WES CGT: Tests list
Select your test and find the gene, mutations and diseases related to them.
- WES CGT Exome
- WES CGT Plus
- CGT Bank
- Other CGT
- CGT 600
- CGT 250
- CGT Basic
- CGT Essential

* Note:
The HFE gene can either be included in or excluded from the reports, depending on the agreement reached with the clinic.
El gen HFE puede incluirse o no en el informe, según el acuerdo establecido con la clínica.
- WES CGT Exome V5.4.5
- Historic Versions
| Chromosome | Gene symbol | OMIM (gene) | Disease name (phenotype) | Inheritance |
|---|---|---|---|---|
| 12 | AAAS | 605378 | Triple-A syndrome (achalasia-addisonianism-alacrimia) | Autosomal recessive |
| 16 | AARS1 | 601065 | Epileptic encephalopathy, early infantile, type 29 | Autosomal recessive |
| 6 | AARS2 | 612035 | Combined oxidative phosphorylation deficiency 8; Leukoencephalopathy, progressive, with ovarian failure | Autosomal recessive |
| 7 | AASS | 605113 | Hyperlysinemia, type 1 and type 2 | Autosomal recessive |
| 16 | ABAT | 137150 | GABA-transaminase deficiency | Autosomal recessive |
| 9 | ABCA1 | 600046 | Tangier disease | Autosomal recessive |
| 2 | ABCA12 | 607800 | Ichthyosis, congenital, autosomal recessive, type 4A; ICAR, type 4B (harlequin) | Autosomal recessive |
| 16 | ABCA3 | 601615 | Surfactant metabolism dysfunction, pulmonary, type 3 | Autosomal recessive |
| 1 | ABCA4 | 601691 | Stargardt disease 1; Retinitis pigmentosa 19; Cone-rod dystrophy 3 | Autosomal recessive |
| 2 | ABCB11 | 603201 | Cholestasis, benign recurrent intrahepatic, type 2; Cholestasis, progressive familial intrahepatic, type 2 | Autosomal recessive |
| 7 | ABCB4 | 171060 | Cholestasis, progressive familial intrahepatic, type 3 | Autosomal recessive |
| 10 | ABCC2 | 601107 | Dubin-Johnson syndrome | Autosomal recessive |
| 16 | ABCC6 | 603234 | Pseudoxanthoma elasticum; Generalized arterial calcification of infancy, type 2 | Autosomal recessive |
| 11 | ABCC8 | 600509 | Hyperinsulinemic hypoglycemia, type 1 (congenital hyperinsulinism); Permanent neonatal diabetes mellitus (PNDM) | Autosomal recessive* |
| X | ABCD1 | 300371 | Adrenoleukodystrophy | X-linked |
| 14 | ABCD4 | 603214 | Methylmalonic aciduria and homocystinuria, cblJ type | Autosomal recessive |
| 2 | ABCG5 | 605459 | Sitosterolemia 2 | Autosomal recessive |
| 2 | ABCG8 | 605460 | Sitosterolemia 1 | Autosomal recessive |
| 20 | ABHD12 | 613599 | PHARC syndrome (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa and cataract) | Autosomal recessive |
| 3 | ABHD5 | 604780 | Chanarin-Dorfman syndrome | Autosomal recessive |
| 11 | ACAD8 | 604773 | Isobutyryl-CoA dehydrogenase deficiency | Autosomal recessive |
| 3 | ACAD9 | 611103 | Acyl-CoA dehydrogenase 9 deficiency (mitochondrial complex I deficiency, nuclear, type 20) | Autosomal recessive |
| 1 | ACADM | 607008 | Medium-chain acyl-CoA dehydrogenase deficiency | Autosomal recessive |
| 12 | ACADS | 606885 | Short-chain acyl-CoA dehydrogenase deficiency | Autosomal recessive |
| 10 | ACADSB | 600301 | Short/branched-chain acyl-CoA dehydrogenase deficiency | Autosomal recessive |
| 17 | ACADVL | 609575 | Very long-chain acyl-CoA dehydrogenase (VLCAD) deficiency | Autosomal recessive |
| 11 | ACAT1 | 607809 | Alpha-methylacetoacetic aciduria (3-ketothiolase deficiency) | Autosomal recessive |
| 17 | ACE | 106180 | Renal tubular dysgenesis | Autosomal recessive |
| 22 | ACO2 | 100850 | Infantile cerebellar-retinal degeneration | Autosomal recessive |
| 17 | ACOX1 | 609751 | Peroxisomal acyl-CoA oxidase deficiency | Autosomal recessive |
| 3 | ACOX2 | 601641 | Bile acid synthesis defect, congenital, type 6 | Autosomal recessive |
| 19 | ACP5 | 171640 | Spondyloenchondrodysplasia with immune dysregulation | Autosomal recessive |
| 16 | ACSF3 | 614245 | Combined malonic and methylmalonic aciduria | Autosomal recessive |
| 1 | ACTA1 | 102610 | Nemaline myopathy 3; Congenital fiber-type disproportion myopathy 1 | Autosomal recessive* |
| 3 | ACY1 | 104620 | Aminoacylase 1 deficiency | Autosomal recessive |
| 20 | ADA | 608958 | Severe combined immunodeficiency due to adenosine deaminase deficiency (ADA) | Autosomal recessive |
| 22 | ADA2 | 607575 | Vasculitis, autoinflammation, immunodeficiency, and hematologic defects syndrome; Sneddon syndrome | Autosomal recessive |
| 8 | ADAM9 | 602713 | Cone-rod dystrophy 9 | Autosomal recessive |
| 19 | ADAMTS10 | 608990 | Weill-Marchesani syndrome, type 1, recessive | Autosomal recessive |
| 9 | ADAMTS13 | 604134 | Thrombotic thrombocytopenic purpura, familial (Schulman-Upshaw syndrome) | Autosomal recessive |
| 15 | ADAMTS17 | 607511 | Weill-Marchesani syndrome, type 4, recessive | Autosomal recessive |
| 16 | ADAMTS18 | 607512 | Microcornea, myopic chorioretinal atrophy, and telecanthus | Autosomal recessive |
| 5 | ADAMTS2 | 604539 | Ehlers-Danlos syndrome, dermatosparaxis type | Autosomal recessive |
| 9 | ADAMTSL2 | 612277 | Geleophysic dysplasia type 1 | Autosomal recessive |
| 1 | ADAMTSL4 | 610113 | Ectopia lentis et pupillae; Ectopia lentis, isolated, type 2 | Autosomal recessive |
| 1 | ADAR | 146920 | Aicardi-Goutieres syndrome, type 6 | Autosomal recessive |
| 19 | ADAT3 | 615302 | Mental retardation, autosomal recessive 36 | Autosomal recessive |
| 16 | ADGRG1 | 604110 | Polymicrogyria, bilateral frontoparietal | Autosomal recessive |
| 6 | ADGRG6 | 612243 | Lethal congenital contracture syndrome 9 | Autosomal recessive |
| 5 | ADGRV1 | 602851 | Usher syndrome, type 2C | Autosomal recessive; Digenic inheritance (PDZD7 gene) |
| 10 | ADK | 102750 | Hypermethioninemia due to adenosine kinase deficiency | Autosomal recessive |
| 22 | ADSL | 608222 | Adenylosuccinase deficiency | Autosomal recessive |
| 14 | ADSS1 | 612498 | Myopathy, distal, 5 | Autosomal recessive |
| 18 | AFG3L2 | 604581 | Spastic ataxia, type 5, autosomal recessive | Autosomal recessive |
| 4 | AFP | 104150 | Alpha-fetoprotein deficiency | Autosomal recessive |
| 4 | AGA | 613228 | Aspartylglucosaminuria (glycosylasparaginase deficiency) | Autosomal recessive |
| 2 | AGBL5 | 615900 | Retinitis pigmentosa 75 | Autosomal recessive |
| 7 | AGK | 610345 | Cataract 38; Sengers syndrome | Autosomal recessive |
| 1 | AGL | 610860 | Glycogen storage disease, type 3 | Autosomal recessive |
| 9 | AGPAT2 | 603100 | Congenital generalized lipodystrophy (Berardinelli-Seip syndrome) | Autosomal recessive |
| 2 | AGPS | 603051 | Rhizomelic chondrodysplasia punctata, type 3 | Autosomal recessive |
| 1 | AGRN | 103320 | Myasthenic syndrome, congenital, type 8 | Autosomal recessive |
| 1 | AGT | 106150 | Renal tubular dysgenesis | Autosomal recessive |
| 3 | AGTR1 | 106165 | Renal tubular dysgenesis | Autosomal recessive |
| 2 | AGXT | 604285 | Hyperoxaluria, primary, type 1 | Autosomal recessive |
| 20 | AHCY | 180960 | Hypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase | Autosomal recessive |
| 6 | AHI1 | 608894 | Joubert syndrome, type 3 | Autosomal recessive |
| 12 | AICDA | 605257 | Immunodeficiency with hyper-IgM, type 2 | Autosomal recessive |
| 4 | AIMP1 | 603605 | Leukodystrophy, hypomyelinating, type 3 | Autosomal recessive |
| 7 | AIMP2 | 600859 | Leukodystrophy, hypomyelinating, type 17 | Autosomal recessive |
| 17 | AIPL1 | 604392 | Leber congenital amaurosis, type 4 | Autosomal recessive |
| 21 | AIRE | 607358 | Autoimmune polyendocrinopathy syndrome, type 1 | Autosomal recessive* |
| 9 | AK1 | 103000 | Hemolytic anemia due to adenylate kinase deficiency | Autosomal recessive |
| 1 | AK2 | 103020 | Reticular dysgenesis | Autosomal recessive |
| 10 | AKR1C2 | 600450 | 46,XY disorder of sex development due to testicular 17,20-desmolase deficiency | Autosomal recessive |
| 7 | AKR1D1 | 604741 | Bile acid synthesis defect, congenital, type 2 | Autosomal recessive |
| 9 | ALAD | 125270 | Porphyria, acute hepatic | Autosomal recessive |
| 4 | ALB | 103600 | Analbuminemia | Autosomal recessive |
| 10 | ALDH18A1 | 138250 | Spastic paraplegia, type 9B, autosomal recessive; Cutis laxa, type 3A (De Barsy syndrome) | Autosomal recessive |
| 15 | ALDH1A3 | 600463 | Microphthalmia, isolated 8 | Autosomal recessive |
| 17 | ALDH3A2 | 609523 | Sjogren-Larsson syndrome | Autosomal recessive |
| 1 | ALDH4A1 | 606811 | Hyperprolinemia, type 2 | Autosomal recessive |
| 6 | ALDH5A1 | 610045 | Succinic semialdehyde dehydrogenase deficiency | Autosomal recessive |
| 14 | ALDH6A1 | 603178 | Methylmalonate semialdehyde dehydrogenase deficiency | Autosomal recessive |
| 5 | ALDH7A1 | 107323 | Epilepsy, pyridoxine-dependent | Autosomal recessive |
| 16 | ALDOA | 103850 | Glycogen storage disease type 12 | Autosomal recessive |
| 9 | ALDOB | 612724 | Fructose intolerance, hereditary | Autosomal recessive |
| 16 | ALG1 | 605907 | Congenital disorder of glycosylation, type 1K | Autosomal recessive |
| 13 | ALG11 | 613666 | Congenital disorder of glycosylation, type 1P | Autosomal recessive |
| 22 | ALG12 | 607144 | Congenital disorder of glycosylation, type 1G | Autosomal recessive |
| 9 | ALG2 | 607905 | Myasthenic syndrome, congenital, type 14, with tubular aggregates | Autosomal recessive |
| 3 | ALG3 | 608750 | Congenital disorder of glycosylation, type 1D | Autosomal recessive |
| 1 | ALG6 | 604566 | Congenital disorder of glycosylation, type 1C | Autosomal recessive |
| 11 | ALG8 | 608103 | Congenital disorder of glycosylation, type 1H | Autosomal recessive |
| 11 | ALG9 | 606941 | Congenital disorder of glycosylation, type 1L; Gillessen-Kaesbach-Nishimura syndrome | Autosomal recessive |
| 2 | ALMS1 | 606844 | Alström syndrome | Autosomal recessive |
| 17 | ALOX12B | 603741 | Ichthyosis, congenital, autosomal recessive, type 2 | Autosomal recessive |
| 17 | ALOXE3 | 607206 | Ichthyosis, congenital, autosomal recessive, type 3 | Autosomal recessive |
| 15 | ALPK3 | 617608 | Cardiomyopathy, familial hypertrophic, type 27 | Autosomal recessive |
| 1 | ALPL | 171760 | ALPL-related conditions | Autosomal recessive |
| 2 | ALS2 | 606352 | Amyotrophic lateral sclerosis, type 2, juvenile; Primary lateral sclerosis, juvenile; Spastic paralysis, infantile onset ascending | Autosomal recessive |
| 12 | ALX1 | 601527 | Frontonasal dysplasia, type 3 | Autosomal recessive |
| 1 | ALX3 | 606014 | Frontonasal dysplasia, type 1 | Autosomal recessive |
| 11 | ALX4 | 605420 | Frontonasal dysplasia, type 2 | Autosomal recessive |
| 5 | AMACR | 604489 | Bile acid synthesis defect, congenital, type 4; Alpha-methylacyl-CoA racemase deficiency | Autosomal recessive |
| 4 | AMBN | 601259 | Amelogenesis imperfecta, type IF | Autosomal recessive |
| 19 | AMH | 600957 | Persistent Mullerian duct syndrome, type 1 | Autosomal recessive |
| 12 | AMHR2 | 600956 | Persistent Mullerian duct syndrome, type II | Autosomal recessive |
| 14 | AMN | 605799 | Megaloblastic anemia 1 (Imerslund-Grasbeck syndrome) | Autosomal recessive |
| 1 | AMPD1 | 102770 | Myopathy due to myoadenylate deaminase deficiency | Autosomal recessive |
| 1 | AMPD2 | 102771 | Pontocerebellar hypoplasia, type 9 | Autosomal recessive |
| 3 | AMT | 238310 | Glycine encephalopathy | Autosomal recessive |
| 1 | ANGPTL3 | 604774 | Hypobetalipoproteinemia, familial, type 2 | Autosomal recessive |
| 9 | ANKS6 | 615370 | Nephronophthisis 16 | Autosomal recessive |
| 3 | ANO10 | 613726 | Spinocerebellar ataxia, autosomal recessive, type 10 | Autosomal recessive |
| 11 | ANO5 | 608662 | Limb-girdle muscular dystrophy, type 12 (LGMD R12) | Autosomal recessive |
| 2 | ANTXR1 | 606410 | GAPO syndrome | Autosomal recessive |
| 4 | ANTXR2 | 608041 | Hyaline fibromatosis syndrome | Autosomal recessive |
| 7 | AP1S1 | 603531 | MEDNIK syndrome | Autosomal recessive |
| X | AP1S2 | 300629 | Mental retardation, X-linked, syndromic, type 5 (Pettigrew syndrome) | X-linked |
| 5 | AP3B1 | 603401 | Hermansky-Pudlak syndrome, type 2 | Autosomal recessive |
| 15 | AP3B2 | 602166 | Epileptic encephalopathy, early infantile, type 48 | Autosomal recessive |
| 19 | AP3D1 | 607246 | Hermansky-Pudlak syndrome, type 10 | Autosomal recessive |
| 1 | AP4B1 | 607245 | Spastic paraplegia, type 47, autosomal recessive | Autosomal recessive |
| 15 | AP4E1 | 607244 | Spastic paraplegia, type 51, autosomal recessive | Autosomal recessive |
| 7 | AP4M1 | 602296 | Spastic paraplegia, type 50, autosomal recessive | Autosomal recessive |
| 14 | AP4S1 | 607243 | Spastic paraplegia, type 52, autosomal recessive | Autosomal recessive |
| 7 | AP5Z1 | 613653 | Spastic paraplegia, type 48, autosomal recessive | Autosomal recessive |
| 19 | APOC2 | 608083 | Hyperlipoproteinemia, type 1B | Autosomal recessive |
| 19 | APOE | 107741 | Sea-blue histiocyte disease | Autosomal recessive |
| 16 | APRT | 102600 | Adenine phosphoribosyltransferase deficiency | Autosomal recessive |
| 9 | APTX | 606350 | Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia | Autosomal recessive |
| 12 | AQP2 | 107777 | Diabetes insipidus, nephrogenic, type 2 | Autosomal recessive* |
| X | AR | 313700 | Androgen insensitivity syndrome | X-linked |
| 20 | ARFGEF2 | 605371 | Periventricular heterotopia with microcephaly | Autosomal recessive |
| 6 | ARG1 | 608313 | Argininemia (arginase deficiency) | Autosomal recessive |
| 17 | ARHGDIA | 601925 | Nephrotic syndrome, type 8 | Autosomal recessive |
| 19 | ARHGEF18 | 616432 | Retinitis pigmentosa 78 | Autosomal recessive |
| 3 | ARL13B | 608922 | Joubert syndrome type 8 | Autosomal recessive |
| 16 | ARL2BP | 615407 | Retinitis pigmentosa with or without situs inversus | Autosomal recessive |
| 3 | ARL6 | 608845 | Bardet-Biedl syndrome, type 3 | Autosomal recessive |
| 2 | ARMC9 | 617612 | Joubert syndrome 30 | Autosomal recessive |
| 7 | ARPC1B | 604223 | Immunodeficiency, type 71, with inflammatory disease and congenital thrombocytopenia | Autosomal recessive |
| 22 | ARSA | 607574 | Metachromatic leukodystrophy | Autosomal recessive |
| 5 | ARSB | 611542 | Mucopolysaccharidosis, type 6 (Maroteaux-Lamy syndrome) | Autosomal recessive |
| X | ARSL | 300180 | Chondrodysplasia punctata, brachytelephalangic | X-linked |
| 1 | ARV1 | 611647 | Epileptic encephalopathy, early infantile, 38 | Autosomal recessive |
| X | ARX | 300382 | Epileptic encephalopathy, early infantile, type 1; ARX-related developmental disorders | X-linked |
| 8 | ASAH1 | 613468 | Farber lipogranulomatosis; Spinal muscular atrophy with progressive myoclonic epilepsy | Autosomal recessive |
| 7 | ASL | 608310 | Argininosuccinic aciduria | Autosomal recessive |
| 7 | ASNS | 108370 | Asparagine synthetase deficiency | Autosomal recessive |
| 17 | ASPA | 608034 | Canavan disease | Autosomal recessive |
| 8 | ASPH | 600582 | Traboulsi syndrome | Autosomal recessive |
| 1 | ASPM | 605481 | Primary microcephaly type 5, autosomal recessive | Autosomal recessive |
| 9 | ASS1 | 603470 | Citrullinemia, type 1 | Autosomal recessive |
| 10 | ATAD1 | 614452 | Hyperekplexia 4 | Autosomal recessive |
| 1 | ATF6 | 605537 | Achromatopsia, type 7 | Autosomal recessive |
| 2 | ATIC | 601731 | AICA-ribosiduria due to ATIC deficiency | Autosomal recessive |
| 11 | ATM | 607585 | ATM-related conditions | Autosomal recessive |
| 10 | ATOH7 | 609875 | Persistent hyperplastic primary vitreous, autosomal recessive | Autosomal recessive |
| 1 | ATP13A2 | 610513 | Kufor-Rakeb syndrome; Spastic paraplegia, type 78, autosomal recessive | Autosomal recessive |
| 16 | ATP2A1 | 108730 | Brody myopathy | Autosomal recessive |
| 12 | ATP6V0A2 | 611716 | Cutis laxa, autosomal recessive, type 2A; Wrinkly skin syndrome | Autosomal recessive |
| 7 | ATP6V0A4 | 605239 | Renal tubular acidosis, distal, autosomal recessive | Autosomal recessive |
| 3 | ATP6V1A | 607027 | Cutis laxa, autosomal recessive, type 2D | Autosomal recessive |
| 2 | ATP6V1B1 | 192132 | Renal tubular acidosis with deafness | Autosomal recessive |
| 22 | ATP6V1E1 | 108746 | Cutis laxa, autosomal recessive, type 2C | Autosomal recessive |
| X | ATP7A | 300011 | Menkes disease; Occipital horn syndrome | X-linked |
| 13 | ATP7B | 606882 | Wilson disease | Autosomal recessive |
| 18 | ATP8B1 | 602397 | Cholestasis, progressive familial intrahepatic, type 1; Cholestasis, benign recurrent intrahepatic, type 1 | Autosomal recessive |
| 3 | ATR | 601215 | Seckel syndrome, type 1 | Autosomal recessive |
| X | ATRX | 300032 | Mental retardation-hypotonic facies syndrome, X-linked; Alpha-thalassemia/mental retardation syndrome | X-linked |
| 9 | AUH | 600529 | 3-methylglutaconic aciduria, type 1 | Autosomal recessive |
| 19 | AURKC | 603495 | Spermatogenic failure, type 5 | Autosomal recessive |
| 12 | AVIL | 613397 | Nephrotic syndrome, type 21 | Autosomal recessive |
| 15 | B2M | 109700 | Immunodeficiency, type 43 | Autosomal recessive |
| 1 | B3GALNT2 | 610194 | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11 | Autosomal recessive |
| 1 | B3GALT6 | 615291 | Ehlers-Danlos syndrome, spondylodysplastic type, 2 | Autosomal recessive |
| 11 | B3GAT3 | 606374 | Multiple joint dislocations, short stature, craniofacial dysmorphism, with or without congenital heart defects | Autosomal recessive |
| 13 | B3GLCT | 610308 | Peters-plus syndrome | Autosomal recessive |
| 12 | B4GALNT1 | 601873 | Spastic paraplegia, type 26, autosomal recessive | Autosomal recessive |
| 9 | B4GALT1 | 137060 | Congenital disorder of glycosylation, type 2D | Autosomal recessive |
| 5 | B4GALT7 | 604327 | Ehlers-Danlos syndrome, spondylodysplastic, type 1 | Autosomal recessive |
| 11 | B4GAT1 | 605517 | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 13 | Autosomal recessive |
| 17 | B9D1 | 614144 | Joubert syndrome, type 27; ?Meckel syndrome 9 | Autosomal recessive |
| 19 | B9D2 | 611951 | Joubert syndrome, type 34; ?Meckel syndrome, type 10 | Autosomal recessive |
| 11 | BBS1 | 209901 | Bardet-Biedl syndrome, type 1 | Autosomal recessive |
| 12 | BBS10 | 610148 | Bardet-Biedl syndrome, type 10 | Autosomal recessive |
| 4 | BBS12 | 610683 | Bardet-Biedl syndrome, type 12 | Autosomal recessive |
| 16 | BBS2 | 606151 | Bardet-Biedl syndrome, type 2 | Autosomal recessive |
| 15 | BBS4 | 600374 | Bardet-Biedl syndrome, type 4 | Autosomal recessive |
| 2 | BBS5 | 603650 | Bardet-Biedl syndrome, type 5 | Autosomal recessive |
| 4 | BBS7 | 607590 | Bardet-Biedl syndrome, type 7 | Autosomal recessive |
| 7 | BBS9 | 607968 | Bardet-Biedl syndrome, type 9 | Autosomal recessive |
| 19 | BCAT2 | 113530 | ?Hypervalinemia or hyperleucine-isoleucinemia | Autosomal recessive |
| 3 | BCHE | 177400 | Butyrylcholinesterase deficiency | Autosomal recessive |
| 19 | BCKDHA | 608348 | Maple syrup urine disease, type 1A | Autosomal recessive |
| 6 | BCKDHB | 248611 | Maple syrup urine disease, type 1B | Autosomal recessive |
| 16 | BCKDK | 614901 | Branched-chain ketoacid dehydrogenase kinase deficiency | Autosomal recessive |
| 1 | BCL10 | 603517 | ?Immunodeficiency, type 37 | Autosomal recessive |
| 2 | BCS1L | 603647 | Mitochondrial complex III deficiency nuclear type 1; GRACILE syndrome; Bjornstad syndrome | Autosomal recessive |
| 11 | BEST1 | 607854 | Bestrophinopathy, AR | Autosomal recessive |
| 20 | BFSP1 | 603307 | Cataract 33, multiple types | Autosomal recessive* |
| 17 | BHLHA9 | 615416 | Syndactyly, mesoaxial synostotic, with phalangeal reduction | Autosomal recessive |
| 2 | BIN1 | 601248 | Centronuclear myopathy, type 2 | Autosomal recessive |
| 15 | BLM | 604610 | Bloom syndrome | Autosomal recessive |
| 10 | BLNK | 604515 | ?Agammaglobulinemia 4 | Autosomal recessive |
| 19 | BLOC1S3 | 609762 | Hermansky-Pudlak syndrome, type 8 | Autosomal recessive |
| 15 | BLOC1S6 | 604310 | ?Hermansky-Pudlak syndrome, type 9 | Autosomal recessive |
| 4 | BLTP1 | 611565 | Alkuraya-Kucinskas syndrome | Autosomal recessive |
| 7 | BLVRA | 109750 | Hyperbiliverdinemia | Autosomal recessive* |
| 8 | BMP1 | 112264 | Osteogenesis imperfecta, type 13 | Autosomal recessive |
| 7 | BMPER | 608699 | Diaphanospondylodysostosis | Autosomal recessive |
| 4 | BMPR1B | 603248 | Acromesomelic dysplasia, Demirhan type | Autosomal recessive |
| 2 | BOLA3 | 613183 | Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia | Autosomal recessive |
| 7 | BPGM | 613896 | Erythrocytosis due to bisphosphoglycerate mutase deficiency | Autosomal recessive |
| 8 | BPNT2 | 614010 | Chondrodysplasia with joint dislocations, GPAPP type | Autosomal recessive |
| 7 | BRAT1 | 614506 | Rigidity and multifocal seizure syndrome, lethal neonatal; Neurodevelopmental disorder with cerebellar atrophy and with or without seizures | Autosomal recessive |
| 14 | BRF1 | 604902 | Cerebellofaciodental syndrome | Autosomal recessive |
| 17 | BRIP1 | 605882 | Fanconi anemia, complementation group J | Autosomal recessive |
| X | BRWD3 | 300553 | Mental retardation, X-linked, type 93 | X-linked |
| 11 | BSCL2 | 606158 | Congenital generalized lipodystrophy, type 2; Encephalopathy, progressive, with or without lipodystrophy | Autosomal recessive |
| 1 | BSND | 606412 | Bartter syndrome, type 4A | Autosomal recessive |
| 3 | BTD | 609019 | Biotinidase deficiency | Autosomal recessive |
| X | BTK | 300300 | Agammaglobulinemia X-linked, type 1 | X-linked |
| 15 | BUB1B | 602860 | Mosaic variegated aneuploidy syndrome 1 | Autosomal recessive |
| 12 | C12orf57 | 615140 | Temtamy syndrome | Autosomal recessive |
| 19 | C19orf12 | 614297 | Neurodegeneration with brain iron accumulation, type 4 | Autosomal recessive* |
| 1 | C1QA | 120550 | C1q deficiency | Autosomal recessive |
| 1 | C1QB | 120570 | C1q deficiency | Autosomal recessive |
| 17 | C1QBP | 601269 | Combined oxidative phosphorylation deficiency 33 | Autosomal recessive |
| 1 | C1QC | 120575 | C1q deficiency | Autosomal recessive |
| 12 | C1S | 120580 | C1s deficiency | Autosomal recessive |
| 6 | C2 | 613927 | C2 deficiency | Autosomal recessive |
| 11 | C2CD3 | 615944 | Orofaciodigital syndrome, type 14 | Autosomal recessive |
| 19 | C3 | 120700 | Complement component 3 deficiency | Autosomal recessive |
| 9 | C5 | 120900 | Complement component 5 deficiency | Autosomal recessive |
| 5 | C6 | 217050 | Complement component 6 deficiency | Autosomal recessive |
| 5 | C7 | 217070 | Complement component 7 deficiency | Autosomal recessive |
| 1 | C8B | 120960 | Complement component 8 deficiency, type 2 | Autosomal recessive |
| 15 | CA12 | 603263 | Hyperchlorhidrosis, isolated | Autosomal recessive |
| 8 | CA2 | 611492 | Osteopetrosis with renal tubular acidosis (osteopetrosis, autosomal recessive, type 3) | Autosomal recessive |
| 16 | CA5A | 114761 | Hyperammonemia due to carbonic anhydrase VA deficiency | Autosomal recessive |
| 8 | CA8 | 114815 | Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3 | Autosomal recessive |
| 11 | CABP2 | 607314 | Deafness, autosomal recessive, type 93 | Autosomal recessive |
| 11 | CABP4 | 608965 | Congenital stationary night blindness, type 2B | Autosomal recessive |
| 3 | CACNA1D | 114206 | Sinoatrial node dysfunction and deafness | Autosomal recessive |
| 12 | CACNA2D4 | 608171 | Retinal cone dystrophy 4 | Autosomal recessive |
| 2 | CAD | 114010 | Epileptic encephalopathy, early infantile, 50 | Autosomal recessive |
| 2 | CALCRL | 114190 | ?Lymphatic malformation 8 | Autosomal recessive |
| 17 | CANT1 | 613165 | Desbuquois dysplasia, type 1; Epiphyseal dysplasia, multiple, type 7 | Autosomal recessive |
| 11 | CAPN1 | 114220 | Spastic paraplegia, type 76, autosomal recessive | Autosomal recessive |
| 15 | CAPN3 | 114240 | Limb-girdle muscular dystrophy, type 1 (LGMD R1) | Autosomal recessive |
| 7 | CARD11 | 607210 | Immunodeficiency, type 11A | Autosomal recessive |
| 9 | CARD9 | 607212 | Candidiasis, familial, type 2, autosomal recessive | Autosomal recessive |
| 13 | CARS2 | 612800 | Combined oxidative phosphorylation deficiency 27 | Autosomal recessive |
| 1 | CASQ2 | 114251 | Ventricular tachycardia, catecholaminergic polymorphic, type 2 | Autosomal recessive |
| 3 | CASR | 601199 | Hyperparathyroidism, neonatal | Autosomal recessive* |
| 5 | CAST | 114090 | Peeling skin with leukonychia, acral punctate keratoses, cheilitis, and knuckle pads | Autosomal recessive |
| 11 | CAT | 115500 | Acatalasemia | Autosomal recessive |
| 11 | CATSPER1 | 606389 | Spermatogenic failure, type 7 | Autosomal recessive |
| 17 | CAVIN1 | 603198 | Lipodystrophy, congenital generalized, type 4 | Autosomal recessive |
| 11 | CBLIF | 609342 | Intrinsic factor deficiency | Autosomal recessive |
| 21 | CBS | 613381 | Homocystinuria due to cystathionine beta-synthase | Autosomal recessive |
| 19 | CC2D1A | 610055 | Mental retardation, autosomal recessive, type 3 | Autosomal recessive |
| 4 | CC2D2A | 612013 | Joubert syndrome, type 9; Meckel syndrome, type 6; COACH syndrome, 2 | Autosomal recessive |
| 18 | CCBE1 | 612753 | Hennekam lymphangiectasia-lymphedema syndrome, type 1 | Autosomal recessive |
| 17 | CCDC103 | 614677 | Ciliary dyskinesia, primary, type 17 | Autosomal recessive |
| 2 | CCDC115 | 613734 | Congenital disorder of glycosylation, type IIo | Autosomal recessive |
| 3 | CCDC174 | 616735 | Hypotonia, infantile, with psychomotor retardation | Autosomal recessive |
| 3 | CCDC39 | 613798 | Ciliary dyskinesia, primary, type 14 | Autosomal recessive |
| 17 | CCDC40 | 613799 | Ciliary dyskinesia, primary, type 15 | Autosomal recessive |
| 12 | CCDC65 | 611088 | Ciliary dyskinesia, primary, type 27 | Autosomal recessive |
| 19 | CCDC8 | 614145 | 3M syndrome 3 | Autosomal recessive |
| 14 | CCDC88C | 611204 | Hydrocephalus, congenital, type 1 | Autosomal recessive |
| 6 | CCN6 | 603400 | Progressive pseudorheumatoid dysplasia | Autosomal recessive |
| 5 | CCNO | 607752 | Ciliary dyskinesia, primary, type 29 | Autosomal recessive |
| 16 | CD19 | 107265 | Immunodeficiency, common variable, type 3 | Autosomal recessive |
| 1 | CD247 | 186780 | ?Immunodeficiency, type 25 | Autosomal recessive |
| 12 | CD27 | 186711 | Lymphoproliferative syndrome 2 | Autosomal recessive |
| 6 | CD2AP | 604241 | Glomerulosclerosis, focal segmental, type 3, susceptibility to | Autosomal recessive* |
| 19 | CD320 | 606475 | Methylmalonic aciduria, transient, due to transcobalamin receptor defect | Autosomal recessive |
| 7 | CD36 | 173510 | Platelet glycoprotein 4 deficiency | Autosomal recessive |
| 11 | CD3D | 186790 | Immunodeficiency, type 19 | Autosomal recessive |
| 11 | CD3E | 186830 | Immunodeficiency, type 18 | Autosomal recessive |
| 11 | CD3G | 186740 | Immunodeficiency, type 17, CD3 gamma deficient | Autosomal recessive |
| 20 | CD40 | 109535 | Immunodeficiency with hyper-IgM, type 3 | Autosomal recessive |
| X | CD40LG | 300386 | Hyper-IgM syndrome, type 1 (immunodeficiency, X-linked, with hyper-IgM, type 1) | X-linked |
| 1 | CD55 | 125240 | Complement hyperactivation, angiopathic thrombosis, and protein-losing enteropathy (CHAPLE) | Autosomal recessive |
| 11 | CD59 | 107271 | CD59 deficiency | Autosomal recessive |
| 19 | CD79A | 112205 | Agammaglobulinemia 3 | Autosomal recessive |
| 17 | CD79B | 147245 | Agammaglobulinemia 6 | Autosomal recessive |
| 11 | CD81 | 186845 | Immunodeficiency, common variable, type 6 | Autosomal recessive |
| 2 | CD8A | 186910 | CD8 deficiency, familial | Autosomal recessive |
| 15 | CDAN1 | 607465 | Dyserythropoietic anemia, congenital, type 1A | Autosomal recessive |
| 1 | CDC14A | 603504 | Deafness, autosomal recessive, type 105 | Autosomal recessive |
| 22 | CDC45 | 603465 | Meier-Gorlin syndrome 7 | Autosomal recessive |
| 2 | CDCA7 | 609937 | Immunodeficiency-centromeric instability-facial anomalies syndrome 3 | Autosomal recessive |
| 16 | CDH11 | 600023 | Elsahy-Waters syndrome | Autosomal recessive |
| 10 | CDH23 | 605516 | Deafness, autosomal recessive, type 12; Usher syndrome, type 1D | Autosomal recessive |
| 16 | CDH3 | 114021 | Ectodermal dysplasia, ectrodactyly, and macular dystrophy; Hypotrichosis, congenital, with juvenile macular dystrophy | Autosomal recessive |
| 10 | CDHR1 | 609502 | Cone-rod dystrophy, type 15 | Autosomal recessive |
| 15 | CDIN1 | 615626 | Dyserythropoietic anemia, congenital, type Ib | Autosomal recessive |
| 16 | CDK10 | 603464 | Al Kaissi syndrome | Autosomal recessive |
| 9 | CDK5RAP2 | 608201 | Primary microcephaly type 3, autosomal recessive | Autosomal recessive |
| 6 | CDSN | 602593 | Peeling skin syndrome 1 | Autosomal recessive |
| 16 | CDT1 | 605525 | Meier-Gorlin syndrome, type 4 | Autosomal recessive |
| 14 | CEBPE | 600749 | Specific granule deficiency | Autosomal recessive |
| 1 | CENPF | 600236 | Stromme syndrome | Autosomal recessive |
| 13 | CENPJ | 609279 | Primary microcephaly type 6, autosomal recessive | Autosomal recessive |
| 1 | CEP104 | 616690 | Joubert syndrome 25 | Autosomal recessive |
| 5 | CEP120 | 613446 | Short-rib thoracic dysplasia 13 with or without polydactyly | Autosomal recessive |
| 4 | CEP135 | 611423 | Microcephaly 8, primary, autosomal recessive | Autosomal recessive |
| 15 | CEP152 | 613529 | Primary microcephaly type 9, autosomal recessive | Autosomal recessive |
| 11 | CEP164 | 614848 | Nephronophthisis 15 | Autosomal recessive |
| 3 | CEP19 | 615586 | Morbid obesity and spermatogenic failure | Autosomal recessive |
| 12 | CEP290 | 610142 | Meckel syndrome, type 4; Joubert syndrome, type 5; Leber congenital amaurosis, type 10 | Autosomal recessive |
| 7 | CEP41 | 610523 | Joubert syndrome, type 15 | Autosomal recessive |
| 10 | CEP55 | 610000 | Multinucleated neurons, anhydramnios, renal dysplasia, cerebellar hypoplasia, and hydranencephaly | Autosomal recessive |
| 11 | CEP57 | 607951 | Mosaic variegated aneuploidy syndrome 2 | Autosomal recessive |
| 9 | CEP78 | 617110 | Cone-rod dystrophy and hearing loss | Autosomal recessive |
| 12 | CEP83 | 615847 | Nephronophthisis 18 | Autosomal recessive |
| 2 | CERKL | 608381 | Retinitis pigmentosa, type 26 | Autosomal recessive |
| 15 | CERS3 | 615276 | Ichthyosis, congenital, autosomal recessive 9 | Autosomal recessive |
| 8 | CFAP418 | 614477 | Bardet-Biedl syndrome, type 21; Cone-rod dystrophy 16 and Retintis pigmentosa 64; Ciliary dyskinesia, primary, 26 | Autosomal recessive |
| 10 | CFAP43 | 617558 | Spermatogenic failure, type 19 | Autosomal recessive |
| 18 | CFAP53 | 614759 | Heterotaxy, visceral, 6, autosomal recessive | Autosomal recessive |
| 19 | CFD | 134350 | Complement factor D deficiency | Autosomal recessive |
| 1 | CFH | 134370 | Complement factor H deficiency | Autosomal recessive |
| 4 | CFI | 217030 | Complement factor I deficiency | Autosomal recessive |
| 14 | CFL2 | 601443 | Nemaline myopathy, type 7, autosomal recessive | Autosomal recessive |
| 7 | CFTR | 602421 | Cystic fibrosis | Autosomal recessive |
| 10 | CHAT | 118490 | Myasthenic syndrome, congenital, type 6, presynaptic | Autosomal recessive |
| 22 | CHKB | 612395 | Muscular dystrophy, congenital, megaconial type | Autosomal recessive |
| X | CHM | 300390 | Choroideremia | X-linked |
| 16 | CHMP1A | 164010 | Pontocerebellar hypoplasia, type 8 | Autosomal recessive |
| 2 | CHRNA1 | 100690 | Multiple pterygium syndrome, lethal type | Autosomal recessive |
| 17 | CHRNB1 | 100710 | ?Myasthenic syndrome, congenital, 2C, associated with acetylcholine receptor deficiency | Autosomal recessive |
| 2 | CHRND | 100720 | Myasthenic syndrome, congenital, type 3B, fast-channel; Multiple pterygium syndrome, lethal type | Autosomal recessive |
| 17 | CHRNE | 100725 | Myasthenic syndrome, congenital, type 4B, fast-channel; Myasthenic syndrome, congenital, type 4C, associated with acetylcholine receptor deficiency | Autosomal recessive |
| 2 | CHRNG | 100730 | Multiple pterygium syndrome (MPS), Escobar type; MPS, lethal type | Autosomal recessive |
| 15 | CHST14 | 608429 | Ehlers-Danlos syndrome, musculocontractural, type 1 | Autosomal recessive |
| 10 | CHST3 | 603799 | Spondyloepiphyseal dysplasia with congenital joint dislocations | Autosomal recessive |
| 16 | CHST6 | 605294 | Macular corneal dystrophy | Autosomal recessive |
| 15 | CHSY1 | 608183 | Temtamy preaxial brachydactyly syndrome | Autosomal recessive |
| 10 | CHUK | 600664 | Cocoon syndrome | Autosomal recessive |
| 15 | CIB2 | 605564 | Deafness, autosomal recessive, type 48; Usher syndrome, type 1J | Autosomal recessive |
| 16 | CIITA | 600005 | Bare lymphocyte syndrome, type 2, complementation group A | Autosomal recessive |
| 6 | CILK1 | 612325 | Endocrine-cerebroosteodysplasia | Autosomal recessive |
| 4 | CISD2 | 611507 | Wolfram syndrome 2 | Autosomal recessive |
| 12 | CIT | 605629 | Microcephaly 17, primary, autosomal recessive | Autosomal recessive |
| 2 | CKAP2L | 616174 | Filippi syndrome | Autosomal recessive |
| 11 | CLCF1 | 607672 | Cold-induced sweating syndrome 2 | Autosomal recessive |
| 7 | CLCN1 | 118425 | Myotonia congenita, recessive | Autosomal recessive |
| 3 | CLCN2 | 600570 | Leukoencephalopathy with ataxia | Autosomal recessive |
| 16 | CLCN7 | 602727 | Osteopetrosis, autosomal recessive type 4 | Autosomal recessive |
| 1 | CLCNKA | 602024 | Bartter syndrome, type 4B, digenic | Digenic inheritance (CLCNKB gene) |
| 1 | CLCNKB | 602023 | Bartter syndrome, type 3; Bartter syndrome, type 4B, digenic | Autosomal recessive; Digenic inheritance (CLCNKA gene) |
| 3 | CLDN1 | 603718 | Ichthyosis, leukocyte vacuoles, alopecia, and sclerosing cholangitis | Autosomal recessive |
| 13 | CLDN10 | 617579 | HELIX syndrome | Autosomal recessive |
| 21 | CLDN14 | 605608 | Deafness type 29, autosomal recessive | Autosomal recessive |
| 3 | CLDN16 | 603959 | Hypomagnesemia, type 3, renal | Autosomal recessive |
| 1 | CLDN19 | 610036 | Rena hypomagnesemia type 5, with ocular involvement | Autosomal recessive |
| 11 | CLMP | 611693 | Congenital short bowel syndrome | Autosomal recessive |
| 16 | CLN3 | 607042 | Ceroid lipofuscinosis, neuronal, type 3 | Autosomal recessive |
| 13 | CLN5 | 608102 | Ceroid lipofuscinosis, neuronal, type 5 | Autosomal recessive |
| 15 | CLN6 | 606725 | Ceroid lipofuscinosis, neuronal, type 6 | Autosomal recessive |
| 8 | CLN8 | 607837 | Ceroid lipofuscinosis, neuronal, type 8 | Autosomal recessive |
| 11 | CLP1 | 608757 | Pontocerebellar hypoplasia, type 10 | Autosomal recessive |
| 11 | CLPB | 616254 | 3-methylglutaconic aciduria, type 7, with cataracts, neurologic involvement and neutropenia | Autosomal recessive |
| 19 | CLPP | 601119 | Perrault syndrome 3 | Autosomal recessive |
| 3 | CLRN1 | 606397 | Usher syndrome, type 3A | Autosomal recessive |
| 4 | CNGA1 | 123825 | Retinitis pigmentosa type 49 | Autosomal recessive |
| 2 | CNGA3 | 600053 | Achromatopsia, type 2 | Autosomal recessive |
| 16 | CNGB1 | 600724 | Retinitis pigmentosa type 45 | Autosomal recessive |
| 8 | CNGB3 | 605080 | Achromatopsia, type 3 | Autosomal recessive |
| 10 | CNNM2 | 607803 | Hypomagnesemia, seizures, and mental retardation | Autosomal recessive* |
| 2 | CNNM4 | 607805 | Jalili syndrome | Autosomal recessive |
| 6 | CNPY3 | 610774 | Epileptic encephalopathy, early infantile, type 60 | Autosomal recessive |
| 17 | CNTNAP1 | 602346 | Lethal congenital contracture syndrome 7 | Autosomal recessive |
| 7 | CNTNAP2 | 604569 | Pitt-Hopkins like syndrome 1 | Autosomal recessive |
| 1 | COA6 | 614772 | Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 4 | Autosomal recessive |
| 14 | COA8 | 616003 | Mitochondrial complex IV deficiency, nuclear type 17 | Autosomal recessive |
| 17 | COASY | 609855 | Neurodegeneration with brain iron accumulation 6 | Autosomal recessive |
| 17 | COG1 | 606973 | Congenital disorder of glycosylation, type IIg | Autosomal recessive |
| 16 | COG4 | 606976 | Congenital disorder of glycosylation, type 2J | Autosomal recessive |
| 7 | COG5 | 606821 | Congenital disorder of glycosylation, type 2I | Autosomal recessive |
| 13 | COG6 | 606977 | Congenital disorder of glycosylation, type 2L; Shaheen syndrome | Autosomal recessive |
| 16 | COG7 | 606978 | Congenital disorder of glycosylation, type 2E | Autosomal recessive |
| 16 | COG8 | 606979 | Congenital disorder of glycosylation, type 2H | Autosomal recessive |
| 1 | COL11A1 | 120280 | Fibrochondrogenesis type 1 | Autosomal recessive |
| 6 | COL11A2 | 120290 | Otospondylomegaepiphyseal dysplasia, autosomal recessive | Autosomal recessive |
| 10 | COL13A1 | 120350 | Myasthenic syndrome, congenital, 19 | Autosomal recessive |
| 10 | COL17A1 | 113811 | Epidermolysis bullosa, junctional, non-Herlitz type | Autosomal recessive |
| 21 | COL18A1 | 120328 | Knobloch syndrome, type 1 | Autosomal recessive |
| 7 | COL1A2 | 120160 | Ehlers-Danlos syndrome, cardiac valvular type | Autosomal recessive |
| 4 | COL25A1 | 610004 | Fibrosis of extraocular muscles, congenital, type 5 | Autosomal recessive |
| 9 | COL27A1 | 608461 | Steel syndrome | Autosomal recessive |
| 2 | COL4A3 | 120070 | Alport syndrome 3B, autosomal recessive | Autosomal recessive; Autosomal dominant |
| 2 | COL4A4 | 120131 | Alport syndrome, autosomal recessive, type 2 | Autosomal recessive; Autosomal dominant |
| X | COL4A5 | 303630 | Alport syndrome, X-linked | X-linked |
| 21 | COL6A1 | 120220 | Ullrich congenital muscular dystrophy, type 1 (Limb-girdle muscular dystrophy, type 22 [LGMD R22]) | Autosomal recessive* |
| 21 | COL6A2 | 120240 | Ullrich congenital muscular dystrophy 1; Bethlem myopathy-1; Myosclerosis | Autosomal recessive |
| 2 | COL6A3 | 120250 | Bethlem myopathy 1; Ullrich congenital muscular dystrophy 1; Dystonia 27 | Autosomal recessive*;Autosomal recessive*;Autosomal recessive |
