and peripheral neuropathy. The prevalence is 1:1,500-1:2,000.600,25
SAGOguchi disease, type 1NM_000541.4NM_000541.4:c.298dupG, NM_000541.4:c.523C>T, NM_000541.4:c.577C>T, NM_000541.4:c.874C>T, NM_000541.4:c.916G>T, NM_000541.4:c.926delA, NM_000541.4:c.993C>GOguchi disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SAG gene located on chromosomal region 2q37. The age of onset is infantile. This disease is characterized by congenital stationary night blindness and the Mizuo-Nakamura phenomenon which is a unique morphological and functional abnormality of the retina that presents with a typical golden-yellow or silver-gray discoloration of the fundus in the presence of light that disappears after dark-adaptation and appears again after the onset of light.600,25
SBDSShwachman-Diamond syndromeNM_016038.2NM_016038.2:c.377G>C, NM_016038.2:c.258+2T>C, NM_016038.2:c.184A>T, NM_016038.2:c.183_184delTAinsCT, NM_016038.2:c.120delGShwachman-Diamond syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBDS gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by chronic and usually mild neutropenia, pancreatic exocrine insufficiency associated with steatorrhea and growth failure, skeletal dysplasia with short stature, and an increased risk of bone marrow aplasia or leukemic transformation, cutaneous (eczema or ichthyosis) and dental anomalies, and psychomotor retardation. The prevalence is 1:76,000 newborn.600,25
SBF2Charcot-Marie-Tooth disease, type 4B2NM_030962.3NM_030962.3:c.5536_5539dupATCT, NM_030962.3:c.3586C>T, NM_030962.3:c.3154A>T, NM_030962.3:c.2875C>T, NM_030962.3:c.1459C>TCharcot-Marie-Tooth disease, type 4B2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBF2 gene located on chromosomal region 11p15.4. The age of onset is infantile. This disease is characterized by muscle weakness, sensory loss, reduced nerve conduction velocities, characteristic myelin outfoldings and a severe disease course.600
SC5DLathosterolosisNM_001024956.2NM_001024956.2:c.86G>ALathosterolosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SC5D gene located on chromosomal region 11q23.3. The age of onset is early. This disease is characterized by malformations, intellectual deficit and liver disease. The prevalence is <1:1,000,000.600
SCNN1APseudohypoaldosteronism, type 1NM_001159576.1NM_001159576.1:c.1942C>T, NM_001159576.1:c.1699C>T, NM_001159576.1:c.1659delC, NM_001159576.1:c.1482delC, NM_001159576.1:c.517G>A, NM_001159576.1:c.380_381delTCPseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.600
SCNN1BPseudohypoaldosteronism, type 1NM_000336.2NM_000336.2:c.109G>APseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.600,25
SCNN1GPseudohypoaldosteronism, type 1NM_001039.3NM_001039.3:c.600dupA, NM_001039.3:c.1373+2T>C, NM_001039.3:c.1570-1G>A, NM_001039.3:c.1627delGPseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.600,25
SELENONMuscular dystrophy, rigid spine, type 1NM_020451.2NM_020451.2:c.713dupA, NM_020451.2:c.818G>A, NM_020451.2:c.943G>A, NM_020451.2:c.1315C>T, NM_020451.2:c.1384T>GRigid spine syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SELENON gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is characterized by contractures of the spinal extensor muscles associated with abnormal posture (limitation of neck and trunk flexure), progressive scoliosis of the spine, early marked cervico-axial muscle weakness with relatively preserved strength and function of the extremities and progressive respiratory insufficiency. The prevalence is 3.5:100,000ﾖ5:100,000.600
SEMA4ACone-rod dystrophy, type 10; Retinitis pigmentosa, type 35NM_001193300.1NM_001193300.1:c.1033G>C, NM_001193300.1:c.1049T>GCone-rod dystrophy, type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SEMA4A gene located on chromosomal region 1q22. The age of onset is childhood/adolescent. This disease is characterized by retinal pigment deposits visible on fundus examination, predominantly in the macular region, and initial loss of cone photoreceptors followed by rod degeneration. This leads to decreased visual acuity and sensitivity in the central visual field, followed by loss of peripheral vision. Severe loss of vision occurs earlier than in retinitis pigmentosa, due to cone photoreceptors degenerating at a higher rate than rod photoreceptors. The prevalence is 1-9/100,000. Retinitis pigmentosa-35 (RP35) can be caused by compound heterozygous mutation in the SEMA4A gene. RP35 is characterized by retinal pigment deposits and primary loss of rod photoreceptor cells followed by secondary loss of cone photoreceptors. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well.600
SETXSpinocerebellar ataxia, autosomal recessive, type 1NM_015046.5NM_015046.5:c.6848_6851delCAGA, NM_015046.5:c.6834_6839delAACAAA, NM_015046.5:c.5927T>G, NM_015046.5:c.5630delG, NM_015046.5:c.5549-1G>T, NM_015046.5:c.5308_5311delGAGA, NM_015046.5:c.4087C>T, NM_015046.5:c.2602C>T, NM_015046.5:c.1166T>C, NM_015046.5:c.1027G>T, NM_015046.5:c.994C>TSpinocerebellar ataxia with axonal neuropathy type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SETX gene located on chromosomal region 9q34.13. The age of onset is infantile. This disease is characterized by progressive cerebellar ataxia, axonal sensorimotor neuropathy with oculomotor apraxia, fixation instability, extrapyramidal features and an elevated serum alpha-fetoprotein level. The prevalence is 4:100,000-8:100,000.600,25
SGCAMuscular dystrophy, limb-girdle, type 2DNM_000023.3NM_000023.3:c.101G>A, NM_000023.3:c.229C>T, NM_000023.3:c.371T>C, NM_000023.3:c.518T>C, NM_000023.3:c.574C>T, NM_000023.3:c.739G>A, NM_000023.3:c.850C>T, NM_000023.3:c.903_904dupCCAutosomal recessive limb-girdle muscular dystrophy type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCA gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness and calf pseudohypertrophy. The prevalence is 1:1,000,000-9:1,000,000.600,25
SGCBMuscular dystrophy, limb-girdle, type 2ENM_000232.4NM_000232.4:c.552T>G, NM_000232.4:c.452C>G, NM_000232.4:c.341C>T, NM_000232.4:c.323T>G, NM_000232.4:c.299T>A, NM_000232.4:c.272G>T, NM_000232.4:c.272G>CAutosomal recessive limb-girdle muscular dystrophy type 2E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCB gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness, particularly of the pelvic girdle muscles.600
SGCGMuscular dystrophy, limb-girdle, type 2CNM_000231.2NM_000231.2:c.89delG, NM_000231.2:c.195+4_195+7delAGTA, NM_000231.2:c.505+1G>A, NM_000231.2:c.525delT, NM_000231.2:c.787G>A, NM_000231.2:c.848G>AAutosomal recessive limb-girdle muscular dystrophy type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCG gene located on chromosomal region 13q12.12. The age of onset is variable. This disease is characterized by limb-girdle weakness, calf hypertrophy, diaphragmatic weakness, and variable cardiac abnormalities.600,25
SGSHMucopolysaccharidosis, type 3A (Sanfilippo A)NM_000199.3NM_000199.3:c.1380delT, NM_000199.3:c.1339G>A, NM_000199.3:c.1298G>A, NM_000199.3:c.1167C>A, NM_000199.3:c.892T>C, NM_000199.3:c.877C>T, NM_000199.3:c.757delG, NM_000199.3:c.617G>C, NM_000199.3:c.466A>T, NM_000199.3:c.449G>A, NM_000199.3:c.383C>T, NM_000199.3:c.364G>A, NM_000199.3:c.337_345delCAAGCTGGTinsGCACAGGTGAG, NM_000199.3:c.320delT, NM_000199.3:c.235A>C, NM_000199.3:c.220C>T, NM_000199.3:c.197C>G, NM_000199.3:c.130G>AMucopolysaccharidosis type 3A (Sanfilippo syndrome type A) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGSH gene located on chromosomal region 17q25.3. The age of onset is infantile. This disease is characterized by behavioural disorders (hyperkinesia, aggressiveness) and intellectual deterioration, sleep disorders and very mild dysmorphism. The prevalence is >1:70,000 newborn.600,25
SH2D1ALymphoproliferative syndrome, X-linked, type 1NM_002351.4NM_002351.4:c.3G>T, NM_002351.4:c.95G>C, NM_002351.4:c.163C>T, NM_002351.4:c.164G>T, NM_002351.4:c.172C>T, NM_002351.4:c.203C>T, NM_002351.4:c.302C>TX-linked lymphoproliferative disease type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the SH2D1A gene located on chromosomal region Xq25. The age of onset is infantile. This disease is characterized by an inadequate immune response to infection with the Epstein-Barr virus: fulminant infectious mononucleosis, macrophage-activation syndrome or hemophagocytic lymphohistiocytosis (HLH) (see these terms), and/or progressive hypogammaglobulinemia and/or lymphomas. The prevalence is 1:1, 000,000 men.600
SH3TC2Charcot-Marie-Tooth disease, type 4CNM_024577.3NM_024577.3:c.3676-1G>A, NM_024577.3:c.3601C>T, NM_024577.3:c.3341delC, NM_024577.3:c.3326G>C, NM_024577.3:c.3325C>T, NM_024577.3:c.2993_2994insC, NM_024577.3:c.2860C>T, NM_024577.3:c.2829T>G, NM_024577.3:c.2710C>T, NM_024577.3:c.2491_2492delAG, NM_024577.3:c.2191delG, NM_024577.3:c.1982T>C, NM_024577.3:c.1972C>T, NM_024577.3:c.1969G>A, NM_024577.3:c.1747_1748delAG, NM_024577.3:c.1724T>A, NM_024577.3:c.1586G>A, NM_024577.3:c.920G>A, NM_024577.3:c.735G>A, NM_024577.3:c.530-2A>G, NM_024577.3:c.217_227delGCTGCTCGGAGinsCCAGTAA, NM_024577.3:c.53-1G>C, NM_024577.3:c.52+1delG, NM_024577.3:c.28delGCharcot-Marie-Tooth disease, type 4C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SH3TC2 gene located on chromosomal region 5q32. The age of onset is infantile. This disease is characterized by scoliosis or kyphoscoliosis, neuropathy, foot deformities, respiratory insufficiency, hypoacousis and deafness.600,25
SIL1Marinesco-Sjogren syndromeNM_001037633.1NM_001037633.1:c.1312C>T, NM_001037633.1:c.331C>TMarinesco-Sj�gren syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SIL1 gene located on chromosomal region 5q31.2. The age of onset is infantile. This disease is characterized by dysarthria, nystagmus, muscle weakness and hypotonia. The prevalence is <1:1,000,000.600
SIX6Optic disc anomalies with retinal and/or macular dystrophyNM_007374.2NM_007374.2:c.532_536delAACCGOptic disc anomalies with retinal and/or macular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SIX6 gene located on chromosomal region 14q23.1. The age of onset is neonatal. This disease is characterized by optic nerve dysplasia, optic disk anomalies, chorioretinal dystrophy and macular atrophy. Some patients have microphthalmia. The prevalence is <1/1,000,000.600
SLC12A1Bartter syndrome, type 1NM_000338.2NM_000338.2:c.223C>T, NM_000338.2:c.628+2T>C, NM_000338.2:c.814G>T, NM_000338.2:c.1875G>A, NM_000338.2:c.1942G>A, NM_000338.2:c.2805dupA, NM_000338.2:c.2952_2955delCAAABartter syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A1 gene located on chromosomal region 15q15-21. The age of onset is infantile. This disease is characterized by polyhydramnios, premature delivery, polyuria, dehydration, hypercalciuria and nephrocalcinosis. The prevalence is 1:1,000,000.600,25
SLC12A6Agenesis of the corpus callosum with peripheral neuropathyNM_133647.1NM_133647.1:c.3031C>T, NM_133647.1:c.2023C>T, NM_133647.1:c.1584_1585delCTinsG, NM_133647.1:c.619C>T, NM_133647.1:c.366T>G, NM_133647.1:c.316+1G>ACorpus callosum agenesis with neuronopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A6 gene located on chromosomal region 15q13-q14. The age of onset is early. This disease is characterized by a delay in developmental milestones, a severe sensory-motor polyneuropathy with areflexia, a variable degree of agenesis of the corpus callosum, amyotrophy, hypotonia, and cognitive impairment. The prevalence is 1:2,117.600
SLC17A5Salla diseaseNM_012434.4NM_012434.4:c.1259+1G>A, NM_012434.4:c.406A>G, NM_012434.4:c.115C>T, NM_012434.4:c.43G>TSalla disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC17A5 gene located on chromosomal region 6q13. The age of onset is from infantile to adult forms. The main symptoms are hypotonia, cerebellar ataxia, and mental retardation; visceromegaly and coarse features are also present in the infantile cases.600,25
SLC25A13Citrullinemia, adult-onset, type 2NM_001160210.1NM_001160210.1:c.1816C>T, NM_001160210.1:c.1804G>T, NM_001160210.1:c.1804G>A, NM_001160210.1:c.1802dupA, NM_001160210.1:c.1595G>A, NM_001160210.1:c.1414_1415delCT, NM_001160210.1:c.1314+1G>A, NM_001160210.1:c.1234-1G>A, NM_001160210.1:c.1180+1G>A, NM_001160210.1:c.1081C>T, NM_001160210.1:c.852_855delTATG, NM_001160210.1:c.674C>A, NM_001160210.1:c.615+5G>A, NM_001160210.1:c.615+1G>CCitrullinemia, adult-onset, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A13 gene located on chromosomal region 7q21.3. This disease is characterized by hyperammonemia and associated neuropsychiatric symptoms such as nocturnal delirium, confusion, restlessness, disorientation, drowsiness, memory loss, abnormal behavior (aggression, irritability, and hyperactivity), seizures, and coma. The prevalence is 1:17,000-1:230,000.600
SLC25A15Hyperornithinemia-hyperammonemia-homocitrullinemia syndromeNM_014252.3NM_014252.3:c.110T>G, NM_014252.3:c.212T>A, NM_014252.3:c.535C>T, NM_014252.3:c.538G>A, NM_014252.3:c.562_564delTTC, NM_014252.3:c.569G>A, NM_014252.3:c.658G>A, NM_014252.3:c.815C>T, NM_014252.3:c.824G>AHyperornithinemia-hyperammonemia-homocitrullinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A15 gene located on chromosomal region 13q14.11. The age of onset is early. This disease is characterized by coma due to hyperammonemia, convulsions, and hypotonia. The prevalence is 1:5,500.600
SLC25A22Epileptic encephalopathy, early infantile, type 3NM_001191060.1NM_001191060.1:c.706G>T, NM_001191060.1:c.617C>TEarly infantile epileptic encephalopathy, type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A22 gene located on chromosomal region 11p15.5. The age of onset is early. This disease is characterized by the onset of tonic spasms within the first 3 months of life leading to psychomotor impairment and death. The prevalence is <1:1,000,000.600
SLC26A2Achondrogenesis, type 1B (diastrophic dysplasia)NM_000112.3NM_000112.3:c.496G>A, NM_000112.3:c.532C>T, NM_000112.3:c.833delC, NM_000112.3:c.835C>T, NM_000112.3:c.1020_1022delTGT, NM_000112.3:c.1273A>G, NM_000112.3:c.1361A>C, NM_000112.3:c.1535C>A, NM_000112.3:c.1724delA, NM_000112.3:c.1878delG, NM_000112.3:c.1957T>A, NM_000112.3:c.2033G>TAchondrogenesis type 1B (diastrophic dysplasia) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by severe micromelia with very short fingers and toes, a flat face, a short neck, thickened soft tissue around the neck, hypoplasia of the thorax, protuberant abdomen, a hydropic fetal appearance and distinctive histological features of the cartilage. The prevalence is 1:20,000.600,25
SLC26A4Deafness, autosomal recessive, type 4NM_000441.1NM_000441.1:c.269C>T, NM_000441.1:c.281C>T, NM_000441.1:c.412G>T, NM_000441.1:c.554G>C, NM_000441.1:c.563T>C, NM_000441.1:c.626G>T, NM_000441.1:c.707T>C, NM_000441.1:c.916dupG, NM_000441.1:c.918+2T>C, NM_000441.1:c.919-2A>G, NM_000441.1:c.961A>T, NM_000441.1:c.1001G>T, NM_000441.1:c.1001+1G>T, NM_000441.1:c.1003T>C, NM_000441.1:c.1034T>A, NM_000441.1:c.1151A>G, NM_000441.1:c.1174A>T, NM_000441.1:c.1198delT, NM_000441.1:c.1226G>A, NM_000441.1:c.1229C>T, NM_000441.1:c.1246A>C, NM_000441.1:c.1263+1G>A, NM_000441.1:c.1334T>G, NM_000441.1:c.1489G>A, NM_000441.1:c.1707+5G>A, NM_000441.1:c.1975G>C, NM_000441.1:c.2048T>C, NM_000441.1:c.2162C>T, NM_000441.1:c.2168A>GAutosomal recessive nonsyndromic sensorineural deafness type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.600,25
SLC35A1Congenital disorder of glycosylation, type 2fNM_006416.4NM_006416.4:c.277_280delGTGCinsTGCongenital disorder of glycosylation type 2F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35A1 gene located on chromosomal region 6q15. The age of onset is early. This disease is characterized by repeated hemorrhagic incidents, including severe pulmonary hemorrhage.600
SLC35C1Congenital disorder of glycosylation, type 2cNM_018389.4NM_018389.4:c.91G>T, NM_018389.4:c.290dupG, NM_018389.4:c.439C>T, NM_018389.4:c.503_505delTCT, NM_018389.4:c.923C>GCongenital disorder of glycosylation type 2c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35C1 gene located on chromosomal region 11p11.2. The age of onset is infantile. This disease is characterized by recurrent bacterial infections, severe growth delay and severe intellectual deficit.600
SLC35D1Schneckenbecken dysplasiaNM_015139.2NM_015139.2:c.932G>A, NM_015139.2:c.319C>TSchneckenbecken dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35D1 gene located on chromosomal region 1p31.3. The age of onset is fetal. This disease is characterized by nail-like configuration of the hypoplastic iliac bone, flattened hypoplastic vertebral bodies, short ribs, short and wide fibulae, short and broad long bones with a dumbbell-like appearance, and precocious ossification of the tarsus.600
SLC37A4Glycogen storage disease, type 1bNM_001164278.1NM_001164278.1:c.1309C>T, NM_001164278.1:c.1190-2_1190-1delAG, NM_001164278.1:c.1129G>T, NM_001164278.1:c.1108_1109delCT, NM_001164278.1:c.1082G>A, NM_001164278.1:c.1081G>T, NM_001164278.1:c.706_708delGTG, NM_001164278.1:c.352T>C, NM_001164278.1:c.287G>A, NM_001164278.1:c.83G>AGlycogen storage disease due to glucose-6-phosphatase deficiency type 1b follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC37A4 gene located on chromosomal region 11q23. The age of onset is early. This disease is characterized by impairment of terminal steps of glycogenolysis and gluconeogenesis. Patients manifest a wide range of clinical symptoms and biochemical abnormalities, including hypoglycemia, severe hepatomegaly due to excessive accumulation of glycogen, kidney enlargement, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. Glycogen storage disease type 1B patients also present a tendency towards infections associated with neutropenia, relapsing aphthous gingivostomatitis, and inflammatory bowel disease. The incidence is 1:100,000.600,25
SLC45A2Albinism, oculocutaneous, type 4NM_016180.4NM_016180.4:c.1121delT, NM_016180.4:c.986delC, NM_016180.4:c.469G>AOculocutaneous albinism type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC45A2 gene located on chromosomal region 5p13.2. The age of onset is early. This disease is characterized by skin and hair hypopigmentation, numerous ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1:100.000.600
SLC4A11Corneal endothelial dystrophy, autosomal recessiveNM_001174090.1NM_001174090.1:c.2687G>A, NM_001174090.1:c.2686C>T, NM_001174090.1:c.2647A>G, NM_001174090.1:c.2609T>C, NM_001174090.1:c.2345G>A, NM_001174090.1:c.2314_2321dupTATGACAC, NM_001174090.1:c.2305G>A, NM_001174090.1:c.1894C>T, NM_001174090.1:c.1547C>T, NM_001174090.1:c.1544G>A, NM_001174090.1:c.1472G>A, NM_001174090.1:c.1119_1120insA, NM_001174090.1:c.718T>C, NM_001174090.1:c.554_561delGCTTCGCCCongenital hereditary endothelial dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by a diffuse ground-glass appearance of the corneas and marked corneal thickening from birth with nystagmus, and blurred vision.600,25
SLC6A8Cerebral creatine deficiency syndrome, type 1NM_005629.3NM_005629.3:c.321_323delCTT, NM_005629.3:c.395G>T, NM_005629.3:c.1011C>G, NM_005629.3:c.1141G>C, NM_005629.3:c.1222_1224delTTC, NM_005629.3:c.1540C>TCerebral creatine deficiency syndrome type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the SLC6A8 gene located on chromosomal region Xq28. The age of onset is infantile. People with this disorder have intellectual disability, which can range from mild to severe, and delayed speech development. Some affected individuals develop behavioral disorders such as attention deficit hyperactivity disorder or autistic behaviors that affect communication and social interaction. They may also experience seizures. The disorder has been estimated to account for between 1 and 2 percent of males with intellectual disability. Carrier females may show mild neuropsychologic impairment (summary by van de Kamp et al., 2011). The prevalence is 11:1,000.600
SMN1Spinal muscular atrophy-0del ex7, del ex7-8Spinal muscular atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMN1 gene located on chromosomal region 5q13.2. The age of onset is variable. This disease comprise a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. Autosomal recessive forms are classified according to the age of onset, the maximum muscular activity achieved, and survivorship. The severity of the disease is mainly determined by the copy number of SMN2, a copy gene which predominantly produces exon 7-skipped transcripts and only low amount of full-length transcripts that encode for a protein identical to SMN1. Only about 4% of patients bear one SMN1 copy with an intragenic mutation. Type 1 is a severe form, with onset before 6 months of age. Patients never achieve the ability to sit. Type 2 has intermediate severity, with onset between 6 and 18 months. Patients do not reach the motor milestone of standing, and survive into adulthood. Type 3 onset is after 18 months. Patients develop ability to stand and walk and survive into adulthood. Type 4 onset is in adulthood, disease progression is slow, and patients can stand and walk. The incidence is 1:10,000 and the prevalence is 1:80,000.600,25
SMPD1Niemann-Pick disease, type A and type BNM_000543.4NM_000543.4:c.96G>A, NM_000543.4:c.103_107delCTGGT, NM_000543.4:c.106delG, NM_000543.4:c.354delC, NM_000543.4:c.475T>C, NM_000543.4:c.557C>T, NM_000543.4:c.564delC, NM_000543.4:c.564dupC, NM_000543.4:c.573delT, NM_000543.4:c.688C>T, NM_000543.4:c.730G>A, NM_000543.4:c.740delG, NM_000543.4:c.739G>A, NM_000543.4:c.742G>A, NM_000543.4:c.757G>C, NM_000543.4:c.788T>A, NM_000543.4:c.842_849dupTCCCCGCA, NM_000543.4:c.911T>C, NM_000543.4:c.996delC, NM_000543.4:c.1092-1G>C, NM_000543.4:c.1117C>T, NM_000543.4:c.1152G>A, NM_000543.4:c.1264-1G>T, NM_000543.4:c.1267C>T, NM_000543.4:c.1299T>G, NM_000543.4:c.1327C>T, NM_000543.4:c.1420_1421delCT, NM_000543.4:c.1426C>T, NM_000543.4:c.1624C>T, NM_000543.4:c.1630delA, NM_000543.4:c.1805G>A, NM_000543.4:c.1829_1831delGCCNiemann-Pick disease, type A and type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMPD1 gene located on chromosomal region 11p15.4. The clinical phenotype ranges from a severe infantile form with neurologic degeneration resulting in death usually by 3 years of age (type A) to a later-onset nonneurologic form (type B) that is compatible with survival into adulthood. Since intermediate cases also have been reported, the disease is best regarded a single entity with a clinical spectrum.600,25
SNAP29Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndromeNM_004782.3NM_004782.3:c.487dupACerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SNAP29 gene located on chromosomal region 22q11.2. The age of onset is early. This disease is characterized by severe developmental abnormalities of the nervous system and aberrant differentiation of the epidermis. The prevalence is <1:1,000,000.600
SPARTSpactic paraplegia, type 20, autosomal recessiveNM_001142294.1NM_001142294.1:c.1110delA, NM_001142294.1:c.364_365delATSpactic paraplegia, type 20 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPART gene located on chromosomal region 13q13.3. The age of onset is infancy. This disease is characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. SPG20 is characterized by dysarthria, distal amyotrophy, mild developmental delay and short stature. The prevalence is <1/1,000,000.600
SPG11Amyotrophic lateral sclerosis, type 5, juvenileNM_025137.3NM_025137.3:c.7152-1G>C, NM_025137.3:c.6847_6848dupTC, NM_025137.3:c.6805_6806delCT, NM_025137.3:c.6100C>T, NM_025137.3:c.5623C>T, NM_025137.3:c.1736-1G>C, NM_025137.3:c.1339_1342dupGGCT, NM_025137.3:c.733_734delAT, NM_025137.3:c.529_533delATATT, NM_025137.3:c.342delT, NM_025137.3:c.118C>TAmyotrophic lateral sclerosis, type 5, juvenile follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG11 gene located on chromosomal region 15q21.1. The age of onset is infancy/childhood. This disease is characterized by progressive upper and lower motor neuron degeneration causing facial spasticity, dysarthria, and gait disorders with onset before 25 years of age. The prevalence is <1/1,000,000.600,25
SPG7Spastic paraplegia, type 7, autosomal recessiveNM_003119.3NM_003119.3:c.233T>A, NM_003119.3:c.286+1G>T, NM_003119.3:c.679C>T, NM_003119.3:c.758+2T>C, NM_003119.3:c.773_774delTG, NM_003119.3:c.1045G>A, NM_003119.3:c.1124delG, NM_003119.3:c.1529C>T, NM_003119.3:c.1676delA, NM_003119.3:c.1749G>C, NM_003119.3:c.2075G>CSpastic paraplegia type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG7 gene located on chromosomal region 16q24.3. The age of onset is adult. This disease is characterized by by progressive muscle stiffness (spasticity) and the development of paralysis of the lower limbs (paraplegia) due to degeneration of corticospinal axons. The prevalence is 1:100,000-9:100,000.600,25
STARLipoid adrenal hyperplasiaNM_000349.2NM_000349.2:c.772C>T, NM_000349.2:c.749G>A, NM_000349.2:c.577C>T, NM_000349.2:c.562C>T, NM_000349.2:c.559G>A, NM_000349.2:c.545G>T, NM_000349.2:c.545G>ALipoid adrenal hyperplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STAR gene located on chromosomal region 8p11.23. The age of onset is neonatal/infancy. This disease is characterized by a defect in the conversion of cholesterol to pregnenolone, the first step in adrenal and gonadal steroidogenesis. All affected individuals are phenotypic females with a severe salt-losing syndrome that is fatal if not treated in early infancy. The prevalence is unknown.600
STILMicrocephaly, type 7, primary, autosomal recessiveNM_001048166.1NM_001048166.1:c.3846_3849delACAG, NM_001048166.1:c.3718C>T, NM_001048166.1:c.3658delG, NM_001048166.1:c.2829+1G>AMicrocephaly, type 7, primary, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STIL gene located on chromosomal region 1p33. The age of onset is prenatal/neonatal. This disease is characterized by a head circumference more than 3 standard deviations below the age-related mean. Brain weight is markedly reduced and the cerebral cortex is disproportionately small. Despite this marked reduction in size, the gyral pattern is relatively well preserved, with no major abnormality in cortical architecture. Affected individuals are mentally retarded. Primary microcephaly is further defined by the absence of other syndromic features or significant neurological deficits due to degenerative brain disorder. The prevalence is unknown.600
STRA6Microphthalmia, isolated, with coloboma, type 8NM_001199042.1NM_001199042.1:c.2081G>A, NM_001199042.1:c.2080C>T, NM_001199042.1:c.2048C>T, NM_001199042.1:c.1816C>T, NM_001199042.1:c.1795G>C, NM_001199042.1:c.1638-1G>A, NM_001199042.1:c.1027_1028delGGinsAA, NM_001199042.1:c.995C>T, NM_001199042.1:c.644dupG, NM_001199042.1:c.394_395insCC, NM_001199042.1:c.264delC, NM_001199042.1:c.186G>A, NM_001199042.1:c.169_170delTAinsCMicrophthalmia, isolated, with coloboma, type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRA6 gene located on chromosomal region 15q24.1. This disease is characterized by bilateral clinical anophthalmia, pulmonary hypoplasia/aplasia, cardiac malformations, and diaphragmatic defects. The phenotype is variable, ranging from isolated clinical anophthalmia or microphthalmia to complex presentations involving the cardiac, pulmonary, diaphragmatic, and renal systems. At its most severe, infants are born without pulmonary structures and die soon after birth.600
STRCDeafness, autosomal recessive, type 16NM_153700.2NM_153700.2:c.5188C>T, NM_153700.2:c.5185C>T, NM_153700.2:c.5168_5171delTTCT, NM_153700.2:c.4560dupC, NM_153700.2:c.4545+1G>C, NM_153700.2:c.3556C>TAutosomal recessive nonsyndromic sensorineural deafness type DFNB16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRC gene located on chromosomal region 15q15.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.600,25
SUCLG1Mitochondrial DNA depletion syndrome, type 9 (encephalomyopathic, type with methylmalonic aciduria)NM_003849.3NM_003849.3:c.152_153delATMitochondrial DNA depletion syndrome, type 9 (encephalomyopathic, type with methylmalonic aciduria) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SUCLG1 gene located on chromosomal region 2p11.2. The age of onset is early. This disease is characterized by polypnea, severe hypotonia, lethargy, and vomiting, after a silent period during which the children were considered as normal. Facial dysmorphism and cerebral malformations may be noted, as well as diverse organ involvement such as hypertrophic myocardiopathy, tubulopathy, or liver insufficiency.600
SUOXSulfite oxidase deficiencyNM_000456.2NM_000456.2:c.37C>T, NM_000456.2:c.650G>A, NM_000456.2:c.794C>A, NM_000456.2:c.894_895delCTSulfocysteinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SUOX gene located on chromosome 12q13.13. The age of onset is early. This disease is characterized by seizures, reduced muscle tone, psychomotor retardation, lens dislocation.600
TATTyrosinemia, type 2NM_000353.2NM_000353.2:c.1297C>T, NM_000353.2:c.1249C>T, NM_000353.2:c.668C>G, NM_000353.2:c.236-5A>G, NM_000353.2:c.169C>TTyrosinemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TAT gene located on chromosomal region 16q22.1. The age of onset is early. This disease is characterized by hypertyrosinemia with oculocutaneous manifestations and, in some cases, intellectual deficit. The prevalence is 1:100,000-1:120,000 newborn.600
TCAPMuscular dystrophy, limb-girdle, type 2GNM_003673.3NM_003673.3:c.157C>TAutosomal recessive limb-girdle muscular dystrophy type 2G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by muscle weakness in the four limbs, mild scapular winging, severe atrophy of the quadriceps and anterior tibialis muscles, calf hypertrophy, and lack of respiratory and cardiac involvement.600,25
TCIRG1Osteopetrosis, autosomal recessive, type 1NM_006019.3NM_006019.3:c.115_116delGA, NM_006019.3:c.1213G>A, NM_006019.3:c.1331G>T, NM_006019.3:c.1674-1G>A, NM_006019.3:c.2236+1G>AAutosomal recessive osteopetrosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCIRG1 gene located on chromosomal region 11q13.2. The age of onset is early. This disease is characterized by bone marrow failure, fractures and visual impairment. The incidence is 1:200.000 live births and the prevalence is 1:250,000.600,25
TECTADeafness, autosomal recessive, type 21NM_005422.2NM_005422.2:c.651dupC, NM_005422.2:c.2428C>T, NM_005422.2:c.2941+1G>A, NM_005422.2:c.4371_4384dupTCAGTGCGACCCGC, NM_005422.2:c.4601G>AAutosomal recessive nonsyndromic sensorineural deafness type DFNB21 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TECTA gene located on chromosomal region 11q23.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.600
TERTDyskeratosis congenita, autosomal recessive, type 4NM_198253.2NM_198253.2:c.2701C>T, NM_198253.2:c.2431C>TDyskeratosis congenita, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TERT gene located on chromosomal region 5p15.33. The age of onset is early. This disease has a wide phenotypic spectrum and age onset. It usually manifests during childhood with the triad of dysplastic nails, lacy reticular pigmentation and atrophy of the skin at the level of the neck and upper chest, and oral leukoplakia. Patients show an increased risk for progressive bone marrow failure and may develop myelodysplastic syndrome or acute myelogenous leukemia at any age (the risk increasing with age). There is also an increased risk for solid tumors, typically squamous cell carcinoma of head and neck (see this term) or anogenital cancer. Various additional clinical findings have been reported and may include: developmental delay, short stature, microcephaly, blepharitis, epiphora, periodontal disease, taurodontism, decreased teeth/root ratio, esophageal stenosis, liver disease, urethral stenosis, osteoporosis, avascular necrosis of femur and/or humerus, premature hair greying/alopecia, or abnormal eyelashes. Individuals with DC are at high risk of pulmonary fibrosis. The prevalence is 1:1,000,000.600,25
TFR2Hemochromatosis, type 3NM_001206855.1NM_001206855.1:c.2T>AHemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000.600,25
TFR2Hemochromatosis, type 3NM_003227.3NM_003227.3:c.2374G>A, NM_003227.3:c.2343G>A, NM_003227.3:c.2014C>T, NM_003227.3:c.1861_1872delGCCGTGGCCCAG, NM_003227.3:c.1665delC, NM_003227.3:c.1632_1633delGA, NM_003227.3:c.1473+1G>A, NM_003227.3:c.1469T>G, NM_003227.3:c.1330G>A, NM_003227.3:c.1235_1237delACA, NM_003227.3:c.1186C>T, NM_003227.3:c.949C>T, NM_003227.3:c.750C>G, NM_003227.3:c.313C>THemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000.600,25
THSegawa syndrome, recessiveNM_199292.2NM_199292.2:c.1481C>T, NM_199292.2:c.1234C>A, NM_199292.2:c.826A>C, NM_199292.2:c.707T>C, NM_199292.2:c.698G>ASegawa syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TH gene located on chromosomal region 11p15.5. This disease is characterized by dystonia presenting in infancy or early childhood. Dystonia is defined by the presence of sustained involuntary muscle contractions, often leading to abnormal postures. Some cases present with parkinsonian symptoms in infancy. Unlike all other forms of dystonia, it is an eminently treatable condition, due to a favorable response to L-DOPA. The prevalence is 1:1,000,000-9:1,000,000.600
TIMM8AMohr-Tranebjaerg syndromeNM_004085.3NM_004085.3:c.238C>T, NM_004085.3:c.198C>G, NM_004085.3:c.112C>TMohr-Tranebjaerg syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the TIMM8A gene located on chromosomal region Xq22. The age of onset is infantile. This disease is characterized by hearing loss, followed by adolescent onset progressive dystonia or ataxia, visual impairment from early adulthood onwards and dementia from the 4th decade onwards. The prevalence is <1:1,000,000.600
TK2Mitochondrial DNA depletion syndrome , type 2 (myopathic type)NM_004614.4NM_004614.4:c.635T>A, NM_004614.4:c.604_606delAAG, NM_004614.4:c.500G>A, NM_004614.4:c.373C>T, NM_004614.4:c.361C>A, NM_004614.4:c.323C>T, NM_004614.4:c.268C>T, NM_004614.4:c.159C>GMitochondrial DNA depletion syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TK2 gene located on chromosomal region 16q21. The age of onset is infantile. This disease is characterized by generalized hypotonia, proximal muscle weakness, loss of previously acquired motor skills, poor feeding, and respiratory difficulties leading to respiratory failure and death within a few years after diagnosis. The prevalence is 1.2:100,000.600,25
TMC1Deafness, autosomal recessive, type 7NM_138691.2NM_138691.2:c.100C>T, NM_138691.2:c.425G>A, NM_138691.2:c.454-1G>C, NM_138691.2:c.1165C>T, NM_138691.2:c.1763+3A>G, NM_138691.2:c.1842G>A, NM_138691.2:c.1960A>GAutosomal recessive nonsyndromic sensorineural deafness type DFNB7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMC1 gene located on chromosomal region 9q21.13. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.600
TMEM216Joubert syndrome, type 2; Meckel syndrome, type 2NM_001173991.2NM_001173991.2:c.79_82delAACG, NM_001173991.2:c.218G>A, NM_001173991.2:c.218G>T, NM_001173991.2:c.230G>C, NM_001173991.2:c.253C>T, NM_001173991.2:c.341T>GJoubert syndrome (JBTS) type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM216 gene located on chromosomal region 11q12.2. The age of onset is early. JBTS is characterized by congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. The TMEM216 gene is also associated with other ciliopathies, as Meckel syndrome type 2, a rare, autosomal recessive lethal condition characterized by central nervous system malformations, postaxial, polydactyly, multicystic kidney dysplasia, and ductal proliferation in the portal area of the liver.600
TMEM67Joubert syndrome, type 6; Meckel syndrome, type 3; COACH syndromeNM_153704.5NM_153704.5:c.130C>T, NM_153704.5:c.148_149insTAAT, NM_153704.5:c.622A>T, NM_153704.5:c.755T>C, NM_153704.5:c.1046T>C, NM_153704.5:c.1538A>G, NM_153704.5:c.1769T>C, NM_153704.5:c.2498T>CJoubert syndrome (JBTS) type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22.1. The age of onset is early. JBTS is characterized by congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. The TMEM67 gene is also associated with Meckel syndrome type 3, a rare, autosomal recessive lethal condition characterized by central nervous system malformations, postaxial, polydactyly, multicystic kidney dysplasia, and ductal proliferation in the portal area of the liver. Other phenotype associated with mutations in the TMEM67 gene is COACH syndrome, an autosomal recessive disorder characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable. COACH syndrome is considered by some to be a subtype of Joubert syndrome with congenital hepatic fibrosis.600,25
TMIEDeafness, autosomal recessive, type 6NM_147196.2NM_147196.2:c.170G>A, NM_147196.2:c.241C>T, NM_147196.2:c.250C>TAutosomal recessive nonsyndromic sensorineural deafness type DFNB6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMIE gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness.600
TMPRSS3Deafness, autosomal recessive, type 8/10NM_024022.2NM_024022.2:c.1276G>A, NM_024022.2:c.1211C>T, NM_024022.2:c.753G>C, NM_024022.2:c.647G>T, NM_024022.2:c.446+1G>T, NM_024022.2:c.413C>A, NM_024022.2:c.242C>G, NM_024022.2:c.208delCAutosomal recessive nonsyndromic sensorineural deafness type DFNB10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMPRSS3 gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness.600,25
TNNT1Nemaline myopathy , type 5, Amish typeNM_003283.5NM_003283.5:c.538G>TNemaline myopathy 5, Amish type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TNNT1 gene located on chromosomal region 19q13.4. The age of onset is from birth to adulthood. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:50,000 newborn.600
TPP1Ceroid lipofuscinosis, neuronal, type 2NM_000391.3NM_000391.3:c.1340G>A, NM_000391.3:c.1093T>C, NM_000391.3:c.851G>T, NM_000391.3:c.827A>T, NM_000391.3:c.622C>T, NM_000391.3:c.616C>T, NM_000391.3:c.509-1G>C, NM_000391.3:c.141_144delGAGTNeuronal ceroid lipofuscinosis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPP1 gene located on chromosomal region 11p15.4. Age of onset is infantile. This disease is characterized by epilepsy, followed by regression of developmental milestones, myoclonic ataxia, and pyramidal signs. Visual impairment typically appears at age four to six years and rapidly progresses to light/dark awareness only. Life expectancy ranges from age six years to early teenage. The prevalence is 1.5:1,000,000-9:1,000,000.600,25
TPRNDeafness, autosomal recessive, type 79NM_001128228.2NM_001128228.2:c.1427delC, NM_001128228.2:c.1239G>AAutosomal recessive nonsyndromic sensorineural deafness type DFNB79 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPRN gene located on chromosomal region 9q34.3. The age of onset is early. This disease is characterized by hearing loss and deafness.600
TREX1Aicardi-Goutieres syndrome, type 1NM_016381.5NM_016381.5:c.309dupC, NM_016381.5:c.506G>A, NM_016381.5:c.655C>TAicardi-Gouti�res syndrome 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TREX1 gene located on chromosomal region 3p21.31. The age of onset is early. This disease is characterized by subacute encephalopathy (feeding problems, irritability and psychomotor regression or delay) associated with epilepsy (53% of cases), chilblain skin lesions on the extremities (43% of cases) and episodes of aseptic febrile illness (40% of cases). The prevalence is <1:1,000,000.600
TRIM32Muscular dystrophy, limb-girdle, type 2HNM_001099679.1NM_001099679.1:c.1459G>A, NM_001099679.1:c.1560delCAutosomal recessive limb-girdle muscular dystrophy type 2H follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIM32 gene located on chromosomal region 9q31-q33. The age of onset is variable. This disease is characterized by proximal muscle weakness and facial muscle wasting.600
TRIM37Mulibrey nanismNM_001005207.3NM_001005207.3:c.2212delG, NM_001005207.3:c.2056C>T, NM_001005207.3:c.1668-1G>C, NM_001005207.3:c.1478_1479delAG, NM_001005207.3:c.1411C>T, NM_001005207.3:c.1346dupA, NM_001005207.3:c.1037_1040dupAGAT, NM_001005207.3:c.965G>T, NM_001005207.3:c.745C>T, NM_001005207.3:c.496_500delAGGAA, NM_001005207.3:c.326G>C, NM_001005207.3:c.227T>CMulibrey nanism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIM37 gene located on chromosomal region 17q22. The age of onset is prenatal. This disease is characterized by pre- and postnatal growth restriction, characteristic craniofacial features with scaphocephaly, triangular face, high and broad forehead, low nasal bridge and yellowish dots in retinal mid peripheral region. The prevalence is <1:1,000,000.600
TRIOBPDeafness, autosomal recessive, type 28NM_001039141.2NM_001039141.2:c.1039C>T, NM_001039141.2:c.1741C>T, NM_001039141.2:c.2362C>T, NM_001039141.2:c.2639_2640insTCAC, NM_001039141.2:c.3195delT, NM_001039141.2:c.3202C>T, NM_001039141.2:c.4436dupG, NM_001039141.2:c.4577C>G, NM_001039141.2:c.5316G>ADeafness autosomal recessive type 28 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIOBP gene located on chromosomal region 22q13.1. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.600,25
TSEN54Pontocerebellar hypoplasia, type 2ANM_207346.2NM_207346.2:c.670_671delAA, NM_207346.2:c.736C>T, NM_207346.2:c.887G>A, NM_207346.2:c.919G>T, NM_207346.2:c.1027C>T, NM_207346.2:c.1039A>TPontocerebellar hypoplasia type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSEN54 gene located on chromosomal region 17q25.1. Pontocerebellar hypoplasia (PCH) refers to a group of severe neurodegenerative disorders affecting growth and function of the brainstem and cerebellum, resulting in little or no development. Different types were classified based on the clinical picture and the spectrum of pathologic changes.ﾠ600,25
TSFMCombined oxidative phosphorylation deficiency, type 3NM_001172696.1NM_001172696.1:c.1_2delAT, NM_001172696.1:c.24_25delCG, NM_001172696.1:c.581delC, NM_001172696.1:c.919C>TCombined oxidative phosphorylation deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSFM gene located on chromosomal region 12q14.1. The age of onset is early. This disease is characterized by hypotonia, lactic acidosis, and hepatic insufficiency, with progressive encephalomyopathy or hypertrophic cardiomyopathy.600,25
TSHBHypothyroidism, congenital, nongoitrous, type 4NM_000549.4NM_000549.4:c.94G>T, NM_000549.4:c.145G>A, NM_000549.4:c.205C>THypothyroidism, congenital, nongoitrous 4, also known as isolated thyroid-stimulating hormone (TSH) deficiency is a type of central congenital hypothyroidism, a permanent thyroid deficiency that is present from birth, characterized by low levels of thyroid hormones due to a deficiency in TSH synthesis.600
TSHRHypothyroidism, congenital, nongoitrous, type 1NM_000369.2NM_000369.2:c.122G>C, NM_000369.2:c.202C>T, NM_000369.2:c.326G>A, NM_000369.2:c.484C>G, NM_000369.2:c.500T>A, NM_000369.2:c.1170T>G, NM_000369.2:c.1742dupCHypothyroidism, congenital, nongoitrous, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSHR gene located on chromosomal region 14q31.1. This disease is characterized by increased levels of plasma TSH and low levels of thyroid hormone. Only a subset of patients develop frank hypothyroidism; the remainder are euthyroid and asymptomatic. 600,25
TTNLimb-girdle muscular dystrophy type 10 (LGMDR10; formerly LGMD2J); Early-onset myopathy with fatal cardiomyopathy NM_001267550.2NM_001267550.2:c.107889delA, NM_001267550.2:c.106070_106071delAT, NM_001267550.2:c.104092delC, NM_001267550.2:c.104092C>T, NM_001267550.2:c.98818_98821delTCCA, NM_001267550.2:c.92373_92379delTGAATTC, NM_001267550.2:c.69344C>G, NM_001267550.2:c.60681dupT, NM_001267550.2:c.56648-1G>A, NM_001267550.2:c.52372delG, NM_001267550.2:c.48253delA, NM_001267550.2:c.47915dupT, NM_001267550.2:c.32471-1G>A, NM_001267550.2:c.28300_28303delAGCA, NM_001267550.2:c.16881C>A, NM_001267550.2:c.15796C>T, NM_001267550.2:c.3165-1G>TLGMDR10 is a severe recessive form of LGMD phenotype with onset in the first to third decades involving weakness of all proximal muscles. Severe disability with loss of ambulation may occur within 20 years (third to sixth decades). Most of the cases are without facial muscle involvement or cardiomyopathy. Some patients later developed distal muscle involvement. Early-onset myopathy with fatal cardiomyopathy (EOMFC), known as Salih myopathy, also follows an autosomal recessive pattern of inheritance. This disease is characterized by skeletal muscle weakness and a form of heart disease called dilated cardiomyopathy. Affected individuals have delayed development of motor skills, such as sitting, standing, and walking. The age of onset is neonatal/infancy. LGMDR10 and EOMFC are caused by pathogenic variants in the TTN gene located on chromosomal region 2q31.2.600,25
TTPAAtaxia with isolated vitamin E deficiencyNM_000370.3NM_000370.3:c.744delA, NM_000370.3:c.661C>T, NM_000370.3:c.575G>AAtaxia with vitamin E deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTPA gene located on chromosomal region 8q13. The age of onset is variable. This disease is characterized by progressive spino-cerebellar ataxia, loss of proprioception, areflexia, and is associated with a marked deficiency in vitamin E. The prevalence is 0.56:1,000,000-3.5:1,000,000.600,25
TULP1Leber congenital amaurosis, type 15NM_003322.4NM_003322.4:c.1511_1521delTGCAGTTCGGC, NM_003322.4:c.1471T>C, NM_003322.4:c.1444C>T, NM_003322.4:c.1376T>A, NM_003322.4:c.1318C>T, NM_003322.4:c.1259G>C, NM_003322.4:c.1204G>T, NM_003322.4:c.1198C>TLeber congenital amaurosis 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TULP1 gene located on chromosomal region 6p21.31. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.600
TWNKMitochondrial DNA depletion syndrome, type 7 (hepatocerebral type); Perrault syndrome type 5NM_021830.4NM_021830.4:c.526dupG, NM_021830.4:c.952G>A, NM_021830.4:c.955A>G, NM_021830.4:c.1287C>T, NM_021830.4:c.1370C>T, NM_021830.4:c.1523A>GMitochondrial DNA depletion syndrome, hepatocerebrorenal form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TWNK gene located on chromosomal region 10q24. The age of onset is neonatal/infantile. It is a severe disease associated with mitochondrial dysfunction. Some patients are affected by progressive atrophy of the cerebellum, brain stem, the spinal cord, and sensory axonal neuropathy. Clinical features include hypotonia, athetosis, ataxia, ophthalmoplegia, sensorineural hearing deficit, sensory axonal neuropathy, epileptic encephalopathy and female hypogonadism. In some individuals liver dysfunction and multi-organ failure is present. On the other hand, Perrault syndrome is a rare condition that causes different patterns of signs and symptoms in affected males and females. A key feature of this condition is hearing loss, which occurs in both males and females. Affected females also have abnormalities of the ovaries. Neurological problems occur in some affected males and females.600
TYRAlbinism, oculocutaneous, type 1ANM_000372.4NM_000372.4:c.1A>G, NM_000372.4:c.140G>A, NM_000372.4:c.164G>A, NM_000372.4:c.230G>A, NM_000372.4:c.242C>T, NM_000372.4:c.265T>C, NM_000372.4:c.272G>A, NM_000372.4:c.286dupA, NM_000372.4:c.325G>A, NM_000372.4:c.533G>A, NM_000372.4:c.572delG, NM_000372.4:c.616G>A, NM_000372.4:c.646T>A, NM_000372.4:c.650G>A, NM_000372.4:c.823G>T, NM_000372.4:c.896G>A, NM_000372.4:c.1012_1013insC, NM_000372.4:c.1111A>G, NM_000372.4:c.1118C>A, NM_000372.4:c.1146C>A, NM_000372.4:c.1147G>A, NM_000372.4:c.1164delT, NM_000372.4:c.1177delG, NM_000372.4:c.1209G>T, NM_000372.4:c.1217C>T, NM_000372.4:c.1255G>A, NM_000372.4:c.1265G>A, NM_000372.4:c.1336G>A, NM_000372.4:c.1342G>A, NM_000372.4:c.1467dupT, NM_000372.4:c.1501dupCOculocutaneous albinism type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYR gene located on chromosomal region 11q14.2. The age of onset is early. This disease is characterized by white hair and skin, blue, fully translucent irises, nystagmus and misrouting of the optic nerves.600,25
TYRP1Albinism, oculocutaneous, type 3NM_000550.2NM_000550.2:c.107delT, NM_000550.2:c.176C>G, NM_000550.2:c.497C>G, NM_000550.2:c.1057_1060delAACA, NM_000550.2:c.1067G>A, NM_000550.2:c.1103delA, NM_000550.2:c.1120C>T, NM_000550.2:c.1372_1375dupGACAType 3 oculocutaneous albinism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYRP1 gene located on chromosomal region 9p23. The age of onset is early. This disease is characterized by rufous or brown albinism and occurring mainly in the African population. The prevalence is of 1/8,500 individuals in Africa.600,25
UBR1Johanson-Blizzard syndromeNM_174916.2NM_174916.2:c.4254G>A, NM_174916.2:c.1537C>T, NM_174916.2:c.1281+1G>T, NM_174916.2:c.869C>GJohanson-Blizzard syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UBR1 gene located on chromosomal region 15q15.2. The age of onset is early. This disease is characterized by congenital exocrine pancreatic insufficiency and aplasia/hypoplasia of alae nasi, together with a variety of other abnormalities including aplasia cutis, anorectal anomalies and failure to thrive. The prevalence is <1:1,000,000.600
UGT1A1Crigler-Najjar syndrome, type 2NM_000463.2NM_000463.2:c.44T>G, NM_000463.2:c.1021C>T, NM_000463.2:c.1070A>G, NM_000463.2:c.1456T>GCrigler-Najjar syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by unconjugated hyperbilirubinemia due to reduced and inducible activity of hepatic bilirubin glucuronosyltransferase with pigmented bile that contains bilirubin glucuronides, and generally do not present neurologic or intellectual impairment. Bilirubin encephalopathy may develop in later life when patients experience a superimposed infection or stress.600,25
UQCRQMitochondrial complex III deficiency, nuclear, type 4NM_014402.4NM_014402.4:c.134C>TMitochondrial complex III deficiency, nuclear type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UQCRQ gene located on chromosomal region 5q31.1. The age of onset is infantile. This disease is characterized by severe psychomotor retardation and extrapyramidal signs. Neurologic features included dystonia, athetoid movements, ataxia, mild axial hypotonia, increased tone, hyperreflexia, and inability to walk unsupported.600
USH1CUsher syndrome, type 1C; Deafness, autosomal recessive, type 18ANM_153676.3NM_153676.3:c.2688_2695dupAATTCACC, NM_153676.3:c.2622_2623delCA, NM_153676.3:c.2547-1G>T, NM_153676.3:c.238dupC, NM_153676.3:c.238delC, NM_153676.3:c.216G>AUsher syndrome type 1C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1C gene located on chromosomal region 11p15.1. This disease is characterized by the association of sensorineural deafness (usually congenital, severe and stable), progressive vision loss caused by retinitis pigmentosa apparent in childhood and balance problems. The prevalence is 4.4:100,000. The USH1C gene is also associated with autosomal recessive nonsyndromic sensorineural deafness type 18A. This phenotype is characterized by profound, prelingual, nonsyndromic sensorineural deafness with normal vestibular and visual function.600,25
USH1GUsher syndrome, type 1GNM_173477.4NM_173477.4:c.805C>T, NM_173477.4:c.649C>T, NM_173477.4:c.394dupG, NM_173477.4:c.186_187delCAUsher syndrome type 1G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1G gene located on chromosomal region 17q25.1. This disease is characterized by the association of sensorineural deafness (usually congenital, severe and stable), progressive vision loss caused by retinitis pigmentosa apparent in childhood and balance problems. The prevalence is 4.4:100,000.600
USH2AUsher syndrome, type 2ANM_206933.2NM_206933.2:c.15520-1G>A, NM_206933.2:c.15371delT, NM_206933.2:c.15089C>A, NM_206933.2:c.14803C>T, NM_206933.2:c.14442C>A, NM_206933.2:c.13709delG, NM_206933.2:c.12574C>T, NM_206933.2:c.12234_12235delGA, NM_206933.2:c.11864G>A, NM_206933.2:c.10636G>A, NM_206933.2:c.10561T>C, NM_206933.2:c.10073G>A, NM_206933.2:c.9799T>C, NM_206933.2:c.8981G>A, NM_206933.2:c.7364G>A, NM_206933.2:c.6862G>T, NM_206933.2:c.5743_5744delAG, NM_206933.2:c.5573-2A>G, NM_206933.2:c.4338_4339delCT, NM_206933.2:c.3491_3492delCT, NM_206933.2:c.2898delG, NM_206933.2:c.2299delG, NM_206933.2:c.2276G>T, NM_206933.2:c.2167+5G>A, NM_206933.2:c.2135delC, NM_206933.2:c.920_923dupGCCA, NM_206933.2:c.820C>T, NM_206933.2:c.779T>GUsher syndrome type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. This disease is characterized by the association of sensorineural deafness (usually congenital, moderate/severe and stable) and progressive vision loss that begins in adolescence or adulthood caused by retinitis pigmentosa. Unlike the other forms of Usher syndrome, type 2 is not associated with vestibular abnormalities that cause difficulties with balance. USH2A accounts for more than half of all cases of Usher syndrome type 2. The estimated prevalence is 3:100,000-4:100,000.600,25
VDRRickets, vitamin D-resistant, type 2ANM_001017536.1NM_001017536.1:c.1135G>A, NM_001017536.1:c.1065C>G, NM_001017536.1:c.1035C>A, NM_001017536.1:c.971G>T, NM_001017536.1:c.389G>A, NM_001017536.1:c.299G>A, NM_001017536.1:c.287G>A, NM_001017536.1:c.238C>TVitamin D-dependent rickets type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VDR gene located on chromosomal region 12q13.11. The age of onset is early. This disease is characterized by hypocalcemia, severe rickets and in many cases alopecia. The prevalence is 1:10,000-5:10,000.600
VLDLRCerebellar hypoplasia and mental retardation with or without quadrupedal locomotion, type 1NM_003383.4NM_003383.4:c.769C>T, NM_003383.4:c.844C>T, NM_003383.4:c.2302_2303delGA, NM_003383.4:c.2339delTCerebellar hypoplasia and mental retardation with or without quadrupedal locomotion, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VLDLR gene located on chromosomal region 9p24.2. The age of onset is early. This disease is characterized by non-progressive congenital ataxia that is predominantly truncal and results in delayed ambulation, moderate-to-profound intellectual disability, dysarthria, strabismus, and seizures. The prevalence is 1:100,000-9:100,000.600
VPS13AChoreoacanthocytosisNM_033305.2NM_033305.2:c.622C>T, NM_033305.2:c.2898T>G, NM_033305.2:c.3091delG, NM_033305.2:c.9109C>T, NM_033305.2:c.9275+1G>TChorea-acanthocytosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VPS13A gene located on chromosomal region 9q21. The age of onset is adult. This disease is characterized by progressive neurological symptoms including movement disorders, psychiatric manifestations and cognitive disturbances.600
VPS33BArthrogryposis, renal dysfunction and cholestasis, type 1NM_018668.4NM_018668.4:c.1594C>T, NM_018668.4:c.1480-1G>T, NM_018668.4:c.1312C>T, NM_018668.4:c.1246C>T, NM_018668.4:c.603+2T>A, NM_018668.4:c.440_449delCTCTTGATGTArthrogryposis, renal dysfunction and cholestasis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VPS33B gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by neurogenic arthrogryposis multiplex congenita, renal tubular dysfunction and neonatal cholestasis. The prevalence is <1:1,000,000.600
WASWiskott-Aldrich syndrome; Thrombocytopenia, X-linkedNM_000377.2NM_000377.2:c.134C>T, NM_000377.2:c.167C>T, NM_000377.2:c.173C>G, NM_000377.2:c.809T>C, NM_000377.2:c.814T>C, NM_000377.2:c.881T>C, NM_000377.2:c.1442T>AWiskott-Aldrich syndrome (WAS) is an X-linked recessive primary immunodeficiency disease characterized by microthrombocytopenia, eczema, recurrent infections and an increased risk for autoinmmune manifestations and malignancies. WAS usually manifests in infancy but onset may also occur during the neonatal period. The incidence of WAS has been estimated at less than 1 in 100,000 live births. Thrombocytopaenia is defined by a decrease in the number of platelets in circulating blood, resulting in the potential for increased bleeding and decreased ability for clotting. Both conditions follow an X-linked pattern of inheritance and are caused by pathogenic variants in the WAS gene located on chromosomal region Xp11.23.600
WDR62Microcephaly, type 2, primary, autosomal recessive, with or without cortical malformationsNM_001083961.1NM_001083961.1:c.193G>A, NM_001083961.1:c.557G>A, NM_001083961.1:c.671G>C, NM_001083961.1:c.702dupG, NM_001083961.1:c.1313G>A, NM_001083961.1:c.1408C>T, NM_001083961.1:c.3514+1delG, NM_001083961.1:c.3574delAAutosomal recessive primary microcephalyc type 2 with or without cortical malformations follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WDR62 gene located on chromosomal region 19q13.12. The age of onset is early. This disease is characterized by reduced head circumference at birth without gross anomalies of brain architecture and variable degrees of intellectual impairment. The incidence is 1:1,000,000.600