| 3 | COL7A1 | 120120 | Dystrophic epidermolysis bullosa (DEB), Hallopeau-Siemens (HS) type and non-HS type; DEB pruriginosa; DEB pretibial | Autosomal recessive; Autosomal recessive*; Autosomal recessive* |
| 6 | COL9A1 | 120210 | Stickler syndrome, type 4 | Autosomal recessive |
| 1 | COL9A2 | 120260 | ?Stickler syndrome, type V | Autosomal recessive |
| 8 | COLEC10 | 607620 | 3MC syndrome 3 | Autosomal recessive |
| 2 | COLEC11 | 612502 | 3MC syndrome 2 | Autosomal recessive |
| 3 | COLQ | 603033 | Myasthenic syndrome, congenital, type 5 | Autosomal recessive |
| 4 | COQ2 | 609825 | Primary coenzyme Q10 deficiency, type 1 | Autosomal recessive |
| 9 | COQ4 | 612898 | Coenzyme Q10 deficiency, primary, type 7 | Autosomal recessive |
| 14 | COQ6 | 614647 | Coenzyme Q10 deficiency, primary, type 6 | Autosomal recessive |
| 1 | COQ8A | 606980 | Primary coenzyme Q10 deficiency, type 4 | Autosomal recessive |
| 19 | COQ8B | 615567 | Nephrotic syndrome, type 9 | Autosomal recessive |
| 16 | COQ9 | 612837 | Coenzyme Q10 deficiency, primary, type 5 | Autosomal recessive |
| 16 | CORO1A | 605000 | Immunodeficiency, type 8 | Autosomal recessive |
| 17 | COX10 | 602125 | Mitochondrial complex IV deficiency, nuclear type 3 | Autosomal recessive |
| 10 | COX15 | 603646 | Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, type 2; Leigh syndrome due to cytochrome c oxidase deficiency | Autosomal recessive |
| 1 | COX20 | 614698 | Mitochondrial complex IV deficiency, nuclear type 11 | Autosomal recessive |
| 19 | COX6B1 | 124089 | Mitochondrial complex IV deficiency, nuclear type 7 | Autosomal recessive |
| 3 | CP | 117700 | Aceruloplasminemia | Autosomal recessive |
| 8 | CPA6 | 609562 | Febrile seizures, familial, type 11 | Autosomal recessive |
| 19 | CPAMD8 | 608841 | Anterior segment dysgenesis, type 8 | Autosomal recessive |
| 5 | CPLANE1 | 614571 | Joubert syndrome 17 | Autosomal recessive |
| 4 | CPLX1 | 605032 | Epileptic encephalopathy, early infantile, 63 | Autosomal recessive |
| 2 | CPS1 | 608307 | Carbamoylphosphate synthetase 1 deficiency | Autosomal recessive |
| 11 | CPT1A | 600528 | Carnitine palmitoyltransferase type 1A deficiency, hepatic | Autosomal recessive |
| 1 | CPT2 | 600650 | Carnitine palmitoyltransferase type 2 deficiency, lethal neonatal; Carnitine palmitoyltransferase type 2 deficiency, infantile | Autosomal recessive |
| 1 | CR2 | 120650 | Immunodeficiency, common variable, type 7 | Autosomal recessive |
| 12 | CRADD | 603454 | Mental retardation, autosomal recessive, type 34, with variant lissencephaly | Autosomal recessive |
| 1 | CRB1 | 604210 | Retinitis pigmentosa, type 12; Leber congenital amaurosis, type 8 | Autosomal recessive |
| 9 | CRB2 | 609720 | Ventriculomegaly with cystic kidney disease | Autosomal recessive |
| 3 | CRBN | 609262 | Mental retardation, autosomal recessive, type 2 | Autosomal recessive |
| 2 | CRIPT | 604594 | Short stature with microcephaly and distinctive facies | Autosomal recessive |
| 19 | CRLF1 | 604237 | Cold-induced sweating syndrome type 1 | Autosomal recessive |
| 7 | CRPPA | 614631 | Muscular dystrophy-dystroglycanopathy, type A7; Muscular dystrophy-dystroglycanopathy, type C7 | Autosomal recessive |
| 3 | CRTAP | 605497 | Osteogenesis imperfecta, type 7 | Autosomal recessive |
| 21 | CRYAA | 123580 | Cataract 9, multiple types | Autosomal recessive* |
| 11 | CRYAB | 123590 | Myopathy, myofibrillar, fatal infantile hypertonic, alpha-B crystallin-related; Cataract 16, multiple types | Autosomal recessive; Autosomal recessive* |
| 22 | CRYBB1 | 600929 | Cataract 17 | Autosomal recessive* |
| 22 | CRYBB3 | 123630 | Cataract 22 | Autosomal recessive |
| 22 | CSF2RB | 138981 | Surfactant metabolism dysfunction, pulmonary, type 5 | Autosomal recessive |
| 1 | CSF3R | 138971 | Neutropenia, severe congenital, type 7, autosomal recessive | Autosomal recessive |
| 8 | CSPP1 | 611654 | Joubert syndrome 21 | Autosomal recessive |
| 3 | CSTA | 184600 | Peeling skin syndrome, type 4 | Autosomal recessive |
| 21 | CSTB | 601145 | Epilepsy, progressive myoclonic type 1A (Unverricht and Lundborg) | Autosomal recessive |
| 17 | CTC1 | 613129 | Cerebroretinal microangiopathy with calcifications and cysts | Autosomal recessive |
| 1 | CTH | 607657 | Cystathioninuria | Autosomal recessive |
| 17 | CTNS | 606272 | Nephropathic cystinosis | Autosomal recessive |
| 1 | CTPS1 | 123860 | Immunodeficiency, type 24 | Autosomal recessive |
| 20 | CTSA | 613111 | Galactosialidosis | Autosomal recessive |
| 11 | CTSC | 602365 | Haim-Munk syndrome; Papillon-Lefevre syndrome | Autosomal recessive |
| 11 | CTSD | 116840 | Ceroid lipofuscinosis, neuronal, type 10 | Autosomal recessive |
| 11 | CTSF | 603539 | Ceroid lipofuscinosis, neuronal, type 13 (Kufs type) | Autosomal recessive |
| 1 | CTSK | 601105 | Pycnodysostosis | Autosomal recessive |
| 10 | CUBN | 602997 | Megaloblastic anemia 1 (Imerslund-Grasbeck syndrome) | Autosomal recessive |
| X | CUL4B | 300304 | Mental retardation, X-linked, syndromic, type 15 (Cabezas type) | X-linked |
| 6 | CUL7 | 609577 | 3M syndrome 1 | Autosomal recessive |
| 5 | CWC27 | 617170 | Retinitis pigmentosa with or without skeletal anomalies | Autosomal recessive |
| 10 | CWF19L1 | 616120 | Spinocerebellar ataxia, autosomal recessive, type 17 | Autosomal recessive |
| 18 | CYB5A | 613218 | 46,XY disorder of sex development due to isolated 17,20-lyase deficiency | Autosomal recessive |
| 22 | CYB5R3 | 613213 | Methemoglobinemia, type 1; Methemoglobinemia, type 2 | Autosomal recessive |
| 16 | CYBA | 608508 | Chronic granulomatous disease, type 4 | Autosomal recessive |
| X | CYBB | 300481 | Chronic granulomatous disease, X-linked | X-linked |
| 8 | CYC1 | 123980 | Mitochondrial complex III deficiency, nuclear type 6 | Autosomal recessive |
| 15 | CYP11A1 | 118485 | 46,XY disorder of sex development-adrenal insufficiency due to CYP11A1 deficiency | Autosomal recessive |
| 8 | CYP11B1 | 610613 | Adrenal hyperplasia, congenital, due to 11-beta-hydroxylase deficiency | Autosomal recessive |
| 8 | CYP11B2 | 124080 | Hypoaldosteronism, congenital, due to CMO I deficiency | Autosomal recessive |
| 10 | CYP17A1 | 609300 | 17 alpha(?)-hydroxylase/17,20-lyase deficiency | Autosomal recessive |
| 15 | CYP19A1 | 107910 | Aromatase deficiency | Autosomal recessive |
| 2 | CYP1B1 | 601771 | Glaucoma, primary congenital, type 3A | Autosomal recessive |
| 6 | CYP21A2 | 613815 | Congenital adrenal hyperplasia due to 21-hydroxylase deficiency | Autosomal recessive |
| 20 | CYP24A1 | 126065 | Hypercalcemia, infantile, type 1 | Autosomal recessive |
| 2 | CYP26B1 | 605207 | Craniosynostosis with radiohumeral fusions and other skeletal and craniofacial anomalies | Autosomal recessive |
| 10 | CYP26C1 | 608428 | Focal facial dermal dysplasia 4 | digenic inheritance (CLCNKB gene) |
| 2 | CYP27A1 | 606530 | Cerebrotendinous xanthomatosis | Autosomal recessive |
| 12 | CYP27B1 | 609506 | Vitamin D-dependent rickets, type 1 | Autosomal recessive |
| 11 | CYP2R1 | 608713 | Rickets due to defect in vitamin D 25-hydroxylation | Autosomal recessive |
| 4 | CYP2U1 | 610670 | Spastic paraplegia, type 56, autosomal recessive | Autosomal recessive |
| 19 | CYP4F22 | 611495 | Ichthyosis, congenital, autosomal recessive, type 5 | Autosomal recessive |
| 4 | CYP4V2 | 608614 | Bietti crystalline corneoretinal dystrophy | Autosomal recessive |
| 8 | CYP7B1 | 603711 | Spastic paraplegia, type 5A, autosomal recessive | Autosomal recessive |
| 2 | D2HGDH | 609186 | D-2-hydroxyglutaric aciduria | Autosomal recessive |
| 3 | DAG1 | 128239 | Muscular dystrophy-dystroglycanopathy type A9; Muscular dystrophy-dystroglycanopathy type C9 | Autosomal recessive |
| 2 | DARS1 | 603084 | Hypomyelination with brainstem and spinal cord involvement and leg spasticity | Autosomal recessive |
| 1 | DARS2 | 610956 | Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation | Autosomal recessive |
| 9 | DBH | 609312 | Dopamine beta-hydroxylase deficiency | Autosomal recessive |
| 1 | DBT | 248610 | Maple syrup urine disease, type 2 | Autosomal recessive |
| 2 | DCAF17 | 612515 | Woodhouse-Sakati syndrome | Autosomal recessive |
| 18 | DCC | 120470 | Gaze palsy, familial horizontal, with progressive scoliosis, type 2 | Autosomal recessive |
| 6 | DCDC2 | 605755 | Sclerosing cholangitis, neonatal; Nephronophthisis 19 | Autosomal recessive |
| 11 | DCHS1 | 603057 | Van Maldergem syndrome 1 | Autosomal recessive |
| 10 | DCLRE1C | 605988 | Omenn syndrome; Severe combined immunodeficiency, Athabascan type | Autosomal recessive |
| 11 | DCPS | 610534 | Al-Raqad syndrome | Autosomal recessive |
| X | DCX | 300121 | Lissencephaly, X-linked, type 1 | X-linked |
| 11 | DDB2 | 600811 | Xeroderma pigmentosum, complementation group E | Autosomal recessive |
| 7 | DDC | 107930 | Aromatic L-amino acid decarboxylase deficiency | Autosomal recessive |
| 14 | DDHD1 | 614603 | Spastic paraplegia, type 28, autosomal recessive | Autosomal recessive |
| 8 | DDHD2 | 615003 | Spastic paraplegia, type 54, autosomal recessive | Autosomal recessive |
| 1 | DDR2 | 191311 | Spondylometaepiphyseal dysplasia, short limb-hand type | Autosomal recessive |
| 20 | DDRGK1 | 616177 | Spondyloepimetaphyseal dysplasia, Shohat type | Autosomal recessive |
| 12 | DDX11 | 601150 | Warsaw breakage syndrome | Autosomal recessive |
| 1 | DDX59 | 615464 | Orofaciodigital syndrome V | Autosomal recessive |
| 11 | DENND5A | 617278 | Epileptic encephalopathy, early infantile, 49 | Autosomal recessive |
| 2 | DES | 125660 | Myopathy, myofibrillar, type 1 | Autosomal recessive*; Autosomal dominant |
| 8 | DGAT1 | 604900 | ?Diarrhea 7, protein-losing enteropathy type | Autosomal recessive |
| 17 | DGKE | 601440 | Nephrotic syndrome, type 7 | Autosomal recessive |
| 2 | DGUOK | 601465 | DGUOK-related mitochondrial DNA depletion syndrome | Autosomal recessive |
| 1 | DHCR24 | 606418 | Desmosterolosis | Autosomal recessive |
| 11 | DHCR7 | 602858 | Smith-Lemli-Opitz syndrome | Autosomal recessive |
| 1 | DHDDS | 608172 | Retinitis pigmentosa, type 59 | Autosomal recessive |
| 5 | DHFR | 126060 | Megaloblastic anemia due to dihydrofolate reductase deficiency | Autosomal recessive |
| 12 | DHH | 605423 | 46,XY complete gonadal dysgenesis | Autosomal recessive |
| 16 | DHODH | 126064 | Miller syndrome | Autosomal recessive |
| 19 | DHPS | 600944 | Neurodevelopmental disorder with seizures and speech and walking impairment | Autosomal recessive |
| 10 | DHTKD1 | 614984 | 2-aminoadipic 2-oxoadipic aciduria | Autosomal recessive |
| 5 | DIAPH1 | 602121 | Seizures, cortical blindness, microcephaly syndrome | Autosomal recessive |
| 2 | DIS3L2 | 614184 | Perlman syndrome | Autosomal recessive |
| X | DKC1 | 300126 | Dyskeratosis congenita, X-linked | X-linked |
| 11 | DLAT | 608770 | Pyruvate dehydrogenase E2 deficiency | Autosomal recessive |
| 7 | DLD | 238331 | Dihydrolipoamide dehydrogenase deficiency | Autosomal recessive |
| X | DLG3 | 300189 | Mental retardation, X-linked, type 90 | X-linked |
| 19 | DLL3 | 602768 | Spondylocostal dysostosis type 1 | Autosomal recessive |
| X | DMD | 300377 | DMD-related conditions | X-linked |
| 5 | DMGDH | 605849 | Dimethylglycine dehydrogenase deficiency | Autosomal recessive |
| 4 | DMP1 | 600980 | Hypophosphatemic rickets, autosomal recessive | Autosomal recessive |
| 15 | DMXL2 | 612186 | Developmental and epileptic encephalopathy, type 81 | Autosomal recessive |
| 16 | DNAAF1 | 613190 | Ciliary dyskinesia, primary, type 13 | Autosomal recessive |
| 8 | DNAAF11 | 614930 | Ciliary dyskinesia, primary, type 19 | Autosomal recessive |
| 14 | DNAAF2 | 612517 | Ciliary dyskinesia, primary, type 10 | Autosomal recessive |
| 19 | DNAAF3 | 614566 | Ciliary dyskinesia, primary, type 2 | Autosomal recessive |
| 15 | DNAAF4 | 608706 | Ciliary dyskinesia, primary, type 25 | Autosomal recessive |
| 7 | DNAAF5 | 614864 | Ciliary dyskinesia, primary, type 18 | Autosomal recessive |
| 3 | DNAH1 | 603332 | Spermatogenic failure, type 18 | Autosomal recessive |
| 7 | DNAH11 | 603339 | Ciliary dyskinesia, primary, type 7, with or without situs inversus | Autosomal recessive |
| 5 | DNAH5 | 603335 | Ciliary dyskinesia, primary, type 3, with or without situs inversus | Autosomal recessive |
| 17 | DNAH9 | 603330 | Ciliary dyskinesia, primary, type 40 | Autosomal recessive |
| 9 | DNAI1 | 604366 | Ciliary dyskinesia, primary, type 1, with or without situs inversus | Autosomal recessive |
| 17 | DNAI2 | 605483 | Ciliary dyskinesia, primary, type 9, with or without situs inversus | Autosomal recessive |
| 11 | DNAJB13 | 610263 | Ciliary dyskinesia, primary, type 34 | Autosomal recessive |
| 2 | DNAJB2 | 604139 | Spinal muscular atrophy, distal, autosomal recessive, type 5 | Autosomal recessive |
| 10 | DNAJC12 | 606060 | Hyperphenylalaninemia, mild, non-BH4-deficient | Autosomal recessive |
| 3 | DNAJC19 | 608977 | 3-methylglutaconic aciduria, type 5 | Autosomal recessive |
| 5 | DNAJC21 | 617048 | Bone marrow failure syndrome, type 3 | Autosomal recessive |
| 1 | DNAJC6 | 608375 | Parkinson disease, type 19A, juvenile-onset; Parkinson disease, type 19B, early-onset | Autosomal recessive |
| 14 | DNAL1 | 610062 | Ciliary dyskinesia, primary, type 16 | Autosomal recessive |
| 3 | DNASE1L3 | 602244 | Systemic lupus erythematosus 16 | Autosomal recessive |
| 12 | DNM1L | 603850 | Encephalopathy due to defective mitochondrial and peroxisomal fission, type 1 | Autosomal recessive* |
| 19 | DNM2 | 602378 | Lethal congenital contracture syndrome, type 5 | Autosomal recessive |
| 20 | DNMT3B | 602900 | Immunodeficiency-centromeric instability-facial anomalies syndrome, type 1 | Autosomal recessive |
| 5 | DOCK2 | 603122 | Immunodeficiency, type 40 | Autosomal recessive |
| 19 | DOCK6 | 614194 | Adams-Oliver syndrome 2 | Autosomal recessive |
| 1 | DOCK7 | 615730 | Epileptic encephalopathy, early infantile, 23 | Autosomal recessive |
| 9 | DOCK8 | 611432 | Hyper-IgE recurrent infection syndrome, autosomal recessive | Autosomal recessive |
| 4 | DOK7 | 610285 | Fetal akinesia deformation sequence, type 3; Myasthenic syndrome, congenital, type 10 | Autosomal recessive |
| 9 | DOLK | 610746 | Congenital disorder of glycosylation, type 1M | Autosomal recessive |
| 21 | DONSON | 611428 | Microcephaly, short stature, and limb abnormalities | Autosomal recessive |
| 11 | DPAGT1 | 191350 | Congenital disorder of glycosylation, type 1J; Myasthenic syndrome, congenital, type 13 | Autosomal recessive |
| 17 | DPH1 | 603527 | Developmental delay with short stature, dysmorphic features, and sparse hair | Autosomal recessive |
| 20 | DPM1 | 603503 | Congenital disorder of glycosylation, type 1E | Autosomal recessive |
| 9 | DPM2 | 603564 | Congenital disorder of glycosylation, type Iu | Autosomal recessive |
| 1 | DPM3 | 605951 | Congenital disorder of glycosylation, type Io | Autosomal recessive |
| 12 | DPY19L2 | 613893 | Spermatogenic failure, type 9 | Autosomal recessive |
| 1 | DPYD | 612779 | Dihydropyrimidine dehydrogenase deficiency | Autosomal recessive |
| 8 | DPYS | 613326 | Dihydropyrimidinuria | Autosomal recessive |
| 1 | DRAM2 | 613360 | Cone-rod dystrophy 21 | Autosomal recessive |
| 2 | DRC1 | 615288 | Ciliary dyskinesia, primary, type 21 | Autosomal recessive |
| 18 | DSG1 | 125670 | Erythroderma, congenital, with palmoplantar keratoderma, hypotrichosis, and hyper IgE | Autosomal recessive |
| 18 | DSG4 | 607892 | Hypotrichosis, type 6 | Autosomal recessive |
| 6 | DSP | 125647 | Cardiomyopathy, dilated, with woolly hair and keratoderma; Epidermolysis bullosa, lethal acantholytic | Autosomal recessive |
| 6 | DST | 113810 | Neuropathy, hereditary sensory and autonomic, type VI;Epidermolysis bullosa simplex 3, localized or generalized intermediate, with bp230 deficiency | Autosomal recessive |
| 1 | DSTYK | 612666 | Spastic paraplegia, type 23, autosomal recessive | Autosomal recessive |
| 6 | DTNBP1 | 607145 | Hermansky-Pudlak syndrome, type 7 | Autosomal recessive |
| 15 | DUOX2 | 606759 | Thyroid dyshormonogenesis, type 6 | Autosomal recessive |
| 15 | DUOXA2 | 612772 | Thyroid dyshormonogenesis, type 5 | Autosomal recessive |
| 18 | DYM | 607461 | Smith-McCort dysplasia; Dyggve-Melchior-Clausen disease | Autosomal recessive |
| 11 | DYNC2H1 | 603297 | Short-rib thoracic dysplasia, type 3, with or without polydactyly | Autosomal recessive |
| 7 | DYNC2I1 | 615462 | Short-rib thoracic dysplasia 8 with or without polydactyly | Autosomal recessive |
| 9 | DYNC2I2 | 613363 | Short-rib thoracic dysplasia 11 with or without polydactyly | Autosomal recessive |
| 2 | DYNC2LI1 | 617083 | Short-rib thoracic dysplasia 15 with polydactyly | Autosomal recessive |
| 3 | DYNLT2B | 617353 | Short-rib thoracic dysplasia 17 with or without polydactyly | Autosomal recessive |
| 2 | DYSF | 603009 | Miyoshi muscular dystrophy, type 1; Limb-girdle muscular dystrophy, type 2 (LGMD R2) | Autosomal recessive |
| 3 | DZIP1L | 617570 | Polycystic kidney disease 5 | Autosomal recessive |
| 16 | EARS2 | 612799 | Combined oxidative phosphorylation deficiency 12 | Autosomal recessive |
| 2 | ECEL1 | 605896 | Arthrogryposis, distal, type 5D | Autosomal recessive |
| 10 | ECHS1 | 602292 | Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency | Autosomal recessive |
| 1 | ECM1 | 602201 | Urbach-Wiethe disease | Autosomal recessive |
| X | EDA | 300451 | Ectodermal dysplasia, type 1, hypohidrotic, X-linked | X-linked |
| 2 | EDAR | 604095 | Ectodermal dysplasia 10B, hypohidrotic/hair/tooth type | Autosomal recessive |
| 1 | EDARADD | 606603 | Ectodermal dysplasia 11B, hypohidrotic/hair/tooth type | Autosomal recessive |
| 6 | EDN1 | 131240 | Auriculocondylar syndrome, type 3 | Autosomal recessive |
| 20 | EDN3 | 131242 | Waardenburg syndrome, type 4B | Autosomal recessive |
| 13 | EDNRB | 131244 | ABCD syndrome | Autosomal recessive |
| 11 | EFEMP2 | 604633 | Cutis laxa, autosomal recessive, type 1B | Autosomal recessive |
| 15 | EFL1 | 617538 | Shwachman-Diamond syndrome 2 | Autosomal recessive |
| 7 | EGFR | 131550 | ?Inflammatory skin and bowel disease, neonatal, 2 | Autosomal recessive |
| 10 | EGR2 | 129010 | Dejerine-Sottas disease | Autosomal recessive* |
| 2 | EIF2AK3 | 604032 | Wolcott-Rallison syndrome | Autosomal recessive |
| 15 | EIF2AK4 | 609280 | Pulmonary venoocclusive disease 2 | Autosomal recessive |
| 12 | EIF2B1 | 606686 | Leukoencephalopathy with vanishing white matter (VWM) | Autosomal recessive |
| 14 | EIF2B2 | 606454 | Leukoencephalopathy with vanishing white matter (VWM) | Autosomal recessive |
| 1 | EIF2B3 | 606273 | Leukoencephalopathy with vanishing white matter (VWM) | Autosomal recessive |
| 2 | EIF2B4 | 606687 | Leukoencephalopathy with vanishing white matter (VWM) | Autosomal recessive |
| 3 | EIF2B5 | 603945 | Leukoencephalopathy with vanishing white matter (VWM) | Autosomal recessive |
| 17 | EIF4A3 | 608546 | Robin sequence with cleft mandible and limb anomalies | Autosomal recessive |
| 17 | ELAC2 | 605367 | Combined oxidative phosphorylation deficiency 17 | Autosomal recessive |
| 20 | ELMO2 | 606421 | Vascular malformation, primary intraosseous | Autosomal recessive |
| 6 | ELOVL4 | 605512 | Ichthyosis, spastic quadriplegia, and mental retardation | Autosomal recessive |
| 9 | ELP1 | 603722 | Familial dysautonomia | Autosomal recessive |
| 18 | ELP2 | 616054 | Mental retardation, autosomal recessive, type 58 | Autosomal recessive |
| 1 | EMC1 | 616846 | Cerebellar atrophy, visual impairment, and psychomotor retardation | Autosomal recessive |
| X | EMD | 300384 | Emery-Dreifuss muscular dystrophy, type 1, X-linked | X-linked |
| 14 | EML1 | 602033 | Band heterotopia | Autosomal recessive |
| 16 | EMP2 | 602334 | Nephrotic syndrome, type 10 | Autosomal recessive |
| 4 | ENAM | 606585 | Amelogenesis imperfecta, type 1C | Autosomal recessive |
| 17 | ENO3 | 131370 | ?Glycogen storage disease XIII | Autosomal recessive |
| 6 | ENPP1 | 173335 | Arterial calcification, generalized, of infancy, type 1 | Autosomal recessive |
| 10 | ENTPD1 | 601752 | Spastic paraplegia, type 64, autosomal recessive | Autosomal recessive |
| 3 | EOGT | 614789 | Adams-Oliver syndrome 4 | Autosomal recessive |
| 1 | EPB41 | 130500 | Elliptocytosis, type 1 | Autosomal recessive* |
| 15 | EPB42 | 177070 | Spherocytosis, type 5 | Autosomal recessive |
| 2 | EPCAM | 185535 | EPCAM-related conditions | Autosomal recessive |
| 18 | EPG5 | 615068 | Vici syndrome | Autosomal recessive |
| 6 | EPM2A | 607566 | Epilepsy, progressive myoclonic, type 2A (Lafora) | Autosomal recessive |
| 1 | EPRS1 | 138295 | Leukodystrophy, hypomyelinating, type 15 | Autosomal recessive |
| 11 | EPS8L2 | 614988 | Deafness autosomal recessive, type 106 | Autosomal recessive |
| 17 | ERAL1 | 607435 | Perrault syndrome 6 | Autosomal recessive |
| 12 | ERBB3 | 190151 | Lethal congenital contractural syndrome, type 2 | Autosomal recessive |
| 19 | ERCC1 | 126380 | Cerebrooculofacioskeletal syndrome, type 4 | Autosomal recessive |
| 19 | ERCC2 | 126340 | Trichothiodystrophy, type 1; Xeroderma pigmentosum, group D | Autosomal recessive |
| 2 | ERCC3 | 133510 | Trichothiodystrophy, type 2 | Autosomal recessive |
| 16 | ERCC4 | 133520 | Fanconi anemia, complementation group Q | Autosomal recessive |
| 13 | ERCC5 | 133530 | Cerebrooculofacioskeletal syndrome 3; Xeroderma pigmentosum, group G;Xeroderma pigmentosum, group G/Cockayne syndrome | Autosomal recessive |
| 10 | ERCC6 | 609413 | Cockayne syndrome, type B; Cerebrooculofacioskeletal syndrome, type 1 | Autosomal recessive |
| 9 | ERCC6L2 | 615667 | Bone marrow failure syndrome, type 2 | Autosomal recessive |
| 5 | ERCC8 | 609412 | Cockayne syndrome, type A | Autosomal recessive |
| 10 | ERLIN1 | 611604 | Spastic paraplegia, type 62, autosomal recessive | Autosomal recessive |
| 8 | ERLIN2 | 611605 | Spastic paraplegia, type 18, autosomal recessive | Autosomal recessive |
| 8 | ESCO2 | 609353 | Roberts syndrome | Autosomal recessive |
| 1 | ESPN | 606351 | Deafness, autosomal recessive, type 36 | Autosomal recessive |
| 6 | ESR1 | 133430 | Estrogen resistance | Autosomal recessive |
| 14 | ESRRB | 602167 | Deafness, autosomal recessive, type 35 | Autosomal recessive |
| 15 | ETFA | 608053 | Glutaric acidemia, type 2A | Autosomal recessive |
| 19 | ETFB | 130410 | Glutaric acidemia, type 2B | Autosomal recessive |
| 4 | ETFDH | 231675 | Glutaric acidemia, type 2C | Autosomal recessive |
| 19 | ETHE1 | 608451 | Ethylmalonic encephalopathy | Autosomal recessive |
| 4 | EVC | 604831 | Ellis-van Creveld syndrome | Autosomal recessive |
| 4 | EVC2 | 607261 | Ellis-van Creveld syndrome | Autosomal recessive |
| 9 | EXOSC3 | 606489 | Pontocerebellar hypoplasia, type 1B | Autosomal recessive |
| 11 | EXPH5 | 612878 | Epidermolysis bullosa, nonspecific, autosomal recessive | Autosomal recessive |
| 8 | EXTL3 | 605744 | Immunoskeletal dysplasia with neurodevelopmental abnormalities | Autosomal recessive |
| 6 | EYS | 612424 | Retinitis pigmentosa, type 25 | Autosomal recessive |
| 13 | F10 | 613872 | Factor X deficiency | Autosomal recessive |
| 4 | F11 | 264900 | Factor XI deficiency | Autosomal recessive* |
| 6 | F13A1 | 134570 | Factor XIIIA deficiency | Autosomal recessive |
| 1 | F13B | 134580 | Factor XIIIB deficiency | Autosomal recessive |
| 11 | F2 | 176930 | Prothrombin deficiency | Autosomal recessive |
| 1 | F5 | 612309 | Factor V deficiency | Autosomal recessive |
| 13 | F7 | 613878 | Factor VII deficiency | Autosomal recessive |
| X | F8 | 300841 | Hemophilia A | X-linked |
| X | F9 | 300746 | Hemophilia B | X-linked |
| 16 | FA2H | 611026 | Spastic paraplegia, type 35, autosomal recessive | Autosomal recessive |
| 11 | FADD | 602457 | Infections, recurrent, with encephalopathy, hepatic dysfunction, and cardiovascular malformations | Autosomal recessive |
| 15 | FAH | 613871 | Tyrosinemia, type 1 | Autosomal recessive |
| 2 | FAM161A | 613596 | Retinitis pigmentosa, type 28 | Autosomal recessive |
| 17 | FAM20A | 611062 | Amelogenesis imperfecta, type 1G (Enamel-renal syndrome) | Autosomal recessive |
| 7 | FAM20C | 611061 | Raine syndrome | Autosomal recessive |
| 15 | FAN1 | 613534 | Interstitial nephritis, karyomegalic | Autosomal recessive |
| 16 | FANCA | 607139 | Fanconi anemia, complementation group A | Autosomal recessive |
| 9 | FANCC | 613899 | Fanconi anemia, complementation group C | Autosomal recessive |
| 3 | FANCD2 | 613984 | Fanconi anemia, complementation group D2 | Autosomal recessive |
| 6 | FANCE | 613976 | Fanconi anemia, complementation group E | Autosomal recessive |
| 11 | FANCF | 613897 | Fanconi anemia, complementation group F | Autosomal recessive |
| 9 | FANCG | 602956 | Fanconi anemia, complementation group G | Autosomal recessive |
| 15 | FANCI | 611360 | Fanconi anemia, complementation group I | Autosomal recessive |
| 2 | FANCL | 608111 | Fanconi anemia, complementation group L | Autosomal recessive |
| 14 | FANCM | 609644 | Spermatogenic failure, type 28; ?Premature ovarian failure 15 | Autosomal recessive |
| 11 | FAR1 | 616107 | Peroxisomal fatty acyl-CoA reductase 1 disorder | Autosomal recessive |
| 6 | FARS2 | 611592 | Combined oxidative phosphorylation deficiency 14; Spastic paraplegia, type 77, autosomal recessive | Autosomal recessive |
| 2 | FASTKD2 | 612322 | Combined oxidative phosphorylation deficiency 44 | Autosomal recessive |
| 4 | FAT4 | 612411 | Hennekam lymphangiectasia-lymphedema syndrome 2 | Autosomal recessive |
| 14 | FBLN5 | 604580 | Cutis laxa, autosomal recessive, type 1A | Autosomal recessive |
| 9 | FBP1 | 611570 | Fructose-1,6-bisphosphatase deficiency | Autosomal recessive |
| 6 | FBXL4 | 605654 | Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type) | Autosomal recessive |
| 22 | FBXO7 | 605648 | Parkinson disease, type 15, autosomal recessive | Autosomal recessive |
| 17 | FDXR | 103270 | Auditory neuropathy and optic atrophy | Autosomal recessive |
| 18 | FECH | 612386 | Protoporphyria, erythropoietic, autosomal recessive | Autosomal recessive |
| 20 | FERMT1 | 607900 | Kindler syndrome | Autosomal recessive |
| 11 | FERMT3 | 607901 | Leukocyte adhesion deficiency, type 3 | Autosomal recessive |
| 7 | FEZF1 | 613301 | Hypogonadotropic hypogonadism type 22, with or without anosmia | Autosomal recessive |
| 4 | FGA | 134820 | Afibrinogenemia, congenital | Autosomal recessive |
| 4 | FGB | 134830 | Congenital afibrinogenemia | Autosomal recessive |
| X | FGD1 | 300546 | Aarskog-Scott syndrome; Mental retardation, X-linked syndromic, type 16 | X-linked |
| 12 | FGD4 | 611104 | Charcot-Marie-Tooth disease, type 4H | Autosomal recessive |
| 12 | FGF23 | 605380 | Tumoral calcinosis, hyperphosphatemic, familial, type 2 | Autosomal recessive |
| 11 | FGF3 | 164950 | Deafness, congenital with inner ear agenesis, microtia, and microdontia | Autosomal recessive |
| 4 | FGG | 134850 | Afibrinogenemia, congenital; Hypofibrinogenemia, congenital | Autosomal recessive |
| 1 | FH | 136850 | Fumarase deficiency | Autosomal recessive |
| 11 | FIBP | 608296 | Thauvin-Robinet-Faivre syndrome | Autosomal recessive |
| 6 | FIG4 | 609390 | Charcot-Marie-Tooth disease, type 4J; Yunis-Varon syndrome | Autosomal recessive |
| 17 | FKBP10 | 607063 | Bruck syndrome 1 | Autosomal recessive |
| 7 | FKBP14 | 614505 | Ehlers-Danlos syndrome, kyphoscoliotic type, 2 | Autosomal recessive |
| 19 | FKRP | 606596 | Muscular dystrophy-dystroglycanopathy, type 5A (Walker-Warburg syndrome); Type 5B; Type 5C (limb-girdle muscular dystrophy, type 9 [LGMDR9]) | Autosomal recessive |
| 9 | FKTN | 607440 | Muscular dystrophy-dystroglycanopathy, type 4A (Walker-Warburg syndrome); Type 4B; Type 4C (limb-girdle muscular dystrophy, type 13 [LGMD R13]) | Autosomal recessive |
| 1 | FLAD1 | 610595 | Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency | Autosomal recessive |
| 1 | FLG | 135940 | Ichthyosis vulgaris | Autosomal recessive* |
| 11 | FLI1 | 193067 | Bleeding disorder, platelet-type, type 21 | Autosomal recessive* |
| 3 | FLNB | 603381 | Spondylocarpotarsal synostosis syndrome | Autosomal recessive |
| 1 | FLVCR1 | 609144 | Posterior column ataxia-retinitis pigmentosa syndrome | Autosomal recessive |
| 14 | FLVCR2 | 610865 | Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome | Autosomal recessive |
| 1 | FMN2 | 606373 | Mental retardation, autosomal recessive, type 47 | Autosomal recessive |
| 1 | FMO3 | 136132 | Trimethylaminuria | Autosomal recessive |
| X | FMR1 | 309550 | FMR1-related conditions | X-linked |
| 11 | FOLR1 | 136430 | Neurodegeneration due to cerebral folate transport deficiency | Autosomal recessive |
| 9 | FOXE1 | 602617 | Bamforth-Lazarus syndrome | Autosomal recessive |
| 1 | FOXE3 | 601094 | Anterior segment dysgenesis, type 2, multiple subtypes | Autosomal recessive |
| 17 | FOXN1 | 600838 | T-cell immunodeficiency, congenital alopecia and nail dystrophy | Autosomal recessive |
| 11 | FOXRED1 | 613622 | Mitochondrial complex I deficiency, nuclear type 19 | Autosomal recessive |
| 4 | FRAS1 | 607830 | Fraser syndrome, type 1 | Autosomal recessive |
| 9 | FREM1 | 608944 | Manitoba oculotrichoanal syndrome | Autosomal recessive |
| 13 | FREM2 | 608945 | Fraser syndrome, type 2 | Autosomal recessive |
| 9 | FRRS1L | 604574 | Epileptic encephalopathy, early infantile, 37 | Autosomal recessive |
| 11 | FSHB | 136530 | Hypogonadotropic hypogonadism, type 24, without anosmia | Autosomal recessive |
| 2 | FSHR | 136435 | Ovarian dysgenesis 1;Ovarian hyperstimulation syndrome;Ovarian response to FSH stimulation | Autosomal recessive; Autosomal dominant; Autosomal recessive |
| 21 | FTCD | 606806 | Glutamate formiminotransferase deficiency | Autosomal recessive |
| 19 | FTL | 134790 | L-ferritin deficiency | Autosomal recessive* |
| 16 | FTO | 610966 | Growth retardation, developmental delay, facial dysmorphism | Autosomal recessive |
| X | FTSJ1 | 300499 | Mental retardation, X-linked 44 | X-linked |
| 1 | FUCA1 | 612280 | Fucosidosis | Autosomal recessive |
| 14 | FUT8 | 602589 | Congenital disorder of glycosylation with defective fucosylation, type 1 | Autosomal recessive |
| 9 | FXN | 606829 | Friedreich ataxia | Autosomal recessive |
| 3 | FYCO1 | 607182 | Cataract 18 | Autosomal recessive |
| 8 | FZD6 | 603409 | Nail disorder, nonsyndromic congenital, type 10 (claw-shaped nails) | Autosomal recessive |
| 17 | G6PC1 | 613742 | Glycogen storage disease, type 1A | Autosomal recessive |
| 17 | G6PC3 | 611045 | Dursun syndrome | Autosomal recessive |
| X | G6PD | 305900 | G6PD deficiency | X-linked |
| 17 | GAA | 606800 | Glycogen storage disease, type 2 | Autosomal recessive |
| 14 | GALC | 606890 | Krabbe disease | Autosomal recessive |
| 1 | GALE | 606953 | Galactose epimerase deficiency | Autosomal recessive |
| 17 | GALK1 | 604313 | Galactokinase deficiency with cataracts | Autosomal recessive |
| 16 | GALNS | 612222 | Mucopolysaccharidosis, type 4A | Autosomal recessive |
| 2 | GALNT3 | 601756 | Tumoral calcinosis, hyperphosphatemic, familial, type 1 | Autosomal recessive |
| 9 | GALT | 606999 | Galactosemia | Autosomal recessive |
| 19 | GAMT | 601240 | Cerebral creatine deficiency syndrome, type 2 | Autosomal recessive |
| 16 | GAN | 605379 | Giant axonal neuropathy, type 1 | Autosomal recessive |
| 16 | GAS8 | 605178 | Ciliary dyskinesia, primary, type 33 | Autosomal recessive |
| 15 | GATM | 602360 | Cerebral creatine deficiency syndrome, type 3 | Autosomal recessive |
| 1 | GBA1 | 606463 | Gaucher disease | Autosomal recessive |
| 9 | GBA2 | 609471 | Spastic paraplegia, type 46, autosomal recessive | Autosomal recessive |
| 3 | GBE1 | 607839 | Glycogen storage disease, type 4 | Autosomal recessive |
| 19 | GCDH | 608801 | Glutaricaciduria, type 1 | Autosomal recessive |
| 14 | GCH1 | 600225 | Hyperphenylalaninemia, BH4-deficient, type B | Autosomal recessive |
| 7 | GCK | 138079 | Permanent neonatal diabetes mellitus (PNDM) | Autosomal recessive* |
| 6 | GCM2 | 603716 | Hypoparathyroidism, familial isolated (FIH) 2 | Autosomal recessive |
| 6 | GCNT2 | 600429 | Cataract 13, with adult i phenotype | Autosomal recessive |
| 16 | GCSH | 238330 | Multiple mitochondrial dysfunctions syndrome 7 | Autosomal recessive |
| 8 | GDAP1 | 606598 | Charcot-Marie-Tooth disease, recessive intermediate, type A | Autosomal recessive |
| 19 | GDF1 | 602880 | Right atrial isomerism (Ivemark syndrome) | Autosomal recessive |
| 20 | GDF5 | 601146 | Chondrodysplasia, Grebe type | Autosomal recessive |
| 8 | GDF6 | 601147 | Leber congenital amaurosis, type 17 | Autosomal recessive |
| 16 | GFER | 600924 | Myopathy, mitochondrial progressive, with congenital cataract, hearing loss, and developmental delay | Autosomal recessive |
| 3 | GFM1 | 606639 | Combined oxidative phosphorylation deficiency, type 1 | Autosomal recessive |
| 2 | GFPT1 | 138292 | Myasthenia, congenital, type 12, with tubular aggregates | Autosomal recessive |
| 2 | GGCX | 137167 | Vitamin K-dependent clotting factors, combined deficiency of, type 1 | Autosomal recessive |
| 17 | GH1 | 139250 | Growth hormone deficiency, isolated, type 1A; Kowarski syndrome | Autosomal recessive |
| 5 | GHR | 600946 | Laron dwarfism | Autosomal recessive |
| 7 | GHRHR | 139191 | Growth hormone deficiency, isolated, type 1B | Autosomal recessive |
| 3 | GHSR | 601898 | Growth hormone deficiency, isolated partial | Autosomal recessive |
| 20 | GINS1 | 610608 | Immunodeficiency, type 55 | Autosomal recessive |
| 19 | GIPC3 | 608792 | Deafness, autosomal recessive, type 15 | Autosomal recessive |
| 6 | GJA1 | 121014 | Craniometaphyseal dysplasia, autosomal recessive | Autosomal recessive |
| X | GJB1 | 304040 | Charcot-Marie-Tooth neuropathy, X-linked dominant, type 1 | X-linked |
| 13 | GJB2 | 121011 | Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6 | Autosomal recessive; Digenic inheritance (GJB6 gene) |
| 13 | GJB6 | 604418 | Deafness, autosomal recessive, type 1B; Deafness, digenic GJB2/GJB6 | Autosomal recessive; Digenic inheritance (GJB2 gene) |
| 1 | GJC2 | 608803 | Spastic paraplegia, type 44, autosomal recessive | Autosomal recessive |
| X | GLA | 300644 | Fabry disease | X-linked |
| 3 | GLB1 | 611458 | GM1-gangliosidosis, types 1-3; Mucopolysaccharidosis, type 4B (Morquio) | Autosomal recessive |
| 9 | GLDC | 238300 | Glycine encephalopathy | Autosomal recessive |
| 15 | GLDN | 608603 | Lethal congenital contracture syndrome 11 | Autosomal recessive |
| 9 | GLE1 | 603371 | Lethal congenital contracture syndrome, type 1; Congenital arthrogryposis with anterior horn cell disease | Autosomal recessive |
| 16 | GLIS2 | 608539 | Nephronophthisis, type 7 | Autosomal recessive |
| 9 | GLIS3 | 610192 | Diabetes mellitus, neonatal, with congenital hypothyroidism | Autosomal recessive |
| 5 | GLRA1 | 138491 | Hyperekplexia, type 1 | Autosomal recessive* |
| 4 | GLRB | 138492 | Hyperekplexia, type 2 | Autosomal recessive |
| 14 | GLRX5 | 609588 | Anemia, sideroblastic, type 3, pyridoxine-refractory; Spasticity, childhood-onset, with hyperglycinemia | Autosomal recessive |
| 1 | GLUL | 138290 | Glutamine deficiency, congenital | Autosomal recessive |
| 3 | GLYCTK | 610516 | D-glyceric aciduria | Autosomal recessive |
| 5 | GM2A | 613109 | GM2-gangliosidosis, AB variant | Autosomal recessive |
| 2 | GMPPA | 615495 | Alacrima, achalasia, and mental retardation syndrome | Autosomal recessive |
| 3 | GMPPB | 615320 | Muscular dystrophy-dystroglycanopathy 14 | Autosomal recessive |
| 3 | GNAT1 | 139330 | Night blindness, congenital stationary, type 1G | Autosomal recessive |
| 1 | GNAT2 | 139340 | Achromatopsia, type 4 | Autosomal recessive |
| 15 | GNB5 | 604447 | Intellectual developmental disorder with cardiac arrhythmia; Language delay and ADHD/cognitive impairment with or without cardiac arrhythmia | Autosomal recessive |
| 9 | GNE | 603824 | Inclusion body myopathy, type 2 (Nonaka myopathy) | Autosomal recessive |
| 6 | GNMT | 606628 | Glycine N-methyltransferase deficiency | Autosomal recessive |
| 1 | GNPAT | 602744 | Rhizomelic chondrodysplasia punctata, type 2 | Autosomal recessive |
| 12 | GNPTAB | 607840 | Mucolipidosis 2 alpha/beta; Mucolipidosis 3 alpha/beta | Autosomal recessive |
| 16 | GNPTG | 607838 | Mucolipidosis III gamma | Autosomal recessive |
| 4 | GNRHR | 138850 | Hypogonadotropic hypogonadism, type 7, without anosmia | Autosomal recessive |
| 12 | GNS | 607664 | Mucopolysaccharidosis, type 3D (Sanfilippo syndrome D) | Autosomal recessive |
| 1 | GORAB | 607983 | Geroderma osteodysplasticum | Autosomal recessive |
| 17 | GOSR2 | 604027 | Epilepsy, progressive myoclonic, type 6 | Autosomal recessive |
| 16 | GOT2 | 138150 | Epileptic encephalopathy, early infantile, 82 | Autosomal recessive |
| 17 | GP1BA | 606672 | Bernard-Soulier syndrome, type A1 | Autosomal recessive |
| 22 | GP1BB | 138720 | Bernard-Soulier syndrome, type B | Autosomal recessive |
| 19 | GP6 | 605546 | Bleeding disorder, platelet-type, type 11 | Autosomal recessive |
| 3 | GP9 | 173515 | Bernard-Soulier syndrome, type C | Autosomal recessive |
| 8 | GPAA1 | 603048 | Glycosylphosphatidylinositol biosynthesis defect 15 | Autosomal recessive |
| 13 | GPC6 | 604404 | Omodysplasia, type 1 | Autosomal recessive |