WFS1Wolfram syndrome, type 1NM_001145853.1NM_001145853.1:c.616C>T, NM_001145853.1:c.676C>T, NM_001145853.1:c.1060_1062delTTC, NM_001145853.1:c.1230_1233delCTCT, NM_001145853.1:c.1234_1237delGTCT, NM_001145853.1:c.1511C>T, NM_001145853.1:c.1943G>A, NM_001145853.1:c.1944G>A, NM_001145853.1:c.2084G>T, NM_001145853.1:c.2643_2644delCTWolfram syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WFS1 gene located on chromosomal region 4p16.1. The age of onset is infantile. This disease is characterized by diabetes mellitus type I, diabetes insipidus, optical atrophy and neurological signs. The prevalence is 1:1,000,000-9:1,000,000.600,25
WHRNUsher syndrome, type 2D; Deafness, autosomal recessive, type 31NM_015404.3NM_015404.3:c.817C>TUsher syndrome type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WHRN gene located on chromosomal region 9q32. This disease is characterized by the association of sensorineural deafness (usually congenital, moderate/severe and stable) and progressive vision loss that begins in adolescence or adulthood caused by retinitis pigmentosa. Unlike the other forms of Usher syndrome, type 2 is not associated with vestibular abnormalities that cause difficulties with balance. The WHRN gene is also associated with autosomal recessive nonsyndromic sensorineural deafness type 31. This phenotype is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.ﾠ600,25
WNT10AOdontoonychodermal dysplasiaNM_025216.2NM_025216.2:c.321C>A, NM_025216.2:c.383G>A, NM_025216.2:c.697G>TOdonto-onycho-dermal dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by hyperkeratosis and hyperhidrosis of the palms and soles, atrophic malar patches, hypodontia, conical teeth, onychodysplasia, and dry and sparse hair. The prevalence is <1:1,000,000.600,25
WNT7AFuhrmann syndromeNM_004625.3NM_004625.3:c.874C>T, NM_004625.3:c.325G>AFuhrmann syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT7A gene located on chromosomal region 3p25.1. The age of onset is neonatal/infancy. This disease is characterized by bowing of the femora, aplasia or hypoplasia of the fibulae and poly-, oligo-, and syndactyly. Most of the patients also have a hypoplastic pelvis and hypoplasia of the fingers and fingernails. Some had congenital dislocation of the hip, absence or fusion of tarsal bones, absence of various metatarsals, and hypoplasia and aplasia of the toes. The prevalence is <1:1,000,000.600
XPAXeroderma pigmentosum, group ANM_000380.3NM_000380.3:c.727C>T, NM_000380.3:c.619C>T, NM_000380.3:c.501delG, NM_000380.3:c.348T>AXeroderma pigmentosum complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the gene XPA located on chromosomal region 9q22.33. The age of onset is variable. This disease is characterized by photosensitivity of skin with burning, freckling, and skin cancers. It is associated with a spectrum of mild to severe neurological anomalies (e.g. cognitive deterioration, dysarthria, balance disturbance, areflexia) and sometimes delay of growth and sexual development. The prevalence is 1:1,000,000.600
ZFYVE26Spastic paraplegia, type 15, autosomal recessiveNM_015346.3NM_015346.3:c.5485-1G>A, NM_015346.3:c.5422C>T, NM_015346.3:c.4936C>T, NM_015346.3:c.4312C>T, NM_015346.3:c.3642_3643insCCACACTTAG, NM_015346.3:c.3206G>A, NM_015346.3:c.3182delT, NM_015346.3:c.2114dupC, NM_015346.3:c.1477C>TSpastic paraplegia type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZFYVE26 gene located on chromosomal region 14q24.1. The age of onset is infancy. This disease is characterized by progressive spasticity primarily affecting the lower limbs. It is a complex form of spastic paraplegia, associated with other neurologic dysfunction, including variable mental retardation, hearing and visual defects, and thin corpus callosum. The prevalence is <1 / 1,000,000.600,25
ZMPSTE24Mandibuloacral dysplasia with, type B lipodystrophyNM_005857.4NM_005857.4:c.54dupT, NM_005857.4:c.121C>T, NM_005857.4:c.955-1G>A, NM_005857.4:c.1018T>C, NM_005857.4:c.1085dupT, NM_005857.4:c.1263dupT, NM_005857.4:c.1349G>AMandibuloacral dysplasia with type B lipodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZMPSTE24 gene located on chromosomal region 1p34.2. The age of onset is early. This disease is characterized by postnatal growth retardation, craniofacial anomalies and skeletal malformations, such as mandibular and clavicular hypoplasia; mottled cutaneous pigmentation and generalized lipoatrophy.600
ZNF469Brittle cornea syndrome, type 1NM_001127464.2NM_001127464.2:c.4174G>TBrittle cornea syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZNF469 gene located on chromosomal region 16q24.2. The age of onset is infantile. This disease is characterized by severe ocular manifestations due to extreme corneal thinning and fragility with rupture in the absence of significant trauma. BCS generally progresses to blindness. The prevalence is <1:1,000,000.600
  • CGT 250 v1
  • CGT 250 v2
GeneDiseaseTranscriptMutationsDisease.descriptionproducts
ABCA4Cone-rod dystrophy type 3NM_000350.2NM_000350.2:c.3540_3555delGTCTAAGGGTTTCTCC, NM_000350.2:c.2616_2617delCT, NM_000350.2:c.4793C>A, NM_000350.2:c.6179T>G, NM_000350.2:c.1222C>T, NM_000350.2:c.763C>TCone rod dystrophy type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness. The prevalence is 1:100,000-9100,000.250,600
ABCA4Retinitis pigmentosa type 19NM_000350.2NM_000350.2:c.1848delARetinitis pigmentosa type 19 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.250,600
ABCA4Stargardt disease type 1NM_000350.2NM_000350.2:c.1018T>G, NM_000350.2:c.4457C>T, NM_000350.2:c.1225delA, NM_000350.2:c.1622T>C, NM_000350.2:c.1715G>A, NM_000350.2:c.1755delA, NM_000350.2:c.1771delT, NM_000350.2:c.1804C>T, NM_000350.2:c.6449G>A, NM_000350.2:c.1938-1G>A, NM_000350.2:c.1964T>G, NM_000350.2:c.2160+1G>T, NM_000350.2:c.2588G>C, NM_000350.2:c.4469G>A, NM_000350.2:c.2690C>T, NM_000350.2:c.2791G>A, NM_000350.2:c.286A>G, NM_000350.2:c.2971G>C, NM_000350.2:c.3083C>T, NM_000350.2:c.3106G>A, NM_000350.2:c.3210_3211dupGT, NM_000350.2:c.3364G>A, NM_000350.2:c.6320G>A, NM_000350.2:c.3970delG, NM_000350.2:c.4139C>T, NM_000350.2:c.4429C>T, NM_000350.2:c.2300T>A, NM_000350.2:c.3322C>T, NM_000350.2:c.52C>T, NM_000350.2:c.5512delC, NM_000350.2:c.5819T>C, NM_000350.2:c.5881G>A, NM_000350.2:c.5882G>A, NM_000350.2:c.5912T>G, NM_000350.2:c.634C>T, NM_000350.2:c.5714+5G>A, NM_000350.2:c.6394G>T, NM_000350.2:c.67-2A>G, NM_000350.2:c.5461-10T>C, NM_000350.2:c.6089G>A, NM_000350.2:c.6118C>T, NM_000350.2:c.6148G>C, NM_000350.2:c.661G>A, NM_000350.2:c.5338C>GStargardt disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by progressive central vision loss, mild loss of color vision, delayed dark adaptation and macular atrophy with or without paramacular flecks and degeneration of the underlying retinal pigment ephitelium. The prevalence is 1:10,000- 5:10,000.250,600
ACAD9Acyl-CoA dehydrogenase type 9 deficiencyNM_014049.4NM_014049.4:c.1240C>T, NM_014049.4:c.1249C>T, NM_014049.4:c.130T>A, NM_014049.4:c.1594C>T, NM_014049.4:c.23delT, NM_014049.4:c.358delT, NM_014049.4:c.797G>A, NM_014049.4:c.976G>C, NM_014049.4:c.453+1G>AAcyl-CoA dehydrogenase type 9 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAD9 gene located on chromosomal region 3q21.3. The age of onset is neonatal/infantile. This disease is characterized by failure to thrive, hypertrophic cardiomyopathy, exercise intolerance and mild to severe neurological dysfunction.250,600
ACADMAcyl-CoA dehydrogenase deficiency, medium-chainNM_000016.5NM_000016.5:c.1102_1105delTTAG, NM_000016.5:c.1232_1233delAA, NM_000016.5:c.287-2A>G, NM_000016.5:c.362C>T, NM_000016.5:c.447G>A, NM_000016.5:c.447G>T, NM_000016.5:c.449_452delCTGA, NM_000016.5:c.616C>T, NM_000016.5:c.617G>A, NM_000016.5:c.683C>A, NM_000016.5:c.797A>G, NM_000016.5:c.799G>A, NM_000016.5:c.815_827delTTGCAATGGGAGC, NM_000016.5:c.890A>G, NM_000016.5:c.984delG, NM_000016.5:c.985A>G, NM_000016.5:c.127G>A, NM_000016.5:c.734C>T, NM_000016.5:c.250C>TMedium chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADM gene located on chromosomal region 1p31. The age of onset is neonatal/infantile. This disease is characterized by a rapidly progressive metabolic crisis, often presenting as hypoketotic hypoglycemia, lethargy, vomiting, seizures and coma. The prevalence is 1:4,900-1:27,000 in Caucasian populations and 1:14,600 in worldwide populations.250,600
ACADSAcyl-CoA dehydrogenase deficiency, short-chainNM_000017.2NM_000017.2:c.1095G>T, NM_000017.2:c.1108A>G, NM_000017.2:c.1147C>T, NM_000017.2:c.136C>T, NM_000017.2:c.319C>T, NM_000017.2:c.417G>C, NM_000017.2:c.529T>C, NM_000017.2:c.561_568delCAATGCCT, NM_000017.2:c.826G>A, NM_000017.2:c.314T>AShort chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADS gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by seizures, developmental delay, failure to grow with poor feeding, and usually muscle weakness and hypotonia. The prevalence is <1:50,000.250,600
ACADSB2-Methylbutyryl-CoA dehydrogenase deficiencyNM_001609.3NM_001609.3:c.1159G>A, NM_001609.3:c.443C>T, NM_001609.3:c.763C>T, NM_001609.3:c.621G>A, NM_001609.3:c.303+1G>A2-Methylbutyryl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADSB gene located on chromosomal region 10q26.3. The age of onset is neonatal/infantile. This disease is characterized by muscle hypotonia, cerebral palsy, developmental delay, lethargy, hypoglycemia, and metabolic acidosis. The prevalence is <1:1,000,000.250,600
ACADVLVery long chain acyl-CoA dehydrogenase deficiencyNM_000018.3NM_000018.3:c.1096C>T, NM_000018.3:c.1097G>A, NM_000018.3:c.1106T>C, NM_000018.3:c.1141_1143delGAG, NM_000018.3:c.1182+1G>A, NM_000018.3:c.1357C>T, NM_000018.3:c.1360G>A, NM_000018.3:c.1375dupC, NM_000018.3:c.1389dupG, NM_000018.3:c.1406G>A, NM_000018.3:c.1468G>C, NM_000018.3:c.1532+1G>A, NM_000018.3:c.1837C>T, NM_000018.3:c.1843C>T, NM_000018.3:c.1882delC, NM_000018.3:c.278-1G>A, NM_000018.3:c.298_299delCA, NM_000018.3:c.343delG, NM_000018.3:c.400C>T, NM_000018.3:c.477+1G>C, NM_000018.3:c.520G>A, NM_000018.3:c.685C>T, NM_000018.3:c.739A>C, NM_000018.3:c.753-2A>C, NM_000018.3:c.896_898delAGA, NM_000018.3:c.917T>C, NM_000018.3:c.1844G>A, NM_000018.3:c.848T>CVery long chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADVL gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by cardiomyopathy, hypoketotic hypoglycemia, liver disease, exercise intolerance and rhabdomyolysis. The prevalence is 1:100,000-9:100,000.250,600
ACERenal tubular dysgenesisNM_000789.3NM_000789.3:c.1319_1322delTGGA, NM_000789.3:c.1510delC, NM_000789.3:c.3381-4C>T, NM_000789.3:c.798C>G, NM_000789.3:c.1486C>T, NM_000789.3:c.2371C>T, NM_000789.3:c.1587-2A>GRenal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.250,600
ADAAdenosine deaminase deficiencyNM_000022.2NM_000022.2:c.226C>T, NM_000022.2:c.632G>A, NM_000022.2:c.890C>A, NM_000022.2:c.247G>A, NM_000022.2:c.320T>C, NM_000022.2:c.872C>T, NM_000022.2:c.956_960delAAGAG, NM_000022.2:c.986C>TAdenosine deaminase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADA gene located on chromosomal region 20q13.12. The age of onset is neonatal/infantile. This disease is characterized by profound lymphopenia and very low immunoglobulin levels of all isotypes resulting in severe and recurrent opportunistic infections. The annual incidence is 1:200,000-1:1,000,000. The prevalence is 1:100,000-9:100,000.250,600
ADCK3Primary coenzyme Q10 deficiency type 4NM_020247.4NM_020247.4:c.911C>T, NM_020247.4:c.815G>T, NM_020247.4:c.993C>T, NM_020247.4:c.1541A>G, NM_020247.4:c.1645G>A, NM_020247.4:c.1651G>A, NM_020247.4:c.1750_1752delACC, NM_020247.4:c.1813_1814insG, NM_020247.4:c.589-3C>G, NM_020247.4:c.637C>T, NM_020247.4:c.815G>APrimary coenzyme Q10 deficiency type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADCK3 gene located on chromosomal region 1q42.13. The age of onset is infantile. This disease is characterized by progressive ataxia, cerebellar atrophy, and often exercise intolerance with elevated lactate levels and mild intellectual deficit.250,600
AGLGlycogen storage disease type 3NM_000642.2NM_000642.2:c.1783C>T, NM_000642.2:c.18_19delGA, NM_000642.2:c.112A>G, NM_000642.2:c.1222C>T, NM_000642.2:c.1481G>A, NM_000642.2:c.1485delT, NM_000642.2:c.16C>T, NM_000642.2:c.4260-1G>T, NM_000642.2:c.3214_3215delGA, NM_000642.2:c.1999delC, NM_000642.2:c.2039G>A, NM_000642.2:c.2590C>T, NM_000642.2:c.4456delT, NM_000642.2:c.3216_3217delGA, NM_000642.2:c.3980G>A, NM_000642.2:c.4342G>C, NM_000642.2:c.4529dupA, NM_000642.2:c.294-2A>T, NM_000642.2:c.4260-12A>GGlycogen storage disease type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGL gene located on chromosomal region 1p21.2. The age of onset is infantile. This disease is characterized by hepatomegaly, growth retardation and occasional seizures related to hypoglycemia and frequently muscular hypotonia and hypertrophic cardiomyopathy.250,600
AGXTPrimary hyperoxaluria type 1NM_000030.2NM_000030.2:c.166-2A>G, NM_000030.2:c.121G>A, NM_000030.2:c.32C>A, NM_000030.2:c.245G>A, NM_000030.2:c.25_26insC, NM_000030.2:c.322T>C, NM_000030.2:c.508G>A, NM_000030.2:c.560C>T, NM_000030.2:c.590G>A, NM_000030.2:c.613T>C, NM_000030.2:c.697C>T, NM_000030.2:c.698G>A, NM_000030.2:c.731T>C, NM_000030.2:c.738G>A, NM_000030.2:c.836T>C, NM_000030.2:c.860G>A, NM_000030.2:c.33_34insC, NM_000030.2:c.454T>A, NM_000030.2:c.466G>A, NM_000030.2:c.248A>GPrimary hyperoxaluria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGXT gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by variable clinical presentation, ranging from occasional symptomatic nephrolithiasis to nephrocalcinosis and end-stage renal disease with systemic involvement. The prevalence is 1:1,000,000-9:1,000,000.250,600
AHI1Joubert syndrome type 3NM_017651.4NM_017651.4:c.1303C>T, NM_017651.4:c.1484G>A, NM_017651.4:c.2295_2296insA, NM_017651.4:c.2295dupA, NM_017651.4:c.3257A>G, NM_017651.4:c.2168G>A, NM_017651.4:c.985C>T, NM_017651.4:c.989A>G, NM_017651.4:c.3263_3264delGG, NM_017651.4:c.1051C>T, NM_017651.4:c.1052G>TEl síndrome de Joubert tipo 3 sigue un patrón de herencia autosómico recesivo y está causado por variantes patogénicas en el gen AHI1 localizado en la región cromosómica 6q23.3. La edad de aparición es neonatal/infantil con síntomas como los rasgos neurológicos del síndrome de Joubert (hipotonía neonatal, retraso del desarrollo, discapacidad intelectural de leve a grave, ataxia, movimiento ocular anormal incluyendo apraxia oculomotora y nistagmo en posición primaria) asociados a una distrofia retiniana.250,600
AIPL1Cone-rod dystrophyNM_014336.4NM_014336.4:c.1053_1064delTGCAGAGCCACCLa distrofia de conos y bastones causada por variantes patogénicas en el gen AIPL1 localizado en la región cromosómica 17p13.2 sigue un patrón de herencia autosómico recesivo. La edad de aparición es temprana. Se caracteriza por una agudeza visual disminuida, defectos en la visión de los colores, fotoaversión y disminución de la sensibilidad en el centro del campo visual, seguido por una pérdida de la visión periférica y ceguera nocturna.250,600
AIPL1Leber congenital amaurosis type 4NM_014336.4NM_014336.4:c.905G>T, NM_014336.4:c.834G>A, NM_014336.4:c.589G>C, NM_014336.4:c.715T>CLeber congenital amaurosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AIPL1gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. The prevalence is 1:100,000-9:100,000.250,600
ALDOBHereditary fructose intoleranceNM_000035.3NM_000035.3:c.1005C>G, NM_000035.3:c.178C>T, NM_000035.3:c.1027T>C, NM_000035.3:c.10C>T, NM_000035.3:c.136A>T, NM_000035.3:c.448G>C, NM_000035.3:c.2T>C, NM_000035.3:c.360_363delCAAA, NM_000035.3:c.442T>C, NM_000035.3:c.1013C>T, NM_000035.3:c.113-1_115delGGTA, NM_000035.3:c.1067C>A, NM_000035.3:c.612T>A, NM_000035.3:c.720C>A, NM_000035.3:c.524C>AHereditary fructose intolerance follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOB gene located on chromosomal region 9q21.3-q22.2. The age of onset is neonatal/infantile. This disease is characterized by severe abdominal pain, vomiting, and hypoglycemia following ingestion of fructose or other sugars metabolised through fructose-1-phosphate. The prevalence is 1:100,000-9:100,000.250,600
ALG6Congenital disorders of glycosylation type IcNM_013339.3NM_013339.3:c.897_899delAAT, NM_013339.3:c.998C>T, NM_013339.3:c.495-3C>G, NM_013339.3:c.53G>A, NM_013339.3:c.316C>T, NM_013339.3:c.482A>G, NM_013339.3:c.1432T>CCongenital disorder of glycosylation type 1c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG6 gene located on chromosomal region 1p31.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay and muscular hypotonia, and possible coagulation anomalies, hormonal abnormalities and seizures. The prevalence is <1:1,000,000.250,600
ALMS1Alström syndromeNM_015120.4NM_015120.4:c.11443C>T, NM_015120.4:c.10775delC, NM_015120.4:c.11316_11319delAGAG, NM_015120.4:c.2323C>T, NM_015120.4:c.11449C>T, NM_015120.4:c.11452_11453insA, NM_015120.4:c.1574_1576delCTCinsT, NM_015120.4:c.8383C>T, NM_015120.4:c.9612_9616delAACAG, NM_015120.4:c.10579_10580delAT, NM_015120.4:c.11610_11611delCT, NM_015120.4:c.12439C>T, NM_015120.4:c.12445C>T, NM_015120.4:c.891_907delTCAGCACCCGCTTATAG, NM_015120.4:c.9911-1G>A, NM_015120.4:c.11618_11619delCT, NM_015120.4:c.4245delC, NM_015120.4:c.5584C>T, NM_015120.4:c.8164C>TAlström syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALMS1 gene located on chromosomal region 2p13.1. The age of onset is neonatal/infantile. This disease is characterized by cone-rod dystrophy, hearing loss, obesity, insulin resistance and hyperinsulinemia, type 2 diabetes mellitus, dilated cardiomyopathy and progressive hepatic and renal dysfunction. The prevalence is 1:10,000-1:1,000,000.250,600
ANO5Limb-girdle muscular dystrophy type 2L, autosomal recessiveNM_213599.2NM_213599.2:c.155A>G, NM_213599.2:c.1622_1623insA, NM_213599.2:c.1407+5G>A, NM_213599.2:c.1887delA, NM_213599.2:c.1733T>C, NM_213599.2:c.692G>T, NM_213599.2:c.1627_1628insA, NM_213599.2:c.172C>T, NM_213599.2:c.206_207delAT, NM_213599.2:c.1210C>T, NM_213599.2:c.1295C>G, NM_213599.2:c.1914G>A, NM_213599.2:c.184_185insA, NM_213599.2:c.1898+1G>A, NM_213599.2:c.191_192insAAutosomal recessive limb-girdle muscular dystrophy type 2L follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ANO5 gene located on chromosomal region 11p14.3. The age of onset is adult. This disease is characterized by weakness and wasting restricted to the limb musculature, proximal greater than distal, and muscle degeneration/regeneration on muscle biopsy. The prevalence is <1:1,000,000.250,600
APTXAtaxia with oculomotor apraxia type 1NM_175073.2NM_175073.2:c.167delT, NM_175073.2:c.788T>G, NM_175073.2:c.320delC, NM_175073.2:c.617C>T, NM_175073.2:c.659C>T, NM_175073.2:c.134-2A>G, NM_175073.2:c.166C>T, NM_175073.2:c.124C>T, NM_175073.2:c.875-1G>A, NM_175073.2:c.837G>A, NM_175073.2:c.596G>AAtaxia with oculomotor apraxia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the APTX gene located on chromosomal region 9p13.1. The age of onset is infantile. This disease is characterized by a progressive cerebellar ataxia associated with oculomotor apraxia, choeroathetosis and severe peripheral neuropathy. The prevalence is 0,4:100.000 in Portugal.250,600
ARAndrogen insensitivity syndromeNM_000044.3NM_000044.3:c.2650A>T, NM_000044.3:c.340C>T, NM_000044.3:c.1937C>A, NM_000044.3:c.2323C>T, NM_000044.3:c.2391G>A, NM_000044.3:c.2567G>A, NM_000044.3:c.1769-11T>A, NM_000044.3:c.1771A>T, NM_000044.3:c.2395C>GAndrogen insensitivity syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the AR gene located on chromosomal region Xq12. The age of onset is variable. This disease is characterized by the presence of female external genitalia in a 46,XY individual with normal testis development but undescended testes and unresponsiveness to age-appropriate levels of androgens. The prevalence is 2:100,000-5:100,000.250,600
ARSAMetachromatic leukodystrophyNM_000487.5NM_000487.5:c.1241delC, NM_000487.5:c.1283C>T, NM_000487.5:c.346C>T, NM_000487.5:c.34delG, NM_000487.5:c.1210+1G>A, NM_000487.5:c.1232C>T, NM_000487.5:c.582delC, NM_000487.5:c.583delT, NM_000487.5:c.542dupT, NM_000487.5:c.542T>G, NM_000487.5:c.1408_1418delGCAGCTGTGAC, NM_000487.5:c.195delC, NM_000487.5:c.641C>T, NM_000487.5:c.1401_1411delGTTAGACGCAG, NM_000487.5:c.869G>A, NM_000487.5:c.869G>T, NM_000487.5:c.883G>A, NM_000487.5:c.899T>C, NM_000487.5:c.931G>A, NM_000487.5:c.937C>T, NM_000487.5:c.938G>A, NM_000487.5:c.979G>A, NM_000487.5:c.737G>A, NM_000487.5:c.739G>A, NM_000487.5:c.763G>A, NM_000487.5:c.827C>T, NM_000487.5:c.854+1G>A, NM_000487.5:c.1108-2A>G, NM_000487.5:c.1125_1126delCT, NM_000487.5:c.1150G>A, NM_000487.5:c.1174C>T, NM_000487.5:c.1175G>A, NM_000487.5:c.986C>T, NM_000487.5:c.991G>T, NM_000487.5:c.465+1G>A, NM_000487.5:c.257G>A, NM_000487.5:c.293C>T, NM_000487.5:c.302G>AMetachromatic leukodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSA gene located on chromosomal region 22q13.33. The age of onset is variable. This disease is characterized by hypotonia, walking difficulties, optic atrophy and motor regression preceding mental impairment in the late infantile form, arrested intellectual development, followed by motor regression, epileptic seizures and ataxia in the juvenile form, and motor or psychiatric disorders, but with slow progression in the adult form. The incidence is 0.5:5,000-1:50,000 and the prevalence is 1:10,000 -5/10,000.250,600
ARSBMucopolysaccharidosis type 6NM_000046.3NM_000046.3:c.410G>T, NM_000046.3:c.427delG, NM_000046.3:c.349T>C, NM_000046.3:c.389C>T, NM_000046.3:c.937C>G, NM_000046.3:c.944G>A, NM_000046.3:c.971G>T, NM_000046.3:c.979C>T, NM_000046.3:c.1562G>A, NM_000046.3:c.629A>G, NM_000046.3:c.1143-1G>C, NM_000046.3:c.571C>T, NM_000046.3:c.589C>T, NM_000046.3:c.1178A>C, NM_000046.3:c.1214G>A, NM_000046.3:c.1143-8T>G, NM_000046.3:c.1161dupC, NM_000046.3:c.707T>C, NM_000046.3:c.753C>G, NM_000046.3:c.1366C>T, NM_000046.3:c.1438_1439insG, NM_000046.3:c.921delAMucopolysaccharidosis type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSB gene located on chromosomal region 5q14.1. The age of onset is infantile. This disease is characterized by educed pulmonary function, hepatosplenomegaly, hearing loss, sleep apnea, corneal clouding, carpal tunnel disease and occasionally central nervous system findings may include cervical cord compression caused by cervical spinal instability, meningeal thickening and/or bony stenosis, communicating hydrocephalus, optic nerve atrophy and blindness. The prevalence is 1:250,000-1:600,000 newborns.250,600
ARSEChondrodysplasia punctata type 1, X-linkedNM_000047.2NM_000047.2:c.119T>G, NM_000047.2:c.1429delG, NM_000047.2:c.1442C>T, NM_000047.2:c.1732C>T, NM_000047.2:c.1743G>A, NM_000047.2:c.24-1G>A, NM_000047.2:c.410G>C, NM_000047.2:c.410G>TX-linked chondrodysplasia punctata type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARSE gene located on chromosomal region Xp22.33. The age of onset is neonatal. This disease is characterized by chondrodysplasia punctata (stippled epiphyses), brachytelephalangy (shortening of the distal phalanges), and nasomaxillary hypoplasia. The prevalence is 1:500,000.250,600
ASLArgininosuccinic aciduriaNM_000048.3NM_000048.3:c.1135C>T, NM_000048.3:c.1060C>T, NM_000048.3:c.1255_1256delCT, NM_000048.3:c.1366C>T, NM_000048.3:c.1045_1057delGTCATCTCTACGC, NM_000048.3:c.578G>A, NM_000048.3:c.539T>G, NM_000048.3:c.544C>T, NM_000048.3:c.557G>A, NM_000048.3:c.1144-2A>G, NM_000048.3:c.602+1G>A, NM_000048.3:c.857A>G, NM_000048.3:c.925G>A, NM_000048.3:c.446+1G>A, NM_000048.3:c.505T>C, NM_000048.3:c.525-2A>T, NM_000048.3:c.532G>A, NM_000048.3:c.337C>T, NM_000048.3:c.346C>T, NM_000048.3:c.35G>A, NM_000048.3:c.1369dupG, NM_000048.3:c.437G>A, NM_000048.3:c.392C>T, NM_000048.3:c.1153C>TArgininosuccinic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASL gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by severe hyperammonemic coma, hypotonia, growth failure, anorexia and chronic vomiting or behavioral disorders during childhood, and hyperammonemic coma or behavioral disorders that simulate psychiatric disorders later in life. The prevalence is 1:70,000 newborns.250,600
ASPACanavan diseaseNM_000049.2NM_000049.2:c.838C>T, NM_000049.2:c.693C>A, NM_000049.2:c.654C>A, NM_000049.2:c.433-2A>G, NM_000049.2:c.854A>C, NM_000049.2:c.914C>A, NM_000049.2:c.212G>A, NM_000049.2:c.863A>GCanavan disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPA gene located on chromosomal region 17p13.3. The age of onset is neonatal/infantile. This disease is characterized by a variable spectrum between severe forms with leukodystrophy, macrocephaly and severe developmental delay, and a very rare mild/juvenile form characterized by mild developmental delay. The prevalence is 1:6,400- 1:13,500 in Askenazis Jewis.250,600
ASPMMicrocephaly primary, type 5, autosomal recessiveNM_018136.4NM_018136.4:c.1002delA, NM_018136.4:c.3055C>T, NM_018136.4:c.2389C>T, NM_018136.4:c.2967G>A, NM_018136.4:c.1260_1266delTCAAGTC, NM_018136.4:c.10059C>A, NM_018136.4:c.1154_1155delAG, NM_018136.4:c.1179delT, NM_018136.4:c.1729_1730delAG, NM_018136.4:c.1959_1962delCAAA, NM_018136.4:c.1990C>T, NM_018136.4:c.3979C>T, NM_018136.4:c.4195dupA, NM_018136.4:c.4583delA, NM_018136.4:c.4795C>T, NM_018136.4:c.4858_4859delAT, NM_018136.4:c.5136C>A, NM_018136.4:c.5149delA, NM_018136.4:c.1366G>T, NM_018136.4:c.1406_1413delATCCTAAA, NM_018136.4:c.1590delA, NM_018136.4:c.6189T>G, NM_018136.4:c.6232C>T, NM_018136.4:c.6337_6338delAT, NM_018136.4:c.6732delA, NM_018136.4:c.719_720delCT, NM_018136.4:c.7491_7495delTATTA, NM_018136.4:c.7565T>G, NM_018136.4:c.7761T>G, NM_018136.4:c.7782_7783delGA, NM_018136.4:c.7860_7861delGA, NM_018136.4:c.7894C>T, NM_018136.4:c.8131_8132delAA, NM_018136.4:c.8230_8231insA, NM_018136.4:c.8378delT, NM_018136.4:c.8508_8509delGA, NM_018136.4:c.8668C>T, NM_018136.4:c.8844delC, NM_018136.4:c.9115_9118dupCATT, NM_018136.4:c.9159delA, NM_018136.4:c.9178C>T, NM_018136.4:c.3082G>A, NM_018136.4:c.3188T>G, NM_018136.4:c.3477_3481delCGCTA, NM_018136.4:c.349C>T, NM_018136.4:c.3527C>G, NM_018136.4:c.3663delG, NM_018136.4:c.3710C>G, NM_018136.4:c.3796G>T, NM_018136.4:c.3811C>T, NM_018136.4:c.3978G>A, NM_018136.4:c.9747_9748delCT, NM_018136.4:c.9754delA, NM_018136.4:c.9789T>A, NM_018136.4:c.8711_8712delAA, NM_018136.4:c.9190C>T, NM_018136.4:c.9238A>T, NM_018136.4:c.9319C>T, NM_018136.4:c.5439_5440delAG, NM_018136.4:c.577C>T, NM_018136.4:c.6073delG, NM_018136.4:c.9677dupG, NM_018136.4:c.9685delA, NM_018136.4:c.9697C>T, NM_018136.4:c.9730C>T, NM_018136.4:c.9557C>G, NM_018136.4:c.9492T>G, NM_018136.4:c.9539A>CPrimary autosomal recessive microcephaly type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPM gene located on chromosomal region 1q31. The age of onset is neonatal/infantile. This disease is characterized by a reduction in head circumference at birth, mild to moderate non-progressive intellectual impairment and delay in early motor milestones, speech delay and hyperactive behavior are common. The annual incidence is 1:1,000,000.250,600
ASS1Citrullinemia type 1NM_000050.4NM_000050.4:c.421-2A>G, NM_000050.4:c.40G>A, NM_000050.4:c.1088G>A, NM_000050.4:c.470G>A, NM_000050.4:c.1085G>T, NM_000050.4:c.1087C>T, NM_000050.4:c.257G>A, NM_000050.4:c.323G>T, NM_000050.4:c.349G>A, NM_000050.4:c.380G>A, NM_000050.4:c.836G>A, NM_000050.4:c.910C>T, NM_000050.4:c.928A>C, NM_000050.4:c.496-2A>G, NM_000050.4:c.535T>C, NM_000050.4:c.539G>A, NM_000050.4:c.53C>T, NM_000050.4:c.571G>A, NM_000050.4:c.787G>A, NM_000050.4:c.793C>T, NM_000050.4:c.794G>A, NM_000050.4:c.805G>A, NM_000050.4:c.835C>T, NM_000050.4:c.919C>T, NM_000050.4:c.970G>A, NM_000050.4:c.814C>T, NM_000050.4:c.970+5G>A, NM_000050.4:c.1168G>A, NM_000050.4:c.1194-1G>C, NM_000050.4:c.256C>TCitrullinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASS1 gene located on chromosomal region 9q34.1. The age of onset is variable. This disease is characterized by hyperammonemia, progressive lethargy, poor feeding and vomiting in the neonatal form and by variable hyperammonemia in the later-onset form. The prevalence is 1:100,000-9:100,000.250,600
ATICAICA-ribosiduriaNM_004044.6NM_004044.6:c.223+1G>A, NM_004044.6:c.1277A>G, NM_004044.6:c.625delGAICA-ribosiduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATIC gene located on chromosomal region 2q35. The age of onset is neonatal/infantile. This disease is characterized by profound intellectual deficit, epilepsy, dysmorphic features of the knees, elbows, and shoulders and congenital blindness. The prevalence is <1:1,000,000.250,600
ATP7BWilson diseaseNM_000053.3NM_000053.3:c.2532delA, NM_000053.3:c.2356-2A>G, NM_000053.3:c.1285+5G>T, NM_000053.3:c.2305A>G, NM_000053.3:c.1145_1151delCCCAACT, NM_000053.3:c.1934T>G, NM_000053.3:c.2071G>A, NM_000053.3:c.2297C>G, NM_000053.3:c.2972C>T, NM_000053.3:c.2975C>T, NM_000053.3:c.3083delA, NM_000053.3:c.2605G>A, NM_000053.3:c.2621C>T, NM_000053.3:c.2755C>G, NM_000053.3:c.2755C>T, NM_000053.3:c.2762G>A, NM_000053.3:c.2795C>A, NM_000053.3:c.2804C>T, NM_000053.3:c.2807T>A, NM_000053.3:c.2906G>A, NM_000053.3:c.2930C>T, NM_000053.3:c.4301C>T, NM_000053.3:c.915T>A, NM_000053.3:c.98T>C, NM_000053.3:c.1745_1746delTA, NM_000053.3:c.2123T>C, NM_000053.3:c.2267C>T, NM_000053.3:c.4088C>T, NM_000053.3:c.4135C>T, NM_000053.3:c.1512_1513insT, NM_000053.3:c.19_20delCA, NM_000053.3:c.1922T>C, NM_000053.3:c.3955C>T, NM_000053.3:c.3990_3993delTTAT, NM_000053.3:c.4058G>A, NM_000053.3:c.3207C>A, NM_000053.3:c.3359T>A, NM_000053.3:c.3688A>G, NM_000053.3:c.3101A>G, NM_000053.3:c.3796G>A, NM_000053.3:c.3809A>G, NM_000053.3:c.562C>T, NM_000053.3:c.3694A>C, NM_000053.3:c.1846C>TWilson disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATP7B gene located on chromosomal region 13q14.3. The age of onset is infantile. This disease is characterized by the toxic accumulation of copper, mainly in the liver and central nervous system, and symptomatic patients may present with hepatic, neurologic or psychiatric forms. The birth incidence is 1:30,000-1:100,000 in France and The prevalence is 1:10,000-1:30,000.250,600
ATRSeckel syndrome type 1NM_001184.3NM_001184.3:c.2341+1G>A, NM_001184.3:c.5645delA, NM_001184.3:c.6037_6038insA, NM_001184.3:c.6488delT, NM_001184.3:c.975_976delCT, NM_001184.3:c.5635G>TSeckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATR gene located on chromosomal region 3q23. The age of onset is neonatal/infantile. This disease is characterized by a proportionate dwarfism of prenatal onset, a severe microcephaly with a bird-headed like appearance and mental retardation. The prevalence is <1:1,000,000.250,600
BCKDHAMaple syrup urine disease type 1ANM_000709.3NM_000709.3:c.1037G>A, NM_000709.3:c.1036C>T, NM_000709.3:c.1234G>A, NM_000709.3:c.14delT, NM_000709.3:c.761C>A, NM_000709.3:c.929C>G, NM_000709.3:c.964C>T, NM_000709.3:c.979G>A, NM_000709.3:c.905A>C, NM_000709.3:c.632C>T, NM_000709.3:c.659C>T, NM_000709.3:c.740_741insT, NM_000709.3:c.868G>A, NM_000709.3:c.909_910delGT, NM_000709.3:c.917delT, NM_000709.3:c.853G>C, NM_000709.3:c.796delAMaple syrup urine disease type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHA gene located on chromosomal region 19q13.1-13.2. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:1,000,000-9:1,000,000.250,600
BCS1LBjörnstad syndromeNM_004328.4NM_004328.4:c.548G>ABjörnstadt syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal/infantile. This disease is characterized by congenital sensorineural hearing loss and pili torti. The prevalence is <1:1,000,000.250,600
BCS1LGRACILE syndromeNM_004328.4NM_004328.4:c.232A>GGRACILE syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal/infantile. This disease is characterized by fetal growth restriction (GR), aminoaciduria (A), cholestasis (C), iron overload (I), lactacidosis (L) and early death (E). The birth incidence is 1:50,000 in Finland and the prevalence is <1:1,000,000.250,600
BCS1LMitochondrial comlpex III deficiency, nuclear type 1NM_004328.4NM_004328.4:c.1057G>A, NM_004328.4:c.830G>A, NM_004328.4:c.133C>T, NM_004328.4:c.103G>C, NM_004328.4:c.696delT, NM_004328.4:c.148A>G, NM_004328.4:c.166C>T, NM_004328.4:c.550C>T, NM_004328.4:c.547C>TMitochondrial comlpex III deficiency, nuclear type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal and it is characterized by lactic acidosis, hypotonia, hypoglycemia, failure to thrive, encephalopathy, and delayed psychomotor development.250,600
BEST1BestrophinopathyNM_004183.3NM_004183.3:c.934G>A, NM_004183.3:c.598C>T, NM_004183.3:c.752G>A, NM_004183.3:c.949G>A, NM_004183.3:c.521_522delTGBestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram.250,600
BEST1Retinitis pigmentosa type 50NM_004183.3NM_004183.3:c.1383_1384insGCCTTGATGGA, NM_004183.3:c.1444delG, NM_004183.3:c.1491_1497dupCAAAGAC, NM_004183.3:c.1566_1576dupCTTGATGGAGC, NM_004183.3:c.341_342delTG, NM_004183.3:c.1308_1309insACCAAAG, NM_004183.3:c.1264delG, NM_004183.3:c.418C>G, NM_004183.3:c.614T>C, NM_004183.3:c.682G>A, NM_004183.3:c.344delG, NM_004183.3:c.524delGRetinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 50 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q12.3. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.250,600
BEST1Vitelliform macular dystrophy type 2NM_004183.3NM_004183.3:c.122T>C, NM_004183.3:c.422G>AVitelliform macular dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q12.3. The age of onset is infancy or adolescence. This disease is characterized by normal vision at birth, then progresses through distinct stages that include an asymptomatic previtelliform phase (stage 1) followed by the formation of a yellow, egg yolk-like (vitelliform) lesion in the macula (stage 2). The contents become less homogenous and develop a "scrambled-egg" appearance (stage 2a). The lesion eventually develops a fluid, yellow-colored vitelline substance (pseudohypopyon or stage 3) and finally breaks down, leaving a scar that causes central visual acuity deterioration (20/200). This may be complicated by a subfoveal choroidal neovascular (CNV) membrane (rare in children). Anomalous color discrimination (mainly the protan axis) and metamorphopsia may be observed but patients retain normal peripheral vision and dark adaptation. Some affected individuals remain asymptomatic. The prevalence is 1/5,000 to 1/67,000.250,600
BRCA2Fanconi anemia, complementation group D1NM_000059.3NM_000059.3:c.1514T>C, NM_000059.3:c.4648G>T, NM_000059.3:c.8415A>T, NM_000059.3:c.7544C>T, NM_000059.3:c.7994A>G, NM_000059.3:c.5574_5577delAATT, NM_000059.3:c.4889C>G, NM_000059.3:c.4936_4939delGAAA, NM_000059.3:c.5066_5067insA, NM_000059.3:c.6024dupG, NM_000059.3:c.6860delG, NM_000059.3:c.7235C>A, NM_000059.3:c.9382C>T, NM_000059.3:c.9900dupA, NM_000059.3:c.3847_3848delGT, NM_000059.3:c.5718_5719delCT, NM_000059.3:c.5837_5838delCAinsAG, NM_000059.3:c.6023_6024insG, NM_000059.3:c.8503T>C, NM_000059.3:c.6486_6489delACAA, NM_000059.3:c.657_658delTG, NM_000059.3:c.6997_6998insTFanconi anemia, complementation group D1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BRCA2 gene located on chromosomal region 13q12.3. The age of onset is infantile. This disease is characterized by physical abnormalities, bone marrow failure, and increased risk of malignancy. The prevalence is 1:1,000,000-9:1,000,000.250,600
BRIP1Fanconi anemia, complementation group JNM_032043.2NM_032043.2:c.2990_2993delCAAA, NM_032043.2:c.1045G>C, NM_032043.2:c.2237_2240delTCAA, NM_032043.2:c.3209C>A, NM_032043.2:c.502C>T, NM_032043.2:c.139C>G, NM_032043.2:c.1702_1703delAA, NM_032043.2:c.2392C>TFanconi anemia, complementation group J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BRIP1 gene located on chromosomal region 17q22.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:1,000,000- 9:1,000,000.250,600
BSNDBartter syndrome type 4ANM_057176.2NM_057176.2:c.1A>T, NM_057176.2:c.22C>T, NM_057176.2:c.3G>A, NM_057176.2:c.10G>T, NM_057176.2:c.23G>T, NM_057176.2:c.35T>C, NM_057176.2:c.23G>A, NM_057176.2:c.139G>ABartter syndrome type 4A with deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSND gene located on chromosomal region 1p32.3. The age of onset is neonatal/infantile. This disease is characterized by maternal polyhydramnios, premature delivery, polyuria, sensorineural deafness and is associated with hypokalemic alkalosis, increased levels of plasma renin and aldosterone, low blood pressure, and vascular resistance to angiotensin II.250,600
BTDBiotinidase deficiencyNM_000060.3NM_000060.3:c.1531C>G, NM_000060.3:c.1508_1512delGGATG, NM_000060.3:c.1339C>T, NM_000060.3:c.1352G>A, NM_000060.3:c.1489C>T, NM_000060.3:c.643C>T, NM_000060.3:c.664G>A, NM_000060.3:c.755A>G, NM_000060.3:c.1368A>C, NM_000060.3:c.933delT, NM_000060.3:c.1595C>T, NM_000060.3:c.1612C>T, NM_000060.3:c.757C>T, NM_000060.3:c.1106C>T, NM_000060.3:c.1321delG, NM_000060.3:c.794A>T, NM_000060.3:c.595G>A, NM_000060.3:c.629A>G, NM_000060.3:c.631C>T, NM_000060.3:c.235C>T, NM_000060.3:c.334G>C, NM_000060.3:c.511G>A, NM_000060.3:c.184G>A, NM_000060.3:c.557G>A, NM_000060.3:c.583A>G, NM_000060.3:c.968A>G, NM_000060.3:c.528G>T, NM_000060.3:c.443G>ABiotinidase deficiency an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BTD gene located on chromosomal region 3p25. The age of onset is neonatal/infantile. This disease is characterized by seizures, breathing difficulties, hypotonia, skin rash, alopecia, hearing loss and delayed development.250,600
CAPN3Limb-girdle muscular dystrophy type 2ANM_000070.2NM_000070.2:c.1838delA, NM_000070.2:c.2120A>G, NM_000070.2:c.1795_1796insA, NM_000070.2:c.1469G>A, NM_000070.2:c.1599_1602delGAGC, NM_000070.2:c.1715G>A, NM_000070.2:c.1743_1745+1delTGAG, NM_000070.2:c.257C>T, NM_000070.2:c.328C>T, NM_000070.2:c.549delA, NM_000070.2:c.2212C>T, NM_000070.2:c.223dupT, NM_000070.2:c.2243G>A, NM_000070.2:c.2251_2254dupGTCA, NM_000070.2:c.2257G>A, NM_000070.2:c.2306G>A, NM_000070.2:c.2361_2363delAGinsTCATCT, NM_000070.2:c.2361_2364delAGinsTCATCT, NM_000070.2:c.2362_2363delAGinsTCATCT, NM_000070.2:c.246G>A, NM_000070.2:c.676G>A, NM_000070.2:c.551C>T, NM_000070.2:c.580delT, NM_000070.2:c.133G>A, NM_000070.2:c.550delA, NM_000070.2:c.1468C>T, NM_000070.2:c.956C>T, NM_000070.2:c.1322delG, NM_000070.2:c.1466G>A, NM_000070.2:c.662G>T, NM_000070.2:c.855_864dupGTTGATTGCA, NM_000070.2:c.1610A>G, NM_000070.2:c.598_612delTTCTGGAGTGCTCTGLimb-girdle muscular dystrophy type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CAPN3 gene located on chromosomal region 15q15.1. The age of onset is variable. This disease is characterized by symmetrical and selective atrophy and weakness of proximal limb and girdle muscles. The prevalence is 1:100,000- 9:100,000.250,600
CBSHomocystinuriaNM_000071.2NM_000071.2:c.1150A>G, NM_000071.2:c.1058C>T, NM_000071.2:c.1136G>A, NM_000071.2:c.341C>T, NM_000071.2:c.1006C>T, NM_000071.2:c.325T>C, NM_000071.2:c.1316G>A, NM_000071.2:c.374G>A, NM_000071.2:c.1265C>T, NM_000071.2:c.1280C>T, NM_000071.2:c.146C>T, NM_000071.2:c.1471C>T, NM_000071.2:c.1616T>C, NM_000071.2:c.162G>A, NM_000071.2:c.833T>C, NM_000071.2:c.904G>A, NM_000071.2:c.919G>A, NM_000071.2:c.393G>C, NM_000071.2:c.415G>A, NM_000071.2:c.430G>A, NM_000071.2:c.434C>T, NM_000071.2:c.502G>A, NM_000071.2:c.526G>T, NM_000071.2:c.572C>T, NM_000071.2:c.676G>A, NM_000071.2:c.689delT, NM_000071.2:c.797G>A, NM_000071.2:c.959T>C, NM_000071.2:c.969G>A, NM_000071.2:c.992C>A, NM_000071.2:c.1330G>A, NM_000071.2:c.1379C>T, NM_000071.2:c.1397C>T, NM_000071.2:c.304A>CHomocystinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CBS gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by the multiple involvement of the eye, skeleton, central nervous system and vascular system. The prevalence is 1:200,000-1:335,000.250,600
CC2D2AJoubert syndrome type 9NM_001080522.2NM_001080522.2:c.4179delG, NM_001080522.2:c.3594+1G>A, NM_001080522.2:c.3289delG, NM_001080522.2:c.4582C>T, NM_001080522.2:c.4667A>T, NM_001080522.2:c.2848C>T, NM_001080522.2:c.3364C>T, NM_001080522.2:c.4333C>T, NM_001080522.2:c.4181delGJoubert syndrome type 9 defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized neonatal hypotonia, developmental delay, intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia, primary position nystagmus and congenital hepatic fibrosis.250,600
CC2D2AMeckel syndrome type 6NM_001080522.2NM_001080522.2:c.3145C>T, NM_001080522.2:c.2486+1G>CMeckel syndrome type 6 with hepatic defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized by a combination of renal cysts, developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and polydactyly.250,600
CDH23Deafness type 12, autosomal recessiveNM_022124.5NM_022124.5:c.6442G>A, NM_022124.5:c.5663T>C, NM_022124.5:c.9565C>T, NM_022124.5:c.7823G>A, NM_022124.5:c.902G>ANon-syndromic autosomal recessive deafness type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.250,600
CDH23Usher syndrome type 1DNM_022124.5NM_022124.5:c.288+1G>A, NM_022124.5:c.193delC, NM_022124.5:c.6050-9G>A, NM_022124.5:c.3141C>A, NM_022124.5:c.146-2A>G, NM_022124.5:c.4504C>T, NM_022124.5:c.3516_3519delATCC, NM_022124.5:c.3579+2T>C, NM_022124.5:c.3293A>G, NM_022124.5:c.9319+1_9319+4delGTAA, NM_022124.5:c.5237G>A, NM_022124.5:c.1858+2T>G, NM_022124.5:c.6392delC, NM_022124.5:c.7660G>AUsher syndrome type 1D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by sensorineural deafness, retinitis pigmentosa and progressive vision loss.250,600
CDHR1Retinitis pigmentosa type 65NM_033100.3NM_033100.3:c.1485+2T>C, NM_033100.3:c.1463delG, NM_033100.3:c.1110delC, NM_033100.3:c.338delG, NM_033100.3:c.524dupA, NM_033100.3:c.1485+2T>G, NM_033100.3:c.1112delC, NM_033100.3:c.640delGRetinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 65 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDHR1 gene located on chromosomal region 10q23.1. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.250,600
CENPJMicrocephaly primary, type 6, autosomal recessiveNM_018451.4NM_018451.4:c.3243_3246delTCAG, NM_018451.4:c.2614delT, NM_018451.4:c.3415G>T, NM_018451.4:c.3653C>T, NM_018451.4:c.2462C>T, NM_018451.4:c.3699_3702dupAATA, NM_018451.4:c.3568_3571dupGTCA, NM_018451.4:c.3843_3844insTA, NM_018451.4:c.757_760delGTCT, NM_018451.4:c.1952_1953insAGTG, NM_018451.4:c.3704A>T, NM_018451.4:c.232_236delCAGAA, NM_018451.4:c.2460_2463delGACG, NM_018451.4:c.2968_2972delAAAAA, NM_018451.4:c.40C>T, NM_018451.4:c.289dupAPrimary autosomal recessive microcephaly type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CENPJ gene located on chromosomal region 13q12.12. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.250,600
CEP290Joubert syndrome, Senior-Loken typeNM_025114.3NM_025114.3:c.5611_5614delCAAA, NM_025114.3:c.164_167delCTCAJoubert syndrome, Senior-Loken type syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infantile. This disease is characterized by symptoms of nephronophthisis such as polyuria, polydipsia, secondary eneuresis and anemia. The progression of the disease can lead to acute or chronic renal insufficiency and finally to end-stage kidney disease. Ocular features include congenital or early-onset severe visual loss, due to retinal dystrophy. In rare occasions, other additional clinical signs may be observed like liver fibrosis, obesity and neurologic disorders.. The prevalence is <1:1,000,000.250,600
CEP290Joubert syndrome type 5NM_025114.3NM_025114.3:c.4656delA, NM_025114.3:c.21G>T, NM_025114.3:c.5668G>TJoubert syndrome with oculorenal defect 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infantile. This disease is characterized by neonatal hypotonia, developmental delay, intellectrual disability, ataxia, abnormal eye movements including oculomotor apraxia, primary position nystagmus and renal and ocular disease.250,600
CEP290Leber congenital amaurosis type 10NM_025114.3NM_025114.3:c.7341_7342insA, NM_025114.3:c.4705-1G>T, NM_025114.3:c.4723A>T, NM_025114.3:c.4962_4963delAA, NM_025114.3:c.4916C>A, NM_025114.3:c.6624delG, NM_025114.3:c.6645+1G>A, NM_025114.3:c.7324G>T, NM_025114.3:c.6798G>A, NM_025114.3:c.7394_7395delAG, NM_025114.3:c.1681C>T, NM_025114.3:c.7341delA, NM_025114.3:c.6448_6455delCAGTTGAA, NM_025114.3:c.1665_1666delAA, NM_025114.3:c.384_387delTAGA, NM_025114.3:c.2249T>G, NM_025114.3:c.3185delT, NM_025114.3:c.4393C>T, NM_025114.3:c.1501G>TLeber congenital amaurosis type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infancy/neonatal. This disease is characterized by retinal dystrophy defined by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.250,600
CEP290Meckel syndrome type 4NM_025114.3NM_025114.3:c.613C>TMeckel syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is neonatal. This disease is characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically occipital encephalocele), hepatic ductal dysplasia and cysts, and postaxial polydactyly. The prevalence is <1 / 1,000,000.250,600
CERKLRetinitis pigmentosa tipo 26NM_201548.4NM_201548.4:c.1012C>T, NM_201548.4:c.1090C>T, NM_201548.4:c.312delA, NM_201548.4:c.715C>T, NM_201548.4:c.769C>T, NM_201548.4:c.780delT, NM_201548.4:c.847C>T, NM_201548.4:c.1553_1569dupTTATCAGTCTTTATGGARetinitis pigmentosa 26 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CERKL gene located on chromosomal region 2q31.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.250,600
CFHComplement factor H deficiencyNM_000186.3NM_000186.3:c.3628C>T, NM_000186.3:c.2876G>A, NM_000186.3:c.380G>T, NM_000186.3:c.481G>T, NM_000186.3:c.1606T>CImmunodeficiency with factor H anomaly follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFH gene located on chromosomal region 1q32. This disease is characterized by recurrent bacterial infections and renal failure.250,600
CFTRCystic fibrosisNM_000492.3NM_000492.3:c.1327_1330dupGATA, NM_000492.3:c.1210-7_1210-6delTT, NM_000492.3:c.125C>T, NM_000492.3:c.1301_1307delCACTTCT, NM_000492.3:c.1397C>A, NM_000492.3:c.1340delA, NM_000492.3:c.1364C>A, NM_000492.3:c.1393-1G>A, NM_000492.3:c.1438G>T, NM_000492.3:c.1466C>A, NM_000492.3:c.1475C>T, NM_000492.3:c.1477C>T, NM_000492.3:c.1516A>G, NM_000492.3:c.1519_1521delATC, NM_000492.3:c.1521_1523delCTT, NM_000492.3:c.1545_1546delTA, NM_000492.3:c.1624G>T, NM_000492.3:c.1692delA, NM_000492.3:c.1706A>G, NM_000492.3:c.1721C>A, NM_000492.3:c.178G>T, NM_000492.3:c.1970delG, NM_000492.3:c.200C>T, NM_000492.3:c.2012delT, NM_000492.3:c.2051_2052delAAinsG, NM_000492.3:c.2052_2053insA, NM_000492.3:c.2052delA, NM_000492.3:c.1000C>T, NM_000492.3:c.1007T>A, NM_000492.3:c.1013C>T, NM_000492.3:c.1021T>C, NM_000492.3:c.1022_1023insTC, NM_000492.3:c.1040G>A, NM_000492.3:c.1040G>C, NM_000492.3:c.1055G>A, NM_000492.3:c.1081delT, NM_000492.3:c.115C>T, NM_000492.3:c.2538G>A, NM_000492.3:c.254G>A, NM_000492.3:c.2551C>T, NM_000492.3:c.2583delT, NM_000492.3:c.262_263delTT, NM_000492.3:c.2657+5G>A, NM_000492.3:c.2668C>T, NM_000492.3:c.273+1G>A, NM_000492.3:c.2737_2738insG, NM_000492.3:c.2739T>A, NM_000492.3:c.274-1G>A, NM_000492.3:c.274G>A, NM_000492.3:c.274G>T, NM_000492.3:c.2780T>C, NM_000492.3:c.2834C>T, NM_000492.3:c.2855T>C, NM_000492.3:c.2869_2870insG, NM_000492.3:c.2875delG, NM_000492.3:c.2908G>C, NM_000492.3:c.292C>T, NM_000492.3:c.2939T>A, NM_000492.3:c.2989-1G>A, NM_000492.3:c.3067_3072delATAGTG, NM_000492.3:c.3140-26A>G, NM_000492.3:c.3194T>C, NM_000492.3:c.3196C>T, NM_000492.3:c.3197G>A, NM_000492.3:c.3230T>C, NM_000492.3:c.325_327delTATinsG, NM_000492.3:c.3266G>A, NM_000492.3:c.3276C>A, NM_000492.3:c.3276C>G, NM_000492.3:c.328G>C, NM_000492.3:c.328G>T, NM_000492.3:c.3302T>A, NM_000492.3:c.3310G>T, NM_000492.3:c.349C>T, NM_000492.3:c.350G>T, NM_000492.3:c.3528delC, NM_000492.3:c.3533_3536delCAAC, NM_000492.3:c.3587C>G, NM_000492.3:c.358G>A, NM_000492.3:c.3611G>A, NM_000492.3:c.3612G>A, NM_000492.3:c.3659delC, NM_000492.3:c.366T>A, NM_000492.3:c.3731G>A, NM_000492.3:c.3744delA, NM_000492.3:c.3752G>A, NM_000492.3:c.3761T>G, NM_000492.3:c.3764C>A, NM_000492.3:c.3773_3774insT, NM_000492.3:c.3846G>A, NM_000492.3:c.3909C>G, NM_000492.3:c.3937C>T, NM_000492.3:c.4056G>T, NM_000492.3:c.4077_4080delinsAA, NM_000492.3:c.4077_4080delTGTTinsAA, NM_000492.3:c.4251delA, NM_000492.3:c.4333G>A, NM_000492.3:c.4426C>T, NM_000492.3:c.442delA, NM_000492.3:c.445G>A, NM_000492.3:c.445G>T, NM_000492.3:c.446G>T, NM_000492.3:c.531delT, NM_000492.3:c.532G>A, NM_000492.3:c.571T>G, NM_000492.3:c.577G>T, NM_000492.3:c.579+1G>T, NM_000492.3:c.579+3A>G, NM_000492.3:c.579+5G>A, NM_000492.3:c.592G>A, NM_000492.3:c.595C>T, NM_000492.3:c.613C>T, NM_000492.3:c.617T>G, NM_000492.3:c.650A>G, NM_000492.3:c.658C>T, NM_000492.3:c.708delT, NM_000492.3:c.722_743delGGAGAATGATGATGAAGTACAG, NM_000492.3:c.803delA, NM_000492.3:c.935_937delTCT, NM_000492.3:c.988G>T, NM_000492.3:c.1046C>T, NM_000492.3:c.14C>T, NM_000492.3:c.1558G>A, NM_000492.3:c.1585-1G>A, NM_000492.3:c.1684G>C, NM_000492.3:c.1766+1G>A, NM_000492.3:c.1397C>G, NM_000492.3:c.1399C>T, NM_000492.3:c.1400T>C, NM_000492.3:c.3380G>A, NM_000492.3:c.3409A>G, NM_000492.3:c.3868C>A, NM_000492.3:c.489+1G>T, NM_000492.3:c.2537G>A, NM_000492.3:c.2125C>T, NM_000492.3:c.2128A>T, NM_000492.3:c.2175_2176insA, NM_000492.3:c.2052dupA, NM_000492.3:c.2195T>G, NM_000492.3:c.2215delG, NM_000492.3:c.223C>T, NM_000492.3:c.2175dupA, NM_000492.3:c.221G>A, NM_000492.3:c.2930C>T, NM_000492.3:c.3205G>A, NM_000492.3:c.2249C>TCystic fibrosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFTR gene located on chromosomal region 7q31.2. The age of onset of severe form is neonatal or infantile but there are also variants associated with moderate clinical or late onset. This disease is characterized by the production of sweat with a high salt content, mucus secretions with an abnormal viscosity, chronic bronchitis, pancreatic insufficiency, adolescent diabetes and, more rarely, stercoral obstruction and cirrhosis. Male sterility is a constant feature. Late-onset forms, which are usually only mild or monosymptomatic. The prevalence is 1:10,000-9:10,000.250,600
CHST6Macular corneal dystrophyNM_021615.4NM_021615.4:c.820G>T, NM_021615.4:c.853delC, NM_021615.4:c.993G>T, NM_021615.4:c.327_328delCT, NM_021615.4:c.392C>AMacular corneal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CHST6 gene located on chromosomal region 16q22. The age of onset is variable. This disease is characterized by bilateral ill-defined cloudy regions within a hazy stroma, and eventually severe visual impairment. The prevalence is 1:100,000-9:100,000.250,600
CLCN1Myotonia congenita, autosomal recessiveNM_000083.2NM_000083.2:c.1453A>G, NM_000083.2:c.409T>G, NM_000083.2:c.568G>A, NM_000083.2:c.899G>A, NM_000083.2:c.1169G>A, NM_000083.2:c.1238T>G, NM_000083.2:c.871G>A, NM_000083.2:c.180+3A>T, NM_000083.2:c.225dupC, NM_000083.2:c.501C>G, NM_000083.2:c.2680C>TMyotonia congenita (Becker disease) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN1 gene located on chromosomal region 7q35. The age of onset is neonatal/infantile. This disease is characterized by slow muscle relaxation, that it is relieved with exercise, associated with hyperexcitation of the muscle fibres. The prevalence is 1:100,000.250,600
CLDN19Hypomagnesemia type 5, renal failure with severe ocular abnormalitiesNM_148960.2NM_148960.2:c.269T>C, NM_148960.2:c.425_437delCCCTGGTGACCCA, NM_148960.2:c.59G>A, NM_148960.2:c.169C>G, NM_148960.2:c.599G>AHypomagnesemia type 5, renal failure with severe ocular abnormalities follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN19 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by excessive magnesium and calcium renal wasting, bilateral nephrocalcinosis, progressive renal failure and severe ocular abnormalities. The prevalence is <1:1,000,000.250,600
CLRN1Retinitis pigmentosa type 61NM_174878.2NM_174878.2:c.92C>TRetinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 61 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1gene located on chromosomal region 3q25.1. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.250,600
CLRN1Usher syndrome type 3ANM_174878.2NM_174878.2:c.591_592insT, NM_174878.2:c.630_631insT, NM_174878.2:c.118T>G, NM_174878.2:c.433+1061A>T, NM_174878.2:c.189C>A, NM_174878.2:c.144T>GUsher syndrome type 3A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1 gene located on chromosomal region 3q25.1. The age of onset is neonatal/infantile. This disease is characterized by the association of sensorineural deafness with retinitis pigmentosa and progressive vision loss. The prevalence is 1:1.000.000- 9/1.000.000.250,600
CNGA1Retinitis pigmentosa type 49NM_000087.3NM_000087.3:c.1747C>T, NM_000087.3:c.1540C>T, NM_000087.3:c.2071T>C, NM_000087.3:c.1927C>T, NM_000087.3:c.1271G>A, NM_000087.3:c.1001G>A, NM_000087.3:c.959C>T, NM_000087.3:c.97_98insA, NM_000087.3:c.449+2T>C, NM_000087.3:c.1972delA, NM_000087.3:c.238G>T, NM_000087.3:c.794G>A, NM_000087.3:c.238G>ARetinitis pigmentosa 49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGA1 gene located on chromosomal region 4p12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.250,600
CNGB1Retinitis pigmentosa tipo 45NM_001297.4NM_001297.4:c.3150delG, NM_001297.4:c.2762_2765delACGA, NM_001297.4:c.2957A>T, NM_001297.4:c.413-1G>A, NM_001297.4:c.218-2A>G, NM_001297.4:c.2492+2T>G, NM_001297.4:c.3462+1G>A, NM_001297.4:c.2653delG, NM_001297.4:c.3425delT, NM_001297.4:c.1122-2A>T, NM_001297.4:c.1958-1G>A, NM_001297.4:c.952C>TRetinitis pigmentosa 45 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB1 gene located on chromosomal region 16q13. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000 to 5:10,000.250,600
CNGB3Achromatopsia type 3NM_019098.4NM_019098.4:c.2011G>T, NM_019098.4:c.1063C>T, NM_019098.4:c.1208G>A, NM_019098.4:c.1672G>T, NM_019098.4:c.819_826delCAGACTCC, NM_019098.4:c.1148delC, NM_019098.4:c.886_890delACTTC, NM_019098.4:c.2048_2049delCA, NM_019098.4:c.446_447insT, NM_019098.4:c.893_897delCAAAA, NM_019098.4:c.887_896delCTTCTACAAAAchromatopsia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is neonatal/Infantile. This disease is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, and reduced or complete loss of color discrimination. Most individuals have complete form, with total lack of function in all three types of cones. Rarely, individuals have incomplete form, with similar, but generally less severe symptoms. The prevalence is 1/30,000-1/50,000.250,600
CNGB3Macular degeneration, juvenileNM_019098.4NM_019098.4:c.1405T>GJuvenile macular degeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is infancy or adolescence. This disease is characterized by blurred or distorted central vision with dark areas. Normally, side vision is not affected, but the perception of color can vary during the later stages of the disease.250,600
COL17A1Epidermolysis bullosa, junctional, non-Herlitz typeNM_000494.3NM_000494.3:c.1898G>A, NM_000494.3:c.3827_3828insC, NM_000494.3:c.2228-3_2235delCAGGTCCTGCTinsTTG, NM_000494.3:c.1706delC, NM_000494.3:c.2336-2A>G, NM_000494.3:c.3897_3900delATCT, NM_000494.3:c.3908G>A, NM_000494.3:c.2336-1G>T, NM_000494.3:c.2965delA, NM_000494.3:c.3043C>T, NM_000494.3:c.3067C>T, NM_000494.3:c.3277+1G>A, NM_000494.3:c.3676C>T, NM_000494.3:c.4319_4320insC, NM_000494.3:c.433C>T, NM_000494.3:c.520_521delAG, NM_000494.3:c.4003_4004delGG, NM_000494.3:c.2551+1G>T, NM_000494.3:c.3800delC, NM_000494.3:c.2564T>G, NM_000494.3:c.2430_2431insCCGA, NM_000494.3:c.2383C>T, NM_000494.3:c.2944_2947+1delGAAGGEpidermolysis bullosa, junctional, non-Herlitz type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL17A1 gene located on chromosomal region 10q24.3. The age of onset is neonatal/infantile. This disease is characterized by a generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.250,600
COL18A1Knobloch syndrome type 1NM_030582.3NM_030582.3:c.3367_3379delCCCCCAGGCCCAC, NM_030582.3:c.3493_3501delGGCCCCCCA, NM_030582.3:c.2797C>T, NM_030582.3:c.995_996insGACGTGAAAGAGGGG, NM_030582.3:c.3502_3511delGGCCCCCCAG, NM_030582.3:c.3618_3618+1delGG, NM_030582.3:c.994_995insGGACGTGAAAGAGGG, NM_030582.3:c.3517_3518delCC, NM_030582.3:c.1535_1536insGACGTGAAAGAGGGG, NM_030582.3:c.2589_2590delAG, NM_030582.3:c.4054_4055delCT, NM_030582.3:c.4463_4464insGKnobloch syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL18A1 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by vitreoretinal and macular degeneration, and occipital encephalocele. The prevalence is <1:1,000,000.250,600
COL4A3Alport syndrome 3B, autosomal recessiveNM_000091.4NM_000091.4:c.345delG, NM_000091.4:c.346C>A, NM_000091.4:c.898G>A, NM_000091.4:c.4421T>C, NM_000091.4:c.2110delC, NM_000091.4:c.343delG, NM_000091.4:c.4420_4424delCTTTT, NM_000091.4:c.5002_*6delAAAAGACACTGAAGCTAA, NM_000091.4:c.2083G>A, NM_000091.4:c.2954G>T, NM_000091.4:c.4484A>G, NM_000091.4:c.4571C>G, NM_000091.4:c.4441C>TAlport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.250,600