| 12 | GPD1 | 138420 | Hypertriglyceridemia, transient infantile | Autosomal recessive |
| 14 | GPHN | 603930 | Molybdenum cofactor deficiency C | Autosomal recessive |
| 19 | GPI | 172400 | Hemolytic anemia, nonspherocytic, due to glucose phosphate isomerase deficiency | Autosomal recessive |
| 8 | GPIHBP1 | 612757 | Hyperlipoproteinemia, type 1D | Autosomal recessive |
| X | GPR143 | 300808 | Ocular albinism, type 1 (Nettleship-Falls type) | X-linked |
| 17 | GPR179 | 614515 | Night blindness, congenital stationary (complete), type 1E, autosomal recessive | Autosomal recessive |
| 14 | GPR68 | 601404 | Amelogenesis imperfecta, type 2A6 (hypomaturation type) | Autosomal recessive |
| 1 | GPSM2 | 609245 | Chudley-McCullough syndrome | Autosomal recessive |
| 16 | GPT2 | 138210 | Mental retardation, autosomal recessive 49 | Autosomal recessive |
| 19 | GPX4 | 138322 | Spondylometaphyseal dysplasia, Sedaghatian type | Autosomal recessive |
| 8 | GRHL2 | 608576 | Ectodermal dysplasia/short stature syndrome | Autosomal recessive |
| 9 | GRHPR | 604296 | Hyperoxaluria, primary, type 2 | Autosomal recessive |
| 4 | GRID2 | 602368 | Spinocerebellar ataxia, autosomal recessive, type 18 | Autosomal recessive |
| 6 | GRIK2 | 138244 | Mental retardation, autosomal recessive, type, 6 | Autosomal recessive |
| 9 | GRIN1 | 138249 | Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive | Autosomal recessive |
| 12 | GRIP1 | 604597 | Fraser syndrome 3 | Autosomal recessive |
| 13 | GRK1 | 180381 | Oguchi disease-2 | Autosomal recessive |
| 6 | GRM1 | 604473 | Spinocerebellar ataxia, autosomal recessive, type 13 | Autosomal recessive |
| 5 | GRM6 | 604096 | Night blindness, congenital stationary (complete), type 1B, autosomal recessive | Autosomal recessive |
| 17 | GRN | 138945 | Ceroid lipofuscinosis, neuronal, type 11 | Autosomal recessive |
| 4 | GRXCR1 | 613283 | Deafness, autosomal recessive, type 25 | Autosomal recessive |
| 14 | GSC | 138890 | Short stature, auditory canal atresia, mandibular hypoplasia, skeletal abnormalities | Autosomal recessive |
| 20 | GSS | 601002 | Glutathione synthetase deficiency | Autosomal recessive |
| 6 | GTF2H5 | 608780 | Trichothiodystrophy, type 3, photosensitive | Autosomal recessive |
| 6 | GTPBP2 | 607434 | Jaberi-Elahi syndrome | Autosomal recessive |
| 19 | GTPBP3 | 608536 | Combined oxidative phosphorylation deficiency 23 | Autosomal recessive |
| 12 | GUCY2C | 601330 | Meconium ileus | Autosomal recessive |
| 17 | GUCY2D | 600179 | Leber congenital amaurosis, type 1 | Autosomal recessive |
| 4 | GUF1 | 617064 | ?Epileptic encephalopathy, early infantile, 40 | Autosomal recessive |
| 7 | GUSB | 611499 | Mucopolysaccharidosis, type 7 | Autosomal recessive |
| 3 | GYG1 | 603942 | Polyglucosan body myopathy, type 2 | Autosomal recessive |
| 19 | GYS1 | 138570 | Glycogen storage disease, type 0, muscle | Autosomal recessive |
| 12 | GYS2 | 138571 | Glycogen storage disease, type 0, liver | Autosomal recessive |
| 20 | GZF1 | 613842 | Joint laxity, short stature, and myopia | Autosomal recessive |
| 1 | H6PD | 138090 | Cortisone reductase deficiency 1 | Autosomal recessive |
| 2 | HAAO | 604521 | Vertebral, cardiac, renal, and limb defects syndrome 1 | Autosomal recessive |
| 6 | HACE1 | 610876 | Spastic paraplegia and psychomotor retardation with or without seizures | Autosomal recessive |
| 4 | HADH | 601609 | 3-hydroxyacyl-CoA dehydrogenase deficiency | Autosomal recessive |
| 2 | HADHA | 600890 | Long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD) deficiency; Mitochondrial trifunctional protein deficiency | Autosomal recessive |
| 2 | HADHB | 143450 | Mitochondrial trifunctional protein deficiency | Autosomal recessive |
| 19 | HAMP | 606464 | Hemochromatosis, type 2B | Autosomal recessive |
| 5 | HARS1 | 142810 | Usher syndrome, type 3B | Autosomal recessive |
| 1 | HAX1 | 605998 | Neutropenia, severe congenital, type 3, autosomal recessive | Autosomal recessive |
| 16 | HBA1 | 141800 | Alpha thalassemia | Autosomal recessive |
| 16 | HBA2 | 141850 | Alpha thalassemia | Autosomal recessive |
| 11 | HBB | 141900 | HBB-related hemoglobinopathies | Autosomal recessive |
| X | HCFC1 | 300019 | Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type ) | X-linked |
| 10 | HELLS | 603946 | Immunodeficiency-centromeric instability-facial anomalies syndrome 4 | Autosomal recessive |
| 11 | HEPACAM | 611642 | Megalencephalic leukoencephalopathy with subcortical cysts 2A | Autosomal recessive |
| 15 | HERC1 | 605109 | Macrocephaly, dysmorphic facies, and psychomotor retardation | Autosomal recessive |
| 15 | HERC2 | 605837 | Mental retardation, autosomal recessive, type 38 | Autosomal recessive |
| 17 | HES7 | 608059 | Spondylocostal dysostosis, type 4, autosomal recessive | Autosomal recessive |
| 3 | HESX1 | 601802 | Growth hormone deficiency with pituitary anomalies | Autosomal recessive |
| 15 | HEXA | 606869 | Tay-Sachs disease | Autosomal recessive |
| 5 | HEXB | 606873 | Sandhoff disease, infantile, juvenile, and adult forms | Autosomal recessive |
| 6 | HFE | 613609 | Hemochromatosis, type 1 | Autosomal recessive |
| 1 | HFM1 | 615684 | Premature ovarian failure 9 | Autosomal recessive |
| 3 | HGD | 607474 | Alkaptonuria | Autosomal recessive |
| 7 | HGF | 142409 | Deafness, autosomal recessive, type 39 | Autosomal recessive |
| 8 | HGSNAT | 610453 | Mucopolysaccharidosis type 3C (Sanfilippo syndrome C) | Autosomal recessive |
| 2 | HIBCH | 610690 | 3-hydroxyisobutryl-CoA hydrolase deficiency | Autosomal recessive |
| 11 | HIKESHI | 614908 | Leukodystrophy, hypomyelinating, type 13 | Autosomal recessive |
| 5 | HINT1 | 601314 | Neuromyotonia and axonal neuropathy, autosomal recessive | Autosomal recessive |
| 1 | HJV | 608374 | Hemochromatosis, type 2A | Autosomal recessive |
| 10 | HK1 | 142600 | Charcot-Marie-Tooth disease, type 4G | Autosomal recessive |
| 21 | HLCS | 609018 | Holocarboxylase synthetase deficiency | Autosomal recessive |
| 1 | HMGCL | 613898 | HMG-CoA lyase deficiency | Autosomal recessive |
| 1 | HMGCS2 | 600234 | HMG-CoA synthase-2 deficiency | Autosomal recessive |
| 22 | HMOX1 | 141250 | Heme oxygenase-1 deficiency | Autosomal recessive |
| 4 | HMX1 | 142992 | Oculoauricular syndrome | Autosomal recessive |
| 2 | HNMT | 605238 | Mental retardation, autosomal recessive, type 51 | Autosomal recessive |
| 10 | HOGA1 | 613597 | Hyperoxaluria, primary, type 3 | Autosomal recessive |
| 7 | HOXA1 | 142955 | Athabaskan brainstem dysgenesis syndrome | Autosomal recessive |
| 17 | HOXB1 | 142968 | Facial paresis, hereditary congenital, 3 | Autosomal recessive |
| 12 | HOXC13 | 142976 | Ectodermal dysplasia 9, hair/nail type | Autosomal recessive |
| 1 | HPCA | 142622 | Dystonia 2, torsion, autosomal recessive | Autosomal recessive |
| 12 | HPD | 609695 | Tyrosinemia, type 3 | Autosomal recessive |
| 4 | HPGD | 601688 | Hypertrophic osteoarthropathy, primary, type 1 (pachydermoperiostosis) | Autosomal recessive |
| X | HPRT1 | 308000 | Lesch-Nyhan syndrome | X-linked |
| 10 | HPS1 | 604982 | Hermansky-Pudlak syndrome, type 1 | Autosomal recessive |
| 3 | HPS3 | 606118 | Hermansky-Pudlak syndrome, type 3 | Autosomal recessive |
| 22 | HPS4 | 606682 | Hermansky-Pudlak syndrome, type 4 | Autosomal recessive |
| 11 | HPS5 | 607521 | Hermansky-Pudlak syndrome, type 5 | Autosomal recessive |
| 10 | HPS6 | 607522 | Hermansky-Pudlak syndrome, type 6 | Autosomal recessive |
| 10 | HPSE2 | 613469 | Urofacial syndrome, type 1 | Autosomal recessive |
| 8 | HR | 602302 | Alopecia universalis; Atrichia with papular lesions | Autosomal recessive |
| 16 | HSD11B2 | 614232 | Apparent mineralocorticoid excess | Autosomal recessive |
| X | HSD17B10 | 300256 | HSD10 mitochondrial disease | X-linked |
| 9 | HSD17B3 | 605573 | 46,XY disorder of sex development due to 17-beta-hydroxysteroid dehydrogenase 3 deficiency | Autosomal recessive |
| 5 | HSD17B4 | 601860 | D-bifunctional protein deficiency | Autosomal recessive |
| 1 | HSD3B2 | 613890 | Adrenal hyperplasia, congenital, due to 3-beta-hydroxysteroid dehydrogenase 2 deficiency | Autosomal recessive |
| 16 | HSD3B7 | 607764 | Bile acid synthesis defect, congenital, type 1 | Autosomal recessive |
| 5 | HSPA9 | 600548 | Even-plus syndrome | Autosomal recessive |
| 2 | HSPD1 | 118190 | Leukodystrophy, hypomyelinating, type 4 | Autosomal recessive |
| 1 | HSPG2 | 142461 | Schwartz-Jampel syndrome, type 1; Dyssegmental dysplasia, Silverman-Handmaker type | Autosomal recessive |
| 10 | HTRA1 | 602194 | CARASIL syndrome | Autosomal recessive |
| 2 | HTRA2 | 606441 | 3-methylglutaconic aciduria, type 8 | Autosomal recessive |
| 3 | HYAL1 | 607071 | ?Mucopolysaccharidosis, type 9 | Autosomal recessive |
| 7 | HYC11 | 610531 | Leukodystrophy, hypomyelinating, type 5 | Autosomal recessive |
| 16 | HYDIN | 610812 | Ciliary dyskinesia, primary, type 5 | Autosomal recessive |
| 11 | HYLS1 | 610693 | Hydrolethalus syndrome | Autosomal recessive |
| 9 | IARS1 | 600709 | Growth retardation, intellectual developmental disorder, hypotonia, and hepatopathy | Autosomal recessive |
| 1 | IBA57 | 615316 | Multiple mitochondrial dysfunctions syndrome 3 | Autosomal recessive |
| 2 | ICOS | 604558 | Immunodeficiency, common variable, 1 | Autosomal recessive |
| 20 | IDH3B | 604526 | Retinitis pigmentosa, type 46 | Autosomal recessive |
| X | IDS | 300823 | Mucopolysaccharidosis, type 2 | X-linked |
| 4 | IDUA | 252800 | Mucopolysaccharidosis type 1 | Autosomal recessive |
| 18 | IER3IP1 | 609382 | Microcephaly, epilepsy, and diabetes syndrome | Autosomal recessive |
| 6 | IFNGR1 | 107470 | Immunodeficiency, type 27A, mycobacteriosis | Autosomal recessive |
| 21 | IFNGR2 | 147569 | Immunodeficiency, type 28, mycobacteriosis | Autosomal recessive |
| 3 | IFT122 | 606045 | Cranioectodermal dysplasia 1 | Autosomal recessive |
| 16 | IFT140 | 614620 | Retinitis pigmentosa, type 80; Short-rib thoracic dysplasia 9 with or without polydactyly | Autosomal recessive |
| 2 | IFT172 | 607386 | Short-rib thoracic dysplasia 10 with or without polydactyly | Autosomal recessive |
| 14 | IFT43 | 614068 | Short-rib thoracic dysplasia 18 with polydactyly | Autosomal recessive |
| 20 | IFT52 | 617094 | Short-rib thoracic dysplasia 16 with or without polydactyly | Autosomal recessive |
| 3 | IFT80 | 611177 | Short-rib thoracic dysplasia, type 2, with or without polydactyly | Autosomal recessive |
| 12 | IFT81 | 605489 | Short-rib thoracic dysplasia 19 with or without polydactyly | Autosomal recessive |
| 12 | IGF1 | 147440 | Growth retardation with deafness and mental retardation due to IGF1 deficiency | Autosomal recessive |
| 15 | IGF1R | 147370 | Insulin-like growth factor I, resistance to | Autosomal recessive* |
| 16 | IGFALS | 601489 | Acid-labile subunit deficiency | Autosomal recessive |
| 4 | IGFBP7 | 602867 | Retinal arterial macroaneurysm with supravalvular pulmonic stenosis | Autosomal recessive |
| 11 | IGHMBP2 | 600502 | Charcot-Marie-Tooth disease, axonal, type 2S | Autosomal recessive |
| 22 | IGLL1 | 146770 | Agammaglobulinemia 2 | Autosomal recessive |
| 2 | IHH | 600726 | Acrocapitofemoral dysplasia | Autosomal recessive |
| 8 | IKBKB | 603258 | Immunodeficiency, type 15 | Autosomal recessive |
| 11 | IL10RA | 146933 | Inflammatory bowel disease, type 28, early onset, autosomal recessive | Autosomal recessive |
| 21 | IL10RB | 123889 | Inflammatory bowel disease, type 25, early onset, autosomal recessive | Autosomal recessive |
| 9 | IL11RA | 600939 | Craniosynostosis and dental anomalies | Autosomal recessive |
| 5 | IL12B | 161561 | Immunodeficiency, type 29, mycobacteriosis | Autosomal recessive |
| 19 | IL12RB1 | 601604 | Immunodeficiency, type 30 | Autosomal recessive |
| 22 | IL17RA | 605461 | Immunodeficiency, type 51 | Autosomal recessive |
| 3 | IL17RC | 610925 | Candidiasis, familial, 9 | Autosomal recessive |
| X | IL1RAPL1 | 300206 | Mental retardation, X-linked, type 21/34 | X-linked |
| 2 | IL1RN | 147679 | Sterile multifocal osteomyelitis with periostitis and pustulosis | Autosomal recessive |
| 16 | IL21R | 605383 | Immunodeficiency, type 56 | Autosomal recessive |
| 10 | IL2RA | 147730 | Immunodeficiency, type 41, with lymphoproliferation and autoimmunity | Autosomal recessive |
| X | IL2RG | 308380 | Severe combined immunodeficiency, X-linked | X-linked |
| 2 | IL36RN | 605507 | Psoriasis, type 14, pustular | Autosomal recessive |
| 5 | IL7R | 146661 | Severe combined immunodeficiency, T-cell negative, B-cell/natural killer cell-positive type | Autosomal recessive |
| 3 | ILDR1 | 609739 | Deafness, autosomal recessive, type 42 | Autosomal recessive |
| 8 | IMPA1 | 602064 | Mental retardation, autosomal recessive 59 | Autosomal recessive |
| 3 | IMPG2 | 607056 | Retinitis pigmentosa, type 56 | Autosomal recessive |
| 9 | INPP5E | 613037 | Joubert syndrome, type 1 | Autosomal recessive |
| 17 | INPP5K | 607875 | Muscular dystrophy, congenital, with cataracts and intellectual disability | Autosomal recessive |
| 11 | INPPL1 | 600829 | Opsismodysplasia | Autosomal recessive |
| 11 | INS | 176730 | Permanent neonatal diabetes mellitus (PNDM) | Autosomal recessive* |
| 19 | INSR | 147670 | Diabetes mellitus, insulin-resistant, with acanthosis nigricans, type A | Autosomal recessive |
| 7 | INTS1 | 611345 | Neurodevelopmental disorder with cataracts, poor growth, and dysmorphic facies | Autosomal recessive |
| 9 | INVS | 243305 | Nephronophthisis, type 2, infantile | Autosomal recessive |
| 3 | IQCB1 | 609237 | Senior-Loken syndrome, type 5 | Autosomal recessive |
| 7 | IQCE | 617631 | Polydactyly, postaxial, type A7 | Autosomal recessive |
| 12 | IRAK4 | 606883 | Immunodeficiency, type 67 (IRAK4 deficiency) | Autosomal recessive |
| 16 | IRF8 | 601565 | Immunodeficiency, type 32B, monocyte and dendritic cell deficiency | Autosomal recessive |
| 16 | IRX5 | 606195 | Hamamy syndrome | Autosomal recessive |
| 9 | ISCA1 | 611006 | Multiple mitochondrial dysfunctions syndrome 5 | Autosomal recessive |
| 14 | ISCA2 | 615317 | Multiple mitochondrial dysfunctions syndrome 4 | Autosomal recessive |
| 12 | ISCU | 611911 | Myopathy with lactic acidosis, hereditary | Autosomal recessive |
| 1 | ISG15 | 147571 | Immunodeficiency, type 38 | Autosomal recessive |
| 20 | ITCH | 606409 | Autoimmune disease, multisystem, with facial dysmorphism | Autosomal recessive |
| 17 | ITGA2B | 607759 | Glanzmann thrombasthenia | Autosomal recessive |
| 17 | ITGA3 | 605025 | Interstitial lung disease, nephrotic syndrome, and epidermolysis bullosa, congenital | Autosomal recessive |
| 2 | ITGA6 | 147556 | Epidermolysis bullosa, junctional, with pyloric stenosis | Autosomal recessive |
| 12 | ITGA7 | 600536 | Muscular dystrophy, congenital, due to ITGA7 deficiency | Autosomal recessive |
| 10 | ITGA8 | 604063 | Renal hypodysplasia/aplasia 1 | Autosomal recessive |
| 21 | ITGB2 | 600065 | Leukocyte adhesion deficiency | Autosomal recessive |
| 17 | ITGB3 | 173470 | Glanzmann thrombasthenia | Autosomal recessive |
| 17 | ITGB4 | 147557 | Epidermolysis bullosa, junctional, with pyloric atresia | Autosomal recessive |
| 2 | ITGB6 | 147558 | Amelogenesis imperfecta, type 1H | Autosomal recessive |
| 5 | ITK | 186973 | Lymphoproliferative syndrome 1 | Autosomal recessive |
| 20 | ITPA | 147520 | Epileptic encephalopathy, early infantile, type 35 | Autosomal recessive |
| 3 | ITPR1 | 147265 | Gillespie syndrome | Autosomal recessive* |
| 15 | IVD | 607036 | Isovaleric acidemia | Autosomal recessive |
| 6 | IYD | 612025 | Thyroid dyshormonogenesis, type 4 | Autosomal recessive |
| 3 | JAGN1 | 616012 | Neutropenia, severe congenital, 6, autosomal recessive | Autosomal recessive |
| 19 | JAK3 | 600173 | Severe Combined Immunodeficiency, autosomal recessive, T-negative/B-positive type | Autosomal recessive |
| 11 | JAM3 | 606871 | Hemorrhagic destruction of the brain, subependymal calcification, and cataracts | Autosomal recessive |
| 17 | JUP | 173325 | Naxos disease | Autosomal recessive |
| 19 | KANK2 | 614610 | Nephrotic syndrome, type 16 | Autosomal recessive |
| 16 | KARS1 | 601421 | Deafness, autosomal recessive, type 89 | Autosomal recessive |
| 16 | KATNB1 | 602703 | Lissencephaly 6, with microcephaly | Autosomal recessive |
| 16 | KATNIP | 616650 | Joubert syndrome 26 | Autosomal recessive |
| 21 | KCNE1 | 176261 | Jervell and Lange-Nielsen syndrome 2 | Autosomal recessive |
| 11 | KCNJ1 | 600359 | Bartter syndrome, type 2 | Autosomal recessive |
| 1 | KCNJ10 | 602208 | SESAME syndrome | Autosomal recessive |
| 11 | KCNJ11 | 600937 | Hyperinsulinemic hypoglycemia, type 2 (congenital hyperinsulinism); Permanent neonatal diabetes mellitus (PNDM) | Autosomal recessive; Autosomal recessive* |
| 2 | KCNJ13 | 603208 | Leber congenital amaurosis, type 16 | Autosomal recessive |
| 9 | KCNV2 | 607604 | Retinal cone dystrophy, type 3B | Autosomal recessive |
| 7 | KCTD7 | 611725 | Epilepsy, progressive myoclonic, type 3, with or without intracellular inclusions | Autosomal recessive |
| X | KDM5C | 314690 | Mental retardation, X-linked, syndromic, Claes-Jensen type | X-linked |
| 18 | KDSR | 136440 | Erythrokeratodermia variabilis et progressiva 4 | Autosomal recessive |
| 12 | KERA | 603288 | Cornea plana 2, autosomal recessive | Autosomal recessive |
| 6 | KHDC3L | 611687 | Hydatidiform mole, recurrent, type 2 | Autosomal recessive |
| 14 | KIAA0586 | 610178 | Joubert syndrome 23; Short-rib thoracic dysplasia 14 with polydactyly | Autosomal recessive |
| 17 | KIAA0753 | 617112 | ?Orofaciodigital syndrome, type 15 | Autosomal recessive |
| 7 | KIAA1549 | 613344 | Retinitis pigmentosa, type 86 | Autosomal recessive |
| 1 | KIF14 | 611279 | Microcephaly 20, primary, autosomal recessive; ?Meckel syndrome 12 | Autosomal recessive |
| 2 | KIF1A | 601255 | Neuropathy, hereditary sensory, type 2C; Spastic paraplegia, type 30, autosomal recessive | Autosomal recessive |
| 17 | KIF1C | 603060 | Spastic ataxia 2, autosomal recessive | Autosomal recessive |
| 15 | KIF7 | 611254 | Acrocallosal syndrome; Joubert syndrome, type 12 | Autosomal recessive |
| 10 | KIFBP | 609367 | Goldberg-Shprintzen megacolon syndrome | Autosomal recessive |
| 19 | KISS1R | 604161 | Hypogonadotropic hypogonadism, type 8, with or without anosmia | Autosomal recessive |
| 20 | KIZ | 615757 | Retinitis pigmentosa 69 | Autosomal recessive |
| 5 | KLHL3 | 605775 | Pseudohypoaldosteronism, type 2D | Autosomal recessive |
| 3 | KLHL40 | 615340 | Nemaline myopathy 8, autosomal recessive | Autosomal recessive |
| 2 | KLHL41 | 607701 | Nemaline myopathy 9 | Autosomal recessive |
| 7 | KLHL7 | 611119 | Cold-induced sweating syndrome 3 | Autosomal recessive |
| 19 | KLK4 | 603767 | Amelogenesis imperfecta, type 2A1 (hypomaturation type) | Autosomal recessive |
| 4 | KLKB1 | 229000 | Fletcher factor (prekallikrein) deficiency | Autosomal recessive |
| 15 | KNL1 | 609173 | Microcephaly 4, primary, autosomal recessive | Autosomal recessive |
| 19 | KPTN | 615620 | Mental retardation, autosomal recessive 41 | Autosomal recessive |
| 22 | KREMEN1 | 609898 | Ectodermal dysplasia 13, hair/tooth type | Autosomal recessive |
| 17 | KRT10 | 148080 | Epidermolytic hyperkeratosis 2B, autosomal recessive | Autosomal recessive* |
| 17 | KRT14 | 148066 | Epidermolysis bullosa simplex, autosomal recessive, type 1 | Autosomal recessive |
| 17 | KRT25 | 616646 | Woolly hair, autosomal recessive 3 | Autosomal recessive |
| 12 | KRT5 | 148040 | Epidermolysis bullosa simplex, autosomal recessive, type 1 | Autosomal recessive |
| 12 | KRT85 | 602767 | Ectodermal dysplasia 4, hair/nail type | Autosomal recessive |
| 3 | KY | 605739 | Myopathy, myofibrillar, type 7 | Autosomal recessive |
| 2 | KYNU | 605197 | Vertebral, cardiac, renal, and limb defects syndrome, type 2 | Autosomal recessive |
| X | L1CAM | 308840 | L1 Syndrome | X-linked |
| 14 | L2HGDH | 609584 | L-2-hydroxyglutaric aciduria | Autosomal recessive |
| 18 | LAMA1 | 150320 | Poretti-Boltshauser syndrome | Autosomal recessive |
| 6 | LAMA2 | 156225 | LAMA2-related muscular dystrophy | Autosomal recessive |
| 18 | LAMA3 | 600805 | Epidermolysis bullosa, junctional 2A, intermediate;Epidermolysis bullosa, junctional 2B, severe;Epidermolysis bullosa, junctional 2C, laryngoonychocutaneous | Autosomal recessive |
| 7 | LAMB1 | 150240 | Lissencephaly, type 5 | Autosomal recessive |
| 3 | LAMB2 | 150325 | Pierson syndrome; Nephrotic syndrome, type 5, with or without ocular abnormalities | Autosomal recessive; Autosomal recessive |
| 1 | LAMB3 | 150310 | Junctional epidermolysis bullosa (JEB) Herlitz type; JEB non-Herlitz type | Autosomal recessive |
| 1 | LAMC2 | 150292 | Epidermolysis bullosa, junctional 3A, intermediate;Epidermolysis bullosa, junctional 3B, severe | Autosomal recessive |
| 9 | LAMC3 | 604349 | Cortical malformations, occipital | Autosomal recessive |
| 22 | LARGE1 | 603590 | Muscular dystrophy-dystroglycanopathy, type 6A and 6B | Autosomal recessive |
| 4 | LARP7 | 612026 | Alazami syndrome | Autosomal recessive |
| 5 | LARS1 | 151350 | ?Infantile liver failure syndrome 1 (ILFS1) | Autosomal recessive |
| 3 | LARS2 | 604544 | Perrault syndrome, type 4 | Autosomal recessive |
| 16 | LAT | 602354 | Immunodeficiency, type 52 | Autosomal recessive |
| 1 | LBR | 600024 | Greenberg skeletal dysplasia | Autosomal recessive |
| 6 | LCA5 | 611408 | Leber congenital amaurosis, type 5 | Autosomal recessive |
| 16 | LCAT | 606967 | Familial LCAT deficiency; Fish-eye disease | Autosomal recessive |
| 1 | LCK | 153390 | ?Immunodeficiency, type 22 | Autosomal recessive |
| 2 | LCT | 603202 | Lactase deficiency, congenital | Autosomal recessive |
| 11 | LDHA | 150000 | Glycogen storage disease type 11 | Autosomal recessive |
| 19 | LDLR | 606945 | Hypercholesterolemia, familial, type 1 | Autosomal recessive; Autosomal dominant |
| 1 | LDLRAP1 | 605747 | Hypercholesterolemia, familial, autosomal recessive | Autosomal recessive |
| 6 | LEMD2 | 616312 | Cataract 46, juvenile-onset | Autosomal recessive |
| 7 | LEP | 164160 | Obesity, morbid, due to leptin deficiency | Autosomal recessive |
| 1 | LEPR | 601007 | Obesity, morbid, due to leptin receptor deficiency | Autosomal recessive |
| 19 | LGI4 | 608303 | Arthrogryposis multiplex congenita, neurogenic, with myelin defect | Autosomal recessive |
| 19 | LHB | 152780 | Hypogonadotropic hypogonadism, type 23, with or without anosmia | Autosomal recessive |
| 2 | LHCGR | 152790 | Leydig cell hypoplasia | Autosomal recessive |
| 6 | LHFPL5 | 609427 | Deafness, autosomal recessive, type 67 | Autosomal recessive |
| 9 | LHX3 | 600577 | Pituitary hormone deficiency, combined, type 3 | Autosomal recessive |
| 4 | LIAS | 607031 | Hyperglycinemia, lactic acidosis, and seizures | Autosomal recessive |
| 5 | LIFR | 151443 | Stuve-Wiedemann syndrome / Schwartz-Jampel type 2 syndrome | Autosomal recessive |
| 13 | LIG4 | 601837 | LIG4 syndrome | Autosomal recessive |
| 19 | LIM2 | 154045 | Cataract 19, multiple types | Autosomal recessive |
| 15 | LINS1 | 610350 | Mental retardation, autosomal recessive, type 27 | Autosomal recessive |
| 10 | LIPA | 613497 | Lysosomal acid lipase deficiency | Autosomal recessive |
| 19 | LIPE | 151750 | Lipodystrophy, familial partial, type 6 | Autosomal recessive |
| 3 | LIPH | 607365 | Hypotrichosis, type 7 or woolly hair, autosomal recessive, type 2, with or without hypotrichosis | Autosomal recessive |
| 10 | LIPN | 613924 | Ichthyosis, congenital, autosomal recessive 8 | Autosomal recessive |
| 2 | LIPT1 | 610284 | Lipoyltransferase 1 deficiency | Autosomal recessive |
| 11 | LIPT2 | 617659 | Encephalopathy, neonatal severe, with lactic acidosis and brain abnormalities | Autosomal recessive |
| 18 | LMAN1 | 601567 | Combined deficiency of factor V and factor VIII, type 1 | Autosomal recessive |
| 6 | LMBRD1 | 612625 | Methylmalonic aciduria and homocystinuria, cblF type | Autosomal recessive |
| 16 | LMF1 | 611761 | Lipase deficiency, combined | Autosomal recessive |
| 3 | LMOD3 | 616112 | Nemaline myopathy 10 | Autosomal recessive |
| 19 | LONP1 | 605490 | CODAS syndrome | Autosomal recessive |
| 18 | LOXHD1 | 613072 | Deafness, autosomal recessive, type 77 | Autosomal recessive |
| 13 | LPAR6 | 609239 | Hypotrichosis, type 8 or woolly hair, autosomal recessive, type 1, with or without hypotrichosis | Autosomal recessive |
| 2 | LPIN1 | 605518 | Myoglobinuria, acute recurrent, autosomal recessive | Autosomal recessive |
| 18 | LPIN2 | 605519 | Majeed syndrome | Autosomal recessive |
| 8 | LPL | 609708 | Lipoprotein lipase deficiency | Autosomal recessive |
| 4 | LRAT | 604863 | Leber congenital amaurosis type 14 | Autosomal recessive |
| 4 | LRBA | 606453 | Immunodeficiency, common variable, 8, with autoimmunity | Autosomal recessive |
| 1 | LRIG2 | 608869 | Urofacial syndrome 2 | Autosomal recessive |
| 4 | LRIT3 | 615004 | Night blindness, congenital stationary (complete), 1F, autosomal recessive | Autosomal recessive |
| 10 | LRMDA | 614537 | Albinism, oculocutaneous, type 7 | Autosomal recessive |
| 2 | LRP2 | 600073 | Donnai-Barrow syndrome | Autosomal recessive |
| 11 | LRP4 | 604270 | Cenani-Lenz syndactyly syndrome | Autosomal recessive |
| 11 | LRP5 | 603506 | Osteoporosis-pseudoglioma syndrome | Autosomal recessive |
| 4 | LRPAP1 | 104225 | Myopia, type 23, autosomal recessive | Autosomal recessive |
| 2 | LRPPRC | 607544 | Leigh syndrome, French-Canadian type | Autosomal recessive |
| 9 | LRSAM1 | 610933 | Charcot-Marie-Tooth disease, axonal, type 2P | Autosomal recessive |
| 11 | LRTOMT | 612414 | Deafness, autosomal recessive, type 63 | Autosomal recessive |
| 21 | LSS | 600909 | Alopecia-intellectual disability syndrome 4; Cataract 44; Hypotrichosis 14 | Autosomal recessive |
| 14 | LTBP2 | 602091 | Microspherophakia and/or megalocornea, with ectopia lentis and with or without secondary glaucoma | Autosomal recessive |
| 11 | LTBP3 | 602090 | Dental anomalies and short stature | Autosomal recessive |
| 19 | LTBP4 | 604710 | Cutis laxa, autosomal recessive, type 1C | Autosomal recessive |
| 5 | LYRM7 | 615831 | Mitochondrial complex III deficiency, nuclear type 8 | Autosomal recessive |
| 1 | LYST | 606897 | Chediak-Higashi syndrome | Autosomal recessive |
| 3 | LZTFL1 | 606568 | Bardet-Biedl syndrome, type 17 | Autosomal recessive |
| 22 | LZTR1 | 600574 | Noonan syndrome, type 2 | Autosomal recessive |
| 19 | MAG | 159460 | Spastic paraplegia, type 75, autosomal recessive | Autosomal recessive |
| 7 | MAGI2 | 606382 | Nephrotic syndrome, type 15 | Autosomal recessive |
| 6 | MAK | 154235 | Retinitis pigmentosa type 62 | Autosomal recessive |
| 18 | MALT1 | 604860 | Immunodeficiency, type 12 | Autosomal recessive |
| 9 | MAN1B1 | 604346 | Mental retardation, autosomal recessive, type 15 | Autosomal recessive |
| 19 | MAN2B1 | 609458 | Alpha-mannosidosis | Autosomal recessive |
| 4 | MANBA | 609489 | Mannosidosis, beta | Autosomal recessive |
| 2 | MAP3K20 | 609479 | Centronuclear myopathy, type 6, with fiber-type disproportion | Autosomal recessive |
| 15 | MAPKBP1 | 616786 | Nephronophthisis 20 | Autosomal recessive |
| 17 | MAPT | 157140 | Supranuclear palsy, progressive atypical (parkinsonism syndrome) | Autosomal recessive |
| 12 | MARS1 | 156560 | Interstitial lung and liver disease | Autosomal recessive |
| 2 | MARS2 | 609728 | Spastic ataxia, type 3, autosomal recessive | Autosomal recessive |
| 5 | MARVELD2 | 610572 | Deafness, autosomal recessive, type 49 | Autosomal recessive |
| 3 | MASP1 | 600521 | 3MC syndrome 1 | Autosomal recessive |
| 10 | MAT1A | 610550 | Methionine adenosyltransferase deficiency, autosomal recessive | Autosomal recessive |
| 2 | MATN3 | 602109 | ?Spondyloepimetaphyseal dysplasia | Autosomal recessive |
| 19 | MBOAT7 | 606048 | Mental retardation, autosomal recessive 57 | Autosomal recessive |
| 18 | MC2R | 607397 | Glucocorticoid deficiency, due to ACTH unresponsiveness | Autosomal recessive |
| 3 | MCCC1 | 609010 | 3-Methylcrotonyl-CoA carboxylase deficiency, type 1 | Autosomal recessive |
| 5 | MCCC2 | 609014 | 3-Methylcrotonyl-CoA carboxylase deficiency, type 2 | Autosomal recessive |
| 2 | MCEE | 608419 | Methylmalonyl-CoA epimerase deficiency | Autosomal recessive |
| 2 | MCFD2 | 607788 | Combined deficiency of factor V and factor VIII, type 2 | Autosomal recessive |
| 5 | MCIDAS | 614086 | Ciliary dyskinesia, primary, type 42 | Autosomal recessive |
| 21 | MCM3AP | 603294 | Peripheral neuropathy, autosomal recessive, with or without impaired intellectual development | Autosomal recessive |
| 8 | MCM4 | 602638 | Immunodeficiency, type 54 | Autosomal recessive |
| 6 | MCM9 | 610098 | Ovarian dysgenesis 4 | Autosomal recessive |
| 19 | MCOLN1 | 605248 | Mucolipidosis type 4 | Autosomal recessive |
| 8 | MCPH1 | 607117 | Microcephaly type 1, primary, autosomal recessive | Autosomal recessive |
| 7 | MDH2 | 154100 | Epileptic encephalopathy, early infantile, 51 | Autosomal recessive |
| X | MECP2 | 300005 | Encephalopathy, neonatal severe; Rett syndrome | X-linked |
| 1 | MECR | 608205 | Dystonia, childhood-onset, with optic atrophy and basal ganglia abnormalities | Autosomal recessive |
| 11 | MED17 | 603810 | Microcephaly, postnatal progressive, with seizures and brain atrophy | Autosomal recessive |
| 6 | MED23 | 605042 | Mental retardation, autosomal recessive, type 18 | Autosomal recessive |
| 19 | MED25 | 610197 | Basel-Vanagait-Smirin-Yosef syndrome | Autosomal recessive |
| 16 | MEFV | 608107 | Familial Mediterranean fever | Autosomal recessive |
| 5 | MEGF10 | 612453 | Myopathy, areflexia, respiratory distress, and dysphagia, early-onset | Autosomal recessive |
| 19 | MEGF8 | 604267 | Carpenter syndrome, type 2 | Autosomal recessive |
| 17 | MEOX1 | 600147 | Klippel-Feil syndrome 2 | Autosomal recessive |
| 2 | MERTK | 604705 | Retinitis pigmentosa type 38 | Autosomal recessive |
| 15 | MESP2 | 605195 | Spondylocostal dysostosis, type 2, autosomal recessive | Autosomal recessive |
| 17 | METTL23 | 615262 | Mental retardation, autosomal recessive 44 | Autosomal recessive |
| 2 | MFF | 614785 | Encephalopathy due to defective mitochondrial and peroxisomal fission, type 2 | Autosomal recessive |
| 1 | MFN2 | 608507 | Charcot-Marie-Tooth disease, axonal, type 2A2B | Autosomal recessive |
| 11 | MFRP | 606227 | Microphthalmia, isolated type 5 | Autosomal recessive |
| 1 | MFSD2A | 614397 | Microcephaly 15, primary, autosomal recessive | Autosomal recessive |
| 4 | MFSD8 | 611124 | Ceroid lipofuscinosis, neuronal, type 7 | Autosomal recessive |
| 14 | MGAT2 | 602616 | Congenital disorder of glycosylation, type 2a | Autosomal recessive |
| 20 | MGME1 | 615076 | Mitochondrial DNA depletion syndrome 11 | Autosomal recessive |
| 12 | MGP | 154870 | Keutel syndrome | Autosomal recessive |
| 10 | MICU1 | 605084 | Myopathy with extrapyramidal signs | Autosomal recessive |
| X | MID1 | 300552 | Opitz GBBB syndrome, type 1 | X-linked |
| 13 | MIPEP | 602241 | Combined oxidative phosphorylation deficiency 31 | Autosomal recessive |
| 3 | MITF | 156845 | COMMAD syndrome | Autosomal recessive |
| 20 | MKKS | 604896 | Bardet-Biedl syndrome type 6 | Autosomal recessive |
| 17 | MKS1 | 609883 | Bardet-Biedl syndrome type 13; Meckel syndrome, type 1; Joubert syndrome, type 28 | Autosomal recessive |
| 22 | MLC1 | 605908 | Megalencephalic leukoencephalopathy with subcortical cysts | Autosomal recessive |
| 2 | MLPH | 606526 | Griscelli syndrome, type 3 | Autosomal recessive |
| 16 | MLYCD | 606761 | Malonyl-CoA decarboxylase deficiency | Autosomal recessive |
| 4 | MMAA | 607481 | Methylmalonic aciduria, vitamin B12-responsive | Autosomal recessive |
| 12 | MMAB | 607568 | Methylmalonic aciduria, vitamin B12-responsive, type cblB | Autosomal recessive |
| 1 | MMACHC | 609831 | Methylmalonic aciduria and homocystinuria, cblC type | Autosomal recessive; digenic inheritance (PRDX1 gene) |
| 2 | MMADHC | 611935 | Homocystinuria, cblD type, variant 1 | Autosomal recessive |
| 3 | MME | 120520 | Charcot-Marie-Tooth disease, axonal, type 2T | Autosomal recessive* |
| 11 | MMP13 | 600108 | Metaphyseal dysplasia, Spahr type | Autosomal recessive |
| 16 | MMP2 | 120360 | Multicentric osteolysis, nodulosis, and arthropathy (MONA) | Autosomal recessive |
| 11 | MMP20 | 604629 | Amelogenesis imperfecta, type 2A2 (hypomaturation type) | Autosomal recessive |
| 10 | MMP21 | 608416 | Heterotaxy, visceral, 7, autosomal | Autosomal recessive |
| 6 | MMUT | 609058 | Methylmalonic aciduria, mut(0) type | Autosomal recessive |
| 18 | MOCOS | 613274 | Xanthinuria, type 2 | Autosomal recessive |
| 6 | MOCS1 | 603707 | Molybdenum cofactor deficiency A | Autosomal recessive |
| 5 | MOCS2 | 603708 | Molybdenum cofactor deficiency B | Autosomal recessive |
| 2 | MOGS | 601336 | Congenital disorder of glycosylation, type 2B | Autosomal recessive |
| 6 | MPC1 | 614738 | Mitochondrial pyruvate carrier deficiency | Autosomal recessive |
| 17 | MPDU1 | 604041 | Congenital disorder of glycosylation, type 1F | Autosomal recessive |
| 9 | MPDZ | 603785 | Hydrocephalus, congenital, type 2, with or without brain or eye anomalies | Autosomal recessive |
| 15 | MPI | 154550 | Congenital disorder of glycosylation, type 1B | Autosomal recessive |
| 6 | MPIG6B | 606520 | Thrombocytopenia, anemia, and myelofibrosis | Autosomal recessive |
| 1 | MPL | 159530 | Thrombocytopenia, congenital amegakaryocytic | Autosomal recessive |
| 7 | MPLKIP | 609188 | Trichothiodystrophy, type 4, nonphotosensitive | Autosomal recessive |
| 17 | MPO | 606989 | Myeloperoxidase deficiency | Autosomal recessive |
| 2 | MPV17 | 137960 | Mitochondrial DNA depletion syndrome type 6 (hepatocerebral); Charcot-Marie-Tooth disease, axonal, type 2EE | Autosomal recessive |
| 1 | MPZ | 159440 | Dejerine-Sottas disease | Autosomal recessive* |
| 21 | MRAP | 609196 | Glucocorticoid deficiency, type 2 | Autosomal recessive |
| 11 | MRE11 | 600814 | Ataxia-telangiectasia-like disorder 1 | Autosomal recessive |
| 10 | MRPS16 | 609204 | Combined oxidative phosphorylation deficiency 2 | Autosomal recessive |
| 3 | MRPS22 | 605810 | Combined oxidative phosphorylation deficiency type 5 | Autosomal recessive |
| 16 | MRPS34 | 611994 | Combined oxidative phosphorylation deficiency 32 | Autosomal recessive |
| 5 | MSH3 | 600887 | Familial adenomatous polyposis, type 4 | Autosomal recessive |
| 4 | MSMO1 | 607545 | Microcephaly, congenital cataract, and psoriasiform dermatitis | Autosomal recessive |
| 12 | MSRB3 | 613719 | Deafness, autosomal recessive, type 74 | Autosomal recessive |
| 1 | MSTO1 | 617619 | Myopathy, mitochondrial, and ataxia | Autosomal recessive* |
| 15 | MTFMT | 611766 | Combined oxidative phosphorylation deficiency 15 | Autosomal recessive |
| 14 | MTHFD1 | 172460 | Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinemia | Autosomal recessive |
| 1 | MTHFR | 607093 | Homocystinuria due to MTHFR deficiency | Autosomal recessive |
| X | MTM1 | 300415 | Myotubular myopathy, X-linked | X-linked |
| 11 | MTMR2 | 603557 | Charcot-Marie-Tooth disease, type 4B1 | Autosomal recessive |
| 6 | MTO1 | 614667 | Combined oxidative phosphorylation deficiency 10 | Autosomal recessive |
| 1 | MTR | 156570 | Homocystinuria-megaloblastic anemia, cblG complementation type | Autosomal recessive |
| 12 | MTRFR | 613541 | Combined oxidative phosphorylation deficiency 7; Spastic paraplegia, type 55, autosomal recessive | Autosomal recessive |
| 5 | MTRR | 602568 | Homocystinuria-megaloblastic anemia, cbl E type | Autosomal recessive |
| 4 | MTTP | 157147 | Abetalipoproteinemia | Autosomal recessive |
| 9 | MUSK | 601296 | Fetal akinesia deformation sequence, type 1; Myasthenic syndrome, congenital, type 9, associated with acetylcholine receptor deficiency | Autosomal recessive |
| 1 | MUTYH | 604933 | Adenomas, multiple colorectal | Autosomal recessive |
| 12 | MVK | 251170 | Mevalonic aciduria | Autosomal recessive |
| 12 | MYBPC1 | 160794 | Lethal congenital contracture syndrome, type 4 | Autosomal recessive |
| 3 | MYD88 | 602170 | Immunodeficiency, type 68 | Autosomal recessive |
| 17 | MYH2 | 160740 | Proximal myopathy and ophthalmoplegia | Autosomal recessive |
| 9 | MYMK | 615345 | Carey-Fineman-Ziter syndrome | Autosomal recessive |
| 17 | MYO15A | 602666 | Deafness, autosomal recessive, type 3 | Autosomal recessive |
| 22 | MYO18B | 607295 | Klippel-Feil syndrome, type 4, autosomal recessive, with myopathy and facial dysmorphism | Autosomal recessive |
| 15 | MYO1E | 601479 | Glomerulosclerosis, focal segmental, 6 | Autosomal recessive |
| 10 | MYO3A | 606808 | Deafness, autosomal recessive, type 30 | Autosomal recessive |
| 15 | MYO5A | 160777 | Griscelli syndrome, type 1 | Autosomal recessive |
| 18 | MYO5B | 606540 | Microvillus inclusion disease | Autosomal recessive |
| 6 | MYO6 | 600970 | Deafness, autosomal recessive, type 37 | Autosomal recessive |
| 11 | MYO7A | 276903 | Usher syndrome, type 1B; Deafness, autosomal recessive, type 2 | Autosomal recessive |
| 10 | MYPN | 608517 | Nemaline myopathy, type 11, autosomal recessive | Autosomal recessive |
| 2 | NADK2 | 615787 | 2,4-dienoyl-CoA reductase deficiency | Autosomal recessive |
| 22 | NAGA | 104170 | Schindler disease, type I; Schindler disease, type III; Kanzaki disease | Autosomal recessive |