COL4A4Alport syndrome, autosomal recessiveNM_000092.4NM_000092.4:c.3713C>A, NM_000092.4:c.4129C>T, NM_000092.4:c.4923C>A, NM_000092.4:c.3601G>A, NM_000092.4:c.2312delG, NM_000092.4:c.71+1G>AAlport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.250,600
COL7A1Epidermolysis bullosa dystrophica, Hallopeau-Siemens typeNM_000094.3NM_000094.3:c.4039G>C, NM_000094.3:c.425A>G, NM_000094.3:c.336C>G, NM_000094.3:c.3809C>T, NM_000094.3:c.4119+1G>T, NM_000094.3:c.6205C>T, NM_000094.3:c.6527_6528insC, NM_000094.3:c.6573+1G>T, NM_000094.3:c.6187C>T, NM_000094.3:c.6752G>A, NM_000094.3:c.6859G>A, NM_000094.3:c.6946G>A, NM_000094.3:c.6670G>T, NM_000094.3:c.1907G>T, NM_000094.3:c.2471_2472insG, NM_000094.3:c.7440+4delC, NM_000094.3:c.7912G>T, NM_000094.3:c.7930-1G>C, NM_000094.3:c.7957G>A, NM_000094.3:c.8245G>A, NM_000094.3:c.8371C>T, NM_000094.3:c.8393T>A, NM_000094.3:c.8440C>T, NM_000094.3:c.8479C>T, NM_000094.3:c.8524_8527+10delGAAGGTGAGGACAG, NM_000094.3:c.887delG, NM_000094.3:c.933C>A, NM_000094.3:c.238G>T, NM_000094.3:c.3831+1G>T, NM_000094.3:c.4373C>T, NM_000094.3:c.6091G>A, NM_000094.3:c.4888C>T, NM_000094.3:c.5052+1G>A, NM_000094.3:c.5096C>T, NM_000094.3:c.4783G>C, NM_000094.3:c.5443G>C, NM_000094.3:c.5532+1G>A, NM_000094.3:c.5821-1G>A, NM_000094.3:c.5287C>T, NM_000094.3:c.706C>T, NM_000094.3:c.7345-1G>A, NM_000094.3:c.592G>A, NM_000094.3:c.7411C>TEpidermolysis bullosa dystrophica, Hallopeau-Siemens type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL7A1 gene located on chromosomal region 3p21.1. The age of onset is neonatal/infantile. This disease is characterized by generalized cutaneous and mucosal blistering and scarring associated with severe deformities and major extracutaneous involvement. The prevalence is <1:1,000,000.250,600
COQ2Primary coenzyme Q10 deficiency type 1NM_015697.7NM_015697.7:c.683A>G, NM_015697.7:c.1197delT, NM_015697.7:c.590G>A, NM_015697.7:c.723delT, NM_015697.7:c.890A>GCoenzyme Q10 deficiency, primary follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ2 gene located on chromosomal region 4q21.23. The age of onset is neonatal/infantile. The phenotypes include an encephalomyopathic form with seizures and ataxia; a multisystem infantile form with encephalopathy, cardiomyopathy and renal failure; a predominantly cerebellar form with ataxia and cerebellar atrophy; Leigh syndrome with growth retardation; and an isolated myopathic form.250,600
CPT2Carnitine palmitoyltransferase deficiency, type 2NM_000098.2NM_000098.2:c.1239_1240delGA, NM_000098.2:c.1369A>T, NM_000098.2:c.1237C>T, NM_000098.2:c.680C>T, NM_000098.2:c.1437C>G, NM_000098.2:c.149C>A, NM_000098.2:c.1784delC, NM_000098.2:c.886C>T, NM_000098.2:c.1763C>G, NM_000098.2:c.359A>G, NM_000098.2:c.370C>T, NM_000098.2:c.1883A>C, NM_000098.2:c.1891C>T, NM_000098.2:c.1148T>A, NM_000098.2:c.638A>G, NM_000098.2:c.725_726delAC, NM_000098.2:c.452G>A, NM_000098.2:c.338C>T, NM_000098.2:c.481C>T, NM_000098.2:c.464dupT, NM_000098.2:c.520G>ACarnitine palmitoyl transferase type 2 deficiency, infantile form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT2 gene located on chromosomal region 1p32. The age of onset is neonatal/infantile. This disease is characterized by a severe fasting intolerance leading to metabolic derangements of hypoketotic hypoglycemia, resulting in coma and seizures, and hepatic encephalopathy leading to liver failure. The prevalence is <1:1,000,000.250,600
CRB1Leber congenital amaurosis type 8NM_201253.2NM_201253.2:c.3299T>G, NM_201253.2:c.3383delT, NM_201253.2:c.3419T>A, NM_201253.2:c.3094G>A, NM_201253.2:c.936T>G, NM_201253.2:c.493_501delGATGGAATT, NM_201253.2:c.3997G>T, NM_201253.2:c.498_506delAATTGATGG, NM_201253.2:c.2688T>A, NM_201253.2:c.613_619delATAGGAA, NM_201253.2:c.2401A>T, NM_201253.2:c.610_616delGAAATAGLeber congenital amaurosis follows an autosomal recessive pattern of inheritance. Type 8 is caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. The age of onset is neonatal/infancy. This disease comprises a group of early-onset childhood retinal dystrophies characterized by vision loss, nystagmus, and severe retinal dysfunction. Patients usually present at birth with profound vision loss and pendular nystagmus. Electroretinogram responses are usually nonrecordable. Other clinical findings may include high hypermetropia, photodysphoria, oculodigital sign, keratoconus, cataracts, and a variable appearance to the fundus.250,600
CRB1Pigmented paravenous chorioretinal atrophyNM_201253.2NM_201253.2:c.484G>APigmented paravenous chorioretinal atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRB1 gene located on chromosomal region 19p12. The age of onset is variable. This disease is characterized by an unusual retinal degeneration characterized by accumulation of pigmentation along retinal veins.250,600
CRB1Retinitis pigmentosa type 12NM_201253.2NM_201253.2:c.3053_3054insTTATA, NM_201253.2:c.3122T>C, NM_201253.2:c.2416G>T, NM_201253.2:c.2843G>A, NM_201253.2:c.3299T>C, NM_201253.2:c.2983G>T, NM_201253.2:c.2290C>TRetinitis pigmentosa 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.250,600
CRXLeber congenital amaurosis type 7NM_000554.4NM_000554.4:c.425A>G, NM_000554.4:c.196G>A, NM_000554.4:c.898T>CLeber congenital amaurosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRX gene located on chromosomal region 19q13.3. The age of onset is neonatal/infantile. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. The prevalence is 2:100,000-3:100,000 newborn.250,600
CTNSCystinosis, ocular nonnephropathicNM_004937.2NM_004937.2:c.589G>A, NM_004937.2:c.853-3C>GOcular non nephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. It presents typical ocular findings of nephropathic cystinosis. However, systemic manifestations are absent and kidney disease does not occur. The prevalence is 1:100,000-1:200,000.250,600
CTNSNephropathic cystinosisNM_004937.2NM_004937.2:c.416C>T, NM_004937.2:c.414G>A, NM_004937.2:c.124G>A, NM_004937.2:c.357_360delCAGC, NM_004937.2:c.397_398delAT, NM_004937.2:c.1015G>A, NM_004937.2:c.646dupA, NM_004937.2:c.283G>T, NM_004937.2:c.329G>T, NM_004937.2:c.506G>ANephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. This disease is characterized by hypothyroidism, insulin-dependent diabetes, hepatosplenomegaly with portal hypertension, and muscle, cerebral and ocular involvement, caused by cystine deposits in various organs. The prevalence is 1:100,000-1:200,000.250,600
CTSKPycnodysostosisNM_000396.3NM_000396.3:c.236G>A, NM_000396.3:c.154A>T, NM_000396.3:c.436G>C, NM_000396.3:c.926T>C, NM_000396.3:c.721C>TPycnodysostosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSK gene located on chromosomal region 1q21. The age of onset is variable. This disease is characterized by osteosclerosis, short stature or dwarfism, acroosteolysis of the distal phalanges, fragile bones associated with spontaneous fractures and dysplasia of the clavicles. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
CYP4V2Bietti crystalline corneoretinal dystrophyNM_207352.3NM_207352.3:c.1523G>A, NM_207352.3:c.130T>A, NM_207352.3:c.327+1G>A, NM_207352.3:c.332T>CBietti crystalline corneoretinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP4V2 gene located on chromosomal region 4q35.2. The age of onset is adult. This disease is characterized by nightblindness, decreased vision, paracentral scotoma, and, in the end stages of the disease, legal blindness.250,600
CYP7B1Congenital bile acid synthesis defect type 3NM_004820.3NM_004820.3:c.1162C>TCongenital bile acid synthesis defect type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by severe neonatal cholestatic liver disease. The prevalence is below 1,000,000.250,600
CYP7B1Spastic paraplegia type 5A, autosomal recessiveNM_004820.3NM_004820.3:c.1460_1461insT, NM_004820.3:c.321_324delACAA, NM_004820.3:c.825T>A, NM_004820.3:c.889A>G, NM_004820.3:c.1456C>T, NM_004820.3:c.187C>TAutosomal recessive spastic paraplegia type 5A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. The prevalence is below 1,000,000.250,600
D2HGDHD-2-Hydroxyglutaric aciduriaNM_152783.4NM_152783.4:c.1315A>G, NM_152783.4:c.1276G>A, NM_152783.4:c.440T>G, NM_152783.4:c.1333_1334delAC, NM_152783.4:c.1123G>T, NM_152783.4:c.1331T>CD-2-Hydroxyglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the D2HGDH gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by extremely variable clinical manifestations, with severe cases characterized by neonatal or early infantile-onset epileptic encephalopathy, and marked hypotonia, and cerebral visual failure, developmental delay, seizures, involuntary movements, and cardiomyopathy are also common in these cases. The prevalence is below 1,000,000.250,600
DBTMaple syrup urine disease type 2NM_001918.3NM_001918.3:c.670G>T, NM_001918.3:c.827T>G, NM_001918.3:c.294C>G, NM_001918.3:c.581C>G, NM_001918.3:c.772+1G>A, NM_001918.3:c.272_275delCAGT, NM_001918.3:c.1281+1G>A, NM_001918.3:c.871C>T, NM_001918.3:c.901C>T, NM_001918.3:c.939G>C, NM_001918.3:c.126T>GMaple syrup urine disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DBT gene located on chromosomal region 1p31. The age of onset is neonatal/infantile. This disease is characterized by a maple syrup odor in the cerumen at birth, poor feeding, lethargy and focal dystonia, followed by progressive encephalopathy and central respiratory failure if untreated. The prevalence is 1/10,000 to 5/10,000.250,600
DCLRE1COmenn syndromeNM_001033855.2NM_001033855.2:c.2T>COmenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency.250,600
DCLRE1CSevere combined immunodeficiency due to DCLRE1C deficiencyNM_001033855.2NM_001033855.2:c.1558_1559insA, NM_001033855.2:c.597C>A, NM_001033855.2:c.780+1delG, NM_001033855.2:c.1639G>T, NM_001033855.2:c.1903_1904insA, NM_001033855.2:c.457G>A, NM_001033855.2:c.1559_1560insASevere combined immunodeficiency due to DCLRE1C deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DCLRE1C gene located on chromosomal region 10p13. The age of onset is neonatal/infantile. This disease is characterized by severe and recurrent infections, diarrhea, failure to thrive, and cell sensitivity to ionizing radiation. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
DFNB31Deafness type 31, autosomal recessiveNM_015404.3NM_015404.3:c.1135C>T, NM_015404.3:c.817C>TDeafness, autosomal recessive type 31 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DFNB31 gene located on chromosomal region 9q32. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. 250,600
DGUOKMitochondrial DNA depletion syndrome type 3NM_080916.2NM_080916.2:c.137A>G, NM_080916.2:c.707+2T>G, NM_080916.2:c.763G>T, NM_080916.2:c.425G>A, NM_080916.2:c.313C>T, NM_080916.2:c.494A>TMitochondrial DNA depletion syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DGUOK gene located on chromosomal region 2p13. The age of onset is neonatal/infantile. This disease is characterized by progressive liver failure, hypoglycemia and neurologic abnormalities including hypotonia, encephalopathy and peripheral neuropathy250,600
DHCR7Smith-Lemli-Opitz syndromeNM_001360.2NM_001360.2:c.1055G>A, NM_001360.2:c.1210C>T, NM_001360.2:c.1054C>T, NM_001360.2:c.461C>G, NM_001360.2:c.151C>T, NM_001360.2:c.1031G>A, NM_001360.2:c.453G>A, NM_001360.2:c.506C>T, NM_001360.2:c.356A>T, NM_001360.2:c.1228G>A, NM_001360.2:c.1A>G, NM_001360.2:c.976G>T, NM_001360.2:c.964-1G>C, NM_001360.2:c.682C>T, NM_001360.2:c.452G>A, NM_001360.2:c.1337G>A, NM_001360.2:c.1342G>A, NM_001360.2:c.730G>A, NM_001360.2:c.292C>T, NM_001360.2:c.904T>C, NM_001360.2:c.907G>A, NM_001360.2:c.841G>A, NM_001360.2:c.744G>T, NM_001360.2:c.724C>T, NM_001360.2:c.725G>A, NM_001360.2:c.866C>T, NM_001360.2:c.278C>T, NM_001360.2:c.839A>G, NM_001360.2:c.832-1G>CSmith-Lemli-Opitz syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHCR7 gene located on chromosomal region 11q13.4. The age of onset is neonatal/infantile. This disease is characterized by multiple congenital anomalies, intellectual deficit, and behavioral problems. The prevalence is 1/20,000 to 1/40,000 newborn.250,600
DPYDDihydropyrimidine dehydrogenase deficiencyNM_000110.3NM_000110.3:c.775A>G, NM_000110.3:c.1679T>G, NM_000110.3:c.299_302delTCAT, NM_000110.3:c.703C>T, NM_000110.3:c.1109_1110delTA, NM_000110.3:c.1905+1G>A, NM_000110.3:c.257C>TDihydropyrimidine dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPYD gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterised by mental and motor retardation and convulsions.250,600
DSPCardiomyopathy, arrhythmogenicNM_004415.2NM_004415.2:c.7000C>T, NM_004415.2:c.88G>A, NM_004415.2:c.6370_6371delCT, NM_004415.2:c.7180_7181delAG, NM_004415.2:c.643G>A, NM_004415.2:c.3098delA, NM_004415.2:c.8188C>TCardiomyopathy, arrhythmogenic follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is a heart condition in which the heart muscle fibers are gradually replaced by fibrous or fibro-fatty tissue, causing abnormal heart electrical rhythms and heart failure. Consequently pumping blood to the body is weakened and sometimes leads to sudden cardiac death. The prevalence is below 1,000,000.250,600
DSPCardiomyopathy, dilated, with woolly hair and keratodermaNM_004415.2NM_004415.2:c.5513G>ACardiomyopathy, dilated, with woolly hair and keratoderma follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterized by a generalized striate keratoderma particularly affecting the palmoplantar epidermis, woolly hair, and dilated left ventricular cardiomyopathy. The prevalence is below 1,000,000.250,600
DSPLethal acantholytic epidermolysis bullosaNM_004415.2NM_004415.2:c.5800C>TLethal acantholytic epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterised by generalized oozing erosions, usually in the absence of blisters. The prevalence is below 1,000,000.250,600
DYSFDysferlinopathyNM_003494.3NM_003494.3:c.1398-2A>G, NM_003494.3:c.1392dupA, NM_003494.3:c.1398-1G>A, NM_003494.3:c.5266C>T, NM_003494.3:c.1620delA, NM_003494.3:c.1481-1G>A, NM_003494.3:c.3041A>G, NM_003494.3:c.3985C>G, NM_003494.3:c.4090C>T, NM_003494.3:c.5713C>T, NM_003494.3:c.1053+1G>A, NM_003494.3:c.200_201delTGinsAT, NM_003494.3:c.2869C>T, NM_003494.3:c.2870_2874delAGACC, NM_003494.3:c.458-390C>T, NM_003494.3:c.757C>T, NM_003494.3:c.3065G>A, NM_003494.3:c.393_394delCC, NM_003494.3:c.3859A>T, NM_003494.3:c.5429G>A, NM_003494.3:c.3130C>T, NM_003494.3:c.3444_3445delTGinsAA, NM_003494.3:c.1638+2T>A, NM_003494.3:c.4108_4109delGT, NM_003494.3:c.3641delC, NM_003494.3:c.1368C>A, NM_003494.3:c.4872_4876delGCCCGinsCCCC, NM_003494.3:c.5341-2A>C, NM_003494.3:c.509C>A, NM_003494.3:c.5836_5839delCAGC, NM_003494.3:c.5644C>T, NM_003494.3:c.1861G>C, NM_003494.3:c.5429+1G>T, NM_003494.3:c.3957delC, NM_003494.3:c.5998C>T, NM_003494.3:c.3724C>T, NM_003494.3:c.5525+1G>A, NM_003494.3:c.3477C>A, NM_003494.3:c.3708delA, NM_003494.3:c.5992G>T, NM_003494.3:c.3113G>C, NM_003494.3:c.1216T>C, NM_003494.3:c.3903delGDysferlinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. Dysferlinopathy includes a spectrum of muscle disease characterized by two main phenotypes: Miyoshi myopathy with primarily distal weakness and limb-girdle muscular dystrophy type 2B (LGMD2B) with primarily proximal weakness. Miyoshi myopathy (median age of onset 19 years) is characterized by muscle weakness and atrophy, most marked in the distal parts of the legs, especially the gastrocnemius and soleus muscles. Over a period of years, the weakness and atrophy spread to the thighs and gluteal muscles. The forearms may become mildly atrophic with decrease in grip strength; the small muscles of the hands are spared. LGMD2B is characterized by early weakness and atrophy of the pelvic and shoulder girdle muscles in adolescence or young adulthood, with slow progression. Other phenotypes are scapuloperoneal syndrome, distal myopathy with anterior tibial onset, elevated serum CK concentration only, and congenital muscular dystrophy. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
DYSFMiyoshi myopathyNM_003494.3NM_003494.3:c.1555G>A, NM_003494.3:c.5509G>A, NM_003494.3:c.5077C>T, NM_003494.3:c.5698_5699delAG, NM_003494.3:c.3892A>G, NM_003494.3:c.286A>C, NM_003494.3:c.1120G>C, NM_003494.3:c.1284+2T>C, NM_003494.3:c.5497G>T, NM_003494.3:c.3478C>T, NM_003494.3:c.2997G>T, NM_003494.3:c.3121C>T, NM_003494.3:c.1813C>T, NM_003494.3:c.3181_3182insAGGCGG, NM_003494.3:c.937+1G>A, NM_003494.3:c.3158T>G, NM_003494.3:c.1276G>A, NM_003494.3:c.701G>A, NM_003494.3:c.610C>T, NM_003494.3:c.5594delG, NM_003494.3:c.3112C>T, NM_003494.3:c.4199C>A, NM_003494.3:c.5999G>A, NM_003494.3:c.4756C>T, NM_003494.3:c.6124C>T, NM_003494.3:c.2966C>T, NM_003494.3:c.663+1G>C, NM_003494.3:c.3175-2A>T, NM_003494.3:c.895G>T, NM_003494.3:c.4985C>T, NM_003494.3:c.6203C>TMiyoshi myopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. This disease is characterised by weakness in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
DYSFMuscular dystrophy, limb girdle type 2BNM_003494.3NM_003494.3:c.5979dupA, NM_003494.3:c.565C>G, NM_003494.3:c.1663C>T, NM_003494.3:c.1873G>T, NM_003494.3:c.1834C>T, NM_003494.3:c.5201A>G, NM_003494.3:c.895G>A, NM_003494.3:c.3805G>T, NM_003494.3:c.4003G>A, NM_003494.3:c.4253G>AMuscular dystrophy, limb girdle type 2B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. This disease is characterised by limb-girdle weakness and atrophy mostly in the shoulder pelvic girdle. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
EDAHypohidrotic ectodermal dysplasia, X-linkedNM_001399.4NM_001399.4:c.206G>T, NM_001399.4:c.463C>T, NM_001399.4:c.187G>A, NM_001399.4:c.573_574insT, NM_001399.4:c.466C>T, NM_001399.4:c.826C>T, NM_001399.4:c.183C>G, NM_001399.4:c.181T>C, NM_001399.4:c.467G>A, NM_001399.4:c.671G>C, NM_001399.4:c.1045G>AHypohidrotic ectodermal dysplasia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EDA gene located on chromosomal region Xq12-q13.1. The age of onset is neonatal/infantile. This disease is characterized by malformation of ectodermal structures such as skin, hair, teeth and sweat glands. The prevalence is 1/5,000 to 1/10,000 newborns.250,600
ENO3Glycogen storage disease type 13NM_053013.3NM_053013.3:c.667+1G>T, NM_053013.3:c.1121G>A, NM_053013.3:c.953delA, NM_053013.3:c.692_707dupTCCAGGCGGCTGGTTA, NM_053013.3:c.467G>A, NM_053013.3:c.1303T>CGlycogen storage disease type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENO3 gene located on chromosomal region 17p13.2. The age of onset is adult. This disease is characterised by exercise intolerance and myalgia due to severe enolase deficiency in muscle. The prevalence is below 1/1,000,000.250,600
ERCC2TrichothiodystrophyNM_000400.3NM_000400.3:c.1972C>TTrichothiodystrophy is a heterogeneous group of disorders that follows an autosomal recessive pattern of inheritance. It is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.32. The age of onset is neonatal or infantile. This disease is characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. The abnormalities are usually obvious at birth, with variable clinical expression.250,600
ERCC2Xeroderma pigmentosum complementation group DNM_000400.3NM_000400.3:c.1308-1G>A, NM_000400.3:c.1454T>C, NM_000400.3:c.1621A>C, NM_000400.3:c.1703_1704delTT, NM_000400.3:c.1381C>G, NM_000400.3:c.719-1G>A, NM_000400.3:c.2230_2233dupCTAG, NM_000400.3:c.183+2T>A, NM_000400.3:c.567G>A, NM_000400.3:c.1354C>T, NM_000400.3:c.2047C>T, NM_000400.3:c.1304T>G, NM_000400.3:c.2176C>T, NM_000400.3:c.950-2A>G, NM_000400.3:c.949+1G>AXeroderma pigmentosum complementation group D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.3. The age of onset is variable. This disease is characterised by typical xeroderma pigmentosum manifestations (photosensitivity of skin with burning, freckling, and dryness of skin, skin cancers) associated with a spectrum of neurological anomalies (from no abnormality to severe neurological disease).250,600
ERCC4Xeroderma pigmentosum complementation group FNM_005236.2NM_005236.2:c.49G>T, NM_005236.2:c.1467_1468insA, NM_005236.2:c.2281_2284delTTTG, NM_005236.2:c.2T>C, NM_005236.2:c.538_539delAG, NM_005236.2:c.706T>C, NM_005236.2:c.2395C>TXeroderma pigmentosum complementation group F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC4 gene located on chromosomal region 16p13.12. The age of onset is variable. This disease is characterised very mild skin symptoms and no ocular or neurological disease. The prevalence is 1/1,000,000.250,600
ERCC5Xeroderma pigmentosum complementation group GNM_000123.3NM_000123.3:c.2620G>A, NM_000123.3:c.463_464insA, NM_000123.3:c.526C>T, NM_000123.3:c.88+2T>C, NM_000123.3:c.2144dupA, NM_000123.3:c.2375C>T, NM_000123.3:c.381-2A>G, NM_000123.3:c.2573T>C, NM_000123.3:c.406C>T, NM_000123.3:c.215C>A, NM_000123.3:c.787C>T, NM_000123.3:c.2751delAXeroderma pigmentosum complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC5 gene located on chromosomal region 13q33. The age of onset is variable. This disease is characterised by variable clinical manifestations, as some patients present with a mild xeroderma pigmentosum phenotype (UV sensitivity, hyper- or hypo-pigmented skin lesions and increased incidence of skin cancer) and others combine symptoms of xeroderma pigmentosum with systemic and neurological manifestations of Cockayne syndrome. The prevalence is 1/1,000,000.250,600
ERCC6Cerebrooculofacioskeletal syndrome tipo 1NM_000124.3NM_000124.3:c.2047C>TCerebrooculofacioskeletal syndrome tipo 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterised by congenital microcephaly, congenital cataract and/or microphthalmia, arthrogryposis, severe psychomotor developmental delay, height-weight growth delay (principally postnatal) and facial dysmorphism (prominent metopic suture, micrognathism). The prevalence is below 1,000,000.250,600
ERCC6Cockayne syndrome type BNM_000124.3NM_000124.3:c.207_208insG, NM_000124.3:c.2203C>T, NM_000124.3:c.1357C>T, NM_000124.3:c.48_49delCT, NM_000124.3:c.3592_3593insGA, NM_000124.3:c.422+1G>A, NM_000124.3:c.1550G>A, NM_000124.3:c.3284C>G, NM_000124.3:c.2587C>T, NM_000124.3:c.3862C>TCockayne syndrome type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterised by growth failure at birth, with little or no postnatal neurologic development.250,600
EYSRetinitis pigmentosa type 25NM_001142800.1NM_001142800.1:c.5044G>T, NM_001142800.1:c.9036delT, NM_001142800.1:c.490C>T, NM_001142800.1:c.5928-2A>G, NM_001142800.1:c.571dupA, NM_001142800.1:c.4597_4613delTCAAGCAACCAGAGACT, NM_001142800.1:c.7822C>T, NM_001142800.1:c.5857G>T, NM_001142800.1:c.6170delA, NM_001142800.1:c.8569G>T, NM_001142800.1:c.232delT, NM_001142800.1:c.6102_6103insT, NM_001142800.1:c.8834G>A, NM_001142800.1:c.1211_1212insA, NM_001142800.1:c.4350_4356delTATAGCT, NM_001142800.1:c.4469_4470insAGCCCCTC, NM_001142800.1:c.8648_8655delCATGCAGA, NM_001142800.1:c.4120C>T, NM_001142800.1:c.863-4_863-3insT, NM_001142800.1:c.8629_8632dupACAG, NM_001142800.1:c.9299_9302delCTCA, NM_001142800.1:c.103C>T, NM_001142800.1:c.2826_2827delAT, NM_001142800.1:c.4045C>T, NM_001142800.1:c.5757_5758insT, NM_001142800.1:c.8408dupA, NM_001142800.1:c.7095T>G, NM_001142800.1:c.3329C>G, NM_001142800.1:c.9405T>ARetinitis pigmentosa 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EYS gene located on chromosomal region 6q12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000.250,600
F11Factor 11 deficiencyNM_000128.3NM_000128.3:c.1613C>T, NM_000128.3:c.166T>C, NM_000128.3:c.403G>T, NM_000128.3:c.731A>G, NM_000128.3:c.809A>T, NM_000128.3:c.1693G>A, NM_000128.3:c.1211C>A, NM_000128.3:c.901T>C, NM_000128.3:c.595+3A>G, NM_000128.3:c.438C>AFactor 11 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F11 gene located on chromosomal region 4q35. The age of onset is variable. This disease is characterized by reduced levels and activity of factor XI resulting in moderate bleeding symptoms, usually occurring after trauma or surgery. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
F5Factor 5 deficiencyNM_000130.4NM_000130.4:c.4876delA, NM_000130.4:c.439G>T, NM_000130.4:c.6419G>A, NM_000130.4:c.2401C>T, NM_000130.4:c.5521G>A, NM_000130.4:c.1083G>A, NM_000130.4:c.5189A>G, NM_000130.4:c.3799delC, NM_000130.4:c.6304C>TFactor 5 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F5 gene located on chromosomal region 1q23. The age of onset is variable. This disease is characterized by mild to severe bleeding symptoms usually occurring after trauma or surgery. In severe forms of the disease, there can be a risk of intracranial, pulmonary or gastrointestinal bleedings. The severity of the bleeding manifestations correlates with the FV levels. The prevalence is 1/5,000.250,600
F5ThrombosisNM_000130.4NM_000130.4:c.1000A>GDeep venous thrombosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F5 gene located on chromosomal region 1q23. The age of onset is variable. This disease is characterized by a poor anticoagulant response to activated Protein C and an increased risk for venous thromboembolism. Deep venous thrombosis and pulmonary embolism are the most common manifestations, but thrombosis in unusual locations also occurs. The prevalence is 1/5,000.250,600
F9Hemophilia BNM_000133.3NM_000133.3:c.1150C>T, NM_000133.3:c.52T>C, NM_000133.3:c.1031T>C, NM_000133.3:c.82T>C, NM_000133.3:c.1136G>A, NM_000133.3:c.79G>A, NM_000133.3:c.19A>T, NM_000133.3:c.80A>THemophilia B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F9 gene located on chromosomal region Xq27.1-q27.2. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor IX deficiency. The prevalence is 1/100,000 to 9/100,000.250,600
FAHTyrosinemia type 1NM_000137.2NM_000137.2:c.1141A>G, NM_000137.2:c.1069G>T, NM_000137.2:c.1090G>T, NM_000137.2:c.401C>A, NM_000137.2:c.456G>A, NM_000137.2:c.192G>T, NM_000137.2:c.607-6T>G, NM_000137.2:c.707-1G>A, NM_000137.2:c.939delC, NM_000137.2:c.103G>A, NM_000137.2:c.982C>T, NM_000137.2:c.837+1G>A, NM_000137.2:c.1009G>A, NM_000137.2:c.47A>T, NM_000137.2:c.554-1G>T, NM_000137.2:c.1027G>T, NM_000137.2:c.1062+5G>A, NM_000137.2:c.786G>A, NM_000137.2:c.1021C>T, NM_000137.2:c.782C>TTyrosinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAH gene located on chromosomal region 15q25.1. The age of onset is variable. This disease is characterized by progressive liver disease, renal tubular dysfunction, porphyria-like crises and a dramatic improvement in prognosis following treatment with nitisinone. The birth incidence is 1/100,000, notably in Québec, Canada, and the prevalence is 1/100,000 to 1/120,000 newborns.250,600
FANCAFanconi anemia, complementation group ANM_000135.2NM_000135.2:c.3788_3790delTCT, NM_000135.2:c.2303T>C, NM_000135.2:c.3558_3559insG, NM_000135.2:c.4130C>G, NM_000135.2:c.233_236delTTGA, NM_000135.2:c.3763G>T, NM_000135.2:c.1115_1118delTTGG, NM_000135.2:c.131_132insAFanconi anemia complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCA gene located on chromosomal region 16q24.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
FANCCFanconi anemia, complementation group CNM_000136.2NM_000136.2:c.1642C>T, NM_000136.2:c.37C>T, NM_000136.2:c.996+1G>T, NM_000136.2:c.67delG, NM_000136.2:c.416G>A, NM_000136.2:c.1015delA, NM_000136.2:c.1487T>G, NM_000136.2:c.1103_1104delTGFanconi anemia complementation group C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCC gene located on chromosomal region 9q22.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
FANCD2Fanconi anemia, complementation group D2NM_033084.3NM_033084.3:c.1278+1delG, NM_033084.3:c.2152C>T, NM_033084.3:c.2494+2T>C, NM_033084.3:c.958C>T, NM_033084.3:c.2444G>A, NM_033084.3:c.782A>T, NM_033084.3:c.904C>TFanconi anemia complementation group D2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCD2 gene located on chromosomal region 3p26. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
FANCGFanconi anemia, complementation group GNM_004629.1NM_004629.1:c.1795_1804delTGGATCCGTC, NM_004629.1:c.313G>T, NM_004629.1:c.637_643delTACCGCC, NM_004629.1:c.1480+1G>C, NM_004629.1:c.1852_1853delAA, NM_004629.1:c.510+1G>A, NM_004629.1:c.1077-2A>G, NM_004629.1:c.908_909insCTFanconi anemia complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCG gene located on chromosomal region 9p13. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
FANCIFanconi anemia, complementation group INM_001113378.1NM_001113378.1:c.3816+1G>A, NM_001113378.1:c.52C>T, NM_001113378.1:c.989_991delTAA, NM_001113378.1:c.2097C>G, NM_001113378.1:c.3466G>C, NM_001113378.1:c.2292-1G>A, NM_001113378.1:c.3492delG, NM_001113378.1:c.3853C>T, NM_001113378.1:c.3626_3627delGT, NM_001113378.1:c.3854G>AFanconi anemia complementation group I follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCI gene located on chromosomal region 15q26.1. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
FANCLFanconi anemia, complementation group LNM_018062.3NM_018062.3:c.1051_1052delAG, NM_018062.3:c.1066_1067delAG, NM_018062.3:c.1096_1099dupATTA, NM_018062.3:c.1099_1100insATTAFanconi anemia complementation group L follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCL gene located on chromosomal region 2p16.1. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
FANCMFanconi anemia, complementation group MNM_020937.2NM_020937.2:c.2171C>A, NM_020937.2:c.5766_5769delGACT, NM_020937.2:c.5101C>T, NM_020937.2:c.1072G>T, NM_020937.2:c.2996_2997insC, NM_020937.2:c.2586_2589delAAAA, NM_020937.2:c.5791C>T, NM_020937.2:c.624_625delAA, NM_020937.2:c.5569G>A, NM_020937.2:c.5764_5767delCTGAFanconi anemia complementation group M follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCM gene located on chromosomal region 14q21.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
FGBCongenital afibrinogenemiaNM_005141.4NM_005141.4:c.1289G>A, NM_005141.4:c.1148T>G, NM_005141.4:c.794C>TCongenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGB gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000.250,600
FIG4Charcot-Marie-Tooth disease type 4JNM_014845.5NM_014845.5:c.592C>T, NM_014845.5:c.831_838delTAAATTTG, NM_014845.5:c.547C>T, NM_014845.5:c.501C>G, NM_014845.5:c.737G>A, NM_014845.5:c.122T>C, NM_014845.5:c.2296_2297insGCharcot-Marie-Tooth disease type 4J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by rapidly progressive, asymmetric motor neuron degeneration with slow nerve conduction velocities, weakness and paralysis, without sensory loss. The prevalence is 4/100,000 to 8/100,000.250,600
FIG4Yunis-Varon syndromeNM_014845.5NM_014845.5:c.311G>AYunis-Varon syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by skeletal defects, including cleidocranial dysplasia and digital anomalies, and severe neurologic involvement with neuronal loss. Enlarged cytoplasmic vacuoles are found in neurons, muscle, and cartilage. The disorder is usually lethal in infancy. The prevalence is 4/100,000 to 8/100,000.250,600
FKRPCongenital muscular dystrophy type 5BNM_024301.4NM_024301.4:c.235G>A, NM_024301.4:c.1343C>T, NM_024301.4:c.1387A>G, NM_024301.4:c.1154C>ACongenital muscular dystrophy type 5B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is neonatal/infantile. This disease is characterized by hypotonia, muscle wasting, weakness or delayed motor milestones. The prevalence is 1/14,500 to 1/123,000.250,600
FKRPLimb-girdle muscular dystrophy type 2I, autosomal recessiveNM_024301.4NM_024301.4:c.160C>TAutosomal recessive limb-girdle muscular dystrophy type 2I follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is infantile. This disease is characterized by proximal limb girdle weakness predominant in the legs, together with bilateral moderate scapulae winging, abdominal muscle weakness, waddling gait, calf hypertrophy, cardiomyopathy and respiratory insufficiency. The prevalence is 1/14,500 to 1/123,000.250,600
FMR1Fragile X syndrome-(CGG)n pre-mutated allele (Detection by PCR and TP-PCR)Fragile X syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FMR1 gene located on chromosomal region Xq27.3. The symptoms are variable depending on the range of CGG triplet expansion. In complete mutation the onset is infantile in men and is characterized by intellectual disability, characteristic appearance (large head, long face, prominent forehead and chin, protruding ears) joint laxity and large testes after puberty. In carrier female, the symptoms are milder and include primary ovarian insufficiency. The prevalence is 1/2,500 (full mutation allele) to 1/4,000 (prevalence of symptomatic cases) for both genders.250,600
FRAS1Fraser syndromeNM_025074.6NM_025074.6:c.7813C>T, NM_025074.6:c.832_835delTGTG, NM_025074.6:c.11159_11166delAGCTGGAG, NM_025074.6:c.776T>G, NM_025074.6:c.6991_6992insGG, NM_025074.6:c.6433C>T, NM_025074.6:c.3799C>T, NM_025074.6:c.1071+1_1071+4delGTGA, NM_025074.6:c.4969+1_4969+2insTAGC, NM_025074.6:c.5605_5606insTFraser syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the genes FRAS1 (located on chromosomal region 4q21.21) and FREM2 (located on chromosomal region 13q13.3). The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000.250,600
G6PCGlycogen storage disease type 1aNM_000151.3NM_000151.3:c.508C>T, NM_000151.3:c.551G>A, NM_000151.3:c.447-1G>A, NM_000151.3:c.1039C>T, NM_000151.3:c.562G>C, NM_000151.3:c.380_381insTA, NM_000151.3:c.497T>G, NM_000151.3:c.247C>T, NM_000151.3:c.113A>T, NM_000151.3:c.229T>C, NM_000151.3:c.230+1G>C, NM_000151.3:c.47C>G, NM_000151.3:c.883C>T, NM_000151.3:c.370G>A, NM_000151.3:c.626A>G, NM_000151.3:c.248G>AGlycogen storage disease type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000.250,600
GAAGlycogen storage disease type 2NM_000152.3NM_000152.3:c.118C>T, NM_000152.3:c.1316T>A, NM_000152.3:c.1799G>A, NM_000152.3:c.1827_1828insA, NM_000152.3:c.1846_1847insA, NM_000152.3:c.1115A>T, NM_000152.3:c.1552-3C>G, NM_000152.3:c.1445C>T, NM_000152.3:c.2238G>C, NM_000152.3:c.1327-2A>G, NM_000152.3:c.1650dupG, NM_000152.3:c.2238G>A, NM_000152.3:c.307T>G, NM_000152.3:c.230_240delCAGTGCCCACA, NM_000152.3:c.2512C>T, NM_000152.3:c.1431delT, NM_000152.3:c.1561G>A, NM_000152.3:c.1465G>A, NM_000152.3:c.1548G>A, NM_000152.3:c.546G>A, NM_000152.3:c.1064T>C, NM_000152.3:c.877G>A, NM_000152.3:c.925G>A, NM_000152.3:c.768_769insT, NM_000152.3:c.2560C>T, NM_000152.3:c.655G>A, NM_000152.3:c.1408_1410delAAC, NM_000152.3:c.953T>C, NM_000152.3:c.1933G>T, NM_000152.3:c.1935C>A, NM_000152.3:c.1585_1586delTCinsGT, NM_000152.3:c.1927G>A, NM_000152.3:c.2041-1G>A, NM_000152.3:c.2066_2070dupAGCCG, NM_000152.3:c.2105G>T, NM_000152.3:c.2237G>A, NM_000152.3:c.525delT, NM_000152.3:c.546+1_546+4delGTGG, NM_000152.3:c.2544delC, NM_000152.3:c.1912G>T, NM_000152.3:c.1634C>T, NM_000152.3:c.710C>T, NM_000152.3:c.2015G>A, NM_000152.3:c.546G>C, NM_000152.3:c.2012T>G, NM_000152.3:c.853C>T, NM_000152.3:c.697delAGlycogen storage disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAA gene located on chromosomal region 17q25.3. There are two forms: adult and infantile.The age of onset in this last form is before the age of three months. This disease is characterized by severe hypotonia, hypertrophic cardiomyopathy and progressive hepatomegaly. The incidence is 1/57,000 for the adult form and 1/138,000 for infantile form.250,600
GALCKrabbe diseaseNM_000153.3NM_000153.3:c.1591C>T, NM_000153.3:c.1161+2T>G, NM_000153.3:c.1586C>T, NM_000153.3:c.1592G>A, NM_000153.3:c.1489+1_1489+2delGT, NM_000153.3:c.582+1G>A, NM_000153.3:c.388G>A, NM_000153.3:c.430delA, NM_000153.3:c.1695delT, NM_000153.3:c.1472delA, NM_000153.3:c.1004A>G, NM_000153.3:c.1153G>T, NM_000153.3:c.658C>T, NM_000153.3:c.1543G>A, NM_000153.3:c.332G>A, NM_000153.3:c.334A>G, NM_000153.3:c.205C>T, NM_000153.3:c.1796T>G, NM_000153.3:c.1814dupA, NM_000153.3:c.1700A>C, NM_000153.3:c.1723_1724insT, NM_000153.3:c.1964delC, NM_000153.3:c.236G>A, NM_000153.3:c.1488_1489+2delTGGT, NM_000153.3:c.453G>A, NM_000153.3:c.1488_1489delTG, NM_000153.3:c.628A>T, NM_000153.3:c.655C>T, NM_000153.3:c.953C>G, NM_000153.3:c.2056T>CKrabbe disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALC gene located on chromosomal region 14q31.3. There are two forms of the disease: infantile form (2-6 months onset) more severe and adult form less severe. It is a degenerative disorder that affects the nervous system characterized by a muscle stiffness, blindness, deafness, and eventually death. The incidence is 1/100,000-1/250,000 and the prevalence is 1/100,000.250,600
GALTGalactosemiaNM_000155.3NM_000155.3:c.130G>A, NM_000155.3:c.132delG, NM_000155.3:c.118G>T, NM_000155.3:c.265T>G, NM_000155.3:c.289_291delAAC, NM_000155.3:c.1138T>C, NM_000155.3:c.113A>C, NM_000155.3:c.152G>A, NM_000155.3:c.1048delA, NM_000155.3:c.290A>G, NM_000155.3:c.221T>C, NM_000155.3:c.253-2A>G, NM_000155.3:c.425T>A, NM_000155.3:c.428C>T, NM_000155.3:c.442C>T, NM_000155.3:c.143G>C, NM_000155.3:c.443G>A, NM_000155.3:c.158G>A, NM_000155.3:c.18delC, NM_000155.3:c.199C>T, NM_000155.3:c.200G>A, NM_000155.3:c.203A>C, NM_000155.3:c.218_219delCT, NM_000155.3:c.512T>C, NM_000155.3:c.547C>A, NM_000155.3:c.552C>A, NM_000155.3:c.563A>G, NM_000155.3:c.565_578delGTATGGGCCAGCAG, NM_000155.3:c.568T>C, NM_000155.3:c.580T>C, NM_000155.3:c.584T>C, NM_000155.3:c.598delC, NM_000155.3:c.601C>T, NM_000155.3:c.602G>A, NM_000155.3:c.1030C>A, NM_000155.3:c.510C>A, NM_000155.3:c.617A>G, NM_000155.3:c.619C>T, NM_000155.3:c.626A>G, NM_000155.3:c.634C>T, NM_000155.3:c.688-2A>C, NM_000155.3:c.692G>A, NM_000155.3:c.292G>A, NM_000155.3:c.329-2A>C, NM_000155.3:c.367C>T, NM_000155.3:c.377+7A>C, NM_000155.3:c.386T>C, NM_000155.3:c.607G>A, NM_000155.3:c.610C>T, NM_000155.3:c.413C>T, NM_000155.3:c.416T>G, NM_000155.3:c.41delinsTT, NM_000155.3:c.904+1G>T, NM_000155.3:c.905-2A>G, NM_000155.3:c.907G>A, NM_000155.3:c.442G>A, NM_000155.3:c.947G>A, NM_000155.3:c.443G>C, NM_000155.3:c.445dupG, NM_000155.3:c.997C>G, NM_000155.3:c.997C>T, NM_000155.3:c.998G>A, NM_000155.3:c.793C>G, NM_000155.3:c.820+13A>G, NM_000155.3:c.1052delC, NM_000155.3:c.844C>G, NM_000155.3:c.855G>T, NM_000155.3:c.719_728delTAGTACTGGT, NM_000155.3:c.772C>T, NM_000155.3:c.939G>A, NM_000155.3:c.71_72insA, NM_000155.3:c.404C>T, NM_000155.3:c.508-1G>C, NM_000155.3:c.775C>T, NM_000155.3:c.400delT, NM_000155.3:c.502_504delGTG, NM_000155.3:c.957C>A, NM_000155.3:c.823C>G, NM_000155.3:c.505C>A, NM_000155.3:c.1006A>T, NM_000155.3:c.985T>C, NM_000155.3:c.790delC, NM_000155.3:c.790_792delinsTAGGalactosemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALT gene located on chromosomal region 9p13.3. The age of onset is neonatal. This disease is characterized by feeding difficulties, lethargy, and severe liver disease. Long-term complications appear including cognitive impairments, motor deficits, and ovarian dysfunction with reduced fertility in women and diminished bone density. The prevalence is 1/40,000-1/60,000.250,600
GANGiant axonal neuropathyNM_022041.3NM_022041.3:c.1447C>T, NM_022041.3:c.1456G>A, NM_022041.3:c.1684C>G, NM_022041.3:c.1429C>T, NM_022041.3:c.601C>T, NM_022041.3:c.413G>A, NM_022041.3:c.505G>A, NM_022041.3:c.1268T>CGiant axonal neuropathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAN gene located on chromosomal region 16q23.2. The age of onset is infantile. This disease is characterized by a progressive motor and sensitive peripheral and central nervous system neuropathy. Twenty families have been reported with this disease but the frequency is likely to be under-estimated.250,600
GBAGaucher diseaseNM_001005741.2NM_001005741.2:c.1093G>A, NM_001005741.2:c.1090G>A, NM_001005741.2:c.1043C>T, NM_001005741.2:c.1274dupA, NM_001005741.2:c.1098dupA, NM_001005741.2:c.1085C>T, NM_001005741.2:c.1102C>T, NM_001005741.2:c.1049A>G, NM_001005741.2:c.1240G>T, NM_001005741.2:c.1246G>A, NM_001005741.2:c.1301G>C, NM_001005741.2:c.1088T>C, NM_001005741.2:c.1348T>A, NM_001005741.2:c.1361C>G, NM_001005741.2:c.1342G>C, NM_001005741.2:c.1448T>C, NM_001005741.2:c.1448T>G, NM_001005741.2:c.1504C>T, NM_001005741.2:c.1447_1466delCTGGACGCAGTGGCACTGATinsTG, NM_001005741.2:c.254G>A, NM_001005741.2:c.259C>T, NM_001005741.2:c.1053G>T, NM_001005741.2:c.160G>T, NM_001005741.2:c.431T>G, NM_001005741.2:c.475C>T, NM_001005741.2:c.476G>A, NM_001005741.2:c.481C>T, NM_001005741.2:c.487delG, NM_001005741.2:c.497A>T, NM_001005741.2:c.508C>T, NM_001005741.2:c.1141T>G, NM_001005741.2:c.115+1G>A, NM_001005741.2:c.1171G>C, NM_001005741.2:c.1174C>G, NM_001005741.2:c.354G>C, NM_001005741.2:c.1060G>C, NM_001005741.2:c.1208G>C, NM_001005741.2:c.1228C>G, NM_001005741.2:c.123A>G, NM_001005741.2:c.1240G>C, NM_001005741.2:c.914delC, NM_001005741.2:c.517A>C, NM_001005741.2:c.1295G>T, NM_001005741.2:c.1307T>C, NM_001005741.2:c.1265_1319del, NM_001005741.2:c.1319C>T, NM_001005741.2:c.1309G>T, NM_001005741.2:c.1226A>G, NM_001005741.2:c.407C>A, NM_001005741.2:c.1343A>T, NM_001005741.2:c.84_85insG, NM_001005741.2:c.518C>T, NM_001005741.2:c.1391A>C, NM_001005741.2:c.509G>T, NM_001005741.2:c.1604G>A, NM_001005741.2:c.84dupG, NM_001005741.2:c.535G>C, NM_001005741.2:c.586A>C, NM_001005741.2:c.1297G>T, NM_001005741.2:c.1184C>T, NM_001005741.2:c.1192C>TGaucher disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBA gene located on chromosomal region 1q22. Gaucher disease encompasses a continuum of clinical findings from a perinatal lethal disorder to an asymptomatic type. There are three major clinical types (1, 2, and 3) and two other subtypes (perinatal-lethal and cardiovascular). Type 1 is characterized by the presence of clinical or radiographic evidence of bone disease, hepatosplenomegaly, anemia and thrombocytopenia, lung disease, and the absence of primary central nervous system disease. GD types 2 and 3 are characterized by the presence of primary neurologic disease. Type 2 has an onset before age two years, limited psychomotor development, and a rapidly progressive course with death by age two to four years. Type 3 may have onset before age two years, but often have a more slowly progressive course, with survival into the third or fourth decade. The perinatal-lethal form is associated with ichthyosiform or collodion skin abnormalities or with nonimmune hydrops fetalis. The cardiovascular form is characterized by calcification of the aortic and mitral valves, mild splenomegaly, corneal opacities, and supranuclear ophthalmoplegia. Cardiopulmonary complications have been described with all the clinical subtypes, although varying in frequency and severity. The incidence is 1/60,000 and the prevalence is approximately 1/100,000.250,600
GBE1Glycogen storage disease type 4NM_000158.3NM_000158.3:c.1571G>A, NM_000158.3:c.1570C>T, NM_000158.3:c.1774G>T, NM_000158.3:c.771T>A, NM_000158.3:c.1543C>T, NM_000158.3:c.1883A>G, NM_000158.3:c.2052+1G>A, NM_000158.3:c.986A>C, NM_000158.3:c.466_470delCGTAT, NM_000158.3:c.1604A>GGlycogen storage disease type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is infantile. This disease is characterized by failure to thrive; hepatomegaly, liver dysfunction, and progressive liver cirrhosis; hypotonia; cardiomyopathy and, finally, death.250,600
GBE1Polyglucosan body disease, adultNM_000158.3NM_000158.3:c.986A>GPolyglucosan body disease, adult form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is late-onset, slowly progressive disorder affecting the central and peripheral nervous systems. This disease is characterized by a variable combination of cognitive impairment, pyramidal tetraparesis, peripheral neuropathy, and neurogenic bladder. Other manifestations include cerebellar dysfunction and extrapyramidal signs.250,600
GCDHGlutaric acidemia type 1NM_000159.3NM_000159.3:c.1093G>A, NM_000159.3:c.1060G>C, NM_000159.3:c.542A>G, NM_000159.3:c.442G>A, NM_000159.3:c.1199dupT, NM_000159.3:c.572T>C, NM_000159.3:c.1060G>A, NM_000159.3:c.1247C>T, NM_000159.3:c.74C>A, NM_000159.3:c.947C>A, NM_000159.3:c.1168G>C, NM_000159.3:c.416C>T, NM_000159.3:c.1198G>A, NM_000159.3:c.636-1G>A, NM_000159.3:c.1204C>T, NM_000159.3:c.1244-2A>C, NM_000159.3:c.751C>T, NM_000159.3:c.1262C>T, NM_000159.3:c.1148G>A, NM_000159.3:c.680G>C, NM_000159.3:c.883T>C, NM_000159.3:c.1015A>G, NM_000159.3:c.764C>T, NM_000159.3:c.271+1G>A, NM_000159.3:c.743C>T, NM_000159.3:c.877G>A, NM_000159.3:c.914C>T, NM_000159.3:c.1002_1003delGA, NM_000159.3:c.383G>A, NM_000159.3:c.769C>TGlutaric acidemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCDH gene located on chromosomal region 19p13.2. The age of onset is infantile or neonatal. This disease is characterized by encephalopathic crises resulting in striatal injury and a severe dystonic dyskinetic movement disorder. The prevalence is 1 in 100,000 births.250,600
GJB2Deafness type 1A, autosomal recessiveNM_004004.5NM_004004.5:c.176_191delGCTGCAAGAACGTGTG, NM_004004.5:c.169C>T, NM_004004.5:c.270dupA, NM_004004.5:c.239A>C, NM_004004.5:c.269T>C, NM_004004.5:c.427C>T, NM_004004.5:c.299_300delAT, NM_004004.5:c.250G>T, NM_004004.5:c.230G>A, NM_004004.5:c.516G>A, NM_004004.5:c.439G>A, NM_004004.5:c.465T>A, NM_004004.5:c.229T>C, NM_004004.5:c.241C>G, NM_004004.5:c.235delC, NM_004004.5:c.238C>T, NM_004004.5:c.557C>T, NM_004004.5:c.269_270insT, NM_004004.5:c.617A>G, NM_004004.5:c.231G>A, NM_004004.5:c.310_323delAGGAAGTTCATCAA, NM_004004.5:c.313_326delAAGTTCATCAAGGG, NM_004004.5:c.358_360delGAG, NM_004004.5:c.35delG, NM_004004.5:c.249C>G, NM_004004.5:c.334_335delAA, NM_004004.5:c.402delG, NM_004004.5:c.413G>A, NM_004004.5:c.416G>A, NM_004004.5:c.299A>T, NM_004004.5:c.250G>C, NM_004004.5:c.550C>T, NM_004004.5:c.551G>C, NM_004004.5:c.503A>G, NM_004004.5:c.227T>C, NM_004004.5:c.380G>A, NM_004004.5:c.132G>A, NM_004004.5:c.365A>T, NM_004004.5:c.139G>TDeafness, autosomal recessive type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 and GJB3 genes located on chromosomal regions 13q12.11 and 1p34.3 respectively. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.250,600
GJB3Deafness type 1A, autosomal recessiveNM_024009.2NM_024009.2:c.529T>G, NM_024009.2:c.580G>A, NM_024009.2:c.94C>TDeafness, autosomal recessive type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 and GJB3 genes located on chromosomal regions 13q12.11 and 1p34.3 respectively. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.250,600
GJB6Deafness type 1B, autosomal recessiveNM_006783.4NM_006783.4:c.261dupA, NM_006783.4:c.169C>T, NM_006783.4:c.485dupA, NM_006783.4:c.689dupA, NM_006783.4:c.14C>T, NM_006783.4:c.443delC, NM_006783.4:c.383_384delTA, NM_006783.4:c.689_690insANonsyndromic sensorineural deafness, autosomal recessive type DFNB1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB6 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.250,600
GLB1GM1 GangliosidosisNM_000404.2NM_000404.2:c.1369C>T, NM_000404.2:c.1370G>A, NM_000404.2:c.1452C>G, NM_000404.2:c.176G>A, NM_000404.2:c.276G>A, NM_000404.2:c.1733A>G, NM_000404.2:c.1355dupA, NM_000404.2:c.442C>A, NM_000404.2:c.202C>T, NM_000404.2:c.591_592insT, NM_000404.2:c.622C>T, NM_000404.2:c.1549G>T, NM_000404.2:c.442C>T, NM_000404.2:c.457+2T>C, NM_000404.2:c.947A>G, NM_000404.2:c.438_440delTCT, NM_000404.2:c.601C>T, NM_000404.2:c.602G>A, NM_000404.2:c.1068+1G>T, NM_000404.2:c.1174_1175delCT, NM_000404.2:c.1004C>T, NM_000404.2:c.1051C>T, NM_000404.2:c.171C>G, NM_000404.2:c.1321G>A, NM_000404.2:c.1325G>A, NM_000404.2:c.818G>T, NM_000404.2:c.152T>C, NM_000404.2:c.1456_1466dupGGTGCATATAT, NM_000404.2:c.145C>T, NM_000404.2:c.175C>T, NM_000404.2:c.901G>A, NM_000404.2:c.1646C>T, NM_000404.2:c.1577dupG, NM_000404.2:c.1310A>TGangliosidosis GM1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. Although the three types differ in severity, their features can overlap significantly. The age of onset in type 1 is infantile, in type 2 is late-infantile or juvenile and adult in type3. This disease is characterized by arrest/regression of neurological development, hypotonia, visceromegaly, macular cherry-red spots, dysostosis and coarse facial features. The prevalence is 1:100,000 a 200,000 newborn.250,600
GLB1Mucopolysaccharidosis type 4BNM_000404.2NM_000404.2:c.1444C>T, NM_000404.2:c.1313G>A, NM_000404.2:c.817T>C, NM_000404.2:c.1445G>A, NM_000404.2:c.1223A>CMucopolysaccharidosis type 4B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. The age of onset is variable infantile/juvenile. In addition to skeletal involvement, significant morbidity can result from respiratory compromise, obstructive sleep apnea, valvular heart disease, hearing impairment, corneal clouding, and spinal cord compression. The prevalence is 1:200,000-1:300,000.250,600
GLDCGlycine encephalopathyNM_000170.2NM_000170.2:c.322G>T, NM_000170.2:c.1229G>A, NM_000170.2:c.1545G>C, NM_000170.2:c.1691G>T, NM_000170.2:c.1166C>T, NM_000170.2:c.2113G>A, NM_000170.2:c.2284G>A, NM_000170.2:c.1705G>A, NM_000170.2:c.2216G>A, NM_000170.2:c.2405C>TGlycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMT and GLDC genes located on chromosomal regions 3p21.31 and 9p24.1 respectively. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000.250,600
GLE1Lethal arthrogryposis with anterior horn cell diseaseNM_001003722.1NM_001003722.1:c.2051T>C, NM_001003722.1:c.1412_1413delAG, NM_001003722.1:c.898-2A>G, NM_001003722.1:c.2069_2072delTTCT, NM_001003722.1:c.1807C>TLethal arthrogryposis with anterior horn cell disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLE1 gene located on chromosomal region 9q34.11. The age of onset is fetal. This disease is characterized by fetal akinesia, arthrogryposis and motor neuron loss. The fetus often survives delivery, but dies early as a result of respiratory failure. Neuropathological findings resemble those of lethal congenital contracture syndrome type 1, but are less severe.250,600
GNEDistal myopathy Nonaka typeNM_005476.5NM_005476.5:c.2116T>C, NM_005476.5:c.2135T>C, NM_005476.5:c.2086G>A, NM_005476.5:c.478C>T, NM_005476.5:c.1844C>G, NM_005476.5:c.737G>A, NM_005476.5:c.385C>T, NM_005476.5:c.1714G>T, NM_005476.5:c.1798G>A, NM_005476.5:c.2086G>T, NM_005476.5:c.787C>T, NM_005476.5:c.2023T>C, NM_005476.5:c.1993G>A, NM_005476.5:c.673G>A, NM_005476.5:c.909T>A, NM_005476.5:c.1727G>ADistal myopathy, Nonaka type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNE gene located on chromosomal region 9p13.3. The age of onset is adult. This disease is characterized by progressive muscle weakness and joint deformity. The prevalence is 1:500-1:1,000.250,600
GNPTABMucolipidosis type 2/type 3NM_024312.4NM_024312.4:c.1931C>T, NM_024312.4:c.1799delC, NM_024312.4:c.3503_3504delTC, NM_024312.4:c.3173C>G, NM_024312.4:c.25C>T, NM_024312.4:c.3663delG, NM_024312.4:c.1906dupA, NM_024312.4:c.2383delG, NM_024312.4:c.732_733delAA, NM_024312.4:c.749dupA, NM_024312.4:c.2896delA, NM_024312.4:c.648_651delAGAA, NM_024312.4:c.3326dupA, NM_024312.4:c.3410T>A, NM_024312.4:c.10A>C, NM_024312.4:c.1000C>T, NM_024312.4:c.1196C>T, NM_024312.4:c.1759C>T, NM_024312.4:c.3565C>T, NM_024312.4:c.616_619delACAG, NM_024312.4:c.99delC, NM_024312.4:c.3598G>A, NM_024312.4:c.3560_3561delAGMucolipidosis type 2/type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNPTAB gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by growth retardation, skeletal abnormalities, facial dysmorphism, stiff skin, developmental delay and cardiomegaly and that is lethal in childhood. The prevalence is 1:123,500-1:625,500.250,600
GPR179Night blindness, congenital stationary type 1ENM_001004334.3NM_001004334.3:c.1784+1G>A, NM_001004334.3:c.1368delT, NM_001004334.3:c.3656_3657delCT, NM_001004334.3:c.6847_6848delCT, NM_001004334.3:c.984delC, NM_001004334.3:c.1807C>T, NM_001004334.3:c.278_279insC, NM_001004334.3:c.5693_5694insT, NM_001004334.3:c.278delC, NM_001004334.3:c.1236G>A, NM_001004334.3:c.376G>C, NM_001004334.3:c.3233_3234delCT, NM_001004334.3:c.5763_5764delGA, NM_001004334.3:c.839_842delATCA, NM_001004334.3:c.4699_4700delAGCongenital stationary night blindness type 1E follow an autosomal recessive, dominant or X-linked pattern of inheritance and is caused by pathogenic variants in the GPR179 gene located on chromosomal region 17q12. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity.250,600
GPR98Usher syndrome type 2CNM_032119.3NM_032119.3:c.11377G>T, NM_032119.3:c.8713_8716dupAACA, NM_032119.3:c.2864C>A, NM_032119.3:c.18131A>G, NM_032119.3:c.2258_2270delAAGTGCTGAAATC, NM_032119.3:c.6275-1G>A, NM_032119.3:c.2636C>T, NM_032119.3:c.14973-1G>C, NM_032119.3:c.17668_17669delAT, NM_032119.3:c.5357_5358delAA, NM_032119.3:c.5747C>T, NM_032119.3:c.15196_15199dupCAAA, NM_032119.3:c.3151G>T, NM_032119.3:c.6901C>T, NM_032119.3:c.8790delC, NM_032119.3:c.5830G>A, NM_032119.3:c.6311_6312insTUsher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR98 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32 respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000.250,600
GRM6Night blindness, congenital stationary type 1BNM_000843.3NM_000843.3:c.2341G>A, NM_000843.3:c.727_728insG, NM_000843.3:c.2213_2219delCCAGAGG, NM_000843.3:c.1861C>T, NM_000843.3:c.2560C>T, NM_000843.3:c.712C>T, NM_000843.3:c.2122C>T, NM_000843.3:c.719_720insG, NM_000843.3:c.1214T>C, NM_000843.3:c.1336C>T, NM_000843.3:c.1258C>T, NM_000843.3:c.1565G>ACongenital stationary night blindness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRM6 gene located on chromosomal region 5q35.3. The age of onset is early infancy. This disease is characterized by hemeralopia with a moderate loss of visual acuity.250,600
GUSBMucopolysaccharidosis type 7NM_000181.3NM_000181.3:c.1065+1G>T, NM_000181.3:c.1084G>A, NM_000181.3:c.1144C>T, NM_000181.3:c.1337G>A, NM_000181.3:c.1222C>T, NM_000181.3:c.1730G>T, NM_000181.3:c.1831C>T, NM_000181.3:c.1856C>T, NM_000181.3:c.1881G>T, NM_000181.3:c.442C>T, NM_000181.3:c.499C>T, NM_000181.3:c.526C>T, NM_000181.3:c.646C>T, NM_000181.3:c.820_821delAC, NM_000181.3:c.1061C>T, NM_000181.3:c.1050G>C, NM_000181.3:c.1534G>A, NM_000181.3:c.1244C>T, NM_000181.3:c.1219_1220insC, NM_000181.3:c.866G>A, NM_000181.3:c.1244+1G>A, NM_000181.3:c.1521G>A, NM_000181.3:c.1429C>T, NM_000181.3:c.1618G>T, NM_000181.3:c.1338G>AMucopolysaccharidosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUSB gene located on chromosomal region 7q11.21. The age of onset is variable. There are prenatal forms with non-immune hydrops fetalis, and severe neonatal forms with dysmorphism, hernias, hepatosplenomegaly, club feet, dysostosis, severe hypotonia and neurological disorders that ultimately lead to profound intellectual deficit and small stature in patients that survive. Finally, there are also very mild cases that are discovered during adolescence or adulthood following presentation with thoracic kyphosis. The prevalence is 1:250,000 in newborn.250,600
HADHATrifunctional protein deficiencyNM_000182.4NM_000182.4:c.1918C>T, NM_000182.4:c.274_278delTCATC, NM_000182.4:c.2131C>A, NM_000182.4:c.1793_1794delAT, NM_000182.4:c.1620+2_1620+6delTAAGG, NM_000182.4:c.2027G>A, NM_000182.4:c.1678C>T, NM_000182.4:c.2132_2133insC, NM_000182.4:c.2146+1G>A, NM_000182.4:c.919-2A>G, NM_000182.4:c.1644delC, NM_000182.4:c.1132C>T, NM_000182.4:c.1528G>C, NM_000182.4:c.499delA, NM_000182.4:c.845T>A, NM_000182.4:c.1422dupTMitochondrial trifunctional protein deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA and HADHB genes located on chromosomal region 2p23.3. The age of onset is neonatal/infancy. It is characterized by a wide clinical spectrum ranging from severe neonatal manifestations including cardiomyopathy, hypoglycemia, metabolic acidosis, skeletal myopathy and neuropathy, liver disease and death to a mild phenotype with peripheral polyneuropathy, episodic rhabdomyolysis and pigmentary retinopathy. The prevalence is <1 / 1,000,000.250,600
HBBBeta-thalassemiaNM_000518.4NM_000518.4:c.135delC, NM_000518.4:c.118C>T, NM_000518.4:c.217dupA, NM_000518.4:c.92+5G>C, NM_000518.4:c.208G>A, NM_000518.4:c.85_86insC, NM_000518.4:c.92+5G>A, NM_000518.4:c.27dupG, NM_000518.4:c.126_129delCTTT, NM_000518.4:c.93-23T>C, NM_000518.4:c.92+1G>A, NM_000518.4:c.-50-u32C>T, NM_000518.4:c.82G>T, NM_000518.4:c.315+1G>A, NM_000518.4:c.52A>T, NM_000518.4:c.380T>A, NM_000518.4:c.93-21G>A, NM_000518.4:c.79G>A, NM_000518.4:c.112delT, NM_000518.4:c.92+6T>C, NM_000518.4:c.59A>G, NM_000518.4:c.364G>ABeta-thalassemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBB gene located on chromosomal region 11p15.4. The age of onset is infantile. Three main types of BT have been described, thalassemia minor is usually asymptomatic, thalassemia major is associated with splenomegaly and microcytic and hypochromic anemia and thalassemia intermedia, in which the anemia is less severe. The incidence is 1/100,000.250,600