| 17 | NAGLU | 609701 | Mucopolysaccharidosis, type 3B (Sanfilippo B) | Autosomal recessive |
| 17 | NAGS | 608300 | N-acetylglutamate synthase deficiency | Autosomal recessive |
| 13 | NALCN | 611549 | Hypotonia, infantile, with psychomotor retardation and characteristic facies 1 | Autosomal recessive |
| 9 | NANS | 605202 | Spondyloepimetaphyseal dysplasia, Camera-Genevieve type | Autosomal recessive |
| 11 | NARS2 | 612803 | Combined oxidative phosphorylation deficiency 24 | Autosomal recessive |
| 1 | NAXE | 608862 | Encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy | Autosomal recessive |
| 2 | NBAS | 608025 | Infantile liver failure syndrome, type 2; Short stature, optic nerve atrophy, and Pelger-Huet anomaly | Autosomal recessive |
| 3 | NBEAL2 | 614169 | Gray platelet syndrome | Autosomal recessive |
| 8 | NBN | 602667 | Nijmegen breakage syndrome | Autosomal recessive |
| 11 | NCAPD3 | 609276 | Microcephaly 22, primary, autosomal recessive | Autosomal recessive |
| 7 | NCF1 | 608512 | Chronic granulomatous disease, type 1 | Autosomal recessive |
| 1 | NCF2 | 608515 | Chronic granulomatous disease, type 2 | Autosomal recessive |
| 22 | NCF4 | 601488 | Chronic granulomatous disease, type 3 | Autosomal recessive |
| 16 | NDE1 | 609449 | Lissencephaly, type 4 (with microcephaly) | Autosomal recessive |
| X | NDP | 300658 | Norrie disease | X-linked |
| 8 | NDRG1 | 605262 | Charcot-Marie-Tooth disease, type 4D | Autosomal recessive |
| 5 | NDST1 | 600853 | Mental retardation, autosomal recessive, type 46 | Autosomal recessive |
| 2 | NDUFA10 | 603835 | Mitochondrial complex I deficiency, nuclear type 22 | Autosomal recessive |
| 19 | NDUFA11 | 612638 | Mitochondrial complex I deficiency, nuclear type 14 | Autosomal recessive |
| 12 | NDUFA12 | 614530 | ?Mitochondrial complex I deficiency, nuclear type 23 | Autosomal recessive |
| 5 | NDUFA2 | 602137 | Mitochondrial complex I deficiency, nuclear type 13 | Autosomal recessive |
| 12 | NDUFA9 | 603834 | Mitochondrial complex I deficiency, nuclear type 26 | Autosomal recessive |
| 15 | NDUFAF1 | 606934 | Mitochondrial complex I deficiency, nuclear type 11 | Autosomal recessive |
| 5 | NDUFAF2 | 609653 | Mitochondrial complex I deficiency, nuclear type 10 | Autosomal recessive |
| 3 | NDUFAF3 | 612911 | Mitochondrial complex I deficiency, nuclear type 18 | Autosomal recessive |
| 20 | NDUFAF5 | 612360 | Mitochondrial complex I deficiency, nuclear type 16 | Autosomal recessive |
| 8 | NDUFAF6 | 612392 | Mitochondrial complex I deficiency, nuclear type 17 | Autosomal recessive |
| 2 | NDUFB3 | 603839 | Mitochondrial complex I deficiency, nuclear type 25 | Autosomal recessive |
| 8 | NDUFB9 | 601445 | Mitochondrial complex I deficiency, nuclear type 24 | Autosomal recessive |
| 2 | NDUFS1 | 157655 | Mitochondrial complex I deficiency, nuclear type 5 | Autosomal recessive |
| 1 | NDUFS2 | 602985 | Mitochondrial complex I deficiency, nuclear type 6 | Autosomal recessive |
| 11 | NDUFS3 | 603846 | Mitochondrial complex I deficiency, nuclear type 8 | Autosomal recessive |
| 5 | NDUFS4 | 602694 | Mitochondrial complex I deficiency, nuclear type 1 | Autosomal recessive |
| 5 | NDUFS6 | 603848 | Mitochondrial complex I deficiency, nuclear type 9 | Autosomal recessive |
| 19 | NDUFS7 | 601825 | Mitochondrial complex I deficiency, nuclear type 3 | Autosomal recessive |
| 11 | NDUFS8 | 602141 | Mitochondrial complex I deficiency, nuclear type 2 | Autosomal recessive |
| 11 | NDUFV1 | 161015 | Mitochondrial complex I deficiency, nuclear type 4 | Autosomal recessive |
| 18 | NDUFV2 | 600532 | Mitochondrial complex I deficiency, nuclear type 7 | Autosomal recessive |
| 2 | NEB | 161650 | Nemaline myopathy type 2 | Autosomal recessive |
| 11 | NECTIN1 | 600644 | Cleft lip/palate-ectodermal dysplasia syndrome; Orofacial cleft 7 | Autosomal recessive |
| 1 | NECTIN4 | 609607 | Ectodermal dysplasia-syndactyly syndrome, type 1 | Autosomal recessive |
| 8 | NEFL | 162280 | Charcot-Marie-Tooth disease, type 1F | Autosomal recessive |
| 4 | NEK1 | 604588 | Short-rib thoracic dysplasia, type 6, with or without polydactyly | Autosomal recessive |
| 17 | NEK8 | 609799 | Renal-hepatic-pancreatic dysplasia, type 2 | Autosomal recessive |
| 14 | NEK9 | 609798 | Lethal congenital contracture syndrome 10 | Autosomal recessive |
| 6 | NEU1 | 608272 | Sialidosis, type 1 and type 2 | Autosomal recessive |
| 10 | NEUROG3 | 604882 | Diarrhea 4, malabsorptive, congenital | Autosomal recessive |
| 2 | NFU1 | 608100 | Multiple mitochondrial dysfunctions syndrome 1 | Autosomal recessive |
| 1 | NGF | 162030 | Neuropathy, hereditary sensory and autonomic, type 5 | Autosomal recessive |
| 3 | NGLY1 | 610661 | Congenital disorder of deglycosylation | Autosomal recessive |
| 2 | NHEJ1 | 611290 | Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation | Autosomal recessive |
| 6 | NHLRC1 | 608072 | Epilepsy, progressive myoclonic, type 2B (Lafora) | Autosomal recessive |
| 5 | NHP2 | 606470 | Dyskeratosis congenita, autosomal recessive type 2 | Autosomal recessive |
| 14 | NIN | 608684 | Seckel syndrome, type 7 | Autosomal recessive |
| 5 | NIPAL4 | 609383 | Ichthyosis, congenital, autosomal recessive, type 6 | Autosomal recessive |
| 8 | NKX2-6 | 611770 | Conotruncal heart malformations | Autosomal recessive |
| 4 | NKX3-2 | 602183 | Spondylo-megaepiphyseal-metaphyseal dysplasia | Autosomal recessive |
| 10 | NKX6-2 | 605955 | Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy | Autosomal recessive |
| 17 | NLRP1 | 606636 | Autoinflammation with arthritis and dyskeratosis | Autosomal recessive* |
| 19 | NLRP7 | 609661 | Hydatidiform mole, recurrent, type 1 | Autosomal recessive |
| 7 | NME8 | 607421 | Ciliary dyskinesia, primary, type 6 | Autosomal recessive |
| 1 | NMNAT1 | 608700 | Leber congenital amaurosis 9; Spondyloepiphyseal dysplasia, sensorineural hearing loss, intellectual developmental disorder, and Leber congenital amaurosis | Autosomal recessive |
| 5 | NNT | 607878 | Glucocorticoid deficiency 4, with or without mineralocorticoid deficiency | Autosomal recessive |
| 15 | NOP10 | 606471 | Dyskeratosis congenita, autosomal recessive type 1 | Autosomal recessive |
| 18 | NPC1 | 607623 | Niemann-Pick disease, type C1 | Autosomal recessive |
| 14 | NPC2 | 601015 | Niemann-pick disease, type C2 | Autosomal recessive |
| 2 | NPHP1 | 607100 | Joubert syndrome type 4 | Autosomal recessive |
| 3 | NPHP3 | 608002 | Meckel syndrome type 7 | Autosomal recessive |
| 1 | NPHP4 | 607215 | Nephronophthisis type 4 | Autosomal recessive |
| 19 | NPHS1 | 602716 | Nephrotic syndrome, type 1 | Autosomal recessive |
| 1 | NPHS2 | 604766 | Nephrotic syndrome, type 2 | Autosomal recessive |
| 9 | NPR2 | 108961 | Acromesomelic dysplasia, Maroteaux type | Autosomal recessive |
| X | NR0B1 | 300473 | Adrenal hypoplasia, congenital | X-linked |
| 12 | NR1H4 | 603826 | Cholestasis, progressive familial intrahepatic, type 5 | Autosomal recessive |
| 15 | NR2E3 | 604485 | Enhanced S-cone syndrome (Goldmann-Favre); Retinitis pigmentosa, type 37 | Autosomal recessive; Autosomal recessive* |
| 14 | NRL | 162080 | Retinal degeneration, autosomal recessive, clumped pigment type | Autosomal recessive* |
| 2 | NRXN1 | 600565 | Pitt-Hopkins-like syndrome, type 2 | Autosomal recessive |
| 8 | NSMCE2 | 617246 | Seckel syndrome, type 10 | Autosomal recessive |
| 5 | NSUN2 | 610916 | Mental retardation, autosomal recessive, type 5 | Autosomal recessive |
| 10 | NT5C2 | 600417 | Spastic paraplegia, type 45, autosomal recessive | Autosomal recessive |
| 7 | NT5C3A | 606224 | Anemia, hemolytic, due to UMPH1 deficiency | Autosomal recessive |
| 6 | NT5E | 129190 | Calcification of joints and arteries | Autosomal recessive |
| 16 | NTHL1 | 602656 | Familial adenomatous polyposis, type 3 | Autosomal recessive |
| 1 | NTRK1 | 191315 | Insensitivity to pain, congenital, with anhidrosis | Autosomal recessive |
| 14 | NUBPL | 613621 | Mitochondrial complex I deficiency, nuclear type 21 | Autosomal recessive |
| 12 | NUP107 | 607617 | Nephrotic syndrome, type 11 | Autosomal recessive |
| 19 | NUP62 | 605815 | Striatonigral degeneration, infantile | Autosomal recessive |
| 16 | NUP93 | 614351 | Nephrotic syndrome, type 12 | Autosomal recessive |
| 10 | OAT | 613349 | Gyrate atrophy of choroid and retina | Autosomal recessive |
| 2 | OBSL1 | 610991 | 3M syndrome 2 | Autosomal recessive |
| 15 | OCA2 | 611409 | Oculocutaneous albinism type 2 | Autosomal recessive |
| 5 | OCLN | 602876 | Pseudo-TORCH syndrome, type 1 | Autosomal recessive |
| X | OCRL | 300535 | Lowe Syndrome; Dent disease type 2 | X-linked |
| 19 | ODAD1 | 615038 | Ciliary dyskinesia, primary, type 20 | Autosomal recessive |
| 10 | ODAD2 | 615408 | Ciliary dyskinesia, primary, type 23 | Autosomal recessive |
| 19 | ODAD3 | 615956 | Ciliary dyskinesia, primary, type 30 | Autosomal recessive |
| 3 | OPA1 | 605290 | Behr syndrome | Autosomal recessive |
| 19 | OPA3 | 606580 | 3-methylglutaconic aciduria, type 3 | Autosomal recessive |
| X | OPHN1 | 300127 | Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance | X-linked |
| 10 | OPTN | 602432 | Amyotrophic lateral sclerosis, type 12 | Autosomal recessive |
| 12 | ORAI1 | 610277 | Immunodeficiency, type 9 | Autosomal recessive |
| 1 | ORC1 | 601902 | Meier-Gorlin syndrome, type 1 | Autosomal recessive |
| 2 | ORC4 | 603056 | Meier-Gorlin syndrome, type 2 | Autosomal recessive |
| 16 | ORC6 | 607213 | Meier-Gorlin syndrome, type 3 | Autosomal recessive |
| 14 | OSGEP | 610107 | Galloway-Mowat syndrome 3 | Autosomal recessive |
| 6 | OSTM1 | 607649 | Osteopetrosis, autosomal recessive type 5 | Autosomal recessive |
| X | OTC | 300461 | Ornithine transcarbamylase deficiency | X-linked |
| 16 | OTOA | 607038 | Deafness, autosomal recessive, type 22 | Autosomal recessive |
| 2 | OTOF | 603681 | Deafness, autosomal recessive, type 9 | Autosomal recessive |
| 11 | OTOG | 604487 | Deafness, autosomal recessive, type 18B | Autosomal recessive |
| 12 | OTOGL | 614925 | Deafness, autosomal recessive, type 84B | Autosomal recessive |
| 8 | OTUD6B | 612021 | Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies | Autosomal recessive |
| 5 | OTULIN | 615712 | Autoinflammation, panniculitis, and dermatosis syndrome | Autosomal recessive |
| 5 | OXCT1 | 601424 | Succinyl CoA:3-oxoacid CoA transferase deficiency | Autosomal recessive |
| 3 | P2RY12 | 600515 | Bleeding disorder, platelet-type, type 8 | Autosomal recessive |
| 1 | P3H1 | 610339 | Osteogenesis imperfecta, type 8 | Autosomal recessive |
| 3 | P3H2 | 610341 | Myopia, high, with cataract and vitreoretinal degeneration | Autosomal recessive |
| 1 | PADI6 | 610363 | Preimplantation embryonic lethality 2 | Autosomal recessive |
| 12 | PAH | 612349 | Phenylketonuria | Autosomal recessive |
| X | PAK3 | 300142 | Mental retardation, X-linked, type 30 | X-linked |
| 16 | PALB2 | 610355 | PALB2-related conditions | Autosomal recessive |
| 16 | PAM16 | 614336 | Spondylometaphyseal dysplasia, Megarbane-Dagher-Melike type | Autosomal recessive |
| 20 | PANK2 | 606157 | Neurodegeneration with brain iron accumulation type 1 | Autosomal recessive |
| 10 | PAPSS2 | 603005 | Brachyolmia, type 4, with mild epiphyseal and metaphyseal changes | Autosomal recessive |
| 1 | PARK7 | 602533 | Parkinson disease, type 7, autosomal recessive, early-onset | Autosomal recessive |
| 16 | PARN | 604212 | Dyskeratosis congenita, autosomal recessive 6 | Autosomal recessive |
| 15 | PATL2 | 614661 | Oocyte maturation defect 4 | Autosomal recessive |
| 1 | PAX7 | 167410 | Rhabdomyosarcoma 2, alveolar | Autosomal recessive |
| 11 | PC | 608786 | Pyruvate carboxylase deficiency | Autosomal recessive |
| 2 | PCARE | 613425 | Retinitis pigmentosa, type 54 | Autosomal recessive |
| 10 | PCBD1 | 126090 | Hyperphenylalaninemia, BH4-deficient, type D | Autosomal recessive |
| 13 | PCCA | 232000 | Propionic acidemia | Autosomal recessive |
| 3 | PCCB | 232050 | Propionic acidemia | Autosomal recessive |
| 5 | PCDH12 | 605622 | Microcephaly, seizures, spasticity, and brain calcification | Autosomal recessive |
| 10 | PCDH15 | 605514 | Deafness, autosomal recessive, type 23; Usher syndrome, type 1D/F digenic | Autosomal recessive |
| 14 | PCK2 | 614095 | PEPCK deficiency, mitochondrial | Autosomal recessive |
| 21 | PCNT | 605925 | Microcephalic osteodysplastic primordial dwarfism, type 2 | Autosomal recessive |
| 5 | PCSK1 | 162150 | Obesity with impaired prohormone processing | Autosomal recessive |
| 3 | PCYT1A | 123695 | Spondylometaphyseal dysplasia with cone-rod dystrophy | Autosomal recessive |
| 6 | PDE10A | 610652 | Dyskinesia, limb and orofacial, infantile-onset | Autosomal recessive |
| 5 | PDE6A | 180071 | Retinitis pigmentosa type 43 | Autosomal recessive |
| 4 | PDE6B | 180072 | Retinitis pigmentosa type 40 | Autosomal recessive |
| 10 | PDE6C | 600827 | Cone dystrophy type 4 | Autosomal recessive |
| 17 | PDE6G | 180073 | Retinitis pigmentosa type 57 | Autosomal recessive |
| 12 | PDE6H | 601190 | Retinal cone dystrophy 3 and achromatopsia 6 | Autosomal recessive* |
| X | PDHA1 | 300502 | Pyruvate dehydrogenase E1-alpha deficiency | X-linked |
| 3 | PDHB | 179060 | Pyruvate dehydrogenase E1-beta deficiency | Autosomal recessive |
| 11 | PDHX | 608769 | Lacticacidemia due to PDX1 deficiency | Autosomal recessive |
| 8 | PDP1 | 605993 | Pyruvate dehydrogenase phosphatase deficiency | Autosomal recessive |
| 10 | PDSS1 | 607429 | Coenzyme Q10 deficiency, primary, type 2 | Autosomal recessive |
| 6 | PDSS2 | 610564 | Coenzyme Q10 deficiency, primary, type 3 | Autosomal recessive |
| 13 | PDX1 | 600733 | Pancreatic agenesis type 1 | Autosomal recessive |
| 21 | PDXK | 179020 | Neuropathy, hereditary motor and sensory, type VIC, with optic atrophy | Autosomal recessive |
| 10 | PDZD7 | 612971 | Deafness, autosomal recessive, type 57; Usher syndrome, type 2C, digenic | Autosomal recessive; Digenic inheritance (ADGRV1 gene) |
| 19 | PEPD | 613230 | Prolidase deficiency | Autosomal recessive |
| 19 | PET100 | 614770 | Mitochondrial complex IV deficiency, nuclear type 12 | Autosomal recessive |
| 7 | PEX1 | 602136 | Heimler syndrome 1; Peroxisome biogenesis disorder 1A (Zellweger); Peroxisome biogenesis disorder 1B (NALD/IRD) | Autosomal recessive |
| 1 | PEX10 | 602859 | Peroxisome biogenesis disorder, type 6A (Zellweger syndrome); Peroxisome biogenesis disorder, type 6B | Autosomal recessive |
| 1 | PEX11B | 603867 | ?Peroxisome biogenesis disorder 14B | Autosomal recessive |
| 17 | PEX12 | 601758 | Peroxisome biogenesis disorder type 3A (Zellweger) | Autosomal recessive |
| 2 | PEX13 | 601789 | Peroxisome biogenesis disorder, type 11A (Zellweger syndrome); Peroxisome biogenesis disorder, type 11B | Autosomal recessive |
| 1 | PEX14 | 601791 | Peroxisome biogenesis disorder, type 13A (Zellweger syndrome) | Autosomal recessive |
| 11 | PEX16 | 603360 | Peroxisome biogenesis disorder, type 8A (Zellweger syndrome); Peroxisome biogenesis disorder, type 8B | Autosomal recessive |
| 1 | PEX19 | 600279 | Peroxisome biogenesis disorder, type 12A (Zellweger syndrome) | Autosomal recessive |
| 8 | PEX2 | 170993 | Peroxisome biogenesis disorder type 5A (Zellweger) | Autosomal recessive |
| 22 | PEX26 | 608666 | Peroxisome biogenesis disorder type 7A (Zellweger) | Autosomal recessive |
| 6 | PEX3 | 603164 | Peroxisome biogenesis disorder, type 10A (Zellweger syndrome) | Autosomal recessive |
| 12 | PEX5 | 600414 | Peroxisome biogenesis disorder type 2A (Zellweger) | Autosomal recessive |
| 6 | PEX6 | 601498 | Peroxisome biogenesis disorder, type 4A (Zellweger syndrome); Peroxisome biogenesis disorder, type 4B; Heimler syndrome 2 | Autosomal recessive; Autosomal recessive*; Autosomal recessive |
| 6 | PEX7 | 601757 | Rhizomelic chondrodysplasia punctata, type 1 | Autosomal recessive |
| 12 | PFKM | 610681 | Glycogen storage disease, type 7 | Autosomal recessive |
| 7 | PGAM2 | 612931 | Glycogen storage disease X | Autosomal recessive |
| 2 | PGAP1 | 611655 | Mental retardation, autosomal recessive 42 | Autosomal recessive |
| 11 | PGAP2 | 615187 | Hyperphosphatasia with mental retardation syndrome 3 | Autosomal recessive |
| 17 | PGAP3 | 611801 | Hyperphosphatasia with mental retardation syndrome 4 | Autosomal recessive |
| X | PGK1 | 311800 | Phosphoglycerate kinase 1 deficiency | X-linked |
| 1 | PGM1 | 171900 | Congenital disorder of glycosylation, type 1t | Autosomal recessive |
| 6 | PGM3 | 172100 | Immunodeficiency, type 23 | Autosomal recessive |
| X | PHF8 | 300560 | Mental retardation syndrome, X-linked, Siderius type | X-linked |
| 1 | PHGDH | 606879 | Neu-Laxova syndrome, type 1; Phosphoglycerate dehydrogenase deficiency | Autosomal recessive |
| 16 | PHKB | 172490 | Glycogen storage disease, type 9B | Autosomal recessive |
| 16 | PHKG2 | 172471 | Glycogen storage disease type 9c | Autosomal recessive |
| 11 | PHOX2A | 602753 | Fibrosis of extraocular muscles, congenital, 2 | Autosomal recessive |
| 10 | PHYH | 602026 | Refsum disease | Autosomal recessive |
| 22 | PI4KA | 600286 | Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis | Autosomal recessive |
| 13 | PIBF1 | 607532 | Joubert syndrome 33 | Autosomal recessive |
| 16 | PIEZO1 | 611184 | Lymphedema, hereditary, type 3 | Autosomal recessive |
| 18 | PIEZO2 | 613629 | Arthrogryposis, distal, with impaired proprioception and touch | Autosomal recessive |
| 1 | PIGC | 601730 | Glycosylphosphatidylinositol biosynthesis defect 16 | Autosomal recessive |
| 4 | PIGG | 616918 | Mental retardation, autosomal recessive 53 | Autosomal recessive |
| 17 | PIGL | 605947 | Zunich neuroectodermal syndrome | Autosomal recessive |
| 1 | PIGM | 610273 | Glycosylphosphatidylinositol deficiency | Autosomal recessive |
| 18 | PIGN | 606097 | Multiple congenital anomalies-hypotonia-seizures syndrome, type 1 | Autosomal recessive |
| 9 | PIGO | 614730 | Hyperphosphatasia with mental retardation syndrome 2 | Autosomal recessive |
| 20 | PIGT | 610272 | Multiple congenital anomalies-hypotonia-seizures syndrome 3 | Autosomal recessive |
| 1 | PIGV | 610274 | Hyperphosphatasia with mental retardation syndrome 1 | Autosomal recessive |
| 17 | PIGW | 610275 | Glycosylphosphatidylinositol biosynthesis defect 11 | Autosomal recessive |
| 4 | PIGY | 610662 | Hyperphosphatasia with mental retardation syndrome 6 | Autosomal recessive |
| 1 | PINK1 | 608309 | Parkinson disease, type 6, early onset | Autosomal recessive |
| 19 | PIP5K1C | 606102 | Lethal congenital contractural syndrome, type 3 | Autosomal recessive |
| 2 | PJVK | 610219 | Deafness, autosomal recessive, type 59 | Autosomal recessive |
| 7 | PKD1L1 | 609721 | Heterotaxy, visceral, 8, autosomal | Autosomal recessive |
| 6 | PKHD1 | 606702 | Polycystic kidney disease type 4 | Autosomal recessive |
| 1 | PKLR | 609712 | Pyruvate kinase deficiency | Autosomal recessive |
| 1 | PKP1 | 601975 | Ectodermal dysplasia/skin fragility syndrome | Autosomal recessive |
| 22 | PLA2G6 | 603604 | Infantile neuroaxonal dystrophy type 1 | Autosomal recessive |
| 9 | PLAA | 603873 | Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies | Autosomal recessive |
| 20 | PLCB1 | 607120 | Epileptic encephalopathy, early infantile, type 12 | Autosomal recessive |
| 20 | PLCB4 | 600810 | Auriculocondylar syndrome, type 2 | Autosomal recessive* |
| 3 | PLCD1 | 602142 | Nail disorder, nonsyndromic congenital, type 3 (leukonychia) | Autosomal recessive |
| 10 | PLCE1 | 608414 | Nephrotic syndrome, type 3 | Autosomal recessive |
| 3 | PLD1 | 602382 | Cardiac valvular defect, developmental | Autosomal recessive |
| 8 | PLEC | 601282 | Epidermolysis bullosa simplex with muscular dystrophy | Autosomal recessive |
| 1 | PLEKHG5 | 611101 | Charcot-Marie-Tooth disease, recessive intermediate, type C | Autosomal recessive |
| 6 | PLG | 173350 | Plasminogen deficiency, type I | Autosomal recessive |
| 4 | PLK4 | 605031 | Microcephaly and chorioretinopathy, autosomal recessive, 2 | Autosomal recessive |
| 1 | PLOD1 | 153454 | Ehlers-Danlos syndrome, kyphoscoliotic type, 1 | Autosomal recessive |
| 3 | PLOD2 | 601865 | Bruck syndrome 2 | Autosomal recessive |
| 7 | PLOD3 | 603066 | Lysyl hydroxylase 3 deficiency | Autosomal recessive |
| X | PLP1 | 300401 | Pelizaeus-Merzbacher disease | X-linked |
| 8 | PLPBP | 604436 | Epilepsy, early-onset, vitamin B6-dependent | Autosomal recessive |
| 16 | PMM2 | 601785 | Congenital disorder of glycosylation, type 1A | Autosomal recessive |
| 17 | PMP22 | 601097 | Dejerine-Sottas disease | Autosomal recessive* |
| 9 | PMPCA | 613036 | Spinocerebellar ataxia, autosomal recessive, type 2 | Autosomal recessive |
| 7 | PMPCB | 603131 | Multiple mitochondrial dysfunctions syndrome 6 | Autosomal recessive |
| 19 | PNKP | 605610 | Microcephaly, seizures, and developmental delay; Ataxia-oculomotor apraxia 4; ?Charcot-Marie-Tooth disease, type 2B2 | Autosomal recessive |
| 14 | PNP | 164050 | Immunodeficiency due to purine nucleoside phosphorylase deficiency | Autosomal recessive |
| 6 | PNPLA1 | 612121 | Ichthyosis, congenital, autosomal recessive, type 10 | Autosomal recessive |
| 11 | PNPLA2 | 609059 | Neutral lipid storage disease with myopathy | Autosomal recessive |
| 19 | PNPLA6 | 603197 | Boucher-Neuhauser syndrome; Oliver-McFarlane syndrome; Spastic paraplegia, type 39, autosomal recessive | Autosomal recessive |
| 17 | PNPO | 603287 | Pyridoxamine 5'-phosphate oxidase deficiency | Autosomal recessive |
| 2 | PNPT1 | 610316 | Combined oxidative phosphorylation deficiency 13 | Autosomal recessive |
| 3 | POC1A | 614783 | Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis | Autosomal recessive |
| 12 | POC1B | 614784 | Cone-rod dystrophy 20 | Autosomal recessive |
| 12 | POLE | 174762 | FILS syndrome | Autosomal recessive |
| 15 | POLG | 174763 | POLG-related disorders | Autosomal recessive |
| 6 | POLH | 603968 | Xeroderma pigmentosum, variant type | Autosomal recessive |
| 6 | POLR1C | 610060 | Leukodystrophy, hypomyelinating, type 11; Treacher Collins syndrome 3 | Autosomal recessive |
| 13 | POLR1D | 613715 | Treacher Collins syndrome, type 2 | Autosomal recessive* |
| 10 | POLR3A | 614258 | Leukodystrophy, hypomyelinating, type 7 | Autosomal recessive |
| 12 | POLR3B | 614366 | Leukodystrophy, hypomyelinating, type 8 | Autosomal recessive |
| 2 | POMC | 176830 | Obesity, adrenal insufficiency, and red hair due to POMC deficiency | Autosomal recessive |
| 1 | POMGNT1 | 606822 | Muscular dystrophy-dystroglycanopathy, type 3A (Walker-Warburg syndrome); Type 3B; Type 3C (limb-girdle muscular dystrophy, type 15 [LGMDR15]) | Autosomal recessive |
| 3 | POMGNT2 | 614828 | Muscular dystrophy-dystroglycanopathy, type 8A (Walker-Warburg syndrome); Type 8C (limb-girdle muscular dystrophy, type 24 [LGMD R24]) | Autosomal recessive |
| 8 | POMK | 615247 | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 12 | Autosomal recessive |
| 13 | POMP | 613386 | Keratosis linearis with ichthyosis congenita and sclerosing keratoderma | Autosomal recessive |
| 9 | POMT1 | 607423 | Muscular dystrophy-dystroglycanopathy, type 1A (Walker-Warburg syndrome); Type 1B; Type 1C (limb-girdle muscular dystrophy, type 11 [LGMD R11]) | Autosomal recessive |
| 14 | POMT2 | 607439 | Muscular dystrophy-dystroglycanopathy, type 2A (Walker-Warburg syndrome); Type 2B; Type 2C (limb-girdle muscular dystrophy, type 14 [LGMD R14]) | Autosomal recessive |
| 8 | POP1 | 602486 | Anauxetic dysplasia, type 2 | Autosomal recessive |
| 7 | POR | 124015 | Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis | Autosomal recessive |
| 3 | POU1F1 | 173110 | Pituitary hormone deficiency, combined, type 1 | Autosomal recessive* |
| X | POU3F4 | 300039 | Deafness, X-linked, type 2 | X-linked |
| 4 | PPA2 | 609988 | Sudden cardiac failure, infantile | Autosomal recessive |
| 15 | PPIB | 123841 | Osteogenesis imperfecta, type 9 | Autosomal recessive |
| 4 | PPM1K | 611065 | ?Maple syrup urine disease, mild variant | Autosomal recessive |
| 1 | PPP1R15B | 613257 | Microcephaly, short stature, and impaired glucose metabolism 2 | Autosomal recessive |
| 1 | PPT1 | 600722 | Ceroid lipofuscinosis, neuronal, type 1 | Autosomal recessive |
| X | PQBP1 | 300463 | Renpenning syndrome | X-linked |
| 17 | PRCD | 610598 | Retinitis pigmentosa, type 36 | Autosomal recessive |
| 9 | PRDM12 | 616458 | Neuropathy, hereditary sensory and autonomic, type VIII | Autosomal recessive |
| 4 | PRDM5 | 614161 | Brittle cornea syndrome, type 2 | Autosomal recessive |
| 1 | PRDX1 | 176763 | Methylmalonic aciduria and homocystinuria, cblC type, digenic | Autosomal recessive; Digenic inheritance (MMACHC gene) |
| 2 | PREPL | 609557 | Myasthenic syndrome, congenital, type 22 | Autosomal recessive |
| 10 | PRF1 | 170280 | Hemophagocytic lymphohistiocytosis, familial, type 2 | Autosomal recessive |
| 1 | PRG4 | 604283 | Camptodactyly-arthropathy-coxa vara-pericarditis syndrome | Autosomal recessive |
| 12 | PRICKLE1 | 608500 | Epilepsy, progressive myoclonic, type 1B | Autosomal recessive |
| 3 | PRKCD | 176977 | Autoimmune lymphoproliferative syndrome, type 3 | Autosomal recessive |
| 6 | PRKN | 602544 | Parkinson disease, type 2, juvenile | Autosomal recessive |
| 2 | PRKRA | 603424 | Dystonia, type 16 | Autosomal recessive |
| 16 | PRMT7 | 610087 | Short stature, brachydactyly, intellectual developmental disability, and seizures | Autosomal recessive |
| 2 | PROC | 612283 | Thrombophilia due to protein C deficiency, autosomal recessive | Autosomal recessive |
| 22 | PRODH | 606810 | Hyperprolinemia, type 1 | Autosomal recessive |
| 4 | PROM1 | 604365 | Retinitis pigmentosa, type 41 | Autosomal recessive |
| 5 | PROP1 | 601538 | Pituitary hormone deficiency, combined, type 2 | Autosomal recessive |
| 3 | PROS1 | 176880 | Thrombophilia due to protein S deficiency, autosomal recessive | Autosomal recessive |
| 6 | PRPH2 | 179605 | Leber congenital amaurosis 18; Retinitis punctata albescens | Autosomal recessive* |
| X | PRPS1 | 311850 | PRPS1-related disoders | X-linked |
| 1 | PRRX1 | 167420 | Agnathia-otocephaly complex | Autosomal recessive* |
| 4 | PRSS12 | 606709 | Mental retardation, autosomal recessive, type 1 | Autosomal recessive |
| 2 | PRSS56 | 613858 | Microphthalmia, isolated, type 6 | Autosomal recessive |
| 1 | PRUNE1 | 617413 | Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies | Autosomal recessive |
| 19 | PRX | 605725 | Charcot-Marie-Tooth disease, type 4F | Autosomal recessive |
| 10 | PSAP | 176801 | Combined SAP deficiency | Autosomal recessive |
| 9 | PSAT1 | 610936 | Neu-Laxova syndrome, type 2 | Autosomal recessive |
| 6 | PSMB8 | 177046 | Autoinflammation, lipodystrophy, and dermatosis syndrome | Autosomal recessive |
| 17 | PSMC3IP | 608665 | Ovarian dysgenesis 3 | Autosomal recessive |
| 7 | PSPH | 172480 | Phosphoserine phosphatase deficiency | Autosomal recessive |
| 10 | PTF1A | 607194 | Pancreatic agenesis 2 | Autosomal recessive |
| 11 | PTH | 168450 | Hypoparathyroidism, familial isolated, type 1 | Autosomal recessive* |
| 3 | PTH1R | 168468 | Chondrodysplasia, Blomstrand type; Eiken syndrome | Autosomal recessive |
| 3 | PTPN23 | 606584 | Neurodevelopmental disorder and structural brain anomalies with or without seizures and spasticity | Autosomal recessive |
| 1 | PTPRC | 151460 | Severe combined immunodeficiency, T cell-negative, B-cell/natural killer-cell positive | Autosomal recessive |
| 12 | PTPRO | 600579 | Nephrotic syndrome, type 6 | Autosomal recessive |
| 12 | PTPRQ | 603317 | Deafness, autosomal recessive, type 84A | Autosomal recessive |
| 17 | PTRH2 | 608625 | Infantile-onset multisystem neurologic, endocrine, and pancreatic disease | Autosomal recessive |
| 11 | PTS | 612719 | Hyperphenylalaninemia, BH4-deficient, type A | Autosomal recessive |
| 12 | PUS1 | 608109 | Myopathy, lactic acidosis, and sideroblastic anemia, type 1 | Autosomal recessive |
| 2 | PXDN | 605158 | Anterior segment dysgenesis, type 7, with sclerocornea | Autosomal recessive |
| 17 | PYCR1 | 179035 | Cutis laxa, autosomal recessive, type 2B | Autosomal recessive |
| 1 | PYCR2 | 616406 | Leukodystrophy, hypomyelinating, type 10 | Autosomal recessive |
| 14 | PYGL | 613741 | Glycogen storage disease, type 6 | Autosomal recessive |
| 11 | PYGM | 608455 | McArdle disease | Autosomal recessive |
| 12 | PYROXD1 | 617220 | Myopathy, myofibrillar, type 8 | Autosomal recessive |
| 3 | QARS1 | 603727 | Microcephaly, progressive, seizures, and cerebral and cerebellar atrophy | Autosomal recessive |
| 4 | QDPR | 612676 | Hyperphenylalaninemia, BH4-deficient, type C | Autosomal recessive |
| 10 | RAB18 | 602207 | Warburg micro syndrome, type 3 | Autosomal recessive |
| 6 | RAB23 | 606144 | Carpenter syndrome | Autosomal recessive |
| 15 | RAB27A | 603868 | Griscelli syndrome, type 2 | Autosomal recessive |
| 4 | RAB28 | 612994 | Cone-rod dystrophy 18 | Autosomal recessive |
| 4 | RAB33B | 605950 | Smith-McCort dysplasia 2 | Autosomal recessive |
| 2 | RAB3GAP1 | 602536 | Warburg micro syndrome, type 1 | Autosomal recessive |
| 1 | RAB3GAP2 | 609275 | Martsolf syndrome 1; Warburg micro syndrome 2 | Autosomal recessive |
| 5 | RAD50 | 604040 | Nijmegen breakage syndrome-like disorder | Autosomal recessive |
| 17 | RAD51C | 602774 | RAD51C-related conditions | Autosomal recessive |
| 11 | RAG1 | 179615 | Omenn syndrome; Severe combined immunodeficiency, B cell-negative | Autosomal recessive |
| 11 | RAG2 | 179616 | Omenn syndrome; Severe combined immunodeficiency, B cell-negative | Autosomal recessive |
| 11 | RAPSN | 601592 | Fetal akinesia deformation sequence, type 2; Myasthenic syndrome, congenital, type 11, associated with AChR deficiency | Autosomal recessive |
| 3 | RARB | 180220 | Microphthalmia, syndromic 12 | Autosomal recessive |
| 5 | RARS1 | 107820 | Leukodystrophy, hypomyelinating, type 9 | Autosomal recessive |
| 6 | RARS2 | 611524 | Pontocerebellar hypoplasia, type 6 | Autosomal recessive |
| 15 | RASGRP1 | 603962 | Immunodeficiency, type 64 | Autosomal recessive |
| 18 | RAX | 601881 | Isolated microphthalmia, type 3 | Autosomal recessive |
| 18 | RBBP8 | 604124 | Jawad syndrome; Seckel syndrome, type 2 | Autosomal recessive |
| 20 | RBCK1 | 610924 | Polyglucosan body myopathy 1 with or without immunodeficiency | Autosomal recessive |
| 1 | RBM8A | 605313 | Thrombocytopenia-absent radius syndrome | Autosomal recessive |
| 10 | RBP3 | 180290 | ?Retinitis pigmentosa 66 | Autosomal recessive |
| 10 | RBP4 | 180250 | Retinal dystrophy, iris coloboma, and comedogenic acne syndrome | Autosomal recessive |
| 13 | RCBTB1 | 607867 | Retinal dystrophy with or without extraocular anomalies | Autosomal recessive |
| 1 | RD3 | 180040 | Leber congenital amaurosis, type 12 | Autosomal recessive |
| 14 | RDH12 | 608830 | Leber congenital amaurosis, type 13 | Autosomal recessive |
| 12 | RDH5 | 601617 | Fundus albipunctatus | Autosomal recessive* |
| 11 | RDX | 179410 | Deafness, autosomal recessive, type 24 | Autosomal recessive |
| 8 | RECQL4 | 603780 | Baller-Gerold syndrome; RAPADILINO syndrome; Rothmund-Thomson syndrome | Autosomal recessive |
| 19 | REEP6 | 609346 | Retinitis pigmentosa 77 | Autosomal recessive |
| 7 | RELN | 600514 | Lissencephaly 2 (Norman-Roberts type) | Autosomal recessive |
| 1 | REN | 179820 | Renal tubular dysgenesis | Autosomal recessive |
| 5 | RETREG1 | 613114 | Neuropathy, hereditary sensory and autonomic, type 2B | Autosomal recessive |
| 3 | RFT1 | 611908 | Congenital disorder of glycosylation, type In | Autosomal recessive |
| 1 | RFX5 | 601863 | Bare lymphocyte syndrome, type 2 | Autosomal recessive |
| 6 | RFX6 | 612659 | Mitchell-Riley syndrome | Autosomal recessive |
| 19 | RFXANK | 603200 | Bare lymphocyte syndrome, type 2, complementation group B | Autosomal recessive |
| 13 | RFXAP | 601861 | Bare lymphocyte syndrome, type 2 | Autosomal recessive |
| 3 | RHO | 180380 | Retinitis pigmentosa, type 4; Retinitis punctata albescens | Autosomal recessive* |
| 20 | RIN2 | 610222 | Macs syndrome | Autosomal recessive |
| 21 | RIPK4 | 605706 | Popliteal pterygium syndrome, Bartsocas-Papas type | Autosomal recessive |
| 6 | RIPOR2 | 611410 | Deafness, autosomal recessive, type 104 | Autosomal recessive |
| 15 | RLBP1 | 180090 | Bothnia retinal dystrophy; Fundus albipunctatus | Autosomal recessive; Autosomal recessive* |
| 6 | RMND1 | 614917 | Combined oxidative phosphorylation deficiency 11 | Autosomal recessive |
| 9 | RMRP | 157660 | Anauxetic dysplasia, type 1 | Autosomal recessive |
| 2 | RNASEH1 | 604123 | Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 2 | Autosomal recessive |
| 19 | RNASEH2A | 606034 | Aicardi-Goutieres syndrome, type 4 | Autosomal recessive |
| 13 | RNASEH2B | 610326 | Aicardi-Goutieres syndrome, type 2 | Autosomal recessive |
| 11 | RNASEH2C | 610330 | Aicardi-Goutieres syndrome, type 3 | Autosomal recessive |
| 6 | RNASET2 | 612944 | Leukoencephalopathy, cystic, without megalencephaly | Autosomal recessive |
| 3 | RNF168 | 612688 | RIDDLE syndrome | Autosomal recessive |
| 7 | RNF216 | 609948 | Gordon Holmes syndrome | Autosomal recessive |
| 11 | ROBO3 | 608630 | Gaze palsy, familial horizontal, with progressive scoliosis, type 1 | Autosomal recessive |
| 16 | ROGDI | 614574 | Kohlschutter-Tonz syndrome | Autosomal recessive |
| 11 | ROM1 | 180721 | Retinitis pigmentosa, type 7, digenic | Autosomal recessive |
| 9 | ROR2 | 602337 | Robinow syndrome, autosomal recessive | Autosomal recessive |
| 1 | RORC | 602943 | Immunodeficiency, type 42 | Autosomal recessive |
| 8 | RP1 | 603937 | Retinitis pigmentosa, type 1 | Autosomal recessive |
| X | RP2 | 300757 | Retinitis pigmentosa, type 2, X-linked | X-linked |
| 1 | RPE65 | 180069 | RPE65-related Leber congenital amaurosis/early-onset severe retinal dystrophy | Autosomal recessive |
| X | RPGR | 312610 | Retinitis pigmentosa, type 3, X-linked; Cone-rod dystrophy, X-linked, 1 | X-linked |
| 14 | RPGRIP1 | 605446 | Leber congenital amaurosis, type 6 | Autosomal recessive |
| 16 | RPGRIP1L | 610937 | Joubert syndrome, type 7; Meckel syndrome, type 5; COACH syndrome | Autosomal recessive |
| 8 | RRM2B | 604712 | Mitochondrial DNA depletion syndrome, type 8A (encephalomyopathic type with renal tubulopathy) and type 8B (MNGIE type) | Autosomal recessive |
| X | RS1 | 300839 | Retinoschisis | X-linked |
| 21 | RSPH1 | 609314 | Ciliary dyskinesia, primary, type 24 | Autosomal recessive |
| 6 | RSPH3 | 615876 | Ciliary dyskinesia, primary, type 32 | Autosomal recessive |
| 6 | RSPH4A | 612647 | Ciliary dyskinesia, primary, type 11 | Autosomal recessive |
| 6 | RSPH9 | 612648 | Ciliary dyskinesia, primary, type 12 | Autosomal recessive |
| 20 | RSPO4 | 610573 | Anonychia congenita | Autosomal recessive |
| 16 | RSPRY1 | 616585 | Spondyloepimetaphyseal dysplasia, Faden-Alkuraya type | Autosomal recessive |
| 20 | RTEL1 | 608833 | Dyskeratosis congenita, autosomal recessive type 5 | Autosomal recessive* |
| 6 | RTN4IP1 | 610502 | Optic atrophy 10 with or without ataxia, mental retardation, and seizures | Autosomal recessive |
| 18 | RTTN | 610436 | Microcephaly, short stature, and polymicrogyria with seizures | Autosomal recessive |
| 9 | RUSC2 | 611053 | Mental retardation, autosomal recessive 61 | Autosomal recessive |
| 12 | RXYLT1 | 605862 | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10 | Autosomal recessive |
| 19 | RYR1 | 180901 | Malignant hyperthermia susceptibility, type 1 | Autosomal dominant |
| 19 | S1PR2 | 605111 | Deafness, autosomal recessive, type 68 | Autosomal recessive |
| 13 | SACS | 604490 | Spastic ataxia, Charlevoix-Saguenay, type | Autosomal recessive |
| 2 | SAG | 181031 | Oguchi disease, type 1 | Autosomal recessive |
| 7 | SAMD9 | 610456 | Tumoral calcinosis, familial, normophosphatemic | Autosomal recessive |
| 20 | SAMHD1 | 606754 | Aicardi-Goutieres syndrome, type 5 | Autosomal recessive |
| 5 | SAR1B | 607690 | Chylomicron retention disease | Autosomal recessive |
| 19 | SARS2 | 612804 | Hyperuricemia, pulmonary hypertension, renal failure, and alkalosis | Autosomal recessive |
| 7 | SBDS | 607444 | Shwachman-Diamond syndrome | Autosomal recessive |
| 22 | SBF1 | 603560 | Charcot-Marie-Tooth disease, type 4B3 | Autosomal recessive |
| 11 | SBF2 | 607697 | Charcot-Marie-Tooth disease, type 4B2 | Autosomal recessive |
| 11 | SC5D | 602286 | Lathosterolosis | Autosomal recessive |
| 4 | SCARB2 | 602257 | Epilepsy, progressive myoclonic, type 4, with or without renal failure | Autosomal recessive |
| 22 | SCARF2 | 613619 | Van den Ende-Gupta syndrome | Autosomal recessive |
| 19 | SCN1B | 600235 | Epileptic encephalopathy, early infantile, type 52 | Autosomal recessive |
| 17 | SCN4A | 603967 | Myasthenic syndrome, congenital, type 16 | Autosomal recessive |
| 2 | SCN9A | 603415 | Indifference to pain and autosomal recessive hereditary sensory neuropathy type 2D | Autosomal recessive |
| 12 | SCNN1A | 600228 | Pseudohypoaldosteronism, type 1 | Autosomal recessive |
| 16 | SCNN1B | 600760 | Pseudohypoaldosteronism, type 1 | Autosomal recessive |
| 16 | SCNN1G | 600761 | Pseudohypoaldosteronism, type 1 | Autosomal recessive |
| 17 | SCO1 | 603644 | Mitochondrial complex IV deficiency, nuclear type 4 | Autosomal recessive |
| 22 | SCO2 | 604272 | Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, type 1 | Autosomal recessive |
| 11 | SCYL1 | 607982 | Spinocerebellar ataxia, autosomal recessive, type 21 | Autosomal recessive |
| 1 | SDCCAG8 | 613524 | Bardet-Biedl syndrome, type 16 | Autosomal recessive |
| 5 | SDHA | 600857 | Mitochondrial respiratory chain complex II deficiency; Leigh syndrome | Autosomal recessive |
| 19 | SDHAF1 | 612848 | Mitochondrial complex II deficiency | Autosomal recessive |
| 12 | SDR9C7 | 609769 | Ichthyosis, congenital, autosomal recessive 13 | Autosomal recessive |
| 14 | SEC23A | 610511 | Craniolenticulosutural dysplasia | Autosomal recessive |
| 20 | SEC23B | 610512 | Dyserythropoietic anemia, congenital, type 2 | Autosomal recessive |
| 4 | SEC24D | 607186 | Cole-Carpenter syndrome 2 | Autosomal recessive |
| 9 | SECISBP2 | 607693 | Thyroid hormone metabolism, abnormal | Autosomal recessive |
| 1 | SELENON | 606210 | Muscular dystrophy, rigid spine, type 1 | Autosomal recessive |
| 1 | SEMA4A | 607292 | Cone-rod dystrophy, type 10; Retinitis pigmentosa, type 35 | Autosomal recessive |
| 4 | SEPSECS | 613009 | Pontocerebellar hypoplasia, type 2D | Autosomal recessive |
| 6 | SERAC1 | 614725 | 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL) | Autosomal recessive |
| 14 | SERPINA1 | 107400 | Alpha-1 antitrypsin deficiency | Autosomal recessive |
| 18 | SERPINB7 | 603357 | Palmoplantar keratoderma, Nagashima type | Autosomal recessive |
| 18 | SERPINB8 | 601697 | Peeling skin syndrome 5 | Autosomal recessive |
| 1 | SERPINC1 | 107300 | Thrombophilia due to antithrombin III deficiency | Autosomal recessive* |
| 7 | SERPINE1 | 173360 | Plasminogen activator inhibitor-1 deficiency | Autosomal recessive* |
| 17 | SERPINF1 | 172860 | Osteogenesis imperfecta, type 6 | Autosomal recessive |
| 17 | SERPINF2 | 613168 | Alpha-2-plasmin inhibitor deficiency | Autosomal recessive |
| 11 | SERPING1 | 606860 | Angioedema, hereditary, types 1 and 2 | Autosomal recessive* |
| 11 | SERPINH1 | 600943 | Osteogenesis imperfecta, type 10 | Autosomal recessive |
| 9 | SETX | 608465 | Spinocerebellar ataxia, autosomal recessive, type 1 | Autosomal recessive |
| 7 | SFRP4 | 606570 | Pyle disease | Autosomal recessive |
| 2 | SFTPB | 178640 | Surfactant metabolism dysfunction, pulmonary, type 1 | Autosomal recessive |
| 10 | SFXN4 | 615564 | Combined oxidative phosphorylation deficiency 18 | Autosomal recessive |
| 17 | SGCA | 600119 | Limb-girdle muscular dystrophy, type 3 (LGMD R3) | Autosomal recessive |
| 4 | SGCB | 600900 | Limb-girdle muscular dystrophy, type 4 (LGMD R4) | Autosomal recessive |
| 5 | SGCD | 601411 | Limb-girdle muscular dystrophy, type 6 (LGMD R6) | Autosomal recessive |
| 13 | SGCG | 608896 | Limb-girdle muscular dystrophy, type 5 (LGMD R5) | Autosomal recessive |
| 10 | SGPL1 | 603729 | Nephrotic syndrome, type 14 | Autosomal recessive |
| 17 | SGSH | 605270 | Mucopolysaccharidosis, type 3A (Sanfilippo A) | Autosomal recessive |
| X | SH2D1A | 300490 | Lymphoproliferative syndrome, X-linked, type 1 | X-linked |
| 5 | SH3PXD2B | 613293 | Frank-ter Haar syndrome | Autosomal recessive |
| 5 | SH3TC2 | 608206 | Charcot-Marie-Tooth disease, type 4C | Autosomal recessive |
| 3 | SI | 609845 | Sucrase-isomaltase deficiency, congenital | Autosomal recessive |
| 5 | SIL1 | 608005 | Marinesco-Sjogren syndrome | Autosomal recessive |
| 14 | SIX6 | 606326 | Optic disc anomalies with retinal and/or macular dystrophy | Autosomal recessive |
| 6 | SKIC2 | 600478 | Trichohepatoenteric syndrome, type 2 (diarrhea, syndromic) | Autosomal recessive |
| 5 | SKIC3 | 614589 | Trichohepatoenteric syndrome, type 1 (diarrhea, syndromic) | Autosomal recessive |
| 13 | SLC10A2 | 601295 | Bile acid malabsorption, primary | Autosomal recessive |
| 12 | SLC11A2 | 600523 | Anemia, hypochromic microcytic, with iron overload 1 | Autosomal recessive |
| 15 | SLC12A1 | 600839 | Bartter syndrome, type 1 | Autosomal recessive |
| 16 | SLC12A3 | 600968 | Gitelman syndrome | Autosomal recessive |
| 20 | SLC12A5 | 606726 | Epileptic encephalopathy, early infantile, 34 | Autosomal recessive |
| 15 | SLC12A6 | 604878 | Agenesis of the corpus callosum with peripheral neuropathy | Autosomal recessive |
| 17 | SLC13A5 | 608305 | Epileptic encephalopathy, early infantile, 25 | Autosomal recessive |
| 1 | SLC16A1 | 600682 | Monocarboxylate transporter 1 deficiency | Autosomal recessive* |
| X | SLC16A2 | 300095 | Allan-Herndon-Dudley syndrome | X-linked |
| 6 | SLC17A5 | 604322 | Salla disease | Autosomal recessive |
| 10 | SLC18A3 | 600336 | Myasthenic syndrome, congenital, 21, presynaptic | Autosomal recessive |
| 1 | SLC19A2 | 603941 | Thiamine-responsive megaloblastic anemia syndrome | Autosomal recessive |
| 2 | SLC19A3 | 606152 | Thiamine metabolism dysfunction syndrome, type 2 (biotin- or thiamine-responsive encephalopathy type) | Autosomal recessive |
| 9 | SLC1A1 | 133550 | Dicarboxylic aminoaciduria | Autosomal recessive |
| 2 | SLC1A4 | 600229 | Spastic tetraplegia, thin corpus callosum, and progressive microcephaly | Autosomal recessive |
| 11 | SLC22A12 | 607096 | Hypouricemia, renal | Autosomal recessive |
| 5 | SLC22A5 | 603377 | Carnitine deficiency, systemic primary | Autosomal recessive |
| 15 | SLC24A1 | 603617 | Night blindness, congenital stationary (complete), type 1D, autosomal recessive | Autosomal recessive |
| 14 | SLC24A4 | 609840 | Amelogenesis imperfecta, type IIA5 | Autosomal recessive |
| 15 | SLC24A5 | 609802 | Albinism, oculocutaneous, type 6 | Autosomal recessive |
| 22 | SLC25A1 | 190315 | Combined D-2- and L-2-hydroxyglutaric aciduria | Autosomal recessive |
| 2 | SLC25A12 | 603667 | Epileptic encephalopathy, early infantile, type 39 | Autosomal recessive |
| 7 | SLC25A13 | 603859 | Citrullinemia, type 2, neonatal-onset; Citrullinemia, type 2, adult-onset | Autosomal recessive |
| 13 | SLC25A15 | 603861 | Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome | Autosomal recessive |
| 17 | SLC25A19 | 606521 | Microcephaly, Amish type; Thiamine metabolism dysfunction syndrome 4 (progressive polyneuropathy type) | Autosomal recessive |
| 3 | SLC25A20 | 613698 | Carnitine-acylcarnitine translocase deficiency | Autosomal recessive |
| 11 | SLC25A22 | 609302 | Epileptic encephalopathy, early infantile, type 3 | Autosomal recessive |
| 3 | SLC25A26 | 611037 | Combined oxidative phosphorylation deficiency 28 | Autosomal recessive |
| 12 | SLC25A3 | 600370 | Mitochondrial phosphate carrier deficiency | Autosomal recessive |
| 3 | SLC25A38 | 610819 | Anemia, sideroblastic, type 2, pyridoxine-refractory | Autosomal recessive |
| 4 | SLC25A4 | 103220 | Mitochondrial DNA depletion syndrome, type 12B (cardiomyopathic type) AR | Autosomal recessive |
| 5 | SLC25A46 | 610826 | Neuropathy, hereditary motor and sensory, type VIB | Autosomal recessive |
| 5 | SLC26A2 | 606718 | Achondrogenesis Ib; Atelosteogenesis, type II;De la Chapelle dysplasia; Diastrophic dysplasia;Diastrophic dysplasia, broad bone-platyspondylic variant;Epiphyseal dysplasia, multiple, 4 | Autosomal recessive |
| 7 | SLC26A3 | 126650 | Diarrhea 1, secretory chloride, congenital | Autosomal recessive |
| 7 | SLC26A4 | 605646 | Deafness, autosomal recessive, type 4; Pendred syndrome | Autosomal recessive |
| 7 | SLC26A5 | 604943 | ?Deafness, autosomal recessive, type 61 | Autosomal recessive |
| 9 | SLC27A4 | 604194 | Ichthyosis prematurity syndrome | Autosomal recessive |
| 10 | SLC29A3 | 612373 | Histiocytosis-lymphadenopathy plus syndrome | Autosomal recessive |
| 1 | SLC2A1 | 138140 | GLUT1 deficiency syndrome 1, infantile onset, severe | Autosomal recessive* |
| 20 | SLC2A10 | 606145 | Arterial tortuosity syndrome | Autosomal recessive |
| 3 | SLC2A2 | 138160 | Fanconi-Bickel syndrome | Autosomal recessive |
| 4 | SLC2A9 | 606142 | Hypouricemia, renal, type 2 | Autosomal recessive* |
| 1 | SLC30A10 | 611146 | Hypermanganesemia with dystonia, type 1 | Autosomal recessive |
| 3 | SLC33A1 | 603690 | Congenital cataracts, hearing loss, and neurodegeneration | Autosomal recessive |
| 5 | SLC34A1 | 182309 | Hypercalcemia, infantile, type 2 | Autosomal recessive |
| 4 | SLC34A2 | 604217 | Pulmonary alveolar microlithiasis | Autosomal recessive |
| 9 | SLC34A3 | 609826 | Hypophosphatemic rickets with hypercalciuria | Autosomal recessive |
| 6 | SLC35A1 | 605634 | Congenital disorder of glycosylation, type 2F | Autosomal recessive |
| 1 | SLC35A3 | 605632 | Arthrogryposis, impaired intellectual development, and seizures | Autosomal recessive |
| 11 | SLC35C1 | 605881 | Congenital disorder of glycosylation, type 2C | Autosomal recessive |
| 1 | SLC35D1 | 610804 | Schneckenbecken dysplasia | Autosomal recessive |
| 11 | SLC37A4 | 602671 | Glycogen storage disease, type 1B | Autosomal recessive |
| 16 | SLC38A8 | 615585 | Foveal hypoplasia 2, with or without optic nerve misrouting and/or anterior segment dysgenesis | Autosomal recessive |
| 11 | SLC39A13 | 608735 | Ehlers-Danlos syndrome, spondylodysplastic type, 3 | Autosomal recessive |
| 8 | SLC39A14 | 608736 | Hypermanganesemia with dystonia 2 | Autosomal recessive |
| 8 | SLC39A4 | 607059 | Acrodermatitis enteropathica | Autosomal recessive |
| 4 | SLC39A8 | 608732 | Congenital disorder of glycosylation, type IIn | Autosomal recessive |
| 2 | SLC3A1 | 104614 | Cystinuria | Autosomal recessive* |
| 1 | SLC45A1 | 605763 | Intellectual developmental disorder with neuropsychiatric features | Autosomal recessive |
| 5 | SLC45A2 | 606202 | Albinism, oculocutaneous, type 4 | Autosomal recessive |
| 17 | SLC46A1 | 611672 | Folate malabsorption, hereditary | Autosomal recessive |
| 17 | SLC4A1 | 109270 | Distal renal tubular acidosis | Autosomal recessive |
| 20 | SLC4A11 | 610206 | Corneal endothelial dystrophy, autosomal recessive | Autosomal recessive |
| 4 | SLC4A4 | 603345 | Renal tubular acidosis, proximal, with ocular abnormalities | Autosomal recessive |
| 8 | SLC52A2 | 607882 | Brown-Vialetto-Van Laere syndrome, type 2 | Autosomal recessive |
| 20 | SLC52A3 | 613350 | Brown-Vialetto-Van Laere syndrome, type 1 | Autosomal recessive |
| 22 | SLC5A1 | 182380 | Glucose/galactose malabsorption | Autosomal recessive |
| 16 | SLC5A2 | 182381 | Renal glucosuria | Autosomal recessive* |
| 19 | SLC5A5 | 601843 | Thyroid dyshormonogenesis, type 1 | Autosomal recessive |
| 2 | SLC5A7 | 608761 | Myasthenic syndrome, congenital, type 20, presynaptic | Autosomal recessive |
| 1 | SLC6A17 | 610299 | Mental retardation, autosomal recessive 48 | Autosomal recessive |
| 5 | SLC6A19 | 608893 | Hartnup disorder | Autosomal recessive |
| 5 | SLC6A3 | 126455 | Parkinsonism-dystonia, infantile | Autosomal recessive |
| 11 | SLC6A5 | 604159 | Hyperekplexia, type 3 | Autosomal recessive* |
| X | SLC6A8 | 300036 | Cerebral creatine deficiency syndrome, type 1 | X-linked |
| 1 | SLC6A9 | 601019 | Glycine encephalopathy with normal serum glycine | Autosomal recessive |
| 3 | SLC7A14 | 615720 | Retinitis pigmentosa 68 | Autosomal recessive |
| 14 | SLC7A7 | 603593 | Lysinuric protein intolerance | Autosomal recessive |
| 19 | SLC7A9 | 604144 | Cystinuria | Autosomal recessive* |
| 5 | SLC9A3 | 182307 | Diarrhea 8, secretory sodium, congenital | Autosomal recessive |
| 3 | SLCO2A1 | 601460 | Hypertrophic osteoarthropathy, primary, autosomal recessive, type 2 | Autosomal recessive |
| 13 | SLITRK6 | 609681 | Deafness and myopia | Autosomal recessive |
| 8 | SLURP1 | 606119 | Meleda disease | Autosomal recessive |
| 16 | SLX4 | 613278 | Fanconi anemia, complementation group P | Autosomal recessive |
| 2 | SMARCAL1 | 606622 | Schimke immunoosseous dysplasia | Autosomal recessive |
| 17 | SMARCD2 | 601736 | Specific granule deficiency 2 | Autosomal recessive |
| 19 | SMG9 | 613176 | Heart and brain malformation syndrome | Autosomal recessive |
| 5 | SMN1 | 600354 | Spinal muscular atrophy | Autosomal recessive |
| 14 | SMOC1 | 608488 | Microphthalmia. with limb anomalies | Autosomal recessive |
| 6 | SMOC2 | 607223 | Dentin dysplasia, type 1, with microdontia and misshapen teeth | Autosomal recessive |
| 11 | SMPD1 | 607608 | Niemann-Pick disease, type A; Niemann-Pick disease, type B | Autosomal recessive |
| 22 | SNAP29 | 604202 | Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome | Autosomal recessive |
| 7 | SNX10 | 614780 | Osteopetrosis, autosomal recessive, type 8 | Autosomal recessive |
| 6 | SNX14 | 616105 | Spinocerebellar ataxia, autosomal recessive, type 20 | Autosomal recessive |
| 6 | SOBP | 613667 | Mental retardation, anterior maxillary protrusion, and strabismus | Autosomal recessive |
| 21 | SOD1 | 147450 | Spastic tetraplegia and axial hypotonia, progressive; Amyotrophic lateral sclerosis, type 1 | Autosomal recessive; Autosomal recessive* |
| 9 | SOHLH1 | 610224 | Ovarian dysgenesis 5 | Autosomal recessive |
| 17 | SOST | 605740 | Sclerosteosis, type 1; Van Buchem disease | Autosomal recessive |
| 20 | SOX18 | 601618 | Hypotrichosis-lymphedema-telangiectasia syndrome | Autosomal recessive |
| 2 | SP110 | 604457 | Hepatic venoocclusive disease with immunodeficiency | Autosomal recessive |
| 12 | SP7 | 606633 | Osteogenesis imperfecta, type XII | Autosomal recessive |
| 8 | SPAG1 | 603395 | Ciliary dyskinesia, primary, type 28 | Autosomal recessive |
| 5 | SPARC | 182120 | Osteogenesis imperfecta, type XVII | Autosomal recessive |
| 13 | SPART | 607111 | Spactic paraplegia, type 20, autosomal recessive | Autosomal recessive |
| 4 | SPATA5 | 613940 | Epilepsy, hearing loss, and mental retardation syndrome | Autosomal recessive |
| 14 | SPATA7 | 609868 | Leber congenital amaurosis, type 3 | Autosomal recessive |
| 2 | SPEG | 615950 | Centronuclear myopathy, type 5 | Autosomal recessive |
| 15 | SPG11 | 610844 | Amyotrophic lateral sclerosis 5, juvenile; Charcot-Marie-Tooth disease, axonal, type 2X; Spastic paraplegia 11 | Autosomal recessive |
| 15 | SPG21 | 608181 | Mast syndrome | Autosomal recessive |
| 16 | SPG7 | 602783 | Spastic paraplegia, type 7, autosomal recessive | Autosomal recessive |
| 5 | SPINK1 | 167790 | Tropical calcific pancreatitis | Autosomal recessive* |
| 5 | SPINK5 | 605010 | Netherton syndrome | Autosomal recessive |
| 19 | SPINT2 | 605124 | Diarrhea 3, secretory sodium, congenital, syndromic | Autosomal recessive |
| 2 | SPR | 182125 | Dystonia, dopa-responsive, due to sepiapterin reductase deficiency | Autosomal recessive* |
| 1 | SPRTN | 616086 | Ruijs-Aalfs syndrome | Autosomal recessive |
| 1 | SPTA1 | 182860 | Pyropoikilocytosis; Spherocytosis, type 3 | Autosomal recessive |
| 11 | SPTBN2 | 604985 | Spinocerebellar ataxia, autosomal recessive, type 14 | Autosomal recessive |
| 19 | SPTBN4 | 606214 | Neurodevelopmental disorder with hypotonia, neuropathy, and deafness | Autosomal recessive |
| 5 | SQSTM1 | 601530 | Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset | Autosomal recessive |
| 2 | SRD5A2 | 607306 | 46,XY disorder of sex development due to 5-alpha-reductase 2 deficiency (pseudovaginal perineoscrotal hypospadias) | Autosomal recessive |
| 4 | SRD5A3 | 611715 | Congenital disorder of glycosylation, type 1Q; Kahrizi syndrome | Autosomal recessive |
| 11 | ST14 | 606797 | Ichthyosis, congenital, autosomal recessive, type 11 | Autosomal recessive |
| 1 | ST3GAL3 | 606494 | Mental retardation, autosomal recessive 12 | Autosomal recessive |
| 2 | ST3GAL5 | 604402 | Salt and pepper developmental regression syndrome | Autosomal recessive |
| 12 | STAC3 | 615521 | Native American myopathy | Autosomal recessive |
| 7 | STAG3 | 608489 | Premature ovarian failure, type 8; Spermatogenic failure 61 | Autosomal recessive |
| 2 | STAMBP | 606247 | Microcephaly-capillary malformation syndrome | Autosomal recessive |
| 8 | STAR | 600617 | Lipoid adrenal hyperplasia | Autosomal recessive |
| 2 | STAT1 | 600555 | Immunodeficiency, type 31B, mycobacterial and viral infections | Autosomal recessive |
| 12 | STAT2 | 600556 | Immunodeficiency, type 44 | Autosomal recessive |
| 17 | STAT5B | 604260 | Laron syndrome with immunodeficiency | Autosomal recessive |
| 1 | STIL | 181590 | Microcephaly, type 7, primary, autosomal recessive | Autosomal recessive |
| 11 | STIM1 | 605921 | Immunodeficiency, type 10 | Autosomal recessive |
| 20 | STK4 | 604965 | T-cell immunodeficiency, recurrent infections, autoimmunity, and cardiac malformations | Autosomal recessive |
| 15 | STRA6 | 610745 | Microphthalmia, isolated, with coloboma, type 8 | Autosomal recessive |
| 17 | STRADA | 608626 | Polyhydramnios, megalencephaly, and symptomatic epilepsy | Autosomal recessive |
| 15 | STRC | 606440 | Deafness, autosomal recessive, type 16 | Autosomal recessive |
| 16 | STUB1 | 607207 | Spinocerebellar ataxia, autosomal recessive, type 16 | Autosomal recessive |
| 6 | STX11 | 605014 | Hemophagocytic lymphohistiocytosis, familial, type 4 | Autosomal recessive |
| 19 | STXBP2 | 601717 | Hemophagocytic lymphohistiocytosis, familial, type 5 | Autosomal recessive |
| 13 | SUCLA2 | 603921 | Mitochondrial DNA depletion syndrome, type 5 (encephalomyopathic with or without methylmalonic aciduria) | Autosomal recessive |
| 2 | SUCLG1 | 611224 | Mitochondrial DNA depletion syndrome, type 9 (encephalomyopathic, type with methylmalonic aciduria) | Autosomal recessive |
| 10 | SUFU | 607035 | Joubert syndrome, type 32 | Autosomal recessive |
| 7 | SUGCT | 609187 | Glutaric aciduria, type 3 | Autosomal recessive |
| 19 | SULT2B1 | 604125 | Ichthyosis, congenital, autosomal recessive, type 14 | Autosomal recessive |
| 3 | SUMF1 | 607939 | Multiple sulfatase deficiency | Autosomal recessive |
| 20 | SUN5 | 613942 | Spermatogenic failure, type 16 | Autosomal recessive |
| 12 | SUOX | 606887 | Sulfite oxidase deficiency | Autosomal recessive |
| 9 | SURF1 | 185620 | Mitochondrial complex IV deficiency, nuclear type 1; Charcot-Marie-Tooth disease, type 4K | Autosomal recessive |
| X | SYN1 | 313440 | Epilepsy, X-linked, with variable learning disabilities and behavior disorders | X-linked |
| 6 | SYNE1 | 608441 | Spinocerebellar ataxia, autosomal recessive, type 8 | Autosomal recessive |
| 19 | SYNE4 | 615535 | Deafness, autosomal recessive, type 76 | Autosomal recessive |
| 21 | SYNJ1 | 604297 | Epileptic encephalopathy, early infantile, 53 | Autosomal recessive |
| 1 | SYT14 | 610949 | ?Spinocerebellar ataxia, autosomal recessive, type 11 | Autosomal recessive |
| 1 | SZT2 | 615463 | Epileptic encephalopathy, early infantile, 18 | Autosomal recessive |
| 12 | TAC3 | 162330 | Hypogonadotropic hypogonadism, type 10, with or without anosmia | Autosomal recessive |
| 17 | TACO1 | 612958 | Mitochondrial complex IV deficiency, nuclear type 8 | Autosomal recessive |
| 4 | TACR3 | 162332 | Hypogonadotropic hypogonadism, type 11, with or without anosmia | Autosomal recessive |
| 1 | TACSTD2 | 137290 | Corneal dystrophy, gelatinous drop-like | Autosomal recessive |
| 1 | TAF13 | 600774 | Mental retardation, autosomal recessive 60 | Autosomal recessive |
| 8 | TAF2 | 604912 | Mental retardation, autosomal recessive 40 | Autosomal recessive |
| 7 | TAF6 | 602955 | Alazami-Yuan syndrome | Autosomal recessive |
| 11 | TALDO1 | 602063 | Transaldolase deficiency | Autosomal recessive |
| 22 | TANGO2 | 616830 | Metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration | Autosomal recessive |
| 6 | TAP1 | 170260 | Bare lymphocyte syndrome, type 1 | Autosomal recessive |
| 6 | TAP2 | 170261 | Bare lymphocyte syndrome, type 1, due to TAP2 deficiency | Autosomal recessive |
| 6 | TAPBP | 601962 | Bare lymphocyte syndrome, type 1 | Autosomal recessive |
| 4 | TAPT1 | 612758 | Osteochondrodysplasia, complex lethal, Symoens-Barnes-Gistelinck type | Autosomal recessive |
| 16 | TAT | 613018 | Tyrosinemia, type 2 | Autosomal recessive |
| 20 | TBC1D20 | 611663 | Warburg micro syndrome 4 | Autosomal recessive |
| 3 | TBC1D23 | 617687 | Pontocerebellar hypoplasia, type 11 | Autosomal recessive |
| 16 | TBC1D24 | 613577 | DOORS (deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures) syndrome; Epileptic encephalopathy, early infantile, type 16; Deafness, autosomal recessive, type 86 | Autosomal recessive |
| 6 | TBC1D7 | 612655 | Macrocephaly/megalencephaly syndrome, autosomal recessive | Autosomal recessive |
| 17 | TBCD | 604649 | Encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum | Autosomal recessive |
| 1 | TBCE | 604934 | Encephalopathy, progressive, with amyotrophy and optic atrophy; Hypoparathyroidism-retardation-dysmorphism syndrome; Kenny-Caffey syndrome, type 1 | Autosomal recessive |
| 4 | TBCK | 616899 | Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 | Autosomal recessive |
| 1 | TBX15 | 604127 | Cousin syndrome | Autosomal recessive |
| 1 | TBX19 | 604614 | Congenital isolated adrenocorticotropic hormone deficiency | Autosomal recessive |
| 7 | TBXAS1 | 274180 | Ghosal syndrome | Autosomal recessive |
| 17 | TCAP | 604488 | Limb-girdle muscular dystrophy, type 7 (LGMD R7) | Autosomal recessive |
| 11 | TCIRG1 | 604592 | Osteopetrosis, autosomal recessive, type 1 | Autosomal recessive |
| 22 | TCN2 | 613441 | Transcobalamin II deficiency | Autosomal recessive |
| 12 | TCTN1 | 609863 | Joubert syndrome, type 13 | Autosomal recessive |
| 12 | TCTN2 | 613846 | Joubert syndrome, type 24; ?Meckel syndrome, type 8 | Autosomal recessive |
| 10 | TCTN3 | 613847 | Joubert syndrome 18; Orofaciodigital syndrome IV | Autosomal recessive |
| 14 | TDP1 | 607198 | ?Spinocerebellar ataxia, autosomal recessive with axonal neuropathy | Autosomal recessive |
| 6 | TDP2 | 605764 | Spinocerebellar ataxia, autosomal recessive, type 23 | Autosomal recessive |
| 9 | TDRD7 | 611258 | Cataract 36 | Autosomal recessive |
| 14 | TECPR2 | 615000 | Spastic paraplegia, type 49, autosomal recessive | Autosomal recessive |
| 19 | TECR | 610057 | Mental retardation, autosomal recessive, type 14 | Autosomal recessive |
| 4 | TECRL | 617242 | Ventricular tachycardia, catecholaminergic polymorphic, 3 | Autosomal recessive |
| 11 | TECTA | 602574 | Deafness, autosomal recessive, type 21 | Autosomal recessive |
| 16 | TELO2 | 611140 | You-Hoover-Fong syndrome | Autosomal recessive |
| 4 | TENM3 | 610083 | Microphthalmia, isolated, with coloboma 9 | Autosomal recessive |
| 5 | TERT | 187270 | Dyskeratosis congenita, autosomal recessive, type 4 | Autosomal recessive |
| 8 | TEX15 | 605795 | Spermatogenic failure, type 25 | Autosomal recessive |
| 3 | TF | 190000 | Atransferrinemia | Autosomal recessive |
| 7 | TFR2 | 604720 | Hemochromatosis, type 3 | Autosomal recessive |
| 3 | TFRC | 190010 | Immunodeficiency, type 46 | Autosomal recessive |
| 8 | TG | 188450 | Thyroid dyshormonogenesis, type 3 | Autosomal recessive |
| 13 | TGDS | 616146 | Catel-Manzke syndrome | Autosomal recessive |
| 14 | TGM1 | 190195 | Ichthyosis, congenital, autosomal recessive, type 1 | Autosomal recessive |
| 15 | TGM5 | 603805 | Peeling skin syndrome, type 2 | Autosomal recessive |
| 11 | TH | 191290 | Segawa syndrome, recessive | Autosomal recessive |
| X | THOC2 | 300395 | Mental retardation, X-linked 12 | X-linked |
| 16 | THOC6 | 615403 | Beaulieu-Boycott-Innes syndrome | Autosomal recessive |
| 3 | THRB | 190160 | Thyroid hormone resistance, autosomal recessive | Autosomal recessive |
| 19 | TIMM50 | 607381 | 3-methylglutaconic aciduria, type 9 | Autosomal recessive |
| 3 | TIMMDC1 | 615534 | Mitochondrial complex I deficiency, nuclear type 31 | Autosomal recessive |
| 9 | TJP2 | 607709 | Cholestasis, progressive familial intrahepatic 4; Hypercholanemia, familial 1 | Autosomal recessive |
| 16 | TK2 | 188250 | Mitochondrial DNA depletion syndrome , type 2 (myopathic type) | Autosomal recessive |
| 3 | TKT | 606781 | Short stature, developmental delay, and congenital heart defects | Autosomal recessive |
| 19 | TLE6 | 612399 | Preimplantation embryonic lethality | Autosomal recessive |
| 9 | TMC1 | 606706 | Deafness, autosomal recessive, type 7 | Autosomal recessive |
| 17 | TMC6 | 605828 | Epidermodysplasia verruciformis | Autosomal recessive |
| 17 | TMC8 | 605829 | Epidermodysplasia verruciformis | Autosomal recessive |
| 1 | TMCO1 | 614123 | Craniofacial dysmorphism, skeletal anomalies, and mental retardation syndrome | Autosomal recessive |
| 17 | TMEM107 | 616183 | Meckel syndrome, type 13; Orofaciodigital syndrome, type 16 | Autosomal recessive |
| 11 | TMEM126A | 612988 | Optic atrophy 7 | Autosomal recessive |
| 11 | TMEM126B | 615533 | Mitochondrial complex I deficiency, nuclear type 29 | Autosomal recessive |
| 11 | TMEM138 | 614459 | Joubert syndrome 16 | Autosomal recessive |
| 4 | TMEM165 | 614726 | Congenital disorder of glycosylation, type 2K | Autosomal recessive |
| 17 | TMEM199 | 616815 | Congenital disorder of glycosylation, type 2P | Autosomal recessive |
| 11 | TMEM216 | 613277 | Joubert syndrome, type 2; Meckel syndrome, type 2 | Autosomal recessive |
| 16 | TMEM231 | 614949 | Joubert syndrome, type 20; Meckel syndrome,type 11 | Autosomal recessive |
| 2 | TMEM237 | 614423 | Joubert syndrome, type 14 | Autosomal recessive |
| 14 | TMEM260 | 617449 | Structural heart defects and renal anomalies syndrome | Autosomal recessive |
| 8 | TMEM67 | 609884 | Meckel syndrome 3; COACH syndrome 1; Joubert syndrome 6; Nephronophthisis 11 | Autosomal recessive |
| 8 | TMEM70 | 612418 | Mitochondrial complex V (ATP synthase) deficiency, nuclear type 2 | Autosomal recessive |
| 3 | TMIE | 607237 | Deafness, autosomal recessive, type 6 | Autosomal recessive |
| 21 | TMPRSS15 | 606635 | Enterokinase deficiency | Autosomal recessive |
| 21 | TMPRSS3 | 605511 | Deafness, autosomal recessive, type 8/10 | Autosomal recessive |
| 22 | TMPRSS6 | 609862 | Iron-refractory iron deficiency anemia | Autosomal recessive |
| 12 | TMTC3 | 617218 | Lissencephaly 8 | Autosomal recessive |
| 18 | TNFRSF11A | 603499 | Osteopetrosis, autosomal recessive, type 7 | Autosomal recessive |
| 8 | TNFRSF11B | 602643 | Paget disease of bone, type 5, juvenile-onset | Autosomal recessive |
| 17 | TNFRSF13B | 604907 | Immunodeficiency, common variable, type 2 | Autosomal recessive |
| 13 | TNFSF11 | 602642 | Osteopetrosis, autosomal recessive, type 2 | Autosomal recessive |
| 3 | TNIK | 610005 | Mental retardation, autosomal recessive 54 | Autosomal recessive |
| 19 | TNNT1 | 191041 | Nemaline myopathy , type 5, Amish type | Autosomal recessive |
| 6 | TNXB | 600985 | Ehlers-Danlos syndrome, classic-like | Autosomal recessive |
| 1 | TOE1 | 613931 | Pontocerebellar hypoplasia, type 7 | Autosomal recessive |
| 17 | TOP3A | 601243 | Microcephaly, growth restriction, and increased sister chromatid exchange 2 | Autosomal recessive |
| 20 | TP53RK | 608679 | Galloway-Mowat syndrome 4 | Autosomal recessive |
| 12 | TPI1 | 190450 | Hemolytic anemia due to triosephosphate isomerase deficiency | Autosomal recessive |
| 7 | TPK1 | 606370 | Episodic encephalopathy due to thiamine pyrophosphokinase deficiency | Autosomal recessive |
| 1 | TPM3 | 191030 | Nemaline myopathy, type 1; Congenital fiber-type disproportion myopathy | Autosomal recessive* |
| 2 | TPO | 606765 | Thyroid dyshormonogenesis, type 2A | Autosomal recessive |
| 11 | TPP1 | 607998 | Ceroid lipofuscinosis, neuronal, type 2; Spinocerebellar ataxia, autosomal recessive, type 7 | Autosomal recessive |
| 9 | TPRN | 613354 | Deafness, autosomal recessive, type 79 | Autosomal recessive |
| 2 | TRAF3IP1 | 607380 | Senior-Loken syndrome, type 9 | Autosomal recessive |
| 3 | TRAIP | 605958 | Seckel syndrome, type 9 | Autosomal recessive |
| 4 | TRAPPC11 | 614138 | Limb-girdle muscular dystrophy, type 18 (LGMD R18) | Autosomal recessive |
| 2 | TRAPPC12 | 614139 | Encephalopathy, progressive, early-onset, with brain atrophy and spasticity | Autosomal recessive |
| 14 | TRAPPC6B | 610397 | Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy | Autosomal recessive |
| 8 | TRAPPC9 | 611966 | Mental retardation, autosomal recessive, type 13 | Autosomal recessive |
| 6 | TRDN | 603283 | Ventricular tachycardia, catecholaminergic polymorphic, type 5, with or without muscle weakness | Autosomal recessive |
| 6 | TREM2 | 605086 | Nasu-Hakola disease | Autosomal recessive |
| 3 | TREX1 | 606609 | Aicardi-Goutieres syndrome, type 1 | Autosomal recessive |
| 8 | TRHR | 188545 | Hypothyroidism, congenital, nongoitrous, type 7 | Autosomal recessive |
| 4 | TRIM2 | 614141 | Charcot-Marie-Tooth disease, type 2R | Autosomal recessive |
| 9 | TRIM32 | 602290 | Limb-girdle muscular dystrophy, type 8 (LGMD R8) | Autosomal recessive |
| 17 | TRIM37 | 605073 | Mulibrey nanism | Autosomal recessive |
| 22 | TRIOBP | 609761 | Deafness, autosomal recessive, type 28 | Autosomal recessive |
| 14 | TRIP11 | 604505 | Achondrogenesis, type 1A | Autosomal recessive |
| 5 | TRIP13 | 604507 | Mosaic variegated aneuploidy syndrome 3 | Autosomal recessive |
| 15 | TRIP4 | 604501 | Spinal muscular atrophy with congenital bone fractures 1 | Autosomal recessive |
| 1 | TRIT1 | 617840 | Combined oxidative phosphorylation deficiency 35 | Autosomal recessive |
| 4 | TRMT10A | 616013 | Microcephaly, short stature, and impaired glucose metabolism 1 | Autosomal recessive |
| 3 | TRMT10C | 615423 | Combined oxidative phosphorylation deficiency 30 | Autosomal recessive |
| 14 | TRMT5 | 611023 | Combined oxidative phosphorylation deficiency 26 | Autosomal recessive |
| 22 | TRMU | 610230 | Liver failure, transient infantile | Autosomal recessive |
| 3 | TRNT1 | 612907 | Retinitis pigmentosa and erythrocytic microcytosis | Autosomal recessive |
| 15 | TRPM1 | 603576 | Night blindness, congenital stationary (complete), type 1C, autosomal recessive | Autosomal recessive |
| 9 | TRPM6 | 607009 | Familial hypomagnesemia with secondary hypocalcemia | Autosomal recessive |
| 7 | TRPV6 | 606680 | Hyperparathyroidism, transient neonatal | Autosomal recessive |
| 1 | TSEN15 | 608756 | Pontocerebellar hypoplasia, type 2F | Autosomal recessive |
| 3 | TSEN2 | 608753 | Pontocerebellar hypoplasia, type 2B | Autosomal recessive |
| 19 | TSEN34 | 608754 | Pontocerebellar hypoplasia type 2C | Autosomal recessive |
| 17 | TSEN54 | 608755 | Pontocerebellar hypoplasia, type 2A; Pontocerebellar hypoplasia, type 4 | Autosomal recessive |
| 12 | TSFM | 604723 | Combined oxidative phosphorylation deficiency, type 3 | Autosomal recessive |
| 1 | TSHB | 188540 | Hypothyroidism, congenital, nongoitrous, type 4 | Autosomal recessive |
| 14 | TSHR | 603372 | Hypothyroidism, congenital, nongoitrous, type 1 | Autosomal recessive |
| 17 | TTC19 | 613814 | Mitochondrial complex III deficiency, nuclear type 2 | Autosomal recessive |
| 2 | TTC21B | 612014 | Short-rib thoracic dysplasia, type 4, with or without polydactyly | Autosomal recessive |
| 2 | TTC7A | 609332 | Gastrointestinal defects and immunodeficiency syndrome | Autosomal recessive |
| 14 | TTC8 | 608132 | Bardet-Biedl syndrome, type 8 | Autosomal recessive |
| 8 | TTI2 | 614426 | Mental retardation, autosomal recessive, type 39 | Autosomal recessive |
| 14 | TTLL5 | 612268 | Cone-rod dystrophy 19 | Autosomal recessive |
| 2 | TTN | 188840 | Limb-girdle muscular dystrophy type 10 (LGMDR10); Early-onset myopathy with fatal cardiomyopathy (Salih myopathy) | Autosomal recessive |
| 8 | TTPA | 600415 | Ataxia with isolated vitamin E deficiency | Autosomal recessive |
| 22 | TUBA8 | 605742 | Cortical dysplasia, complex, with other brain malformations, type 8 | Autosomal recessive |
| 15 | TUBGCP4 | 609610 | Microcephaly and chorioretinopathy, autosomal recessive, type 3 | Autosomal recessive |
| 22 | TUBGCP6 | 610053 | Microcephaly and chorioretinopathy, autosomal recessive, type 1 | Autosomal recessive |
| 16 | TUFM | 602389 | Combined oxidative phosphorylation deficiency 4 | Autosomal recessive |
| 6 | TULP1 | 602280 | Retinitis pigmentosa 14; Leber congenital amaurosis 15 | Autosomal recessive |
| 8 | TUSC3 | 601385 | Mental retardation, autosomal recessive, type 7 | Autosomal recessive |
| 2 | TWIST2 | 607556 | Focal facial dermal dysplasia, type 3 (Setleis type) | Autosomal recessive |
| 10 | TWNK | 606075 | Mitochondrial DNA depletion syndrome, type 7 (hepatocerebral type); Perrault syndrome type 5 | Autosomal recessive |
| 18 | TXNL4A | 611595 | Burn-McKeown syndrome | Autosomal recessive |
| 19 | TYK2 | 176941 | Immunodeficiency, type 35 | Autosomal recessive |
| 22 | TYMP | 131222 | Mitochondrial DNA depletion syndrome, type 1 (MNGIE type) | Autosomal recessive |
| 11 | TYR | 606933 | Oculocutaneous albinism (OCA) type 1A; OCA type 1B | Autosomal recessive |
| 19 | TYROBP | 604142 | Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy, type 1 (Nasu-Hakola disease) | Autosomal recessive |
| 9 | TYRP1 | 115501 | Albinism, oculocutaneous, type 3 | Autosomal recessive |
| 3 | UBA5 | 610552 | Epileptic encephalopathy, early infantile, 44 | Autosomal recessive |
| 1 | UBE2T | 610538 | Fanconi anemia, complementation group T | Autosomal recessive |
| 15 | UBE3A | 601623 | Angelman syndrome | Autosomal dominant* |
| 12 | UBE3B | 608047 | Kaufman oculocerebrofacial syndrome | Autosomal recessive |
| 15 | UBR1 | 605981 | Johanson-Blizzard syndrome | Autosomal recessive |
| 4 | UCHL1 | 191342 | Spastic paraplegia, type 79, autosomal recessive | Autosomal recessive |
| 13 | UFM1 | 610553 | Leukodystrophy, hypomyelinating, type 14 | Autosomal recessive |
| 2 | UGT1A1 | 191740 | Crigler-Najjar syndrome, type 1; Crigler-Najjar syndrome, type 2 | Autosomal recessive |
| 3 | UMPS | 613891 | Orotic aciduria | Autosomal recessive |
| 17 | UNC13D | 608897 | Hemophagocytic lymphohistiocytosis, familial, type 3 | Autosomal recessive |
| 2 | UNC80 | 612636 | Hypotonia, infantile, with psychomotor retardation and characteristic facies, type 2 | Autosomal recessive |
| 12 | UNG | 191525 | Immunodeficiency with hyper IgM, type 5 | Autosomal recessive |
| 22 | UPB1 | 606673 | Beta-ureidopropionase deficiency | Autosomal recessive |
| X | UPF3B | 300298 | Mental retardation, X-linked, syndromic, type 14 | X-linked |
| 8 | UQCRB | 191330 | Mitochondrial complex III deficiency, nuclear, type 3 | Autosomal recessive |
| 16 | UQCRC2 | 191329 | Mitochondrial complex III deficiency, nuclear type 5 | Autosomal recessive |
| 5 | UQCRQ | 612080 | Mitochondrial complex III deficiency, nuclear, type 4 | Autosomal recessive |
| 1 | UROD | 613521 | Porphyria cutanea tarda | Autosomal recessive |
| 10 | UROS | 606938 | Porphyria, congenital erythropoietic | Autosomal recessive |
| 16 | USB1 | 613276 | Poikiloderma with neutropenia | Autosomal recessive |
| 11 | USH1C | 605242 | Usher syndrome, type 1C; Deafness, autosomal recessive, type 18A | Autosomal recessive |
| 17 | USH1G | 607696 | Usher syndrome, type 1G | Autosomal recessive |
| 1 | USH2A | 608400 | Usher syndrome, type 2A; Retinitis pigmentosa 39 | Autosomal recessive |
| 22 | USP18 | 607057 | Pseudo-TORCH syndrome 2 | Autosomal recessive |
| 4 | UVSSA | 614632 | UV-sensitive syndrome, type 3 | Autosomal recessive |
| 16 | VAC14 | 604632 | Striatonigral degeneration, childhood-onset | Autosomal recessive |
| 6 | VARS1 | 192150 | Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy | Autosomal recessive |
| 6 | VARS2 | 612802 | Combined oxidative phosphorylation deficiency 20 | Autosomal recessive |
| 12 | VDR | 601769 | Rickets, vitamin D-resistant, type 2A | Autosomal recessive |
| 14 | VIPAS39 | 613401 | Arthrogryposis, renal dysfunction and cholestasis, type 2 | Autosomal recessive |
| 16 | VKORC1 | 608547 | Vitamin K-dependent clotting factors, combined deficiency of, type 2 | Autosomal recessive |
| 9 | VLDLR | 192977 | Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion, type 1 | Autosomal recessive |
| 9 | VPS13A | 605978 | Choreoacanthocytosis | Autosomal recessive |
| 8 | VPS13B | 607817 | Cohen syndrome | Autosomal recessive |
| 15 | VPS13C | 608879 | Parkinson disease 23, autosomal recessive, early onset | Autosomal recessive |
| 15 | VPS33B | 608552 | Arthrogryposis, renal dysfunction and cholestasis, type 1 | Autosomal recessive |
| 8 | VPS37A | 609927 | Spastic paraplegia, type 53, autosomal recessive | Autosomal recessive |
| 1 | VPS45 | 610035 | Neutropenia, severe congenital, type 5 | Autosomal recessive |
| 17 | VPS53 | 615850 | Pontocerebellar hypoplasia, type 2E | Autosomal recessive |
| 14 | VRK1 | 602168 | Pontocerebellar hypoplasia, type 1A | Autosomal recessive |
| 14 | VSX2 | 142993 | Microphthalmia with coloboma 3; Isolated microphthalmia 2 | Autosomal recessive |
| 12 | VWF | 613160 | von Willibrand disease, type 3 | Autosomal recessive |
| 1 | WARS2 | 604733 | Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures | Autosomal recessive |
| X | WAS | 300392 | Wiskott-Aldrich syndrome; Thrombocytopenia, X-linked | X-linked |
| 12 | WASHC4 | 615748 | ?Mental retardation, autosomal recessive, type 43 | Autosomal recessive |
| 8 | WASHC5 | 610657 | Ritscher-Schinzel syndrome, type 1 | Autosomal recessive |
| 4 | WDR19 | 608151 | Nephronophthisis, type 13; Senior-Loken syndrome, type 8 | Autosomal recessive |
| 2 | WDR35 | 613602 | Cranioectodermal dysplasia 2 | Autosomal recessive |
| 17 | WDR45B | 609226 | Neurodevelopmental disorder with spastic quadriplegia and brain abnormalities with or without seizures | Autosomal recessive |
| 19 | WDR62 | 613583 | Microcephaly, type 2, primary, autosomal recessive, with or without cortical malformations | Autosomal recessive |