HBBSickle cell anaemiaNM_000518.4NM_000518.4:c.19G>A, NM_000518.4:c.20A>TSickle cell anemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBB gene located on chromosomal region 11p15.4. The age of onset is infantile. This disease is characterized by chronic severe anemia, bacterial infections, and ischemic vaso-occlusive accidents. This results in tissue ischemia leading to acute and chronic pain as well as organ damage that can affect any organ in the body, including the bones, lungs, liver, kidneys, brain, eyes, and joints. The highest frequency of sickle cell disease is found in tropical regions, particularly sub-Saharan Africa, India and the Middle-East.250,600
HESX1Combined pituitary hormone deficiencies, genetic formsNM_003865.2NM_003865.2:c.374A>G, NM_003865.2:c.77T>C, NM_003865.2:c.445G>A, NM_003865.2:c.450_451delCA, NM_003865.2:c.18G>CCombined pituitary hormone deficiencies, genetic forms follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the HESX1 gene located on chromosomal region 3p14.3. The age of onset is infantile. These diseases are characterized by short stature, cognitive alterations or delayed puberty. The incidence is 1:3,000 and 1:4,000 births.250,600
HEXATay-Sachs diseaseNM_000520.4NM_000520.4:c.1176G>A, NM_000520.4:c.1495C>T, NM_000520.4:c.1177C>T, NM_000520.4:c.116T>G, NM_000520.4:c.1510delC, NM_000520.4:c.1496G>A, NM_000520.4:c.1260G>C, NM_000520.4:c.1351C>G, NM_000520.4:c.1511G>A, NM_000520.4:c.1499delT, NM_000520.4:c.1510C>T, NM_000520.4:c.380T>G, NM_000520.4:c.459+5G>A, NM_000520.4:c.508C>T, NM_000520.4:c.509G>A, NM_000520.4:c.532C>T, NM_000520.4:c.533G>A, NM_000520.4:c.533G>T, NM_000520.4:c.1528C>T, NM_000520.4:c.173G>A, NM_000520.4:c.1A>G, NM_000520.4:c.1A>T, NM_000520.4:c.1444G>A, NM_000520.4:c.1453T>C, NM_000520.4:c.739C>T, NM_000520.4:c.745C>T, NM_000520.4:c.749G>A, NM_000520.4:c.759_774dupGCTTGCAGAGTTTGAC, NM_000520.4:c.772G>C, NM_000520.4:c.1214_1215delinsG, NM_000520.4:c.78G>A, NM_000520.4:c.538T>C, NM_000520.4:c.540C>G, NM_000520.4:c.805G>A, NM_000520.4:c.915_917delCTT, NM_000520.4:c.254-1G>C, NM_000520.4:c.2T>C, NM_000520.4:c.1537C>T, NM_000520.4:c.1490A>G, NM_000520.4:c.77G>A, NM_000520.4:c.1422G>C, NM_000520.4:c.805+1G>A, NM_000520.4:c.805+1G>C, NM_000520.4:c.672+1G>A, NM_000520.4:c.629C>T, NM_000520.4:c.987G>A, NM_000520.4:c.632T>C, NM_000520.4:c.1278_1279insTATC, NM_000520.4:c.1274_1277dupTATC, NM_000520.4:c.986+3A>G, NM_000520.4:c.611A>G, NM_000520.4:c.1277_1278insTATTay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births.250,600
HEXBSandhoff diseaseNM_000521.3NM_000521.3:c.1310_1311delCA, NM_000521.3:c.1380G>A, NM_000521.3:c.1367A>C, NM_000521.3:c.1238_1242delCAAAG, NM_000521.3:c.298delC, NM_000521.3:c.1345delT, NM_000521.3:c.797A>G, NM_000521.3:c.1539_1540delCT, NM_000521.3:c.1375G>T, NM_000521.3:c.508C>T, NM_000521.3:c.1517_1529dupCAAGTGCTGTTGG, NM_000521.3:c.841C>T, NM_000521.3:c.202_203insGG, NM_000521.3:c.1250C>T, NM_000521.3:c.1619_1620insTTCATGTTATCTACAGACGTG, NM_000521.3:c.1537_1538delCT, NM_000521.3:c.170delG, NM_000521.3:c.115delG, NM_000521.3:c.171delG, NM_000521.3:c.850C>TSandhoff disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXB gene located on chromosomal region 5q13.3. The age of onset is adult or infantile. This disease is characterized by central nervous system degeneration, with startle reactions, early blindness, progressive motor and mental deterioration, macrocephaly and cherry-red spots on the macula. The prevalence is 1/130.000.250,600
HFEHaemochromatosisNM_000410.3NM_000410.3:c.18G>C, NM_000410.3:c.252G>A, NM_000410.3:c.989G>T, NM_000410.3:c.314T>C, NM_000410.3:c.193A>T, NM_000410.3:c.829G>A, NM_000410.3:c.277G>CHemochromatosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HFE gene located on chromosomal region 6p22.2. The age of onset is adult. This disease is characterized by chronic fatigue, bronzed skin pigmentation and tissue damage in the liver, pancreas, joints, bone, endocrine glands, heart. The prevalence is 1/200 - 1/1.000.250,600
HGDAlkaptonuriaNM_000187.3NM_000187.3:c.140C>T, NM_000187.3:c.16-1G>A, NM_000187.3:c.342+1G>A, NM_000187.3:c.1111_1112insC, NM_000187.3:c.899T>G, NM_000187.3:c.1189-2A>G, NM_000187.3:c.674G>A, NM_000187.3:c.175delA, NM_000187.3:c.283-5delT, NM_000187.3:c.172A>T, NM_000187.3:c.873C>A, NM_000187.3:c.283-4C>T, NM_000187.3:c.808G>A, NM_000187.3:c.1102A>G, NM_000187.3:c.469+2T>C, NM_000187.3:c.688C>T, NM_000187.3:c.481G>AAlkaptonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGD gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by darkening of the urine when it is left exposed to air, grey-blue colouration of the eye sclerae and the ear helix (ochronosis), and a disabling joint disease involving both the axial and peripheral joints (ochronotic arthropathy). The prevalence is 1:250,000-1:1.000.000 newborn.250,600
HGSNATMucopolysaccharidosis type 3CNM_152419.2NM_152419.2:c.1378-1G>A, NM_152419.2:c.1843G>A, NM_152419.2:c.607C>T, NM_152419.2:c.1250+1G>A, NM_152419.2:c.848C>T, NM_152419.2:c.1464+1G>A, NM_152419.2:c.1501delA, NM_152419.2:c.1030C>T, NM_152419.2:c.1503delA, NM_152419.2:c.1553C>T, NM_152419.2:c.1622C>T, NM_152419.2:c.493+1G>AMucopolysaccharidosis type 3C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGSNAT gene located on chromosomal region 8p11.21. The age of onset is infantile. This disease is characterized by defective or missing enzymes to break down mucopolysaccharides are missing or are defective. The prevalence is <1:70.000 newborn.250,600
HPDTyrosinemia type 3NM_002150.2NM_002150.2:c.600C>G, NM_002150.2:c.774T>G, NM_002150.2:c.1005C>G, NM_002150.2:c.987delATyrosinemia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPD gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by intellectual deficit and ataxia. The prevalence is 1:100,000-1:120,000 newborn.250,600
IGHMBP2Spinal muscular atrophy, distal, type 1, autosomal recessiveNM_002180.2NM_002180.2:c.1488C>A, NM_002180.2:c.2611+1G>T, NM_002180.2:c.1540G>A, NM_002180.2:c.1738G>A, NM_002180.2:c.661delA, NM_002180.2:c.121C>T, NM_002180.2:c.1101_1116delCTACTTCGACGTGGTG, NM_002180.2:c.2922T>G, NM_002180.2:c.1107C>G, NM_002180.2:c.2362C>T, NM_002180.2:c.638A>GAutosomal recessive distal spinal muscular atrophy type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGHMBP2 gene located on chromosomal region 11q13.3. The age of onset is infantile. This disease is characterized by neuromuscular disorder characterized by progressive weakness and atrophy of the diaphragm and skeletal muscles, leading to death in childhood. The prevalence is 4:100,000-10:100,000.250,600
IMPDH1Retinitis pigmentosa type 10NM_000883.3NM_000883.3:c.1057G>A, NM_000883.3:c.1390delC, NM_000883.3:c.931G>ARetinitis pigmentosa type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IMPDH1 gene located on chromosomal region 7q32.1. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades. The prevalence is 1/4,000.250,600
INPP5EJoubert syndrome type 1NM_019892.4NM_019892.4:c.1132C>T, NM_019892.4:c.855_856insCG, NM_019892.4:c.1688G>A, NM_019892.4:c.1543C>T, NM_019892.4:c.1304G>AJoubert syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized by congenital malformation of the brainstem and agenesis or hypoplasia of the cerebellar vermis leading to an abnormal respiratory pattern, nystagmus, hypotonia, ataxia, and delay in achieving motor milestones.. The prevalence is 1/100.000.250,600
INPP5EMORM syndromeNM_019892.4NM_019892.4:c.1879C>TMORM syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized by the association of intellectual deficit, truncal obesity, retinal dystrophy and micropenis. The prevalence is 1/100.000.250,600
INSRDiabetes mellitus, insulin-resistantNM_000208.2NM_000208.2:c.3079C>T, NM_000208.2:c.3680G>C, NM_000208.2:c.3034G>A, NM_000208.2:c.1114C>T, NM_000208.2:c.1378A>GDiabetes mellitus, insulin-resistant follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by the triad of hyperinsulinemia, acanthosis nigricans (skin lesions associated with insulin resistance), and signs of hyperandrogenism in females without lipodystrophy and who are not overweight. It is generally diagnosed in young women with marked signs of hyperandrogenism, but insulin resistance and acanthosis nigricans may be observed in men and in childhood. Acromegaloid facies or muscular cramps are sometimes associated. Hyperinsulinemia, a biological marker for insulin resistance, is often associated with glucose tolerance defects over the course of the disease, and diabetes progressively sets in. Hyperandrogenism (associated with polycystic ovarian syndrome (see this term) or ovarian hyperthecoses) leads to fertility problems. The prevalence is <1:1,000,000.250,600
INSRLeprechaunismNM_000208.2NM_000208.2:c.2668C>T, NM_000208.2:c.172G>ALeprechaunism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by intrauterine and mainly postnatal severe growth retardation, extreme insulin resistance. The prevalence is <1:1,000,000.250,600
ITGB4Epidermolysis bullosa, junctional with pyloric atresiaNM_001005731.1NM_001005731.1:c.112T>C, NM_001005731.1:c.1684T>C, NM_001005731.1:c.1150delG, NM_001005731.1:c.1544G>A, NM_001005731.1:c.3977-19T>A, NM_001005731.1:c.4410delG, NM_001005731.1:c.4433G>A, NM_001005731.1:c.5119+2T>C, NM_001005731.1:c.3321_3331delACTGGACCGGA, NM_001005731.1:c.4618C>T, NM_001005731.1:c.182G>A, NM_001005731.1:c.2607delC, NM_001005731.1:c.3801_3802insT, NM_001005731.1:c.3841C>T, NM_001005731.1:c.2608delC, NM_001005731.1:c.3793+1G>A, NM_001005731.1:c.1660C>T, NM_001005731.1:c.3674G>AJunctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGA6 and ITGB4 genes located on chromosomal regions 2q31.1 and 17q25.1 respectively. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract.250,600
ITGB4Epidermolysis bullosa, without pyloric atresiaNM_001005731.1NM_001005731.1:c.2792G>AJunctional epidermolysis bullosa with piloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGB4 gene located on chromosomal region 17q25.1. The age of onset is neonatal. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. More than 100 cases have been reported around the world.250,600
IVDIsovaleric acidemiaNM_002225.3NM_002225.3:c.158G>C, NM_002225.3:c.1208A>G, NM_002225.3:c.157C>T, NM_002225.3:c.1141T>C, NM_002225.3:c.243+1G>A, NM_002225.3:c.1147+1_1147+4delGTGA, NM_002225.3:c.367G>A, NM_002225.3:c.605G>T, NM_002225.3:c.1145_1147+4delTTGGTGA, NM_002225.3:c.559+1G>A, NM_002225.3:c.134T>C, NM_002225.3:c.941C>T, NM_002225.3:c.627delT, NM_002225.3:c.793+1G>A, NM_002225.3:c.2T>G, NM_002225.3:c.1183C>T, NM_002225.3:c.390delT, NM_002225.3:c.406_407delTG, NM_002225.3:c.158G>A, NM_002225.3:c.593G>A, NM_002225.3:c.507delG, NM_002225.3:c.1188delT, NM_002225.3:c.465+2T>C, NM_002225.3:c.434_437dupATGA, NM_002225.3:c.860G>A, NM_002225.3:c.994_995delAT, NM_002225.3:c.1192C>T, NM_002225.3:c.478_479insGTIsovaleric academia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IVD gene located on chromosomal region 15q15.1. The age of onset is neonatal. This disease is characterized by vomiting, dehydration, coma and abnormal movements. The prevalence is 1/100,000.250,600
JAK3Severe combined immunodeficiency T-B+NK-NM_000215.3NM_000215.3:c.452C>G, NM_000215.3:c.1765G>A, NM_000215.3:c.1333C>T, NM_000215.3:c.1172_1173insG, NM_000215.3:c.1837C>T, NM_000215.3:c.299A>G, NM_000215.3:c.1695C>ASevere combined immunodeficiency T-B+NK- follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the JAK3 gene located on chromosomal region 19p13.11. The age of onset is infantile. This disease is characterized by chronic diarrhea, failure to thrive, recurrent respiratory infections and/or generalized infections due to opportunistic pathogens. The incidence is 1/100,000 and 1/1,000,000.250,600
KCNJ1Bartter syndrome type 2NM_000220.4NM_000220.4:c.1012C>T, NM_000220.4:c.1070T>C, NM_000220.4:c.592G>A, NM_000220.4:c.322G>C, NM_000220.4:c.372T>A, NM_000220.4:c.500G>A, NM_000220.4:c.237C>G, NM_000220.4:c.1014delA, NM_000220.4:c.641C>T, NM_000220.4:c.657C>G, NM_000220.4:c.996_999delAAAG, NM_000220.4:c.942T>GBartter syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ1 gene located on chromosomal region 11q24.3. The age of onset is antenatal. This disease is characterized by severe polyhydramnios in mother leading to premature delivery, postnatally newborns suffer from recurrent episodes of severe dehydration and electrolyte imbalance which can lead to fatal outcome.250,600
KCNV2Retinal cone dystrophy type 3BNM_133497.3NM_133497.3:c.1016_1024delACCTGGTGG, NM_133497.3:c.1376G>A, NM_133497.3:c.427G>T, NM_133497.3:c.226C>T, NM_133497.3:c.325C>T, NM_133497.3:c.357_358insC, NM_133497.3:c.1480A>C, NM_133497.3:c.1132_1133insT, NM_133497.3:c.854T>G, NM_133497.3:c.491T>C, NM_133497.3:c.767C>G, NM_133497.3:c.916G>T, NM_133497.3:c.778A>T, NM_133497.3:c.442G>TRetinal cone dystrophy type 3B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNV2 gene located on 9p24.2. The age of onset is in the first or second decade of life. This disease is characterized by is characterized by onset in the first or second decade of life of very marked photophobia, myopia, reduced color vision along the red-green axis with relatively preserved tritan discrimination, and central scotomata with peripheral widespread sensitivity loss predominating in the superior visual field. Nyctalopia is a later feature of the disorder. There is often retinal pigment epithelium disturbance at the macula with a normal retinal periphery.250,600
LAMA2Congenital muscular dystrophy type 1ANM_000426.3NM_000426.3:c.184G>T, NM_000426.3:c.1612C>T, NM_000426.3:c.3718C>T, NM_000426.3:c.2750-1G>C, NM_000426.3:c.2049_2050delAG, NM_000426.3:c.5050G>T, NM_000426.3:c.1634T>A, NM_000426.3:c.2045_2046delAG, NM_000426.3:c.4645C>T, NM_000426.3:c.2962C>T, NM_000426.3:c.2098_2099delTT, NM_000426.3:c.4437-5T>A, NM_000426.3:c.2901C>A, NM_000426.3:c.112+1G>A, NM_000426.3:c.7732C>T, NM_000426.3:c.6038delT, NM_000426.3:c.7888C>T, NM_000426.3:c.825delC, NM_000426.3:c.8314delA, NM_000426.3:c.3976C>T, NM_000426.3:c.9101_9104dupAACA, NM_000426.3:c.9253C>T, NM_000426.3:c.2323-2A>T, NM_000426.3:c.8748delA, NM_000426.3:c.6334A>T, NM_000426.3:c.1050delT, NM_000426.3:c.7536delC, NM_000426.3:c.8705delT, NM_000426.3:c.9221delA, NM_000426.3:c.5227G>T, NM_000426.3:c.6429+1G>A, NM_000426.3:c.6617delT, NM_000426.3:c.2451-2A>G, NM_000426.3:c.6011delA, NM_000426.3:c.7810C>T, NM_000426.3:c.8684C>G, NM_000426.3:c.3630delT, NM_000426.3:c.3215delG, NM_000426.3:c.3623_3645delAGGGCATTGTTTTTCAACATCCA, NM_000426.3:c.6955C>T, NM_000426.3:c.7279_7280delCT, NM_000426.3:c.725G>A, NM_000426.3:c.7147C>T, NM_000426.3:c.3237C>ACongenital muscular dystrophy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMA2 gene located on chromosomal region 6q22.33. The age of onset is early infancy. This disease is characterized by hypotonia, muscle weakness and muscle wasting and motor development delayed. The prevalence is 1/30,000.250,600
LAMB3Epidermolysis bullosa, junctionalNM_000228.2NM_000228.2:c.1587_1588delAG, NM_000228.2:c.124C>T, NM_000228.2:c.1438_1442delCCGTG, NM_000228.2:c.1830G>A, NM_000228.2:c.565-2A>G, NM_000228.2:c.2806C>T, NM_000228.2:c.904delT, NM_000228.2:c.1357delT, NM_000228.2:c.3228+1G>T, NM_000228.2:c.628+1delG, NM_000228.2:c.496C>T, NM_000228.2:c.1903C>T, NM_000228.2:c.628G>A, NM_000228.2:c.3228+1G>A, NM_000228.2:c.727C>TJunctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 and LAMC2 genes located on chromosomal regions 1q32.2 and 1q25.3 respectively. The age of onset is infantile. It is a lethal form of junctional epidermolysis bullosa, a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement. In the Herlitz type, death occurs usually within the first six months of life. Occasionally, children survive to teens. It is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic.250,600
LMNACardiomyopathy, dilated type 1ANM_170707.3NM_170707.3:c.1366A>C, NM_170707.3:c.1930C>T, NM_170707.3:c.1567G>A, NM_170707.3:c.1786G>ADilated cardiomyopathy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death.250,600
LMNAHutchinson-Gilford progeria syndromeNM_170707.3NM_170707.3:c.1579C>T, NM_170707.3:c.1411C>T, NM_170707.3:c.1824C>T, NM_170707.3:c.1626G>CHutchinson-Gilford progeria syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/infancy. It is characterized by growth reduction, failure to thrive, a typical facial appearance (prominent forehead, protuberant eyes, thin nose with a beaked tip, thin lips, micrognathia and protruding ears) and distinct dermatologic features (generalized alopecia, aged-looking skin, sclerotic and dimpled skin over the abdomen and extremities, prominent cutaneous vasculature, dyspigmentation, nail hypoplasia and loss of subcutaneous fat).250,600
LMNALipodystrophy, familial partial, type 2NM_170707.3NM_170707.3:c.1318G>ALipodystrophy, familial partial, type2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by the loss of subcutaneous adipose tissue in the lower parts of the body (limbs, buttocks, trunk). It is accompanied by an accumulation of adipose tissue in the face and neck causing a double chin, fat neck, or cushingoid appearance. Adipose tissue may also accumulate in the axillae, back, labia majora, and intraabdominal region. Affected patients are insulin-resistant and may develop glucose intolerance and diabetes mellitus after age 20 years,hypertriglyceridemia, and low levels of high density lipoprotein cholesterol.250,600
LMNAMandibuloacral dysplasiaNM_170707.3NM_170707.3:c.1586C>T, NM_170707.3:c.1580G>A, NM_170707.3:c.1585G>A, NM_170707.3:c.1228C>TMandibuloacral dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/. This disease is characterized by postnatal growth retardation, craniofacial anomalies, skeletal malformations, and mottled cutaneous pigmentation. The prevalence is 1:2,700-1:5,000.250,600
LMNAMuscular dystrophy, Emery-Dreifuss type 3NM_170707.3NM_170707.3:c.1072G>A, NM_170707.3:c.419T>C, NM_170707.3:c.1488+1G>A, NM_170707.3:c.1583C>AEmery-Dreifuss muscular dystrophy type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by weakness and atrophy of muscle without involvement of the nervous system, early contractures of the elbows, Achilles tendons and spine, and cardiomyopathy associated with cardiac conduction defects.250,600
LRP5Exudative vitreoretinopathy type 4NM_002335.3NM_002335.3:c.2254C>G, NM_002335.3:c.518C>T, NM_002335.3:c.1709G>A, NM_002335.3:c.804_813delGGGGAAGAGG, NM_002335.3:c.4099G>AExudative vitreoretinopathy type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile or juvenile. This disease is characterized by abnormal or incomplete vascularization of the peripheral retina leading to variable clinical manifestations ranging from no effects to minor anomalies, or even retinal detachment with blindness.250,600
LRP5Isolated polycystic liver diseaseNM_002335.3NM_002335.3:c.4651G>AIsolated polycystic liver disease due to LRP5 gene located on chromosomal region 11q13.2 follows an autosomal recessive pattern of inheritance. The age of onset is variable. This disease is characterized by the appearance of numerous cysts spread throughout the liver.250,600
LRP5Osteoporosis-pseudoglioma syndromeNM_002335.3NM_002335.3:c.1481G>A, NM_002335.3:c.1453G>T, NM_002335.3:c.1468delG, NM_002335.3:c.2305delG, NM_002335.3:c.2202G>A, NM_002335.3:c.1708C>T, NM_002335.3:c.3107G>A, NM_002335.3:c.2557C>TOsteoporosis-pseudoglioma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by congenital or infancy-onset blindness and severe juvenile-onset osteoporosis and spontaneous fractures. The prevalence is 1:2,000,000.250,600
MAN2B1Alpha-mannosidosisNM_000528.3NM_000528.3:c.215A>T, NM_000528.3:c.2401G>T, NM_000528.3:c.2278C>T, NM_000528.3:c.2368C>T, NM_000528.3:c.2119C>T, NM_000528.3:c.2013delT, NM_000528.3:c.1A>G, NM_000528.3:c.1067C>G, NM_000528.3:c.384G>A, NM_000528.3:c.2398G>A, NM_000528.3:c.1915C>T, NM_000528.3:c.2426T>C, NM_000528.3:c.2436+2T>C, NM_000528.3:c.1259G>T, NM_000528.3:c.1780C>T, NM_000528.3:c.1929G>A, NM_000528.3:c.2686_2687delCTinsG, NM_000528.3:c.1830+1G>CAlpha-mannosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAN2B1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by immunodeficiency, facial and skeletal abnormalities, hearing impairment and intellectual disability. The prevalence is 1:1,000,000-9:1,000,000.250,600
MCCC23-Methylcrotonyl-CoA carboxylase 2 deficiency, type 2NM_022132.4NM_022132.4:c.295G>C, NM_022132.4:c.380C>G, NM_022132.4:c.1309A>G, NM_022132.4:c.515_516insT, NM_022132.4:c.1015G>A, NM_022132.4:c.464G>A, NM_022132.4:c.641delG, NM_022132.4:c.1576_1577insT, NM_022132.4:c.735_736insC, NM_022132.4:c.517_518insT, NM_022132.4:c.838G>T, NM_022132.4:c.499T>C, NM_022132.4:c.1367C>T, NM_022132.4:c.929C>G, NM_022132.4:c.1065A>T, NM_022132.4:c.1580G>A, NM_022132.4:c.994C>T, NM_022132.4:c.1072+1G>A3-methylcrotonyl-CoA carboxylase deficiency type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC2 gene located on chromosomal region 5q13.2. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn.250,600
MED25Charcot-Marie-Tooth disease type 2B2NM_030973.3NM_030973.3:c.316delG, NM_030973.3:c.1366C>T, NM_030973.3:c.1004C>TCharcot-Marie-Tooth disease type 2B2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MED25 gene located on chromosomal region 19q13.33. The age of onset is adult. This disease is characterized by symmetric moderate to severe weakness of the distal muscles, predominantly affecting the lower extremities. Marked sensory deficits were also reported.250,600
MEFVFamilial mediterranean feverNM_000243.2NM_000243.2:c.163_164insA, NM_000243.2:c.1437C>G, NM_000243.2:c.2282G>A, NM_000243.2:c.163dupA, NM_000243.2:c.2076_2078delAAT, NM_000243.2:c.1958G>A, NM_000243.2:c.443A>T, NM_000243.2:c.656_657insG, NM_000243.2:c.688G>A, NM_000243.2:c.800C>T, NM_000243.2:c.1223G>A, NM_000243.2:c.501G>C, NM_000243.2:c.2040G>A, NM_000243.2:c.2040G>C, NM_000243.2:c.2084A>G, NM_000243.2:c.1141C>T, NM_000243.2:c.1016C>T, NM_000243.2:c.2177T>C, NM_000243.2:c.1772T>C, NM_000243.2:c.2080A>G, NM_000243.2:c.2082G>A, NM_000243.2:c.2230G>TFamilial Mediterranean fever follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MEFV gene located on chromosomal region 16p13.3. The age of onset is infantile or adult (before the age of 30). This disease is characterized by recurrent short episodes of fever and serositis resulting in pain in the abdomen, chest, joints and muscles. The prevalence is 1:10,000-5:10,000.250,600
MERTKRetinitis pigmentosa type 38NM_006343.2NM_006343.2:c.2189+1G>T, NM_006343.2:c.1605-2A>G, NM_006343.2:c.2070_2074delAGGAC, NM_006343.2:c.2784_2785insTA, NM_006343.2:c.2785_2786dupTA, NM_006343.2:c.2323C>T, NM_006343.2:c.2207_2210delCTGTRetinitis pigmentosa type 38 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MERTK gene located on chromosomal region 2q13. The age of onset is infantile. This disease is characterized by. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness.250,600
MFRPMicrophthalmia - Retinitis pigmentosa - foveoschisis - optic disc drusenNM_031433.3NM_031433.3:c.498delC, NM_031433.3:c.523C>T, NM_031433.3:c.629G>T, NM_031433.3:c.1150_1151insC, NM_031433.3:c.545T>C, NM_031433.3:c.1124+1G>TMicrophthalmia - Retinitis pigmentosa - foveoschisis - optic disc drusen follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFRP gene located on chromosomal region 11q23.3. The age of onset is infantile. This disease is characterized by posterior microphthalmos, retinitis pigmentosa, foveoschisis, and optic disk drusen.250,600
MKKSBardet-Biedl/McKusick-Kaufman syndromeNM_018848.3NM_018848.3:c.353delGBardet-Biedl syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. McKusick-Kaufman syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is fetal. This disease is characterized by hydrometrocolpos, post-axial polydactyly, and to a lesser extent cardiac defects.250,600
MKKSBardet-Biedl syndrome type 6NM_018848.3NM_018848.3:c.830T>C, NM_018848.3:c.1436C>GBardet-Biedl syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.250,600
MKKSMcKusick-Kaufman syndromeNM_018848.3NM_018848.3:c.250C>T, NM_018848.3:c.1225_1226delGG, NM_018848.3:c.724G>TMcKusick-Kaufman syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is fetal. This disease is characterized by hydrometrocolpos, post-axial polydactyly, and to a lesser extent cardiac defects.250,600
MKS1Bardet-Biedl syndrome type 13NM_017777.3NM_017777.3:c.1349T>CBardet-Biedl syndrome type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.250,600
MKS1Meckel type 1/Bardet-Biedl syndromeNM_017777.3NM_017777.3:c.1024+1G>A, NM_017777.3:c.857A>G, NM_017777.3:c.1319T>C, NM_017777.3:c.814G>C, NM_017777.3:c.508C>T, NM_017777.3:c.1319G>CMeckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is infantile, etc/. This disease is characterized by a combination of renal cysts and variably associated features, including developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and cysts, and polydactyly.. The prevalence is 1:1,000,000-9:1,000,000. Bardet-Biedl syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.250,600
MMACHCMethylmalonic aciduria cblC type, with homocystinuriaNM_015506.2NM_015506.2:c.389A>G, NM_015506.2:c.388T>C, NM_015506.2:c.482G>A, NM_015506.2:c.609G>A, NM_015506.2:c.688C>T, NM_015506.2:c.394C>T, NM_015506.2:c.440G>C, NM_015506.2:c.608G>A, NM_015506.2:c.481C>T, NM_015506.2:c.619_620insG, NM_015506.2:c.547_548delGT, NM_015506.2:c.347T>C, NM_015506.2:c.658_660delAAG, NM_015506.2:c.388_390delTAC, NM_015506.2:c.615C>A, NM_015506.2:c.331C>T, NM_015506.2:c.616C>T, NM_015506.2:c.270_271insA, NM_015506.2:c.271dupA, NM_015506.2:c.615C>GMethylmalonic acidemia with homocystinuria, type cblC follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMACHC gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by failure to thrive, acute neurological deterioration, intellectual deficit, lethargy, seizures, microcephaly, a salt-and-pepper retinopathy, and signs of megaloblastic anemia. The prevalence is <1:1,000,000.250,600
MOCS2Molybdenum cofactor deficiency type BNM_176806.3NM_176806.3:c.106_107delAT, NM_176806.3:c.*297+1G>A, NM_176806.3:c.58delT, NM_176806.3:c.245delT, NM_176806.3:c.190G>A, NM_176806.3:c.16C>T, NM_176806.3:c.*487A>C, NM_176806.3:c.*422G>A, NM_176806.3:c.*26_*27delAT, NM_176806.3:c.539_540delAA, NM_176806.3:c.*459_*460delAAMolybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death.250,600
MTTPAbetalipoproteinemiaNM_000253.3NM_000253.3:c.1769G>T, NM_000253.3:c.2030delC, NM_000253.3:c.1619G>A, NM_000253.3:c.2593G>T, NM_000253.3:c.708_709delCA, NM_000253.3:c.1867+1G>A, NM_000253.3:c.703_704delACAbetalipoproteinemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTP gene located on chromosomal region 4q23. The age of onset is infantile. This disease is characterized by growth delay, malabsorption, hepatomegaly, and neurological and neuromuscular manifestations. The prevalence is <1:1,000,000.250,600
MUTMethylmalonic acidemiaNM_000255.3NM_000255.3:c.1420C>T, NM_000255.3:c.1445-2A>G, NM_000255.3:c.2080C>T, NM_000255.3:c.1867G>A, NM_000255.3:c.607G>A, NM_000255.3:c.1658delT, NM_000255.3:c.1280G>A, NM_000255.3:c.1399C>T, NM_000255.3:c.914T>C, NM_000255.3:c.643G>A, NM_000255.3:c.655A>T, NM_000255.3:c.1741C>T, NM_000255.3:c.1106G>A, NM_000255.3:c.1871A>G, NM_000255.3:c.1924G>C, NM_000255.3:c.682C>T, NM_000255.3:c.572C>A, NM_000255.3:c.313T>C, NM_000255.3:c.1181T>A, NM_000255.3:c.278G>A, NM_000255.3:c.678_679insAATTTATG, NM_000255.3:c.794dupT, NM_000255.3:c.671_678dupAATTTATG, NM_000255.3:c.2150G>T, NM_000255.3:c.280G>A, NM_000255.3:c.91C>T, NM_000255.3:c.1207C>TMethylmalonic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MUT gene located on chromosomal region 6p12.3. The age of onset is very early infantile. This disease is characterized by recurrent ketoacidotic comas or transient vomiting, dehydration, hypotonia and intellectual deficit, which does not respond to administration of vitamin B12.250,600
MVKHyper-IgD syndromeNM_000431.3NM_000431.3:c.829C>T, NM_000431.3:c.803T>C, NM_000431.3:c.185G>A, NM_000431.3:c.494C>T, NM_000431.3:c.59A>C, NM_000431.3:c.1129G>AHyper IgD syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by periodic attacks of fever and a systemic inflammatory reaction (cervical lymphadenopathy, abdominal pain, vomiting, diarrhea, arthralgias and skin signs).250,600
MVKMevalonic aciduriaNM_000431.3NM_000431.3:c.1000G>A, NM_000431.3:c.902A>C, NM_000431.3:c.928G>AMevalonic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by psychomotor retardation, failure to thrive, progressive cerebellar ataxia, dysmorphic features, progressive visual impairment and recurrent febrile crises. The prevalence is <1:1,000,000.250,600
MYO15ADeafness type 3, autosomal recessiveNM_016239.3NM_016239.3:c.3385C>T, NM_016239.3:c.6003delG, NM_016239.3:c.6004delG, NM_016239.3:c.10573delA, NM_016239.3:c.3313G>T, NM_016239.3:c.3336delG, NM_016239.3:c.755dupA, NM_016239.3:c.5492G>T, NM_016239.3:c.4351G>A, NM_016239.3:c.6864_6874delGGACCTGGAGC, NM_016239.3:c.4751_4752dupTC, NM_016239.3:c.625G>T, NM_016239.3:c.3693-2A>G, NM_016239.3:c.6614C>T, NM_016239.3:c.6743C>T, NM_016239.3:c.6046+2T>G, NM_016239.3:c.5326C>T, NM_016239.3:c.3756+1G>T, NM_016239.3:c.8410A>T, NM_016239.3:c.8429_8447delGCGGGCAGCTGCGGGTCCT, NM_016239.3:c.8148G>T, NM_016239.3:c.9958_9961delGACT, NM_016239.3:c.4750_4751insTC, NM_016239.3:c.8548C>TDeafness autosomal recessive type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO15A gene located on chromosomal region 17p11.2. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.250,600
MYO3ADeafness type 30, autosomal recessiveNM_017433.4NM_017433.4:c.1086T>G, NM_017433.4:c.2793+2T>A, NM_017433.4:c.4586+2T>G, NM_017433.4:c.4730+1G>A, NM_017433.4:c.1A>G, NM_017433.4:c.2506-1G>A, NM_017433.4:c.1777-12G>A, NM_017433.4:c.1952delC, NM_017433.4:c.1193C>A, NM_017433.4:c.770C>G, NM_017433.4:c.3154C>T, NM_017433.4:c.585+5G>C, NM_017433.4:c.2243delA, NM_017433.4:c.3112-2A>G, NM_017433.4:c.732-2A>GDeafness autosomal recessive type 30 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO3A gene located on chromosomal region 10p12.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.250,600
MYO6Deafness type 37, autosomal recessiveNM_004999.3NM_004999.3:c.2897_2899delAAG, NM_004999.3:c.2840G>A, NM_004999.3:c.647A>T, NM_004999.3:c.3496C>T, NM_004999.3:c.3808C>T, NM_004999.3:c.1446_1447insTDeafness autosomal recessive type 37 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO6 gene located on chromosomal region 6q14.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.250,600
MYO7ADeafness type 2, autosomal recessiveNM_000260.3NM_000260.3:c.1797G>A, NM_000260.3:c.2023C>T, NM_000260.3:c.731G>C, NM_000260.3:c.3596dupT, NM_000260.3:c.1184G>A, NM_000260.3:c.133-2A>GDeafness autosomal recessive type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.250,600
MYO7AUsher syndrome type 1BNM_000260.3NM_000260.3:c.1996C>T, NM_000260.3:c.1884C>A, NM_000260.3:c.448C>T, NM_000260.3:c.2476G>A, NM_000260.3:c.4024delT, NM_000260.3:c.2617C>T, NM_000260.3:c.5227C>T, NM_000260.3:c.1344-1G>A, NM_000260.3:c.5507T>G, NM_000260.3:c.5886_5889delCTTT, NM_000260.3:c.3504-1G>C, NM_000260.3:c.3508G>A, NM_000260.3:c.4018G>A, NM_000260.3:c.5392C>T, NM_000260.3:c.640G>A, NM_000260.3:c.3134T>C, NM_000260.3:c.5824G>T, NM_000260.3:c.3G>A, NM_000260.3:c.494C>T, NM_000260.3:c.5618G>A, NM_000260.3:c.5884_5887delTTCT, NM_000260.3:c.634C>T, NM_000260.3:c.3719G>A, NM_000260.3:c.5967C>G, NM_000260.3:c.3763delA, NM_000260.3:c.635G>A, NM_000260.3:c.6025delGUsher syndrome type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 1:100,000-9:100,000.250,600
NAGASchindler diseaseNM_000262.2NM_000262.2:c.973G>A, NM_000262.2:c.985C>T, NM_000262.2:c.986G>A, NM_000262.2:c.577G>TSchindler disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGA gene located on chromosomal region 22q13.2. The age of onset is infantile. This disease is characterized by early-onset neuroaxonal dystrophy and neurological signs (convulsion during fever, epilepsy, psychomotor retardation and hypotonia). NAGA deficiency is typically classified in three main phenotypes: NAGA deficiency type I (Schindler disease or Schindler disease type I) with severe manifestations; NAGA deficiency type II (Kanzazi disease or Schindler disease type II) which is mild; NAGA deficiency type III (Schindler disease type III) characterized by mild-to-moderate neurologic manifestations. NAGA deficiency results in the increased urinary excretion of glycopeptides and oligosaccharides containing alpha-N-acetylgalactosaminyl moieties.250,600
NEBNemaline myopathy type 2NM_004543.4NM_004543.4:c.11474_11475delTG, NM_004543.4:c.19119_19120delGA, NM_004543.4:c.19306-1G>A, NM_004543.4:c.19606G>T, NM_004543.4:c.6105dupT, NM_004543.4:c.3191A>G, NM_004543.4:c.18318_18319delAG, NM_004543.4:c.11473_11474delAT, NM_004543.4:c.2173G>T, NM_004543.4:c.19097_19098delTT, NM_004543.4:c.19836+1_19836+2insATGGA, NM_004543.4:c.18825+1370C>T, NM_004543.4:c.5567G>A, NM_004543.4:c.6105_6106insT, NM_004543.4:c.16842+1G>A, NM_004543.4:c.843T>G, NM_004543.4:c.8031_8041delAAATAAACGAG, NM_004543.4:c.14182_14183delGCinsAA, NM_004543.4:c.15973C>TNemaline myopathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEB gene located on chromosomal region 2q23.3. The age of onset is infantile or adult. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:100,000-9:100,000 and the incidence is 1/50.000 newborn.250,600
NMNAT1Leber congenital amaurosis type 9NM_022787.3NM_022787.3:c.451G>T, NM_022787.3:c.25G>A, NM_022787.3:c.457C>G, NM_022787.3:c.507G>A, NM_022787.3:c.710G>T, NM_022787.3:c.619C>T, NM_022787.3:c.769G>ALeber congenital amaurosis type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NMNAT1 gene located on chromosomal region 1p36.22. The age of onset is early infantile. This disease is characterized by blindness, nystagmus, roving eye movement, leading to severe visual impairment.250,600
NPC1Niemann-Pick disease type C1NM_000271.4NM_000271.4:c.1042C>T, NM_000271.4:c.2842G>A, NM_000271.4:c.1628C>T, NM_000271.4:c.2974G>T, NM_000271.4:c.3019C>G, NM_000271.4:c.1211G>A, NM_000271.4:c.2072C>T, NM_000271.4:c.2324A>C, NM_000271.4:c.337T>C, NM_000271.4:c.3107C>T, NM_000271.4:c.530G>A, NM_000271.4:c.743G>T, NM_000271.4:c.3611_3614delTTAC, NM_000271.4:c.813_815delCAT, NM_000271.4:c.2932C>T, NM_000271.4:c.3425T>C, NM_000271.4:c.2761C>T, NM_000271.4:c.3104C>T, NM_000271.4:c.3662delT, NM_000271.4:c.2972_2973delAG, NM_000271.4:c.2974G>A, NM_000271.4:c.2873G>A, NM_000271.4:c.352_353delAG, NM_000271.4:c.3182T>C, NM_000271.4:c.3467A>G, NM_000271.4:c.3175C>T, NM_000271.4:c.2861C>T, NM_000271.4:c.2848G>ANiemann-Pick disease type C1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC1 gene located on chromosomal region 18q11.2. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000.250,600
NPC2Niemann-Pick disease type C2NM_006432.3NM_006432.3:c.115G>A, NM_006432.3:c.190+5G>A, NM_006432.3:c.27delG, NM_006432.3:c.352G>T, NM_006432.3:c.58G>T, NM_006432.3:c.358C>T, NM_006432.3:c.295T>C, NM_006432.3:c.441+1G>A, NM_006432.3:c.436C>TNiemann-Pick disease type C2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC2 gene located on chromosomal region 14q24.3. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000.250,600
NPHP3Nephronophthisis type 3NM_153240.4NM_153240.4:c.1817G>A, NM_153240.4:c.434_437delAAAG, NM_153240.4:c.1119-2A>G, NM_153240.4:c.1729C>T, NM_153240.4:c.2694-2A>G, NM_153240.4:c.1985+5G>A, NM_153240.4:c.3406C>T, NM_153240.4:c.3373C>T, NM_153240.4:c.1381G>T, NM_153240.4:c.2694-2_2694-1delAG, NM_153240.4:c.1157A>G, NM_153240.4:c.2369T>C, NM_153240.4:c.3550G>A, NM_153240.4:c.2541delG, NM_153240.4:c.2570+1G>T, NM_153240.4:c.3156_3157insA, NM_153240.4:c.3662C>TNephronophthisis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP3 gene located on chromosomal region 3q22.1. The age of onset is adult. This disease is characterized by polyuria, polydipsia, anemia. Onset of terminal renal failure occur significantly later (median age, 19 years) than in juvenile nephronophthisis. Renal pathology is characterized by alterations of tubular basement membranes, tubular atrophy and dilation, sclerosing tubulointerstitial nephropathy, and renal cyst development predominantly at the corticomedullary junction. The prevalence is <1:1,000,000.250,600
NPHP4Nephronophthisis type 4NM_015102.4NM_015102.4:c.4179T>A, NM_015102.4:c.3767_3768insAA, NM_015102.4:c.3674C>T, NM_015102.4:c.556_557insT, NM_015102.4:c.2940_2944dupGCTCC, NM_015102.4:c.3231+1G>C, NM_015102.4:c.517C>T, NM_015102.4:c.2335C>T, NM_015102.4:c.2219G>A, NM_015102.4:c.7G>T, NM_015102.4:c.1972C>T, NM_015102.4:c.1120-1G>CNephronophthisis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP4 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease results in end-stage renal disease at age ranging between 6 and 35 years. It is a progressive tubulo-interstitial kidney disorder characterized by polydipsia, polyuria, anemia and growth retardation. The prevalence is 1:1,000,000-9:1,000,000.250,600
NPHS1Nephrotic syndrome type 1NM_004646.3NM_004646.3:c.59-5C>G, NM_004646.3:c.3109+1G>A, NM_004646.3:c.3478C>T, NM_004646.3:c.121_122delCT, NM_004646.3:c.1481delC, NM_004646.3:c.2456A>T, NM_004646.3:c.2491C>T, NM_004646.3:c.2464G>A, NM_004646.3:c.1307_1308dupAC, NM_004646.3:c.3250delG, NM_004646.3:c.3325C>T, NM_004646.3:c.2928G>T, NM_004646.3:c.3250_3251insG, NM_004646.3:c.2746G>T, NM_004646.3:c.1715G>ANephrotic syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHS1 gene located on chromosomal region 19q13.12. The age of onset is fetal- infantile. This disease is characterized by fetal proteinuria and nephritic infantile syndrome. The prevalence is 1 in 8 200 births.250,600
NR2E3Enhaced S-Cone SyndromeNM_014249.3NM_014249.3:c.119-2A>C, NM_014249.3:c.297_298delGT, NM_014249.3:c.932G>A, NM_014249.3:c.226C>T, NM_014249.3:c.361G>A, NM_014249.3:c.227G>A, NM_014249.3:c.1034_1038delTGCAGEnhaced S-Cone Syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NR2E3 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by night blindness, reduced bilateral visual acuity, and typical fundus findings (progressive pigmentary degenerative changes, macular edema, retinoschisis).250,600
OCA2Oculocutaneous albinism type 2NM_000275.2NM_000275.2:c.1610A>G, NM_000275.2:c.1960delG, NM_000275.2:c.2359G>A, NM_000275.2:c.819_822delCTGGinsGGTC, NM_000275.2:c.2228C>T, NM_000275.2:c.1025A>G, NM_000275.2:c.1842+1G>T, NM_000275.2:c.157delA, NM_000275.2:c.1182G>A, NM_000275.2:c.1182+2T>C, NM_000275.2:c.1441G>A, NM_000275.2:c.79G>A, NM_000275.2:c.1465A>G, NM_000275.2:c.1327G>A, NM_000275.2:c.1364+1G>TOculocutaneous albinism type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OCA2 gene located on chromosomal region 15q12-q13. The age of onset is infantile. This disease is characterized by variable hypopigmentation of the skin and hair, numerous characteristic ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1/38,000-1/40,000250,600
OTOADeafness type 22, autosomal recessiveNM_144672.3NM_144672.3:c.2301+1G>T, NM_144672.3:c.2359G>T, NM_144672.3:c.121-1G>A, NM_144672.3:c.827delT, NM_144672.3:c.1725_1726delCADeafness, autosomal recessive type 22 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOA gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems.250,600
OTOFDeaffness type 9, autosomal recessiveNM_194248.2NM_194248.2:c.149G>A, NM_194248.2:c.1867G>A, NM_194248.2:c.1669G>A, NM_194248.2:c.2381G>A, NM_194248.2:c.1498C>T, NM_194248.2:c.1544T>C, NM_194248.2:c.5473C>G, NM_194248.2:c.1150G>A, NM_194248.2:c.1778delT, NM_194248.2:c.5103+2T>A, NM_194248.2:c.227+2T>C, NM_194248.2:c.5474_5475delCC, NM_194248.2:c.5332G>A, NM_194248.2:c.584-1G>C, NM_194248.2:c.98G>A, NM_194248.2:c.2348delG, NM_194248.2:c.3032T>C, NM_194248.2:c.4559G>A, NM_194248.2:c.4491T>A, NM_194248.2:c.5816G>A, NM_194248.2:c.766-2A>G, NM_194248.2:c.2485C>T, NM_194248.2:c.2401G>TDeaffness, autosomal recessive type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems.250,600
PAHPhenylketonuriaNM_000277.1NM_000277.1:c.1139C>T, NM_000277.1:c.1066-3C>T, NM_000277.1:c.117C>G, NM_000277.1:c.1166delC, NM_000277.1:c.1068C>A, NM_000277.1:c.1315+1G>A, NM_000277.1:c.1162G>A, NM_000277.1:c.143T>C, NM_000277.1:c.1243G>A, NM_000277.1:c.1169A>G, NM_000277.1:c.136G>A, NM_000277.1:c.1184C>A, NM_000277.1:c.194T>C, NM_000277.1:c.1199+17G>A, NM_000277.1:c.232G>A, NM_000277.1:c.1045T>C, NM_000277.1:c.1197A>T, NM_000277.1:c.441+1G>A, NM_000277.1:c.442-1G>A, NM_000277.1:c.442-5C>G, NM_000277.1:c.450_451insA, NM_000277.1:c.472C>T, NM_000277.1:c.204A>T, NM_000277.1:c.482T>C, NM_000277.1:c.250G>T, NM_000277.1:c.261C>A, NM_000277.1:c.1030G>A, NM_000277.1:c.1199+1G>A, NM_000277.1:c.1238G>C, NM_000277.1:c.1241A>G, NM_000277.1:c.673C>G, NM_000277.1:c.688G>A, NM_000277.1:c.721C>T, NM_000277.1:c.722delG, NM_000277.1:c.722G>A, NM_000277.1:c.727C>T, NM_000277.1:c.728G>A, NM_000277.1:c.733G>C, NM_000277.1:c.734T>C, NM_000277.1:c.737C>A, NM_000277.1:c.745C>T, NM_000277.1:c.1042C>G, NM_000277.1:c.638T>C, NM_000277.1:c.764T>C, NM_000277.1:c.782G>A, NM_000277.1:c.806delT, NM_000277.1:c.809G>A, NM_000277.1:c.814G>T, NM_000277.1:c.818C>T, NM_000277.1:c.823C>T, NM_000277.1:c.829T>G, NM_000277.1:c.898G>T, NM_000277.1:c.912+1G>A, NM_000277.1:c.284_286delTCA, NM_000277.1:c.754C>T, NM_000277.1:c.755G>A, NM_000277.1:c.357delC, NM_000277.1:c.1217T>C, NM_000277.1:c.1222C>T, NM_000277.1:c.157C>T, NM_000277.1:c.158G>A, NM_000277.1:c.165T>G, NM_000277.1:c.473G>A, NM_000277.1:c.490A>G, NM_000277.1:c.503delA, NM_000277.1:c.508C>G, NM_000277.1:c.533A>G, NM_000277.1:c.665A>G, NM_000277.1:c.838G>A, NM_000277.1:c.842+5G>A, NM_000277.1:c.896T>G, NM_000277.1:c.320A>G, NM_000277.1:c.441+5G>T, NM_000277.1:c.311C>A, NM_000277.1:c.527G>T, NM_000277.1:c.529G>A, NM_000277.1:c.47_48delCT, NM_000277.1:c.1208C>T, NM_000277.1:c.331C>T, NM_000277.1:c.926C>T, NM_000277.1:c.955G>T, NM_000277.1:c.926C>A, NM_000277.1:c.509+1G>A, NM_000277.1:c.1033G>T, NM_000277.1:c.611A>G, NM_000277.1:c.1066-11G>A, NM_000277.1:c.569T>CPhenylketonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAH gene located on chromosomal region 12q23.2. The age of onset is neonatal. This disease is characterized by gradual developmental delay, stunted growth, microcephaly, seizures, tremors, eczema, vomiting, and musty odor. Untreated patients subsequently develop intellectual disability, behavioral disorders (hyperactivity) and motor disorders. The prevalence is 1:2,600-1:200,000.250,600
PALB2Fanconi anemia, complementation group NNM_024675.3NM_024675.3:c.1882_1890delAAGTCCTGC, NM_024675.3:c.2962C>T, NM_024675.3:c.50T>G, NM_024675.3:c.3116delA, NM_024675.3:c.3287A>G, NM_024675.3:c.3549C>G, NM_024675.3:c.3113G>A, NM_024675.3:c.2816T>G, NM_024675.3:c.1240C>T, NM_024675.3:c.557_558insAFanconi anemia, complementation group N follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PALB2 gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:1,000,000-9:1,000,000.250,600
PANK2Pantothenate kinase-associated neurodegenerationNM_153638.2NM_153638.2:c.1561G>A, NM_153638.2:c.688G>A, NM_153638.2:c.790C>T, NM_153638.2:c.821_822delCT, NM_153638.2:c.1583C>T, NM_153638.2:c.1211A>TPantothenate kinase-associated neurodegeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PANK2 gene located on chromosomal region 20p13. The age of onset is infantile. This disease is characterized by progressive extrapyramidal dysfunction (dystonia, rigidity, choreoathetosis), iron accumulation on the brain and axonal spheroids in the central nervous system. The prevalence is 1-2/1,000,000.250,600
PCPyruvate carboxylase deficiencyNM_000920.3NM_000920.3:c.434T>C, NM_000920.3:c.1748G>T, NM_000920.3:c.496G>APyruvate carboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PC gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by metabolic acidosis, failure to thrive, developmental delay, and recurrent seizures. The prevalence is 1:250,000.250,600
PCCAPropionic acidemia type 1NM_000282.3NM_000282.3:c.1598_1601delTTGT, NM_000282.3:c.412G>A, NM_000282.3:c.1226_1227delTT, NM_000282.3:c.1891G>C, NM_000282.3:c.1899+1_1899+4delGTAA, NM_000282.3:c.1284+1G>A, NM_000282.3:c.229C>T, NM_000282.3:c.1023dupT, NM_000282.3:c.600+1G>A, NM_000282.3:c.261_262insT, NM_000282.3:c.1118T>A, NM_000282.3:c.862A>TPropionic acidemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCA gene located on chromosomal region 13q32.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000.250,600
PCCBPropionic acidemia type 2NM_000532.4NM_000532.4:c.1279_1291delGTTCCCinsAA, NM_000532.4:c.1283C>T, NM_000532.4:c.337C>T, NM_000532.4:c.1538_1540dupCCC, NM_000532.4:c.990dupT, NM_000532.4:c.1304A>G, NM_000532.4:c.1228C>T, NM_000532.4:c.1229_1230insT, NM_000532.4:c.1606A>G, NM_000532.4:c.1223_1226delTCAT, NM_000532.4:c.1490C>T, NM_000532.4:c.1534C>T, NM_000532.4:c.1173_1174insT, NM_000532.4:c.1540_1541insCCC, NM_000532.4:c.331C>T, NM_000532.4:c.683C>T, NM_000532.4:c.797G>T, NM_000532.4:c.737G>T, NM_000532.4:c.1218_1231delinsTAGAGCACAGGA, NM_000532.4:c.502G>A, NM_000532.4:c.562G>A, NM_000532.4:c.1219_1224delGGCATCinsAAPropionic acidemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCB gene located on chromosomal region 3q22.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy.. The prevalence is 1:100,000.250,600
PCDH15Usher syndrome type 1FNM_033056.3NM_033056.3:c.1583T>A, NM_033056.3:c.4885delA, NM_033056.3:c.4961_4962insTGAT, NM_033056.3:c.5659A>T, NM_033056.3:c.4937_4940dupTGAT, NM_033056.3:c.785G>A, NM_033056.3:c.5622_5624delAAC, NM_033056.3:c.400C>T, NM_033056.3:c.5724_5755delACGCACAAATGTTTCAGAACTTCAAACTATGT, NM_033056.3:c.4864delA, NM_033056.3:c.1737C>G, NM_033056.3:c.1021C>T, NM_033056.3:c.1088delT, NM_033056.3:c.1006C>T, NM_033056.3:c.1940C>G, NM_033056.3:c.400C>G, NM_033056.3:c.3718-2A>G, NM_033056.3:c.4548_4551dupATCT, NM_033056.3:c.7C>T, NM_033056.3:c.2645_2646delATUsher syndrome type 1F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCDH15 gene located on chromosomal region 10q21.1. The age of onset is early. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 4.4:100,000.250,600
PDE6ARetinitis pigmentosa type 43NM_000440.2NM_000440.2:c.1683G>A, NM_000440.2:c.1113+1G>T, NM_000440.2:c.718-4_718-3insT, NM_000440.2:c.1749C>G, NM_000440.2:c.2053G>A, NM_000440.2:c.1560_1561insA, NM_000440.2:c.304C>A, NM_000440.2:c.1040C>T, NM_000440.2:c.1113+1G>ARetinitis pigmentosa 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.250,600
PDE6BRetinitis pigmentosa type 43NM_000283.3NM_000283.3:c.1580T>C, NM_000283.3:c.655T>C, NM_000283.3:c.1540delC, NM_000283.3:c.1572delC, NM_000283.3:c.1920+2T>C, NM_000283.3:c.1669C>T, NM_000283.3:c.892C>TRetinitis pigmentosa 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.250,600
PEX1Peroxisome biogenesis disorder type 1ANM_000466.2NM_000466.2:c.2097dupT, NM_000466.2:c.2916delA, NM_000466.2:c.1842delA, NM_000466.2:c.1991T>C, NM_000466.2:c.1239+1G>TPeroxisome biogenesis disorder type 1A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. The age of onset is early. This disease is characterized by neuronal migration defects in the brain, dysmorphic craniofacial features, profound hypotonia, neonatal seizures, and liver dysfunction. The prevalence is 1:1,000,000.250,600
PEX1Peroxisome biogenesis disorder type 1BNM_000466.2NM_000466.2:c.2097_2098insT, NM_000466.2:c.1952_1960dupCAGTGTGGA, NM_000466.2:c.877C>T, NM_000466.2:c.3505_3517delCAGTTGTTTTCAC, NM_000466.2:c.2528G>APeroxisome biogenesis disorder type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. The age of onset is early. This disease includes neonatal adrenoleukodystrophy and infantile Refsum disease, two milder manifestations of the Zellweger disease spectrum. The clinical course of patients is variable and may include developmental delay, hypotonia, liver dysfunction, sensorineural hearing loss, retinal dystrophy and vision impairment.250,600
PEX7Rhizomelic chondrodysplasia punctata type 1NM_000288.3NM_000288.3:c.694C>T, NM_000288.3:c.649G>A, NM_000288.3:c.618G>A, NM_000288.3:c.722A>T, NM_000288.3:c.875T>A, NM_000288.3:c.653C>T, NM_000288.3:c.854A>G, NM_000288.3:c.532C>T, NM_000288.3:c.903+1G>CRhizomelic chondrodysplasia punctata type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX7 gene located on chromosomal region 6q23.3. The age of onset is early. This disease is characterized by proximal shortening of the humerus and to a lesser degree the femur (rhizomelia), punctate calcifications in cartilage with epiphyseal and metaphyseal abnormalities (chondrodysplasia punctata), coronal clefts of the vertebral bodies, cataracts, postnatal growth deficiency is profound, intellectual disability is severe, seizures. The prevalence is <1:100,000.250,600
PHYHRefsum diseaseNM_006214.3NM_006214.3:c.135-2A>G, NM_006214.3:c.497-2A>G, NM_006214.3:c.135-1G>C, NM_006214.3:c.805A>C, NM_006214.3:c.678+5G>T, NM_006214.3:c.823C>T, NM_006214.3:c.530A>G, NM_006214.3:c.164delT, NM_006214.3:c.678+2T>G, NM_006214.3:c.824G>ARefsum disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHYH gene located on chromosomal region 10p13. The age of onset is variable. This disease is characterized by hemeralopia (loss of vision in the dark), followed by episods of chronic distal motor polyneuropathy. Other associated signs include perceptive deafness, anosmia, cerebellous ataxia and sometimes, severe intellectual deficiency. Over the course of time cutaneous signs appear (ichtyosis), along with polyepiphyseal dysplasia, myocardiopathy, elevated protein in cerebrospinal fluid, and pigmentary retinitis that may result in blindness. The prevalence is 1:1.000,000-9:1.000,000.250,600
PKHD1Polycystic kidney disease, autosomal recessiveNM_138694.3NM_138694.3:c.10515C>A, NM_138694.3:c.11363_11372delCTTCCCTGGA, NM_138694.3:c.10585G>C, NM_138694.3:c.107C>T, NM_138694.3:c.10452dupT, NM_138694.3:c.2452C>T, NM_138694.3:c.2747A>C, NM_138694.3:c.12027C>G, NM_138694.3:c.11284C>A, NM_138694.3:c.3367G>A, NM_138694.3:c.353delG, NM_138694.3:c.2827_2828delGA, NM_138694.3:c.2854G>A, NM_138694.3:c.1342G>C, NM_138694.3:c.1409G>A, NM_138694.3:c.11611T>C, NM_138694.3:c.3761_3762delCCinsG, NM_138694.3:c.2414C>T, NM_138694.3:c.5895_5896insA, NM_138694.3:c.5895dupA, NM_138694.3:c.6499C>T, NM_138694.3:c.664A>G, NM_138694.3:c.682A>G, NM_138694.3:c.6854G>A, NM_138694.3:c.370C>T, NM_138694.3:c.8407T>C, NM_138694.3:c.3766delC, NM_138694.3:c.3940delA, NM_138694.3:c.1486C>T, NM_138694.3:c.2341C>T, NM_138694.3:c.10219C>T, NM_138694.3:c.9107T>G, NM_138694.3:c.930delC, NM_138694.3:c.9370C>T, NM_138694.3:c.9530T>C, NM_138694.3:c.9689delA, NM_138694.3:c.982C>T, NM_138694.3:c.9866G>T, NM_138694.3:c.10036T>C, NM_138694.3:c.3229-2A>C, NM_138694.3:c.4870C>T, NM_138694.3:c.4165C>A, NM_138694.3:c.9719G>A, NM_138694.3:c.5325_5326delAG, NM_138694.3:c.5498C>T, NM_138694.3:c.8824C>T, NM_138694.3:c.85G>T, NM_138694.3:c.10412T>G, NM_138694.3:c.8518C>T, NM_138694.3:c.8408G>A, NM_138694.3:c.8317G>T, NM_138694.3:c.8870T>CAutosomal recessive polycystic kidney disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKHD1 gene located on chromosomal region 6p12.3-p12.2. The age of onset is early. This disease is characterized by the development of cysts affecting the collecting ducts. It is frequently associated with hepatic involvement. After birth, in addition to nephromegaly, arterial hypertension and urinary tract infections are common and often severe. The prevalence is 1:10,000-1:40,000.250,600
PKLRHemolytic anemia due to red cell pyruvate kinase deficiencyNM_000298.5NM_000298.5:c.1151C>T, NM_000298.5:c.1706G>A, NM_000298.5:c.1529G>A, NM_000298.5:c.1528C>T, NM_000298.5:c.1595G>A, NM_000298.5:c.721G>T, NM_000298.5:c.1076G>A, NM_000298.5:c.1675C>T, NM_000298.5:c.1261C>A, NM_000298.5:c.1436G>A, NM_000298.5:c.1456C>THemolytic anemia due to red cell pyruvate kinase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKLR gene located on chromosomal region 1q22. The age of onset is early. This disease is characterized by highly variable degree of chronic hemolysis, with severe neonatal jaundice and fatal anemia at birth, severe transfusion-dependent chronic hemolysis, and moderate hemolysis with exacerbation during infection. The prevalence is 1:20,000.250,600
PLCE1Nephrotic syndrome type 3NM_016341.3NM_016341.3:c.3346C>T, NM_016341.3:c.4808delA, NM_016341.3:c.3846delG, NM_016341.3:c.3736C>T, NM_016341.3:c.5560C>T, NM_016341.3:c.4451C>T, NM_016341.3:c.5669C>T, NM_016341.3:c.961C>TNephrotic syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLCE1 gene located on chromosomal region 10q23.33. The age of onset is variable. This disease is characterized by low blood protein levels, high cholesterol levels, high triglyceride levels, and presence of protein in the urine. The prevalence is 2:100,000-7:100,000 Children; 3:100,000 adults.250,600
PLGCongenital plasminogen deficiency type 1NM_000301.3NM_000301.3:c.704G>A, NM_000301.3:c.1848G>A, NM_000301.3:c.1435G>T, NM_000301.3:c.693_695delGAA, NM_000301.3:c.1120G>T, NM_000301.3:c.112A>GPlasminogen deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLG gene located on chromosomal region 6q26. The age of onset is infantile.This disease is characterized by markedly impaired extracellular fibrinolysis leading to the formation of ligneous (fibrin-rich) pseudomembranes on mucosae during wound healing. The prevalence is 1:1,000,000-9:1,000,000.250,600
PMM2Congenital disorders of glycosylation type 1aNM_000303.2NM_000303.2:c.349G>C, NM_000303.2:c.357C>A, NM_000303.2:c.255+2T>C, NM_000303.2:c.127G>C, NM_000303.2:c.395T>C, NM_000303.2:c.415G>A, NM_000303.2:c.368G>A, NM_000303.2:c.385G>A, NM_000303.2:c.470T>C, NM_000303.2:c.484C>T, NM_000303.2:c.422G>A, NM_000303.2:c.442G>A, NM_000303.2:c.623G>C, NM_000303.2:c.647A>T, NM_000303.2:c.652C>G, NM_000303.2:c.323C>T, NM_000303.2:c.677C>G, NM_000303.2:c.691G>A, NM_000303.2:c.710C>G, NM_000303.2:c.669C>G, NM_000303.2:c.95_96delTAinsGC, NM_000303.2:c.95T>G, NM_000303.2:c.53C>G, NM_000303.2:c.710C>T, NM_000303.2:c.620T>C, NM_000303.2:c.97C>T, NM_000303.2:c.193G>T, NM_000303.2:c.338C>T, NM_000303.2:c.563A>G, NM_000303.2:c.131T>C, NM_000303.2:c.26G>A, NM_000303.2:c.109C>T, NM_000303.2:c.317A>T, NM_000303.2:c.190delT, NM_000303.2:c.256-1G>CCongenital disorder of glycosylation type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PMM2 gene located on chromosomal region 16p13.2. The age of onset is infantile. This disease is characterized by highly variable clinical manifestations that may include feeding problems, vomiting, and diarrhea with failure to thrive in infants, and severe encephalopathy with axial hypotonia, abnormal eye movement, marked psychomotor retardation, peripheral neuropathy, cerebellar hypoplasia, stroke-like episodes, and retinitis pigmentosa in late infancy, childhood or adulthood.250,600
POLGMitochondrial DNA depletion syndrome, Alpers typeNM_002693.2NM_002693.2:c.2617G>T, NM_002693.2:c.1120C>T, NM_002693.2:c.830A>T, NM_002693.2:c.3218C>T, NM_002693.2:c.3630dupCMitochondrial DNA depletion syndrome, Alpers type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by the clinical triad of psychomotor regression, seizures, and liver disease. The prevalence is 1:1,600 newborn.250,600
POLGProgressive external ophthalmoplegiaNM_002693.2NM_002693.2:c.1437C>G, NM_002693.2:c.2591A>G, NM_002693.2:c.1754G>A, NM_002693.2:c.1399G>A, NM_002693.2:c.1491G>C, NM_002693.2:c.3151G>C, NM_002693.2:c.803G>C, NM_002693.2:c.3286C>T, NM_002693.2:c.2794C>T, NM_002693.2:c.752C>T, NM_002693.2:c.3644-1G>A, NM_002693.2:c.1879C>T, NM_002693.2:c.2605C>T, NM_002693.2:c.911T>G, NM_002693.2:c.1760C>T, NM_002693.2:c.2542G>A, NM_002693.2:c.1550G>T, NM_002693.2:c.2557C>T, NM_002693.2:c.2207A>G, NM_002693.2:c.2243G>C, NM_002693.2:c.2209G>CProgressive external ophthalmoplegia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by ptosis, paralysis of the extraocular muscles, oropharyngeal weakness, and variably severe proximal limb weakness.250,600
POMGNT1Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3NM_017739.3NM_017739.3:c.1425G>A, NM_017739.3:c.1545delC, NM_017739.3:c.1274G>C, NM_017739.3:c.1864delC, NM_017739.3:c.1411A>T, NM_017739.3:c.1469G>A, NM_017739.3:c.1539+1G>A, NM_017739.3:c.92dupA, NM_017739.3:c.1539+1G>T, NM_017739.3:c.932G>A, NM_017739.3:c.794G>A, NM_017739.3:c.880-1G>A, NM_017739.3:c.652+1G>A, NM_017739.3:c.931C>T, NM_017739.3:c.1666G>A, NM_017739.3:c.1814G>C, NM_017739.3:c.636C>T, NM_017739.3:c.187C>TMuscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3 which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMGNT1 gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent psychomotor development, eye involvement and seizures. The prevalence is 1-9:100,000.250,600