| 15 | WDR72 | 613214 | Amelogenesis imperfecta, type 2A3 (hypomaturation type) | Autosomal recessive |
| 15 | WDR73 | 616144 | Galloway-Mowat syndrome 1 | Autosomal recessive |
| 17 | WDR81 | 614218 | Cerebellar ataxia, mental retardation, and dysequilibrium syndrome, type 2 | Autosomal recessive |
| 7 | WEE2 | 614084 | Oocyte maturation defect 5 | Autosomal recessive |
| 4 | WFS1 | 606201 | Wolfram syndrome, type 1 | Autosomal recessive |
| 9 | WHRN | 607928 | Usher syndrome, type 2D; Deafness, autosomal recessive, type 31 | Autosomal recessive |
| 2 | WIPF1 | 602357 | ?Wiskott-Aldrich syndrome 2 | Autosomal recessive |
| 12 | WNK1 | 605232 | Neuropathy, hereditary sensory and autonomic, type 2 | Autosomal recessive |
| 12 | WNT1 | 164820 | Osteogenesis imperfecta, type XV | Autosomal recessive |
| 2 | WNT10A | 606268 | WNT10A-related conditions | Autosomal recessive |
| 12 | WNT10B | 601906 | Split-hand/foot malformation, type 6 | Autosomal recessive |
| 17 | WNT3 | 165330 | ?Tetra-amelia syndrome | Autosomal recessive |
| 3 | WNT7A | 601570 | Fuhrmann syndrome | Autosomal recessive |
| 17 | WRAP53 | 612661 | Dyskeratosis congenita, autosomal recessive, type 3 | Autosomal recessive |
| 8 | WRN | 604611 | Werner syndrome | Autosomal recessive |
| 16 | WWOX | 605131 | Epileptic encephalopathy, early infantile, type 28; Spinocerebellar ataxia, autosomal recessive, type 12 | Autosomal recessive |
| 2 | XDH | 607633 | Xanthinuria, type 1 | Autosomal recessive |
| 9 | XPA | 611153 | Xeroderma pigmentosum, group A | Autosomal recessive |
| 3 | XPC | 613208 | Xeroderma pigmentosum, group C | Autosomal recessive |
| 22 | XPNPEP3 | 613553 | Nephronophthisis-like nephropathy, type 1 | Autosomal recessive |
| 5 | XRCC4 | 194363 | Short stature, microcephaly, and endocrine dysfunction | Autosomal recessive |
| 16 | XYLT1 | 608124 | Desbuquois dysplasia, type 2 | Autosomal recessive |
| 17 | XYLT2 | 608125 | Spondyloocular syndrome | Autosomal recessive |
| 12 | YARS2 | 610957 | Myopathy, lactic acidosis, and sideroblastic anemia, type 2 | Autosomal recessive |
| 1 | YY1AP1 | 607860 | Grange syndrome | Autosomal recessive |
| 2 | ZAP70 | 176947 | Autoimmune disease, multisystem, infantile-onset, type 2; Immunodeficiency, type 48 | Autosomal recessive |
| 11 | ZBTB16 | 176797 | Skeletal defects, genital hypoplasia, and mental retardation | Autosomal recessive |
| 6 | ZBTB24 | 614064 | Immunodeficiency-centromeric instability-facial anomalies syndrome, type 2 | Autosomal recessive |
| 14 | ZC3H14 | 613279 | Mental retardation, autosomal recessive, type 56 | Autosomal recessive |
| X | ZDHHC9 | 300646 | Intellectual developmental disorder, X-linked syndromic, Raymond type | X-linked |
| 14 | ZFYVE26 | 612012 | Spastic paraplegia, type 15, autosomal recessive | Autosomal recessive |
| 1 | ZMPSTE24 | 606480 | Mandibuloacral dysplasia with, type B lipodystrophy | Autosomal recessive |
| 3 | ZMYND10 | 607070 | Ciliary dyskinesia, primary, type 22 | Autosomal recessive |
| 11 | ZNF408 | 616454 | Retinitis pigmentosa, type 72 | Autosomal recessive |
| 16 | ZNF423 | 604557 | Joubert syndrome, type 19 | Autosomal recessive |
| 16 | ZNF469 | 612078 | Brittle cornea syndrome, type 1 | Autosomal recessive |
| X | ZNF711 | 314990 | Mental retardation, X-linked, type 97 | X-linked |
| 17 | ZNHIT3 | 604500 | PEHO syndrome | Autosomal recessive |
| 11 | ZP1 | 195000 | Oocyte maturation defect, type 1 | Autosomal recessive |
- WES CGT Plus V5.4.8
- Historic Versions
| Chromosome | Gene symbol | OMIM (gene) | Disease name (phenotype) | Inheritance |
|---|---|---|---|---|
| 12 | AAAS | 605378 | Triple-A syndrome (achalasia-addisonianism-alacrimia) | Autosomal recessive |
| 2 | ABCA12 | 607800 | Ichthyosis, congenital, autosomal recessive, type 4A; ICAR, type 4B (harlequin) | Autosomal recessive |
| 16 | ABCA3 | 601615 | Surfactant metabolism dysfunction, pulmonary, type 3 | Autosomal recessive |
| 1 | ABCA4 | 601691 | Stargardt disease 1; Retinitis pigmentosa 19; Cone-rod dystrophy 3 | Autosomal recessive |
| 2 | ABCB11 | 603201 | Cholestasis, benign recurrent intrahepatic, type 2; Cholestasis, progressive familial intrahepatic, type 2 | Autosomal recessive |
| 11 | ABCC8 | 600509 | Hyperinsulinemic hypoglycemia, type 1 (congenital hyperinsulinism); Permanent neonatal diabetes mellitus (PNDM) | Autosomal recessive* |
| X | ABCD1 | 300371 | Adrenoleukodystrophy | X-linked |
| 14 | ABCD4 | 603214 | Methylmalonic aciduria and homocystinuria, cblJ type | Autosomal recessive |
| 11 | ACAD8 | 604773 | Isobutyryl-CoA dehydrogenase deficiency | Autosomal recessive |
| 3 | ACAD9 | 611103 | Acyl-CoA dehydrogenase 9 deficiency (mitochondrial complex I deficiency, nuclear, type 20) | Autosomal recessive |
| 1 | ACADM | 607008 | Medium-chain acyl-CoA dehydrogenase deficiency | Autosomal recessive |
| 12 | ACADS | 606885 | Short-chain acyl-CoA dehydrogenase deficiency | Autosomal recessive |
| 10 | ACADSB | 600301 | Short/branched-chain acyl-CoA dehydrogenase deficiency | Autosomal recessive |
| 17 | ACADVL | 609575 | Very long-chain acyl-CoA dehydrogenase (VLCAD) deficiency | Autosomal recessive |
| 11 | ACAT1 | 607809 | Alpha-methylacetoacetic aciduria (3-ketothiolase deficiency) | Autosomal recessive |
| 17 | ACOX1 | 609751 | Peroxisomal acyl-CoA oxidase deficiency | Autosomal recessive |
| 16 | ACSF3 | 614245 | Combined malonic and methylmalonic aciduria | Autosomal recessive |
| 20 | ADA | 608958 | Severe combined immunodeficiency due to adenosine deaminase deficiency (ADA) | Autosomal recessive |
| 5 | ADAMTS2 | 604539 | Ehlers-Danlos syndrome, dermatosparaxis type | Autosomal recessive |
| 16 | ADGRG1 | 604110 | Polymicrogyria, bilateral frontoparietal | Autosomal recessive |
| 5 | ADGRV1 | 602851 | Usher syndrome, type 2C | Autosomal recessive; Digenic inheritance (PDZD7 gene) |
| 10 | ADK | 102750 | Hypermethioninemia due to adenosine kinase deficiency | Autosomal recessive |
| 4 | AGA | 613228 | Aspartylglucosaminuria (glycosylasparaginase deficiency) | Autosomal recessive |
| 1 | AGL | 610860 | Glycogen storage disease, type 3 | Autosomal recessive |
| 2 | AGPS | 603051 | Rhizomelic chondrodysplasia punctata, type 3 | Autosomal recessive |
| 2 | AGXT | 604285 | Hyperoxaluria, primary, type 1 | Autosomal recessive |
| 20 | AHCY | 180960 | Hypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase | Autosomal recessive |
| 6 | AHI1 | 608894 | Joubert syndrome, type 3 | Autosomal recessive |
| 17 | AIPL1 | 604392 | Leber congenital amaurosis, type 4 | Autosomal recessive |
| 21 | AIRE | 607358 | Autoimmune polyendocrinopathy syndrome, type 1 | Autosomal recessive* |
| 17 | ALDH3A2 | 609523 | Sjogren-Larsson syndrome | Autosomal recessive |
| 1 | ALDH4A1 | 606811 | Hyperprolinemia, type 2 | Autosomal recessive |
| 9 | ALDOB | 612724 | Fructose intolerance, hereditary | Autosomal recessive |
| 16 | ALG1 | 605907 | Congenital disorder of glycosylation, type 1K | Autosomal recessive |
| 1 | ALG6 | 604566 | Congenital disorder of glycosylation, type 1C | Autosomal recessive |
| 2 | ALMS1 | 606844 | Alström syndrome | Autosomal recessive |
| 1 | ALPL | 171760 | ALPL-related conditions | Autosomal recessive |
| 3 | AMT | 238310 | Glycine encephalopathy | Autosomal recessive |
| 3 | ANO10 | 613726 | Spinocerebellar ataxia, autosomal recessive, type 10 | Autosomal recessive |
| X | AP1S2 | 300629 | Mental retardation, X-linked, syndromic, type 5 (Pettigrew syndrome) | X-linked |
| 12 | AQP2 | 107777 | Diabetes insipidus, nephrogenic, type 2 | Autosomal recessive* |
| X | AR | 313700 | Androgen insensitivity syndrome | X-linked |
| 6 | ARG1 | 608313 | Argininemia (arginase deficiency) | Autosomal recessive |
| 3 | ARL13B | 608922 | Joubert syndrome type 8 | Autosomal recessive |
| 22 | ARSA | 607574 | Metachromatic leukodystrophy | Autosomal recessive |
| 5 | ARSB | 611542 | Mucopolysaccharidosis, type 6 (Maroteaux-Lamy syndrome) | Autosomal recessive |
| X | ARSL | 300180 | Chondrodysplasia punctata, brachytelephalangic | X-linked |
| X | ARX | 300382 | Epileptic encephalopathy, early infantile, type 1; ARX-related developmental disorders | X-linked |
| 7 | ASL | 608310 | Argininosuccinic aciduria | Autosomal recessive |
| 7 | ASNS | 108370 | Asparagine synthetase deficiency | Autosomal recessive |
| 17 | ASPA | 608034 | Canavan disease | Autosomal recessive |
| 9 | ASS1 | 603470 | Citrullinemia, type 1 | Autosomal recessive |
| 11 | ATM | 607585 | ATM-related conditions | Autosomal recessive |
| 2 | ATP6V1B1 | 192132 | Renal tubular acidosis with deafness | Autosomal recessive |
| X | ATP7A | 300011 | Menkes disease; Occipital horn syndrome | X-linked |
| 13 | ATP7B | 606882 | Wilson disease | Autosomal recessive |
| 18 | ATP8B1 | 602397 | Cholestasis, progressive familial intrahepatic, type 1; Cholestasis, benign recurrent intrahepatic, type 1 | Autosomal recessive |
| X | ATRX | 300032 | Mental retardation-hypotonic facies syndrome, X-linked; Alpha-thalassemia/mental retardation syndrome | X-linked |
| 9 | AUH | 600529 | 3-methylglutaconic aciduria, type 1 | Autosomal recessive |
| 9 | B4GALT1 | 137060 | Congenital disorder of glycosylation, type 2D | Autosomal recessive |
| 11 | BBS1 | 209901 | Bardet-Biedl syndrome, type 1 | Autosomal recessive |
| 12 | BBS10 | 610148 | Bardet-Biedl syndrome, type 10 | Autosomal recessive |
| 4 | BBS12 | 610683 | Bardet-Biedl syndrome, type 12 | Autosomal recessive |
| 16 | BBS2 | 606151 | Bardet-Biedl syndrome, type 2 | Autosomal recessive |
| 3 | BCHE | 177400 | Butyrylcholinesterase deficiency | Autosomal recessive |
| 19 | BCKDHA | 608348 | Maple syrup urine disease, type 1A | Autosomal recessive |
| 6 | BCKDHB | 248611 | Maple syrup urine disease, type 1B | Autosomal recessive |
| 2 | BCS1L | 603647 | Mitochondrial complex III deficiency nuclear type 1; GRACILE syndrome; Bjornstad syndrome | Autosomal recessive |
| 15 | BLM | 604610 | Bloom syndrome | Autosomal recessive |
| X | BRWD3 | 300553 | Mental retardation, X-linked, type 93 | X-linked |
| 1 | BSND | 606412 | Bartter syndrome, type 4A | Autosomal recessive |
| 3 | BTD | 609019 | Biotinidase deficiency | Autosomal recessive |
| X | BTK | 300300 | Agammaglobulinemia X-linked, type 1 | X-linked |
| 8 | CA2 | 611492 | Osteopetrosis with renal tubular acidosis (osteopetrosis, autosomal recessive, type 3) | Autosomal recessive |
| 15 | CAPN3 | 114240 | Limb-girdle muscular dystrophy, type 1 (LGMD R1) | Autosomal recessive |
| 1 | CASQ2 | 114251 | Ventricular tachycardia, catecholaminergic polymorphic, type 2 | Autosomal recessive |
| 21 | CBS | 613381 | Homocystinuria due to cystathionine beta-synthase | Autosomal recessive |
| 4 | CC2D2A | 612013 | Joubert syndrome, type 9; Meckel syndrome, type 6; COACH syndrome, 2 | Autosomal recessive |
| 14 | CCDC88C | 611204 | Hydrocephalus, congenital, type 1 | Autosomal recessive |
| 6 | CCN6 | 603400 | Progressive pseudorheumatoid dysplasia | Autosomal recessive |
| X | CD40LG | 300386 | Hyper-IgM syndrome, type 1 (immunodeficiency, X-linked, with hyper-IgM, type 1) | X-linked |
| 10 | CDH23 | 605516 | Deafness, autosomal recessive, type 12; Usher syndrome, type 1D | Autosomal recessive |
| 12 | CEP290 | 610142 | Meckel syndrome, type 4; Joubert syndrome, type 5; Leber congenital amaurosis, type 10 | Autosomal recessive |
| 2 | CERKL | 608381 | Retinitis pigmentosa, type 26 | Autosomal recessive |
| 7 | CFTR | 602421 | Cystic fibrosis | Autosomal recessive |
| 10 | CHAT | 118490 | Myasthenic syndrome, congenital, type 6, presynaptic | Autosomal recessive |
| X | CHM | 300390 | Choroideremia | X-linked |
| 17 | CHRNE | 100725 | Myasthenic syndrome, congenital, type 4B, fast-channel; Myasthenic syndrome, congenital, type 4C, associated with acetylcholine receptor deficiency | Autosomal recessive |
| 2 | CHRNG | 100730 | Multiple pterygium syndrome (MPS), Escobar type; MPS, lethal type | Autosomal recessive |
| 16 | CHST6 | 605294 | Macular corneal dystrophy | Autosomal recessive |
| 16 | CIITA | 600005 | Bare lymphocyte syndrome, type 2, complementation group A | Autosomal recessive |
| 7 | CLCN1 | 118425 | Myotonia congenita, recessive | Autosomal recessive |
| 16 | CLN3 | 607042 | Ceroid lipofuscinosis, neuronal, type 3 | Autosomal recessive |
| 13 | CLN5 | 608102 | Ceroid lipofuscinosis, neuronal, type 5 | Autosomal recessive |
| 15 | CLN6 | 606725 | Ceroid lipofuscinosis, neuronal, type 6 | Autosomal recessive |
| 8 | CLN8 | 607837 | Ceroid lipofuscinosis, neuronal, type 8 | Autosomal recessive |
| 3 | CLRN1 | 606397 | Usher syndrome, type 3A | Autosomal recessive |
| 4 | CNGA1 | 123825 | Retinitis pigmentosa type 49 | Autosomal recessive |
| 16 | CNGB1 | 600724 | Retinitis pigmentosa type 45 | Autosomal recessive |
| 8 | CNGB3 | 605080 | Achromatopsia, type 3 | Autosomal recessive |
| 9 | COL27A1 | 608461 | Steel syndrome | Autosomal recessive |
| 2 | COL4A3 | 120070 | Alport syndrome 3B, autosomal recessive | Autosomal recessive; Autosomal dominant |
| 2 | COL4A4 | 120131 | Alport syndrome, autosomal recessive, type 2 | Autosomal recessive; Autosomal dominant |
| X | COL4A5 | 303630 | Alport syndrome, X-linked | X-linked |
| 3 | COL7A1 | 120120 | Dystrophic epidermolysis bullosa (DEB), Hallopeau-Siemens (HS) type and non-HS type; DEB pruriginosa; DEB pretibial | Autosomal recessive; Autosomal recessive*; Autosomal recessive* |
| 3 | COLQ | 603033 | Myasthenic syndrome, congenital, type 5 | Autosomal recessive |
| 10 | COX15 | 603646 | Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, type 2; Leigh syndrome due to cytochrome c oxidase deficiency | Autosomal recessive |
| 2 | CPS1 | 608307 | Carbamoylphosphate synthetase 1 deficiency | Autosomal recessive |
| 11 | CPT1A | 600528 | Carnitine palmitoyltransferase type 1A deficiency, hepatic | Autosomal recessive |
| 1 | CPT2 | 600650 | Carnitine palmitoyltransferase type 2 deficiency, lethal neonatal; Carnitine palmitoyltransferase type 2 deficiency, infantile | Autosomal recessive |
| 1 | CRB1 | 604210 | Retinitis pigmentosa, type 12; Leber congenital amaurosis, type 8 | Autosomal recessive |
| 3 | CRTAP | 605497 | Osteogenesis imperfecta, type 7 | Autosomal recessive |
| 1 | CTH | 607657 | Cystathioninuria | Autosomal recessive |
| 17 | CTNS | 606272 | Nephropathic cystinosis | Autosomal recessive |
| 20 | CTSA | 613111 | Galactosialidosis | Autosomal recessive |
| 11 | CTSC | 602365 | Haim-Munk syndrome; Papillon-Lefevre syndrome | Autosomal recessive |
| 11 | CTSD | 116840 | Ceroid lipofuscinosis, neuronal, type 10 | Autosomal recessive |
| 1 | CTSK | 601105 | Pycnodysostosis | Autosomal recessive |
| X | CUL4B | 300304 | Mental retardation, X-linked, syndromic, type 15 (Cabezas type) | X-linked |
| 16 | CYBA | 608508 | Chronic granulomatous disease, type 4 | Autosomal recessive |
| X | CYBB | 300481 | Chronic granulomatous disease, X-linked | X-linked |
| 15 | CYP11A1 | 118485 | 46,XY disorder of sex development-adrenal insufficiency due to CYP11A1 deficiency | Autosomal recessive |
| 8 | CYP11B1 | 610613 | Adrenal hyperplasia, congenital, due to 11-beta-hydroxylase deficiency | Autosomal recessive |
| 8 | CYP11B2 | 124080 | Hypoaldosteronism, congenital, due to CMO I deficiency | Autosomal recessive |
| 10 | CYP17A1 | 609300 | 17 alpha(?)-hydroxylase/17,20-lyase deficiency | Autosomal recessive |
| 15 | CYP19A1 | 107910 | Aromatase deficiency | Autosomal recessive |
| 2 | CYP1B1 | 601771 | Glaucoma, primary congenital, type 3A | Autosomal recessive |
| 6 | CYP21A2 | 613815 | Congenital adrenal hyperplasia due to 21-hydroxylase deficiency | Autosomal recessive |
| 2 | CYP27A1 | 606530 | Cerebrotendinous xanthomatosis | Autosomal recessive |
| 12 | CYP27B1 | 609506 | Vitamin D-dependent rickets, type 1 | Autosomal recessive |
| 1 | DBT | 248610 | Maple syrup urine disease, type 2 | Autosomal recessive |
| 10 | DCLRE1C | 605988 | Omenn syndrome; Severe combined immunodeficiency, Athabascan type | Autosomal recessive |
| X | DCX | 300121 | Lissencephaly, X-linked, type 1 | X-linked |
| 11 | DDB2 | 600811 | Xeroderma pigmentosum, complementation group E | Autosomal recessive |
| 11 | DHCR7 | 602858 | Smith-Lemli-Opitz syndrome | Autosomal recessive |
| 1 | DHDDS | 608172 | Retinitis pigmentosa, type 59 | Autosomal recessive |
| X | DKC1 | 300126 | Dyskeratosis congenita, X-linked | X-linked |
| 7 | DLD | 238331 | Dihydrolipoamide dehydrogenase deficiency | Autosomal recessive |
| X | DLG3 | 300189 | Mental retardation, X-linked, type 90 | X-linked |
| X | DMD | 300377 | DMD-related conditions | X-linked |
| 5 | DNAH5 | 603335 | Ciliary dyskinesia, primary, type 3, with or without situs inversus | Autosomal recessive |
| 9 | DNAI1 | 604366 | Ciliary dyskinesia, primary, type 1, with or without situs inversus | Autosomal recessive |
| 17 | DNAI2 | 605483 | Ciliary dyskinesia, primary, type 9, with or without situs inversus | Autosomal recessive |
| 10 | DNAJC12 | 606060 | Hyperphenylalaninemia, mild, non-BH4-deficient | Autosomal recessive |
| 4 | DOK7 | 610285 | Fetal akinesia deformation sequence, type 3; Myasthenic syndrome, congenital, type 10 | Autosomal recessive |
| 9 | DOLK | 610746 | Congenital disorder of glycosylation, type 1M | Autosomal recessive |
| 11 | DPAGT1 | 191350 | Congenital disorder of glycosylation, type 1J; Myasthenic syndrome, congenital, type 13 | Autosomal recessive |
| 20 | DPM1 | 603503 | Congenital disorder of glycosylation, type 1E | Autosomal recessive |
| 1 | DPYD | 612779 | Dihydropyrimidine dehydrogenase deficiency | Autosomal recessive |
| 15 | DUOX2 | 606759 | Thyroid dyshormonogenesis, type 6 | Autosomal recessive |
| 15 | DUOXA2 | 612772 | Thyroid dyshormonogenesis, type 5 | Autosomal recessive |
| 11 | DYNC2H1 | 603297 | Short-rib thoracic dysplasia, type 3, with or without polydactyly | Autosomal recessive |
| 2 | DYSF | 603009 | Miyoshi muscular dystrophy, type 1; Limb-girdle muscular dystrophy, type 2 (LGMD R2) | Autosomal recessive |
| X | EDA | 300451 | Ectodermal dysplasia, type 1, hypohidrotic, X-linked | X-linked |
| 2 | EDAR | 604095 | Ectodermal dysplasia 10B, hypohidrotic/hair/tooth type | Autosomal recessive |
| 2 | EIF2AK3 | 604032 | Wolcott-Rallison syndrome | Autosomal recessive |
| 3 | EIF2B5 | 603945 | Leukoencephalopathy with vanishing white matter (VWM) | Autosomal recessive |
| 9 | ELP1 | 603722 | Familial dysautonomia | Autosomal recessive |
| X | EMD | 300384 | Emery-Dreifuss muscular dystrophy, type 1, X-linked | X-linked |
| 19 | ERCC2 | 126340 | Trichothiodystrophy, type 1; Xeroderma pigmentosum, group D | Autosomal recessive |
| 2 | ERCC3 | 133510 | Trichothiodystrophy, type 2 | Autosomal recessive |
| 13 | ERCC5 | 133530 | Cerebrooculofacioskeletal syndrome 3; Xeroderma pigmentosum, group G;Xeroderma pigmentosum, group G/Cockayne syndrome | Autosomal recessive |
| 10 | ERCC6 | 609413 | Cockayne syndrome, type B; Cerebrooculofacioskeletal syndrome, type 1 | Autosomal recessive |
| 5 | ERCC8 | 609412 | Cockayne syndrome, type A | Autosomal recessive |
| 8 | ESCO2 | 609353 | Roberts syndrome | Autosomal recessive |
| 15 | ETFA | 608053 | Glutaric acidemia, type 2A | Autosomal recessive |
| 19 | ETFB | 130410 | Glutaric acidemia, type 2B | Autosomal recessive |
| 4 | ETFDH | 231675 | Glutaric acidemia, type 2C | Autosomal recessive |
| 19 | ETHE1 | 608451 | Ethylmalonic encephalopathy | Autosomal recessive |
| 4 | EVC | 604831 | Ellis-van Creveld syndrome | Autosomal recessive |
| 4 | EVC2 | 607261 | Ellis-van Creveld syndrome | Autosomal recessive |
| 9 | EXOSC3 | 606489 | Pontocerebellar hypoplasia, type 1B | Autosomal recessive |
| 6 | EYS | 612424 | Retinitis pigmentosa, type 25 | Autosomal recessive |
| 4 | F11 | 264900 | Factor XI deficiency | Autosomal recessive* |
| 11 | F2 | 176930 | Prothrombin deficiency | Autosomal recessive |
| 1 | F5 | 612309 | Factor V deficiency | Autosomal recessive |
| X | F8 | 300841 | Hemophilia A | X-linked |
| X | F9 | 300746 | Hemophilia B | X-linked |
| 15 | FAH | 613871 | Tyrosinemia, type 1 | Autosomal recessive |
| 2 | FAM161A | 613596 | Retinitis pigmentosa, type 28 | Autosomal recessive |
| 7 | FAM20C | 611061 | Raine syndrome | Autosomal recessive |
| 16 | FANCA | 607139 | Fanconi anemia, complementation group A | Autosomal recessive |
| 9 | FANCC | 613899 | Fanconi anemia, complementation group C | Autosomal recessive |
| 9 | FANCG | 602956 | Fanconi anemia, complementation group G | Autosomal recessive |
| X | FGD1 | 300546 | Aarskog-Scott syndrome; Mental retardation, X-linked syndromic, type 16 | X-linked |
| 1 | FH | 136850 | Fumarase deficiency | Autosomal recessive |
| 19 | FKRP | 606596 | Muscular dystrophy-dystroglycanopathy, type 5A (Walker-Warburg syndrome); Type 5B; Type 5C (limb-girdle muscular dystrophy, type 9 [LGMDR9]) | Autosomal recessive |
| 9 | FKTN | 607440 | Muscular dystrophy-dystroglycanopathy, type 4A (Walker-Warburg syndrome); Type 4B; Type 4C (limb-girdle muscular dystrophy, type 13 [LGMD R13]) | Autosomal recessive |
| 1 | FMO3 | 136132 | Trimethylaminuria | Autosomal recessive |
| X | FMR1 | 309550 | FMR1-related conditions | X-linked |
| 11 | FOXRED1 | 613622 | Mitochondrial complex I deficiency, nuclear type 19 | Autosomal recessive |
| 4 | FRAS1 | 607830 | Fraser syndrome, type 1 | Autosomal recessive |
| 21 | FTCD | 606806 | Glutamate formiminotransferase deficiency | Autosomal recessive |
| X | FTSJ1 | 300499 | Mental retardation, X-linked 44 | X-linked |
| 1 | FUCA1 | 612280 | Fucosidosis | Autosomal recessive |
| 9 | FXN | 606829 | Friedreich ataxia | Autosomal recessive |
| 17 | G6PC1 | 613742 | Glycogen storage disease, type 1A | Autosomal recessive |
| 17 | G6PC3 | 611045 | Dursun syndrome | Autosomal recessive |
| X | G6PD | 305900 | G6PD deficiency | X-linked |
| 17 | GAA | 606800 | Glycogen storage disease, type 2 | Autosomal recessive |
| 14 | GALC | 606890 | Krabbe disease | Autosomal recessive |
| 1 | GALE | 606953 | Galactose epimerase deficiency | Autosomal recessive |
| 17 | GALK1 | 604313 | Galactokinase deficiency with cataracts | Autosomal recessive |
| 16 | GALNS | 612222 | Mucopolysaccharidosis, type 4A | Autosomal recessive |
| 9 | GALT | 606999 | Galactosemia | Autosomal recessive |
| 19 | GAMT | 601240 | Cerebral creatine deficiency syndrome, type 2 | Autosomal recessive |
| 1 | GBA1 | 606463 | Gaucher disease | Autosomal recessive |
| 3 | GBE1 | 607839 | Glycogen storage disease, type 4 | Autosomal recessive |
| 19 | GCDH | 608801 | Glutaricaciduria, type 1 | Autosomal recessive |
| 14 | GCH1 | 600225 | Hyperphenylalaninemia, BH4-deficient, type B | Autosomal recessive |
| 16 | GCSH | 238330 | Multiple mitochondrial dysfunctions syndrome 7 | Autosomal recessive |
| 8 | GDAP1 | 606598 | Charcot-Marie-Tooth disease, recessive intermediate, type A | Autosomal recessive |
| 20 | GDF5 | 601146 | Chondrodysplasia, Grebe type | Autosomal recessive |
| 3 | GFM1 | 606639 | Combined oxidative phosphorylation deficiency, type 1 | Autosomal recessive |
| 7 | GHRHR | 139191 | Growth hormone deficiency, isolated, type 1B | Autosomal recessive |
| X | GJB1 | 304040 | Charcot-Marie-Tooth neuropathy, X-linked dominant, type 1 | X-linked |
| 13 | GJB2 | 121011 | Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6 | Autosomal recessive; Digenic inheritance (GJB6 gene) |
| 13 | GJB6 | 604418 | Deafness, autosomal recessive, type 1B; Deafness, digenic GJB2/GJB6 | Autosomal recessive; Digenic inheritance (GJB2 gene) |
| X | GLA | 300644 | Fabry disease | X-linked |
| 3 | GLB1 | 611458 | GM1-gangliosidosis, types 1-3; Mucopolysaccharidosis, type 4B (Morquio) | Autosomal recessive |
| 9 | GLDC | 238300 | Glycine encephalopathy | Autosomal recessive |
| 9 | GLE1 | 603371 | Lethal congenital contracture syndrome, type 1; Congenital arthrogryposis with anterior horn cell disease | Autosomal recessive |
| 9 | GNE | 603824 | Inclusion body myopathy, type 2 (Nonaka myopathy) | Autosomal recessive |
| 6 | GNMT | 606628 | Glycine N-methyltransferase deficiency | Autosomal recessive |
| 12 | GNPTAB | 607840 | Mucolipidosis 2 alpha/beta; Mucolipidosis 3 alpha/beta | Autosomal recessive |
| 16 | GNPTG | 607838 | Mucolipidosis III gamma | Autosomal recessive |
| 4 | GNRHR | 138850 | Hypogonadotropic hypogonadism, type 7, without anosmia | Autosomal recessive |
| 12 | GNS | 607664 | Mucopolysaccharidosis, type 3D (Sanfilippo syndrome D) | Autosomal recessive |
| 17 | GP1BA | 606672 | Bernard-Soulier syndrome, type A1 | Autosomal recessive |
| 22 | GP1BB | 138720 | Bernard-Soulier syndrome, type B | Autosomal recessive |
| 3 | GP9 | 173515 | Bernard-Soulier syndrome, type C | Autosomal recessive |
| X | GPR143 | 300808 | Ocular albinism, type 1 (Nettleship-Falls type) | X-linked |
| 9 | GRHPR | 604296 | Hyperoxaluria, primary, type 2 | Autosomal recessive |
| 12 | GRIP1 | 604597 | Fraser syndrome 3 | Autosomal recessive |
| 20 | GSS | 601002 | Glutathione synthetase deficiency | Autosomal recessive |
| 17 | GUCY2D | 600179 | Leber congenital amaurosis, type 1 | Autosomal recessive |
| 7 | GUSB | 611499 | Mucopolysaccharidosis, type 7 | Autosomal recessive |
| 4 | HADH | 601609 | 3-hydroxyacyl-CoA dehydrogenase deficiency | Autosomal recessive |
| 2 | HADHA | 600890 | Long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD) deficiency; Mitochondrial trifunctional protein deficiency | Autosomal recessive |
| 2 | HADHB | 143450 | Mitochondrial trifunctional protein deficiency | Autosomal recessive |
| 1 | HAX1 | 605998 | Neutropenia, severe congenital, type 3, autosomal recessive | Autosomal recessive |
| 16 | HBA1 | 141800 | Alpha thalassemia | Autosomal recessive |
| 16 | HBA2 | 141850 | Alpha thalassemia | Autosomal recessive |
| 11 | HBB | 141900 | HBB-related hemoglobinopathies | Autosomal recessive |
| X | HCFC1 | 300019 | Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type ) | X-linked |
| 15 | HEXA | 606869 | Tay-Sachs disease | Autosomal recessive |
| 5 | HEXB | 606873 | Sandhoff disease, infantile, juvenile, and adult forms | Autosomal recessive |
| 6 | HFE | 613609 | Hemochromatosis, type 1 | Autosomal recessive |
| 3 | HGD | 607474 | Alkaptonuria | Autosomal recessive |
| 8 | HGSNAT | 610453 | Mucopolysaccharidosis type 3C (Sanfilippo syndrome C) | Autosomal recessive |
| 1 | HJV | 608374 | Hemochromatosis, type 2A | Autosomal recessive |
| 21 | HLCS | 609018 | Holocarboxylase synthetase deficiency | Autosomal recessive |
| 1 | HMGCL | 613898 | HMG-CoA lyase deficiency | Autosomal recessive |
| 22 | HMOX1 | 141250 | Heme oxygenase-1 deficiency | Autosomal recessive |
| 10 | HOGA1 | 613597 | Hyperoxaluria, primary, type 3 | Autosomal recessive |
| 12 | HPD | 609695 | Tyrosinemia, type 3 | Autosomal recessive |
| X | HPRT1 | 308000 | Lesch-Nyhan syndrome | X-linked |
| 10 | HPS1 | 604982 | Hermansky-Pudlak syndrome, type 1 | Autosomal recessive |
| 3 | HPS3 | 606118 | Hermansky-Pudlak syndrome, type 3 | Autosomal recessive |
| X | HSD17B10 | 300256 | HSD10 mitochondrial disease | X-linked |
| 9 | HSD17B3 | 605573 | 46,XY disorder of sex development due to 17-beta-hydroxysteroid dehydrogenase 3 deficiency | Autosomal recessive |
| 5 | HSD17B4 | 601860 | D-bifunctional protein deficiency | Autosomal recessive |
| 1 | HSD3B2 | 613890 | Adrenal hyperplasia, congenital, due to 3-beta-hydroxysteroid dehydrogenase 2 deficiency | Autosomal recessive |
| 1 | HSPG2 | 142461 | Schwartz-Jampel syndrome, type 1; Dyssegmental dysplasia, Silverman-Handmaker type | Autosomal recessive |
| 3 | HYAL1 | 607071 | ?Mucopolysaccharidosis, type 9 | Autosomal recessive |
| 11 | HYLS1 | 610693 | Hydrolethalus syndrome | Autosomal recessive |
| 20 | IDH3B | 604526 | Retinitis pigmentosa, type 46 | Autosomal recessive |
| X | IDS | 300823 | Mucopolysaccharidosis, type 2 | X-linked |
| 4 | IDUA | 252800 | Mucopolysaccharidosis type 1 | Autosomal recessive |
| 11 | IGHMBP2 | 600502 | Charcot-Marie-Tooth disease, axonal, type 2S | Autosomal recessive |
| X | IL1RAPL1 | 300206 | Mental retardation, X-linked, type 21/34 | X-linked |
| X | IL2RG | 308380 | Severe combined immunodeficiency, X-linked | X-linked |
| 15 | IVD | 607036 | Isovaleric acidemia | Autosomal recessive |
| 6 | IYD | 612025 | Thyroid dyshormonogenesis, type 4 | Autosomal recessive |
| 19 | JAK3 | 600173 | Severe Combined Immunodeficiency, autosomal recessive, T-negative/B-positive type | Autosomal recessive |
| 11 | KCNJ11 | 600937 | Hyperinsulinemic hypoglycemia, type 2 (congenital hyperinsulinism); Permanent neonatal diabetes mellitus (PNDM) | Autosomal recessive; Autosomal recessive* |
| X | KDM5C | 314690 | Mental retardation, X-linked, syndromic, Claes-Jensen type | X-linked |
| X | L1CAM | 308840 | L1 Syndrome | X-linked |
| 6 | LAMA2 | 156225 | LAMA2-related muscular dystrophy | Autosomal recessive |
| 18 | LAMA3 | 600805 | Epidermolysis bullosa, junctional 2A, intermediate;Epidermolysis bullosa, junctional 2B, severe;Epidermolysis bullosa, junctional 2C, laryngoonychocutaneous | Autosomal recessive |
| 1 | LAMB3 | 150310 | Junctional epidermolysis bullosa (JEB) Herlitz type; JEB non-Herlitz type | Autosomal recessive |
| 1 | LAMC2 | 150292 | Epidermolysis bullosa, junctional 3A, intermediate;Epidermolysis bullosa, junctional 3B, severe | Autosomal recessive |
| 22 | LARGE1 | 603590 | Muscular dystrophy-dystroglycanopathy, type 6A and 6B | Autosomal recessive |
| 6 | LCA5 | 611408 | Leber congenital amaurosis, type 5 | Autosomal recessive |
| 19 | LDLR | 606945 | Hypercholesterolemia, familial, type 1 | Autosomal recessive; Autosomal dominant |
| 1 | LDLRAP1 | 605747 | Hypercholesterolemia, familial, autosomal recessive | Autosomal recessive |
| 2 | LHCGR | 152790 | Leydig cell hypoplasia | Autosomal recessive |
| 9 | LHX3 | 600577 | Pituitary hormone deficiency, combined, type 3 | Autosomal recessive |
| 5 | LIFR | 151443 | Stuve-Wiedemann syndrome / Schwartz-Jampel type 2 syndrome | Autosomal recessive |
| 10 | LIPA | 613497 | Lysosomal acid lipase deficiency | Autosomal recessive |
| 3 | LIPH | 607365 | Hypotrichosis, type 7 or woolly hair, autosomal recessive, type 2, with or without hypotrichosis | Autosomal recessive |
| 6 | LMBRD1 | 612625 | Methylmalonic aciduria and homocystinuria, cblF type | Autosomal recessive |
| 18 | LOXHD1 | 613072 | Deafness, autosomal recessive, type 77 | Autosomal recessive |
| 8 | LPL | 609708 | Lipoprotein lipase deficiency | Autosomal recessive |
| 2 | LRP2 | 600073 | Donnai-Barrow syndrome | Autosomal recessive |
| 2 | LRPPRC | 607544 | Leigh syndrome, French-Canadian type | Autosomal recessive |
| 1 | LYST | 606897 | Chediak-Higashi syndrome | Autosomal recessive |
| 19 | MAN2B1 | 609458 | Alpha-mannosidosis | Autosomal recessive |
| 4 | MANBA | 609489 | Mannosidosis, beta | Autosomal recessive |
| 10 | MAT1A | 610550 | Methionine adenosyltransferase deficiency, autosomal recessive | Autosomal recessive |
| 3 | MCCC1 | 609010 | 3-Methylcrotonyl-CoA carboxylase deficiency, type 1 | Autosomal recessive |
| 5 | MCCC2 | 609014 | 3-Methylcrotonyl-CoA carboxylase deficiency, type 2 | Autosomal recessive |
| 2 | MCEE | 608419 | Methylmalonyl-CoA epimerase deficiency | Autosomal recessive |
| 19 | MCOLN1 | 605248 | Mucolipidosis type 4 | Autosomal recessive |
| 8 | MCPH1 | 607117 | Microcephaly type 1, primary, autosomal recessive | Autosomal recessive |
| X | MECP2 | 300005 | Encephalopathy, neonatal severe; Rett syndrome | X-linked |
| 11 | MED17 | 603810 | Microcephaly, postnatal progressive, with seizures and brain atrophy | Autosomal recessive |
| 16 | MEFV | 608107 | Familial Mediterranean fever | Autosomal recessive |
| 15 | MESP2 | 605195 | Spondylocostal dysostosis, type 2, autosomal recessive | Autosomal recessive |
| 4 | MFSD8 | 611124 | Ceroid lipofuscinosis, neuronal, type 7 | Autosomal recessive |
| X | MID1 | 300552 | Opitz GBBB syndrome, type 1 | X-linked |
| 17 | MKS1 | 609883 | Bardet-Biedl syndrome type 13; Meckel syndrome, type 1; Joubert syndrome, type 28 | Autosomal recessive |
| 22 | MLC1 | 605908 | Megalencephalic leukoencephalopathy with subcortical cysts | Autosomal recessive |
| 16 | MLYCD | 606761 | Malonyl-CoA decarboxylase deficiency | Autosomal recessive |
| 4 | MMAA | 607481 | Methylmalonic aciduria, vitamin B12-responsive | Autosomal recessive |
| 12 | MMAB | 607568 | Methylmalonic aciduria, vitamin B12-responsive, type cblB | Autosomal recessive |
| 1 | MMACHC | 609831 | Methylmalonic aciduria and homocystinuria, cblC type | Autosomal recessive; digenic inheritance (PRDX1 gene) |
| 2 | MMADHC | 611935 | Homocystinuria, cblD type, variant 1 | Autosomal recessive |
| 6 | MMUT | 609058 | Methylmalonic aciduria, mut(0) type | Autosomal recessive |
| 2 | MOGS | 601336 | Congenital disorder of glycosylation, type 2B | Autosomal recessive |
| 15 | MPI | 154550 | Congenital disorder of glycosylation, type 1B | Autosomal recessive |
| 1 | MPL | 159530 | Thrombocytopenia, congenital amegakaryocytic | Autosomal recessive |
| 2 | MPV17 | 137960 | Mitochondrial DNA depletion syndrome type 6 (hepatocerebral); Charcot-Marie-Tooth disease, axonal, type 2EE | Autosomal recessive |
| 1 | MTHFR | 607093 | Homocystinuria due to MTHFR deficiency | Autosomal recessive |
| X | MTM1 | 300415 | Myotubular myopathy, X-linked | X-linked |
| 11 | MTMR2 | 603557 | Charcot-Marie-Tooth disease, type 4B1 | Autosomal recessive |
| 1 | MTR | 156570 | Homocystinuria-megaloblastic anemia, cblG complementation type | Autosomal recessive |
| 5 | MTRR | 602568 | Homocystinuria-megaloblastic anemia, cbl E type | Autosomal recessive |
| 4 | MTTP | 157147 | Abetalipoproteinemia | Autosomal recessive |
| 12 | MVK | 251170 | Mevalonic aciduria | Autosomal recessive |
| 17 | MYO15A | 602666 | Deafness, autosomal recessive, type 3 | Autosomal recessive |
| 11 | MYO7A | 276903 | Usher syndrome, type 1B; Deafness, autosomal recessive, type 2 | Autosomal recessive |
| 2 | NADK2 | 615787 | 2,4-dienoyl-CoA reductase deficiency | Autosomal recessive |
| 22 | NAGA | 104170 | Schindler disease, type I; Schindler disease, type III; Kanzaki disease | Autosomal recessive |
| 17 | NAGLU | 609701 | Mucopolysaccharidosis, type 3B (Sanfilippo B) | Autosomal recessive |
| 17 | NAGS | 608300 | N-acetylglutamate synthase deficiency | Autosomal recessive |
| 8 | NBN | 602667 | Nijmegen breakage syndrome | Autosomal recessive |
| 7 | NCF1 | 608512 | Chronic granulomatous disease, type 1 | Autosomal recessive |
| 1 | NCF2 | 608515 | Chronic granulomatous disease, type 2 | Autosomal recessive |
| X | NDP | 300658 | Norrie disease | X-linked |
| 8 | NDRG1 | 605262 | Charcot-Marie-Tooth disease, type 4D | Autosomal recessive |
| 5 | NDUFAF2 | 609653 | Mitochondrial complex I deficiency, nuclear type 10 | Autosomal recessive |
| 20 | NDUFAF5 | 612360 | Mitochondrial complex I deficiency, nuclear type 16 | Autosomal recessive |
| 5 | NDUFS4 | 602694 | Mitochondrial complex I deficiency, nuclear type 1 | Autosomal recessive |
| 5 | NDUFS6 | 603848 | Mitochondrial complex I deficiency, nuclear type 9 | Autosomal recessive |
| 19 | NDUFS7 | 601825 | Mitochondrial complex I deficiency, nuclear type 3 | Autosomal recessive |
| 11 | NDUFV1 | 161015 | Mitochondrial complex I deficiency, nuclear type 4 | Autosomal recessive |
| 2 | NEB | 161650 | Nemaline myopathy type 2 | Autosomal recessive |
| 6 | NEU1 | 608272 | Sialidosis, type 1 and type 2 | Autosomal recessive |
| 5 | NHP2 | 606470 | Dyskeratosis congenita, autosomal recessive type 2 | Autosomal recessive |
| 19 | NLRP7 | 609661 | Hydatidiform mole, recurrent, type 1 | Autosomal recessive |
| 15 | NOP10 | 606471 | Dyskeratosis congenita, autosomal recessive type 1 | Autosomal recessive |
| 18 | NPC1 | 607623 | Niemann-Pick disease, type C1 | Autosomal recessive |
| 14 | NPC2 | 601015 | Niemann-pick disease, type C2 | Autosomal recessive |
| 2 | NPHP1 | 607100 | Joubert syndrome type 4 | Autosomal recessive |
| 19 | NPHS1 | 602716 | Nephrotic syndrome, type 1 | Autosomal recessive |
| 1 | NPHS2 | 604766 | Nephrotic syndrome, type 2 | Autosomal recessive |
| X | NR0B1 | 300473 | Adrenal hypoplasia, congenital | X-linked |
| 15 | NR2E3 | 604485 | Enhanced S-cone syndrome (Goldmann-Favre); Retinitis pigmentosa, type 37 | Autosomal recessive; Autosomal recessive* |
| 1 | NTRK1 | 191315 | Insensitivity to pain, congenital, with anhidrosis | Autosomal recessive |
| 10 | OAT | 613349 | Gyrate atrophy of choroid and retina | Autosomal recessive |
| 15 | OCA2 | 611409 | Oculocutaneous albinism type 2 | Autosomal recessive |
| X | OCRL | 300535 | Lowe Syndrome; Dent disease type 2 | X-linked |
| 19 | OPA3 | 606580 | 3-methylglutaconic aciduria, type 3 | Autosomal recessive |
| X | OPHN1 | 300127 | Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance | X-linked |
| 6 | OSTM1 | 607649 | Osteopetrosis, autosomal recessive type 5 | Autosomal recessive |
| X | OTC | 300461 | Ornithine transcarbamylase deficiency | X-linked |
| 2 | OTOF | 603681 | Deafness, autosomal recessive, type 9 | Autosomal recessive |
| 1 | P3H1 | 610339 | Osteogenesis imperfecta, type 8 | Autosomal recessive |
| 12 | PAH | 612349 | Phenylketonuria | Autosomal recessive |
| X | PAK3 | 300142 | Mental retardation, X-linked, type 30 | X-linked |
| 20 | PANK2 | 606157 | Neurodegeneration with brain iron accumulation type 1 | Autosomal recessive |