POMT1Congenital muscular dystrophy with intellectual disability type B1NM_007171.3NM_007171.3:c.598G>C, NM_007171.3:c.193G>A, NM_007171.3:c.1770G>C, NM_007171.3:c.2005G>A, NM_007171.3:c.2163C>A, NM_007171.3:c.1746G>C, NM_007171.3:c.793C>TCongenital muscular dystrophy with intellectual disability type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 gene located on chromosomal region 9q34.13. The age of onset is early. This disease is associated with mental retardation and mild structural brain abnormalities.250,600
POMT1Walker-Warburg syndromeNM_007171.3NM_007171.3:c.1540C>T, NM_007171.3:c.226G>A, NM_007171.3:c.1611C>G, NM_007171.3:c.1242-2A>G, NM_007171.3:c.907C>T, NM_007171.3:c.2163_2164insG, NM_007171.3:c.2167dupG, NM_007171.3:c.1153C>T, NM_007171.3:c.1261_1262insC, NM_007171.3:c.831C>G, NM_007171.3:c.1545C>G, NM_007171.3:c.1280_1281delAGinsTCWalker-Warburg syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 and POMT2 genes located on chromosomal regions 9q34.13 and 14q24.3 respectively. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent or very poor psychomotor development, eye involvement and seizures. The prevalence is 1:100,000-9:100,000.250,600
POMT2Congenital muscular dystrophy with intellectual disability type A2NM_013382.5NM_013382.5:c.2243G>C, NM_013382.5:c.1997A>G, NM_013382.5:c.2242T>C, NM_013382.5:c.1445G>T, NM_013382.5:c.2177G>A, NM_013382.5:c.1238G>C, NM_013382.5:c.1941G>A, NM_013382.5:c.1057G>A, NM_013382.5:c.551C>TCongenital muscular dystrophy with intellectual disability type A2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT2 gene located on chromosomal region 14q24.3. The age of onset is early. This disorder characterized by congenital muscular dystrophy associated with cobblestone lissencephaly and other brain anomalies, eye malformations, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease.250,600
POMT2Walker-Warburg syndromeNM_013382.5NM_013382.5:c.1726-2A>G, NM_013382.5:c.1417C>T, NM_013382.5:c.1912C>T, NM_013382.5:c.1608_1609delCA, NM_013382.5:c.1045_1052delinsGWalker-Warburg syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 and POMT2 genes located on chromosomal regions 9q34.13 and 14q24.3 respectively. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent or very poor psychomotor development, eye involvement and seizures. The prevalence is 1:100,000-9:100,000.250,600
PPT1Neuronal ceroid-lipofuscinoses type 1NM_000310.3NM_000310.3:c.29T>A, NM_000310.3:c.223A>C, NM_000310.3:c.627+1G>T, NM_000310.3:c.169_170insA, NM_000310.3:c.451C>T, NM_000310.3:c.541G>T, NM_000310.3:c.840_841insANeuronal ceroid lipofuscinoses, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PPT1 gene located on chromosomal region 1p32. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 1.5:1,000,000-9:1,000,000.250,600
PRODHHyperprolinemia type 1NM_016335.4NM_016335.4:c.865T>A, NM_016335.4:c.1331G>AHyperprolinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRODH gene located on chromosomal region 22q11.2. The age of onset is variable. This disease is characterized by benign symptoms, but associations with renal abnormalities, epileptic seizures, and other neurological manifestations, as well as certain forms of schizophrenia have been reported.250,600
PROM1Retinitis pigmentosa type 41NM_006017.2NM_006017.2:c.1841delG, NM_006017.2:c.1354_1355insT, NM_006017.2:c.1726C>T, NM_006017.2:c.199C>T, NM_006017.2:c.2490-2A>G, NM_006017.2:c.1177_1178delATRetinitis pigmentosa 41 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROM1 gene located on chromosomal region 4p15.32. The age of onset is early. This disease is characterized by night blindness often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 19:100,000-27:100,000.250,600
PYGMMcArdle diseaseNM_005609.2NM_005609.2:c.1628A>C, NM_005609.2:c.1466C>G, NM_005609.2:c.1094C>T, NM_005609.2:c.1827G>A, NM_005609.2:c.13_14delCT, NM_005609.2:c.1A>G, NM_005609.2:c.2009C>T, NM_005609.2:c.2128_2130delTTC, NM_005609.2:c.393delG, NM_005609.2:c.2392T>C, NM_005609.2:c.148C>T, NM_005609.2:c.1621G>T, NM_005609.2:c.613G>A, NM_005609.2:c.1963G>A, NM_005609.2:c.2262delA, NM_005609.2:c.1722T>G, NM_005609.2:c.255C>A, NM_005609.2:c.280C>T, NM_005609.2:c.1768+1G>A, NM_005609.2:c.501dupT, NM_005609.2:c.481C>T, NM_005609.2:c.1726C>TMcArdle disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PYGM gene located on chromosomal region 11q13.1. The age of onset is infantile. This disease is characterized by muscular exercise intolerance with myalgia, cramps, fatigue, and muscle weakness.250,600
RAG1Immunodeficiency severe combined B cell-negativeNM_000448.2NM_000448.2:c.2333G>A, NM_000448.2:c.2320G>T, NM_000448.2:c.2164G>A, NM_000448.2:c.940C>T, NM_000448.2:c.2814T>G, NM_000448.2:c.2923C>T, NM_000448.2:c.2326C>TSevere combined immunodeficiency, autosomal recessive, T cell-negative, B cell negative, NK cell positive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 gene located on chromosomal region 11p13. The age of onset is early. This disease is characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development.250,600
RAG1Omenn syndromeNM_000448.2NM_000448.2:c.983G>A, NM_000448.2:c.3016A>G, NM_000448.2:c.256_257delAA, NM_000448.2:c.1682G>A, NM_000448.2:c.1681C>TOmenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency.250,600
RAPSNCongenital myasthenic syndromeNM_005055.4NM_005055.4:c.484G>A, NM_005055.4:c.264C>A, NM_005055.4:c.807C>A, NM_005055.4:c.848T>C, NM_005055.4:c.490C>T, NM_005055.4:c.603C>ACongenital myasthenic syndromes follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by fatigable weakness of skeletal muscle (e.g., ocular, bulbar, limb muscles) with onset at or shortly after birth or in early childhood; rarely, symptoms may not manifest until later in childhood. Cardiac and smooth muscle are not involved. Severity and course of disease are highly variable, ranging from minor symptoms to progressive disabling weakness. The prevalence is 1:3,000.250,600
RAPSNFetal akinesia deformation sequenceNM_005055.4NM_005055.4:c.416T>C, NM_005055.4:c.566C>TFetal akinesia deformation sequence follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by multiple joint contractures, facial anomalies and pulmonary hypoplasia. The prevalence is 1:3,000.250,600
RAXIsolated microphthalmia type 3NM_013435.2NM_013435.2:c.909C>G, NM_013435.2:c.18C>A, NM_013435.2:c.197G>C, NM_013435.2:c.439C>T, NM_013435.2:c.383_384delAGIsolated microphthalmia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAX gene located on chromosomal region 18q21.32. Microphthalmia designates a heterogeneous group of ocular malformations with a more or less evident reduction in the size of the eyeball. Additional features include high hypermetropia and a short axial length.250,600
RDH12Leber congenital amaurosis type 13NM_152443.2NM_152443.2:c.184C>T, NM_152443.2:c.146C>T, NM_152443.2:c.152T>A, NM_152443.2:c.451C>A, NM_152443.2:c.295C>A, NM_152443.2:c.377C>T, NM_152443.2:c.379G>T, NM_152443.2:c.565C>T, NM_152443.2:c.677A>G, NM_152443.2:c.805_809delGCCCT, NM_152443.2:c.164C>T, NM_152443.2:c.210dupC, NM_152443.2:c.448+1_448+4delGTAA, NM_152443.2:c.451C>G, NM_152443.2:c.464C>T, NM_152443.2:c.523T>CLeber congenital amaurosis type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDH12 gene located on chromosomal region 14q24.1. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.250,600
RGRRetinitis pigmentosa type 44NM_001012720.1NM_001012720.1:c.196A>C, NM_001012720.1:c.249_250insGGCTCGGA, NM_001012720.1:c.261_262insGGCTCGGA, NM_001012720.1:c.454C>A, NM_001012720.1:c.865C>T, NM_001012720.1:c.877C>TRetinitis pigmentosa type 44 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RGR gene located on chromosomal region 10q23.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.250,600
RHORetinitis pigmentosa type 4NM_000539.3NM_000539.3:c.152G>C, NM_000539.3:c.173C>T, NM_000539.3:c.448G>A, NM_000539.3:c.620T>G, NM_000539.3:c.670G>A, NM_000539.3:c.745G>T, NM_000539.3:c.659T>GRetinitis pigmentosa type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RHO gene located on chromosomal region 3q22.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.250,600
RLBP1Retinitis punctata albescensNM_000326.4NM_000326.4:c.333T>G, NM_000326.4:c.452G>A, NM_000326.4:c.700C>T, NM_000326.4:c.875C>TRetinitis punctata albescens follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RLBP1 gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by night blindness from early childhood, delay in the regeneration of cone and rod photopigments in young adults, followed by macular degeneration and a decrease in visual acuity that led to legal blindness in early adulthood.250,600
RPE65Leber congenital amaurosis type 2NM_000329.2NM_000329.2:c.1067delA, NM_000329.2:c.1301C>T, NM_000329.2:c.1292A>G, NM_000329.2:c.272G>A, NM_000329.2:c.907A>T, NM_000329.2:c.514_515delGTLeber congenital amaurosis 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus.250,600
RPE65Retinitis pigmentosa type 20NM_000329.2NM_000329.2:c.1022T>C, NM_000329.2:c.1087C>A, NM_000329.2:c.1102T>C, NM_000329.2:c.271C>T, NM_000329.2:c.1355T>G, NM_000329.2:c.1543C>T, NM_000329.2:c.394G>A, NM_000329.2:c.881A>CRetinitis pigmentosa type 20 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.250,600
RPGRIP1LJoubert syndrome type 7NM_015272.2NM_015272.2:c.1177G>A, NM_015272.2:c.1326_1329delAAAA, NM_015272.2:c.1329_1330insA, NM_015272.2:c.1843A>C, NM_015272.2:c.1975T>C, NM_015272.2:c.2030C>T, NM_015272.2:c.2050C>T, NM_015272.2:c.2413C>T, NM_015272.2:c.757C>T, NM_015272.2:c.3548C>G, NM_015272.2:c.697A>T, NM_015272.2:c.3634_3637delGAAA, NM_015272.2:c.776+1G>A, NM_015272.2:c.2794_2795delTTJoubert syndrome type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. This disease is characterized by cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy and renal disease.250,600
RPGRIP1LMeckel syndrome type 5NM_015272.2NM_015272.2:c.394A>T, NM_015272.2:c.3706C>T, NM_015272.2:c.2614C>TMeckel syndrome, type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. This disease is characterized by a combination of renal cysts and variably associated features, including developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and cysts, and polydactyly. The prevalence is <1:1,000,000.250,600
RYR1Central core diseaseNM_000540.2NM_000540.2:c.1021G>A, NM_000540.2:c.10343C>T, NM_000540.2:c.10579C>T, NM_000540.2:c.10616G>A, NM_000540.2:c.11798A>G, NM_000540.2:c.1205T>C, NM_000540.2:c.13480G>T, NM_000540.2:c.13513G>C, NM_000540.2:c.14365-2A>T, NM_000540.2:c.14511+1_14511+2delGT, NM_000540.2:c.14545G>A, NM_000540.2:c.1739_1742dupATCA, NM_000540.2:c.1841G>T, NM_000540.2:c.325C>T, NM_000540.2:c.4076delG, NM_000540.2:c.4178A>G, NM_000540.2:c.4405C>T, NM_000540.2:c.487C>T, NM_000540.2:c.5036G>A, NM_000540.2:c.5333C>A, NM_000540.2:c.5726_5727delAG, NM_000540.2:c.6082C>T, NM_000540.2:c.6104A>T, NM_000540.2:c.631+2T>C, NM_000540.2:c.6961A>G, NM_000540.2:c.7025A>G, NM_000540.2:c.7268T>A, NM_000540.2:c.7300G>A, NM_000540.2:c.7360C>T, NM_000540.2:c.7373G>A, NM_000540.2:c.738T>G, NM_000540.2:c.7463_7475delCAAAGATGTCAGC, NM_000540.2:c.9000+1G>T, NM_000540.2:c.14126C>T, NM_000540.2:c.1655G>A, NM_000540.2:c.4729G>A, NM_000540.2:c.7781C>A, NM_000540.2:c.7836-1G>A, NM_000540.2:c.8360C>G, NM_000540.2:c.9868G>A, NM_000540.2:c.9905_9906insC, NM_000540.2:c.1186G>T, NM_000540.2:c.6721C>TCentral core disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RYR1 gene located on chromosomal region 19q13.2. Typical central core disease is a relatively mild congenital myopathy, usually characterized by motor developmental delay and signs of mild proximal weakness most pronounced in the hip girdle musculature. Orthopedic complications, particularly congenital dislocation of the hips and scoliosis, are common, and patients are at risk of having malignant hyperthermia. Onset is usually in childhood, although adult onset has also been reported.250,600
SACSSpastic ataxia, Charlevoix-Saguenay typeNM_014363.5NM_014363.5:c.10907G>A, NM_014363.5:c.10954C>A, NM_014363.5:c.11624G>A, NM_014363.5:c.12160C>T, NM_014363.5:c.517C>T, NM_014363.5:c.6355C>T, NM_014363.5:c.6781C>A, NM_014363.5:c.7504C>T, NM_014363.5:c.8107C>T, NM_014363.5:c.8844delT, NM_014363.5:c.994A>T, NM_014363.5:c.13237C>T, NM_014363.5:c.3198T>A, NM_014363.5:c.4933C>T, NM_014363.5:c.5618_5619delAT, NM_014363.5:c.6563T>ASpastic ataxia, Charlevoix-Saguenay type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SACS gene located on chromosomal region 13q11. The age of onset is early. This disease is characterized by early-onset cerebellar ataxia with spasticity, a pyramidal syndrome and peripheral neuropathy. The prevalence is 1:1,500-1:2,000.250,600
SAGOguchi diseaseNM_000541.4NM_000541.4:c.293_294insG, NM_000541.4:c.523C>T, NM_000541.4:c.577C>T, NM_000541.4:c.874C>T, NM_000541.4:c.916G>T, NM_000541.4:c.926delA, NM_000541.4:c.993C>GOguchi disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SAG gene located on chromosomal region 2q37. The age of onset is infantile. This disease is characterized by congenital stationary night blindness and the Mizuo-Nakamura phenomenon which is a unique morphological and functional abnormality of the retina that presents with a typical golden-yellow or silver-gray discoloration of the fundus in the presence of light that disappears after dark-adaptation and appears again after the onset of light.250,600
SBDSShwachman-Diamond syndromeNM_016038.2NM_016038.2:c.120delG, NM_016038.2:c.127G>T, NM_016038.2:c.183_184delTAinsCT, NM_016038.2:c.184A>T, NM_016038.2:c.377G>C, NM_016038.2:c.505C>T, NM_016038.2:c.652C>T, NM_016038.2:c.258+2T>CShwachman-Diamond syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBDS gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by chronic and usually mild neutropenia, pancreatic exocrine insufficiency associated with steatorrhea and growth failure, skeletal dysplasia with short stature, and an increased risk of bone marrow aplasia or leukemic transformation, cutaneous (eczema or ichthyosis) and dental anomalies, and psychomotor retardation. The prevalence is 1:76,000 newborn.250,600
SCNN1BPseudohypoaldosteronism, type 1NM_000336.2NM_000336.2:c.109G>APseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.250,600
SCNN1GPseudohypoaldosteronism, type 1NM_001039.3NM_001039.3:c.1373+2T>C, NM_001039.3:c.1570-1G>A, NM_001039.3:c.1627delG, NM_001039.3:c.598_599insAPseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.250,600
SERPINA1Alpha1-antitrypsin deficiencyNM_000295.4NM_000295.4:c.1177C>T, NM_000295.4:c.187C>T, NM_000295.4:c.194T>C, NM_000295.4:c.230C>T, NM_000295.4:c.250G>A, NM_000295.4:c.272G>A, NM_000295.4:c.347T>A, NM_000295.4:c.415G>A, NM_000295.4:c.514G>A, NM_000295.4:c.514G>T, NM_000295.4:c.739C>T, NM_000295.4:c.839A>T, NM_000295.4:c.1093G>A, NM_000295.4:c.848A>TAlpha-1-antitrypsin deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SERPINA1 gene located on chromosomal region 14q32.13. The age of onset is variable. This disease is characterized by emphysema, which becomes evident by the third to fourth decade. A less common manifestation of the deficiency is liver disease, which occurs in children and adults, and may result in cirrhosis and liver failure. Environmental factors, particularly cigarette smoking, greatly increase the risk of emphysema at an earlier age. The prevalence is 1:1,500-1:3,500 in European.250,600
SETXSpinocerebellar ataxia with axonal neuropathy type 2NM_015046.5NM_015046.5:c.1027G>T, NM_015046.5:c.1166T>C, NM_015046.5:c.1807A>G, NM_015046.5:c.2602C>T, NM_015046.5:c.3880C>T, NM_015046.5:c.4087C>T, NM_015046.5:c.5630delG, NM_015046.5:c.5927T>G, NM_015046.5:c.6848_6851delCAGA, NM_015046.5:c.994C>T, NM_015046.5:c.5308_5311delGAGA, NM_015046.5:c.5549-1G>T, NM_015046.5:c.6834_6839delAACAAASpinocerebellar ataxia with axonal neuropathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SETX gene located on chromosomal region 9q34.13. The age of onset is infantile. This disease is characterized by progressive cerebellar ataxia, axonal sensorimotor neuropathy with oculomotor apraxia, fixation instability, extrapyramidal features and an elevated serum alpha-fetoprotein level. The prevalence is 4:100,000-8:100,000.250,600
SGCALimb-girdle muscular dystrophy type 2DNM_000023.2NM_000023.2:c.101G>A, NM_000023.2:c.229C>T, NM_000023.2:c.371T>C, NM_000023.2:c.518T>C, NM_000023.2:c.574C>T, NM_000023.2:c.850C>T, NM_000023.2:c.662G>A, NM_000023.2:c.739G>A, NM_000023.2:c.904_905insCCAutosomal recessive limb-girdle muscular dystrophy type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCA gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness and calf pseudohypertrophy. The prevalence is 1:1,000,000-9:1,000,000.250,600
SGCGLimb-girdle muscular dystrophy type 2CNM_000231.2NM_000231.2:c.195+4_195+7delAGTA, NM_000231.2:c.505+1G>A, NM_000231.2:c.787G>A, NM_000231.2:c.848G>A, NM_000231.2:c.88delG, NM_000231.2:c.521delTAutosomal recessive limb-girdle muscular dystrophy type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCG gene located on chromosomal region 13q12.12. The age of onset is variable. This disease is characterized by limb-girdle weakness, calf hypertrophy, diaphragmatic weakness, and variable cardiac abnormalities.250,600
SGSHMucopolysaccharidosis type 3A (Sanfilippo disease type A)NM_000199.3NM_000199.3:c.1167C>A, NM_000199.3:c.1298G>A, NM_000199.3:c.130G>A, NM_000199.3:c.1339G>A, NM_000199.3:c.1380delT, NM_000199.3:c.197C>G, NM_000199.3:c.220C>T, NM_000199.3:c.235A>C, NM_000199.3:c.320delT, NM_000199.3:c.337_345delinsGCACAGGTGAG, NM_000199.3:c.364G>A, NM_000199.3:c.383C>T, NM_000199.3:c.416C>T, NM_000199.3:c.449G>A, NM_000199.3:c.466A>T, NM_000199.3:c.617G>C, NM_000199.3:c.752G>C, NM_000199.3:c.757delG, NM_000199.3:c.877C>T, NM_000199.3:c.892T>CMucopolysaccharidosis type 3A (Sanfilippo syndrome type A) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGSH gene located on chromosomal region 17q25.3. The age of onset is infantile. This disease is characterized by behavioural disorders (hyperkinesia, aggressiveness) and intellectual deterioration, sleep disorders and very mild dysmorphism. The prevalence is >1:70,000 newborn.250,600
SH3TC2Charcot-Marie-Tooth disease type 4CNM_024577.3NM_024577.3:c.1586G>A, NM_024577.3:c.1747_1748delAG, NM_024577.3:c.1969G>A, NM_024577.3:c.1972C>T, NM_024577.3:c.1982T>C, NM_024577.3:c.217_227delGCTGCTCGGAGinsCCAGTAA, NM_024577.3:c.2191delG, NM_024577.3:c.2491_2492delAG, NM_024577.3:c.2710C>T, NM_024577.3:c.2829T>G, NM_024577.3:c.2860C>T, NM_024577.3:c.28delG, NM_024577.3:c.2993_2994insC, NM_024577.3:c.3325C>T, NM_024577.3:c.3326G>C, NM_024577.3:c.3341delC, NM_024577.3:c.3601C>T, NM_024577.3:c.3686A>T, NM_024577.3:c.505T>C, NM_024577.3:c.52+1delG, NM_024577.3:c.530-2A>G, NM_024577.3:c.735G>A, NM_024577.3:c.920G>A, NM_024577.3:c.3676-1G>A, NM_024577.3:c.1724T>A, NM_024577.3:c.53-1G>CCharcot-Marie-Tooth disease, type 4C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SH3TC2 gene located on chromosomal region 5q32. The age of onset is infantile. This disease is characterized by scoliosis or kyphoscoliosis, neuropathy, foot deformities, respiratory insufficiency, hypoacousis and deafness.250,600
SLC12A1Bartter syndrome type 1NM_000338.2NM_000338.2:c.1875G>A, NM_000338.2:c.1942G>A, NM_000338.2:c.2805_2806insA, NM_000338.2:c.347G>A, NM_000338.2:c.611T>C, NM_000338.2:c.628+2T>C, NM_000338.2:c.814G>T, NM_000338.2:c.223C>T, NM_000338.2:c.2952_2955delCAAABartter syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A1 gene located on chromosomal region 15q15-21. The age of onset is infantile. This disease is characterized by polyhydramnios, premature delivery, polyuria, dehydration, hypercalciuria and nephrocalcinosis. The prevalence is 1:1,000,000.250,600
SLC17A5Sialic acid storage diseaseNM_012434.4NM_012434.4:c.115C>T, NM_012434.4:c.406A>G, NM_012434.4:c.43G>T, NM_012434.4:c.918T>G, NM_012434.4:c.1259+1G>A, NM_012434.4:c.500T>CSialic acid storage diseases, follow an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC17A5 gene located on chromosomal region 6q13. The age of onset is from infantile to adult forms. The main symptoms are hypotonia, cerebellar ataxia, and mental retardation; visceromegaly and coarse features are also present in the infantile cases.250,600
SLC24A1Night blindness, congenital stationary type 1DNM_004727.2NM_004727.2:c.1963C>TNight blindness, congenital stationary type 1D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC24A1 gene located on chromosomal region 15q22.31. The age of onset is early. This disease is characterized by hemeralopia with a moderate loss of visual acuity.250,600
SLC26A2Achondrogenesis type 1BNM_000112.3NM_000112.3:c.1020_1022delTGT, NM_000112.3:c.1273A>G, NM_000112.3:c.532C>T, NM_000112.3:c.2033G>TAchondrogenesis type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by severe micromelia with very short fingers and toes, a flat face, a short neck, thickened soft tissue around the neck, hypoplasia of the thorax, protuberant abdomen, a hydropic fetal appearance and distinctive histological features of the cartilage. The prevalence is 1:20,000.250,600
SLC26A2Atelosteogenesis type 2NM_000112.3NM_000112.3:c.1535C>A, NM_000112.3:c.835C>TAtelosteogenesis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by limb shortening, normal sized skull with cleft palate, hitchhiker thumbs, distinctive facial dysmorphism and radiographic skeletal features. The prevalence is 1:20,000.250,600
SLC26A2Diastrophic dysplasiaNM_000112.3NM_000112.3:c.1724delA, NM_000112.3:c.1878delG, NM_000112.3:c.1361A>C, NM_000112.3:c.767T>C, NM_000112.3:c.833delC, NM_000112.3:c.496G>A, NM_000112.3:c.1957T>ADiastrophic dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by short stature with short extremities (final adult height is 120cm), and joint malformations leading to multiple joint contractures (principally involving the shoulders, elbows, interphalangeal joints and hips). The prevalence is 1:20,000.250,600
SLC26A4Deafness type 4, autosomal recessiveNM_000441.1NM_000441.1:c.1001G>T, NM_000441.1:c.1034T>A, NM_000441.1:c.2162C>T, NM_000441.1:c.1975G>C, NM_000441.1:c.1174A>T, NM_000441.1:c.2131G>A, NM_000441.1:c.1454C>T, NM_000441.1:c.1468A>C, NM_000441.1:c.2211G>C, NM_000441.1:c.269C>T, NM_000441.1:c.916dupG, NM_000441.1:c.281C>T, NM_000441.1:c.1634T>G, NM_000441.1:c.1707+5G>A, NM_000441.1:c.1489G>A, NM_000441.1:c.961A>T, NM_000441.1:c.2048T>C, NM_000441.1:c.898A>C, NM_000441.1:c.918+2T>C, NM_000441.1:c.1001+1G>T, NM_000441.1:c.970A>T, NM_000441.1:c.563T>CAutosomal recessive nonsyndromic sensorineural deafness type DFNB4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.250,600
SLC26A4Pendred syndromeNM_000441.1NM_000441.1:c.1246A>C, NM_000441.1:c.1826T>G, NM_000441.1:c.1229C>T, NM_000441.1:c.1263+1G>A, NM_000441.1:c.1061T>C, NM_000441.1:c.1790T>C, NM_000441.1:c.2168A>G, NM_000441.1:c.1151A>G, NM_000441.1:c.1226G>A, NM_000441.1:c.1003T>C, NM_000441.1:c.919-2A>G, NM_000441.1:c.554G>C, NM_000441.1:c.626G>T, NM_000441.1:c.1334T>G, NM_000441.1:c.1198delT, NM_000441.1:c.412G>T, NM_000441.1:c.707T>CPendred syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. The main presenting clinical sign is prelingual sensorineural deafness, although occasionally the hearing loss develops later in childhood. The degree of hearing loss is variable: it can be mild-to-moderate and progressive in some patients, and severe-to-profound in others. Fluctuations in hearing are also common and may be associated with or preceded by vertigo. The onset and presentation of euthyroid goiter (75%) is highly variable within and between families, with thyroid enlargement usually developing in late childhood or early adulthood. The thyromegaly reflects a defect in iodide transport from the thyrocyte to the colloid, although organification itself is not impaired. Hypothyroidism may develop if nutritional iodide intake is low.250,600
SLC37A4Glycogen storage disease types 1b, 1c and 1dNM_001164278.1NM_001164278.1:c.1042_1043delCT, NM_001164278.1:c.1081G>T, NM_001164278.1:c.1082G>A, NM_001164278.1:c.1108_1109delCT, NM_001164278.1:c.1129G>T, NM_001164278.1:c.1190-2_1190-1delAG, NM_001164278.1:c.1309C>T, NM_001164278.1:c.287G>A, NM_001164278.1:c.352T>C, NM_001164278.1:c.593A>T, NM_001164278.1:c.706_708delGTG, NM_001164278.1:c.83G>A, NM_001164278.1:c.899G>AGlycogen storage disease due to glucose-6-phosphatase deficiency types 1b, 1c and 1d follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC37A4 gene located on chromosomal region 11q23. The age of onset is early. This disease is characterized by impairment of terminal steps of glycogenolysis and gluconeogenesis. Patients manifest a wide range of clinical symptoms and biochemical abnormalities, including hypoglycemia, severe hepatomegaly due to excessive accumulation of glycogen, kidney enlargement, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. Glycogen storage disease type 1B patients also present a tendency towards infections associated with neutropenia, relapsing aphthous gingivostomatitis, and inflammatory bowel disease. The incidence is 1:100,000.250,600
SLC4A11Congenital hereditary endothelial dystrophy type 2NM_032034.3NM_032034.3:c.1038_1039insA, NM_032034.3:c.1391G>A, NM_032034.3:c.2318C>T, NM_032034.3:c.1466C>T, NM_032034.3:c.1813C>T, NM_032034.3:c.2264G>A, NM_032034.3:c.2605C>T, NM_032034.3:c.2399C>T, NM_032034.3:c.554_561delGCTTCGCC, NM_032034.3:c.2606G>ACongenital hereditary endothelial dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by a diffuse ground-glass appearance of the corneas and marked corneal thickening from birth with nystagmus, and blurred vision.250,600
SLC4A11Corneal dystrophy and perceptive deafnessNM_032034.3NM_032034.3:c.2528T>C, NM_032034.3:c.1463G>A, NM_032034.3:c.473_480delGCTTCGCC, NM_032034.3:c.2566A>G, NM_032034.3:c.637T>C, NM_032034.3:c.625C>T, NM_032034.3:c.2224G>A, NM_032034.3:c.2240_2240+1insTATGACACCorneal dystrophy - perceptive deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by the association of congenital hereditary endothelial dystrophy with progressive, postlingual sensorineural hearing loss.250,600
SLX4Fanconi anemia, complementation group PNM_032444.2NM_032444.2:c.1093delC, NM_032444.2:c.286delA, NM_032444.2:c.4921_4922insG, NM_032444.2:c.5097_5098delTC, NM_032444.2:c.5408_5409insAC, NM_032444.2:c.4739+1G>T, NM_032444.2:c.2808_2809delAGFanconi anemia complementation group P follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLX4 gene located on chromosomal region 16p13.3. The age of onset is early. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:160,000.250,600
SMN1Spinal muscular atrophy-del ex7, del ex7-8, del ex8 (Detection by MLPA)Spinal muscular atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMN1 gene located on chromosomal region 5q13.2. The age of onset is variable. This disease comprise a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. Autosomal recessive forms are classified according to the age of onset, the maximum muscular activity achieved, and survivorship. The severity of the disease is mainly determined by the copy number of SMN2, a copy gene which predominantly produces exon 7-skipped transcripts and only low amount of full-length transcripts that encode for a protein identical to SMN1. Only about 4% of patients bear one SMN1 copy with an intragenic mutation. Type 1 is a severe form, with onset before 6 months of age. Patients never achieve the ability to sit. Type 2 has intermediate severity, with onset between 6 and 18 months. Patients do not reach the motor milestone of standing, and survive into adulthood. Type 3 onset is after 18 months. Patients develop ability to stand and walk and survive into adulthood. Type 4 onset is in adulthood, disease progression is slow, and patients can stand and walk. The incidence is 1:10,000 and the prevalence is 1:80,000.250,600
SMPD1Niemann-Pick diseaseNM_000543.4NM_000543.4:c.103_118delCTGGTGCTGGCGCTGG, NM_000543.4:c.103_119delCTGGTGCTGGCGCTGGC, NM_000543.4:c.103_107delCTGGT, NM_000543.4:c.103_113delCTGGTGCTGGCGinsCTGGTG, NM_000543.4:c.1092-1G>C, NM_000543.4:c.1117C>T, NM_000543.4:c.106delG, NM_000543.4:c.108_124delGCTGGCGCTGGCGCTGGC, NM_000543.4:c.1267C>T, NM_000543.4:c.1299T>G, NM_000543.4:c.1327C>T, NM_000543.4:c.1420_1421delCT, NM_000543.4:c.1426C>T, NM_000543.4:c.1624C>T, NM_000543.4:c.1630delA, NM_000543.4:c.1805G>A, NM_000543.4:c.354delC, NM_000543.4:c.475T>C, NM_000543.4:c.551C>T, NM_000543.4:c.557C>T, NM_000543.4:c.558_559insC, NM_000543.4:c.558_574delGCCCCCCAAACCCCCTA, NM_000543.4:c.564delC, NM_000543.4:c.573delT, NM_000543.4:c.689G>A, NM_000543.4:c.730G>A, NM_000543.4:c.739G>A, NM_000543.4:c.740delG, NM_000543.4:c.742G>A, NM_000543.4:c.757G>C, NM_000543.4:c.785_807delTGTTGAGTGGGCTGGGCCCAGCC, NM_000543.4:c.788T>A, NM_000543.4:c.842_849dupTCCCCGCA, NM_000543.4:c.911T>C, NM_000543.4:c.940G>A, NM_000543.4:c.96G>A, NM_000543.4:c.996delC, NM_000543.4:c.688C>T, NM_000543.4:c.995C>G, NM_000543.4:c.1829_1831delGCC, NM_000543.4:c.1264-1G>T, NM_000543.4:c.1152G>ANiemann-Pick disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMPD1 gene located on chromosomal region 11p15.4. The clinical phenotype ranges from a severe infantile form with neurologic degeneration resulting in death usually by 3 years of age (type A) to a later-onset nonneurologic form (type B) that is compatible with survival into adulthood.250,600
SPG11Spastic paraplegia type 11NM_025137.3NM_025137.3:c.118C>T, NM_025137.3:c.529_533delATATT, NM_025137.3:c.5623C>T, NM_025137.3:c.1339_1342dupGGCT, NM_025137.3:c.342delT, NM_025137.3:c.7152-1G>C, NM_025137.3:c.733_734delAT, NM_025137.3:c.6805_6806delCT, NM_025137.3:c.1736-1G>C, NM_025137.3:c.6100C>T, NM_025137.3:c.6848_6849insTCSpastic paraplegia type 11 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG11 gene located on chromosomal region 13q13.3. The age of onset is infantile. This disease is characterized by progressive spasticity and weakness of the lower limbs frequently associated with the following: mild intellectual disability with learning difficulties in childhood and/or progressive cognitive decline; peripheral neuropathy; pseudobulbar involvement; and increased reflexes in the upper limbs. The prevalence is 5:100.000.250,600
SPG7Spastic paraplegia type 7NM_003119.3NM_003119.3:c.1457G>A, NM_003119.3:c.1529C>T, NM_003119.3:c.2075G>C, NM_003119.3:c.233T>A, NM_003119.3:c.1676delA, NM_003119.3:c.1749G>C, NM_003119.3:c.773_774delTG, NM_003119.3:c.1045G>A, NM_003119.3:c.1124delG, NM_003119.3:c.679C>T, NM_003119.3:c.758+2T>C, NM_003119.3:c.286+1G>TSpastic paraplegia type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG7 gene located on chromosomal region 16q24.3. The age of onset is adult. This disease is characterized by insidiously progressive bilateral lower limb weakness and spasticity. The prevalence is 1:100,000-9:100,000.250,600
STRCDeafness type 16, autosomal recessiveNM_153700.2NM_153700.2:c.4561_4562insC, NM_153700.2:c.5188C>T, NM_153700.2:c.3556C>T, NM_153700.2:c.5168_5171delTTCT, NM_153700.2:c.5185C>T, NM_153700.2:c.4545+1G>CAutosomal recessive nonsyndromic sensorineural deafness type DFNB16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRC gene located on chromosomal region 15q15.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.250,600
TCAPCardiomyopathy, hypertrophic, type 25NM_003673.3NM_003673.3:c.260G>A, NM_003673.3:c.316C>TCardiomyopathy, hypertrophic, type 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by dyspnea, syncope, collapse, palpitations, and chest pain. They can be readily provoked by exercise. The disorder has inter- and intrafamilial variability ranging from benign to malignant forms with high risk of cardiac failure and sudden cardiac death.250,600
TCAPLimb-girdle muscular dystrophy type 2GNM_003673.3NM_003673.3:c.157C>TAutosomal recessive limb-girdle muscular dystrophy type 2G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by muscle weakness in the four limbs, mild scapular winging, severe atrophy of the quadriceps and anterior tibialis muscles, calf hypertrophy, and lack of respiratory and cardiac involvement.250,600
TCIRG1Osteopetrosis type 1, autosomal recessiveNM_006019.3NM_006019.3:c.1331G>T, NM_006019.3:c.1674-1G>A, NM_006019.3:c.179A>G, NM_006019.3:c.2236+1G>A, NM_006019.3:c.2415-3C>G, NM_006019.3:c.112_113delAG, NM_006019.3:c.1213G>AAutosomal recessive osteopetrosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCIRG1 gene located on chromosomal region 11q13.2. The age of onset is early. This disease is characterized by bone marrow failure, fractures and visual impairment. The incidence is 1:200.000 live births and the prevalence is 1:250,000.250,600
TERTDyskeratosis congenita, autosomal recessiveNM_198253.2NM_198253.2:c.1234C>T, NM_198253.2:c.835G>A, NM_198253.2:c.2701C>T, NM_198253.2:c.2431C>TDyskeratosis congenita, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TERT gene located on chromosomal region 5p15.33. The age of onset is early. This disease has a wide phenotypic spectrum and age onset. It usually manifests during childhood with the triad of dysplastic nails, lacy reticular pigmentation and atrophy of the skin at the level of the neck and upper chest, and oral leukoplakia. Patients show an increased risk for progressive bone marrow failure and may develop myelodysplastic syndrome or acute myelogenous leukemia at any age (the risk increasing with age). There is also an increased risk for solid tumors, typically squamous cell carcinoma of head and neck (see this term) or anogenital cancer. Various additional clinical findings have been reported and may include: developmental delay, short stature, microcephaly, blepharitis, epiphora, periodontal disease, taurodontism, decreased teeth/root ratio, esophageal stenosis, liver disease, urethral stenosis, osteoporosis, avascular necrosis of femur and/or humerus, premature hair greying/alopecia, or abnormal eyelashes. Individuals with DC are at high risk of pulmonary fibrosis. The prevalence is 1:1.000.000.250,600
TFR2Hemochromatosis, type 3NM_003227.3NM_003227.3:c.1330G>A, NM_003227.3:c.1403G>A, NM_003227.3:c.1469T>G, NM_003227.3:c.1235_1237delACA, NM_003227.3:c.1861_1872delGCCGTGGCCCAG, NM_003227.3:c.2343G>A, NM_003227.3:c.313C>T, NM_003227.3:c.1665delC, NM_003227.3:c.750C>G, NM_003227.3:c.840C>G, NM_003227.3:c.949C>T, NM_003227.3:c.515T>A, NM_003227.3:c.1632_1633delGA, NM_003227.3:c.2014C>T, NM_003227.3:c.2374G>A, NM_003227.3:c.1473+1G>A, NM_003227.3:c.1186C>THemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000.250,600
TK2Mitochondrial DNA depletion syndrome type 2NM_004614.4NM_004614.4:c.323C>T, NM_004614.4:c.361C>A, NM_004614.4:c.373C>T, NM_004614.4:c.500G>A, NM_004614.4:c.604_606delAAG, NM_004614.4:c.635T>A, NM_004614.4:c.623A>G, NM_004614.4:c.159C>G, NM_004614.4:c.268C>TMitochondrial DNA depletion syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TK2 gene located on chromosomal region 16q21. The age of onset is infantile. This disease is characterized by generalized hypotonia, proximal muscle weakness, loss of previously acquired motor skills, poor feeding, and respiratory difficulties leading to respiratory failure and death within a few years after diagnosis. The prevalence is 1.2:100,000.250,600
TMEM67COACH syndromeNM_153704.5NM_153704.5:c.1769T>C, NM_153704.5:c.2498T>CCOACH syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is variable. This disease is characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable.250,600
TMEM67Joubert syndrome type 6NM_153704.5NM_153704.5:c.130C>T, NM_153704.5:c.148_149insTAAT, NM_153704.5:c.1538A>GJoubert syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is infantile. This disease is characterized by an irregular breathing pattern (episodic tachypnea and/or apnea), and nystagmus. During infancy, hypotonia may appear. Cerebellar ataxia (staggering gait and imbalance) may develop later. Delayed acquisition of motor milestones is common. Cognitive abilities are variable, ranging from severe intellectual deficit to normal intelligence. Neuro-ophthalmologic examination may show oculomotor apraxia. In some cases, seizures occur. Careful examination of the face shows a characteristic appearance: large head, prominent forehead, high rounded eyebrows, epicanthal folds, ptosis (occasionally), an upturned nose with prominent nostrils, an open mouth (which tends to have an oval shape early on, a 'rhomboid' appearance later, and finally can appear triangular with downturned angles), tongue protrusion and rhythmic tongue motions, and occasionally low-set and tilted ears. Other features sometimes present in Joubert syndrome include retinal dystrophy, nephronophthisis, and polydactyly. The prevalence is 1:80,000-1:100,000.250,600
TMEM67Meckel syndrome type 3NM_153704.5NM_153704.5:c.1309C>G, NM_153704.5:c.755T>C, NM_153704.5:c.1046T>C, NM_153704.5:c.653G>C, NM_153704.5:c.406+1402_406+1403insTAAT, NM_153704.5:c.622A>TMeckel syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is variable. This disease is characterized multiple congenital anomaly disorder characterized by the triad of brain malformation mainly occipital encephalocele (see this term), large polycystic kidneys, and polydactyly as well as associated abnormalities that may include cleft lip/palate (see these terms), cardiac and genital anomalies, central nervous system (CNS) malformations, liver fibrosis, and bone dysplasia.250,600
TMPRSS3Deafness types 8/10, autosomal recessiveNM_024022.2NM_024022.2:c.1211C>T, NM_024022.2:c.1276G>A, NM_024022.2:c.1159G>A, NM_024022.2:c.413C>A, NM_024022.2:c.446+1G>T, NM_024022.2:c.647G>T, NM_024022.2:c.753G>C, NM_024022.2:c.646C>T, NM_024022.2:c.208delC, NM_024022.2:c.242C>GAutosomal recessive nonsyndromic sensorineural deafness type DFNB10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMPRSS3 gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness.250,600
TPP1Neuronal ceroid-lipofuscinoses type 2NM_000391.3NM_000391.3:c.1093T>C, NM_000391.3:c.616C>T, NM_000391.3:c.622C>T, NM_000391.3:c.1340G>A, NM_000391.3:c.141_144delGAGT, NM_000391.3:c.827A>T, NM_000391.3:c.509-1G>C, NM_000391.3:c.851G>TNeuronal ceroid lipofuscinosis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPP1 gene located on chromosomal region 11p15.4. Age of onset is infantile. This disease is characterized by epilepsy, followed by regression of developmental milestones, myoclonic ataxia, and pyramidal signs. Visual impairment typically appears at age four to six years and rapidly progresses to light/dark awareness only. Life expectancy ranges from age six years to early teenage. The prevalence is 1.5:1,000,000-9:1,000,000.250,600
TRIOBPDeafness type 28, autosomal recessiveNM_001039141.2NM_001039141.2:c.2362C>T, NM_001039141.2:c.3194delT, NM_001039141.2:c.1039C>T, NM_001039141.2:c.1741C>T, NM_001039141.2:c.4577C>G, NM_001039141.2:c.2639_2640insTCAC, NM_001039141.2:c.5316G>A, NM_001039141.2:c.3202C>T, NM_001039141.2:c.4429_4430insGDeafness autosomal recessive type 28 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIOBP gene located on chromosomal region 22q13.1. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.250,600
TSEN54Pontocerebellar hypoplasiaNM_207346.2NM_207346.2:c.670_671delAA, NM_207346.2:c.736C>T, NM_207346.2:c.1027C>T, NM_207346.2:c.1039A>T, NM_207346.2:c.887G>A, NM_207346.2:c.919G>TPontocerebellar hypoplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSEN54 gene located on chromosomal region 17q25.1. Pontocerebellar hypoplasia (PCH) refers to a group of severe neurodegenerative disorders affecting growth and function of the brainstem and cerebellum, resulting in little or no development. Different types were classified based on the clinical picture and the spectrum of pathologic changes. 250,600
TSFMCombined oxidative phosphorylation deficiency type 3NM_001172696.1NM_001172696.1:c.1_2delAT, NM_001172696.1:c.580delC, NM_001172696.1:c.919C>T, NM_001172696.1:c.21_22delGCCombined oxidative phosphorylation deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSFM gene located on chromosomal region 12q14.1. The age of onset is early. This disease is characterized by hypotonia, lactic acidosis, and hepatic insufficiency, with progressive encephalomyopathy or hypertrophic cardiomyopathy.250,600
TSHRHypothyroidismNM_000369.2NM_000369.2:c.100G>A, NM_000369.2:c.1170T>G, NM_000369.2:c.484C>G, NM_000369.2:c.500T>A, NM_000369.2:c.122G>C, NM_000369.2:c.326G>A, NM_000369.2:c.1741_1742insC, NM_000369.2:c.202C>THypothyroidism due to TSH receptor mutations follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSHR gene located on chromosomal region 14q31. The age of onset is early. This disease is characterized by decreased activity and increased sleep, feeding difficulty and constipation, prolonged jaundice, myxedematous facies, large fontanels (especially posterior), macroglossia, a distended abdomen with umbilical hernia, and hypotonia. Slow linear growth and developmental delay are usually apparent by 4-6 months of age. Without treatment CH results in severe intellectual deficit and short stature. The prevalence is 1:3,000-1:4,000 newborn.250,600
TTNCardiomyopathy, dilated/Tibial muscular dystrophyNM_133378.4NM_133378.4:c.13149C>A, NM_133378.4:c.22246G>A, NM_133378.4:c.31780G>A, NM_133378.4:c.40211dupT, NM_133378.4:c.44668delG, NM_133378.4:c.52977dupT, NM_133378.4:c.61640C>G, NM_133378.4:c.84669_84675delTGAATTC, NM_133378.4:c.94567C>T, NM_133378.4:c.96388C>T, NM_133378.4:c.96388delC, NM_133378.4:c.98366_98367delAT, NM_133378.4:c.12064C>T, NM_133378.4:c.28739-1G>A, NM_133378.4:c.3165-1G>T, NM_133378.4:c.4724_4728delTGAAA, NM_133378.4:c.48944-1G>A, NM_133378.4:c.91114_91117delTCCA, NM_133378.4:c.100185delA, NM_133378.4:c.40549delA, NM_133378.4:c.24568_24571delAGCACardiomyopathy, dilated/Tibial muscular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTN gene located on chromosomal region 2q31.2. The age of onset is variable. This disease is characterized by slowly progressive weakness and atrophy of the anterior tibial muscles with decreased dorsiflexion. Sometimes it could be companied by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death. The prevalence is >9:100,000.250,600
TTPAAtaxia with vitamin E deficiencyNM_000370.3NM_000370.3:c.661C>T, NM_000370.3:c.744delA, NM_000370.3:c.575G>AAtaxia with vitamin E deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTPA gene located on chromosomal region 8q13. The age of onset is variable. This disease is characterized by progressive spino-cerebellar ataxia, loss of proprioception, areflexia, and is associated with a marked deficiency in vitamin E. The prevalence is 0.56:1,000,000-3.5:1,000,000.250,600
TYROculocutaneous albinism type 1NM_000372.4NM_000372.4:c.1012_1013insC, NM_000372.4:c.1146C>A, NM_000372.4:c.1164delT, NM_000372.4:c.1177delG, NM_000372.4:c.1147G>A, NM_000372.4:c.115T>G, NM_000372.4:c.1255G>A, NM_000372.4:c.1265G>A, NM_000372.4:c.1209G>T, NM_000372.4:c.1217C>T, NM_000372.4:c.140G>A, NM_000372.4:c.1467dupT, NM_000372.4:c.1501dupC, NM_000372.4:c.164G>A, NM_000372.4:c.1A>G, NM_000372.4:c.230G>A, NM_000372.4:c.242C>T, NM_000372.4:c.265T>C, NM_000372.4:c.272G>A, NM_000372.4:c.286dupA, NM_000372.4:c.533G>A, NM_000372.4:c.1336G>A, NM_000372.4:c.1342G>A, NM_000372.4:c.646T>A, NM_000372.4:c.650G>A, NM_000372.4:c.823G>T, NM_000372.4:c.896G>A, NM_000372.4:c.1111A>G, NM_000372.4:c.1118C>A, NM_000372.4:c.325G>A, NM_000372.4:c.572delG, NM_000372.4:c.616G>AOculocutaneous albinism type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYR gene located on chromosomal region 11q14.2. The age of onset is early. This disease is characterized by white hair and skin, blue, fully translucent irises, nystagmus and misrouting of the optic nerves.250,600
TYRP1Oculocutaneous albinism type 3NM_000550.2NM_000550.2:c.107delT, NM_000550.2:c.1103delA, NM_000550.2:c.1057_1060delAACA, NM_000550.2:c.1067G>A, NM_000550.2:c.1557T>G, NM_000550.2:c.176C>G, NM_000550.2:c.497C>G, NM_000550.2:c.1120C>T, NM_000550.2:c.1369_1370insCAGAType 3 oculocutaneous albinism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYRP1 gene located on chromosomal region 9p23. The age of onset is early. This disease is characterized by rufous or brown albinism and occurring mainly in the African population. The prevalence is of 1/8,500 individuals in Africa.250,600
UGT1A1Crigler-Najjar syndrome type 1NM_000463.2NM_000463.2:c.1021C>T, NM_000463.2:c.1070A>GCrigler-Najjar syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by severe neonatal unconjugated hyperbilirubinemia, persistent jaundice and bilirubin encephalopathy manifesting as hypotonia, deafness, oculomotor palsy and lethargy. Neurologic defects can occur, generally associated with intellectual and motor impairment.250,600
UGT1A1Crigler-Najjar syndrome type 2NM_000463.2NM_000463.2:c.1207C>T, NM_000463.2:c.674T>G, NM_000463.2:c.1130G>T, NM_000463.2:c.524T>A, NM_000463.2:c.44T>GCrigler-Najjar syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by unconjugated hyperbilirubinemia due to reduced and inducible activity of hepatic bilirubin glucuronosyltransferase with pigmented bile that contains bilirubin glucuronides, and generally do not present neurologic or intellectual impairment. Bilirubin encephalopathy may develop in later life when patients experience a superimposed infection or stress.250,600
UGT1A1Gilbert syndromeNM_000463.2NM_000463.2:c.1211T>C, NM_000463.2:c.1456T>GGilbert syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by jaundice due to unconjugated hyperbilirubinemia, resulting a partial deficiency in hepatic bilirubin glucuronosyltransferase activity.250,600
USH1CUsher syndrome type 1CNM_153676.3NM_153676.3:c.216G>A, NM_153676.3:c.2362G>A, NM_153676.3:c.2622_2623delCA, NM_153676.3:c.2688_2695dupAATTCACC, NM_153676.3:c.238_239insC, NM_153676.3:c.238delC, NM_153676.3:c.2547-1G>T, NM_153676.3:c.2695_2696insAATTCACC, NM_153676.3:c.388G>AUsher syndrome type 1C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1C gene located on chromosomal region 11p15.1. The age of onset is infantile. This disease is characterized by the association of sensorineural deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 3:100,000-4:100,000.250,600
USH2ARetinitis pigmentosa type 39NM_206933.2NM_206933.2:c.10073G>A, NM_206933.2:c.2296T>C, NM_206933.2:c.14519T>C, NM_206933.2:c.7364G>A, NM_206933.2:c.12574C>T, NM_206933.2:c.2276G>TRetinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 39 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000.250,600
USH2AUsher syndrome type 2ANM_206933.2NM_206933.2:c.10636G>A, NM_206933.2:c.10561T>C, NM_206933.2:c.15371delT, NM_206933.2:c.2167+5G>A, NM_206933.2:c.11864G>A, NM_206933.2:c.14803C>T, NM_206933.2:c.2898delG, NM_206933.2:c.3491_3492delCT, NM_206933.2:c.11549-5_11549-4insT, NM_206933.2:c.2299delG, NM_206933.2:c.5975A>G, NM_206933.2:c.6670G>T, NM_206933.2:c.6862G>T, NM_206933.2:c.5743_5744delAG, NM_206933.2:c.779T>G, NM_206933.2:c.820C>T, NM_206933.2:c.8981G>A, NM_206933.2:c.956G>A, NM_206933.2:c.9799T>C, NM_206933.2:c.15089C>A, NM_206933.2:c.2135delC, NM_206933.2:c.4338_4339delCT, NM_206933.2:c.5573-2A>G, NM_206933.2:c.920_923dupGCCA, NM_206933.2:c.13709delG, NM_206933.2:c.14926G>A, NM_206933.2:c.15520-1G>A, NM_206933.2:c.8431C>A, NM_206933.2:c.12234_12235delGA, NM_206933.2:c.14442C>AUsher syndrome type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. The age of onset is infantile. This disease is characterized by the association of sensorineural deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 3:100,000-4:100,000.250,600
WFS1Wolfram syndromeNM_006005.3NM_006005.3:c.1234_1237delGTCT, NM_006005.3:c.1511C>T, NM_006005.3:c.2168T>C, NM_006005.3:c.2171C>T, NM_006005.3:c.1944G>A, NM_006005.3:c.2084G>T, NM_006005.3:c.577A>C, NM_006005.3:c.676C>T, NM_006005.3:c.2327A>T, NM_006005.3:c.407_408insGGGCCGTCGCGAGGCT, NM_006005.3:c.2576G>A, NM_006005.3:c.2643_2644delCT, NM_006005.3:c.616C>T, NM_006005.3:c.1060_1062delTTC, NM_006005.3:c.400G>A, NM_006005.3:c.1943G>A, NM_006005.3:c.1230_1233delCTCTWolfram syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WFS1 gene located on chromosomal region 4p16.1. The age of onset is infantile. This disease is characterized by diabetes mellitus type I, diabetes insipidus, optical atrophy and neurological signs. The prevalence is 1:1,000,000-9:1,000,000.250,600
WNT10AHypohidrotic ectodermal dysplasia, autosomal recessiveNM_025216.2NM_025216.2:c.347T>C, NM_025216.2:c.383G>A, NM_025216.2:c.321C>AHypohidrotic ectodermal displasia, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by sparse hair (atrichosis or hypotrichosis), abnormal or missing teeth and the inability to sweat due to the absence of sweat glands. The prevalence is <1:1,000,000.250,600
WNT10AOdontoonychodermal dysplasiaNM_025216.2NM_025216.2:c.697G>TOdonto-onycho-dermal dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by hyperkeratosis and hyperhidrosis of the palms and soles, atrophic malar patches, hypodontia, conical teeth, onychodysplasia, and dry and sparse hair. The prevalence is <1:1,000,000.250,600
ZFYVE26Spastic paraplegia type 15, autosomal recessiveNM_015346.3NM_015346.3:c.3206G>A, NM_015346.3:c.3642_3643insCCACACTTAG, NM_015346.3:c.1477C>T, NM_015346.3:c.2887G>C, NM_015346.3:c.5422C>T, NM_015346.3:c.5485-1G>A, NM_015346.3:c.4312C>T, NM_015346.3:c.4936C>T, NM_015346.3:c.3182delT, NM_015346.3:c.2114_2115insCSpastic paraplegia type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZFYVE26 gene located on chromosomal region 14q24.1. The age of onset is infancy. This disease is characterized by progressive spasticity primarily affecting the lower limbs. It is a complex form of spastic paraplegia, associated with other neurologic dysfunction, including variable mental retardation, hearing and visual defects, and thin corpus callosum. The prevalence is <1 / 1,000,000.250,600
GeneDiseaseTranscriptMutationsDisease.descriptionproducts
ABCA4Stargardt disease type 1; Cone-rod dystrophy type 3NM_000350.2NM_000350.2:c.6449G>A, NM_000350.2:c.6394G>T, NM_000350.2:c.6320G>A, NM_000350.2:c.6118C>T, NM_000350.2:c.6089G>A, NM_000350.2:c.5912T>G, NM_000350.2:c.5882G>A, NM_000350.2:c.5881G>A, NM_000350.2:c.5819T>C, NM_000350.2:c.5714+5G>A, NM_000350.2:c.5512delC, NM_000350.2:c.5461-10T>C, NM_000350.2:c.5338C>G, NM_000350.2:c.4793C>A, NM_000350.2:c.4469G>A, NM_000350.2:c.4457C>T, NM_000350.2:c.4429C>T, NM_000350.2:c.4139C>T, NM_000350.2:c.3970delG, NM_000350.2:c.3364G>A, NM_000350.2:c.3322C>T, NM_000350.2:c.3210_3211dupGT, NM_000350.2:c.3106G>A, NM_000350.2:c.3083C>T, NM_000350.2:c.2791G>A, NM_000350.2:c.2616_2617delCT, NM_000350.2:c.2588G>C, NM_000350.2:c.2300T>A, NM_000350.2:c.2160+1G>T, NM_000350.2:c.1964T>G, NM_000350.2:c.1938-1G>A, NM_000350.2:c.1848delA, NM_000350.2:c.1804C>T, NM_000350.2:c.1771delT, NM_000350.2:c.1755delA, NM_000350.2:c.1622T>C, NM_000350.2:c.1225delA, NM_000350.2:c.1222C>T, NM_000350.2:c.1018T>G, NM_000350.2:c.763C>T, NM_000350.2:c.634C>T, NM_000350.2:c.286A>G, NM_000350.2:c.67-2A>G, NM_000350.2:c.52C>TStargardt disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by progressive central vision loss, mild loss of color vision, delayed dark adaptation and macular atrophy with or without paramacular flecks and degeneration of the underlying retinal pigment ephitelium. The estimated prevalence is 1:8,000-10,000. Mutations in the ABCA4 gene account also for 30 to 60 percent of cases of cone-rod dystrophy that are inherited in an autosomal recessive pattern. The problems associated with this condition include a loss of visual sharpness (acuity), an increased sensitivity to light (photophobia), and impaired color vision. These vision problems worsen over time.600,25
ACAD9Mitochondrial complex I deficiency due to ACAD9NM_014049.4NM_014049.4:c.23delT, NM_014049.4:c.130T>A, NM_014049.4:c.359delT, NM_014049.4:c.453+1G>A, NM_014049.4:c.797G>A, NM_014049.4:c.976G>C, NM_014049.4:c.1240C>T, NM_014049.4:c.1249C>T, NM_014049.4:c.1594C>TMitochondrial complex I deficiency due to ACAD9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAD9 gene located on chromosomal region 3q21.3. The age of onset is neonatal/infantile. This disease is a multisystem disorder characterized by infantile onset of acute metabolic acidosis, hypertrophic cardiomyopathy, and muscle weakness associated with a deficiency of mitochondrial complex I activity in muscle, liver, and fibroblasts (summary by Haack et al., 2010).600,25
ACADMMedium-chain acyl-CoA dehydrogenase deficiencyNM_001286043.1NM_001286043.1:c.250C>T, NM_001286043.1:c.386-2A>G, NM_001286043.1:c.461C>T, NM_001286043.1:c.548_551delCTGA, NM_001286043.1:c.546G>A, NM_001286043.1:c.715C>T, NM_001286043.1:c.716G>A, NM_001286043.1:c.833C>T, NM_001286043.1:c.896A>G, NM_001286043.1:c.898G>A, NM_001286043.1:c.916_928delGCAATGGGAGCTT, NM_001286043.1:c.1083delG, NM_001286043.1:c.1084A>G, NM_001286043.1:c.1201_1204delTTAGMedium-chain acyl-CoA dehydrogenase (MCAD) deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADM gene located on chromosomal region 1p31. Inherited deficiency of MCAD is a condition that prevents the body from converting certain fats to energy, particularly during periods without food (fasting). Signs and symptoms of MCAD deficiency typically appear during infancy or early childhood and can include vomiting, lack of energy (lethargy), and low blood sugar (hypoglycemia). Individuals with MCAD deficiency are at risk of serious complications such as seizures, breathing difficulties, liver problems, brain damage, coma, and sudden death. The estimated prevalence is 1:4,900-1:27,000 in Caucasian populations and 1:14,600 in worldwide populations.600,25
ACADSShort-chain acyl-CoA dehydrogenase deficiencyNM_000017.3NM_000017.3:c.136C>T, NM_000017.3:c.319C>T, NM_000017.3:c.417G>C, NM_000017.3:c.529T>C, NM_000017.3:c.561_568delCAATGCCT, NM_000017.3:c.1095G>T, NM_000017.3:c.1147C>TShort-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADS gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by seizures, developmental delay, failure to grow with poor feeding, and usually muscle weakness and hypotonia. The prevalence is <1:50,000.600,25
ACADSBShort/branched-chain acyl-CoA dehydrogenase deficiencyNM_001609.3NM_001609.3:c.303+1G>A, NM_001609.3:c.443C>T, NM_001609.3:c.621G>A, NM_001609.3:c.763C>TShort/branched-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADSB gene located on chromosomal region 10q26.3. The age of onset is neonatal/infantile. This disease is characterized by muscle hypotonia, cerebral palsy, developmental delay, lethargy, hypoglycemia, and metabolic acidosis. The prevalence is <1:1,000,000.600,25
ACADVLVery long-chain acyl-CoA dehydrogenase deficiencyNM_001270447.1NM_001270447.1:c.347-1G>A, NM_001270447.1:c.367_368delCA, NM_001270447.1:c.412delG, NM_001270447.1:c.469C>T, NM_001270447.1:c.546+1G>C, NM_001270447.1:c.589G>A, NM_001270447.1:c.754C>T, NM_001270447.1:c.822-2A>C, NM_001270447.1:c.917T>C, NM_001270447.1:c.965_967delAGA, NM_001270447.1:c.1165C>T, NM_001270447.1:c.1166G>A, NM_001270447.1:c.1175T>C, NM_001270447.1:c.1210_1212delGAG, NM_001270447.1:c.1251+1G>A, NM_001270447.1:c.1426C>T, NM_001270447.1:c.1444dupC, NM_001270447.1:c.1458dupG, NM_001270447.1:c.1475G>A, NM_001270447.1:c.1537G>C, NM_001270447.1:c.1601+1G>A, NM_001270447.1:c.1906C>T, NM_001270447.1:c.1912C>T, NM_001270447.1:c.1951delCVery long-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADVL gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by cardiomyopathy, hypoketotic hypoglycemia, liver disease, exercise intolerance and rhabdomyolysis. The prevalence is 1:100,000-9:100,000.600,25
ACERenal tubular dysgenesisNM_000789.3NM_000789.3:c.798C>G, NM_000789.3:c.1319_1322delTGGA, NM_000789.3:c.1486C>T, NM_000789.3:c.1511delC, NM_000789.3:c.1587-2A>G, NM_000789.3:c.2371C>TRenal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and the most common cause are pathogenic variants in the ACE (chromosomal region 17q23.3). The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects.600,25
ADAAdenosine deaminase deficiency / Severe combined immunodeficiency due to ADA deficiencyNM_000022.3NM_000022.3:c.986C>T, NM_000022.3:c.956_960delAAGAG, NM_000022.3:c.890C>A, NM_000022.3:c.872C>T, NM_000022.3:c.632G>A, NM_000022.3:c.320T>CAdenosine deaminase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADA gene located on chromosomal region 20q13.12. The age of onset is neonatal/infantile. This disease is characterized by profound lymphopenia and very low immunoglobulin levels of all isotypes resulting in severe and recurrent opportunistic infections. The annual incidence is 1:200,000-1:1,000,000. The prevalence is 1:100,000-9:100,000.600,25
ADGRV1Usher syndrome, type 2CNM_032119.3NM_032119.3:c.2258_2270delAAGTGCTGAAATC, NM_032119.3:c.2864C>A, NM_032119.3:c.5357_5358delAA, NM_032119.3:c.6275-1G>A, NM_032119.3:c.6312dupT, NM_032119.3:c.6901C>T, NM_032119.3:c.8713_8716dupAACA, NM_032119.3:c.8790delC, NM_032119.3:c.11377G>T, NM_032119.3:c.14973-1G>C, NM_032119.3:c.15196_15199dupCAAA, NM_032119.3:c.17668_17669delAT, NM_032119.3:c.18131A>GUsher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADGRV1 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32 respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000.600,25
AGLGlycogen storage disease type 3NM_000028.2NM_000028.2:c.16C>T, NM_000028.2:c.18_19delGA, NM_000028.2:c.294-2A>T, NM_000028.2:c.1222C>T, NM_000028.2:c.1485delT, NM_000028.2:c.1783C>T, NM_000028.2:c.1999delC, NM_000028.2:c.2039G>A, NM_000028.2:c.2590C>T, NM_000028.2:c.3216_3217delGA, NM_000028.2:c.3980G>A, NM_000028.2:c.4260-12A>G, NM_000028.2:c.4260-1G>T, NM_000028.2:c.4342G>C, NM_000028.2:c.4456delT, NM_000028.2:c.4529dupAGlycogen storage disease (GSD) type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGL gene located on chromosomal region 1p21.2. The age of onset is infantile. This metabolic disorder is caused by deficiency of the glycogen debrancher enzyme and is associated with an accumulation of abnormal glycogen with short outer chains. Most patients are enzyme-deficient in both liver and muscle (IIIa), but about 15% are enzyme-deficient in liver only (IIIb) (Shen et al., 1996). These subtypes have been explained by differences in tissue expression of the deficient enzyme (Endo et al., 2006). In rare cases, selective loss of only 1 of the 2 debranching activities, glucosidase or transferase, results in type IIIc or IIId, respectively (Van Hoof and Hers, 1967; Ding et al., 1990). Clinically, patients with GSD type 3 present in infancy or early childhood with hepatomegaly, hypoglycemia, and growth retardation. Muscle weakness in those with IIIa is minimal in childhood but can become more severe in adults; some patients develop cardiomyopathy (Shen et al., 1996). 600,25
AGXTHyperoxaluria, primary, type 1NM_000030.2NM_000030.2:c.33dupC, NM_000030.2:c.121G>A, NM_000030.2:c.166-2A>G, NM_000030.2:c.245G>A, NM_000030.2:c.248A>G, NM_000030.2:c.322T>C, NM_000030.2:c.454T>A, NM_000030.2:c.466G>A, NM_000030.2:c.508G>A, NM_000030.2:c.560C>T, NM_000030.2:c.613T>C, NM_000030.2:c.697C>T, NM_000030.2:c.698G>A, NM_000030.2:c.731T>C, NM_000030.2:c.738G>APrimary hyperoxaluria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGXT gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by variable clinical presentation, ranging from occasional symptomatic nephrolithiasis to nephrocalcinosis and end-stage renal disease with systemic involvement. The prevalence is 1:1,000,000-9:1,000,000.600,25
AHI1Joubert syndrome type 3NM_001134830.1NM_001134830.1:c.3263_3264delGG, NM_001134830.1:c.2295dupA, NM_001134830.1:c.2168G>A, NM_001134830.1:c.1484G>A, NM_001134830.1:c.1303C>T, NM_001134830.1:c.1052G>T, NM_001134830.1:c.1051C>T, NM_001134830.1:c.985C>TJoubert syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AHI1 gene located on chromosomal region 6q23.3. The age of onset is variable. This disease is characterized by the neurological features of Joubert syndrome (neonatal hypotonia, developmental delay, mild to severe intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia and primary position nystagmus) associated with retinal dystrophy.600,25
AIPL1Leber congenital amaurosis type 4NM_014336.4NM_014336.4:c.1053_1064delTGCAGAGCCACC, NM_014336.4:c.834G>A, NM_014336.4:c.715T>C, NM_014336.4:c.589G>CLeber congenital amaurosis type 4 (LCA4) is a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus. Mutations in the AIPL1 gene may cause approximately 20% of recessive LCA. Other conditions caused by pathogenic variants in the AIPL1 gene are cone rod dystrophy and the less agressive form, juvenile retinitis pigmentosa. Cone-rod dystropy is characterized by decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness.600,25
ALDOBFructose intolerance, hereditaryNM_000035.3NM_000035.3:c.1067C>A, NM_000035.3:c.1013C>T, NM_000035.3:c.1005C>G, NM_000035.3:c.720C>A, NM_000035.3:c.612T>A, NM_000035.3:c.524C>A, NM_000035.3:c.448G>C, NM_000035.3:c.442T>C, NM_000035.3:c.360_363delCAAA, NM_000035.3:c.178C>T, NM_000035.3:c.113-1_115delGGTA, NM_000035.3:c.10C>T, NM_000035.3:c.2T>CHereditary fructose intolerance follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOB gene located on chromosomal region 9q21.3-q22.2. The age of onset is neonatal/infantile. This disease is characterized by severe abdominal pain, vomiting, and hypoglycemia following ingestion of fructose or other sugars metabolised through fructose-1-phosphate. The prevalence is 1:100,000-9:100,000.600,25
ALG6Congenital disorder of glycosylation, type 1cNM_013339.3NM_013339.3:c.316C>T, NM_013339.3:c.897_899delAAT, NM_013339.3:c.998C>T, NM_013339.3:c.1432T>CCongenital disorder of glycosylation type 1c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG6 gene located on chromosomal region 1p31.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay and muscular hypotonia, and possible coagulation anomalies, hormonal abnormalities and seizures. The prevalence is <1:1,000,000.600,25
ALMS1Alstr�m syndromeNM_015120.4NM_015120.4:c.2323C>T, NM_015120.4:c.4246delC, NM_015120.4:c.5584C>T, NM_015120.4:c.8383C>T, NM_015120.4:c.9614_9618delCAGAA, NM_015120.4:c.11443C>T, NM_015120.4:c.11453dupA, NM_015120.4:c.11612_11613delCT, NM_015120.4:c.12439C>T, NM_015120.4:c.12445C>TAlstr�m syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALMS1 gene located on chromosomal region 2p13.1. The age of onset is neonatal/infantile. This disease is characterized by cone-rod dystrophy, hearing loss, obesity, insulin resistance and hyperinsulinemia, type 2 diabetes mellitus, dilated cardiomyopathy and progressive hepatic and renal dysfunction. The prevalence is 1:10,000-1:1,000,000.600,25
ANO5Limb-girdle muscular dystrophy type 12 (LGMDR12; formerly LGMD2L)NM_213599.2NM_213599.2:c.172C>T, NM_213599.2:c.191dupA, NM_213599.2:c.206_207delAT, NM_213599.2:c.692G>T, NM_213599.2:c.1210C>T, NM_213599.2:c.1295C>G, NM_213599.2:c.1407+5G>A, NM_213599.2:c.1627dupA, NM_213599.2:c.1733T>C, NM_213599.2:c.1887delA, NM_213599.2:c.1898+1G>A, NM_213599.2:c.1914G>ALimb-girdle muscular dystrophy type 12 (LGMDR12, formerly LGMD2L) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ANO5 gene located on chromosomal region 11p14.3. This disease is characterized by weakness and wasting restricted to the limb musculature. Most often is characterized by an adult onset (but ranging from 11 to 51 years) of mainly proximal lower limb weakness, with difficulties standing on tiptoes being one of the initial signs. Proximal upper limb and distal lower limb weakness is also common, as well as atrophy of the quadriceps (most commonly), biceps brachii, and lower leg muscles. Calf hypertrophy has also been reported in some cases. LGMDR12 progresses slowly, with most patients remaining ambulatory until late adulthood. The estimated prevalence is <1:1,000,000.600,25
APTXAtaxia, early-onset, with oculomotor apraxia and hypoalbuminemiaNM_001195248.1NM_001195248.1:c.917-1G>A, NM_001195248.1:c.879G>A, NM_001195248.1:c.830T>G, NM_001195248.1:c.659C>T, NM_001195248.1:c.362delC, NM_001195248.1:c.209delT, NM_001195248.1:c.176-2A>G, NM_001195248.1:c.166C>TAtaxia, early-onset, with oculomotor apraxia and hipoalbuminemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the APTX gene located on chromosomal region 9p13.1. Ataxia-oculomotor apraxia syndrome is an early-onset autosomal recessive, progressive, cerebellar ataxia with peripheral axonal neuropathy, oculomotor apraxia (defined as the limitation of ocular movements on command), and hypoalbuminemia. The prevalence is unknown.600,25
ARAndrogen insensitivity syndrome, completeNM_000044.3NM_000044.3:c.340C>T, NM_000044.3:c.1771A>T, NM_000044.3:c.2323C>T, NM_000044.3:c.2391G>A, NM_000044.3:c.2395C>G, NM_000044.3:c.2567G>A, NM_000044.3:c.2650A>TThe complete androgen insensitivity syndrome (CAIS) follows an X-linked pattern of inheritance and is caused by pathogenic variants in the AR gene located on chromosomal region Xq12. Affected males have female external genitalia, female breast development, blind vagina, absent uterus and female adnexa, and abdominal or inguinal testes, despite a normal male 46,XY karyotype. There is unresponsiveness to age-appropriate levels of androgens. There is also a partial androgen insensitivity syndrome (PAIS; OMIM 312300) caused by mutations in the AR gene, called Reifenstein syndrome, which results in hypospadias and micropenis with gynecomastia. Note: A specific type of mutation in the AR gene (a CAG repeat expansion) also cause a rare condition known as Spinal and bulbar muscular atrophy or Kennedy disease; this mutation is not tested by this carrier test. 600,25
ARSAMetachromatic leukodystrophyNM_000487.5NM_000487.5:c.1408_1418delGCAGCTGTGAC, NM_000487.5:c.1401_1411delGTTAGACGCAG, NM_000487.5:c.1283C>T, NM_000487.5:c.1241delC, NM_000487.5:c.1232C>T, NM_000487.5:c.1210+1G>A, NM_000487.5:c.1175G>A, NM_000487.5:c.1174C>T, NM_000487.5:c.1150G>A, NM_000487.5:c.1125_1126delCT, NM_000487.5:c.1108-2A>G, NM_000487.5:c.991G>T, NM_000487.5:c.986C>T, NM_000487.5:c.979G>A, NM_000487.5:c.938G>A, NM_000487.5:c.937C>T, NM_000487.5:c.931G>A, NM_000487.5:c.899T>C, NM_000487.5:c.883G>A, NM_000487.5:c.869G>A, NM_000487.5:c.854+1G>A, NM_000487.5:c.827C>T, NM_000487.5:c.763G>A, NM_000487.5:c.739G>A, NM_000487.5:c.737G>A, NM_000487.5:c.641C>T, NM_000487.5:c.583delT, NM_000487.5:c.582delC, NM_000487.5:c.542dupT, NM_000487.5:c.542T>G, NM_000487.5:c.465+1G>A, NM_000487.5:c.346C>T, NM_000487.5:c.302G>A, NM_000487.5:c.293C>T, NM_000487.5:c.257G>A, NM_000487.5:c.195delC, NM_000487.5:c.34delGMetachromatic leukodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSA gene located on chromosomal region 22q13.33. The age of onset is variable. This disease is characterized by hypotonia, walking difficulties, optic atrophy and motor regression preceding mental impairment in the late infantile form, arrested intellectual development, followed by motor regression, epileptic seizures and ataxia in the juvenile form, and motor or psychiatric disorders, but with slow progression in the adult form. The incidence is 0.5:5,000-1:50,000ﾠand the prevalence is 1:10,000 -5/10,000.600,25
ARSBMucopolysaccharidosis type 6 (Maroteaux-Lamy)NM_000046.3NM_000046.3:c.1438dupG, NM_000046.3:c.1366C>T, NM_000046.3:c.1214G>A, NM_000046.3:c.1178A>C, NM_000046.3:c.1161dupC, NM_000046.3:c.1143-1G>C, NM_000046.3:c.1143-8T>G, NM_000046.3:c.979C>T, NM_000046.3:c.971G>T, NM_000046.3:c.944G>A, NM_000046.3:c.937C>G, NM_000046.3:c.921delA, NM_000046.3:c.753C>G, NM_000046.3:c.629A>G, NM_000046.3:c.589C>T, NM_000046.3:c.571C>T, NM_000046.3:c.427delG, NM_000046.3:c.349T>CMucopolysaccharidosis type 6 (Maroteaux-Lamy) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSB gene located on chromosomal region 5q14.1. The age of onset is infantile. This lysosomal storage disorder resulting from a deficiency of arylsulfatase B is characterized by educed pulmonary function, hepatosplenomegaly, hearing loss, sleep apnea, corneal clouding, carpal tunnel disease and occasionally central nervous system findings may include cervical cord compression caused by cervical spinal instability, meningeal thickening and/or bony stenosis, communicating hydrocephalus, optic nerve atrophy and blindness. The prevalence is 1:250,000-1:600,000 newborns.600,25
ARSEChondrodysplasia punctata, X-linked recessiveNM_001282628.1NM_001282628.1:c.1807C>T, NM_001282628.1:c.1517C>T, NM_001282628.1:c.1504delG, NM_001282628.1:c.485G>T, NM_001282628.1:c.194T>G, NM_001282628.1:c.99-1G>AX-linked chondrodysplasia punctata follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARSE gene located on chromosomal region Xp22.33. The age of onset is neonatal. Thisﾠis a disorder of cartilage and bone development that occurs almost exclusively in males. Include short stature and unusually short fingertips and ends of the toes. This condition is also associated with distinctive facial features, particularly a flattened-appearing nose with crescent-shaped nostrils and a flat nasal bridge. People with X-linked chondrodysplasia punctata 1 typically have normal intelligence and a normal life expectancy. However, some affected individuals have had serious or life-threatening complications including abnormal thickening (stenosis) of the cartilage that makes up the airways, which restricts breathing. Also, abnormalities of spinal bones in the neck can lead to pinching (compression) of the spinal cord, which can cause pain, numbness, and weakness. Other, less common features of X-linked chondrodysplasia punctata 1 include delayed development, hearing loss, vision abnormalities, and heart defects. The prevalence is 1:500,000.600,25
ASLArgininosuccinic aciduriaNM_000048.3NM_000048.3:c.35G>A, NM_000048.3:c.337C>T, NM_000048.3:c.346C>T, NM_000048.3:c.446+1G>A, NM_000048.3:c.525-2A>T, NM_000048.3:c.532G>A, NM_000048.3:c.539T>G, NM_000048.3:c.544C>T, NM_000048.3:c.578G>A, NM_000048.3:c.602+1G>A, NM_000048.3:c.857A>G, NM_000048.3:c.1045_1057delGTCATCTCTACGC, NM_000048.3:c.1060C>T, NM_000048.3:c.1135C>T, NM_000048.3:c.1144-2A>G, NM_000048.3:c.1153C>T, NM_000048.3:c.1255_1256delCT, NM_000048.3:c.1369dupGArgininosuccinic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASL gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by severe hyperammonemic coma, hypotonia, growth failure, anorexia and chronic vomiting or behavioral disorders during childhood, and hyperammonemic coma or behavioral disorders that simulate psychiatric disorders later in life. The prevalence is 1:70,000 newborns.600,25
ASPACanavan diseaseNM_000049.2NM_000049.2:c.212G>A, NM_000049.2:c.433-2A>G, NM_000049.2:c.654C>A, NM_000049.2:c.693C>A, NM_000049.2:c.854A>C, NM_000049.2:c.914C>ACanavan disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPA gene located on chromosomal region 17p13.3. The age of onset is neonatal/infantile. This disease is characterized by a variable spectrum between severe forms with leukodystrophy, macrocephaly and severe developmental delay, and a very rare mild/juvenile form characterized by mild developmental delay. The prevalence is 1:6,400- 1:13,500 in Askenazis Jewis.600,25
ASPMPrimary microcephaly type 5, autosomal recessiveNM_018136.4NM_018136.4:c.10059C>A, NM_018136.4:c.9789T>A, NM_018136.4:c.9754delA, NM_018136.4:c.9747_9748delCT, NM_018136.4:c.9730C>T, NM_018136.4:c.9697C>T, NM_018136.4:c.9685delA, NM_018136.4:c.9677dupG, NM_018136.4:c.9557C>G, NM_018136.4:c.9492T>G, NM_018136.4:c.9319C>T, NM_018136.4:c.9238A>T, NM_018136.4:c.9190C>T, NM_018136.4:c.9178C>T, NM_018136.4:c.9159delA, NM_018136.4:c.9115_9118dupCATT, NM_018136.4:c.8844delC, NM_018136.4:c.8711_8712delAA, NM_018136.4:c.8668C>T, NM_018136.4:c.8508_8509delGA, NM_018136.4:c.8378delT, NM_018136.4:c.8230dupA, NM_018136.4:c.8131_8132delAA, NM_018136.4:c.7894C>T, NM_018136.4:c.7860_7861delGA, NM_018136.4:c.7782_7783delGA, NM_018136.4:c.7761T>G, NM_018136.4:c.7491_7495delTATTA, NM_018136.4:c.6732delA, NM_018136.4:c.6337_6338delAT, NM_018136.4:c.6232C>T, NM_018136.4:c.6189T>G, NM_018136.4:c.6073delG, NM_018136.4:c.5439_5440delAG, NM_018136.4:c.5149delA, NM_018136.4:c.5136C>A, NM_018136.4:c.4858_4859delAT, NM_018136.4:c.4795C>T, NM_018136.4:c.4583delA, NM_018136.4:c.4195dupA, NM_018136.4:c.3979C>T, NM_018136.4:c.3978G>A, NM_018136.4:c.3811C>T, NM_018136.4:c.3796G>T, NM_018136.4:c.3710C>G, NM_018136.4:c.3663delG, NM_018136.4:c.3527C>G, NM_018136.4:c.3477_3481delCGCTA, NM_018136.4:c.3188T>G, NM_018136.4:c.3082G>A, NM_018136.4:c.3055C>T, NM_018136.4:c.2967G>A, NM_018136.4:c.2389C>T, NM_018136.4:c.1990C>T, NM_018136.4:c.1959_1962delCAAA, NM_018136.4:c.1729_1730delAG, NM_018136.4:c.1590delA, NM_018136.4:c.1406_1413delATCCTAAA, NM_018136.4:c.1366G>T, NM_018136.4:c.1260_1266delTCAAGTC, NM_018136.4:c.1179delT, NM_018136.4:c.1154_1155delAG, NM_018136.4:c.1002delA, NM_018136.4:c.719_720delCT, NM_018136.4:c.577C>T, NM_018136.4:c.349C>TPrimary autosomal recessive microcephaly type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPM gene located on chromosomal region 1q31. The age of onset is neonatal/infantile. This disease is characterized by a reduction in head circumference at birth, mild to moderate non-progressive intellectual impairment and delay in early motor milestones, speech delay and hyperactive behavior are common.ﾠThe annual incidence is 1:1,000,000.600,25
ASS1Citrullinemia type 1NM_000050.4NM_000050.4:c.40G>A, NM_000050.4:c.256C>T, NM_000050.4:c.257G>A, NM_000050.4:c.349G>A, NM_000050.4:c.421-2A>G, NM_000050.4:c.470G>A, NM_000050.4:c.496-2A>G, NM_000050.4:c.535T>C, NM_000050.4:c.539G>A, NM_000050.4:c.571G>A, NM_000050.4:c.787G>A, NM_000050.4:c.793C>T, NM_000050.4:c.794G>A, NM_000050.4:c.805G>A, NM_000050.4:c.814C>T, NM_000050.4:c.835C>T, NM_000050.4:c.836G>A, NM_000050.4:c.910C>T, NM_000050.4:c.919C>T, NM_000050.4:c.970G>A, NM_000050.4:c.970+5G>A, NM_000050.4:c.1085G>T, NM_000050.4:c.1087C>T, NM_000050.4:c.1088G>A, NM_000050.4:c.1168G>A, NM_000050.4:c.1194-1G>CCitrullinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASS1 gene located on chromosomal region 9q34.1. The age of onset is variable. This disease is characterized by hyperammonemia, progressive lethargy, poor feeding and vomiting in the neonatal form and by variable hyperammonemia in the later-onset form. The prevalence is 1:100,000-9:100,000.600,25
ATICAICA-ribosiduria due to ATIC deficiencyNM_004044.6NM_004044.6:c.1277A>GAICA-ribosiduria due to ATIC deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATIC gene located on chromosomal region 2q35. The age of onset is neonatal/infantile. This disease is characterized by profound intellectual deficit, epilepsy, dysmorphic features of the knees, elbows, and shoulders and congenital blindness. The prevalence is <1:1,000,000.600,25
ATP7BWilson diseaseNM_000053.3NM_000053.3:c.4088C>T, NM_000053.3:c.4058G>A, NM_000053.3:c.3990_3993delTTAT, NM_000053.3:c.3955C>T, NM_000053.3:c.3809A>G, NM_000053.3:c.3796G>A, NM_000053.3:c.3694A>C, NM_000053.3:c.3359T>A, NM_000053.3:c.3207C>A, NM_000053.3:c.3083delA, NM_000053.3:c.2975C>T, NM_000053.3:c.2972C>T, NM_000053.3:c.2930C>T, NM_000053.3:c.2906G>A, NM_000053.3:c.2807T>A, NM_000053.3:c.2804C>T, NM_000053.3:c.2795C>A, NM_000053.3:c.2755C>T, NM_000053.3:c.2755C>G, NM_000053.3:c.2621C>T, NM_000053.3:c.2605G>A, NM_000053.3:c.2532delA, NM_000053.3:c.2356-2A>G, NM_000053.3:c.2305A>G, NM_000053.3:c.2297C>G, NM_000053.3:c.2123T>C, NM_000053.3:c.2071G>A, NM_000053.3:c.1934T>G, NM_000053.3:c.1846C>T, NM_000053.3:c.1745_1746delTA, NM_000053.3:c.1512dupT, NM_000053.3:c.1145_1151delCCCAACT, NM_000053.3:c.915T>A, NM_000053.3:c.562C>T, NM_000053.3:c.19_20delCAWilson disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATP7B gene located on chromosomal region 13q14.3. The age of onset is infantile. This disease is characterized by the toxic accumulation of copper, mainly in the liver and central nervous system, and symptomatic patients may present with hepatic, neurologic or psychiatric forms. The birth incidence is 1:30,000-1:100,000 in France and The prevalence is 1:10,000-1:30,000.600,25
ATRSeckel syndrome type 1NM_001184.3NM_001184.3:c.6488delT, NM_001184.3:c.6037dupA, NM_001184.3:c.5645delA, NM_001184.3:c.5635G>T, NM_001184.3:c.2341+1G>A, NM_001184.3:c.975_976delCTSeckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATR gene located on chromosomal region 3q23. The age of onset is neonatal/infantile. This disease is characterized by a proportionate dwarfism of prenatal onset, a severe microcephaly with a bird-headed like appearance and mental retardation.ﾠThe prevalence is <1:1,000,000.600,25
BCKDHAMaple syrup urine disease, type 1aNM_000709.3NM_000709.3:c.14delT, NM_000709.3:c.632C>T, NM_000709.3:c.659C>T, NM_000709.3:c.741dupT, NM_000709.3:c.797delA, NM_000709.3:c.853G>C, NM_000709.3:c.868G>A, NM_000709.3:c.905A>C, NM_000709.3:c.909_910delGT, NM_000709.3:c.917delT, NM_000709.3:c.929C>G, NM_000709.3:c.964C>T, NM_000709.3:c.979G>A, NM_000709.3:c.1036C>T, NM_000709.3:c.1037G>A, NM_000709.3:c.1234G>AMaple syrup urine disease type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHA gene located on chromosomal region 19q13.1-13.2. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:1,000,000-9:1,000,000.600,25
BCS1LBCS1L-related disorders, including Leigh syndromeNM_001079866.1NM_001079866.1:c.103G>C, NM_001079866.1:c.133C>T, NM_001079866.1:c.148A>G, NM_001079866.1:c.166C>T, NM_001079866.1:c.232A>G, NM_001079866.1:c.547C>T, NM_001079866.1:c.548G>A, NM_001079866.1:c.550C>T, NM_001079866.1:c.696delT, NM_001079866.1:c.830G>A, NM_001079866.1:c.1057G>ALeigh syndrome caused by mutations in the BCS1L gene -located on chromosomal region 2q35- follows an autosomal recessive pattern of inheritance. Leigh syndrome is a clinically and genetically heterogeneous disorder resulting from defective mitochondrial energy generation; It presents extensive genetic heterogeneity (more than 75 different genes) with mutations identified in both nuclear- and mitochondrial-encoded genes involved in energy metabolism, including mitochondrial respiratory chain complexes I, II, III, IV, and V. It most commonly presents as a progressive and severe neurodegenerative disorder with onset within the first months or years of life, and may result in early death. Affected individuals usually show global developmental delay or developmental regression, hypotonia, ataxia, dystonia, and ophthalmologic abnormalities, such as nystagmus or optic atrophy. The BCS1L protein is critical for the formation of mitochondrial complex III. This syndrome affects at least 1 in 40,000 newborns. 600,25
BEST1Bestrophinopathy, ARNM_001139443.1NM_001139443.1:c.242G>A, NM_001139443.1:c.341_342delTG, NM_001139443.1:c.344delG, NM_001139443.1:c.418C>T, NM_001139443.1:c.434T>C, NM_001139443.1:c.502G>A, NM_001139443.1:c.754G>A, NM_001139443.1:c.769G>A, NM_001139443.1:c.1129_1130insCCAAAGA, NM_001139443.1:c.1203_1204insGCCTTGATGGA, NM_001139443.1:c.1311_1317dupCAAAGACBestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram. Genetic heterogeneity: Mutations in this gene may cause dominant phenotypes like Macular dystrophy, vitelliform, 2 ( OMIM 153700) and Vitreoretinochoroidopathy (193220).600,25
BEST1Bestrophinopathy, ARNM_004183.3NM_004183.3:c.122T>CBestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram. Genetic heterogeneity: Mutations in this gene may cause dominant phenotypes like Macular dystrophy, vitelliform, 2 ( OMIM 153700) and Vitreoretinochoroidopathy (193220).600,25
BSNDBartter syndrome, type 4aNM_057176.2NM_057176.2:c.1A>T, NM_057176.2:c.3G>A, NM_057176.2:c.10G>T, NM_057176.2:c.22C>T, NM_057176.2:c.23G>T, NM_057176.2:c.35T>C, NM_057176.2:c.139G>ABartter syndrome type 4A with deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSND gene located on chromosomal region 1p32.3. The age of onset is neonatal/infantile. This disease is characterized by maternal polyhydramnios, premature delivery, polyuria, sensorineural deafness and is associated with hypokalemic alkalosis, increased levels of plasma renin and aldosterone, low blood pressure, and vascular resistance to angiotensin II.600,25
BTDBiotinidase deficiencyNM_001281723.2NM_001281723.2:c.190G>A, NM_001281723.2:c.241C>T, NM_001281723.2:c.340G>C, NM_001281723.2:c.449G>A, NM_001281723.2:c.517G>A, NM_001281723.2:c.534G>T, NM_001281723.2:c.563G>A, NM_001281723.2:c.589A>G, NM_001281723.2:c.601G>A, NM_001281723.2:c.635A>G, NM_001281723.2:c.637C>T, NM_001281723.2:c.649C>T, NM_001281723.2:c.670G>A, NM_001281723.2:c.761A>G, NM_001281723.2:c.800A>T, NM_001281723.2:c.939delT, NM_001281723.2:c.1330delG, NM_001281723.2:c.1345C>T, NM_001281723.2:c.1358G>A, NM_001281723.2:c.1374A>C, NM_001281723.2:c.1495C>T, NM_001281723.2:c.1514_1518delGGATG, NM_001281723.2:c.1601C>T, NM_001281723.2:c.1618C>TBiotinidase deficiency an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BTD gene located on chromosomal region 3p25. The age of onset is neonatal/infantile. This disease is characterized by seizures, breathing difficulties, hypotonia, skin rash, alopecia, hearing loss and delayed development.600,25
CAPN3Limb-girdle muscular dystrophy type 1 (LGMDR1; formerly LGMD2A)NM_000070.2NM_000070.2:c.133G>A, NM_000070.2:c.223dupT, NM_000070.2:c.257C>T, NM_000070.2:c.328C>T, NM_000070.2:c.550delA, NM_000070.2:c.580delT, NM_000070.2:c.598_612delTTCTGGAGTGCTCTG, NM_000070.2:c.855_864dupGTTGATTGCA, NM_000070.2:c.956C>T, NM_000070.2:c.1322delG, NM_000070.2:c.1466G>A, NM_000070.2:c.1468C>T, NM_000070.2:c.1469G>A, NM_000070.2:c.1599_1602delGAGC, NM_000070.2:c.1715G>A, NM_000070.2:c.1795dupA, NM_000070.2:c.1838delA, NM_000070.2:c.2120A>G, NM_000070.2:c.2212C>T, NM_000070.2:c.2243G>A, NM_000070.2:c.2251_2254dupGTCA, NM_000070.2:c.2306G>A, NM_000070.2:c.2362_2363delAGinsTCATCTLimb-girdle muscular dystrophy type 1 (LGMDR1; formerly LGMD2A) follows an autosomal recessive pattern of inheritance and is caused by biallelic pathogenic variants in the CAPN3 gene located on chromosomal region 15q15.1. The age of onset is variable. This disease is characterized by a variable age of onset of progressive, typically symmetrical and selective weakness and atrophy of proximal shoulder- and pelvic-girdle muscles (gluteus maximus, thigh adductors, and muscles of the posterior compartment of the limbs are most commonly affected) without cardiac or facial involvement. Clinical manifestations include exercise intolerance, a waddling gait, scapular winging and calf pseudo-hypertrophy.The prevalence is 1:100,000- 9:100,000. Genetic heterogeneity: Heterozygous mutation in the CAPN3 gene can cause autosomal dominant limb-girdle muscular dystrophy-4 (LGMDD4; OMIM 618129), which has a later onset and milder features.600,25
CBSHomocystinuria, B6-responsive and nonresponsive typesNM_000071.2NM_000071.2:c.1330G>A, NM_000071.2:c.1280C>T, NM_000071.2:c.1150A>G, NM_000071.2:c.1136G>A, NM_000071.2:c.1058C>T, NM_000071.2:c.1006C>T, NM_000071.2:c.992C>A, NM_000071.2:c.969G>A, NM_000071.2:c.959T>C, NM_000071.2:c.919G>A, NM_000071.2:c.833T>C, NM_000071.2:c.797G>A, NM_000071.2:c.689delT, NM_000071.2:c.676G>A, NM_000071.2:c.572C>T, NM_000071.2:c.526G>T, NM_000071.2:c.502G>A, NM_000071.2:c.434C>T, NM_000071.2:c.430G>A, NM_000071.2:c.415G>A, NM_000071.2:c.393G>C, NM_000071.2:c.374G>A, NM_000071.2:c.341C>T, NM_000071.2:c.325T>C, NM_000071.2:c.162G>A, NM_000071.2:c.146C>THomocystinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CBS gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by the multiple involvement of the eye, skeleton, central nervous system and vascular system. The prevalence is 1:200,000-1:335,000.600,25
CC2D2AJoubert syndrome type 9; Meckel syndrome type 6NM_001080522.2NM_001080522.2:c.2486+1G>C, NM_001080522.2:c.2848C>T, NM_001080522.2:c.3145C>T, NM_001080522.2:c.3289delG, NM_001080522.2:c.3364C>T, NM_001080522.2:c.3594+1G>A, NM_001080522.2:c.4179+1delG, NM_001080522.2:c.4181delG, NM_001080522.2:c.4333C>T, NM_001080522.2:c.4582C>T, NM_001080522.2:c.4667A>TJoubert syndrome type 9 defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized neonatal hypotonia, developmental delay, intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia, primary position nystagmus and congenital hepatic fibrosis.600,25
CDH23Usher syndrome, type 1DNM_022124.5NM_022124.5:c.146-2A>G, NM_022124.5:c.193delC, NM_022124.5:c.288+1G>A, NM_022124.5:c.1858+2T>G, NM_022124.5:c.3141C>A, NM_022124.5:c.3516_3519delATCC, NM_022124.5:c.3579+2T>C, NM_022124.5:c.4504C>T, NM_022124.5:c.5237G>A, NM_022124.5:c.5663T>C, NM_022124.5:c.6050-9G>A, NM_022124.5:c.6393delC, NM_022124.5:c.6442G>ANon-syndromic autosomal recessive deafness type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.600,25
CDHR1Cone-rod dystrophy, type 15NM_033100.3NM_033100.3:c.338delG, NM_033100.3:c.524dupA, NM_033100.3:c.640delG, NM_033100.3:c.1112delC, NM_033100.3:c.1463delG, NM_033100.3:c.1485+2T>C, NM_033100.3:c.1485+2T>GCone-rod dystrophy, type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDHR1 gene located on chromosomal region 10q23.1. This disease is characterized by decreased visual acuity and sensitivity in the central visual field, followed by loss of peripheral vision. The overall prevalence of all types of cone-rod dystrophy is 1-9:100,000.600,25
CENPJPrimary microcephaly type 6, autosomal recessiveNM_018451.4NM_018451.4:c.3842_3843dupTA, NM_018451.4:c.3704A>T, NM_018451.4:c.3699_3702dupAATA, NM_018451.4:c.3568_3571dupGTCA, NM_018451.4:c.3415G>T, NM_018451.4:c.3243_3246delTCAG, NM_018451.4:c.2968_2972delAAAAA, NM_018451.4:c.2614delT, NM_018451.4:c.2460_2463delGACG, NM_018451.4:c.1949_1952dupAGTG, NM_018451.4:c.757_760delGTCT, NM_018451.4:c.289dupA, NM_018451.4:c.232_236delCAGAA, NM_018451.4:c.40C>TPrimary autosomal recessive microcephaly type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CENPJ gene located on chromosomal region 13q12.12.ﾠThe age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment.600,25
CEP290Meckel syndrome type 4; Joubert syndrome type 5NM_025114.3NM_025114.3:c.7341dupA, NM_025114.3:c.7341delA, NM_025114.3:c.7324G>T, NM_025114.3:c.6798G>A, NM_025114.3:c.6645+1G>A, NM_025114.3:c.6624delG, NM_025114.3:c.6448_6455delCAGTTGAA, NM_025114.3:c.5668G>T, NM_025114.3:c.5611_5614delCAAA, NM_025114.3:c.4962_4963delAA, NM_025114.3:c.4916C>A, NM_025114.3:c.4723A>T, NM_025114.3:c.4705-1G>T, NM_025114.3:c.4656delA, NM_025114.3:c.4393C>T, NM_025114.3:c.3185delT, NM_025114.3:c.2249T>G, NM_025114.3:c.1681C>T, NM_025114.3:c.1665_1666delAA, NM_025114.3:c.1501G>T, NM_025114.3:c.613C>T, NM_025114.3:c.384_387delTAGA, NM_025114.3:c.164_167delCTCA, NM_025114.3:c.21G>TMeckel syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is neonatal. This disease is characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically occipital encephalocele), hepatic ductal dysplasia and cysts, and postaxial polydactyly. The prevalence is <1/1,000,000.600,25
CERKLRetinitis pigmentosa type 26NM_001030311.2NM_001030311.2:c.1090C>T, NM_001030311.2:c.858delT, NM_001030311.2:c.847C>T, NM_001030311.2:c.312delARetinitis pigmentosa 26 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CERKL gene located on chromosomal region 2q31.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.600,25
CFHComplement factor H deficiencyNM_000186.3NM_000186.3:c.380G>T, NM_000186.3:c.1606T>C, NM_000186.3:c.2876G>AComplement factor H deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFH gene located on chromosomal region 1q32. This disease is characterized by increased susceptibility to recurrent, usually severe, infections (particularly by Neisseria meningitidis, Escherichia coli, and Haemophilus influenzae), renal impairment and/or autoimmune diseases.600,25
CFTRCystic fibrosisNM_000492.3NM_000492.3:c.1A>G, NM_000492.3:c.4C>T, NM_000492.3:c.11C>A, NM_000492.3:c.50delT, NM_000492.3:c.44T>C, NM_000492.3:c.53+1G>T, NM_000492.3:c.57G>A, NM_000492.3:c.79G>T, NM_000492.3:c.88C>T, NM_000492.3:c.115C>T, NM_000492.3:c.137C>A, NM_000492.3:c.164+1G>A, NM_000492.3:c.164+1G>T, NM_000492.3:c.164+2T>C, NM_000492.3:c.164+4dupT, NM_000492.3:c.165-3C>T, NM_000492.3:c.165-1G>A, NM_000492.3:c.166G>A, NM_000492.3:c.169T>G, NM_000492.3:c.170G>A, NM_000492.3:c.171G>A, NM_000492.3:c.174_177delTAGA, NM_000492.3:c.175dupA, NM_000492.3:c.178G>A, NM_000492.3:c.178G>T, NM_000492.3:c.200C>T, NM_000492.3:c.223C>T, NM_000492.3:c.233dupT, NM_000492.3:c.254G>A, NM_000492.3:c.262_263delTT, NM_000492.3:c.263T>A, NM_000492.3:c.263T>G, NM_000492.3:c.271G>A, NM_000492.3:c.273+1G>A, NM_000492.3:c.273+3A>C, NM_000492.3:c.274-2A>G, NM_000492.3:c.274-1G>A, NM_000492.3:c.274G>A, NM_000492.3:c.274G>T, NM_000492.3:c.292C>T, NM_000492.3:c.305T>G, NM_000492.3:c.310delA, NM_000492.3:c.313delA, NM_000492.3:c.325_327delTATinsG, NM_000492.3:c.328G>C, NM_000492.3:c.328G>T, NM_000492.3:c.349C>T, NM_000492.3:c.350G>A, NM_000492.3:c.350G>T, NM_000492.3:c.366T>A, NM_000492.3:c.409delC, NM_000492.3:c.413_415dupTAC, NM_000492.3:c.416A>G, NM_000492.3:c.442delA, NM_000492.3:c.445G>A, NM_000492.3:c.445G>T, NM_000492.3:c.446G>T, NM_000492.3:c.489+1G>T, NM_000492.3:c.531delT, NM_000492.3:c.532G>A, NM_000492.3:c.543_546delTAGT, NM_000492.3:c.571T>G, NM_000492.3:c.577G>T, NM_000492.3:c.579+1G>T, NM_000492.3:c.579+3A>G, NM_000492.3:c.579+5G>A, NM_000492.3:c.580-1G>T, NM_000492.3:c.595C>T, NM_000492.3:c.613C>T, NM_000492.3:c.617T>G, NM_000492.3:c.647G>A, NM_000492.3:c.658C>T, NM_000492.3:c.680T>G, NM_000492.3:c.695T>A, NM_000492.3:c.708delT, NM_000492.3:c.717delG, NM_000492.3:c.803delA, NM_000492.3:c.825C>G, NM_000492.3:c.828C>A, NM_000492.3:c.850dupA, NM_000492.3:c.861_865delCTTAA, NM_000492.3:c.935_937delTCT, NM_000492.3:c.933C>G, NM_000492.3:c.948delT, NM_000492.3:c.987delA, NM_000492.3:c.988G>T, NM_000492.3:c.1000C>T, NM_000492.3:c.1001G>T, NM_000492.3:c.1006_1007insG, NM_000492.3:c.1007T>A, NM_000492.3:c.1013C>T, NM_000492.3:c.1021_1022dupTC, NM_000492.3:c.1021T>C, NM_000492.3:c.1029delC, NM_000492.3:c.1037T>C, NM_000492.3:c.1040G>A, NM_000492.3:c.1040G>C, NM_000492.3:c.1055G>A, NM_000492.3:c.1075C>A, NM_000492.3:c.1079C>A, NM_000492.3:c.1081delT, NM_000492.3:c.1116+1G>A, NM_000492.3:c.1117-1G>A, NM_000492.3:c.1130dupA, NM_000492.3:c.1155_1156dupTA, NM_000492.3:c.1202G>A, NM_000492.3:c.1203G>A, NM_000492.3:c.1209+1G>A, NM_000492.3:c.1211delG, NM_000492.3:c.1240C>T, NM_000492.3:c.1301_1307delCACTTCT, NM_000492.3:c.1327_1330dupGATA, NM_000492.3:c.1340delA, NM_000492.3:c.1364C>A, NM_000492.3:c.1365_1366delGG, NM_000492.3:c.1393-2A>G, NM_000492.3:c.1393-1G>A, NM_000492.3:c.1397C>A, NM_000492.3:c.1397C>G, NM_000492.3:c.1400T>C, NM_000492.3:c.1418delG, NM_000492.3:c.1420G>A, NM_000492.3:c.1438G>T, NM_000492.3:c.1466C>A, NM_000492.3:c.1475C>T, NM_000492.3:c.1477_1478delCA, NM_000492.3:c.1477C>T, NM_000492.3:c.1487G>A, NM_000492.3:c.1505T>C, NM_000492.3:c.1519_1521delATC, NM_000492.3:c.1516A>G, NM_000492.3:c.1519A>G, NM_000492.3:c.1521_1523delCTT, NM_000492.3:c.1523T>G, NM_000492.3:c.1538A>G, NM_000492.3:c.1545_1546delTA, NM_000492.3:c.1558G>T, NM_000492.3:c.1572C>A, NM_000492.3:c.1573C>T, NM_000492.3:c.1584+1G>A, NM_000492.3:c.1585-8G>A, NM_000492.3:c.1585-1G>A, NM_000492.3:c.1624G>T, NM_000492.3:c.1645A>C, NM_000492.3:c.1646G>A, NM_000492.3:c.1647T>G, NM_000492.3:c.1648G>T, NM_000492.3:c.1650delA, NM_000492.3:c.1651G>A, NM_000492.3:c.1652G>A, NM_000492.3:c.1654C>T, NM_000492.3:c.1657C>T, NM_000492.3:c.1670delC, NM_000492.3:c.1673T>C, NM_000492.3:c.1675G>A, NM_000492.3:c.1679G>A, NM_000492.3:c.1679G>C, NM_000492.3:c.1679+1G>A, NM_000492.3:c.1679+1G>C, NM_000492.3:c.1680-886A>G, NM_000492.3:c.1680-1G>A, NM_000492.3:c.1682C>A, NM_000492.3:c.1692delA, NM_000492.3:c.1703delT, NM_000492.3:c.1705T>G, NM_000492.3:c.1721C>A, NM_000492.3:c.1753G>T, NM_000492.3:c.1766+1G>A, NM_000492.3:c.1766+1G>C, NM_000492.3:c.1766+1G>T, NM_000492.3:c.1766+3A>G, NM_000492.3:c.1766+5G>T, NM_000492.3:c.1792_1798delAAAACTA, NM_000492.3:c.1826A>G, NM_000492.3:c.1882G>C, NM_000492.3:c.1923_1931delCTCAAAACTinsA, NM_000492.3:c.1973_1985delGAAATTCAATCCTinsAGAAA, NM_000492.3:c.1986_1989delAACT, NM_000492.3:c.2012delT, NM_000492.3:c.2017G>T, NM_000492.3:c.2052dupA, NM_000492.3:c.2052delA, NM_000492.3:c.2051_2052delAAinsG, NM_000492.3:c.2053dupC, NM_000492.3:c.2053C>T, NM_000492.3:c.2125C>T, NM_000492.3:c.2128A>T, NM_000492.3:c.2143C>T, NM_000492.3:c.2158C>T, NM_000492.3:c.2175dupA, NM_000492.3:c.2195T>G, NM_000492.3:c.2215delG, NM_000492.3:c.2241_2248delGATACTGC, NM_000492.3:c.2290C>T, NM_000492.3:c.2353C>T, NM_000492.3:c.2374C>T, NM_000492.3:c.2423_2424dupAT, NM_000492.3:c.2453delT, NM_000492.3:c.2463_2464delTG, NM_000492.3:c.2464G>T, NM_000492.3:c.2490+1G>A, NM_000492.3:c.2491G>T, NM_000492.3:c.2537G>A, NM_000492.3:c.2538G>A, NM_000492.3:c.2547C>A, NM_000492.3:c.2551C>T, NM_000492.3:c.2583delT, NM_000492.3:c.2589_2599delAATTTGGTGCT, NM_000492.3:c.2601dupA, NM_000492.3:c.2645G>A, NM_000492.3:c.2657+5G>A, NM_000492.3:c.2658-1G>C, NM_000492.3:c.2668C>T, NM_000492.3:c.2735C>A, NM_000492.3:c.2737_2738insG, NM_000492.3:c.2739T>A, NM_000492.3:c.2763_2764dupAG, NM_000492.3:c.2780T>C, NM_000492.3:c.2810dupT, NM_000492.3:c.2825delT, NM_000492.3:c.2834C>T, NM_000492.3:c.2869_2870insG, NM_000492.3:c.2875delG, NM_000492.3:c.2896delA, NM_000492.3:c.2908G>C, NM_000492.3:c.2930C>T, NM_000492.3:c.2936A>T, NM_000492.3:c.2988G>A, NM_000492.3:c.2988+1G>A, NM_000492.3:c.2989-2A>G, NM_000492.3:c.2989-1G>A, NM_000492.3:c.3002_3003delTG, NM_000492.3:c.3011_3019delCTATAGCAG, NM_000492.3:c.3017C>A, NM_000492.3:c.3039dupC, NM_000492.3:c.3039delC, NM_000492.3:c.3067_3072delATAGTG, NM_000492.3:c.3080T>C, NM_000492.3:c.3107C>A, NM_000492.3:c.3124C>T, NM_000492.3:c.3139_3139+1delGG, NM_000492.3:c.3140-26A>G, NM_000492.3:c.3160C>G, NM_000492.3:c.3181G>C, NM_000492.3:c.3194T>C, NM_000492.3:c.3196C>T, NM_000492.3:c.3197G>A, NM_000492.3:c.3205G>A, NM_000492.3:c.3209G>A, NM_000492.3:c.3230T>C, NM_000492.3:c.3266G>A, NM_000492.3:c.3276C>A, NM_000492.3:c.3276C>G, NM_000492.3:c.3292T>C, NM_000492.3:c.3293G>A, NM_000492.3:c.3294G>A, NM_000492.3:c.3294G>C, NM_000492.3:c.3294G>T, NM_000492.3:c.3302T>A, NM_000492.3:c.3302T>G, NM_000492.3:c.3304A>T, NM_000492.3:c.3310G>T, NM_000492.3:c.3353C>T, NM_000492.3:c.3368-2A>G, NM_000492.3:c.3435G>A, NM_000492.3:c.3454G>C, NM_000492.3:c.3468G>A, NM_000492.3:c.3468+5G>A, NM_000492.3:c.3472C>T, NM_000492.3:c.3484C>T, NM_000492.3:c.3528delC, NM_000492.3:c.3532_3535dupTCAA, NM_000492.3:c.3536_3539delCCAA, NM_000492.3:c.3587C>G, NM_000492.3:c.3605delA, NM_000492.3:c.3611G>A, NM_000492.3:c.3612G>A, NM_000492.3:c.3659delC, NM_000492.3:c.3691delT, NM_000492.3:c.3700A>G, NM_000492.3:c.3717+4A>G, NM_000492.3:c.3717+5G>A, NM_000492.3:c.3717+40A>G, NM_000492.3:c.3718-2477C>T, NM_000492.3:c.3718-3T>G, NM_000492.3:c.3718-1G>A, NM_000492.3:c.3719T>G, NM_000492.3:c.3731G>A, NM_000492.3:c.3744delA, NM_000492.3:c.3747delG, NM_000492.3:c.3752G>A, NM_000492.3:c.3761T>G, NM_000492.3:c.3763T>C, NM_000492.3:c.3764C>A, NM_000492.3:c.3773dupT, NM_000492.3:c.3846G>A, NM_000492.3:c.3848G>T, NM_000492.3:c.3873+1G>A, NM_000492.3:c.3873+2T>C, NM_000492.3:c.3883_3886delATTT, NM_000492.3:c.3883delA, NM_000492.3:c.3889dupT, NM_000492.3:c.3891dupT, NM_000492.3:c.3908delA, NM_000492.3:c.3909C>G, NM_000492.3:c.3937C>T, NM_000492.3:c.3971T>C, NM_000492.3:c.4036_4042delCTAAGCC, NM_000492.3:c.4046G>A, NM_000492.3:c.4077_4080delTGTTinsAA, NM_000492.3:c.4086dupT, NM_000492.3:c.4111G>T, NM_000492.3:c.4127_4131delTGGAT, NM_000492.3:c.4144C>T, NM_000492.3:c.4147dupA, NM_000492.3:c.4197_4198delCT, NM_000492.3:c.4231C>T, NM_000492.3:c.4234C>T, NM_000492.3:c.4242+1G>A, NM_000492.3:c.4242+1G>T, NM_000492.3:c.4251delA, NM_000492.3:c.4300_4301dupAG, NM_000492.3:c.4426C>TCystic fibrosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFTR gene located on chromosomal region 7q31.2. The age of onset of severe form is neonatal or infantile but there are also variants associated with moderate clinical or late onset. This disease is characterized by the production of sweat with a high salt content, mucus secretions with an abnormal viscosity, chronic bronchitis, pancreatic insufficiency, adolescent diabetes and, more rarely, stercoral obstruction and cirrhosis. Male sterility is a constant feature. Late-onset forms, which are usually only mild or monosymptomatic. The prevalence is 1:10,000-9:10,000.600,25
CHST6Macular corneal dystrophyNM_021615.4NM_021615.4:c.853delC, NM_021615.4:c.820G>T, NM_021615.4:c.392C>A, NM_021615.4:c.327_328delCTMacular corneal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CHST6 gene located on chromosomal region 16q22. The age of onset is variable. This disease is characterized by bilateral ill-defined cloudy regions within a hazy stroma, and eventually severe visual impairment. The prevalence is 1:100,000-9:100,000.600,25
CLCN1Myotonia congenita, recessiveNM_000083.2NM_000083.2:c.180+3A>T, NM_000083.2:c.225dupC, NM_000083.2:c.409T>G, NM_000083.2:c.871G>A, NM_000083.2:c.1238T>G, NM_000083.2:c.1453A>G, NM_000083.2:c.2680C>TMyotonia congenita follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN1 gene located on chromosomal region 7q35. The age of onset is neonatal/infantile. This is a nondystrophic skeletal muscle disorder characterized by muscle stiffness and an inability of the muscle to relax after voluntary contraction. Most patients have symptom onset in the legs, which later progresses to the arms, neck, and facial muscles. Many patients show marked hypertrophy of the lower limb muscles. The prevalence is 1:100,000.600,25
CLDN19Rena hypomagnesemia type 5, with ocular involvementNM_148960.2NM_148960.2:c.425_437delCCCTGGTGACCCA, NM_148960.2:c.269T>C, NM_148960.2:c.169C>G, NM_148960.2:c.59G>ARenal hypomagnesemia type 5, with ocular involvement follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN19 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by excessive magnesium and calcium renal wasting, bilateral nephrocalcinosis, progressive renal failure and severe ocular abnormalities. The prevalence is <1:1,000,000.600,25
CLRN1Usher syndrome, type 3ANM_001195794.1NM_001195794.1:c.669_670insT, NM_001195794.1:c.630dupT, NM_001195794.1:c.189C>A, NM_001195794.1:c.144T>G, NM_001195794.1:c.118T>G, NM_001195794.1:c.92C>TUsher syndrome type 3A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1 gene located on chromosomal region 3q25.1. The age of onset is neonatal/infantile. This disease is characterized by the association of sensorineural deafness with retinitis pigmentosa and progressive vision loss. The prevalence is 1:1.000.000- 9/1.000.000.600,25
CNGA1Retinitis pigmentosa type 49NM_001142564.1NM_001142564.1:c.2179delA, NM_001142564.1:c.2134C>T, NM_001142564.1:c.1747C>T, NM_001142564.1:c.1166C>T, NM_001142564.1:c.1001G>A, NM_001142564.1:c.656+2T>C, NM_001142564.1:c.445G>T, NM_001142564.1:c.304dupARetinitis pigmentosa 49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGA1 gene located on chromosomal region 4p12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000.600,25
CNGB1Retinitis pigmentosa type 45NM_001297.4NM_001297.4:c.3462+1G>A, NM_001297.4:c.3425delT, NM_001297.4:c.3150delG, NM_001297.4:c.2762_2765delACGA, NM_001297.4:c.2653delG, NM_001297.4:c.2492+2T>G, NM_001297.4:c.1958-1G>A, NM_001297.4:c.1122-2A>T, NM_001297.4:c.952C>T, NM_001297.4:c.413-1G>A, NM_001297.4:c.218-2A>GRetinitis pigmentosa 45 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB1 gene located on chromosomal region 16q13. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000 to 5:10,000.600,25
CNGB3Achromatopsia type 3NM_019098.4NM_019098.4:c.2048_2049delCA, NM_019098.4:c.2011G>T, NM_019098.4:c.1148delC, NM_019098.4:c.1063C>T, NM_019098.4:c.893_897delCAAAA, NM_019098.4:c.887_896delCTTCTACAAA, NM_019098.4:c.886_890delACTTC, NM_019098.4:c.819_826delCAGACTCC, NM_019098.4:c.446_447insTAchromatopsia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is neonatal/Infantile. This disease is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, and reduced or complete loss of color discrimination. Most individuals have complete form, with total lack of function in all three types of cones. Rarely, individuals have incomplete form, with similar, but generally less severe symptoms. The prevalence is 1/30,000-1/50,000.600,25
COL17A1Epidermolysis bullosa, junctional, non-Herlitz typeNM_000494.3NM_000494.3:c.4319dupC, NM_000494.3:c.4003_4004delGG, NM_000494.3:c.3908G>A, NM_000494.3:c.3897_3900delATCT, NM_000494.3:c.3827dupC, NM_000494.3:c.3795delC, NM_000494.3:c.3676C>T, NM_000494.3:c.3277+1G>A, NM_000494.3:c.3067C>T, NM_000494.3:c.3043C>T, NM_000494.3:c.2965delA, NM_000494.3:c.2944_2947+1delGAAGG, NM_000494.3:c.2564T>G, NM_000494.3:c.2551+1G>T, NM_000494.3:c.2430_2431insCCGA, NM_000494.3:c.2383C>T, NM_000494.3:c.2336-1G>T, NM_000494.3:c.2336-2A>G, NM_000494.3:c.2228-3_2235delCAGGTCCTGCTinsTTG, NM_000494.3:c.1898G>A, NM_000494.3:c.1706delC, NM_000494.3:c.520_521delAG, NM_000494.3:c.433C>TEpidermolysis bullosa, junctional, non-Herlitz type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL17A1 gene located on chromosomal region 10q24.3. The age of onset is neonatal/infantile. This disease is characterized by a generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.600,25
COL18A1Knobloch syndrome, type 1NM_130444.2NM_130444.2:c.1700_1701insGACGTGAAAGAGGGG, NM_130444.2:c.2240_2241insGACGTGAAAGAGGGG, NM_130444.2:c.3294_3295delAG, NM_130444.2:c.3502C>T, NM_130444.2:c.4072_4084delCCCCCAGGCCCAC, NM_130444.2:c.4214_4223delCAGGGCCCCC, NM_130444.2:c.4222_4223delCC, NM_130444.2:c.4323_4323+1delGG, NM_130444.2:c.4759_4760delCT, NM_130444.2:c.5168dupGKnobloch syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL18A1 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by vitreoretinal and macular degeneration, and occipital encephalocele.ﾠThe prevalence is <1:1,000,000.600,25
COL4A3Alport syndrome 3B, autosomal recessiveNM_000091.4NM_000091.4:c.345delG, NM_000091.4:c.898G>A, NM_000091.4:c.2083G>A, NM_000091.4:c.2111delC, NM_000091.4:c.2954G>T, NM_000091.4:c.4420_4424delCTTTT, NM_000091.4:c.4441C>T, NM_000091.4:c.4571C>GAlport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.600,25
COL4A4Alport syndrome, autosomal recessiveNM_000092.4NM_000092.4:c.4923C>A, NM_000092.4:c.4129C>T, NM_000092.4:c.3713C>A, NM_000092.4:c.3601G>A, NM_000092.4:c.2312delG, NM_000092.4:c.71+1G>AAlport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn.600,25
COL7A1Epidermolysis bullosa dystrophica, ARNM_000094.3NM_000094.3:c.8524_8527+10delGAAGGTGAGGACAG, NM_000094.3:c.8479C>T, NM_000094.3:c.8440C>T, NM_000094.3:c.8393T>A, NM_000094.3:c.8245G>A, NM_000094.3:c.7957G>A, NM_000094.3:c.7930-1G>C, NM_000094.3:c.7912G>T, NM_000094.3:c.7411C>T, NM_000094.3:c.7345-1G>A, NM_000094.3:c.6946G>A, NM_000094.3:c.6859G>A, NM_000094.3:c.6752G>A, NM_000094.3:c.6670G>T, NM_000094.3:c.6573+1G>T, NM_000094.3:c.6527dupC, NM_000094.3:c.6205C>T, NM_000094.3:c.6187C>T, NM_000094.3:c.6091G>A, NM_000094.3:c.5821-1G>A, NM_000094.3:c.5532+1G>A, NM_000094.3:c.5287C>T, NM_000094.3:c.5096C>T, NM_000094.3:c.5052+1G>A, NM_000094.3:c.4888C>T, NM_000094.3:c.4783G>C, NM_000094.3:c.4373C>T, NM_000094.3:c.4119+1G>T, NM_000094.3:c.4039G>C, NM_000094.3:c.3831+1G>T, NM_000094.3:c.2471dupG, NM_000094.3:c.933C>A, NM_000094.3:c.887delG, NM_000094.3:c.706C>T, NM_000094.3:c.425A>G, NM_000094.3:c.336C>GEpidermolysis bullosa dystrophica follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL7A1 gene located on chromosomal region 3p21.1. The age of onset is neonatal/infantile. This disease is characterized by generalized cutaneous and mucosal blistering and scarring associated with severe deformities and major extracutaneous involvement. The prevalence is <1:1,000,000.600,25
COQ2Primary coenzyme Q10 deficiency, type 1NM_015697.7NM_015697.7:c.1197delT, NM_015697.7:c.890A>G, NM_015697.7:c.723delT, NM_015697.7:c.683A>G, NM_015697.7:c.590G>APrimary coenzyme Q10 deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ2 gene located on chromosomal region 4q21.23. The age of onset is neonatal/infantile. The phenotypes include an encephalomyopathic form with seizures and ataxia; a multisystem infantile form with encephalopathy, cardiomyopathy and renal failure; a predominantly cerebellar form with ataxia and cerebellar atrophy; Leigh syndrome with growth retardation; and an isolated myopathic form.600,25
COQ8APrimary coenzyme Q10 deficiency, type 4NM_020247.4NM_020247.4:c.589-3C>G, NM_020247.4:c.637C>T, NM_020247.4:c.815G>A, NM_020247.4:c.815G>T, NM_020247.4:c.911C>T, NM_020247.4:c.1541A>G, NM_020247.4:c.1645G>A, NM_020247.4:c.1651G>A, NM_020247.4:c.1750_1752delACC, NM_020247.4:c.1813dupGPrimary coenzyme Q10 deficiency type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ8A gene located on chromosomal region 1q42.13. The age of onset is infantile. This disease is characterized by progressive ataxia, cerebellar atrophy, and often exercise intolerance with elevated lactate levels and mild intellectual deficit.600,25
CPT2Carnitine palmitoyltransferase type 2 deficiency, lethal neonatalNM_000098.2NM_000098.2:c.149C>A, NM_000098.2:c.338C>T, NM_000098.2:c.359A>G, NM_000098.2:c.370C>T, NM_000098.2:c.452G>A, NM_000098.2:c.464dupT, NM_000098.2:c.520G>A, NM_000098.2:c.638A>G, NM_000098.2:c.680C>T, NM_000098.2:c.725_726delAC, NM_000098.2:c.886C>T, NM_000098.2:c.1148T>A, NM_000098.2:c.1237C>T, NM_000098.2:c.1239_1240delGA, NM_000098.2:c.1369A>T, NM_000098.2:c.1437C>G, NM_000098.2:c.1784delC, NM_000098.2:c.1883A>C, NM_000098.2:c.1891C>TCarnitine palmitoyltransferase deficiency, type 2, lethal neonatal form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT2 gene located on chromosomal region 1p32. The age of onset is neonatal/infantile. This disease is characterized by a severe fasting intolerance leading to metabolic derangements of hypoketotic hypoglycemia, resulting in coma and seizures, and hepatic encephalopathy leading to liver failure.ﾠThe prevalence is <1:1,000,000.600,25
CRB1Retinitis pigmentosa type 12, AR; Leber congenital amaurosis type 8NM_201253.2NM_201253.2:c.498_506delAATTGATGG, NM_201253.2:c.613_619delATAGGAA, NM_201253.2:c.2290C>T, NM_201253.2:c.2401A>T, NM_201253.2:c.2416G>T, NM_201253.2:c.2688T>A, NM_201253.2:c.2983G>T, NM_201253.2:c.3055_3059dupTATAT, NM_201253.2:c.3122T>C, NM_201253.2:c.3299T>C, NM_201253.2:c.3299T>G, NM_201253.2:c.3383delT, NM_201253.2:c.3419T>A, NM_201253.2:c.3997G>TRetinitis pigmentosa type 12 and leber congenital amaurosis type 8 follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. Retinitis pigmentosa type 12 is characterized by night blindness, peripheral visual field impairment and over time loss of central visionm, and its prevalence is 1-5:10,000. Leber congenital amaurosis, with a neonatal/infantile age of onset, comprises a group of early-onset childhood retinal dystrophies characterized by vision loss, nystagmus, and severe retinal dysfunction. Patients usually present at birth with profound vision loss and pendular nystagmus. Other clinical findings of this disease may include high hypermetropia, photodysphoria, oculodigital sign, keratoconus, cataracts, and a variable appearance to the fundus.600,25
CTNSCystinosis (atypical/juvenile/ocular) nephropathicNM_001031681.2NM_001031681.2:c.283G>T, NM_001031681.2:c.329G>T, NM_001031681.2:c.357_360delCAGC, NM_001031681.2:c.397_398delAT, NM_001031681.2:c.414G>A, NM_001031681.2:c.416C>T, NM_001031681.2:c.506G>A, NM_001031681.2:c.589G>A, NM_001031681.2:c.646dupA, NM_001031681.2:c.853-3C>G, NM_001031681.2:c.1015G>ANephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. This disease is characterized by hypothyroidism, insulin-dependent diabetes, hepatosplenomegaly with portal hypertension, and muscle, cerebral and ocular involvement, caused by cystine deposits in various organs. The prevalence is 1:100,000-1:200,000.600,25
CTSKPycnodysostosisNM_000396.3NM_000396.3:c.926T>C, NM_000396.3:c.721C>T, NM_000396.3:c.436G>C, NM_000396.3:c.236G>A, NM_000396.3:c.154A>TPycnodysostosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSK gene located on chromosomal region 1q21. The age of onset is variable. This disease is characterized by osteosclerosis, short stature or dwarfism, acroosteolysis of the distal phalanges, fragile bones associated with spontaneous fractures and dysplasia of the clavicles. The prevalence is 1/1,000,000 to 9/1,000,000.600,25
CYP4V2Bietti crystalline corneoretinal dystrophyNM_207352.3NM_207352.3:c.130T>A, NM_207352.3:c.327+1G>A, NM_207352.3:c.332T>C, NM_207352.3:c.1523G>ABietti crystalline corneoretinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP4V2 gene located on chromosomal region 4q35.2. The age of onset is adult. This disease is characterized by nightblindness, decreased vision, paracentral scotoma, and, in the end stages of the disease, legal blindness.600,25
CYP7B1Spastic paraplegia type 5A, autosomal recessiveNM_004820.4NM_004820.4:c.1460dupT, NM_004820.4:c.1456C>T, NM_004820.4:c.1162C>T, NM_004820.4:c.889A>G, NM_004820.4:c.825T>A, NM_004820.4:c.321_324delACAA, NM_004820.4:c.187C>TSpastic paraplegia type 5A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. The prevalence is below 1,000,000.600,25
D2HGDHD-2-hydroxyglutaric aciduriaNM_152783.4NM_152783.4:c.440T>G, NM_152783.4:c.1123G>T, NM_152783.4:c.1315A>G, NM_152783.4:c.1331T>C, NM_152783.4:c.1333_1334delACD-2-Hydroxyglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the D2HGDH gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by extremely variable clinical manifestations, with severe cases characterized by neonatal or early infantile-onset epileptic encephalopathy, and marked hypotonia, and cerebral visual failure, developmental delay, seizures, involuntary movements, and cardiomyopathy are also common in these cases. The prevalence is below 1,000,000.600,25
DBTMaple syrup urine disease, type 2NM_001918.3NM_001918.3:c.1281+1G>A, NM_001918.3:c.939G>C, NM_001918.3:c.901C>T, NM_001918.3:c.871C>T, NM_001918.3:c.827T>G, NM_001918.3:c.772+1G>A, NM_001918.3:c.670G>T, NM_001918.3:c.581C>G, NM_001918.3:c.294C>G, NM_001918.3:c.272_275delCAGT, NM_001918.3:c.126T>GMaple syrup urine disease, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DBT gene located on chromosomal region 1p21.2. The age of onset in neonatal/infantil. This disease is characterized by a maple syrup odor to the urine, deficient diet, lethargy and focal dystonia, followed by progressive encephalopathy and central respiratory failure if not treated. The prevalence is 1-5/10,000.600,25
DCLRE1COmenn syndrome; Severe combined immunodeficiency, Athabascan typeNM_001033855.2NM_001033855.2:c.1639G>T, NM_001033855.2:c.1558dupA, NM_001033855.2:c.780+1delG, NM_001033855.2:c.597C>A, NM_001033855.2:c.2T>COmenn syndrome and Athabascan type severe combined immunodeficiency follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the DCLRE1C gene located on chromosomal region 10p13. Omenn syndrome has an early age of onset and it is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. The age of onset of Athabascan type severe combined immunodeficiency is neonatal/infantile and it is characterized by severe and recurrent infections, diarrhea, failure to thrive, and cell sensitivity to ionizing radiation. The prevalence is 1-9/1,000,000.600,25
DGUOKDGUOK-related mitochondrial DNA depletion syndromeNM_080916.2NM_080916.2:c.137A>G, NM_080916.2:c.313C>T, NM_080916.2:c.425G>A, NM_080916.2:c.494A>T, NM_080916.2:c.707+2T>G, NM_080916.2:c.763G>TMitochondrial DNA depletion syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DGUOK gene located on chromosomal region 2p13. The age of onset is neonatal/infantile. This disease is characterized by progressive liver failure, hypoglycemia and neurologic abnormalities including hypotonia, encephalopathy and peripheral neuropathy600,25
DHCR7Smith-Lemli-Opitz syndromeNM_001163817.1NM_001163817.1:c.1342G>A, NM_001163817.1:c.1337G>A, NM_001163817.1:c.1228G>A, NM_001163817.1:c.1210C>T, NM_001163817.1:c.1055G>A, NM_001163817.1:c.1054C>T, NM_001163817.1:c.976G>T, NM_001163817.1:c.964-1G>C, NM_001163817.1:c.907G>A, NM_001163817.1:c.866C>T, NM_001163817.1:c.841G>A, NM_001163817.1:c.839A>G, NM_001163817.1:c.832-1G>C, NM_001163817.1:c.744G>T, NM_001163817.1:c.730G>A, NM_001163817.1:c.725G>A, NM_001163817.1:c.724C>T, NM_001163817.1:c.506C>T, NM_001163817.1:c.461C>G, NM_001163817.1:c.453G>A, NM_001163817.1:c.452G>A, NM_001163817.1:c.356A>T, NM_001163817.1:c.292C>T, NM_001163817.1:c.278C>T, NM_001163817.1:c.151C>T, NM_001163817.1:c.1A>GSmith-Lemli-Opitz syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHCR7 gene located on chromosomal region 11q13.4. The age of onset is neonatal/infantile. This disease is characterized by multiple congenital anomalies, intellectual deficit, and behavioral problems.ﾠThe prevalence is 1/20,000 to 1/40,000 newborn.600,25
DPYDDihydropyrimidine dehydrogenase deficiencyNM_000110.3NM_000110.3:c.1905+1G>A, NM_000110.3:c.1679T>G, NM_000110.3:c.1109_1110delTA, NM_000110.3:c.299_302delTCATDihydropyrimidine dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPYD gene located on chromosomal region 1p22. This disease shows large phenotypic variability, ranging from no symptoms to a convulsive disorder with motor and mental retardation in homozygous patients. In people with severe dihydropyrimidine dehydrogenase deficiency, the disorder becomes apparent in infancy. These affected individuals have recurrent seizures (epilepsy), intellectual disability, a small head size (microcephaly), increased muscle tone (hypertonia), delayed development of motor skills such as walking, and autistic behaviors that affect communication and social interaction. The prevalence is unknow.