| 11 | PC | 608786 | Pyruvate carboxylase deficiency | Autosomal recessive |
| 10 | PCBD1 | 126090 | Hyperphenylalaninemia, BH4-deficient, type D | Autosomal recessive |
| 13 | PCCA | 232000 | Propionic acidemia | Autosomal recessive |
| 3 | PCCB | 232050 | Propionic acidemia | Autosomal recessive |
| 10 | PCDH15 | 605514 | Deafness, autosomal recessive, type 23; Usher syndrome, type 1D/F digenic | Autosomal recessive |
| 5 | PDE6A | 180071 | Retinitis pigmentosa type 43 | Autosomal recessive |
| X | PDHA1 | 300502 | Pyruvate dehydrogenase E1-alpha deficiency | X-linked |
| 3 | PDHB | 179060 | Pyruvate dehydrogenase E1-beta deficiency | Autosomal recessive |
| 7 | PEX1 | 602136 | Heimler syndrome 1; Peroxisome biogenesis disorder 1A (Zellweger); Peroxisome biogenesis disorder 1B (NALD/IRD) | Autosomal recessive |
| 1 | PEX10 | 602859 | Peroxisome biogenesis disorder, type 6A (Zellweger syndrome); Peroxisome biogenesis disorder, type 6B | Autosomal recessive |
| 17 | PEX12 | 601758 | Peroxisome biogenesis disorder type 3A (Zellweger) | Autosomal recessive |
| 8 | PEX2 | 170993 | Peroxisome biogenesis disorder type 5A (Zellweger) | Autosomal recessive |
| 22 | PEX26 | 608666 | Peroxisome biogenesis disorder type 7A (Zellweger) | Autosomal recessive |
| 12 | PEX5 | 600414 | Peroxisome biogenesis disorder type 2A (Zellweger) | Autosomal recessive |
| 6 | PEX6 | 601498 | Peroxisome biogenesis disorder, type 4A (Zellweger syndrome); Peroxisome biogenesis disorder, type 4B; Heimler syndrome 2 | Autosomal recessive; Autosomal recessive*; Autosomal recessive |
| 6 | PEX7 | 601757 | Rhizomelic chondrodysplasia punctata, type 1 | Autosomal recessive |
| 12 | PFKM | 610681 | Glycogen storage disease, type 7 | Autosomal recessive |
| X | PGK1 | 311800 | Phosphoglycerate kinase 1 deficiency | X-linked |
| X | PHF8 | 300560 | Mental retardation syndrome, X-linked, Siderius type | X-linked |
| 1 | PHGDH | 606879 | Neu-Laxova syndrome, type 1; Phosphoglycerate dehydrogenase deficiency | Autosomal recessive |
| 6 | PKHD1 | 606702 | Polycystic kidney disease type 4 | Autosomal recessive |
| 22 | PLA2G6 | 603604 | Infantile neuroaxonal dystrophy type 1 | Autosomal recessive |
| 1 | PLOD1 | 153454 | Ehlers-Danlos syndrome, kyphoscoliotic type, 1 | Autosomal recessive |
| X | PLP1 | 300401 | Pelizaeus-Merzbacher disease | X-linked |
| 16 | PMM2 | 601785 | Congenital disorder of glycosylation, type 1A | Autosomal recessive |
| 17 | PNPO | 603287 | Pyridoxamine 5'-phosphate oxidase deficiency | Autosomal recessive |
| 15 | POLG | 174763 | POLG-related disorders | Autosomal recessive |
| 6 | POLR1C | 610060 | Leukodystrophy, hypomyelinating, type 11; Treacher Collins syndrome 3 | Autosomal recessive |
| 1 | POMGNT1 | 606822 | Muscular dystrophy-dystroglycanopathy, type 3A (Walker-Warburg syndrome); Type 3B; Type 3C (limb-girdle muscular dystrophy, type 15 [LGMDR15]) | Autosomal recessive |
| 9 | POMT1 | 607423 | Muscular dystrophy-dystroglycanopathy, type 1A (Walker-Warburg syndrome); Type 1B; Type 1C (limb-girdle muscular dystrophy, type 11 [LGMD R11]) | Autosomal recessive |
| 14 | POMT2 | 607439 | Muscular dystrophy-dystroglycanopathy, type 2A (Walker-Warburg syndrome); Type 2B; Type 2C (limb-girdle muscular dystrophy, type 14 [LGMD R14]) | Autosomal recessive |
| 7 | POR | 124015 | Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis | Autosomal recessive |
| 3 | POU1F1 | 173110 | Pituitary hormone deficiency, combined, type 1 | Autosomal recessive* |
| X | POU3F4 | 300039 | Deafness, X-linked, type 2 | X-linked |
| 4 | PPM1K | 611065 | ?Maple syrup urine disease, mild variant | Autosomal recessive |
| 1 | PPT1 | 600722 | Ceroid lipofuscinosis, neuronal, type 1 | Autosomal recessive |
| X | PQBP1 | 300463 | Renpenning syndrome | X-linked |
| 1 | PRDX1 | 176763 | Methylmalonic aciduria and homocystinuria, cblC type, digenic | Autosomal recessive; Digenic inheritance (MMACHC gene) |
| 10 | PRF1 | 170280 | Hemophagocytic lymphohistiocytosis, familial, type 2 | Autosomal recessive |
| 22 | PRODH | 606810 | Hyperprolinemia, type 1 | Autosomal recessive |
| 5 | PROP1 | 601538 | Pituitary hormone deficiency, combined, type 2 | Autosomal recessive |
| X | PRPS1 | 311850 | PRPS1-related disoders | X-linked |
| 10 | PSAP | 176801 | Combined SAP deficiency | Autosomal recessive |
| 11 | PTS | 612719 | Hyperphenylalaninemia, BH4-deficient, type A | Autosomal recessive |
| 12 | PUS1 | 608109 | Myopathy, lactic acidosis, and sideroblastic anemia, type 1 | Autosomal recessive |
| 11 | PYGM | 608455 | McArdle disease | Autosomal recessive |
| 4 | QDPR | 612676 | Hyperphenylalaninemia, BH4-deficient, type C | Autosomal recessive |
| 6 | RAB23 | 606144 | Carpenter syndrome | Autosomal recessive |
| 11 | RAG1 | 179615 | Omenn syndrome; Severe combined immunodeficiency, B cell-negative | Autosomal recessive |
| 11 | RAG2 | 179616 | Omenn syndrome; Severe combined immunodeficiency, B cell-negative | Autosomal recessive |
| 11 | RAPSN | 601592 | Fetal akinesia deformation sequence, type 2; Myasthenic syndrome, congenital, type 11, associated with AChR deficiency | Autosomal recessive |
| 6 | RARS2 | 611524 | Pontocerebellar hypoplasia, type 6 | Autosomal recessive |
| 18 | RAX | 601881 | Isolated microphthalmia, type 3 | Autosomal recessive |
| 14 | RDH12 | 608830 | Leber congenital amaurosis, type 13 | Autosomal recessive |
| 9 | RMRP | 157660 | Anauxetic dysplasia, type 1 | Autosomal recessive |
| 13 | RNASEH2B | 610326 | Aicardi-Goutieres syndrome, type 2 | Autosomal recessive |
| 11 | RNASEH2C | 610330 | Aicardi-Goutieres syndrome, type 3 | Autosomal recessive |
| X | RP2 | 300757 | Retinitis pigmentosa, type 2, X-linked | X-linked |
| 1 | RPE65 | 180069 | RPE65-related Leber congenital amaurosis/early-onset severe retinal dystrophy | Autosomal recessive |
| X | RPGR | 312610 | Retinitis pigmentosa, type 3, X-linked; Cone-rod dystrophy, X-linked, 1 | X-linked |
| 16 | RPGRIP1L | 610937 | Joubert syndrome, type 7; Meckel syndrome, type 5; COACH syndrome | Autosomal recessive |
| X | RS1 | 300839 | Retinoschisis | X-linked |
| 20 | RTEL1 | 608833 | Dyskeratosis congenita, autosomal recessive type 5 | Autosomal recessive* |
| 13 | SACS | 604490 | Spastic ataxia, Charlevoix-Saguenay, type | Autosomal recessive |
| 2 | SAG | 181031 | Oguchi disease, type 1 | Autosomal recessive |
| 20 | SAMHD1 | 606754 | Aicardi-Goutieres syndrome, type 5 | Autosomal recessive |
| 7 | SBDS | 607444 | Shwachman-Diamond syndrome | Autosomal recessive |
| 22 | SCO2 | 604272 | Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, type 1 | Autosomal recessive |
| 4 | SEPSECS | 613009 | Pontocerebellar hypoplasia, type 2D | Autosomal recessive |
| 14 | SERPINA1 | 107400 | Alpha-1 antitrypsin deficiency | Autosomal recessive |
| 17 | SGCA | 600119 | Limb-girdle muscular dystrophy, type 3 (LGMD R3) | Autosomal recessive |
| 4 | SGCB | 600900 | Limb-girdle muscular dystrophy, type 4 (LGMD R4) | Autosomal recessive |
| 5 | SGCD | 601411 | Limb-girdle muscular dystrophy, type 6 (LGMD R6) | Autosomal recessive |
| 13 | SGCG | 608896 | Limb-girdle muscular dystrophy, type 5 (LGMD R5) | Autosomal recessive |
| 17 | SGSH | 605270 | Mucopolysaccharidosis, type 3A (Sanfilippo A) | Autosomal recessive |
| X | SH2D1A | 300490 | Lymphoproliferative syndrome, X-linked, type 1 | X-linked |
| 5 | SH3TC2 | 608206 | Charcot-Marie-Tooth disease, type 4C | Autosomal recessive |
| 5 | SKIC3 | 614589 | Trichohepatoenteric syndrome, type 1 (diarrhea, syndromic) | Autosomal recessive |
| 16 | SLC12A3 | 600968 | Gitelman syndrome | Autosomal recessive |
| 15 | SLC12A6 | 604878 | Agenesis of the corpus callosum with peripheral neuropathy | Autosomal recessive |
| X | SLC16A2 | 300095 | Allan-Herndon-Dudley syndrome | X-linked |
| 6 | SLC17A5 | 604322 | Salla disease | Autosomal recessive |
| 1 | SLC19A2 | 603941 | Thiamine-responsive megaloblastic anemia syndrome | Autosomal recessive |
| 2 | SLC19A3 | 606152 | Thiamine metabolism dysfunction syndrome, type 2 (biotin- or thiamine-responsive encephalopathy type) | Autosomal recessive |
| 5 | SLC22A5 | 603377 | Carnitine deficiency, systemic primary | Autosomal recessive |
| 7 | SLC25A13 | 603859 | Citrullinemia, type 2, neonatal-onset; Citrullinemia, type 2, adult-onset | Autosomal recessive |
| 13 | SLC25A15 | 603861 | Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome | Autosomal recessive |
| 3 | SLC25A20 | 613698 | Carnitine-acylcarnitine translocase deficiency | Autosomal recessive |
| 5 | SLC26A2 | 606718 | Achondrogenesis Ib; Atelosteogenesis, type II;De la Chapelle dysplasia; Diastrophic dysplasia;Diastrophic dysplasia, broad bone-platyspondylic variant;Epiphyseal dysplasia, multiple, 4 | Autosomal recessive |
| 7 | SLC26A3 | 126650 | Diarrhea 1, secretory chloride, congenital | Autosomal recessive |
| 7 | SLC26A4 | 605646 | Deafness, autosomal recessive, type 4; Pendred syndrome | Autosomal recessive |
| 6 | SLC35A1 | 605634 | Congenital disorder of glycosylation, type 2F | Autosomal recessive |
| 1 | SLC35A3 | 605632 | Arthrogryposis, impaired intellectual development, and seizures | Autosomal recessive |
| 11 | SLC35C1 | 605881 | Congenital disorder of glycosylation, type 2C | Autosomal recessive |
| 1 | SLC35D1 | 610804 | Schneckenbecken dysplasia | Autosomal recessive |
| 11 | SLC37A4 | 602671 | Glycogen storage disease, type 1B | Autosomal recessive |
| 8 | SLC39A4 | 607059 | Acrodermatitis enteropathica | Autosomal recessive |
| 2 | SLC3A1 | 104614 | Cystinuria | Autosomal recessive* |
| 5 | SLC45A2 | 606202 | Albinism, oculocutaneous, type 4 | Autosomal recessive |
| 17 | SLC46A1 | 611672 | Folate malabsorption, hereditary | Autosomal recessive |
| 20 | SLC4A11 | 610206 | Corneal endothelial dystrophy, autosomal recessive | Autosomal recessive |
| 19 | SLC5A5 | 601843 | Thyroid dyshormonogenesis, type 1 | Autosomal recessive |
| 5 | SLC6A19 | 608893 | Hartnup disorder | Autosomal recessive |
| X | SLC6A8 | 300036 | Cerebral creatine deficiency syndrome, type 1 | X-linked |
| 14 | SLC7A7 | 603593 | Lysinuric protein intolerance | Autosomal recessive |
| 19 | SLC7A9 | 604144 | Cystinuria | Autosomal recessive* |
| 2 | SMARCAL1 | 606622 | Schimke immunoosseous dysplasia | Autosomal recessive |
| 5 | SMN1 | 600354 | Spinal muscular atrophy | Autosomal recessive |
| 11 | SMPD1 | 607608 | Niemann-Pick disease, type A; Niemann-Pick disease, type B | Autosomal recessive |
| 15 | SPG11 | 610844 | Amyotrophic lateral sclerosis 5, juvenile; Charcot-Marie-Tooth disease, axonal, type 2X; Spastic paraplegia 11 | Autosomal recessive |
| 16 | SPG7 | 602783 | Spastic paraplegia, type 7, autosomal recessive | Autosomal recessive |
| 2 | SRD5A2 | 607306 | 46,XY disorder of sex development due to 5-alpha-reductase 2 deficiency (pseudovaginal perineoscrotal hypospadias) | Autosomal recessive |
| 2 | ST3GAL5 | 604402 | Salt and pepper developmental regression syndrome | Autosomal recessive |
| 8 | STAR | 600617 | Lipoid adrenal hyperplasia | Autosomal recessive |
| 3 | SUMF1 | 607939 | Multiple sulfatase deficiency | Autosomal recessive |
| 9 | SURF1 | 185620 | Mitochondrial complex IV deficiency, nuclear type 1; Charcot-Marie-Tooth disease, type 4K | Autosomal recessive |
| X | SYN1 | 313440 | Epilepsy, X-linked, with variable learning disabilities and behavior disorders | X-linked |
| 16 | TAT | 613018 | Tyrosinemia, type 2 | Autosomal recessive |
| 11 | TCIRG1 | 604592 | Osteopetrosis, autosomal recessive, type 1 | Autosomal recessive |
| 14 | TECPR2 | 615000 | Spastic paraplegia, type 49, autosomal recessive | Autosomal recessive |
| 3 | TF | 190000 | Atransferrinemia | Autosomal recessive |
| 7 | TFR2 | 604720 | Hemochromatosis, type 3 | Autosomal recessive |
| 8 | TG | 188450 | Thyroid dyshormonogenesis, type 3 | Autosomal recessive |
| 14 | TGM1 | 190195 | Ichthyosis, congenital, autosomal recessive, type 1 | Autosomal recessive |
| 11 | TH | 191290 | Segawa syndrome, recessive | Autosomal recessive |
| X | THOC2 | 300395 | Mental retardation, X-linked 12 | X-linked |
| 11 | TMEM216 | 613277 | Joubert syndrome, type 2; Meckel syndrome, type 2 | Autosomal recessive |
| 8 | TMEM67 | 609884 | Meckel syndrome 3; COACH syndrome 1; Joubert syndrome 6; Nephronophthisis 11 | Autosomal recessive |
| 21 | TMPRSS3 | 605511 | Deafness, autosomal recessive, type 8/10 | Autosomal recessive |
| 6 | TNXB | 600985 | Ehlers-Danlos syndrome, classic-like | Autosomal recessive |
| 2 | TPO | 606765 | Thyroid dyshormonogenesis, type 2A | Autosomal recessive |
| 11 | TPP1 | 607998 | Ceroid lipofuscinosis, neuronal, type 2; Spinocerebellar ataxia, autosomal recessive, type 7 | Autosomal recessive |
| 6 | TRDN | 603283 | Ventricular tachycardia, catecholaminergic polymorphic, type 5, with or without muscle weakness | Autosomal recessive |
| 3 | TREX1 | 606609 | Aicardi-Goutieres syndrome, type 1 | Autosomal recessive |
| 9 | TRIM32 | 602290 | Limb-girdle muscular dystrophy, type 8 (LGMD R8) | Autosomal recessive |
| 17 | TRIM37 | 605073 | Mulibrey nanism | Autosomal recessive |
| 22 | TRMU | 610230 | Liver failure, transient infantile | Autosomal recessive |
| 17 | TSEN54 | 608755 | Pontocerebellar hypoplasia, type 2A; Pontocerebellar hypoplasia, type 4 | Autosomal recessive |
| 12 | TSFM | 604723 | Combined oxidative phosphorylation deficiency, type 3 | Autosomal recessive |
| 1 | TSHB | 188540 | Hypothyroidism, congenital, nongoitrous, type 4 | Autosomal recessive |
| 14 | TSHR | 603372 | Hypothyroidism, congenital, nongoitrous, type 1 | Autosomal recessive |
| 8 | TTPA | 600415 | Ataxia with isolated vitamin E deficiency | Autosomal recessive |
| 22 | TYMP | 131222 | Mitochondrial DNA depletion syndrome, type 1 (MNGIE type) | Autosomal recessive |
| 11 | TYR | 606933 | Oculocutaneous albinism (OCA) type 1A; OCA type 1B | Autosomal recessive |
| 9 | TYRP1 | 115501 | Albinism, oculocutaneous, type 3 | Autosomal recessive |
| 15 | UBE3A | 601623 | Angelman syndrome | Autosomal dominant* |
| 2 | UGT1A1 | 191740 | Crigler-Najjar syndrome, type 1; Crigler-Najjar syndrome, type 2 | Autosomal recessive |
| 17 | UNC13D | 608897 | Hemophagocytic lymphohistiocytosis, familial, type 3 | Autosomal recessive |
| X | UPF3B | 300298 | Mental retardation, X-linked, syndromic, type 14 | X-linked |
| 11 | USH1C | 605242 | Usher syndrome, type 1C; Deafness, autosomal recessive, type 18A | Autosomal recessive |
| 17 | USH1G | 607696 | Usher syndrome, type 1G | Autosomal recessive |
| 1 | USH2A | 608400 | Usher syndrome, type 2A; Retinitis pigmentosa 39 | Autosomal recessive |
| 9 | VPS13A | 605978 | Choreoacanthocytosis | Autosomal recessive |
| 8 | VPS13B | 607817 | Cohen syndrome | Autosomal recessive |
| 1 | VPS45 | 610035 | Neutropenia, severe congenital, type 5 | Autosomal recessive |
| 17 | VPS53 | 615850 | Pontocerebellar hypoplasia, type 2E | Autosomal recessive |
| 14 | VRK1 | 602168 | Pontocerebellar hypoplasia, type 1A | Autosomal recessive |
| 14 | VSX2 | 142993 | Microphthalmia with coloboma 3; Isolated microphthalmia 2 | Autosomal recessive |
| X | WAS | 300392 | Wiskott-Aldrich syndrome; Thrombocytopenia, X-linked | X-linked |
| 9 | WHRN | 607928 | Usher syndrome, type 2D; Deafness, autosomal recessive, type 31 | Autosomal recessive |
| 2 | WNT10A | 606268 | WNT10A-related conditions | Autosomal recessive |
| 8 | WRN | 604611 | Werner syndrome | Autosomal recessive |
| 9 | XPA | 611153 | Xeroderma pigmentosum, group A | Autosomal recessive |
| 3 | XPC | 613208 | Xeroderma pigmentosum, group C | Autosomal recessive |
| X | ZDHHC9 | 300646 | Intellectual developmental disorder, X-linked syndromic, Raymond type | X-linked |
| 14 | ZFYVE26 | 612012 | Spastic paraplegia, type 15, autosomal recessive | Autosomal recessive |
| X | ZNF711 | 314990 | Mental retardation, X-linked, type 97 | X-linked |
- CGT Bank v3.3.10
- CGT Bank v3.3.11
- Historic Versions
| chrom | OMIM (gene) | gene | previous symbol | OMIM (phen) | disease name (phenotype) | inheritance |
|---|---|---|---|---|---|---|
| X | 300371 | ABCD1 | 300100 | Adrenoleukodystrophy | X-linked | |
| X | 300629 | AP1S2 | 304340 | Mental retardation, X-linked, syndromic, type 5 (Pettigrew syndrome) | X-linked | |
| X | 313700 | AR | 300068 | Androgen insensitivity syndrome, complete | X-linked | |
| X | 300180 | ARSL | ARSE | 302950 | Chondrodysplasia punctata, brachytelephalangic | X-linked |
| X | 300382 | ARX | 308350; 300215; 309510 | Epileptic encephalopathy, early infantile, type 1; ARX-related developmental disorders | X-linked | |
| X | 300011 | ATP7A | 309400; 304150 | Menkes disease; Occipital horn syndrome | X-linked | |
| X | 300504 | ATRX | 309580; 301040 | Mental retardation-hypotonic facies syndrome, X-linked; Alpha-thalassemia/mental retardation syndrome | X-linked | |
| X | 300553 | BRWD3 | 300659 | Mental retardation, X-linked, type 93 | X-linked | |
| X | 300300 | BTK | 300755 | Agammaglobulinemia X-linked, type 1 | X-linked | |
| X | 300386 | CD40LG | 308230 | Hyper-IgM syndrome, type 1 (immunodeficiency, X-linked, with hyper-IgM, type 1) | X-linked | |
| 7 | 602421 | CFTR | 219700 | Cystic fibrosis | Autosomal recessive | |
| X | 300390 | CHM | 303100 | Choroideremia | X-linked | |
| X | 303630 | COL4A5 | 301050 | Alport syndrome, X-linked | X-linked | |
| X | 300304 | CUL4B | 300354 | Mental retardation, X-linked, syndromic, type 15 (Cabezas type) | X-linked | |
| X | 300481 | CYBB | 306400 | Chronic granulomatous disease, X-linked | X-linked | |
| 6 | 613815 | CYP21A2 | 201910 | Congenital adrenal hyperplasia due to 21-hydroxylase deficiency | Autosomal recessive | |
| X | 300121 | DCX | 300067 | Lissencephaly, X-linked, type 1 | X-linked | |
| X | 300126 | DKC1 | 305000 | Dyskeratosis congenita, X-linked | X-linked | |
| X | 300189 | DLG3 | 300850 | Mental retardation, X-linked, type 90 | X-linked | |
| X | 300377 | DMD | 310200; 300376 | Duchenne/Becker muscular dystrophy | X-linked | |
| X | 300451 | EDA | 305100 | Ectodermal dysplasia, type 1, hypohidrotic, X-linked | X-linked | |
| X | 300384 | EMD | 310300 | Emery-Dreifuss muscular dystrophy, type 1, X-linked | X-linked | |
| X | 300841 | F8 | 306700 | Hemophilia A | X-linked | |
| X | 300746 | F9 | 306900 | Hemophilia B | X-linked | |
| X | 300546 | FGD1 | 305400 | Aarskog-Scott syndrome; Mental retardation, X-linked syndromic, type 16 | X-linked | |
| X | 309550 | FMR1 | 300624 | Fragile X syndrome | X-linked | |
| X | 300499 | FTSJ1 | 309549 | Mental retardation, X-linked 44 | X-linked | |
| X | 305900 | G6PD | 300908 | Hemolytic anemia, G6PD deficient (favism) | X-linked | |
| X | 304040 | GJB1 | 302800 | Charcot-Marie-Tooth neuropathy, X-linked dominant, type 1 | X-linked | |
| 13 | 121011 | GJB2 | 220290 | Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6 | Autosomal recessive; Digenic inheritance (GJB6 gene) | |
| X | 300644 | GLA | 301500 | Fabry disease | X-linked | |
| X | 300808 | GPR143 | 300500 | Ocular albinism, type 1 (Nettleship-Falls type) | X-linked | |
| 16 | 141800 | HBA1 | 604131 | Thalassemia, alpha- | Autosomal recessive | |
| 16 | 141850 | HBA2 | 604131 | Thalassemia, alpha- | Autosomal recessive | |
| 11 | 141900 | HBB | 603903 | HBB-related hemoglobinopathy | Autosomal recessive | |
| X | 300019 | HCFC1 | 309541 | Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type ) | X-linked | |
| X | 308000 | HPRT1 | 300322 | Lesch-Nyhan syndrome | X-linked | |
| X | 300256 | HSD17B10 | 300438 | HSD10 mitochondrial disease | X-linked | |
| X | 300823 | IDS | 309900 | Mucopolysaccharidosis, type 2 | X-linked | |
| X | 300206 | IL1RAPL1 | 300143 | Mental retardation, X-linked, type 21/34 | X-linked | |
| X | 308380 | IL2RG | 300400 | Severe combined immunodeficiency, X-linked | X-linked | |
| X | 314690 | KDM5C | 300534 | Mental retardation, X-linked, syndromic, Claes-Jensen type | X-linked | |
| X | 308840 | L1CAM | 307000; 303350; 304100 | L1 Syndrome | X-linked | |
| X | 300005 | MECP2 | 300673; 312750 | Encephalopathy, neonatal severe; Rett syndrome | X-linked | |
| X | 300415 | MTM1 | 310400 | Myotubular myopathy, X-linked | X-linked | |
| X | 300658 | NDP | 310600 | Norrie disease | X-linked | |
| X | 300473 | NR0B1 | 300200 | Adrenal hypoplasia, congenital | X-linked | |
| X | 300535 | OCRL | 309000; 300555 | Lowe Syndrome; Dent disease type 2 | X-linked | |
| X | 300127 | OPHN1 | 300486 | Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance | X-linked | |
| X | 300461 | OTC | 311250 | Ornithine transcarbamylase deficiency | X-linked | |
| X | 300142 | PAK3 | 300558 | Mental retardation, X-linked, type 30 | X-linked | |
| X | 300502 | PDHA1 | 312170 | Pyruvate dehydrogenase E1-alpha deficiency | X-linked | |
| X | 311800 | PGK1 | 300653 | Phosphoglycerate kinase 1 deficiency | X-linked | |
| X | 300560 | PHF8 | 300263 | Mental retardation syndrome, X-linked, Siderius type | X-linked | |
| X | 300401 | PLP1 | 312080 | Pelizaeus-Merzbacher disease | X-linked | |
| X | 300039 | POU3F4 | 304400 | Deafness, X-linked, type 2 | X-linked | |
| X | 300463 | PQBP1 | 309500 | Renpenning syndrome | X-linked | |
| X | 311850 | PRPS1 | 300661; 304500; 311070; 301835 | PRPS1-related disoders | X-linked | |
| X | 300757 | RP2 | 312600 | Retinitis pigmentosa, type 2, X-linked | X-linked | |
| X | 312610 | RPGR | 300029; 304020 | Retinitis pigmentosa, type 3, X-linked; Cone-rod dystrophy, X-linked, 1 | X-linked | |
| X | 300839 | RS1 | 312700 | Retinoschisis | X-linked | |
| X | 300490 | SH2D1A | 308240 | Lymphoproliferative syndrome, X-linked, type 1 | X-linked | |
| X | 300095 | SLC16A2 | 300523 | Allan-Herndon-Dudley syndrome | X-linked | |
| X | 300036 | SLC6A8 | 300352 | Cerebral creatine deficiency syndrome, type 1 | X-linked | |
| 5 | 600354 | SMN1 | 253300 | Spinal muscular atrophy | Autosomal recessive | |
| X | 313440 | SYN1 | 300491 | Epilepsy, X-linked, with variable learning disabilities and behavior disorders | X-linked | |
| X | 300395 | THOC2 | 300957 | Mental retardation, X-linked 12 | X-linked | |
| X | 300298 | UPF3B | 300676 | Mental retardation, X-linked, syndromic, type 14 | X-linked | |
| X | 300392 | WAS | 301000; 313900 | Wiskott-Aldrich syndrome; Thrombocytopenia, X-linked | X-linked | |
| X | 300646 | ZDHHC9 | 300799 | Intellectual developmental disorder, X-linked syndromic, Raymond type | X-linked | |
| X | 314990 | ZNF711 | 300803 | Mental retardation, X-linked, type 97 | X-linked |
| chrom | OMIM (gene) | Gene | Previous Symbol | OMIM (phen) | disease name (phenotype) | inheritance |
|---|---|---|---|---|---|---|
| X | 300371 | ABCD1 | 300100 | Adrenoleukodystrophy | X-linked | |
| 1 | 607008 | ACADM | 201450 | Medium-chain acyl-CoA dehydrogenase deficiency | Autosomal recessive | |
| 2 | 604285 | AGXT | 259900 | Hyperoxaluria, primary, type 1 | Autosomal recessive | |
| X | 300629 | AP1S2 | 304340 | Mental retardation, X-linked, syndromic, type 5 (Pettigrew syndrome) | X-linked | |
| X | 313700 | AR | 300068 | Androgen insensitivity syndrome, complete | X-linked | |
| 22 | 607574 | ARSA | 250100 | Metachromatic leukodystrophy | Autosomal recessive | |
| X | 300180 | ARSL | ARSE | 302950 | Chondrodysplasia punctata, brachytelephalangic | X-linked |
| X | 300382 | ARX | 308350; 300215; 309510 | Epileptic encephalopathy, early infantile, type 1; ARX-related developmental disorders | X-linked | |
| X | 300011 | ATP7A | 309400; 304150 | Menkes disease; Occipital horn syndrome | X-linked | |
| X | 300504 | ATRX | 309580; 301040 | Mental retardation-hypotonic facies syndrome, X-linked; Alpha-thalassemia/mental retardation syndrome | X-linked | |
| X | 300553 | BRWD3 | 300659 | Mental retardation, X-linked, type 93 | X-linked | |
| 3 | 609019 | BTD | 253260 | Biotinidase deficiency | Autosomal recessive | |
| X | 300300 | BTK | 300755 | Agammaglobulinemia X-linked, type 1 | X-linked | |
| 21 | 613381 | CBS | 236200 | Homocystinuria due to cystathionine beta-synthase | Autosomal recessive | |
| X | 300386 | CD40LG | 308230 | Hyper-IgM syndrome, type 1 (immunodeficiency, X-linked, with hyper-IgM, type 1) | X-linked | |
| 7 | 602421 | CFTR | 219700 | Cystic fibrosis | Autosomal recessive | |
| X | 300390 | CHM | 303100 | Choroideremia | X-linked | |
| X | 303630 | COL4A5 | 301050 | Alport syndrome, X-linked | X-linked | |
| X | 300304 | CUL4B | 300354 | Mental retardation, X-linked, syndromic, type 15 (Cabezas type) | X-linked | |
| X | 300481 | CYBB | 306400 | Chronic granulomatous disease, X-linked | X-linked | |
| X | 300121 | DCX | 300067 | Lissencephaly, X-linked, type 1 | X-linked | |
| 11 | 602858 | DHCR7 | 270400 | Smith-Lemli-Opitz syndrome | Autosomal recessive | |
| X | 300126 | DKC1 | 305000 | Dyskeratosis congenita, X-linked | X-linked | |
| X | 300189 | DLG3 | 300850 | Mental retardation, X-linked, type 90 | X-linked | |
| X | 300377 | DMD | 310200; 300376 | Duchenne/Becker muscular dystrophy | X-linked | |
| X | 300451 | EDA | 305100 | Ectodermal dysplasia, type 1, hypohidrotic, X-linked | X-linked | |
| X | 300384 | EMD | 310300 | Emery-Dreifuss muscular dystrophy, type 1, X-linked | X-linked | |
| X | 300841 | F8 | 306700 | Hemophilia A | X-linked | |
| X | 300746 | F9 | 306900 | Hemophilia B | X-linked | |
| X | 300546 | FGD1 | 305400 | Aarskog-Scott syndrome; Mental retardation, X-linked syndromic, type 16 | X-linked | |
| X | 309550 | FMR1 | 300624 | Fragile X syndrome | X-linked | |
| X | 300499 | FTSJ1 | 309549 | Mental retardation, X-linked 44 | X-linked | |
| X | 305900 | G6PD | 300908 | Hemolytic anemia, G6PD deficient (favism) | X-linked | |
| 17 | 606800 | GAA | 232300 | Glycogen storage disease, type 2 | Autosomal recessive | |
| 9 | 606999 | GALT | 230400 | Galactosemia | Autosomal recessive | |
| X | 304040 | GJB1 | 302800 | Charcot-Marie-Tooth neuropathy, X-linked dominant, type 1 | X-linked | |
| 13 | 121011 | GJB2 | 220290 | Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6 | Autosomal recessive; Digenic inheritance (GJB6 gene) | |
| X | 300644 | GLA | 301500 | Fabry disease | X-linked | |
| X | 300808 | GPR143 | 300500 | Ocular albinism, type 1 (Nettleship-Falls type) | X-linked | |
| 2 | 600890 | HADHA | 609016; 609015 | Long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD) deficiency; Mitochondrial trifunctional protein deficiency | Autosomal recessive | |
| 16 | 141800 | HBA1 | 604131 | Thalassemia, alpha- | Autosomal recessive | |
| 16 | 141850 | HBA2 | 604131 | Thalassemia, alpha- | Autosomal recessive | |
| 11 | 141900 | HBB | 603903 | HBB-related hemoglobinopathy | Autosomal recessive | |
| X | 300019 | HCFC1 | 309541 | Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type ) | X-linked | |
| X | 308000 | HPRT1 | 300322 | Lesch-Nyhan syndrome | X-linked | |
| X | 300256 | HSD17B10 | 300438 | HSD10 mitochondrial disease | X-linked | |
| X | 300823 | IDS | 309900 | Mucopolysaccharidosis, type 2 | X-linked | |
| X | 300206 | IL1RAPL1 | 300143 | Mental retardation, X-linked, type 21/34 | X-linked | |
| X | 308380 | IL2RG | 300400 | Severe combined immunodeficiency, X-linked | X-linked | |
| X | 314690 | KDM5C | 300534 | Mental retardation, X-linked, syndromic, Claes-Jensen type | X-linked | |
| X | 308840 | L1CAM | 307000; 303350; 304100 | L1 Syndrome | X-linked | |
| X | 300005 | MECP2 | 300673; 312750 | Encephalopathy, neonatal severe; Rett syndrome | X-linked | |
| 1 | 609831 | MMACHC | 277400 | Methylmalonic aciduria and homocystinuria, cblC type | Autosomal recessive, digenic inheritance (PRDX1 gene) | |
| X | 300415 | MTM1 | 310400 | Myotubular myopathy, X-linked | X-linked | |
| X | 300658 | NDP | 310600 | Norrie disease | X-linked | |
| X | 300473 | NR0B1 | 300200 | Adrenal hypoplasia, congenital | X-linked | |
| X | 300535 | OCRL | 309000; 300555 | Lowe Syndrome; Dent disease type 2 | X-linked | |
| X | 300127 | OPHN1 | 300486 | Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance | X-linked | |
| X | 300461 | OTC | 311250 | Ornithine transcarbamylase deficiency | X-linked | |
| 12 | 612349 | PAH | 261600 | Phenylketonuria | Autosomal recessive | |
| X | 300142 | PAK3 | 300558 | Mental retardation, X-linked, type 30 | X-linked | |
| X | 300502 | PDHA1 | 312170 | Pyruvate dehydrogenase E1-alpha deficiency | X-linked | |
| X | 311800 | PGK1 | 300653 | Phosphoglycerate kinase 1 deficiency | X-linked | |
| X | 300560 | PHF8 | 300263 | Mental retardation syndrome, X-linked, Siderius type | X-linked | |
| X | 300401 | PLP1 | 312080 | Pelizaeus-Merzbacher disease | X-linked | |
| 16 | 601785 | PMM2 | 212065 | Congenital disorder of glycosylation, type 1A | Autosomal recessive | |
| X | 300039 | POU3F4 | 304400 | Deafness, X-linked, type 2 | X-linked | |
| X | 300463 | PQBP1 | 309500 | Renpenning syndrome | X-linked | |
| X | 311850 | PRPS1 | 300661; 304500; 311070; 301835 | PRPS1-related disoders | X-linked | |
| X | 300757 | RP2 | 312600 | Retinitis pigmentosa, type 2, X-linked | X-linked | |
| X | 312610 | RPGR | 300029; 304020 | Retinitis pigmentosa, type 3, X-linked; Cone-rod dystrophy, X-linked, 1 | X-linked | |
| X | 300839 | RS1 | 312700 | Retinoschisis | X-linked | |
| X | 300490 | SH2D1A | 308240 | Lymphoproliferative syndrome, X-linked, type 1 | X-linked | |
| X | 300095 | SLC16A2 | 300523 | Allan-Herndon-Dudley syndrome | X-linked | |
| 5 | 606718 | SLC26A2 | 600972 | Achondrogenesis, type 1B (diastrophic dysplasia) | Autosomal recessive | |
| X | 300036 | SLC6A8 | 300352 | Cerebral creatine deficiency syndrome, type 1 | X-linked | |
| 5 | 600354 | SMN1 | 253300 | Spinal muscular atrophy | Autosomal recessive | |
| X | 313440 | SYN1 | 300491 | Epilepsy, X-linked, with variable learning disabilities and behavior disorders | X-linked | |
| X | 300395 | THOC2 | 300957 | Mental retardation, X-linked 12 | X-linked | |
| X | 300298 | UPF3B | 300676 | Mental retardation, X-linked, syndromic, type 14 | X-linked | |
| X | 300392 | WAS | 301000; 313900 | Wiskott-Aldrich syndrome; Thrombocytopenia, X-linked | X-linked | |
| X | 300646 | ZDHHC9 | 300799 | Intellectual developmental disorder, X-linked syndromic, Raymond type | X-linked | |
| X | 314990 | ZNF711 | 300803 | Mental retardation, X-linked, type 97 | X-linked |
Download CGT Bank v1.1
Export
Download CGT Bank v2.0
Export
Download CGT Bank v2.1
Export
Download CGT Bank v2.2
Export
Download CGT Bank v2.3
Export
Download CGT Bank v3.0.2
Export
Download CGT Bank v3.1.1
Export
Download CGT Bank v3.1.2
Export
Download CGT Bank v3.1.3
Export
Download CGT Bank v3.1.5
Export
Download CGT Bank v3.2.3
Export
Download CGT Bank v3.2.2
Export
Download CGT Bank v3.2.1
Export
Download CGT Bankv3.3.1.0
Export
Download CGT Bankv3.3.1.1
Export
- CGT 600 v1
- CGT 600 v2
| Gene | Disease | Transcript | Mutations | Disease.description | products |
|---|---|---|---|---|---|
| ABCA4 | Cone-rod dystrophy type 3 | NM_000350.2 | NM_000350.2:c.3540_3555delGTCTAAGGGTTTCTCC, NM_000350.2:c.2616_2617delCT, NM_000350.2:c.4793C>A, NM_000350.2:c.6179T>G, NM_000350.2:c.1222C>T, NM_000350.2:c.763C>T | Cone rod dystrophy type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness. The prevalence is 1:100,000-9100,000. | 250,600 |
| ABCA4 | Retinitis pigmentosa type 19 | NM_000350.2 | NM_000350.2:c.1848delA | Retinitis pigmentosa type 19 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000. | 250,600 |
| ABCA4 | Stargardt disease type 1 | NM_000350.2 | NM_000350.2:c.1018T>G, NM_000350.2:c.4457C>T, NM_000350.2:c.1225delA, NM_000350.2:c.1622T>C, NM_000350.2:c.1715G>A, NM_000350.2:c.1755delA, NM_000350.2:c.1771delT, NM_000350.2:c.1804C>T, NM_000350.2:c.6449G>A, NM_000350.2:c.1938-1G>A, NM_000350.2:c.1964T>G, NM_000350.2:c.2160+1G>T, NM_000350.2:c.2588G>C, NM_000350.2:c.4469G>A, NM_000350.2:c.2690C>T, NM_000350.2:c.2791G>A, NM_000350.2:c.286A>G, NM_000350.2:c.2971G>C, NM_000350.2:c.3083C>T, NM_000350.2:c.3106G>A, NM_000350.2:c.3210_3211dupGT, NM_000350.2:c.3364G>A, NM_000350.2:c.6320G>A, NM_000350.2:c.3970delG, NM_000350.2:c.4139C>T, NM_000350.2:c.4429C>T, NM_000350.2:c.2300T>A, NM_000350.2:c.3322C>T, NM_000350.2:c.52C>T, NM_000350.2:c.5512delC, NM_000350.2:c.5819T>C, NM_000350.2:c.5881G>A, NM_000350.2:c.5882G>A, NM_000350.2:c.5912T>G, NM_000350.2:c.634C>T, NM_000350.2:c.5714+5G>A, NM_000350.2:c.6394G>T, NM_000350.2:c.67-2A>G, NM_000350.2:c.5461-10T>C, NM_000350.2:c.6089G>A, NM_000350.2:c.6118C>T, NM_000350.2:c.6148G>C, NM_000350.2:c.661G>A, NM_000350.2:c.5338C>G | Stargardt disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by progressive central vision loss, mild loss of color vision, delayed dark adaptation and macular atrophy with or without paramacular flecks and degeneration of the underlying retinal pigment ephitelium. The prevalence is 1:10,000- 5:10,000. | 250,600 |
| ABCB7 | Sideroblastic anemia and ataxia, X-linked | NM_004299.4 | NM_004299.4:c.1203T>G, NM_004299.4:c.1234G>C, NM_004299.4:c.1300G>A | X-linked sideroblastic anemia with ataxia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ABCB7 gene located on chromosomal region Xq13.3. The age of onset is neonatal/infantile. This disease is characterized by core neurological features including motor delay, ataxia evident from early childhood, and dysarthria and patients usually have a mild asymptomatic anaemia or a borderline decreased mean corpuscular volume. The prevalence is <1:1,000,000. | 600 |
| ACAD9 | Acyl-CoA dehydrogenase type 9 deficiency | NM_014049.4 | NM_014049.4:c.1240C>T, NM_014049.4:c.1249C>T, NM_014049.4:c.130T>A, NM_014049.4:c.1594C>T, NM_014049.4:c.23delT, NM_014049.4:c.358delT, NM_014049.4:c.797G>A, NM_014049.4:c.976G>C, NM_014049.4:c.453+1G>A | Acyl-CoA dehydrogenase type 9 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAD9 gene located on chromosomal region 3q21.3. The age of onset is neonatal/infantile. This disease is characterized by failure to thrive, hypertrophic cardiomyopathy, exercise intolerance and mild to severe neurological dysfunction. | 250,600 |
| ACADM | Acyl-CoA dehydrogenase deficiency, medium-chain | NM_000016.5 | NM_000016.5:c.1102_1105delTTAG, NM_000016.5:c.1232_1233delAA, NM_000016.5:c.287-2A>G, NM_000016.5:c.362C>T, NM_000016.5:c.447G>A, NM_000016.5:c.447G>T, NM_000016.5:c.449_452delCTGA, NM_000016.5:c.616C>T, NM_000016.5:c.617G>A, NM_000016.5:c.683C>A, NM_000016.5:c.797A>G, NM_000016.5:c.799G>A, NM_000016.5:c.815_827delTTGCAATGGGAGC, NM_000016.5:c.890A>G, NM_000016.5:c.984delG, NM_000016.5:c.985A>G, NM_000016.5:c.127G>A, NM_000016.5:c.734C>T, NM_000016.5:c.250C>T | Medium chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADM gene located on chromosomal region 1p31. The age of onset is neonatal/infantile. This disease is characterized by a rapidly progressive metabolic crisis, often presenting as hypoketotic hypoglycemia, lethargy, vomiting, seizures and coma. The prevalence is 1:4,900-1:27,000 in Caucasian populations and 1:14,600 in worldwide populations. | 250,600 |
| ACADS | Acyl-CoA dehydrogenase deficiency, short-chain | NM_000017.2 | NM_000017.2:c.1095G>T, NM_000017.2:c.1108A>G, NM_000017.2:c.1147C>T, NM_000017.2:c.136C>T, NM_000017.2:c.319C>T, NM_000017.2:c.417G>C, NM_000017.2:c.529T>C, NM_000017.2:c.561_568delCAATGCCT, NM_000017.2:c.826G>A, NM_000017.2:c.314T>A | Short chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADS gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by seizures, developmental delay, failure to grow with poor feeding, and usually muscle weakness and hypotonia. The prevalence is <1:50,000. | 250,600 |
| ACADSB | 2-Methylbutyryl-CoA dehydrogenase deficiency | NM_001609.3 | NM_001609.3:c.1159G>A, NM_001609.3:c.443C>T, NM_001609.3:c.763C>T, NM_001609.3:c.621G>A, NM_001609.3:c.303+1G>A | 2-Methylbutyryl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADSB gene located on chromosomal region 10q26.3. The age of onset is neonatal/infantile. This disease is characterized by muscle hypotonia, cerebral palsy, developmental delay, lethargy, hypoglycemia, and metabolic acidosis. The prevalence is <1:1,000,000. | 250,600 |
| ACADVL | Very long chain acyl-CoA dehydrogenase deficiency | NM_000018.3 | NM_000018.3:c.1096C>T, NM_000018.3:c.1097G>A, NM_000018.3:c.1106T>C, NM_000018.3:c.1141_1143delGAG, NM_000018.3:c.1182+1G>A, NM_000018.3:c.1357C>T, NM_000018.3:c.1360G>A, NM_000018.3:c.1375dupC, NM_000018.3:c.1389dupG, NM_000018.3:c.1406G>A, NM_000018.3:c.1468G>C, NM_000018.3:c.1532+1G>A, NM_000018.3:c.1837C>T, NM_000018.3:c.1843C>T, NM_000018.3:c.1882delC, NM_000018.3:c.278-1G>A, NM_000018.3:c.298_299delCA, NM_000018.3:c.343delG, NM_000018.3:c.400C>T, NM_000018.3:c.477+1G>C, NM_000018.3:c.520G>A, NM_000018.3:c.685C>T, NM_000018.3:c.739A>C, NM_000018.3:c.753-2A>C, NM_000018.3:c.896_898delAGA, NM_000018.3:c.917T>C, NM_000018.3:c.1844G>A, NM_000018.3:c.848T>C | Very long chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADVL gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by cardiomyopathy, hypoketotic hypoglycemia, liver disease, exercise intolerance and rhabdomyolysis. The prevalence is 1:100,000-9:100,000. | 250,600 |
| ACAT1 | Beta-ketothiolase deficiency | NM_000019.3 | NM_000019.3:c.1035_1037delAGA, NM_000019.3:c.1083dupA, NM_000019.3:c.1136G>T, NM_000019.3:c.1138G>A, NM_000019.3:c.2T>A, NM_000019.3:c.410_417delCTCAAAGT, NM_000019.3:c.547G>A, NM_000019.3:c.622C>T, NM_000019.3:c.905delA | Beta-ketothiolase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAT1 gene located on chromosomal region 11q22.3. The age of onset is neonatal/infantile. This disease is characterized by normal early development followed by a progressive loss of mental and motor skills. The prevalence is < 1:1,000,000. | 600 |