In addition, homozygous and heterozygous mutation carriers can develop severe toxicity after the administration of the antineoplastic drug 5-fluorouracil (5FU).		600,25
DSPCardiomyopathy, dilated, with woolly hair and keratoderma; Epidermolysis bullosa, lethal acantholyticNM_004415.3NM_004415.3:c.3098delA, NM_004415.3:c.5800C>T, NM_004415.3:c.6370_6371delCT, NM_004415.3:c.7000C>T, NM_004415.3:c.7180_7181delAG, NM_004415.3:c.8188C>TDilated cardiomyopathy with woolly hair and keratoderma, known as Carvajal syndrome, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterized by woolly hair is present at birth and the palmoplantar keratoderma appears during the first year of life. The cardiac anomaly presents during childhood and is marked by dilation of the left ventricle accompanied by alterations in muscle contractility. The dilated cardiomyopathy may lead to life-threatening congestive heart failure and death. The prevalence is below 1,000,000. Furthermore, mutations in the DSP gene have been identified in people with an autosomal recessive disorder called lethal acantholytic epidermolysis bullosa. Features of this condition include very fragile skin that blisters and detaches easily, a complete absence of hair (alopecia), abnormal or missing fingernails, teeth that are present from birth (neonatal teeth), and abnormalities of the heart muscle (cardiomyopathy). The skin abnormalities lead to a severe loss of fluids and death in early infancy.600,25
DYSFMiyoshi muscular dystrophy, type 1; Muscular dystrophy, limb-girdle, autosomal recessive, type 2 NM_001130978.1NM_001130978.1:c.1481-1G>AMiyoshi muscular dystrophy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is young adulthood. This disease is characterized by weakness and atrophy in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000. Mutations in the DYSF gene can also cause muscular dystrophy, limb-girdle, autosomal recessive, type 2. This disease is characterized by an onset in late adolescence or early adulthood of slowly progressive, proximal weakness and atrophy of shoulder and pelvic girdle muscles. Cardiac and respiratory muscles are not involved. Hypertrophy of the calf muscles and highly elevated serum creatine kinase levels are frequently observed.600,25
DYSFMiyoshi muscular dystrophy, type 1; Muscular dystrophy, limb-girdle, autosomal recessive, type 2 NM_001130987.1NM_001130987.1:c.203_204delTGinsAT, NM_001130987.1:c.396_397delCC, NM_001130987.1:c.706C>T, NM_001130987.1:c.759+1G>C, NM_001130987.1:c.797G>A, NM_001130987.1:c.853C>T, NM_001130987.1:c.991G>A, NM_001130987.1:c.991G>T, NM_001130987.1:c.1033+1G>A, NM_001130987.1:c.1149+1G>A, NM_001130987.1:c.1372G>A, NM_001130987.1:c.1380+2T>C, NM_001130987.1:c.1464C>A, NM_001130987.1:c.1488dupA, NM_001130987.1:c.1494-2A>G, NM_001130987.1:c.1494-1G>A, NM_001130987.1:c.1609G>A, NM_001130987.1:c.1674delA, NM_001130987.1:c.1692+2T>A, NM_001130987.1:c.1717C>T, NM_001130987.1:c.1867C>T, NM_001130987.1:c.1888C>T, NM_001130987.1:c.1927G>T, NM_001130987.1:c.2924_2928delAGACC, NM_001130987.1:c.2923C>T, NM_001130987.1:c.3051G>T, NM_001130987.1:c.3095A>G, NM_001130987.1:c.3166C>T, NM_001130987.1:c.3229-2A>T, NM_001130987.1:c.3498_3499delTGinsAA, NM_001130987.1:c.3531C>A, NM_001130987.1:c.3532C>T, NM_001130987.1:c.3695delC, NM_001130987.1:c.3762delA, NM_001130987.1:c.3859G>T, NM_001130987.1:c.3957+1delG, NM_001130987.1:c.4011delC, NM_001130987.1:c.4144C>T, NM_001130987.1:c.4162_4163delGT, NM_001130987.1:c.4307G>A, NM_001130987.1:c.4873C>T, NM_001130987.1:c.4989_4993delGCCCGinsCCCC, NM_001130987.1:c.5194C>T, NM_001130987.1:c.5318A>G, NM_001130987.1:c.5383C>T, NM_001130987.1:c.5458-2A>C, NM_001130987.1:c.5546G>A, NM_001130987.1:c.5546+1G>T, NM_001130987.1:c.5614G>T, NM_001130987.1:c.5626G>A, NM_001130987.1:c.5642+1G>A, NM_001130987.1:c.5711delG, NM_001130987.1:c.5761C>T, NM_001130987.1:c.5815_5816delAG, NM_001130987.1:c.5830C>T, NM_001130987.1:c.5953_5956delCAGC, NM_001130987.1:c.6096dupA, NM_001130987.1:c.6109G>T, NM_001130987.1:c.6241C>TMiyoshi muscular dystrophy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is young adulthood. This disease is characterized by weakness and atrophy in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000. Mutations in the DYSF gene can also cause muscular dystrophy, limb-girdle, autosomal recessive, type 2. This disease is characterized by an onset in late adolescence or early adulthood of slowly progressive, proximal weakness and atrophy of shoulder and pelvic girdle muscles. Cardiac and respiratory muscles are not involved. Hypertrophy of the calf muscles and highly elevated serum creatine kinase levels are frequently observed.600,25
EDAEctodermal dysplasia, type 1, hypohidrotic, X-linkedNM_001399.4NM_001399.4:c.181T>C, NM_001399.4:c.183C>G, NM_001399.4:c.187G>A, NM_001399.4:c.463C>T, NM_001399.4:c.466C>T, NM_001399.4:c.467G>A, NM_001399.4:c.573_574insT, NM_001399.4:c.671G>C, NM_001399.4:c.826C>T, NM_001399.4:c.1045G>AHypohidrotic ectodermal dysplasia, type 1, hypohidrotic, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EDA gene located on chromosomal region Xq12-q13.1. The age of onset is neonatal/infantile. This disease is characterized by malformation of ectodermal structures such as skin, hair, teeth and sweat glands. The prevalence is 1/5,000 to 1/10,000 newborns.600,25
ERCC2Trichothiodystrophy, type 1NM_000400.3NM_000400.3:c.2230_2233dupCTAG, NM_000400.3:c.2176C>T, NM_000400.3:c.2047C>T, NM_000400.3:c.1972C>T, NM_000400.3:c.1703_1704delTT, NM_000400.3:c.1621A>C, NM_000400.3:c.1454T>C, NM_000400.3:c.1381C>G, NM_000400.3:c.1354C>T, NM_000400.3:c.1308-1G>A, NM_000400.3:c.950-2A>G, NM_000400.3:c.949+1G>A, NM_000400.3:c.719-1G>A, NM_000400.3:c.567G>A, NM_000400.3:c.183+2T>ATrichothiodystrophy (TTD), type 1 is a heterogeneous group of disorders that follows an autosomal recessive pattern of inheritance. It is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.32. The age of onset is neonatal or infantile. This disease, with variable clinical expression, is characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. About half of the patients with TTD exhibit marked photosensitivity.600,25
ERCC5Cerebrooculofacioskeletal syndrome, type 3NM_000123.3NM_000123.3:c.88+2T>C, NM_000123.3:c.215C>A, NM_000123.3:c.381-2A>G, NM_000123.3:c.406C>T, NM_000123.3:c.464dupA, NM_000123.3:c.526C>T, NM_000123.3:c.787C>T, NM_000123.3:c.2144dupA, NM_000123.3:c.2375C>T, NM_000123.3:c.2573T>C, NM_000123.3:c.2751delACerebrooculofacioskeletal syndrome type 3, also known as COFS syndrome, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC5 gene located on chromosomal region 13q33.1. COFS syndrome is characterized by prenatal onset of arthrogryposis, microcephaly and growth failure. Postnatal features include severe developmental delay, congenital cataracts (in some), and marked UV sensitivity of the skin. Survival beyond 6 years of age is rare. The prevalence is below 1/1,000,000.600,25
ERCC6Cockayne syndrome, type B; Cerebrooculofacioskeletal syndrome, type 1NM_000124.3NM_000124.3:c.3862C>T, NM_000124.3:c.3591_3592dupGA, NM_000124.3:c.2587C>T, NM_000124.3:c.2203C>T, NM_000124.3:c.2047C>T, NM_000124.3:c.1550G>A, NM_000124.3:c.1357C>T, NM_000124.3:c.422+1G>A, NM_000124.3:c.207dupG, NM_000124.3:c.48_49delCTCockayne syndrome (CS), type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterized by short stature, a characteristic facial appearance, premature aging, photosensitivity, progressive neurological dysfunction, and intellectual deficit. Mutations in the ERRC6 gene have been also found in patients with COFS syndrome type 1, an extreme prenatal form of the CS clinical spectrum. This autosomal recessive progressive neurodegenerative disorder is characterized by microcephaly, congenital cataracts, severe mental retardation, facial dysmorphism, and arthrogryposis.600,25
EYSRetinitis pigmentosa, type 25NM_001292009.1NM_001292009.1:c.9468T>A, NM_001292009.1:c.9362_9365delCTCA, NM_001292009.1:c.9099delT, NM_001292009.1:c.8711_8718delCATGCAGA, NM_001292009.1:c.8692_8695dupACAG, NM_001292009.1:c.8632G>T, NM_001292009.1:c.8471dupA, NM_001292009.1:c.7822C>T, NM_001292009.1:c.7095T>G, NM_001292009.1:c.6170delA, NM_001292009.1:c.6102dupT, NM_001292009.1:c.5928-2A>G, NM_001292009.1:c.5857G>T, NM_001292009.1:c.5757dupT, NM_001292009.1:c.4462_4469dupAGCCCCTC, NM_001292009.1:c.4350_4356delTATAGCT, NM_001292009.1:c.4120C>T, NM_001292009.1:c.4045C>T, NM_001292009.1:c.2826_2827delAT, NM_001292009.1:c.1211dupA, NM_001292009.1:c.571dupA, NM_001292009.1:c.490C>T, NM_001292009.1:c.232delT, NM_001292009.1:c.103C>TRetinitis pigmentosa, type 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EYS gene located on chromosomal region 6q12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000.600,25
F11Factor XI deficiency, autosomal recessiveNM_000128.3NM_000128.3:c.166T>C, NM_000128.3:c.403G>T, NM_000128.3:c.438C>A, NM_000128.3:c.595+3A>G, NM_000128.3:c.901T>C, NM_000128.3:c.1211C>A, NM_000128.3:c.1613C>T, NM_000128.3:c.1693G>AFactor XI deficiency, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F11 gene located on chromosomal region 4q35. The age of onset is variable. This disease is characterized by reduced levels and activity of factor XI resulting in moderate bleeding symptoms, usually occurring after trauma or surgery. The prevalence is 1/1,000,000 to 9/1,000,000.600,25
F9Hemophilia BNM_000133.3NM_000133.3:c.82T>C, NM_000133.3:c.1031T>C, NM_000133.3:c.1136G>A, NM_000133.3:c.1150C>THemophilia B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F9 gene located on chromosomal region Xq27.1-q27.2. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor IX deficiency. The prevalence is 1/100,000 to 9/100,000.600,25
FAHTyrosinemia, type 1NM_000137.2NM_000137.2:c.47A>T, NM_000137.2:c.192G>T, NM_000137.2:c.401C>A, NM_000137.2:c.456G>A, NM_000137.2:c.554-1G>T, NM_000137.2:c.707-1G>A, NM_000137.2:c.782C>T, NM_000137.2:c.786G>A, NM_000137.2:c.837+1G>A, NM_000137.2:c.939delC, NM_000137.2:c.982C>T, NM_000137.2:c.1009G>A, NM_000137.2:c.1027G>T, NM_000137.2:c.1062+5G>A, NM_000137.2:c.1069G>T, NM_000137.2:c.1090G>T, NM_000137.2:c.1141A>GTyrosinemia, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAH gene located on chromosomal region 15q25.1. The age of onset is variable. This disease is characterized by progressive liver disease, renal tubular dysfunction, porphyria-like crises and a dramatic improvement in prognosis following treatment with nitisinone. The birth incidence is 1/100,000, notably in Qu�bec, Canada, and the prevalence is 1/100,000 to 1/120,000 newborns.600,25
FANCAFanconi anemia, complementation group ANM_000135.2NM_000135.2:c.4130C>G, NM_000135.2:c.3788_3790delTCT, NM_000135.2:c.3763G>T, NM_000135.2:c.3558dupG, NM_000135.2:c.2303T>C, NM_000135.2:c.1115_1118delTTGG, NM_000135.2:c.233_236delTTGA, NM_000135.2:c.131dupAFanconi anemia, complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCA gene located on chromosomal region 16q24.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.600,25
FANCCFanconi anemia, complementation group CNM_000136.2NM_000136.2:c.1642C>T, NM_000136.2:c.1487T>G, NM_000136.2:c.1103_1104delTG, NM_000136.2:c.1015delA, NM_000136.2:c.996+1G>T, NM_000136.2:c.67delG, NM_000136.2:c.37C>TFanconi anemia, complementation group C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCC gene located on chromosomal region 9q22.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.600,25
FANCGFanconi anemia, complementation group GNM_004629.1NM_004629.1:c.1852_1853delAA, NM_004629.1:c.1795_1804delTGGATCCGTC, NM_004629.1:c.1480+1G>C, NM_004629.1:c.1077-2A>G, NM_004629.1:c.907_908dupCT, NM_004629.1:c.637_643delTACCGCC, NM_004629.1:c.510+1G>A, NM_004629.1:c.313G>TFanconi anemia, complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCG gene located on chromosomal region 9p13. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000.600,25
FGBCongenital afibrinogenemiaNM_005141.4NM_005141.4:c.1148T>G, NM_005141.4:c.1289G>ACongenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGB gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000.600,25
FIG4Charcot-Marie-Tooth disease, type 4J; Yunis-Varon syndromeNM_014845.5NM_014845.5:c.122T>C, NM_014845.5:c.311G>A, NM_014845.5:c.501C>G, NM_014845.5:c.547C>T, NM_014845.5:c.592C>T, NM_014845.5:c.737G>A, NM_014845.5:c.831_838delTAAATTTG, NM_014845.5:c.2299dupGCharcot-Marie-Tooth disease, type 4J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by rapidly progressive, asymmetric motor neuron degeneration with slow nerve conduction velocities, weakness and paralysis, without sensory loss. The prevalence is 4/100,000 to 8/100,000. Mutations in the FIG4 gene have been also found in patient with Yunis-Varon syndrome. This disease is a severe autosomal recessive disorder characterized by skeletal defects, including cleidocranial dysplasia and digital anomalies, and severe neurologic involvement with neuronal loss. Enlarged cytoplasmic vacuoles are found in neurons, muscle, and cartilage. The disorder is usually lethal in infancy.600,25
FKRPMuscular dystrophy-dystroglycanopathy, type 5A, 5B and 5CNM_001039885.2NM_001039885.2:c.160C>T, NM_001039885.2:c.1154C>A, NM_001039885.2:c.1343C>T, NM_001039885.2:c.1387A>GMuscular dystrophy-dystroglycanopathy type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is neonatal or early infancy. There are three subtypes of dystroglycanopathies related to FKRP gene: subtype 5A, 5B and 5C. Subtype 5A is the most severe phenotype and is associated with congenital brain and eye anomalies, cobblestone lissencephaly, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Subtype 5B represents an intermediate phenotype with or without congenital mental retardation, white matter changes and structural brain abnormalities. Finally, subtype 5C is the less severe phenotype characterized by limb-girdle muscular dystrophy, variable age at onset, normal cognition, and no structural brain changes.600,25
FMR1Fragile X syndrome-0(CGG)n pre-mutated alleleFragile X syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FMR1 gene located on chromosomal region Xq27.3. The symptoms are variable depending on the range of CGG triplet expansion. In complete mutation the onset is infantile in men and is characterized by intellectual disability, characteristic appearance (large head, long face, prominent forehead and chin, protruding ears) joint laxity and large testes after puberty. In carrier female, the symptoms are milder and include primary ovarian insufficiency. The prevalence is 1/2,500 (full mutation allele) to 1/4,000 (prevalence of symptomatic cases) for both genders.600,25
FRAS1Fraser syndrome, type 1NM_025074.6NM_025074.6:c.835_838delGTGT, NM_025074.6:c.3799C>T, NM_025074.6:c.5605_5606insT, NM_025074.6:c.6433C>T, NM_025074.6:c.6991_6992insGG, NM_025074.6:c.7813C>T, NM_025074.6:c.11160_11167delGCTGGAGAFraser syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the gene FRAS1 located on chromosomal region 4q21.21. The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000.600,25
G6PCGlycogen storage disease, type 1ANM_000151.3NM_000151.3:c.113A>T, NM_000151.3:c.229T>C, NM_000151.3:c.230+1G>C, NM_000151.3:c.247C>T, NM_000151.3:c.248G>A, NM_000151.3:c.370G>A, NM_000151.3:c.379_380dupTA, NM_000151.3:c.447-1G>A, NM_000151.3:c.497T>G, NM_000151.3:c.508C>T, NM_000151.3:c.562G>C, NM_000151.3:c.883C>T, NM_000151.3:c.1039C>TGlycogen storage disease, type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000.600,25
G6PCGlycogen storage disease, type 1ANM_001270397.1NM_001270397.1:c.474G>AGlycogen storage disease, type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000.600,25
GALCKrabbe diseaseNM_000153.3NM_000153.3:c.2056T>C, NM_000153.3:c.1964delC, NM_000153.3:c.1814dupA, NM_000153.3:c.1796T>G, NM_000153.3:c.1723_1724insT, NM_000153.3:c.1700A>C, NM_000153.3:c.1695delT, NM_000153.3:c.1592G>A, NM_000153.3:c.1591C>T, NM_000153.3:c.1586C>T, NM_000153.3:c.1543G>A, NM_000153.3:c.1489+1_1489+2delGT, NM_000153.3:c.1488_1489+2delTGGT, NM_000153.3:c.1488_1489delTG, NM_000153.3:c.1472delA, NM_000153.3:c.1161+2T>G, NM_000153.3:c.1153G>T, NM_000153.3:c.953C>G, NM_000153.3:c.658C>T, NM_000153.3:c.655C>T, NM_000153.3:c.628A>T, NM_000153.3:c.582+1G>A, NM_000153.3:c.453G>A, NM_000153.3:c.430delA, NM_000153.3:c.388G>A, NM_000153.3:c.205C>TKrabbe disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALC gene located on chromosomal region 14q31.3. There are two forms of the disease: infantile form (2-6 months onset) more severe and adult form less severe. It is a degenerative disorder that affects the nervous system characterized by a muscle stiffness, blindness, deafness, and eventually death. The incidence is 1/100,000-1/250,000 and the prevalence is 1/100,000.600,25
GALTGalactosemiaNM_000155.3NM_000155.3:c.18delC, NM_000155.3:c.41delCinsTT, NM_000155.3:c.71_72insA, NM_000155.3:c.113A>C, NM_000155.3:c.118G>T, NM_000155.3:c.130G>A, NM_000155.3:c.132delG, NM_000155.3:c.152G>A, NM_000155.3:c.158G>A, NM_000155.3:c.199C>T, NM_000155.3:c.203A>C, NM_000155.3:c.220_221delCT, NM_000155.3:c.221T>C, NM_000155.3:c.253-2A>G, NM_000155.3:c.265T>G, NM_000155.3:c.289_291delAAC, NM_000155.3:c.290A>G, NM_000155.3:c.292G>A, NM_000155.3:c.329-2A>C, NM_000155.3:c.367C>T, NM_000155.3:c.386T>C, NM_000155.3:c.400delT, NM_000155.3:c.404C>T, NM_000155.3:c.413C>T, NM_000155.3:c.425T>A, NM_000155.3:c.428C>T, NM_000155.3:c.445dupG, NM_000155.3:c.442C>T, NM_000155.3:c.443G>A, NM_000155.3:c.502_504delGTG, NM_000155.3:c.505C>A, NM_000155.3:c.508-1G>C, NM_000155.3:c.512T>C, NM_000155.3:c.547C>A, NM_000155.3:c.552C>A, NM_000155.3:c.563A>G, NM_000155.3:c.565_578delGTATGGGCCAGCAG, NM_000155.3:c.568T>C, NM_000155.3:c.580T>C, NM_000155.3:c.584T>C, NM_000155.3:c.598delC, NM_000155.3:c.601C>T, NM_000155.3:c.602G>A, NM_000155.3:c.607G>A, NM_000155.3:c.610C>T, NM_000155.3:c.619C>T, NM_000155.3:c.626A>G, NM_000155.3:c.634C>T, NM_000155.3:c.688-2A>C, NM_000155.3:c.692G>A, NM_000155.3:c.719_728delTAGTACTGGT, NM_000155.3:c.772C>T, NM_000155.3:c.775C>T, NM_000155.3:c.790delC, NM_000155.3:c.790_792delCTAinsTAG, NM_000155.3:c.820+13A>G, NM_000155.3:c.844C>G, NM_000155.3:c.855G>T, NM_000155.3:c.904+1G>T, NM_000155.3:c.905-2A>G, NM_000155.3:c.939G>A, NM_000155.3:c.947G>A, NM_000155.3:c.957C>A, NM_000155.3:c.985T>C, NM_000155.3:c.997C>G, NM_000155.3:c.997C>T, NM_000155.3:c.998G>A, NM_000155.3:c.1006A>T, NM_000155.3:c.1030C>A, NM_000155.3:c.1048delA, NM_000155.3:c.1052delC, NM_000155.3:c.1138T>CGalactosemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALT gene located on chromosomal region 9p13.3. The age of onset is neonatal. This disease is characterized by feeding difficulties, lethargy, and severe liver disease. Long-term complications appear including cognitive impairments, motor deficits, and ovarian dysfunction with reduced fertility in women and diminished bone density. The prevalence is 1/40,000-1/60,000.600,25
GANGiant axonal neuropathy, type 1NM_022041.3NM_022041.3:c.413G>A, NM_022041.3:c.505G>A, NM_022041.3:c.601C>T, NM_022041.3:c.1268T>C, NM_022041.3:c.1429C>T, NM_022041.3:c.1447C>T, NM_022041.3:c.1456G>AGiant axonal neuropathy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAN gene located on chromosomal region 16q23.2. The age of onset is infantile. This disease is characterized by a progressive motor and sensitive peripheral and central nervous system neuropathy. Twenty families have been reported with this disease but the frequency is likely to be under-estimated.600,25
GBAGaucher diseaseNM_000157.3NM_000157.3:c.1604G>A, NM_000157.3:c.1504C>T, NM_000157.3:c.1448T>G, NM_000157.3:c.1448T>C, NM_000157.3:c.1361C>G, NM_000157.3:c.1348T>A, NM_000157.3:c.1343A>T, NM_000157.3:c.1342G>C, NM_000157.3:c.1319C>T, NM_000157.3:c.1309G>T, NM_000157.3:c.1307T>C, NM_000157.3:c.1301G>C, NM_000157.3:c.1297G>T, NM_000157.3:c.1295G>T, NM_000157.3:c.1274dupA, NM_000157.3:c.1246G>A, NM_000157.3:c.1240G>T, NM_000157.3:c.1240G>C, NM_000157.3:c.1228C>G, NM_000157.3:c.1226A>G, NM_000157.3:c.1208G>C, NM_000157.3:c.1192C>T, NM_000157.3:c.1184C>T, NM_000157.3:c.1174C>G, NM_000157.3:c.1171G>C, NM_000157.3:c.1141T>G, NM_000157.3:c.1098dupA, NM_000157.3:c.1090G>A, NM_000157.3:c.1085C>T, NM_000157.3:c.1060G>C, NM_000157.3:c.1053G>T, NM_000157.3:c.1049A>G, NM_000157.3:c.1043C>T, NM_000157.3:c.914delC, NM_000157.3:c.586A>C, NM_000157.3:c.509G>T, NM_000157.3:c.508C>T, NM_000157.3:c.487delG, NM_000157.3:c.481C>T, NM_000157.3:c.476G>A, NM_000157.3:c.475C>T, NM_000157.3:c.431T>G, NM_000157.3:c.407C>A, NM_000157.3:c.354G>C, NM_000157.3:c.259C>T, NM_000157.3:c.254G>A, NM_000157.3:c.160G>T, NM_000157.3:c.115+1G>A, NM_000157.3:c.84dupGGaucher disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBA gene located on chromosomal region 1q22. Gaucher disease encompasses a continuum of clinical findings from a perinatal lethal disorder to an asymptomatic type. There are three major clinical types (1, 2, and 3) and two other subtypes (perinatal-lethal and cardiovascular). Type 1 is characterized by the presence of clinical or radiographic evidence of bone disease, hepatosplenomegaly, anemia and thrombocytopenia, lung disease, and the absence of primary central nervous system disease. GD types 2 and 3 are characterized by the presence of primary neurologic disease. Type 2 has an onset before age two years, limited psychomotor development, and a rapidly progressive course with death by age two to four years. Type 3 may have onset before age two years, but often have a more slowly progressive course, with survival into the third or fourth decade. The perinatal-lethal form is associated with ichthyosiform or collodion skin abnormalities or with nonimmune hydrops fetalis. The cardiovascular form is characterized by calcification of the aortic and mitral valves, mild splenomegaly, corneal opacities, and supranuclear ophthalmoplegia. Cardiopulmonary complications have been described with all the clinical subtypes, although varying in frequency and severity. The incidence is 1/60,000 and the prevalence is approximately 1/100,000.600,25
GBE1Glycogen storage disease, type 4NM_000158.3NM_000158.3:c.2052+1G>A, NM_000158.3:c.1883A>G, NM_000158.3:c.1774G>T, NM_000158.3:c.1604A>G, NM_000158.3:c.1571G>A, NM_000158.3:c.1570C>T, NM_000158.3:c.1543C>T, NM_000158.3:c.986A>C, NM_000158.3:c.771T>A, NM_000158.3:c.466_470delCGTATGlycogen storage disease, type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is infantile. This disease is characterized by failure to thrive; hepatomegaly, liver dysfunction, and progressive liver cirrhosis; hypotonia; cardiomyopathy and, finally, death.600,25
GCDHGlutaricaciduria, type 1NM_000159.3NM_000159.3:c.74C>A, NM_000159.3:c.271+1G>A, NM_000159.3:c.383G>A, NM_000159.3:c.416C>T, NM_000159.3:c.542A>G, NM_000159.3:c.572T>C, NM_000159.3:c.636-1G>A, NM_000159.3:c.680G>C, NM_000159.3:c.743C>T, NM_000159.3:c.751C>T, NM_000159.3:c.764C>T, NM_000159.3:c.769C>T, NM_000159.3:c.877G>A, NM_000159.3:c.883T>C, NM_000159.3:c.914C>T, NM_000159.3:c.1002_1003delGA, NM_000159.3:c.1060G>A, NM_000159.3:c.1093G>A, NM_000159.3:c.1168G>C, NM_000159.3:c.1198G>A, NM_000159.3:c.1199dupT, NM_000159.3:c.1204C>T, NM_000159.3:c.1244-2A>C, NM_000159.3:c.1247C>T, NM_000159.3:c.1262C>TGlutaricaciduria, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCDH gene located on chromosomal region 19p13.2. The age of onset is infantile or neonatal. This disease is characterized by encephalopathic crises resulting in striatal injury and a severe dystonic dyskinetic movement disorder. The prevalence is 1 in 100,000 births.600,25
GJB2Deafness, autosomal recessive, type 1ANM_004004.5NM_004004.5:c.617A>G, NM_004004.5:c.551G>C, NM_004004.5:c.550C>T, NM_004004.5:c.516G>A, NM_004004.5:c.465T>A, NM_004004.5:c.439G>A, NM_004004.5:c.427C>T, NM_004004.5:c.416G>A, NM_004004.5:c.402delG, NM_004004.5:c.365A>T, NM_004004.5:c.358_360delGAG, NM_004004.5:c.334_335delAA, NM_004004.5:c.313_326delAAGTTCATCAAGGG, NM_004004.5:c.310_323delAGGAAGTTCATCAA, NM_004004.5:c.299_300delAT, NM_004004.5:c.299A>T, NM_004004.5:c.270dupA, NM_004004.5:c.269dupT, NM_004004.5:c.269T>C, NM_004004.5:c.250G>T, NM_004004.5:c.250G>C, NM_004004.5:c.239A>C, NM_004004.5:c.238C>T, NM_004004.5:c.235delC, NM_004004.5:c.231G>A, NM_004004.5:c.230G>A, NM_004004.5:c.229T>C, NM_004004.5:c.169C>T, NM_004004.5:c.139G>T, NM_004004.5:c.132G>A, NM_004004.5:c.35delGAutosomal recessive nonsyndromic sensorineural deafness type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.600,25
GJB6Deafness, autosomal recessive, type 1BNM_001110219.2NM_001110219.2:c.485dupA, NM_001110219.2:c.443delC, NM_001110219.2:c.383_384delTA, NM_001110219.2:c.261dupA, NM_001110219.2:c.169C>T, NM_001110219.2:c.14C>TAutosomal recessive nonsyndromic sensorineural deafness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB6 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment. No other associated medical findings are present.600,25
GLB1GM1-gangliosidosis, type 1NM_001317040.1NM_001317040.1:c.1877A>G, NM_001317040.1:c.1790C>T, NM_001317040.1:c.1721dupG, NM_001317040.1:c.1693G>T, NM_001317040.1:c.1600_1610dupGGTGCATATAT, NM_001317040.1:c.1589G>A, NM_001317040.1:c.1514G>A, NM_001317040.1:c.1513C>T, NM_001317040.1:c.1499dupA, NM_001317040.1:c.1469G>A, NM_001317040.1:c.1465G>A, NM_001317040.1:c.1457G>A, NM_001317040.1:c.1318_1319delCT, NM_001317040.1:c.1212+1G>T, NM_001317040.1:c.1195C>T, NM_001317040.1:c.1148C>T, NM_001317040.1:c.1091A>G, NM_001317040.1:c.1045G>A, NM_001317040.1:c.962G>T, NM_001317040.1:c.766C>T, NM_001317040.1:c.746G>A, NM_001317040.1:c.745C>T, NM_001317040.1:c.735dupT, NM_001317040.1:c.601+2T>C, NM_001317040.1:c.586C>T, NM_001317040.1:c.586C>A, NM_001317040.1:c.582_584delTCT, NM_001317040.1:c.420G>A, NM_001317040.1:c.346C>T, NM_001317040.1:c.320G>A, NM_001317040.1:c.319C>T, NM_001317040.1:c.315C>G, NM_001317040.1:c.296T>C, NM_001317040.1:c.289C>TGangliosidosis GM1, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. Although the three types differ in severity, their features can overlap significantly. The age of onset in type 1 is infantile, in type 2 is late-infantile or juvenile and adult in type3. This disease is characterized by arrest/regression of neurological development, hypotonia, visceromegaly, macular cherry-red spots, dysostosis and coarse facial features. The prevalence is 1:100,000 a 200,000 newborn.600,25
GLDCGlycine encephalopathyNM_000170.2NM_000170.2:c.2405C>T, NM_000170.2:c.2284G>A, NM_000170.2:c.2216G>A, NM_000170.2:c.1691G>T, NM_000170.2:c.1545G>C, NM_000170.2:c.1166C>T, NM_000170.2:c.322G>TGlycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in GLDC gene located on chromosomal region 9p24.1. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000.600,25
GLE1Lethal congenital contracture syndrome, type 1NM_001003722.1NM_001003722.1:c.898-2A>G, NM_001003722.1:c.1412_1413delAG, NM_001003722.1:c.2051T>C, NM_001003722.1:c.2069_2072delTTCTLethal congenital contracture syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLE1 gene located on chromosomal region 9q34.11. The age of onset is neonatal. This disease is characterized by total fetal akinesia (detectable since the 13th week of gestation) accompanied by hydrops, micrognathia, pulmonary hypoplasia, pterygia and multiple joint contractures (usually flexion contractures in the elbows and extension in the knees), leading invariably to death before the 32nd week of gestation. Lack of anterior horn motoneurons, severe atrophy of the ventral spinal cord and severe skeletal muscle hypoplasia are characteristic neuropathological findings, with no evidence of other organ structural anomalies.600,25
GNEInclusion body myopathy, type 2 (Nonaka myopathy)NM_001128227.2NM_001128227.2:c.2228T>C, NM_001128227.2:c.2179G>A, NM_001128227.2:c.1937C>G, NM_001128227.2:c.1891G>A, NM_001128227.2:c.1820G>A, NM_001128227.2:c.1002T>A, NM_001128227.2:c.880C>T, NM_001128227.2:c.830G>A, NM_001128227.2:c.478C>TInclusion body myopathy, type 2 (Nonaka myopathy) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNE gene located on chromosomal region 9p13.3. The age of onset is adult. This disease is characterized by progressive muscle weakness and joint deformity. The prevalence is 1:500-1:1,000.600,25
GNPTABMucolipidosis 2 alpha/betaNM_024312.4NM_024312.4:c.3663delG, NM_024312.4:c.3565C>T, NM_024312.4:c.3560_3561delAG, NM_024312.4:c.3503_3504delTC, NM_024312.4:c.3410T>A, NM_024312.4:c.3326dupA, NM_024312.4:c.3173C>G, NM_024312.4:c.2896delA, NM_024312.4:c.2383delG, NM_024312.4:c.1906dupA, NM_024312.4:c.1759C>T, NM_024312.4:c.1196C>T, NM_024312.4:c.1000C>T, NM_024312.4:c.749dupA, NM_024312.4:c.732_733delAA, NM_024312.4:c.648_651delAGAA, NM_024312.4:c.616_619delACAG, NM_024312.4:c.99delC, NM_024312.4:c.25C>T, NM_024312.4:c.10A>CMucolipidosis type 2 alpha/beta follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNPTAB gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by growth retardation, short stature, skeletal abnormalities, facial dysmorphism, stiff skin, developmental delay and cardiomegaly and that is lethal in childhood. The prevalence is 1:123,500-1:625,500.600,25
GPR179Night blindness, congenital stationary (complete), type 1E, autosomal recessiveNM_001004334.3NM_001004334.3:c.6847_6848delCT, NM_001004334.3:c.5763_5764delGA, NM_001004334.3:c.5693dupT, NM_001004334.3:c.4699_4700delAG, NM_001004334.3:c.3233_3234delCT, NM_001004334.3:c.1807C>T, NM_001004334.3:c.1784+1G>A, NM_001004334.3:c.1368delT, NM_001004334.3:c.1236G>A, NM_001004334.3:c.984delC, NM_001004334.3:c.839_842delATCA, NM_001004334.3:c.278dupC, NM_001004334.3:c.278delCCongenital stationary night blindness type 1E follow an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR179 gene located on chromosomal region 17q12. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity.600,25
GRM6Night blindness, congenital stationary (complete), type 1B, autosomal recessiveNM_000843.3NM_000843.3:c.2560C>T, NM_000843.3:c.2341G>A, NM_000843.3:c.2213_2219delCCAGAGG, NM_000843.3:c.2122C>T, NM_000843.3:c.1861C>T, NM_000843.3:c.1565G>A, NM_000843.3:c.1336C>T, NM_000843.3:c.1258C>T, NM_000843.3:c.1214T>C, NM_000843.3:c.727dupG, NM_000843.3:c.719_720insG, NM_000843.3:c.712C>TCongenital stationary night blindness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRM6 gene located on chromosomal region 5q35.3. The age of onset is early infancy. This disease is characterized by hemeralopia with a moderate loss of visual acuity.600,25
GUSBMucopolysaccharidosis, type 7NM_000181.3NM_000181.3:c.1881G>T, NM_000181.3:c.1856C>T, NM_000181.3:c.1831C>T, NM_000181.3:c.1730G>T, NM_000181.3:c.1618G>T, NM_000181.3:c.1534G>A, NM_000181.3:c.1521G>A, NM_000181.3:c.1429C>T, NM_000181.3:c.1338G>A, NM_000181.3:c.1337G>A, NM_000181.3:c.1244+1G>A, NM_000181.3:c.1219_1220insC, NM_000181.3:c.1144C>T, NM_000181.3:c.1084G>A, NM_000181.3:c.1065+1G>T, NM_000181.3:c.1061C>T, NM_000181.3:c.1050G>C, NM_000181.3:c.866G>A, NM_000181.3:c.820_821delAC, NM_000181.3:c.646C>T, NM_000181.3:c.526C>T, NM_000181.3:c.499C>T, NM_000181.3:c.442C>TMucopolysaccharidosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUSB gene located on chromosomal region 7q11.21. The age of onset is variable. There are prenatal forms with non-immune hydrops fetalis, and severe neonatal forms with dysmorphism, hernias, hepatosplenomegaly, club feet, dysostosis, severe hypotonia and neurological disorders that ultimately lead to profound intellectual deficit and small stature in patients that survive. Finally, there are also very mild cases that are discovered during adolescence or adulthood following presentation with thoracic kyphosis. The prevalence is 1:250,000 in newborn.600,25
HADHALCHAD deficiencyNM_000182.4NM_000182.4:c.2146+1G>A, NM_000182.4:c.2132dupC, NM_000182.4:c.1918C>T, NM_000182.4:c.1793_1794delAT, NM_000182.4:c.1678C>T, NM_000182.4:c.1644delC, NM_000182.4:c.1620+2_1620+6delTAAGG, NM_000182.4:c.1528G>C, NM_000182.4:c.1422dupT, NM_000182.4:c.1132C>T, NM_000182.4:c.919-2A>G, NM_000182.4:c.845T>A, NM_000182.4:c.499delA, NM_000182.4:c.274_278delTCATCIsolated deficiency of long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD deficiency) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA gene located on chromosomal region 2p23.3. This disease is characterized in infancy/early childhood of hypoketotic hypoglycemia, metabolic acidosis, liver disease, hypotonia and, frequently, cardiac involvement with arrhythmias and/or cardiomyopathy. The prevalence is 1/250,000.600,25
HBBHBB-related hemoglobinopathyNM_000518.4NM_000518.4:c.*110T>C, NM_000518.4:c.440_441dupAC, NM_000518.4:c.440A>T, NM_000518.4:c.440A>C, NM_000518.4:c.439C>G, NM_000518.4:c.438T>A, NM_000518.4:c.437A>G, NM_000518.4:c.436T>C, NM_000518.4:c.435G>C, NM_000518.4:c.431A>C, NM_000518.4:c.428C>A, NM_000518.4:c.421G>A, NM_000518.4:c.383A>C, NM_000518.4:c.371_378delCCCCACCA, NM_000518.4:c.364G>T, NM_000518.4:c.364G>A, NM_000518.4:c.347C>A, NM_000518.4:c.344T>C, NM_000518.4:c.343_344delCTinsG, NM_000518.4:c.341T>A, NM_000518.4:c.332T>C, NM_000518.4:c.328delG, NM_000518.4:c.328G>A, NM_000518.4:c.323dupG, NM_000518.4:c.320T>G, NM_000518.4:c.316-1G>T, NM_000518.4:c.316-1G>A, NM_000518.4:c.316-2A>G, NM_000518.4:c.316-2A>C, NM_000518.4:c.316-3C>A, NM_000518.4:c.316-106C>G, NM_000518.4:c.316-146T>G, NM_000518.4:c.316-197C>T, NM_000518.4:c.315+2T>G, NM_000518.4:c.315+1G>C, NM_000518.4:c.315+1G>A, NM_000518.4:c.312C>G, NM_000518.4:c.306G>C, NM_000518.4:c.305A>G, NM_000518.4:c.304G>A, NM_000518.4:c.302C>T, NM_000518.4:c.299A>T, NM_000518.4:c.299A>G, NM_000518.4:c.299A>C, NM_000518.4:c.298G>T, NM_000518.4:c.298G>C, NM_000518.4:c.298G>A, NM_000518.4:c.295G>A, NM_000518.4:c.293A>T, NM_000518.4:c.287dupA, NM_000518.4:c.282_283dupTG, NM_000518.4:c.283G>C, NM_000518.4:c.277C>T, NM_000518.4:c.277C>A, NM_000518.4:c.275T>C, NM_000518.4:c.271G>T, NM_000518.4:c.269G>A, NM_000518.4:c.268A>C, NM_000518.4:c.257T>C, NM_000518.4:c.251delG, NM_000518.4:c.248A>T, NM_000518.4:c.248A>C, NM_000518.4:c.247A>G, NM_000518.4:c.230delC, NM_000518.4:c.226delC, NM_000518.4:c.217_221delAGTGAinsT, NM_000518.4:c.217dupA, NM_000518.4:c.216dupT, NM_000518.4:c.208G>A, NM_000518.4:c.206T>A, NM_000518.4:c.203_204delTG, NM_000518.4:c.201delA, NM_000518.4:c.199A>G, NM_000518.4:c.194delG, NM_000518.4:c.190C>T, NM_000518.4:c.184A>T, NM_000518.4:c.182T>A, NM_000518.4:c.179A>C, NM_000518.4:c.176C>G, NM_000518.4:c.162delT, NM_000518.4:c.143_146dupATCT, NM_000518.4:c.143dupA, NM_000518.4:c.135delC, NM_000518.4:c.134C>G, NM_000518.4:c.130G>T, NM_000518.4:c.126_129delCTTT, NM_000518.4:c.128T>C, NM_000518.4:c.127T>G, NM_000518.4:c.127T>C, NM_000518.4:c.114_120delGACCCAG, NM_000518.4:c.117_118delCC, NM_000518.4:c.118C>T, NM_000518.4:c.114G>A, NM_000518.4:c.113G>A, NM_000518.4:c.112delT, NM_000518.4:c.110delC, NM_000518.4:c.108C>A, NM_000518.4:c.103G>T, NM_000518.4:c.93G>T, NM_000518.4:c.93-1G>C, NM_000518.4:c.93-1G>A, NM_000518.4:c.93-2A>C, NM_000518.4:c.93-21G>A, NM_000518.4:c.92+6T>C, NM_000518.4:c.92+5G>T, NM_000518.4:c.92+5G>C, NM_000518.4:c.92+5G>A, NM_000518.4:c.92+2T>C, NM_000518.4:c.92+2T>A, NM_000518.4:c.92+1G>T, NM_000518.4:c.92+1G>A, NM_000518.4:c.92G>C, NM_000518.4:c.92G>A, NM_000518.4:c.91A>C, NM_000518.4:c.90C>T, NM_000518.4:c.86T>A, NM_000518.4:c.85dupC, NM_000518.4:c.82G>T, NM_000518.4:c.80A>G, NM_000518.4:c.79_80insT, NM_000518.4:c.79G>T, NM_000518.4:c.79G>A, NM_000518.4:c.75T>A, NM_000518.4:c.68_74delAAGTTGG, NM_000518.4:c.64dupG, NM_000518.4:c.59A>G, NM_000518.4:c.52A>T, NM_000518.4:c.51delC, NM_000518.4:c.48G>A, NM_000518.4:c.47G>A, NM_000518.4:c.46delT, NM_000518.4:c.45dupG, NM_000518.4:c.36delT, NM_000518.4:c.27dupG, NM_000518.4:c.25_26delAA, NM_000518.4:c.20delA, NM_000518.4:c.20A>T, NM_000518.4:c.19G>A, NM_000518.4:c.17_18delCT, NM_000518.4:c.8A>C, NM_000518.4:c.4delG, NM_000518.4:c.4G>T, NM_000518.4:c.3G>A, NM_000518.4:c.2T>G, NM_000518.4:c.2T>C, NM_000518.4:c.2T>A, NM_000518.4:c.1A>G, NM_000518.4:c.-50A>C, NM_000518.4:c.-75G>C, NM_000518.4:c.-78A>G, NM_000518.4:c.-78A>C, NM_000518.4:c.-79A>G, NM_000518.4:c.-80T>A, NM_000518.4:c.-137C>G, NM_000518.4:c.-137C>A, NM_000518.4:c.-138C>T, NM_000518.4:c.-151C>TDNA variations in the HBB gene result in the production of different versions of beta-globin. Some of these variations may affect a person's health while other variations cause no noticeable signs or symptoms. Two of the most common HBB-related conditions are beta-thalassemia and sickle cell anemia (SCA). Beta thalassemia is caused by HBB gene mutations that prevent or decrease beta-globin production, subunits that make up hemoglobin. A lack of hemoglobin disrupts the normal development of red blood cells. A shortage of mature red blood cells can reduce the amount of oxygen that is delivered to tissues to below what is needed to satisfy the body's energy needs. A lack of oxygen in the body's tissues can lead to poor growth, organ damage, and other health problems associated with beta thalassemia. SCA is a multisystem disease associated with episodes of acute illness and progressive organ damage. SCA-associated mutations cause red blood cells assuming an abnormal, rigid, sickle shape promoting cell break down prematurely, which can lead to anemia. Anemia can cause shortness of breath, fatigue, and delayed growth and development in children.600,25
HESX1Growth hormone deficiency with pituitary anomaliesNM_003865.2NM_003865.2:c.450_451delCA, NM_003865.2:c.445G>A, NM_003865.2:c.77T>C, NM_003865.2:c.18G>CGrowth hormone deficiency with pituitary anomalies follows an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the HESX1 gene located on chromosomal region 3p14.3. The age of onset is infantile. These diseases are characterized by short stature, cognitive alterations or delayed puberty. The incidence is 1:3,000 and 1:4,000 births.600,25
HEXATay-Sachs diseaseNM_000520.5NM_000520.5:c.254-1G>CTay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births.600,25
HEXATay-Sachs diseaseNM_001318825.1NM_001318825.1:c.1570C>T, NM_001318825.1:c.1561C>T, NM_001318825.1:c.1544G>A, NM_001318825.1:c.1543delC, NM_001318825.1:c.1543C>T, NM_001318825.1:c.1532delT, NM_001318825.1:c.1529G>A, NM_001318825.1:c.1528C>T, NM_001318825.1:c.1477G>A, NM_001318825.1:c.1455G>C, NM_001318825.1:c.1311_1312insTATC, NM_001318825.1:c.1307_1310dupTATC, NM_001318825.1:c.1293G>C, NM_001318825.1:c.1247_1248delAAinsG, NM_001318825.1:c.1210C>T, NM_001318825.1:c.1209G>A, NM_001318825.1:c.1020G>A, NM_001318825.1:c.1019+3A>G, NM_001318825.1:c.948_950delCTT, NM_001318825.1:c.838+1G>C, NM_001318825.1:c.838+1G>A, NM_001318825.1:c.838G>A, NM_001318825.1:c.805G>C, NM_001318825.1:c.782G>A, NM_001318825.1:c.705+1G>A, NM_001318825.1:c.665T>C, NM_001318825.1:c.662C>T, NM_001318825.1:c.573C>G, NM_001318825.1:c.571T>C, NM_001318825.1:c.566G>T, NM_001318825.1:c.566G>A, NM_001318825.1:c.565C>T, NM_001318825.1:c.542G>A, NM_001318825.1:c.541C>T, NM_001318825.1:c.492+5G>A, NM_001318825.1:c.413T>G, NM_001318825.1:c.173G>A, NM_001318825.1:c.116T>G, NM_001318825.1:c.78G>A, NM_001318825.1:c.77G>A, NM_001318825.1:c.2T>C, NM_001318825.1:c.1A>T, NM_001318825.1:c.1A>GTay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births.600,25
HEXBSandhoff disease, infantile, juvenile, and adult formsNM_000521.3NM_000521.3:c.115delG, NM_000521.3:c.171delG, NM_000521.3:c.202_203insGG, NM_000521.3:c.298delC, NM_000521.3:c.508C>T, NM_000521.3:c.797A>G, NM_000521.3:c.841C>T, NM_000521.3:c.850C>T, NM_000521.3:c.1238_1242delCAAAG, NM_000521.3:c.1250C>T, NM_000521.3:c.1310_1311delCA, NM_000521.3:c.1345delT, NM_000521.3:c.1375G>T, NM_000521.3:c.1380G>A, NM_000521.3:c.1517_1529dupCAAGTGCTGTTGG, NM_000521.3:c.1539_1540delCTSandhoff disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXB gene located on chromosomal region 5q13.3. The age of onset is adult or infantile. This disease is characterized by central nervous system degeneration, with startle reactions, early blindness, progressive motor and mental deterioration, macrocephaly and cherry-red spots on the macula. The prevalence is 1/130.000.600,25
HGDAlkaptonuriaNM_000187.3NM_000187.3:c.1189-2A>G, NM_000187.3:c.1111dupC, NM_000187.3:c.1102A>G, NM_000187.3:c.899T>G, NM_000187.3:c.808G>A, NM_000187.3:c.688C>T, NM_000187.3:c.674G>A, NM_000187.3:c.481G>A, NM_000187.3:c.469+2T>C, NM_000187.3:c.342+1G>A, NM_000187.3:c.175delA, NM_000187.3:c.172A>T, NM_000187.3:c.140C>T, NM_000187.3:c.16-1G>AAlkaptonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGD gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by darkening of the urine when it is left exposed to air, grey-blue colouration of the eye sclerae and the ear helix (ochronosis), and a disabling joint disease involving both the axial and peripheral joints (ochronotic arthropathy). The prevalence is 1:250,000-1:1.000.000 newborn.600,25
HGSNATMucopolysaccharidosis type 3C (Sanfilippo C)NM_152419.2NM_152419.2:c.493+1G>A, NM_152419.2:c.607C>T, NM_152419.2:c.848C>T, NM_152419.2:c.1030C>T, NM_152419.2:c.1250+1G>A, NM_152419.2:c.1378-1G>A, NM_152419.2:c.1464+1G>A, NM_152419.2:c.1503delA, NM_152419.2:c.1553C>T, NM_152419.2:c.1622C>TMucopolysaccharidosis type 3C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGSNAT gene located on chromosomal region 8p11.21. The age of onset is infantile. This disease is characterized by defective or missing enzymes to break down mucopolysaccharides are missing or are defective. The prevalence is <1:70.000 newborn.600,25
HPDTyrosinemia, type 3NM_002150.2NM_002150.2:c.987delA, NM_002150.2:c.774T>G, NM_002150.2:c.600C>GTyrosinemia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPD gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by intellectual deficit and ataxia. The prevalence is 1:100,000-1:120,000 newborn.600,25
IGHMBP2Charcot-Marie-Tooth disease, axonal, type 2SNM_002180.2NM_002180.2:c.121C>T, NM_002180.2:c.638A>G, NM_002180.2:c.661delA, NM_002180.2:c.1107C>G, NM_002180.2:c.1488C>A, NM_002180.2:c.1540G>A, NM_002180.2:c.1738G>A, NM_002180.2:c.2362C>T, NM_002180.2:c.2611+1G>TCharcot-Marie-Tooth disease, axonal, type 2S follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGHMBP2 gene located on chromosomal region 11q13.3. The age of onset can be infancy, childhood, adult or adolescent. This disease is characterized by progressive distal muscle weakness and atrophy of both the lower and upper limbs, absent or reduced deep tendon reflexes, mild sensory loss, foot drop, and pes cavus leading eventually to wheelchair dependence. Some patients present with early hypotonia and delayed motor development. Scoliosis and variable autonomic disturbances may be associated. The prevalence is below 1/1,000,000.600,25
INPP5EJoubert syndrome, type 1NM_019892.5NM_019892.5:c.1879C>T, NM_019892.5:c.1688G>A, NM_019892.5:c.1543C>T, NM_019892.5:c.1304G>A, NM_019892.5:c.1132C>T, NM_019892.5:c.855_856insCGJoubert syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:100,000.600,25
INSRDiabetes mellitus, insulin-resistant, with acanthosis nigricans, type ANM_000208.3NM_000208.3:c.3680G>C, NM_000208.3:c.3079C>T, NM_000208.3:c.2668C>T, NM_000208.3:c.1114C>T, NM_000208.3:c.172G>ADiabetes mellitus, insulin-resistant, with acanthosis nigricans type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by the triad of hyperinsulinemia, acanthosis nigricans (skin lesions associated with insulin resistance), and signs of hyperandrogenism in females without lipodystrophy and who are not overweight. It is generally diagnosed in young women with marked signs of hyperandrogenism, but insulin resistance and acanthosis nigricans may be observed in men and in childhood. Acromegaloid facies or muscular cramps are sometimes associated. Hyperinsulinemia, a biological marker for insulin resistance, is often associated with glucose tolerance defects over the course of the disease, and diabetes progressively sets in. Hyperandrogenism (associated with polycystic ovarian syndrome (see this term) or ovarian hyperthecoses) leads to fertility problems. The prevalence is <1:1,000,000.600,25
ITGB4Epidermolysis bullosa, junctional, with pyloric atresiaNM_000213.4NM_000213.4:c.112T>C, NM_000213.4:c.182G>A, NM_000213.4:c.1150delG, NM_000213.4:c.1660C>T, NM_000213.4:c.1684T>C, NM_000213.4:c.2608delC, NM_000213.4:c.2792G>A, NM_000213.4:c.3321_3331delACTGGACCGGA, NM_000213.4:c.3674G>A, NM_000213.4:c.3793+1G>A, NM_000213.4:c.3801dupT, NM_000213.4:c.3841C>T, NM_000213.4:c.4620delG, NM_000213.4:c.4643G>A, NM_000213.4:c.4828C>T, NM_000213.4:c.5329+2T>CJunctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGB4 gene located on chromosomal region 17q25.1. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. More than 100 cases have been reported around the world.600,25
IVDIsovaleric acidemiaNM_002225.3NM_002225.3:c.2T>G, NM_002225.3:c.134T>C, NM_002225.3:c.157C>T, NM_002225.3:c.158G>A, NM_002225.3:c.158G>C, NM_002225.3:c.243+1G>A, NM_002225.3:c.367G>A, NM_002225.3:c.390delT, NM_002225.3:c.406_407delTG, NM_002225.3:c.434_437dupATGA, NM_002225.3:c.465+2T>C, NM_002225.3:c.478_479insGT, NM_002225.3:c.507delG, NM_002225.3:c.559+1G>A, NM_002225.3:c.593G>A, NM_002225.3:c.605G>T, NM_002225.3:c.627delT, NM_002225.3:c.793+1G>A, NM_002225.3:c.941C>T, NM_002225.3:c.994_995delAT, NM_002225.3:c.1141T>C, NM_002225.3:c.1145_1147+4delTTGGTGA, NM_002225.3:c.1183C>T, NM_002225.3:c.1188delT, NM_002225.3:c.1192C>T, NM_002225.3:c.1208A>GIsovaleric academia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IVD gene located on chromosomal region 15q15.1. The age of onset is neonatal. This disease is characterized by vomiting, dehydration, coma and abnormal movements. The prevalence is 1/100,000.600,25
JAK3Severe Combined Immunodeficiency, autosomal recessive, T-negative/B-positive typeNM_000215.3NM_000215.3:c.1837C>T, NM_000215.3:c.1765G>A, NM_000215.3:c.1695C>A, NM_000215.3:c.1333C>T, NM_000215.3:c.1172_1173insG, NM_000215.3:c.299A>GSevere combined immunodeficiency, T-B+ type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the JAK3 gene located on chromosomal region 19p13.11. The age of onset is infantile. This disease is characterized by chronic diarrhea, failure to thrive, recurrent respiratory infections and/or generalized infections due to opportunistic pathogens. The incidence is 1/100,000 and 1/1,000,000.600,25
KCNJ1Bartter syndrome, type 2NM_000220.4NM_000220.4:c.1014delA, NM_000220.4:c.1012C>T, NM_000220.4:c.996_999delAAAG, NM_000220.4:c.942T>G, NM_000220.4:c.657C>G, NM_000220.4:c.641C>T, NM_000220.4:c.592G>A, NM_000220.4:c.500G>A, NM_000220.4:c.372T>A, NM_000220.4:c.322G>C, NM_000220.4:c.237C>GBartter syndrome, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ1 gene located on chromosomal region 11q24.3. The age of onset is antenatal. This disease is characterized by severe polyhydramnios in mother leading to premature delivery, postnatally newborns suffer from recurrent episodes of severe dehydration and electrolyte imbalance which can lead to fatal outcome.600,25
KCNV2Retinal cone dystrophy, type 3BNM_133497.3NM_133497.3:c.226C>T, NM_133497.3:c.325C>T, NM_133497.3:c.357dupC, NM_133497.3:c.427G>T, NM_133497.3:c.442G>T, NM_133497.3:c.491T>C, NM_133497.3:c.767C>G, NM_133497.3:c.778A>T, NM_133497.3:c.916G>T, NM_133497.3:c.1016_1024delACCTGGTGG, NM_133497.3:c.1133dupT, NM_133497.3:c.1376G>ARetinal cone dystrophy, type 3B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNV2 gene located on 9p24.2. The age of onset is in the first or second decade of life. This disease is characterized by is characterized by onset in the first or second decade of life of very marked photophobia, myopia, reduced color vision along the red-green axis with relatively preserved tritan discrimination, and central scotomata with peripheral widespread sensitivity loss predominating in the superior visual field. Nyctalopia is a later feature of the disorder. There is often retinal pigment epithelium disturbance at the macula with a normal retinal periphery.600,25
LAMA2LAMA2-related muscular dystrophyNM_000426.3NM_000426.3:c.112+1G>A, NM_000426.3:c.184G>T, NM_000426.3:c.825delC, NM_000426.3:c.1050delT, NM_000426.3:c.1612C>T, NM_000426.3:c.2049_2050delAG, NM_000426.3:c.2098_2099delTT, NM_000426.3:c.2323-2A>T, NM_000426.3:c.2451-2A>G, NM_000426.3:c.2750-1G>C, NM_000426.3:c.2901C>A, NM_000426.3:c.2962C>T, NM_000426.3:c.3215delG, NM_000426.3:c.3237C>A, NM_000426.3:c.3630delT, NM_000426.3:c.3718C>T, NM_000426.3:c.3976C>T, NM_000426.3:c.4645C>T, NM_000426.3:c.5050G>T, NM_000426.3:c.5227G>T, NM_000426.3:c.6011delA, NM_000426.3:c.6038delT, NM_000426.3:c.6334A>T, NM_000426.3:c.6429+1G>A, NM_000426.3:c.6617delT, NM_000426.3:c.6955C>T, NM_000426.3:c.7147C>T, NM_000426.3:c.7279_7280delCT, NM_000426.3:c.7536delC, NM_000426.3:c.7732C>T, NM_000426.3:c.7810C>T, NM_000426.3:c.7888C>T, NM_000426.3:c.8314delA, NM_000426.3:c.8705delT, NM_000426.3:c.8748delA, NM_000426.3:c.9101_9104dupAACA, NM_000426.3:c.9221delA, NM_000426.3:c.9253C>TLAMA2-related muscular dystrophy 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMA2 gene located on chromosomal region 6q22.33. LAMA2-related muscular dystrophy is a disorder that causes weakness and atrophy of skeletal muscles. This condition varies in severity, from a severe, early-onset type to a milder, late-onset form. Early-onset LAMA2-related muscular dystrophy is apparent at birth or within the first few months of life, called merosin-deficient congenital muscular dystrophy type 1A (607855). Patients show hypotonia, poor suck and cry, and delayed motor development; most never achieve independent ambulation. Most patients also have periventricular white matter abnormalities on brain imaging, but mental retardation and/or seizures occur only rarely. Symptoms of late-onset LAMA2-related muscular dystrophy become evident later in childhood or adulthood, and are similar to those of a group of muscle disorders classified as autosomal recessive limb-girdle muscular dystrophies, type 23. This group is characterized by slowly progressive proximal muscle weakness primarily affecting the lower limbs and resulting in gait difficulties. Additional features include white matter abnormalities on brain imaging, increased serum creatine kinase, and dystrophic features, with partial LAMA2 deficiency on muscle biopsy. Some patients may have additional neurologic features, including executive deficits, seizures, and peripheral neuropathy. Patients remain ambulatory well into adulthood. The prevalence is 1/30,000. 600,25
LAMB3Junctional epidermolysis bullosa, Herlitz and non-Herlitz typeNM_000228.2NM_000228.2:c.3228+1G>T, NM_000228.2:c.3228+1G>A, NM_000228.2:c.2806C>T, NM_000228.2:c.1903C>T, NM_000228.2:c.1830G>A, NM_000228.2:c.1587_1588delAG, NM_000228.2:c.1438_1442delCCGTG, NM_000228.2:c.1357delT, NM_000228.2:c.904delT, NM_000228.2:c.727C>T, NM_000228.2:c.628+1delG, NM_000228.2:c.628G>A, NM_000228.2:c.565-2A>G, NM_000228.2:c.496C>T, NM_000228.2:c.124C>TJunctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 gene located on chromosomal region 1q32.2. The age of onset is neonatal/infancy. Junctional epidermolysis bullosa (JEB) is a group of genetic conditions that cause the skin to be very fragile and to blister easily. Blisters and skin erosions form in response to minor injury or friction, such as rubbing or scratching. Researchers classify junctional epidermolysis bullosa into two main types based on severity: Herlitz JEB and non-Herlitz JEB. Herlitz type is more severe phenotype characterized by blisters and erosions, localized to the skin and mucous membranes and often results in early death. More than 80 mutations in the LAMB3 gene have been identified in people with Herlitz JEB. Other LAMB3 gene mutations cause the milder form non-Herlitz JEB, disease characterized by generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.600,25
LMNALMNA-related disorders, autosomal recessiveNM_001282626.1NM_001282626.1:c.1818+6C>TLMNA-related disorders, autosomal recessive, are caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22, and include Charcot-Marie-Tooth disease, type 2B1, Emery-Dreifuss muscular dystrophy type 3, mandibuloacral dysplasia, lethal restrictive dermopathy among others. Charcot-Marie-Tooth disease constitutes a clinically and genetically heterogeneous group of hereditary motor and sensory neuropathies. Emery-Dreifuss muscular dystrophy is characterized classically by the triad of weakness of the shoulder and pelvic girdle muscles, contractures of the elbows, neck, and Achilles tendon, and cardiac involvement, most commonly arrhythmias. Mandibuloacral dysplasia is characterized by growth retardation, craniofacial anomalies with mandibular hypoplasia, skeletal abnormalities with progressive osteolysis of the distal phalanges and clavicles, and pigmentary skin changes. Restrictive dermopathy is a rare, lethal genodermatosis characterized by thin, tightly adherent translucent skin with erosions at flexure sites, superficial vessels, typical facial dysmorphism, and generalized joint ankylosis.600,25
LMNALMNA-related disorders, autosomal recessiveNM_170707.3NM_170707.3:c.419T>C, NM_170707.3:c.1072G>A, NM_170707.3:c.1228C>T, NM_170707.3:c.1366A>C, NM_170707.3:c.1411C>T, NM_170707.3:c.1488+1G>A, NM_170707.3:c.1579C>T, NM_170707.3:c.1580G>A, NM_170707.3:c.1583C>A, NM_170707.3:c.1585G>A, NM_170707.3:c.1586C>T, NM_170707.3:c.1626G>CLMNA-related disorders, autosomal recessive, are caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22, and include Charcot-Marie-Tooth disease, type 2B1, Emery-Dreifuss muscular dystrophy type 3, mandibuloacral dysplasia, lethal restrictive dermopathy among others. Charcot-Marie-Tooth disease constitutes a clinically and genetically heterogeneous group of hereditary motor and sensory neuropathies. Emery-Dreifuss muscular dystrophy is characterized classically by the triad of weakness of the shoulder and pelvic girdle muscles, contractures of the elbows, neck, and Achilles tendon, and cardiac involvement, most commonly arrhythmias. Mandibuloacral dysplasia is characterized by growth retardation, craniofacial anomalies with mandibular hypoplasia, skeletal abnormalities with progressive osteolysis of the distal phalanges and clavicles, and pigmentary skin changes. Restrictive dermopathy is a rare, lethal genodermatosis characterized by thin, tightly adherent translucent skin with erosions at flexure sites, superficial vessels, typical facial dysmorphism, and generalized joint ankylosis.600,25
LRP5Osteoporosis-pseudoglioma syndromeNM_002335.3NM_002335.3:c.804_813delGGGGAAGAGG, NM_002335.3:c.1453G>T, NM_002335.3:c.1468delG, NM_002335.3:c.1481G>A, NM_002335.3:c.1708C>T, NM_002335.3:c.1709G>A, NM_002335.3:c.2202G>A, NM_002335.3:c.2254C>G, NM_002335.3:c.2305delG, NM_002335.3:c.2557C>T, NM_002335.3:c.4099G>A, NM_002335.3:c.4651G>AOsteoporosis-pseudoglioma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by congenital or infancy-onset blindness and severe juvenile-onset osteoporosis and spontaneous fractures. The prevalence is 1:2,000,000.600,25
MAN2B1Mannosidosis, alpha-, types I and IINM_000528.3NM_000528.3:c.2686_2687delCTinsG, NM_000528.3:c.2436+2T>C, NM_000528.3:c.2426T>C, NM_000528.3:c.2398G>A, NM_000528.3:c.2368C>T, NM_000528.3:c.2278C>T, NM_000528.3:c.2119C>T, NM_000528.3:c.2013delT, NM_000528.3:c.1929G>A, NM_000528.3:c.1915C>T, NM_000528.3:c.1830+1G>C, NM_000528.3:c.1780C>T, NM_000528.3:c.384G>A, NM_000528.3:c.1A>GAlpha-mannosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAN2B1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by immunodeficiency, facial and skeletal abnormalities, hearing impairment and intellectual disability. The prevalence is 1:1,000,000-9:1,000,000.600,25
MCCC23-Methylcrotonyl-CoA carboxylase type 2, deficiencyNM_022132.4NM_022132.4:c.295G>C, NM_022132.4:c.380C>G, NM_022132.4:c.464G>A, NM_022132.4:c.499T>C, NM_022132.4:c.517dupT, NM_022132.4:c.641delG, NM_022132.4:c.735dupC, NM_022132.4:c.838G>T, NM_022132.4:c.929C>G, NM_022132.4:c.994C>T, NM_022132.4:c.1015G>A, NM_022132.4:c.1065A>T, NM_022132.4:c.1072+1G>A, NM_022132.4:c.1577dupT, NM_022132.4:c.1580G>A3-methylcrotonyl-CoA carboxylase deficiency type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC2 gene located on chromosomal region 5q13.2. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn.600,25
MED25Basel-Vanagait-Smirin-Yosef syndromeNM_030973.3NM_030973.3:c.320delG, NM_030973.3:c.1366C>TBasel-Vanagait-Smirin-Yosef syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MED25 gene located on chromosomal region 19q13.33. The age of onset neonatal/infantile. This syndrome is characterized by eye, brain, cardiac and palatal abnormalities as well as growth retardation, microcephaly and severe intellectual disability.600,25
MEFVFamilial Mediterranean fever, ARNM_000243.2NM_000243.2:c.2282G>A, NM_000243.2:c.2230G>T, NM_000243.2:c.2177T>C, NM_000243.2:c.2084A>G, NM_000243.2:c.2082G>A, NM_000243.2:c.2080A>G, NM_000243.2:c.2076_2078delAAT, NM_000243.2:c.2040G>C, NM_000243.2:c.2040G>A, NM_000243.2:c.1958G>A, NM_000243.2:c.1437C>G, NM_000243.2:c.1141C>T, NM_000243.2:c.656dupG, NM_000243.2:c.501G>C, NM_000243.2:c.163dupAFamilial Mediterranean fever follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MEFV gene located on chromosomal region 16p13.3. The age of onset is infantile or adult (before the age of 30). This disease is characterized by recurrent short episodes of fever and serositis resulting in pain in the abdomen, chest, joints and muscles. The prevalence is 1:10,000-5:10,000.600,25
MERTKRetinitis pigmentosa type 38NM_006343.2NM_006343.2:c.1605-2A>G, NM_006343.2:c.2070_2074delAGGAC, NM_006343.2:c.2189+1G>T, NM_006343.2:c.2211_2214delCTGT, NM_006343.2:c.2323C>T, NM_006343.2:c.2785_2786dupTARetinitis pigmentosa type 38 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MERTK gene located on chromosomal region 2q13. The age of onset is infantile. This disease is characterized by. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness.600,25
MFRPMicrophthalmia, isolated type 5NM_031433.3NM_031433.3:c.1149dupC, NM_031433.3:c.1124+1G>T, NM_031433.3:c.545T>C, NM_031433.3:c.523C>T, NM_031433.3:c.498delCMicrophthalmia, isolated type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFRP gene located on chromosomal region 11q23.3. The age of onset is infantile. This disease is characterized by posterior microphthalmos, retinitis pigmentosa, foveoschisis, and optic disk drusen.600,25
MKKSBardet-Biedl syndrome type 6NM_018848.3NM_018848.3:c.1436C>G, NM_018848.3:c.1225_1226delGG, NM_018848.3:c.830T>C, NM_018848.3:c.353delGBardet-Biedl syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.600,25
MKS1Bardet-Biedl syndrome type 13NM_001321269.1NM_001321269.1:c.1024+1G>A, NM_001321269.1:c.508C>TBardet-Biedl syndrome type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course.600,25
MMACHCMethylmalonic aciduria and homocystinuria, cblC typeNM_015506.2NM_015506.2:c.271dupA, NM_015506.2:c.331C>T, NM_015506.2:c.347T>C, NM_015506.2:c.388_390delTAC, NM_015506.2:c.394C>T, NM_015506.2:c.440G>C, NM_015506.2:c.481C>T, NM_015506.2:c.482G>A, NM_015506.2:c.547_548delGT, NM_015506.2:c.608G>A, NM_015506.2:c.609G>A, NM_015506.2:c.615C>A, NM_015506.2:c.615C>G, NM_015506.2:c.619dupG, NM_015506.2:c.616C>T, NM_015506.2:c.658_660delAAG, NM_015506.2:c.688C>TVitamin B12-responsive methylmalonic acidemia type cbl B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAB gene located on chromosomal region 12q24.31. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000.600,25
MOCS2Molybdenum cofactor deficiency BNM_004531.4NM_004531.4:c.567A>C, NM_004531.4:c.539_540delAA, NM_004531.4:c.502G>A, NM_004531.4:c.377+1G>A, NM_004531.4:c.106_107delAT, NM_004531.4:c.58delT, NM_004531.4:c.3G>AMolybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death.600,25
MOCS2Molybdenum cofactor deficiency BNM_176806.3NM_176806.3:c.16C>TMolybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death.600,25
MTTPAbetalipoproteinemiaNM_001300785.1NM_001300785.1:c.789_790delCA, NM_001300785.1:c.1700G>A, NM_001300785.1:c.1850G>T, NM_001300785.1:c.1948+1G>A, NM_001300785.1:c.2112delC, NM_001300785.1:c.2674G>TAbetalipoproteinemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTTP gene located on chromosomal region 4q23. The age of onset is infantile. This disease is characterized by growth delay, malabsorption, hepatomegaly, and neurological and neuromuscular manifestations. The prevalence is <1:1,000,000.600,25
MUTMethylmalonic aciduria, mut(0) typeNM_000255.3NM_000255.3:c.2150G>T, NM_000255.3:c.2080C>T, NM_000255.3:c.1924G>C, NM_000255.3:c.1871A>G, NM_000255.3:c.1867G>A, NM_000255.3:c.1741C>T, NM_000255.3:c.1658delT, NM_000255.3:c.1445-2A>G, NM_000255.3:c.1420C>T, NM_000255.3:c.1399C>T, NM_000255.3:c.1280G>A, NM_000255.3:c.1207C>T, NM_000255.3:c.1181T>A, NM_000255.3:c.1106G>A, NM_000255.3:c.914T>C, NM_000255.3:c.682C>T, NM_000255.3:c.671_678dupAATTTATG, NM_000255.3:c.655A>T, NM_000255.3:c.643G>A, NM_000255.3:c.607G>A, NM_000255.3:c.572C>A, NM_000255.3:c.313T>C, NM_000255.3:c.280G>A, NM_000255.3:c.278G>A, NM_000255.3:c.91C>TMethylmalonic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MUT gene located on chromosomal region 6p12.3. The age of onset is very early infantile. This disease is characterized by recurrent ketoacidotic comas or transient vomiting, dehydration, hypotonia and intellectual deficit, which does not respond to administration of vitamin B12.600,25
MVKMevalonic aciduriaNM_000431.3NM_000431.3:c.59A>C, NM_000431.3:c.185G>A, NM_000431.3:c.494C>T, NM_000431.3:c.803T>C, NM_000431.3:c.902A>C, NM_000431.3:c.928G>A, NM_000431.3:c.1000G>A, NM_000431.3:c.1129G>AMevalonic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by psychomotor retardation, failure to thrive, progressive cerebellar ataxia, dysmorphic features, progressive visual impairment and recurrent febrile crises. The prevalence is <1:1,000,000.600,25
MYO15ADeafness, autosomal recessive type 3NM_016239.3NM_016239.3:c.625G>T, NM_016239.3:c.755dupA, NM_016239.3:c.3313G>T, NM_016239.3:c.3336delG, NM_016239.3:c.3385C>T, NM_016239.3:c.3693-2A>G, NM_016239.3:c.3756+1G>T, NM_016239.3:c.4751_4752dupTC, NM_016239.3:c.5326C>T, NM_016239.3:c.5492G>T, NM_016239.3:c.6004delG, NM_016239.3:c.6864_6874delGGACCTGGAGC, NM_016239.3:c.8148G>T, NM_016239.3:c.8410A>T, NM_016239.3:c.8548C>T, NM_016239.3:c.9958_9961delGACT, NM_016239.3:c.10573delADeafness autosomal recessive type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO15A gene located on chromosomal region 17p11.2. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.600,25
MYO3ADeafness, autosomal recessive type 30NM_017433.4NM_017433.4:c.1A>G, NM_017433.4:c.732-2A>G, NM_017433.4:c.770C>G, NM_017433.4:c.1086T>G, NM_017433.4:c.1193C>A, NM_017433.4:c.1777-12G>A, NM_017433.4:c.1953delC, NM_017433.4:c.2243delA, NM_017433.4:c.2506-1G>A, NM_017433.4:c.2793+2T>A, NM_017433.4:c.3112-2A>G, NM_017433.4:c.3154C>T, NM_017433.4:c.4586+2T>G, NM_017433.4:c.4730+1G>ADeafness autosomal recessive type 30 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO3A gene located on chromosomal region 10p12.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.600,25
MYO6Deafness, autosomal recessive type 37NM_004999.3NM_004999.3:c.1452dupT, NM_004999.3:c.2907_2909delAGA, NM_004999.3:c.3496C>T, NM_004999.3:c.3808C>TDeafness autosomal recessive type 37 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO6 gene located on chromosomal region 6q14.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems.600,25
MYO7AUsher syndrome, type 1BNM_000260.3NM_000260.3:c.3G>A, NM_000260.3:c.133-2A>G, NM_000260.3:c.448C>T, NM_000260.3:c.494C>T, NM_000260.3:c.634C>T, NM_000260.3:c.635G>A, NM_000260.3:c.640G>A, NM_000260.3:c.731G>C, NM_000260.3:c.1184G>A, NM_000260.3:c.1344-1G>A, NM_000260.3:c.1797G>A, NM_000260.3:c.1884C>A, NM_000260.3:c.1996C>T, NM_000260.3:c.2476G>A, NM_000260.3:c.3504-1G>C, NM_000260.3:c.3508G>A, NM_000260.3:c.3596dupT, NM_000260.3:c.3719G>A, NM_000260.3:c.3764delA, NM_000260.3:c.4024delT, NM_000260.3:c.5392C>T, NM_000260.3:c.5618G>A, NM_000260.3:c.5824G>T, NM_000260.3:c.5886_5889delCTTT, NM_000260.3:c.5967C>G, NM_000260.3:c.6025delGUsher syndrome type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 1:100,000-9:100,000.600,25
NAGASchindler disease, type INM_000262.2NM_000262.2:c.986G>A, NM_000262.2:c.985C>T, NM_000262.2:c.973G>A, NM_000262.2:c.577G>TSchindler disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGA gene located on chromosomal region 22q13.2. The age of onset is infantile. This disease is characterized by early-onset neuroaxonal dystrophy and neurological signs (convulsion during fever, epilepsy, psychomotor retardation and hypotonia). NAGA deficiency is typically classified in three main phenotypes: NAGA deficiency type I (Schindler disease or Schindler disease type I) with severe manifestations; NAGA deficiency type II (Kanzazi disease or Schindler disease type II) which is mild; NAGA deficiency type III (Schindler disease type III) characterized by mild-to-moderate neurologic manifestations. NAGA deficiency results in the increased urinary excretion of glycopeptides and oligosaccharides containing alpha-N-acetylgalactosaminyl moieties.600,25
NEBNemaline myopathy type 2, autosomal recessiveNM_001271208.1NM_001271208.1:c.12238_12239delAT, NM_001271208.1:c.8031_8041delAAATAAACGAG, NM_001271208.1:c.6105dupT, NM_001271208.1:c.2173G>T, NM_001271208.1:c.843T>GNemaline myopathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEB gene located on chromosomal region 2q23.3. The age of onset is infantile or adult. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:100,000-9:100,000 and the incidence is 1/50.000 newborn.600,25
NMNAT1Leber congenital amaurosis type 9NM_001297778.1NM_001297778.1:c.25G>A, NM_001297778.1:c.451G>T, NM_001297778.1:c.457C>G, NM_001297778.1:c.507G>A, NM_001297778.1:c.619C>T, NM_001297778.1:c.710G>T, NM_001297778.1:c.769G>ALeber congenital amaurosis type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NMNAT1 gene located on chromosomal region 1p36.22. The age of onset is early infantile. This disease is characterized by blindness, nystagmus, roving eye movement, leading to severe visual impairment.600,25
NPC1Niemann-Pick disease, type C1NM_000271.4NM_000271.4:c.3662delT, NM_000271.4:c.3611_3614delTTAC, NM_000271.4:c.3467A>G, NM_000271.4:c.3425T>C, NM_000271.4:c.3182T>C, NM_000271.4:c.3175C>T, NM_000271.4:c.3107C>T, NM_000271.4:c.3104C>T, NM_000271.4:c.3019C>G, NM_000271.4:c.2974G>T, NM_000271.4:c.2974G>A, NM_000271.4:c.2972_2973delAG, NM_000271.4:c.2932C>T, NM_000271.4:c.2873G>A, NM_000271.4:c.2861C>T, NM_000271.4:c.2848G>A, NM_000271.4:c.2842G>A, NM_000271.4:c.2761C>T, NM_000271.4:c.2324A>C, NM_000271.4:c.2072C>T, NM_000271.4:c.1628C>T, NM_000271.4:c.1211G>A, NM_000271.4:c.1042C>T, NM_000271.4:c.813_815delCAT, NM_000271.4:c.530G>A, NM_000271.4:c.352_353delAG, NM_000271.4:c.337T>CNiemann-Pick disease type C1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC1 gene located on chromosomal region 18q11.2. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000.600,25
NPC2Niemann-pick disease, type C2NM_006432.3NM_006432.3:c.436C>T, NM_006432.3:c.358C>T, NM_006432.3:c.352G>T, NM_006432.3:c.295T>C, NM_006432.3:c.190+5G>A, NM_006432.3:c.115G>A, NM_006432.3:c.58G>T, NM_006432.3:c.27delGNiemann-Pick disease type C2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC2 gene located on chromosomal region 14q24.3. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000.600,25
NPHP3Meckel syndrome type 7NM_153240.4NM_153240.4:c.3406C>T, NM_153240.4:c.3373C>T, NM_153240.4:c.3156dupA, NM_153240.4:c.2694-2_2694-1delAG, NM_153240.4:c.2694-2A>G, NM_153240.4:c.2570+1G>T, NM_153240.4:c.2541delG, NM_153240.4:c.2369T>C, NM_153240.4:c.1985+5G>A, NM_153240.4:c.1817G>A, NM_153240.4:c.1729C>T, NM_153240.4:c.1381G>T, NM_153240.4:c.1119-2A>G, NM_153240.4:c.434_437delAAAGMeckel syndrome type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP3 gene located on chromosomal region 3q22.1. The age of onset is infantile. This is a disorder characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically encephalocele), hepatic ductal dysplasia and cysts, and polydactyly.600,25
NPHP4Nephronophthisis type 4NM_015102.4NM_015102.4:c.3767_3768insAA, NM_015102.4:c.3231+1G>C, NM_015102.4:c.2940_2944dupGCTCC, NM_015102.4:c.2335C>T, NM_015102.4:c.1972C>T, NM_015102.4:c.1120-1G>C, NM_015102.4:c.556_557insT, NM_015102.4:c.517C>TNephronophthisis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP4 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease results in end-stage renal disease at age ranging between 6 and 35 years. It is a progressive tubulo-interstitial kidney disorder characterized by polydipsia, polyuria, anemia and growth retardation. The prevalence is 1:1,000,000-9:1,000,000.600,25
NPHS1Nephrotic syndrome, type 1NM_004646.3NM_004646.3:c.3478C>T, NM_004646.3:c.3325C>T, NM_004646.3:c.3250dupG, NM_004646.3:c.3250delG, NM_004646.3:c.3109+1G>A, NM_004646.3:c.2928G>T, NM_004646.3:c.2491C>T, NM_004646.3:c.1715G>A, NM_004646.3:c.1481delC, NM_004646.3:c.1307_1308dupAC, NM_004646.3:c.121_122delCTNephrotic syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHS1 gene located on chromosomal region 19q13.12. The age of onset is fetal- infantile. This disease is characterized by fetal proteinuria and nephritic infantile syndrome. The prevalence is 1 in 8 200 births.600,25
NR2E3Enhanced S-cone syndromeNM_014249.3NM_014249.3:c.119-2A>C, NM_014249.3:c.226C>T, NM_014249.3:c.298_299delTG, NM_014249.3:c.932G>A, NM_014249.3:c.1034_1038delTGCAGEnhaced S-Cone Syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NR2E3 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by night blindness, reduced bilateral visual acuity, and typical fundus findings (progressive pigmentary degenerative changes, macular edema, retinoschisis).600,25
OCA2Oculocutaneous albinism type 2NM_000275.2NM_000275.2:c.2228C>T, NM_000275.2:c.1960delG, NM_000275.2:c.1842+1G>T, NM_000275.2:c.1465A>G, NM_000275.2:c.1364+1G>T, NM_000275.2:c.1327G>A, NM_000275.2:c.1182+2T>C, NM_000275.2:c.1182G>A, NM_000275.2:c.1025A>G, NM_000275.2:c.819_822delCTGGinsGGTC, NM_000275.2:c.157delA, NM_000275.2:c.79G>AOculocutaneous albinism type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OCA2 gene located on chromosomal region 15q12-q13. The age of onset is infantile. This disease is characterized by variable hypopigmentation of the skin and hair, numerous characteristic ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1/38,000-1/40,000600,25
OTOADeafness, autosomal recessive type 22NM_144672.3NM_144672.3:c.121-1G>A, NM_144672.3:c.828delT, NM_144672.3:c.1725_1726delCADeafness, autosomal recessive type 22 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOA gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems.600,25
OTOFAuditory neuropathy, autosomal recessive, type 1NM_001287489.1NM_001287489.1:c.5474_5475delCC, NM_001287489.1:c.5473C>G, NM_001287489.1:c.5103+2T>A, NM_001287489.1:c.4559G>A, NM_001287489.1:c.4491T>A, NM_001287489.1:c.3032T>C, NM_001287489.1:c.2485C>T, NM_001287489.1:c.2348delG, NM_001287489.1:c.1778delT, NM_001287489.1:c.1544T>C, NM_001287489.1:c.1498C>T, NM_001287489.1:c.766-2A>G, NM_001287489.1:c.584-1G>C, NM_001287489.1:c.227+2T>C, NM_001287489.1:c.149G>AAuditory neuropathy, autosomal recessive type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. Patients can have varying degrees of hearing loss with poor speech reception out of proportion to the degree of hearing loss.600,25
OTOFAuditory neuropathy, autosomal recessive, type 1NM_004802.3NM_004802.3:c.3515G>AAuditory neuropathy, autosomal recessive type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. Patients can have varying degrees of hearing loss with poor speech reception out of proportion to the degree of hearing loss.600,25
PAHPhenylketonuriaNM_000277.1NM_000277.1:c.1315+1G>A, NM_000277.1:c.1243G>A, NM_000277.1:c.1241A>G, NM_000277.1:c.1238G>C, NM_000277.1:c.1222C>T, NM_000277.1:c.1217T>C, NM_000277.1:c.1208C>T, NM_000277.1:c.1199+17G>A, NM_000277.1:c.1199+1G>A, NM_000277.1:c.1197A>T, NM_000277.1:c.1184C>A, NM_000277.1:c.1169A>G, NM_000277.1:c.1166delC, NM_000277.1:c.1162G>A, NM_000277.1:c.1139C>T, NM_000277.1:c.1068C>A, NM_000277.1:c.1066-3C>T, NM_000277.1:c.1066-11G>A, NM_000277.1:c.1045T>C, NM_000277.1:c.1042C>G, NM_000277.1:c.1033G>T, NM_000277.1:c.1030G>A, NM_000277.1:c.955G>T, NM_000277.1:c.926C>T, NM_000277.1:c.926C>A, NM_000277.1:c.912+1G>A, NM_000277.1:c.898G>T, NM_000277.1:c.896T>G, NM_000277.1:c.842+5G>A, NM_000277.1:c.838G>A, NM_000277.1:c.829T>G, NM_000277.1:c.823C>T, NM_000277.1:c.818C>T, NM_000277.1:c.814G>T, NM_000277.1:c.809G>A, NM_000277.1:c.806delT, NM_000277.1:c.782G>A, NM_000277.1:c.764T>C, NM_000277.1:c.755G>A, NM_000277.1:c.754C>T, NM_000277.1:c.745C>T, NM_000277.1:c.737C>A, NM_000277.1:c.734T>C, NM_000277.1:c.733G>C, NM_000277.1:c.728G>A, NM_000277.1:c.727C>T, NM_000277.1:c.722delG, NM_000277.1:c.722G>A, NM_000277.1:c.721C>T, NM_000277.1:c.688G>A, NM_000277.1:c.673C>G, NM_000277.1:c.665A>G, NM_000277.1:c.638T>C, NM_000277.1:c.611A>G, NM_000277.1:c.569T>C, NM_000277.1:c.533A>G, NM_000277.1:c.529G>A, NM_000277.1:c.527G>T, NM_000277.1:c.509+1G>A, NM_000277.1:c.508C>G, NM_000277.1:c.503delA, NM_000277.1:c.490A>G, NM_000277.1:c.482T>C, NM_000277.1:c.473G>A, NM_000277.1:c.472C>T, NM_000277.1:c.450dupA, NM_000277.1:c.442-1G>A, NM_000277.1:c.442-5C>G, NM_000277.1:c.441+5G>T, NM_000277.1:c.441+1G>A, NM_000277.1:c.357delC, NM_000277.1:c.331C>T, NM_000277.1:c.320A>G, NM_000277.1:c.311C>A, NM_000277.1:c.284_286delTCA, NM_000277.1:c.261C>A, NM_000277.1:c.250G>T, NM_000277.1:c.204A>T, NM_000277.1:c.194T>C, NM_000277.1:c.165T>G, NM_000277.1:c.143T>C, NM_000277.1:c.136G>A, NM_000277.1:c.117C>G, NM_000277.1:c.47_48delCTPhenylketonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAH gene located on chromosomal region 12q23.2. The age of onset is neonatal. This disease is characterized by gradual developmental delay, stunted growth, microcephaly, seizures, tremors, eczema, vomiting, and musty odor. Untreated patients subsequently develop intellectual disability, behavioral disorders (hyperactivity) and motor disorders. The prevalence is 1:2,600-1:200,000.600,25
PANK2Neurodegeneration with brain iron accumulation type 1NM_153638.3NM_153638.3:c.790C>T, NM_153638.3:c.823_824delCT, NM_153638.3:c.1561G>A, NM_153638.3:c.1583C>TNeurodegeneration with brain iron accumulation type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PANK2 gene located on chromosomal region 20p13. The age of onset is infantile. This disease is characterized by progressive extrapyramidal dysfunction (dystonia, rigidity, choreoathetosis), iron accumulation on the brain and axonal spheroids in the central nervous system. The prevalence is 1-2/1,000,000.600,25
PCPyruvate carboxylase deficiencyNM_000920.3NM_000920.3:c.1748G>T, NM_000920.3:c.434T>CPyruvate carboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PC gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by metabolic acidosis, failure to thrive, developmental delay, and recurrent seizures. The prevalence is 1:250,000.600,25
PCCAPropionic acidemiaNM_000282.3NM_000282.3:c.229C>T, NM_000282.3:c.261dupT, NM_000282.3:c.412G>A, NM_000282.3:c.600+1G>A, NM_000282.3:c.862A>T, NM_000282.3:c.1023dupT, NM_000282.3:c.1118T>A, NM_000282.3:c.1226_1227delTT, NM_000282.3:c.1284+1G>A, NM_000282.3:c.1598_1601delTTGT, NM_000282.3:c.1891G>C, NM_000282.3:c.1899+4_1899+7delAGTAPropionic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCA gene located on chromosomal region 13q32.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000.600,25
PCCBPropionic acidemiaNM_001178014.1NM_001178014.1:c.331C>T, NM_001178014.1:c.337C>T, NM_001178014.1:c.562G>A, NM_001178014.1:c.622G>A, NM_001178014.1:c.743C>T, NM_001178014.1:c.1050dupT, NM_001178014.1:c.1233dupT, NM_001178014.1:c.1278_1291delGGGCATCATCCGGCinsTAGAGCACAGGA, NM_001178014.1:c.1279_1284delGGCATCinsAA, NM_001178014.1:c.1283_1286delTCAT, NM_001178014.1:c.1288C>T, NM_001178014.1:c.1289_1290insT, NM_001178014.1:c.1343C>T, NM_001178014.1:c.1364A>G, NM_001178014.1:c.1594C>T, NM_001178014.1:c.1598_1600dupCCC, NM_001178014.1:c.1666A>GPropionic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCB gene located on chromosomal region 3q22.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000.600,25
PCDH15Deafness, autosomal recessive type 23NM_001142763.1NM_001142763.1:c.5680A>T, NM_001142763.1:c.4982_4983insTGAT, NM_001142763.1:c.4958_4961dupTGAT, NM_001142763.1:c.4885delA, NM_001142763.1:c.4569_4572dupATCT, NM_001142763.1:c.3733-2A>G, NM_001142763.1:c.2660_2661delAT, NM_001142763.1:c.1955C>G, NM_001142763.1:c.1752C>G, NM_001142763.1:c.1598T>A, NM_001142763.1:c.1103delT, NM_001142763.1:c.1021C>T, NM_001142763.1:c.800G>A, NM_001142763.1:c.415C>T, NM_001142763.1:c.415C>G, NM_001142763.1:c.7C>TDeafness, autosomal recessive 23 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCDH15 gene located on chromosomal region 10q21.1. This is a form of non-syndromic sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.600,25
PDE6ARetinitis pigmentosa type 43NM_000440.2NM_000440.2:c.2053G>A, NM_000440.2:c.1749C>G, NM_000440.2:c.1683G>A, NM_000440.2:c.1560dupA, NM_000440.2:c.1113+1G>T, NM_000440.2:c.1113+1G>ARetinitis pigmentosa type 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.600,25
PDE6BRetinitis pigmentosa type 40NM_000283.3NM_000283.3:c.892C>T, NM_000283.3:c.1540delC, NM_000283.3:c.1572delC, NM_000283.3:c.1580T>C, NM_000283.3:c.1669C>T, NM_000283.3:c.1920+2T>CRetinitis pigmentosa 40 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6B gene located on chromosomal region 4p16.3. The age of onset is variable. Retinitis pigmentosa 40 is a retinal dystrophy belonging to the group of pigmentary retinopathies.This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness.600,25
PEX1Heimler syndrome type 1NM_000466.2NM_000466.2:c.3505_3517delCAGTTGTTTTCAC, NM_000466.2:c.2916delA, NM_000466.2:c.2528G>A, NM_000466.2:c.2097dupT, NM_000466.2:c.1991T>C, NM_000466.2:c.1952_1960dupCAGTGTGGA, NM_000466.2:c.1842delA, NM_000466.2:c.1239+1G>T, NM_000466.2:c.877C>THeimler syndrome 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. This disease is characterized by sensorineural hearing loss, enamel hyoplasia of the secondary dentition, and nail abnormalities.600,25
PEX7Rhizomelic chondrodysplasia punctata, type 1NM_000288.3NM_000288.3:c.532C>T, NM_000288.3:c.618G>A, NM_000288.3:c.649G>A, NM_000288.3:c.653C>T, NM_000288.3:c.694C>T, NM_000288.3:c.854A>G, NM_000288.3:c.875T>A, NM_000288.3:c.903+1G>CRhizomelic chondrodysplasia punctata type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX7 gene located on chromosomal region 6q23.3. The age of onset is early. This disease is characterized by proximal shortening of the humerus and to a lesser degree the femur (rhizomelia), punctate calcifications in cartilage with epiphyseal and metaphyseal abnormalities (chondrodysplasia punctata), coronal clefts of the vertebral bodies, cataracts, postnatal growth deficiency is profound, intellectual disability is severe, seizures. The prevalence is <1:100,000.600,25
PHYHRefsum diseaseNM_001323082.1NM_001323082.1:c.830G>A, NM_001323082.1:c.829C>T, NM_001323082.1:c.811A>C, NM_001323082.1:c.684+5G>T, NM_001323082.1:c.684+2T>G, NM_001323082.1:c.503-2A>G, NM_001323082.1:c.164delT, NM_001323082.1:c.135-1G>C, NM_001323082.1:c.135-2A>GRefsum disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHYH gene located on chromosomal region 10p13. The age of onset is variable. This disease is characterized by hemeralopia (loss of vision in the dark), followed by episods of chronic distal motor polyneuropathy. Other associated signs include perceptive deafness, anosmia, cerebellous ataxia and sometimes, severe intellectual deficiency. Over the course of time cutaneous signs appear (ichtyosis), along with polyepiphyseal dysplasia, myocardiopathy, elevated protein in cerebrospinal fluid, and pigmentary retinitis that may result in blindness. The prevalence is 1:1.000,000-9:1.000,000.600,25
PKHD1Polycystic kidney disease type 4NM_138694.3NM_138694.3:c.12027C>G, NM_138694.3:c.11363_11372delCTTCCCTGGA, NM_138694.3:c.10452dupT, NM_138694.3:c.10412T>G, NM_138694.3:c.10219C>T, NM_138694.3:c.9719G>A, NM_138694.3:c.9689delA, NM_138694.3:c.9530T>C, NM_138694.3:c.9370C>T, NM_138694.3:c.8870T>C, NM_138694.3:c.8824C>T, NM_138694.3:c.8408G>A, NM_138694.3:c.8407T>C, NM_138694.3:c.8317G>T, NM_138694.3:c.6499C>T, NM_138694.3:c.5895dupA, NM_138694.3:c.5325_5326delAG, NM_138694.3:c.4870C>T, NM_138694.3:c.3940delA, NM_138694.3:c.3766delC, NM_138694.3:c.3761_3762delCCinsG, NM_138694.3:c.3367G>A, NM_138694.3:c.3229-2A>C, NM_138694.3:c.2854G>A, NM_138694.3:c.2827_2828delGA, NM_138694.3:c.2452C>T, NM_138694.3:c.2414C>T, NM_138694.3:c.2341C>T, NM_138694.3:c.1486C>T, NM_138694.3:c.982C>T, NM_138694.3:c.930delC, NM_138694.3:c.682A>G, NM_138694.3:c.664A>G, NM_138694.3:c.370C>T, NM_138694.3:c.353delG, NM_138694.3:c.107C>T, NM_138694.3:c.85G>TPolycystic kidney disease type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKHD1 gene located on chromosomal region 6p12.3-p12.2. The age of onset is early. This disease is a severe form of polycystic kidney disease affecting the kidneys and, in some cases, the hepatic biliary tract. Up to 50% of the affected neonates die shortly after birth, as a result of severe pulmonary hypoplasia and secondary respiratory insufficiency. In the subset that survives the perinatal period, morbidity and mortality are mainly related to severe systemic hypertension, renal insufficiency, and portal hypertension due to portal-tract fibrosis.600,25
PKLRPyruvate kinase deficiencyNM_000298.5NM_000298.5:c.1675C>T, NM_000298.5:c.1529G>A, NM_000298.5:c.1528C>T, NM_000298.5:c.1456C>T, NM_000298.5:c.1436G>A, NM_000298.5:c.1261C>A, NM_000298.5:c.1151C>T, NM_000298.5:c.721G>TPyruvate kinase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKLR gene located on chromosomal region 1q22. The age of onset is early. This disease is characterized by highly variable degree of chronic hemolysis, with severe neonatal jaundice and fatal anemia at birth, severe transfusion-dependent chronic hemolysis, and moderate hemolysis with exacerbation during infection. The prevalence is 1:20,000.600,25
PLCE1Nephrotic syndrome, type 3NM_016341.3NM_016341.3:c.961C>T, NM_016341.3:c.3346C>T, NM_016341.3:c.3736C>T, NM_016341.3:c.3846delG, NM_016341.3:c.4451C>T, NM_016341.3:c.4809delA, NM_016341.3:c.5560C>TNephrotic syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLCE1 gene located on chromosomal region 10q23.33. The age of onset is variable. This disease is characterized by low blood protein levels, high cholesterol levels, high triglyceride levels, and presence of protein in the urine. The prevalence is 2:100,000-7:100,000 Children; 3:100,000 adults.600,25
PLGPlasminogen deficiency, type INM_000301.3NM_000301.3:c.112A>G, NM_000301.3:c.693_695delGAA, NM_000301.3:c.704G>A, NM_000301.3:c.1120G>T, NM_000301.3:c.1435G>T, NM_000301.3:c.1848G>APlasminogen deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLG gene located on chromosomal region 6q26. The age of onset is infantile.This disease is characterized by markedly impaired extracellular fibrinolysis leading to the formation of ligneous (fibrin-rich) pseudomembranes on mucosae during wound healing. The prevalence is 1:1,000,000-9:1,000,000.600,25
PMM2Congenital disorder of glycosylation, type 1aNM_000303.2NM_000303.2:c.26G>A, NM_000303.2:c.53C>G, NM_000303.2:c.95T>G, NM_000303.2:c.95_96delTAinsGC, NM_000303.2:c.97C>T, NM_000303.2:c.109C>T, NM_000303.2:c.131T>C, NM_000303.2:c.190delT, NM_000303.2:c.193G>T, NM_000303.2:c.255+2T>C, NM_000303.2:c.256-1G>C, NM_000303.2:c.323C>T, NM_000303.2:c.338C>T, NM_000303.2:c.349G>C, NM_000303.2:c.357C>A, NM_000303.2:c.368G>A, NM_000303.2:c.385G>A, NM_000303.2:c.395T>C, NM_000303.2:c.415G>A, NM_000303.2:c.422G>A, NM_000303.2:c.442G>A, NM_000303.2:c.470T>C, NM_000303.2:c.484C>T, NM_000303.2:c.563A>G, NM_000303.2:c.620T>C, NM_000303.2:c.623G>C, NM_000303.2:c.647A>T, NM_000303.2:c.652C>G, NM_000303.2:c.669C>G, NM_000303.2:c.677C>G, NM_000303.2:c.691G>A, NM_000303.2:c.710C>G, NM_000303.2:c.710C>TCongenital disorder of glycosylation type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PMM2 gene located on chromosomal region 16p13.2. The age of onset is infantile. This disease is characterized by highly variable clinical manifestations that may include feeding problems, vomiting, and diarrhea with failure to thrive in infants, and severe encephalopathy with axial hypotonia, abnormal eye movement, marked psychomotor retardation, peripheral neuropathy, cerebellar hypoplasia, stroke-like episodes, and retinitis pigmentosa in late infancy, childhood or adulthood.600,25
POLGMitochondrial DNA depletion syndrome 4A (Alpers type)NM_001126131.1NM_001126131.1:c.3644-1G>A, NM_001126131.1:c.3630dupC, NM_001126131.1:c.3286C>T, NM_001126131.1:c.3218C>T, NM_001126131.1:c.3151G>C, NM_001126131.1:c.2794C>T, NM_001126131.1:c.2617G>T, NM_001126131.1:c.2605C>T, NM_001126131.1:c.2591A>G, NM_001126131.1:c.2557C>T, NM_001126131.1:c.2542G>A, NM_001126131.1:c.2243G>C, NM_001126131.1:c.2209G>C, NM_001126131.1:c.1879C>T, NM_001126131.1:c.1760C>T, NM_001126131.1:c.1754G>A, NM_001126131.1:c.1437C>G, NM_001126131.1:c.1399G>A, NM_001126131.1:c.1120C>T, NM_001126131.1:c.911T>G, NM_001126131.1:c.752C>TMitochondrial DNA depletion syndrome, Alpers type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by the clinical triad of psychomotor regression, seizures, and liver disease. The prevalence is 1:1,600 newborn.600,25
POMGNT1Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3NM_001243766.1NM_001243766.1:c.1864delC, NM_001243766.1:c.1814G>C, NM_001243766.1:c.1545delC, NM_001243766.1:c.1539+1G>T, NM_001243766.1:c.1539+1G>A, NM_001243766.1:c.1469G>A, NM_001243766.1:c.1425G>A, NM_001243766.1:c.1411A>T, NM_001243766.1:c.1274G>C, NM_001243766.1:c.932G>A, NM_001243766.1:c.931C>T, NM_001243766.1:c.880-1G>A, NM_001243766.1:c.652+1G>A, NM_001243766.1:c.636C>T, NM_001243766.1:c.187C>T, NM_001243766.1:c.92dupAMuscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3 which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMGNT1 gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent psychomotor development, eye involvement and seizures. The prevalence is 1-9:100,000.600,25
POMT1Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1NM_007171.3NM_007171.3:c.193G>A, NM_007171.3:c.226G>A, NM_007171.3:c.598G>C, NM_007171.3:c.793C>T, NM_007171.3:c.831C>G, NM_007171.3:c.907C>T, NM_007171.3:c.1153C>T, NM_007171.3:c.1242-2A>G, NM_007171.3:c.1261dupC, NM_007171.3:c.1280_1281delAGinsTC, NM_007171.3:c.1540C>T, NM_007171.3:c.1545C>G, NM_007171.3:c.1746G>C, NM_007171.3:c.1770G>C, NM_007171.3:c.2005G>A, NM_007171.3:c.2163C>A, NM_007171.3:c.2167dupGMuscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 gene located on chromosomal region 9q34.13. Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies (type A), which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), is a genetically heterogeneous disorder with characteristic brain and eye malformations, profound mental retardation, congenital muscular dystrophy, and early death. The phenotype commonly includes cobblestone (type II) lissencephaly, cerebellar malformations, and retinal malformations.600,25
POMT2Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2NM_013382.5NM_013382.5:c.2243G>C, NM_013382.5:c.2177G>A, NM_013382.5:c.1997A>G, NM_013382.5:c.1941G>A, NM_013382.5:c.1912C>T, NM_013382.5:c.1726-2A>G, NM_013382.5:c.1608_1609delCA, NM_013382.5:c.1445G>T, NM_013382.5:c.1417C>T, NM_013382.5:c.1057G>A, NM_013382.5:c.1045_1052delCGGATGGCinsG, NM_013382.5:c.551C>TMuscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT2 gene located on chromosomal region 14q24.3. Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies (type A), which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), is a genetically heterogeneous disorder with characteristic brain and eye malformations, profound mental retardation, congenital muscular dystrophy, and early death. The phenotype commonly includes cobblestone (type II) lissencephaly, cerebellar malformations, and retinal malformations.600,25
PPT1Ceroid lipofuscinosis, neuronal, type 1NM_000310.3NM_000310.3:c.840dupA, NM_000310.3:c.627+1G>T, NM_000310.3:c.541G>T, NM_000310.3:c.451C>T, NM_000310.3:c.223A>C, NM_000310.3:c.169dupA, NM_000310.3:c.29T>ANeuronal ceroid lipofuscinoses, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PPT1 gene located on chromosomal region 1p32. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 1.5:1,000,000-9:1,000,000.600,25
PROM1Retinitis pigmentosa, type 41NM_006017.2NM_006017.2:c.2490-2A>G, NM_006017.2:c.1841delG, NM_006017.2:c.1726C>T, NM_006017.2:c.1354dupT, NM_006017.2:c.1177_1178delAT, NM_006017.2:c.199C>TRetinitis pigmentosa, type 41 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROM1 gene located on chromosomal region 4p15.32. The age of onset is early. This disease is characterized by night blindness often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 19:100,000-27:100,000.600,25
PYGMMcArdle diseaseNM_005609.3NM_005609.3:c.2392T>C, NM_005609.3:c.2262delA, NM_005609.3:c.2128_2130delTTC, NM_005609.3:c.1963G>A, NM_005609.3:c.1827G>A, NM_005609.3:c.1768+1G>A, NM_005609.3:c.1726C>T, NM_005609.3:c.1722T>G, NM_005609.3:c.1628A>C, NM_005609.3:c.1621G>T, NM_005609.3:c.1466C>G, NM_005609.3:c.613G>A, NM_005609.3:c.501dupT, NM_005609.3:c.393delG, NM_005609.3:c.280C>T, NM_005609.3:c.255C>A, NM_005609.3:c.148C>T, NM_005609.3:c.13_14delCT, NM_005609.3:c.1A>GMcArdle disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PYGM gene located on chromosomal region 11q13.1. The age of onset is infantile. This disease is characterized by muscular exercise intolerance with myalgia, cramps, fatigue, and muscle weakness.600,25
RAG1Omenn syndrome; Severe combined immunodeficiency, B cell-negativeNM_000448.2NM_000448.2:c.256_257delAA, NM_000448.2:c.940C>T, NM_000448.2:c.983G>A, NM_000448.2:c.1681C>T, NM_000448.2:c.1682G>A, NM_000448.2:c.2164G>A, NM_000448.2:c.2320G>T, NM_000448.2:c.2326C>T, NM_000448.2:c.2333G>A, NM_000448.2:c.2814T>G, NM_000448.2:c.2923C>TOmenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency.
Severe combined immunodeficiency, autosomal recessive, T cell-negative (T-), B cell negative (B-), NK cell positive (NK+) is also caused by mutation in the RAG1 and RAG2 genes. This disease is characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development. Without treatment, patients usually die within the first year of life.		600,25
RAPSNFetal akinesia deformation sequenceNM_005055.4NM_005055.4:c.848T>C, NM_005055.4:c.807C>A, NM_005055.4:c.566C>T, NM_005055.4:c.490C>T, NM_005055.4:c.484G>A, NM_005055.4:c.416T>C, NM_005055.4:c.264C>AFetal akinesia deformation sequence follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by multiple joint contractures, facial anomalies and pulmonary hypoplasia. The prevalence is 1:3,000.600,25
RAXIsolated microphthalmia, type 3NM_013435.2NM_013435.2:c.909C>G, NM_013435.2:c.439C>T, NM_013435.2:c.383_384delAG, NM_013435.2:c.18C>AIsolated microphthalmia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAX gene located on chromosomal region 18q21.32. Microphthalmia designates a heterogeneous group of ocular malformations with a more or less evident reduction in the size of the eyeball. Additional features include high hypermetropia and a short axial length.600,25
RDH12Leber congenital amaurosis, type 13NM_152443.2NM_152443.2:c.146C>T, NM_152443.2:c.152T>A, NM_152443.2:c.184C>T, NM_152443.2:c.210dupC, NM_152443.2:c.295C>A, NM_152443.2:c.377C>T, NM_152443.2:c.379G>T, NM_152443.2:c.451C>A, NM_152443.2:c.451C>G, NM_152443.2:c.464C>T, NM_152443.2:c.523T>C, NM_152443.2:c.565C>T, NM_152443.2:c.677A>G, NM_152443.2:c.806_810delCCCTGLeber congenital amaurosis type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDH12 gene located on chromosomal region 14q24.1. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life.600,25
RGRRetinitis pigmentosa, type 44NM_002921.3NM_002921.3:c.262_269dupGGCTCGGA, NM_002921.3:c.273_274insGGCTCGGA, NM_002921.3:c.877C>TRetinitis pigmentosa type 44 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RGR gene located on chromosomal region 10q23.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.600,25
RHORetinitis pigmentosa, type 4, autosomal recessiveNM_000539.3NM_000539.3:c.173C>T, NM_000539.3:c.448G>A, NM_000539.3:c.620T>G, NM_000539.3:c.745G>TRetinitis pigmentosa type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RHO gene located on chromosomal region 3q22.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000.600,25
RLBP1Bothnia retinal dystrophyNM_000326.4NM_000326.4:c.700C>T, NM_000326.4:c.452G>A, NM_000326.4:c.333T>GBothnia retinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RLBP1 gene located on chromosomal region 15q26.1. This disease is characterized by night blindness from early childhood with features consistent with retinitis punctata albescens and macular degeneration. The prevalence is unknown.600,25
RPE65Leber congenital amaurosis, type 2NM_000329.2NM_000329.2:c.1543C>T, NM_000329.2:c.1355T>G, NM_000329.2:c.1292A>G, NM_000329.2:c.1102T>C, NM_000329.2:c.1087C>A, NM_000329.2:c.1067delA, NM_000329.2:c.1022T>C, NM_000329.2:c.907A>T, NM_000329.2:c.514_515delGT, NM_000329.2:c.271C>TLeber congenital amaurosis 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus.600,25
RPGRIP1LJoubert syndrome, type 7; Meckel syndrome, type 5; COACH syndromeNM_015272.4NM_015272.4:c.3634_3637delGAAA, NM_015272.4:c.2794_2795delTT, NM_015272.4:c.2614C>T, NM_015272.4:c.2413C>T, NM_015272.4:c.2050C>T, NM_015272.4:c.1975T>C, NM_015272.4:c.1843A>C, NM_015272.4:c.1329dupA, NM_015272.4:c.1326_1329delAAAA, NM_015272.4:c.776+1G>A, NM_015272.4:c.757C>T, NM_015272.4:c.697A>T, NM_015272.4:c.394A>TJoubert syndrome (JBTS) type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. JBTS is characterized by congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (less common in JBTS7) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. RPGRIP1L gene is also associated with Meckel syndrome type 5, a rare, autosomal recessive lethal condition characterized by central nervous system malformations, postaxial, polydactyly, multicystic kidney dysplasia, and ductal proliferation in the portal area of the liver. Other phenotype associated is COACH syndrome, an autosomal recessive disorder characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable. COACH syndrome is considered by some to be a subtype of Joubert syndrome with congenital hepatic fibrosis.600,25
RYR1Minicore myopathy with external ophthalmoplegiaNM_000540.2NM_000540.2:c.325C>T, NM_000540.2:c.487C>T, NM_000540.2:c.631+2T>C, NM_000540.2:c.738T>G, NM_000540.2:c.1021G>A, NM_000540.2:c.1186G>T, NM_000540.2:c.1205T>C, NM_000540.2:c.1739_1742dupATCA, NM_000540.2:c.1841G>T, NM_000540.2:c.4076delG, NM_000540.2:c.4405C>T, NM_000540.2:c.5333C>A, NM_000540.2:c.5726_5727delAG, NM_000540.2:c.6082C>T, NM_000540.2:c.6104A>T, NM_000540.2:c.6721C>T, NM_000540.2:c.7268T>A, NM_000540.2:c.7300G>A, NM_000540.2:c.7360C>T, NM_000540.2:c.7373G>A, NM_000540.2:c.7463_7475delCAAAGATGTCAGC, NM_000540.2:c.7781C>A, NM_000540.2:c.7836-1G>A, NM_000540.2:c.9000+1G>T, NM_000540.2:c.9905dupC, NM_000540.2:c.10343C>T, NM_000540.2:c.10579C>T, NM_000540.2:c.13480G>T, NM_000540.2:c.14126C>T, NM_000540.2:c.14365-2A>T, NM_000540.2:c.14545G>AMultiminicore disease (MMD) is an inherited neuromuscular disorder defined pathologically by the presence of multiple areas of reduced mitochondrial oxidative activity running along a limited extent of the longitudinal axis of the muscle fiber, so-called 'minicores.' These regions show sarcomere disorganization and mitochondria depletion. Typically, no dystrophic signs, such as muscle fiber necrosis or regeneration or significant endomysial fibrosis, are present. MMD is a pathologic diagnosis and shows clinical and genetic heterogeneity. Affected individuals have clinical features of a congenital myopathy, including neonatal hypotonia, delayed motor development, and generalized muscle weakness and amyotrophy, which may progress slowly or remain stable (Ferreiro and Fardeau, 2002).Patients with recessive mutations in the RYR1 gene typically show severe congenital muscular dystrophy with ophthalmoplegia, although there is phenotypic variability. Some patients may present in utero with fetal akinesia, arthrogryposis, and lung hypoplasia resulting in fetal or perinatal death (McKie et al., 2014). Skeletal muscle biopsy of patients with recessive RYR1 mutations show variable features, including central cores (Jungbluth et al., 2007), congenital fiber-type disproportion (CFTD) (Monnier et al., 2009), and centronuclear myopathy (Wilmshurst et al., 2010).600,25
SACSSpastic ataxia, Charlevoix-Saguenay, typeNM_014363.5NM_014363.5:c.13237C>T, NM_014363.5:c.12160C>T, NM_014363.5:c.8844delT, NM_014363.5:c.7504C>T, NM_014363.5:c.6563T>A, NM_014363.5:c.6355C>T, NM_014363.5:c.5618_5619delAT, NM_014363.5:c.4933C>T, NM_014363.5:c.3198T>A, NM_014363.5:c.994A>T, NM_014363.5:c.517C>TSpastic ataxia, Charlevoix-Saguenay type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SACS gene located on chromosomal region 13q11. The age of onset is early. This disease is characterized by early-onset cerebellar ataxia with spasticity, a pyramidal syndrome and peripheral neuropathy. The prevalence is 1:1,500-1:2,000.600,25
SAGOguchi disease, type 1NM_000541.4NM_000541.4:c.298dupG, NM_000541.4:c.523C>T, NM_000541.4:c.577C>T, NM_000541.4:c.874C>T, NM_000541.4:c.916G>T, NM_000541.4:c.926delA, NM_000541.4:c.993C>GOguchi disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SAG gene located on chromosomal region 2q37. The age of onset is infantile. This disease is characterized by congenital stationary night blindness and the Mizuo-Nakamura phenomenon which is a unique morphological and functional abnormality of the retina that presents with a typical golden-yellow or silver-gray discoloration of the fundus in the presence of light that disappears after dark-adaptation and appears again after the onset of light.600,25
SBDSShwachman-Diamond syndromeNM_016038.2NM_016038.2:c.377G>C, NM_016038.2:c.258+2T>C, NM_016038.2:c.184A>T, NM_016038.2:c.183_184delTAinsCT, NM_016038.2:c.120delGShwachman-Diamond syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBDS gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by chronic and usually mild neutropenia, pancreatic exocrine insufficiency associated with steatorrhea and growth failure, skeletal dysplasia with short stature, and an increased risk of bone marrow aplasia or leukemic transformation, cutaneous (eczema or ichthyosis) and dental anomalies, and psychomotor retardation. The prevalence is 1:76,000 newborn.600,25
SCNN1BPseudohypoaldosteronism, type 1NM_000336.2NM_000336.2:c.109G>APseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.600,25
SCNN1GPseudohypoaldosteronism, type 1NM_001039.3NM_001039.3:c.600dupA, NM_001039.3:c.1373+2T>C, NM_001039.3:c.1570-1G>A, NM_001039.3:c.1627delGPseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest.600,25
SETXSpinocerebellar ataxia, autosomal recessive, type 1NM_015046.5NM_015046.5:c.6848_6851delCAGA, NM_015046.5:c.6834_6839delAACAAA, NM_015046.5:c.5927T>G, NM_015046.5:c.5630delG, NM_015046.5:c.5549-1G>T, NM_015046.5:c.5308_5311delGAGA, NM_015046.5:c.4087C>T, NM_015046.5:c.2602C>T, NM_015046.5:c.1166T>C, NM_015046.5:c.1027G>T, NM_015046.5:c.994C>TSpinocerebellar ataxia with axonal neuropathy type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SETX gene located on chromosomal region 9q34.13. The age of onset is infantile. This disease is characterized by progressive cerebellar ataxia, axonal sensorimotor neuropathy with oculomotor apraxia, fixation instability, extrapyramidal features and an elevated serum alpha-fetoprotein level. The prevalence is 4:100,000-8:100,000.600,25
SGCAMuscular dystrophy, limb-girdle, type 2DNM_000023.3NM_000023.3:c.101G>A, NM_000023.3:c.229C>T, NM_000023.3:c.371T>C, NM_000023.3:c.518T>C, NM_000023.3:c.574C>T, NM_000023.3:c.739G>A, NM_000023.3:c.850C>T, NM_000023.3:c.903_904dupCCAutosomal recessive limb-girdle muscular dystrophy type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCA gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness and calf pseudohypertrophy. The prevalence is 1:1,000,000-9:1,000,000.600,25
SGCGMuscular dystrophy, limb-girdle, type 2CNM_000231.2NM_000231.2:c.89delG, NM_000231.2:c.195+4_195+7delAGTA, NM_000231.2:c.505+1G>A, NM_000231.2:c.525delT, NM_000231.2:c.787G>A, NM_000231.2:c.848G>AAutosomal recessive limb-girdle muscular dystrophy type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCG gene located on chromosomal region 13q12.12. The age of onset is variable. This disease is characterized by limb-girdle weakness, calf hypertrophy, diaphragmatic weakness, and variable cardiac abnormalities.600,25
SGSHMucopolysaccharidosis, type 3A (Sanfilippo A)NM_000199.3NM_000199.3:c.1380delT, NM_000199.3:c.1339G>A, NM_000199.3:c.1298G>A, NM_000199.3:c.1167C>A, NM_000199.3:c.892T>C, NM_000199.3:c.877C>T, NM_000199.3:c.757delG, NM_000199.3:c.617G>C, NM_000199.3:c.466A>T, NM_000199.3:c.449G>A, NM_000199.3:c.383C>T, NM_000199.3:c.364G>A, NM_000199.3:c.337_345delCAAGCTGGTinsGCACAGGTGAG, NM_000199.3:c.320delT, NM_000199.3:c.235A>C, NM_000199.3:c.220C>T, NM_000199.3:c.197C>G, NM_000199.3:c.130G>AMucopolysaccharidosis type 3A (Sanfilippo syndrome type A) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGSH gene located on chromosomal region 17q25.3. The age of onset is infantile. This disease is characterized by behavioural disorders (hyperkinesia, aggressiveness) and intellectual deterioration, sleep disorders and very mild dysmorphism. The prevalence is >1:70,000 newborn.600,25
SH3TC2Charcot-Marie-Tooth disease, type 4CNM_024577.3NM_024577.3:c.3676-1G>A, NM_024577.3:c.3601C>T, NM_024577.3:c.3341delC, NM_024577.3:c.3326G>C, NM_024577.3:c.3325C>T, NM_024577.3:c.2993_2994insC, NM_024577.3:c.2860C>T, NM_024577.3:c.2829T>G, NM_024577.3:c.2710C>T, NM_024577.3:c.2491_2492delAG, NM_024577.3:c.2191delG, NM_024577.3:c.1982T>C, NM_024577.3:c.1972C>T, NM_024577.3:c.1969G>A, NM_024577.3:c.1747_1748delAG, NM_024577.3:c.1724T>A, NM_024577.3:c.1586G>A, NM_024577.3:c.920G>A, NM_024577.3:c.735G>A, NM_024577.3:c.530-2A>G, NM_024577.3:c.217_227delGCTGCTCGGAGinsCCAGTAA, NM_024577.3:c.53-1G>C, NM_024577.3:c.52+1delG, NM_024577.3:c.28delGCharcot-Marie-Tooth disease, type 4C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SH3TC2 gene located on chromosomal region 5q32. The age of onset is infantile. This disease is characterized by scoliosis or kyphoscoliosis, neuropathy, foot deformities, respiratory insufficiency, hypoacousis and deafness.600,25
SLC12A1Bartter syndrome, type 1NM_000338.2NM_000338.2:c.223C>T, NM_000338.2:c.628+2T>C, NM_000338.2:c.814G>T, NM_000338.2:c.1875G>A, NM_000338.2:c.1942G>A, NM_000338.2:c.2805dupA, NM_000338.2:c.2952_2955delCAAABartter syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A1 gene located on chromosomal region 15q15-21. The age of onset is infantile. This disease is characterized by polyhydramnios, premature delivery, polyuria, dehydration, hypercalciuria and nephrocalcinosis. The prevalence is 1:1,000,000.600,25
SLC17A5Salla diseaseNM_012434.4NM_012434.4:c.1259+1G>A, NM_012434.4:c.406A>G, NM_012434.4:c.115C>T, NM_012434.4:c.43G>TSalla disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC17A5 gene located on chromosomal region 6q13. The age of onset is from infantile to adult forms. The main symptoms are hypotonia, cerebellar ataxia, and mental retardation; visceromegaly and coarse features are also present in the infantile cases.600,25
SLC26A2Achondrogenesis, type 1B (diastrophic dysplasia)NM_000112.3NM_000112.3:c.496G>A, NM_000112.3:c.532C>T, NM_000112.3:c.833delC, NM_000112.3:c.835C>T, NM_000112.3:c.1020_1022delTGT, NM_000112.3:c.1273A>G, NM_000112.3:c.1361A>C, NM_000112.3:c.1535C>A, NM_000112.3:c.1724delA, NM_000112.3:c.1878delG, NM_000112.3:c.1957T>A, NM_000112.3:c.2033G>TAchondrogenesis type 1B (diastrophic dysplasia) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by severe micromelia with very short fingers and toes, a flat face, a short neck, thickened soft tissue around the neck, hypoplasia of the thorax, protuberant abdomen, a hydropic fetal appearance and distinctive histological features of the cartilage. The prevalence is 1:20,000.600,25
SLC26A4Deafness, autosomal recessive, type 4NM_000441.1NM_000441.1:c.269C>T, NM_000441.1:c.281C>T, NM_000441.1:c.412G>T, NM_000441.1:c.554G>C, NM_000441.1:c.563T>C, NM_000441.1:c.626G>T, NM_000441.1:c.707T>C, NM_000441.1:c.916dupG, NM_000441.1:c.918+2T>C, NM_000441.1:c.919-2A>G, NM_000441.1:c.961A>T, NM_000441.1:c.1001G>T, NM_000441.1:c.1001+1G>T, NM_000441.1:c.1003T>C, NM_000441.1:c.1034T>A, NM_000441.1:c.1151A>G, NM_000441.1:c.1174A>T, NM_000441.1:c.1198delT, NM_000441.1:c.1226G>A, NM_000441.1:c.1229C>T, NM_000441.1:c.1246A>C, NM_000441.1:c.1263+1G>A, NM_000441.1:c.1334T>G, NM_000441.1:c.1489G>A, NM_000441.1:c.1707+5G>A, NM_000441.1:c.1975G>C, NM_000441.1:c.2048T>C, NM_000441.1:c.2162C>T, NM_000441.1:c.2168A>GAutosomal recessive nonsyndromic sensorineural deafness type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.600,25
SLC37A4Glycogen storage disease, type 1bNM_001164278.1NM_001164278.1:c.1309C>T, NM_001164278.1:c.1190-2_1190-1delAG, NM_001164278.1:c.1129G>T, NM_001164278.1:c.1108_1109delCT, NM_001164278.1:c.1082G>A, NM_001164278.1:c.1081G>T, NM_001164278.1:c.706_708delGTG, NM_001164278.1:c.352T>C, NM_001164278.1:c.287G>A, NM_001164278.1:c.83G>AGlycogen storage disease due to glucose-6-phosphatase deficiency type 1b follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC37A4 gene located on chromosomal region 11q23. The age of onset is early. This disease is characterized by impairment of terminal steps of glycogenolysis and gluconeogenesis. Patients manifest a wide range of clinical symptoms and biochemical abnormalities, including hypoglycemia, severe hepatomegaly due to excessive accumulation of glycogen, kidney enlargement, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. Glycogen storage disease type 1B patients also present a tendency towards infections associated with neutropenia, relapsing aphthous gingivostomatitis, and inflammatory bowel disease. The incidence is 1:100,000.600,25
SLC4A11Corneal endothelial dystrophy, autosomal recessiveNM_001174090.1NM_001174090.1:c.2687G>A, NM_001174090.1:c.2686C>T, NM_001174090.1:c.2647A>G, NM_001174090.1:c.2609T>C, NM_001174090.1:c.2345G>A, NM_001174090.1:c.2314_2321dupTATGACAC, NM_001174090.1:c.2305G>A, NM_001174090.1:c.1894C>T, NM_001174090.1:c.1547C>T, NM_001174090.1:c.1544G>A, NM_001174090.1:c.1472G>A, NM_001174090.1:c.1119_1120insA, NM_001174090.1:c.718T>C, NM_001174090.1:c.554_561delGCTTCGCCCongenital hereditary endothelial dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by a diffuse ground-glass appearance of the corneas and marked corneal thickening from birth with nystagmus, and blurred vision.600,25
SMN1Spinal muscular atrophy-0del ex7, del ex7-8Spinal muscular atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMN1 gene located on chromosomal region 5q13.2. The age of onset is variable. This disease comprise a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. Autosomal recessive forms are classified according to the age of onset, the maximum muscular activity achieved, and survivorship. The severity of the disease is mainly determined by the copy number of SMN2, a copy gene which predominantly produces exon 7-skipped transcripts and only low amount of full-length transcripts that encode for a protein identical to SMN1. Only about 4% of patients bear one SMN1 copy with an intragenic mutation. Type 1 is a severe form, with onset before 6 months of age. Patients never achieve the ability to sit. Type 2 has intermediate severity, with onset between 6 and 18 months. Patients do not reach the motor milestone of standing, and survive into adulthood. Type 3 onset is after 18 months. Patients develop ability to stand and walk and survive into adulthood. Type 4 onset is in adulthood, disease progression is slow, and patients can stand and walk. The incidence is 1:10,000 and the prevalence is 1:80,000.600,25
SMPD1Niemann-Pick disease, type A and type BNM_000543.4NM_000543.4:c.96G>A, NM_000543.4:c.103_107delCTGGT, NM_000543.4:c.106delG, NM_000543.4:c.354delC, NM_000543.4:c.475T>C, NM_000543.4:c.557C>T, NM_000543.4:c.564delC, NM_000543.4:c.564dupC, NM_000543.4:c.573delT, NM_000543.4:c.688C>T, NM_000543.4:c.730G>A, NM_000543.4:c.740delG, NM_000543.4:c.739G>A, NM_000543.4:c.742G>A, NM_000543.4:c.757G>C, NM_000543.4:c.788T>A, NM_000543.4:c.842_849dupTCCCCGCA, NM_000543.4:c.911T>C, NM_000543.4:c.996delC, NM_000543.4:c.1092-1G>C, NM_000543.4:c.1117C>T, NM_000543.4:c.1152G>A, NM_000543.4:c.1264-1G>T, NM_000543.4:c.1267C>T, NM_000543.4:c.1299T>G, NM_000543.4:c.1327C>T, NM_000543.4:c.1420_1421delCT, NM_000543.4:c.1426C>T, NM_000543.4:c.1624C>T, NM_000543.4:c.1630delA, NM_000543.4:c.1805G>A, NM_000543.4:c.1829_1831delGCCNiemann-Pick disease, type A and type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMPD1 gene located on chromosomal region 11p15.4. The clinical phenotype ranges from a severe infantile form with neurologic degeneration resulting in death usually by 3 years of age (type A) to a later-onset nonneurologic form (type B) that is compatible with survival into adulthood. Since intermediate cases also have been reported, the disease is best regarded a single entity with a clinical spectrum.600,25
SPG11Amyotrophic lateral sclerosis, type 5, juvenileNM_025137.3NM_025137.3:c.7152-1G>C, NM_025137.3:c.6847_6848dupTC, NM_025137.3:c.6805_6806delCT, NM_025137.3:c.6100C>T, NM_025137.3:c.5623C>T, NM_025137.3:c.1736-1G>C, NM_025137.3:c.1339_1342dupGGCT, NM_025137.3:c.733_734delAT, NM_025137.3:c.529_533delATATT, NM_025137.3:c.342delT, NM_025137.3:c.118C>TAmyotrophic lateral sclerosis, type 5, juvenile follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG11 gene located on chromosomal region 15q21.1. The age of onset is infancy/childhood. This disease is characterized by progressive upper and lower motor neuron degeneration causing facial spasticity, dysarthria, and gait disorders with onset before 25 years of age. The prevalence is <1/1,000,000.600,25
SPG7Spastic paraplegia, type 7, autosomal recessiveNM_003119.3NM_003119.3:c.233T>A, NM_003119.3:c.286+1G>T, NM_003119.3:c.679C>T, NM_003119.3:c.758+2T>C, NM_003119.3:c.773_774delTG, NM_003119.3:c.1045G>A, NM_003119.3:c.1124delG, NM_003119.3:c.1529C>T, NM_003119.3:c.1676delA, NM_003119.3:c.1749G>C, NM_003119.3:c.2075G>CSpastic paraplegia type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG7 gene located on chromosomal region 16q24.3. The age of onset is adult. This disease is characterized by by progressive muscle stiffness (spasticity) and the development of paralysis of the lower limbs (paraplegia) due to degeneration of corticospinal axons. The prevalence is 1:100,000-9:100,000.600,25
STRCDeafness, autosomal recessive, type 16NM_153700.2NM_153700.2:c.5188C>T, NM_153700.2:c.5185C>T, NM_153700.2:c.5168_5171delTTCT, NM_153700.2:c.4560dupC, NM_153700.2:c.4545+1G>C, NM_153700.2:c.3556C>TAutosomal recessive nonsyndromic sensorineural deafness type DFNB16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRC gene located on chromosomal region 15q15.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.600,25
TCAPMuscular dystrophy, limb-girdle, type 2GNM_003673.3NM_003673.3:c.157C>TAutosomal recessive limb-girdle muscular dystrophy type 2G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by muscle weakness in the four limbs, mild scapular winging, severe atrophy of the quadriceps and anterior tibialis muscles, calf hypertrophy, and lack of respiratory and cardiac involvement.600,25
TCIRG1Osteopetrosis, autosomal recessive, type 1NM_006019.3NM_006019.3:c.115_116delGA, NM_006019.3:c.1213G>A, NM_006019.3:c.1331G>T, NM_006019.3:c.1674-1G>A, NM_006019.3:c.2236+1G>AAutosomal recessive osteopetrosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCIRG1 gene located on chromosomal region 11q13.2. The age of onset is early. This disease is characterized by bone marrow failure, fractures and visual impairment. The incidence is 1:200.000 live births and the prevalence is 1:250,000.600,25
TERTDyskeratosis congenita, autosomal recessive, type 4NM_198253.2NM_198253.2:c.2701C>T, NM_198253.2:c.2431C>TDyskeratosis congenita, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TERT gene located on chromosomal region 5p15.33. The age of onset is early. This disease has a wide phenotypic spectrum and age onset. It usually manifests during childhood with the triad of dysplastic nails, lacy reticular pigmentation and atrophy of the skin at the level of the neck and upper chest, and oral leukoplakia. Patients show an increased risk for progressive bone marrow failure and may develop myelodysplastic syndrome or acute myelogenous leukemia at any age (the risk increasing with age). There is also an increased risk for solid tumors, typically squamous cell carcinoma of head and neck (see this term) or anogenital cancer. Various additional clinical findings have been reported and may include: developmental delay, short stature, microcephaly, blepharitis, epiphora, periodontal disease, taurodontism, decreased teeth/root ratio, esophageal stenosis, liver disease, urethral stenosis, osteoporosis, avascular necrosis of femur and/or humerus, premature hair greying/alopecia, or abnormal eyelashes. Individuals with DC are at high risk of pulmonary fibrosis. The prevalence is 1:1,000,000.600,25
TFR2Hemochromatosis, type 3NM_001206855.1NM_001206855.1:c.2T>AHemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000.600,25
TFR2Hemochromatosis, type 3NM_003227.3NM_003227.3:c.2374G>A, NM_003227.3:c.2343G>A, NM_003227.3:c.2014C>T, NM_003227.3:c.1861_1872delGCCGTGGCCCAG, NM_003227.3:c.1665delC, NM_003227.3:c.1632_1633delGA, NM_003227.3:c.1473+1G>A, NM_003227.3:c.1469T>G, NM_003227.3:c.1330G>A, NM_003227.3:c.1235_1237delACA, NM_003227.3:c.1186C>T, NM_003227.3:c.949C>T, NM_003227.3:c.750C>G, NM_003227.3:c.313C>THemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000.600,25
TK2Mitochondrial DNA depletion syndrome , type 2 (myopathic type)NM_004614.4NM_004614.4:c.635T>A, NM_004614.4:c.604_606delAAG, NM_004614.4:c.500G>A, NM_004614.4:c.373C>T, NM_004614.4:c.361C>A, NM_004614.4:c.323C>T, NM_004614.4:c.268C>T, NM_004614.4:c.159C>GMitochondrial DNA depletion syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TK2 gene located on chromosomal region 16q21. The age of onset is infantile. This disease is characterized by generalized hypotonia, proximal muscle weakness, loss of previously acquired motor skills, poor feeding, and respiratory difficulties leading to respiratory failure and death within a few years after diagnosis. The prevalence is 1.2:100,000.600,25
TMEM67Joubert syndrome, type 6; Meckel syndrome, type 3; COACH syndromeNM_153704.5NM_153704.5:c.130C>T, NM_153704.5:c.148_149insTAAT, NM_153704.5:c.622A>T, NM_153704.5:c.755T>C, NM_153704.5:c.1046T>C, NM_153704.5:c.1538A>G, NM_153704.5:c.1769T>C, NM_153704.5:c.2498T>CJoubert syndrome (JBTS) type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22.1. The age of onset is early. JBTS is characterized by congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. The TMEM67 gene is also associated with Meckel syndrome type 3, a rare, autosomal recessive lethal condition characterized by central nervous system malformations, postaxial, polydactyly, multicystic kidney dysplasia, and ductal proliferation in the portal area of the liver. Other phenotype associated with mutations in the TMEM67 gene is COACH syndrome, an autosomal recessive disorder characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable. COACH syndrome is considered by some to be a subtype of Joubert syndrome with congenital hepatic fibrosis.600,25
TMPRSS3Deafness, autosomal recessive, type 8/10NM_024022.2NM_024022.2:c.1276G>A, NM_024022.2:c.1211C>T, NM_024022.2:c.753G>C, NM_024022.2:c.647G>T, NM_024022.2:c.446+1G>T, NM_024022.2:c.413C>A, NM_024022.2:c.242C>G, NM_024022.2:c.208delCAutosomal recessive nonsyndromic sensorineural deafness type DFNB10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMPRSS3 gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness.600,25
TPP1Ceroid lipofuscinosis, neuronal, type 2NM_000391.3NM_000391.3:c.1340G>A, NM_000391.3:c.1093T>C, NM_000391.3:c.851G>T, NM_000391.3:c.827A>T, NM_000391.3:c.622C>T, NM_000391.3:c.616C>T, NM_000391.3:c.509-1G>C, NM_000391.3:c.141_144delGAGTNeuronal ceroid lipofuscinosis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPP1 gene located on chromosomal region 11p15.4. Age of onset is infantile. This disease is characterized by epilepsy, followed by regression of developmental milestones, myoclonic ataxia, and pyramidal signs. Visual impairment typically appears at age four to six years and rapidly progresses to light/dark awareness only. Life expectancy ranges from age six years to early teenage. The prevalence is 1.5:1,000,000-9:1,000,000.600,25
TRIOBPDeafness, autosomal recessive, type 28NM_001039141.2NM_001039141.2:c.1039C>T, NM_001039141.2:c.1741C>T, NM_001039141.2:c.2362C>T, NM_001039141.2:c.2639_2640insTCAC, NM_001039141.2:c.3195delT, NM_001039141.2:c.3202C>T, NM_001039141.2:c.4436dupG, NM_001039141.2:c.4577C>G, NM_001039141.2:c.5316G>ADeafness autosomal recessive type 28 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIOBP gene located on chromosomal region 22q13.1. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems.600,25
TSEN54Pontocerebellar hypoplasia, type 2ANM_207346.2NM_207346.2:c.670_671delAA, NM_207346.2:c.736C>T, NM_207346.2:c.887G>A, NM_207346.2:c.919G>T, NM_207346.2:c.1027C>T, NM_207346.2:c.1039A>TPontocerebellar hypoplasia type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSEN54 gene located on chromosomal region 17q25.1. Pontocerebellar hypoplasia (PCH) refers to a group of severe neurodegenerative disorders affecting growth and function of the brainstem and cerebellum, resulting in little or no development. Different types were classified based on the clinical picture and the spectrum of pathologic changes.ﾠ600,25
TSFMCombined oxidative phosphorylation deficiency, type 3NM_001172696.1NM_001172696.1:c.1_2delAT, NM_001172696.1:c.24_25delCG, NM_001172696.1:c.581delC, NM_001172696.1:c.919C>TCombined oxidative phosphorylation deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSFM gene located on chromosomal region 12q14.1. The age of onset is early. This disease is characterized by hypotonia, lactic acidosis, and hepatic insufficiency, with progressive encephalomyopathy or hypertrophic cardiomyopathy.600,25
TSHRHypothyroidism, congenital, nongoitrous, type 1NM_000369.2NM_000369.2:c.122G>C, NM_000369.2:c.202C>T, NM_000369.2:c.326G>A, NM_000369.2:c.484C>G, NM_000369.2:c.500T>A, NM_000369.2:c.1170T>G, NM_000369.2:c.1742dupCHypothyroidism, congenital, nongoitrous, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSHR gene located on chromosomal region 14q31.1. This disease is characterized by increased levels of plasma TSH and low levels of thyroid hormone. Only a subset of patients develop frank hypothyroidism; the remainder are euthyroid and asymptomatic. 600,25
TTNLimb-girdle muscular dystrophy type 10 (LGMDR10; formerly LGMD2J); Early-onset myopathy with fatal cardiomyopathy NM_001267550.2NM_001267550.2:c.107889delA, NM_001267550.2:c.106070_106071delAT, NM_001267550.2:c.104092delC, NM_001267550.2:c.104092C>T, NM_001267550.2:c.98818_98821delTCCA, NM_001267550.2:c.92373_92379delTGAATTC, NM_001267550.2:c.69344C>G, NM_001267550.2:c.60681dupT, NM_001267550.2:c.56648-1G>A, NM_001267550.2:c.52372delG, NM_001267550.2:c.48253delA, NM_001267550.2:c.47915dupT, NM_001267550.2:c.32471-1G>A, NM_001267550.2:c.28300_28303delAGCA, NM_001267550.2:c.16881C>A, NM_001267550.2:c.15796C>T, NM_001267550.2:c.3165-1G>TLGMDR10 is a severe recessive form of LGMD phenotype with onset in the first to third decades involving weakness of all proximal muscles. Severe disability with loss of ambulation may occur within 20 years (third to sixth decades). Most of the cases are without facial muscle involvement or cardiomyopathy. Some patients later developed distal muscle involvement. Early-onset myopathy with fatal cardiomyopathy (EOMFC), known as Salih myopathy, also follows an autosomal recessive pattern of inheritance. This disease is characterized by skeletal muscle weakness and a form of heart disease called dilated cardiomyopathy. Affected individuals have delayed development of motor skills, such as sitting, standing, and walking. The age of onset is neonatal/infancy. LGMDR10 and EOMFC are caused by pathogenic variants in the TTN gene located on chromosomal region 2q31.2.600,25
TTPAAtaxia with isolated vitamin E deficiencyNM_000370.3NM_000370.3:c.744delA, NM_000370.3:c.661C>T, NM_000370.3:c.575G>AAtaxia with vitamin E deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTPA gene located on chromosomal region 8q13. The age of onset is variable. This disease is characterized by progressive spino-cerebellar ataxia, loss of proprioception, areflexia, and is associated with a marked deficiency in vitamin E. The prevalence is 0.56:1,000,000-3.5:1,000,000.600,25
TYRAlbinism, oculocutaneous, type 1ANM_000372.4NM_000372.4:c.1A>G, NM_000372.4:c.140G>A, NM_000372.4:c.164G>A, NM_000372.4:c.230G>A, NM_000372.4:c.242C>T, NM_000372.4:c.265T>C, NM_000372.4:c.272G>A, NM_000372.4:c.286dupA, NM_000372.4:c.325G>A, NM_000372.4:c.533G>A, NM_000372.4:c.572delG, NM_000372.4:c.616G>A, NM_000372.4:c.646T>A, NM_000372.4:c.650G>A, NM_000372.4:c.823G>T, NM_000372.4:c.896G>A, NM_000372.4:c.1012_1013insC, NM_000372.4:c.1111A>G, NM_000372.4:c.1118C>A, NM_000372.4:c.1146C>A, NM_000372.4:c.1147G>A, NM_000372.4:c.1164delT, NM_000372.4:c.1177delG, NM_000372.4:c.1209G>T, NM_000372.4:c.1217C>T, NM_000372.4:c.1255G>A, NM_000372.4:c.1265G>A, NM_000372.4:c.1336G>A, NM_000372.4:c.1342G>A, NM_000372.4:c.1467dupT, NM_000372.4:c.1501dupCOculocutaneous albinism type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYR gene located on chromosomal region 11q14.2. The age of onset is early. This disease is characterized by white hair and skin, blue, fully translucent irises, nystagmus and misrouting of the optic nerves.600,25
TYRP1Albinism, oculocutaneous, type 3NM_000550.2NM_000550.2:c.107delT, NM_000550.2:c.176C>G, NM_000550.2:c.497C>G, NM_000550.2:c.1057_1060delAACA, NM_000550.2:c.1067G>A, NM_000550.2:c.1103delA, NM_000550.2:c.1120C>T, NM_000550.2:c.1372_1375dupGACAType 3 oculocutaneous albinism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYRP1 gene located on chromosomal region 9p23. The age of onset is early. This disease is characterized by rufous or brown albinism and occurring mainly in the African population. The prevalence is of 1/8,500 individuals in Africa.600,25
UGT1A1Crigler-Najjar syndrome, type 2NM_000463.2NM_000463.2:c.44T>G, NM_000463.2:c.1021C>T, NM_000463.2:c.1070A>G, NM_000463.2:c.1456T>GCrigler-Najjar syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by unconjugated hyperbilirubinemia due to reduced and inducible activity of hepatic bilirubin glucuronosyltransferase with pigmented bile that contains bilirubin glucuronides, and generally do not present neurologic or intellectual impairment. Bilirubin encephalopathy may develop in later life when patients experience a superimposed infection or stress.600,25
USH1CUsher syndrome, type 1C; Deafness, autosomal recessive, type 18ANM_153676.3NM_153676.3:c.2688_2695dupAATTCACC, NM_153676.3:c.2622_2623delCA, NM_153676.3:c.2547-1G>T, NM_153676.3:c.238dupC, NM_153676.3:c.238delC, NM_153676.3:c.216G>AUsher syndrome type 1C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1C gene located on chromosomal region 11p15.1. This disease is characterized by the association of sensorineural deafness (usually congenital, severe and stable), progressive vision loss caused by retinitis pigmentosa apparent in childhood and balance problems. The prevalence is 4.4:100,000. The USH1C gene is also associated with autosomal recessive nonsyndromic sensorineural deafness type 18A. This phenotype is characterized by profound, prelingual, nonsyndromic sensorineural deafness with normal vestibular and visual function.600,25
USH2AUsher syndrome, type 2ANM_206933.2NM_206933.2:c.15520-1G>A, NM_206933.2:c.15371delT, NM_206933.2:c.15089C>A, NM_206933.2:c.14803C>T, NM_206933.2:c.14442C>A, NM_206933.2:c.13709delG, NM_206933.2:c.12574C>T, NM_206933.2:c.12234_12235delGA, NM_206933.2:c.11864G>A, NM_206933.2:c.10636G>A, NM_206933.2:c.10561T>C, NM_206933.2:c.10073G>A, NM_206933.2:c.9799T>C, NM_206933.2:c.8981G>A, NM_206933.2:c.7364G>A, NM_206933.2:c.6862G>T, NM_206933.2:c.5743_5744delAG, NM_206933.2:c.5573-2A>G, NM_206933.2:c.4338_4339delCT, NM_206933.2:c.3491_3492delCT, NM_206933.2:c.2898delG, NM_206933.2:c.2299delG, NM_206933.2:c.2276G>T, NM_206933.2:c.2167+5G>A, NM_206933.2:c.2135delC, NM_206933.2:c.920_923dupGCCA, NM_206933.2:c.820C>T, NM_206933.2:c.779T>GUsher syndrome type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. This disease is characterized by the association of sensorineural deafness (usually congenital, moderate/severe and stable) and progressive vision loss that begins in adolescence or adulthood caused by retinitis pigmentosa. Unlike the other forms of Usher syndrome, type 2 is not associated with vestibular abnormalities that cause difficulties with balance. USH2A accounts for more than half of all cases of Usher syndrome type 2. The estimated prevalence is 3:100,000-4:100,000.600,25
WFS1Wolfram syndrome, type 1NM_001145853.1NM_001145853.1:c.616C>T, NM_001145853.1:c.676C>T, NM_001145853.1:c.1060_1062delTTC, NM_001145853.1:c.1230_1233delCTCT, NM_001145853.1:c.1234_1237delGTCT, NM_001145853.1:c.1511C>T, NM_001145853.1:c.1943G>A, NM_001145853.1:c.1944G>A, NM_001145853.1:c.2084G>T, NM_001145853.1:c.2643_2644delCTWolfram syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WFS1 gene located on chromosomal region 4p16.1. The age of onset is infantile. This disease is characterized by diabetes mellitus type I, diabetes insipidus, optical atrophy and neurological signs. The prevalence is 1:1,000,000-9:1,000,000.600,25
WHRNUsher syndrome, type 2D; Deafness, autosomal recessive, type 31NM_015404.3NM_015404.3:c.817C>TUsher syndrome type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WHRN gene located on chromosomal region 9q32. This disease is characterized by the association of sensorineural deafness (usually congenital, moderate/severe and stable) and progressive vision loss that begins in adolescence or adulthood caused by retinitis pigmentosa. Unlike the other forms of Usher syndrome, type 2 is not associated with vestibular abnormalities that cause difficulties with balance. The WHRN gene is also associated with autosomal recessive nonsyndromic sensorineural deafness type 31. This phenotype is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.ﾠ600,25
WNT10AOdontoonychodermal dysplasiaNM_025216.2NM_025216.2:c.321C>A, NM_025216.2:c.383G>A, NM_025216.2:c.697G>TOdonto-onycho-dermal dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by hyperkeratosis and hyperhidrosis of the palms and soles, atrophic malar patches, hypodontia, conical teeth, onychodysplasia, and dry and sparse hair. The prevalence is <1:1,000,000.600,25
ZFYVE26Spastic paraplegia, type 15, autosomal recessiveNM_015346.3NM_015346.3:c.5485-1G>A, NM_015346.3:c.5422C>T, NM_015346.3:c.4936C>T, NM_015346.3:c.4312C>T, NM_015346.3:c.3642_3643insCCACACTTAG, NM_015346.3:c.3206G>A, NM_015346.3:c.3182delT, NM_015346.3:c.2114dupC, NM_015346.3:c.1477C>TSpastic paraplegia type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZFYVE26 gene located on chromosomal region 14q24.1. The age of onset is infancy. This disease is characterized by progressive spasticity primarily affecting the lower limbs. It is a complex form of spastic paraplegia, associated with other neurologic dysfunction, including variable mental retardation, hearing and visual defects, and thin corpus callosum. The prevalence is <1 / 1,000,000.600,25
  • Current version
  • Historic versions
chromOMIM (gene)genepreviousOMIM (phen)disease name (phenotype)inheritance
7602421CFTR219700Cystic fibrosisAutosomal recessive
X309550FMR1300624Fragile X syndromeX-linked
X305900G6PD300908Hemolytic anemia, G6PD deficient (favism)X-linked
13121011GJB2220290Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6Autosomal recessive; Digenic inheritance (GJB6 gene)
16141800HBA1604131Thalassemia, alpha-Autosomal recessive
16141850HBA2604131Thalassemia, alpha-Autosomal recessive
11141900HBB603903HBB-related hemoglobinopathyAutosomal recessive
5600354SMN1253300Spinal muscular atrophyAutosomal recessive
Download CGT Basic v1.0 Export Download CGT Basic v2.1 Export
  • CGT Essential
  • Historic versions
chromOMIM (gene)GenePrevious symbolOMIM (phen)DISEASEMOI
1607008ACADM201450Medium-chain acyl-CoA dehydrogenase deficiencyAutosomal recessive
2604285AGXT259900Hyperoxaluria, primary, type 1Autosomal recessive
22607574ARSA250100Metachromatic leukodystrophyAutosomal recessive
3609019BTD253260Biotinidase deficiencyAutosomal recessive
21613381CBS236200Homocystinuria due to cystathionine beta-synthaseAutosomal recessive
7602421CFTR219700Cystic fibrosisAutosomal recessive
11602858DHCR7270400Smith-Lemli-Opitz syndromeAutosomal recessive
X300384EMD310300Emery-Dreifuss muscular dystrophy, type 1, X-linkedX-linked
X309550FMR1300624Fragile X syndromeX-linked
17606800GAA232300Glycogen storage disease, type 2Autosomal recessive
9606999GALT230400GalactosemiaAutosomal recessive
X300644GLA301500Fabry diseaseX-linked
2600890HADHA609016; 609015Long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD) deficiency; Mitochondrial trifunctional protein deficiencyAutosomal recessive
11141900HBB603903HBB-related hemoglobinopathyAutosomal recessive
1609831MMACHC277400Methylmalonic aciduria and homocystinuria, cblC typeAutosomal recessive, digenic inheritance (PRDX1 gene)
12612349PAH261600PhenylketonuriaAutosomal recessive
16601785PMM2212065Congenital disorder of glycosylation, type 1AAutosomal recessive
5606718SLC26A2600972Achondrogenesis, type 1B (diastrophic dysplasia)Autosomal recessive
5600354SMN1253300Spinal muscular atrophyAutosomal recessive
Download CGT Essential v1.0 Export Download CGT Essential v1.1 Export Download CGT Essential v1.2 Export Download CGT Essential web Export