| ACE | Renal tubular dysgenesis | NM_000789.3 | NM_000789.3:c.1319_1322delTGGA, NM_000789.3:c.1510delC, NM_000789.3:c.3381-4C>T, NM_000789.3:c.798C>G, NM_000789.3:c.1486C>T, NM_000789.3:c.2371C>T, NM_000789.3:c.1587-2A>G | Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects. | 250,600 |
| ACOX1 | Peroxisomal acyl-CoA oxidase deficiency | NM_004035.6 | NM_004035.6:c.832A>G, NM_004035.6:c.532G>T, NM_004035.6:c.591delG | Peroxisomal acyl-CoA oxidase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACOX1 gene located on chromosomal region 17q25.1. The age of onset is neonatal/infantile. This disease is characterized by hypotonia and seizures in the neonatal period and neurological regression in early infancy. The prevalence is < 1:1,000,000. | 600 |
| ACTN4 | Glomerulosclerosis, focal segmental, type 1 | NM_004924.4 | NM_004924.4:c.763A>G, NM_004924.4:c.2619_2620insC, NM_004924.4:c.776C>T, NM_004924.4:c.784T>C | Focal segmental glomerulosclerosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACTN4 gene located on chromosomal region 19q13.2. The age of onset is variable. This disease is characterized by severe proteinuria with low serum albumin and possible edemas. | 600 |
| ADA | Adenosine deaminase deficiency | NM_000022.2 | NM_000022.2:c.226C>T, NM_000022.2:c.632G>A, NM_000022.2:c.890C>A, NM_000022.2:c.247G>A, NM_000022.2:c.320T>C, NM_000022.2:c.872C>T, NM_000022.2:c.956_960delAAGAG, NM_000022.2:c.986C>T | Adenosine deaminase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADA gene located on chromosomal region 20q13.12. The age of onset is neonatal/infantile. This disease is characterized by profound lymphopenia and very low immunoglobulin levels of all isotypes resulting in severe and recurrent opportunistic infections. The annual incidence is 1:200,000-1:1,000,000. The prevalence is 1:100,000-9:100,000. | 250,600 |
| ADAMTS2 | Ehlers-Danlos syndrome type 7C | NM_014244.4 | NM_014244.4:c.2384G>A | Ehlers-Danlos syndrome type 7C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADAMTS2 gene located on chromosomal region 5q35.3. The age of onset is neonatal/infantile. This disease is characterized by extremely fragile tissues, hyperextensible skin and easy bruising. The prevalence is <1:1,000,000. | 600 |
| ADAMTSL2 | Geleophysic dysplasia type 1 | NM_014694.3 | NM_014694.3:c.338G>A, NM_014694.3:c.440C>T, NM_014694.3:c.661C>T, NM_014694.3:c.340G>A | Geleophysic dysplasia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADAMTSL2 gene located on chromosomal region 9q34.2. The age of onset is infantile. This disease is characterized by extremely by short stature, prominent abnormalities in hands and feet, and a characteristic facial appearance. The prevalence is <1:1,000,000. | 600 |
| ADCK3 | Primary coenzyme Q10 deficiency type 4 | NM_020247.4 | NM_020247.4:c.911C>T, NM_020247.4:c.815G>T, NM_020247.4:c.993C>T, NM_020247.4:c.1541A>G, NM_020247.4:c.1645G>A, NM_020247.4:c.1651G>A, NM_020247.4:c.1750_1752delACC, NM_020247.4:c.1813_1814insG, NM_020247.4:c.589-3C>G, NM_020247.4:c.637C>T, NM_020247.4:c.815G>A | Primary coenzyme Q10 deficiency type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADCK3 gene located on chromosomal region 1q42.13. The age of onset is infantile. This disease is characterized by progressive ataxia, cerebellar atrophy, and often exercise intolerance with elevated lactate levels and mild intellectual deficit. | 250,600 |
| AGA | Aspartylglucosaminuria | NM_000027.3 | NM_000027.3:c.488G>C, NM_000027.3:c.755G>A, NM_000027.3:c.214T>C, NM_000027.3:c.302C>T, NM_000027.3:c.800dupT, NM_000027.3:c.904G>A | Aspartylglucosaminuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGA gene located on chromosomal region 4q34.3. The age of onset is infantile. This disease is characterized by slowly developping mental retardation, beginning with clumsiness, late speech, and hyperkinesia, mild facial dysmorphism, and slight kyphoscoliosis. | 600 |
| AGL | Glycogen storage disease type 3 | NM_000642.2 | NM_000642.2:c.1783C>T, NM_000642.2:c.18_19delGA, NM_000642.2:c.112A>G, NM_000642.2:c.1222C>T, NM_000642.2:c.1481G>A, NM_000642.2:c.1485delT, NM_000642.2:c.16C>T, NM_000642.2:c.4260-1G>T, NM_000642.2:c.3214_3215delGA, NM_000642.2:c.1999delC, NM_000642.2:c.2039G>A, NM_000642.2:c.2590C>T, NM_000642.2:c.4456delT, NM_000642.2:c.3216_3217delGA, NM_000642.2:c.3980G>A, NM_000642.2:c.4342G>C, NM_000642.2:c.4529dupA, NM_000642.2:c.294-2A>T, NM_000642.2:c.4260-12A>G | Glycogen storage disease type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGL gene located on chromosomal region 1p21.2. The age of onset is infantile. This disease is characterized by hepatomegaly, growth retardation and occasional seizures related to hypoglycemia and frequently muscular hypotonia and hypertrophic cardiomyopathy. | 250,600 |
| AGPS | Rhizomelic chondrodysplasia punctata type 3 | NM_003659.3 | NM_003659.3:c.1256G>A, NM_003659.3:c.926C>T, NM_003659.3:c.1406T>C, NM_003659.3:c.1703C>T | Rhizomelic chondrodysplasia punctata type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGPS gene located on chromosomal region 2q31.2. The age of onset is neonatal/infantile. This disease is characterized by shortness of the femur and humerus, vertebral disorders, cataract, cutaneous lesions and severe intellectual deficit. The prevalence is 1:100,000-9:100,000. | 600 |
| AGT | Renal tubular dysgenesis | NM_000029.3 | NM_000029.3:c.1124G>A, NM_000029.3:c.604C>T, NM_000029.3:c.1290_1291insT, NM_000029.3:c.1290delT | Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects. | 600 |
| AGTR1 | Renal tubular dysgenesis | NM_031850.3 | NM_031850.3:c.481delC, NM_031850.3:c.259dupG, NM_031850.3:c.215dupT, NM_031850.3:c.481C>T | Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects. | 600 |
| AGXT | Primary hyperoxaluria type 1 | NM_000030.2 | NM_000030.2:c.166-2A>G, NM_000030.2:c.121G>A, NM_000030.2:c.32C>A, NM_000030.2:c.245G>A, NM_000030.2:c.25_26insC, NM_000030.2:c.322T>C, NM_000030.2:c.508G>A, NM_000030.2:c.560C>T, NM_000030.2:c.590G>A, NM_000030.2:c.613T>C, NM_000030.2:c.697C>T, NM_000030.2:c.698G>A, NM_000030.2:c.731T>C, NM_000030.2:c.738G>A, NM_000030.2:c.836T>C, NM_000030.2:c.860G>A, NM_000030.2:c.33_34insC, NM_000030.2:c.454T>A, NM_000030.2:c.466G>A, NM_000030.2:c.248A>G | Primary hyperoxaluria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGXT gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by variable clinical presentation, ranging from occasional symptomatic nephrolithiasis to nephrocalcinosis and end-stage renal disease with systemic involvement. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| AHI1 | Joubert syndrome type 3 | NM_017651.4 | NM_017651.4:c.1303C>T, NM_017651.4:c.1484G>A, NM_017651.4:c.2295_2296insA, NM_017651.4:c.2295dupA, NM_017651.4:c.3257A>G, NM_017651.4:c.2168G>A, NM_017651.4:c.985C>T, NM_017651.4:c.989A>G, NM_017651.4:c.3263_3264delGG, NM_017651.4:c.1051C>T, NM_017651.4:c.1052G>T | El síndrome de Joubert tipo 3 sigue un patrón de herencia autosómico recesivo y está causado por variantes patogénicas en el gen AHI1 localizado en la región cromosómica 6q23.3. La edad de aparición es neonatal/infantil con síntomas como los rasgos neurológicos del síndrome de Joubert (hipotonía neonatal, retraso del desarrollo, discapacidad intelectural de leve a grave, ataxia, movimiento ocular anormal incluyendo apraxia oculomotora y nistagmo en posición primaria) asociados a una distrofia retiniana. | 250,600 |
| AIPL1 | Cone-rod dystrophy | NM_014336.4 | NM_014336.4:c.1053_1064delTGCAGAGCCACC | La distrofia de conos y bastones causada por variantes patogénicas en el gen AIPL1 localizado en la región cromosómica 17p13.2 sigue un patrón de herencia autosómico recesivo. La edad de aparición es temprana. Se caracteriza por una agudeza visual disminuida, defectos en la visión de los colores, fotoaversión y disminución de la sensibilidad en el centro del campo visual, seguido por una pérdida de la visión periférica y ceguera nocturna. | 250,600 |
| AIPL1 | Leber congenital amaurosis type 4 | NM_014336.4 | NM_014336.4:c.905G>T, NM_014336.4:c.834G>A, NM_014336.4:c.589G>C, NM_014336.4:c.715T>C | Leber congenital amaurosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AIPL1gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. The prevalence is 1:100,000-9:100,000. | 250,600 |
| ALAS2 | Erythropoietic protoporphyria | NM_000032.4 | NM_000032.4:c.1699_1700delAT, NM_000032.4:c.1706_1709delAGTG | Erythropoietic protoporphyria caused by pathogenic variants in the ALAS2 gene located on chromosomal region Xp11.21 follows a dominant X-linked pattern of inheritance. The age of onset is neonatal/infancy. This disease is characterized by cutaneous manifestations of acute painful photosensitivity with erythema and edema, sometimes with petechiae, together with stinging and burning sensations without blistering, upon exposure to sunlight or artificial light (400-700 nm). These episodes have a variable severity depending on the exposure duration and may result in chronic permanent lesions on exposed skin. There is a risk of .cholelithiasis with obstructive episodes, and chronic liver disease that might evolve to acute liver failure. The global prevalence is ranging between 1/75,000 and 1/200,000. | 600 |
| ALAS2 | Sideroblastic anemia, X-linked | NM_000032.4 | NM_000032.4:c.1354C>T | X-linked sideroblastic anemia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ALAS2 gene located on chromosomal region Xp11.21. The age of onset is variable. This disease is characterized by clinical features of anemia and/or iron overload such as pallor, fatigue, weakness, and more rarely breathlessness, mild splenomegaly, cardiac problems, abnormal liver function, hyperglycemia, glucose intolerance and skin hyperpigmentation. | 600 |
| ALDH4A1 | Hyperprolinemia type 2 | NM_003748.3 | NM_003748.3:c.1055C>T | Hyperprolinemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDH4A1 gene located on chromosomal region 1p36. The age of onset is variable. This disease is characterized by seizures, intellectual deficit and mild developmental delay. | 600 |
| ALDH5A1 | Succinic semialdehyde dehydrogenase deficiency | NM_001080.3 | NM_001080.3:c.1234C>T, NM_001080.3:c.1226G>A, NM_001080.3:c.901A>G, NM_001080.3:c.1540C>T, NM_001080.3:c.1579C>T, NM_001080.3:c.612G>A, NM_001080.3:c.803G>A, NM_001080.3:c.862A>G | Succinic semialdehyde dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDH451 gene located on chromosomal region 6p22. The age of onset is infantile. This disease is characterized by psychomotor retardation, delayed speech development, hypotonia and ataxia. It is a rare disease with around 350 cases reported. | 600 |
| ALDOA | Glycogen storage disease type 12 | NM_000034.3 | NM_000034.3:c.619G>A, NM_000034.3:c.386A>G | Glycogen storage disease type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOA gene located on chromosomal region 16p11.2. The age of onset is neonatal/infantile. This disease is characterized by myopathy with exercise intolerance and rhabdomyolysis associated with hemolytic anaemia. | 600 |
| ALDOB | Hereditary fructose intolerance | NM_000035.3 | NM_000035.3:c.1005C>G, NM_000035.3:c.178C>T, NM_000035.3:c.1027T>C, NM_000035.3:c.10C>T, NM_000035.3:c.136A>T, NM_000035.3:c.448G>C, NM_000035.3:c.2T>C, NM_000035.3:c.360_363delCAAA, NM_000035.3:c.442T>C, NM_000035.3:c.1013C>T, NM_000035.3:c.113-1_115delGGTA, NM_000035.3:c.1067C>A, NM_000035.3:c.612T>A, NM_000035.3:c.720C>A, NM_000035.3:c.524C>A | Hereditary fructose intolerance follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOB gene located on chromosomal region 9q21.3-q22.2. The age of onset is neonatal/infantile. This disease is characterized by severe abdominal pain, vomiting, and hypoglycemia following ingestion of fructose or other sugars metabolised through fructose-1-phosphate. The prevalence is 1:100,000-9:100,000. | 250,600 |
| ALG1 | Congenital disorders of glycosylation type 1k | NM_019109.4 | NM_019109.4:c.1187+1G>A, NM_019109.4:c.1079C>T, NM_019109.4:c.1129A>G, NM_019109.4:c.901+1G>A, NM_019109.4:c.434G>A, NM_019109.4:c.450C>G, NM_019109.4:c.773C>T | Congenital disorder of glycosylation type 1k follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG1 gene located on chromosomal region 16p13.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay, seizures, microcephaly and coagulation anomalies. The prevalence is <1:1,000,000. | 600 |
| ALG6 | Congenital disorders of glycosylation type Ic | NM_013339.3 | NM_013339.3:c.897_899delAAT, NM_013339.3:c.998C>T, NM_013339.3:c.495-3C>G, NM_013339.3:c.53G>A, NM_013339.3:c.316C>T, NM_013339.3:c.482A>G, NM_013339.3:c.1432T>C | Congenital disorder of glycosylation type 1c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG6 gene located on chromosomal region 1p31.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay and muscular hypotonia, and possible coagulation anomalies, hormonal abnormalities and seizures. The prevalence is <1:1,000,000. | 250,600 |
| ALMS1 | Alström syndrome | NM_015120.4 | NM_015120.4:c.11443C>T, NM_015120.4:c.10775delC, NM_015120.4:c.11316_11319delAGAG, NM_015120.4:c.2323C>T, NM_015120.4:c.11449C>T, NM_015120.4:c.11452_11453insA, NM_015120.4:c.1574_1576delCTCinsT, NM_015120.4:c.8383C>T, NM_015120.4:c.9612_9616delAACAG, NM_015120.4:c.10579_10580delAT, NM_015120.4:c.11610_11611delCT, NM_015120.4:c.12439C>T, NM_015120.4:c.12445C>T, NM_015120.4:c.891_907delTCAGCACCCGCTTATAG, NM_015120.4:c.9911-1G>A, NM_015120.4:c.11618_11619delCT, NM_015120.4:c.4245delC, NM_015120.4:c.5584C>T, NM_015120.4:c.8164C>T | Alström syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALMS1 gene located on chromosomal region 2p13.1. The age of onset is neonatal/infantile. This disease is characterized by cone-rod dystrophy, hearing loss, obesity, insulin resistance and hyperinsulinemia, type 2 diabetes mellitus, dilated cardiomyopathy and progressive hepatic and renal dysfunction. The prevalence is 1:10,000-1:1,000,000. | 250,600 |
| ALPL | Hypophosphatasia | NM_000478.4 | NM_000478.4:c.1001G>A, NM_000478.4:c.1366G>A, NM_000478.4:c.211C>T, NM_000478.4:c.212G>C, NM_000478.4:c.323C>T, NM_000478.4:c.346G>A, NM_000478.4:c.407G>A, NM_000478.4:c.526G>A, NM_000478.4:c.535G>A, NM_000478.4:c.571G>A, NM_000478.4:c.620A>C, NM_000478.4:c.1133A>T, NM_000478.4:c.1250A>G, NM_000478.4:c.1306T>C, NM_000478.4:c.98C>T, NM_000478.4:c.1574delG, NM_000478.4:c.892G>A, NM_000478.4:c.814C>T, NM_000478.4:c.881A>C | Childhood-onset hypophosphatasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALPL gene located on chromosomal region 1p36.12. The age of onset is infantile. This disease is characterized by clinical features ranging from stillbirth without mineralized bone to pathologic fractures of the lower extremities in later adulthood. | 600 |
| AMACR | Alpha-methylacyl-CoA racemase deficiency | NM_014324.5 | NM_014324.5:c.857delT, NM_014324.5:c.320T>C, NM_014324.5:c.43delG, NM_014324.5:c.154T>C | Alpha-methylacyl-Coa racemase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMACR gene located on chromosomal region 5p13. The age of onset is variable. This disease is characterized by mild cholestatic liver disease, fat malabsorption and/or neurological disease. The prevalence is <1:1,000,000. | 600 |
| AMT | Glycine encephalopathy | NM_000481.3 | NM_000481.3:c.139G>A, NM_000481.3:c.125A>G, NM_000481.3:c.959G>A, NM_000481.3:c.574C>T, NM_000481.3:c.806G>A, NM_000481.3:c.826G>C, NM_000481.3:c.259-1G>C | Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMT and GLDC genes located on chromosomal regions 3p21.31 and 9p24.1 respectively. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000. | 600 |
| ANO5 | Limb-girdle muscular dystrophy type 2L, autosomal recessive | NM_213599.2 | NM_213599.2:c.155A>G, NM_213599.2:c.1622_1623insA, NM_213599.2:c.1407+5G>A, NM_213599.2:c.1887delA, NM_213599.2:c.1733T>C, NM_213599.2:c.692G>T, NM_213599.2:c.1627_1628insA, NM_213599.2:c.172C>T, NM_213599.2:c.206_207delAT, NM_213599.2:c.1210C>T, NM_213599.2:c.1295C>G, NM_213599.2:c.1914G>A, NM_213599.2:c.184_185insA, NM_213599.2:c.1898+1G>A, NM_213599.2:c.191_192insA | Autosomal recessive limb-girdle muscular dystrophy type 2L follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ANO5 gene located on chromosomal region 11p14.3. The age of onset is adult. This disease is characterized by weakness and wasting restricted to the limb musculature, proximal greater than distal, and muscle degeneration/regeneration on muscle biopsy. The prevalence is <1:1,000,000. | 250,600 |
| APTX | Ataxia with oculomotor apraxia type 1 | NM_175073.2 | NM_175073.2:c.167delT, NM_175073.2:c.788T>G, NM_175073.2:c.320delC, NM_175073.2:c.617C>T, NM_175073.2:c.659C>T, NM_175073.2:c.134-2A>G, NM_175073.2:c.166C>T, NM_175073.2:c.124C>T, NM_175073.2:c.875-1G>A, NM_175073.2:c.837G>A, NM_175073.2:c.596G>A | Ataxia with oculomotor apraxia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the APTX gene located on chromosomal region 9p13.1. The age of onset is infantile. This disease is characterized by a progressive cerebellar ataxia associated with oculomotor apraxia, choeroathetosis and severe peripheral neuropathy. The prevalence is 0,4:100.000 in Portugal. | 250,600 |
| AR | Androgen insensitivity syndrome | NM_000044.3 | NM_000044.3:c.2650A>T, NM_000044.3:c.340C>T, NM_000044.3:c.1937C>A, NM_000044.3:c.2323C>T, NM_000044.3:c.2391G>A, NM_000044.3:c.2567G>A, NM_000044.3:c.1769-11T>A, NM_000044.3:c.1771A>T, NM_000044.3:c.2395C>G | Androgen insensitivity syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the AR gene located on chromosomal region Xq12. The age of onset is variable. This disease is characterized by the presence of female external genitalia in a 46,XY individual with normal testis development but undescended testes and unresponsiveness to age-appropriate levels of androgens. The prevalence is 2:100,000-5:100,000. | 250,600 |
| ARG1 | Argininemia | NM_000045.3 | NM_000045.3:c.61C>T, NM_000045.3:c.365G>A, NM_000045.3:c.413G>T, NM_000045.3:c.871C>T, NM_000045.3:c.32T>C, NM_000045.3:c.703G>C, NM_000045.3:c.869C>G | Argininemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARG1gene located on chromosomal region 6q23. The age of onset is neonatal/infantile. This disease is characterized by variable degrees of hyperammonemia, developing from about 3 years of age, and leading to progressive loss of developmental milestones and spasticity in the absence of treatment. The prevalence is 1:350,000-1:1,000,000. | 600 |
| ARL13B | Joubert syndrome type 8 | NM_182896.2 | NM_182896.2:c.1186C>G, NM_182896.2:c.246G>A, NM_182896.2:c.1252C>T, NM_182896.2:c.598C>T | Joubert syndrome type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL13B gene located on chromosomal region 3q11.1. The age of onset is neonatal/infantile. This disease is characterized by congenital malformation of the brainstem and agenesis or hypoplasia of the cerebellar vermis leading to an abnormal respiratory pattern, nystagmus, hypotonia, ataxia and delay in achieving motor milestones. The prevalence is 1/80,000 to 1/100,000. | 600 |
| ARL6 | Bardet-Biedl syndrome type 3 | NM_177976.2 | NM_177976.2:c.4G>T, NM_177976.2:c.92C>G, NM_177976.2:c.281T>C, NM_177976.2:c.92C>T, NM_177976.2:c.431C>T, NM_177976.2:c.364C>T | Bardet-Biedl syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL6 gene located on chromosomal region 3q11.2. The age of onset is early. A syndrome characterized by usually severe pigmentary retinopathy, early-onset obesity, polydactyly, hypogenitalism, renal malformation and mental retardation. Secondary features include diabetes mellitus, hypertension and congenital heart disease. | 600 |
| ARL6 | Retinitis pigmentosa type 55 | NM_177976.2 | NM_177976.2:c.266C>T | Retinitis pigmentosa type 55 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL6 gene located on chromosomal region 3q11.2. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000. | 600 |
| ARSA | Metachromatic leukodystrophy | NM_000487.5 | NM_000487.5:c.1241delC, NM_000487.5:c.1283C>T, NM_000487.5:c.346C>T, NM_000487.5:c.34delG, NM_000487.5:c.1210+1G>A, NM_000487.5:c.1232C>T, NM_000487.5:c.582delC, NM_000487.5:c.583delT, NM_000487.5:c.542dupT, NM_000487.5:c.542T>G, NM_000487.5:c.1408_1418delGCAGCTGTGAC, NM_000487.5:c.195delC, NM_000487.5:c.641C>T, NM_000487.5:c.1401_1411delGTTAGACGCAG, NM_000487.5:c.869G>A, NM_000487.5:c.869G>T, NM_000487.5:c.883G>A, NM_000487.5:c.899T>C, NM_000487.5:c.931G>A, NM_000487.5:c.937C>T, NM_000487.5:c.938G>A, NM_000487.5:c.979G>A, NM_000487.5:c.737G>A, NM_000487.5:c.739G>A, NM_000487.5:c.763G>A, NM_000487.5:c.827C>T, NM_000487.5:c.854+1G>A, NM_000487.5:c.1108-2A>G, NM_000487.5:c.1125_1126delCT, NM_000487.5:c.1150G>A, NM_000487.5:c.1174C>T, NM_000487.5:c.1175G>A, NM_000487.5:c.986C>T, NM_000487.5:c.991G>T, NM_000487.5:c.465+1G>A, NM_000487.5:c.257G>A, NM_000487.5:c.293C>T, NM_000487.5:c.302G>A | Metachromatic leukodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSA gene located on chromosomal region 22q13.33. The age of onset is variable. This disease is characterized by hypotonia, walking difficulties, optic atrophy and motor regression preceding mental impairment in the late infantile form, arrested intellectual development, followed by motor regression, epileptic seizures and ataxia in the juvenile form, and motor or psychiatric disorders, but with slow progression in the adult form. The incidence is 0.5:5,000-1:50,000 and the prevalence is 1:10,000 -5/10,000. | 250,600 |
| ARSB | Mucopolysaccharidosis type 6 | NM_000046.3 | NM_000046.3:c.410G>T, NM_000046.3:c.427delG, NM_000046.3:c.349T>C, NM_000046.3:c.389C>T, NM_000046.3:c.937C>G, NM_000046.3:c.944G>A, NM_000046.3:c.971G>T, NM_000046.3:c.979C>T, NM_000046.3:c.1562G>A, NM_000046.3:c.629A>G, NM_000046.3:c.1143-1G>C, NM_000046.3:c.571C>T, NM_000046.3:c.589C>T, NM_000046.3:c.1178A>C, NM_000046.3:c.1214G>A, NM_000046.3:c.1143-8T>G, NM_000046.3:c.1161dupC, NM_000046.3:c.707T>C, NM_000046.3:c.753C>G, NM_000046.3:c.1366C>T, NM_000046.3:c.1438_1439insG, NM_000046.3:c.921delA | Mucopolysaccharidosis type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSB gene located on chromosomal region 5q14.1. The age of onset is infantile. This disease is characterized by educed pulmonary function, hepatosplenomegaly, hearing loss, sleep apnea, corneal clouding, carpal tunnel disease and occasionally central nervous system findings may include cervical cord compression caused by cervical spinal instability, meningeal thickening and/or bony stenosis, communicating hydrocephalus, optic nerve atrophy and blindness. The prevalence is 1:250,000-1:600,000 newborns. | 250,600 |
| ARSE | Chondrodysplasia punctata type 1, X-linked | NM_000047.2 | NM_000047.2:c.119T>G, NM_000047.2:c.1429delG, NM_000047.2:c.1442C>T, NM_000047.2:c.1732C>T, NM_000047.2:c.1743G>A, NM_000047.2:c.24-1G>A, NM_000047.2:c.410G>C, NM_000047.2:c.410G>T | X-linked chondrodysplasia punctata type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARSE gene located on chromosomal region Xp22.33. The age of onset is neonatal. This disease is characterized by chondrodysplasia punctata (stippled epiphyses), brachytelephalangy (shortening of the distal phalanges), and nasomaxillary hypoplasia. The prevalence is 1:500,000. | 250,600 |
| ARX | Epileptic encephalopathy, early infantile, type 1 | NM_139058.2 | NM_139058.2:c.1058C>T | Early infantile epileptic encephalopathy type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARX gene located on chromosomal region Xp21.3. The age of onset is neonatal/infantile. This disease is characterized by poor suckling reflexes, hypotonia and generalized and symmetrical tonic spasms. The prevalence is 1:500,000. | 600 |
| ARX | Lissencephaly with abnormal genitalia, X-linked | NM_139058.2 | NM_139058.2:c.980_983delAACA | X-linked lissencephaly with abnormal genitalia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARX gene located on chromosomal region Xp21.3. The age of onset is neonatal/infantile. It is a severe neurological disorder that only manifests in genotypic males and includes lissencephaly with posterior-to-anterior gradient and only moderate increase in thickness of the cortex, absent corpus callosum, neonatal-onset severe epilepsy, hypothalamic dysfunction including defective temperature regulation, and ambiguous genitalia with micropenis and cryptorchidism. | 600 |
| ASL | Argininosuccinic aciduria | NM_000048.3 | NM_000048.3:c.1135C>T, NM_000048.3:c.1060C>T, NM_000048.3:c.1255_1256delCT, NM_000048.3:c.1366C>T, NM_000048.3:c.1045_1057delGTCATCTCTACGC, NM_000048.3:c.578G>A, NM_000048.3:c.539T>G, NM_000048.3:c.544C>T, NM_000048.3:c.557G>A, NM_000048.3:c.1144-2A>G, NM_000048.3:c.602+1G>A, NM_000048.3:c.857A>G, NM_000048.3:c.925G>A, NM_000048.3:c.446+1G>A, NM_000048.3:c.505T>C, NM_000048.3:c.525-2A>T, NM_000048.3:c.532G>A, NM_000048.3:c.337C>T, NM_000048.3:c.346C>T, NM_000048.3:c.35G>A, NM_000048.3:c.1369dupG, NM_000048.3:c.437G>A, NM_000048.3:c.392C>T, NM_000048.3:c.1153C>T | Argininosuccinic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASL gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by severe hyperammonemic coma, hypotonia, growth failure, anorexia and chronic vomiting or behavioral disorders during childhood, and hyperammonemic coma or behavioral disorders that simulate psychiatric disorders later in life. The prevalence is 1:70,000 newborns. | 250,600 |
| ASPA | Canavan disease | NM_000049.2 | NM_000049.2:c.838C>T, NM_000049.2:c.693C>A, NM_000049.2:c.654C>A, NM_000049.2:c.433-2A>G, NM_000049.2:c.854A>C, NM_000049.2:c.914C>A, NM_000049.2:c.212G>A, NM_000049.2:c.863A>G | Canavan disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPA gene located on chromosomal region 17p13.3. The age of onset is neonatal/infantile. This disease is characterized by a variable spectrum between severe forms with leukodystrophy, macrocephaly and severe developmental delay, and a very rare mild/juvenile form characterized by mild developmental delay. The prevalence is 1:6,400- 1:13,500 in Askenazis Jewis. | 250,600 |
| ASPM | Microcephaly primary, type 5, autosomal recessive | NM_018136.4 | NM_018136.4:c.1002delA, NM_018136.4:c.3055C>T, NM_018136.4:c.2389C>T, NM_018136.4:c.2967G>A, NM_018136.4:c.1260_1266delTCAAGTC, NM_018136.4:c.10059C>A, NM_018136.4:c.1154_1155delAG, NM_018136.4:c.1179delT, NM_018136.4:c.1729_1730delAG, NM_018136.4:c.1959_1962delCAAA, NM_018136.4:c.1990C>T, NM_018136.4:c.3979C>T, NM_018136.4:c.4195dupA, NM_018136.4:c.4583delA, NM_018136.4:c.4795C>T, NM_018136.4:c.4858_4859delAT, NM_018136.4:c.5136C>A, NM_018136.4:c.5149delA, NM_018136.4:c.1366G>T, NM_018136.4:c.1406_1413delATCCTAAA, NM_018136.4:c.1590delA, NM_018136.4:c.6189T>G, NM_018136.4:c.6232C>T, NM_018136.4:c.6337_6338delAT, NM_018136.4:c.6732delA, NM_018136.4:c.719_720delCT, NM_018136.4:c.7491_7495delTATTA, NM_018136.4:c.7565T>G, NM_018136.4:c.7761T>G, NM_018136.4:c.7782_7783delGA, NM_018136.4:c.7860_7861delGA, NM_018136.4:c.7894C>T, NM_018136.4:c.8131_8132delAA, NM_018136.4:c.8230_8231insA, NM_018136.4:c.8378delT, NM_018136.4:c.8508_8509delGA, NM_018136.4:c.8668C>T, NM_018136.4:c.8844delC, NM_018136.4:c.9115_9118dupCATT, NM_018136.4:c.9159delA, NM_018136.4:c.9178C>T, NM_018136.4:c.3082G>A, NM_018136.4:c.3188T>G, NM_018136.4:c.3477_3481delCGCTA, NM_018136.4:c.349C>T, NM_018136.4:c.3527C>G, NM_018136.4:c.3663delG, NM_018136.4:c.3710C>G, NM_018136.4:c.3796G>T, NM_018136.4:c.3811C>T, NM_018136.4:c.3978G>A, NM_018136.4:c.9747_9748delCT, NM_018136.4:c.9754delA, NM_018136.4:c.9789T>A, NM_018136.4:c.8711_8712delAA, NM_018136.4:c.9190C>T, NM_018136.4:c.9238A>T, NM_018136.4:c.9319C>T, NM_018136.4:c.5439_5440delAG, NM_018136.4:c.577C>T, NM_018136.4:c.6073delG, NM_018136.4:c.9677dupG, NM_018136.4:c.9685delA, NM_018136.4:c.9697C>T, NM_018136.4:c.9730C>T, NM_018136.4:c.9557C>G, NM_018136.4:c.9492T>G, NM_018136.4:c.9539A>C | Primary autosomal recessive microcephaly type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPM gene located on chromosomal region 1q31. The age of onset is neonatal/infantile. This disease is characterized by a reduction in head circumference at birth, mild to moderate non-progressive intellectual impairment and delay in early motor milestones, speech delay and hyperactive behavior are common. The annual incidence is 1:1,000,000. | 250,600 |
| ASS1 | Citrullinemia type 1 | NM_000050.4 | NM_000050.4:c.421-2A>G, NM_000050.4:c.40G>A, NM_000050.4:c.1088G>A, NM_000050.4:c.470G>A, NM_000050.4:c.1085G>T, NM_000050.4:c.1087C>T, NM_000050.4:c.257G>A, NM_000050.4:c.323G>T, NM_000050.4:c.349G>A, NM_000050.4:c.380G>A, NM_000050.4:c.836G>A, NM_000050.4:c.910C>T, NM_000050.4:c.928A>C, NM_000050.4:c.496-2A>G, NM_000050.4:c.535T>C, NM_000050.4:c.539G>A, NM_000050.4:c.53C>T, NM_000050.4:c.571G>A, NM_000050.4:c.787G>A, NM_000050.4:c.793C>T, NM_000050.4:c.794G>A, NM_000050.4:c.805G>A, NM_000050.4:c.835C>T, NM_000050.4:c.919C>T, NM_000050.4:c.970G>A, NM_000050.4:c.814C>T, NM_000050.4:c.970+5G>A, NM_000050.4:c.1168G>A, NM_000050.4:c.1194-1G>C, NM_000050.4:c.256C>T | Citrullinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASS1 gene located on chromosomal region 9q34.1. The age of onset is variable. This disease is characterized by hyperammonemia, progressive lethargy, poor feeding and vomiting in the neonatal form and by variable hyperammonemia in the later-onset form. The prevalence is 1:100,000-9:100,000. | 250,600 |
| ATIC | AICA-ribosiduria | NM_004044.6 | NM_004044.6:c.223+1G>A, NM_004044.6:c.1277A>G, NM_004044.6:c.625delG | AICA-ribosiduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATIC gene located on chromosomal region 2q35. The age of onset is neonatal/infantile. This disease is characterized by profound intellectual deficit, epilepsy, dysmorphic features of the knees, elbows, and shoulders and congenital blindness. The prevalence is <1:1,000,000. | 250,600 |
| ATP7A | Menkes disease | NM_000052.6 | NM_000052.6:c.2938C>T, NM_000052.6:c.2531G>A, NM_000052.6:c.1639C>T, NM_000052.6:c.1974_1977dupGTTT, NM_000052.6:c.3257_3258delAC, NM_000052.6:c.3294+2T>G, NM_000052.6:c.3915_3921delCTCCCCA, NM_000052.6:c.3931A>G | Menkes disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ATP7A gene located on chromosomal region Xq21.1. The age of onset is neonatal/infantile. This disease is characterized by progressive neurodegeneration and marked connective tissue anomalies as well as typical sparse abnormal steely hair. The birth incidence is 1:300,000 in Europe, 1:360,000 in Japan and 1:50,000-1:100,000 in Australia, and The prevalence is 1:100,000 newborns. | 600 |
| ATP7A | Occipital horn syndrome | NM_000052.6 | NM_000052.6:c.3911A>G | Occipital horn syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ATP7A gene located on chromosomal region Xq21.1. The age of onset is variable. This disease is characterized by progressive neurodegeneration and connective tissue disorders due to a copper transport defect. The prevalence is 1:100,000 newborns. | 600 |
| ATP7A | Spinal muscular atrophy, distal, X-linked | NM_000052.6 | NM_000052.6:c.2981C>T | Spinal muscular atrophy, distal follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ATP7A gene located on chromosomal region Xq21.1. The age of onset is infantile. This disease is characterized by distal weakness, atrophy of the muscles of the lower limbs, particularly in the tibioperoneal compartment and pes cavus. | 600 |
| ATP7B | Wilson disease | NM_000053.3 | NM_000053.3:c.2532delA, NM_000053.3:c.2356-2A>G, NM_000053.3:c.1285+5G>T, NM_000053.3:c.2305A>G, NM_000053.3:c.1145_1151delCCCAACT, NM_000053.3:c.1934T>G, NM_000053.3:c.2071G>A, NM_000053.3:c.2297C>G, NM_000053.3:c.2972C>T, NM_000053.3:c.2975C>T, NM_000053.3:c.3083delA, NM_000053.3:c.2605G>A, NM_000053.3:c.2621C>T, NM_000053.3:c.2755C>G, NM_000053.3:c.2755C>T, NM_000053.3:c.2762G>A, NM_000053.3:c.2795C>A, NM_000053.3:c.2804C>T, NM_000053.3:c.2807T>A, NM_000053.3:c.2906G>A, NM_000053.3:c.2930C>T, NM_000053.3:c.4301C>T, NM_000053.3:c.915T>A, NM_000053.3:c.98T>C, NM_000053.3:c.1745_1746delTA, NM_000053.3:c.2123T>C, NM_000053.3:c.2267C>T, NM_000053.3:c.4088C>T, NM_000053.3:c.4135C>T, NM_000053.3:c.1512_1513insT, NM_000053.3:c.19_20delCA, NM_000053.3:c.1922T>C, NM_000053.3:c.3955C>T, NM_000053.3:c.3990_3993delTTAT, NM_000053.3:c.4058G>A, NM_000053.3:c.3207C>A, NM_000053.3:c.3359T>A, NM_000053.3:c.3688A>G, NM_000053.3:c.3101A>G, NM_000053.3:c.3796G>A, NM_000053.3:c.3809A>G, NM_000053.3:c.562C>T, NM_000053.3:c.3694A>C, NM_000053.3:c.1846C>T | Wilson disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATP7B gene located on chromosomal region 13q14.3. The age of onset is infantile. This disease is characterized by the toxic accumulation of copper, mainly in the liver and central nervous system, and symptomatic patients may present with hepatic, neurologic or psychiatric forms. The birth incidence is 1:30,000-1:100,000 in France and The prevalence is 1:10,000-1:30,000. | 250,600 |
| ATR | Seckel syndrome type 1 | NM_001184.3 | NM_001184.3:c.2341+1G>A, NM_001184.3:c.5645delA, NM_001184.3:c.6037_6038insA, NM_001184.3:c.6488delT, NM_001184.3:c.975_976delCT, NM_001184.3:c.5635G>T | Seckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATR gene located on chromosomal region 3q23. The age of onset is neonatal/infantile. This disease is characterized by a proportionate dwarfism of prenatal onset, a severe microcephaly with a bird-headed like appearance and mental retardation. The prevalence is <1:1,000,000. | 250,600 |
| AUH | 3-Methylglutaconic aciduria type 1 | NM_001698.2 | NM_001698.2:c.471delT, NM_001698.2:c.559G>A, NM_001698.2:c.589C>T, NM_001698.2:c.650G>A, NM_001698.2:c.895-1G>A, NM_001698.2:c.991A>T, NM_001698.2:c.656-2A>G, NM_001698.2:c.943-2A>G | 3-Methylglutaconic aciduria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AUH gene located on chromosomal region 9q22.31. The age of onset is neonatal/infantile. This disease is characterized by a variable clinical phenotype ranging from mildly delayed speech to psychomotor retardation, coma, failure to thrive, metabolic acidosis and dystonia. The prevalence is <1:1,000,000. | 600 |
| B4GALT1 | Congenital disorders of glycosylation type 2d | NM_001497.3 | NM_001497.3:c.1031dupC | Congenital disorder of glycosylation type 2d follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the B4GALT1 gene located on chromosomal region 9p13. The age of onset is neonatal/infantile. This disease is characterized by macrocephaly, hydrocephaly, hypotonia, myopathy and coagulation anomalies. The prevalence is <1:1,000,000. | 600 |
| B9D2 | Meckel syndrome type 10 | NM_030578.3 | NM_030578.3:c.301A>C | Meckel syndrome type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the B9D2 gene located on chromosomal region 19q13.2. The age of onset is neonatal/infantile. This disease is characterized by a combination of renal cysts developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and polydactyly. The prevalence is <1:1,000,000. | 600 |
| BCKDHA | Maple syrup urine disease type 1A | NM_000709.3 | NM_000709.3:c.1037G>A, NM_000709.3:c.1036C>T, NM_000709.3:c.1234G>A, NM_000709.3:c.14delT, NM_000709.3:c.761C>A, NM_000709.3:c.929C>G, NM_000709.3:c.964C>T, NM_000709.3:c.979G>A, NM_000709.3:c.905A>C, NM_000709.3:c.632C>T, NM_000709.3:c.659C>T, NM_000709.3:c.740_741insT, NM_000709.3:c.868G>A, NM_000709.3:c.909_910delGT, NM_000709.3:c.917delT, NM_000709.3:c.853G>C, NM_000709.3:c.796delA | Maple syrup urine disease type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHA gene located on chromosomal region 19q13.1-13.2. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| BCKDHB | Maple syrup urine disease type 1B | NM_183050.2 | NM_183050.2:c.1046G>A, NM_183050.2:c.547C>T, NM_183050.2:c.509G>A, NM_183050.2:c.526A>T, NM_183050.2:c.344-1G>A, NM_183050.2:c.1114G>T, NM_183050.2:c.302G>A, NM_183050.2:c.342T>G, NM_183050.2:c.508C>A, NM_183050.2:c.508C>G, NM_183050.2:c.508C>T, NM_183050.2:c.748G>T, NM_183050.2:c.752T>C, NM_183050.2:c.799C>T, NM_183050.2:c.548G>C, NM_183050.2:c.884delT, NM_183050.2:c.902T>G, NM_183050.2:c.952-1G>A, NM_183050.2:c.853C>T, NM_183050.2:c.832G>A, NM_183050.2:c.356T>G, NM_183050.2:c.970C>T, NM_183050.2:c.488A>T, NM_183050.2:c.479T>G | Maple syrup urine disease type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHB gene located on chromosomal region 6q14.1. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:10,000-5:10,000. | 600 |
| BCS1L | Björnstad syndrome | NM_004328.4 | NM_004328.4:c.548G>A | Björnstadt syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal/infantile. This disease is characterized by congenital sensorineural hearing loss and pili torti. The prevalence is <1:1,000,000. | 250,600 |
| BCS1L | GRACILE syndrome | NM_004328.4 | NM_004328.4:c.232A>G | GRACILE syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal/infantile. This disease is characterized by fetal growth restriction (GR), aminoaciduria (A), cholestasis (C), iron overload (I), lactacidosis (L) and early death (E). The birth incidence is 1:50,000 in Finland and the prevalence is <1:1,000,000. | 250,600 |
| BCS1L | Mitochondrial comlpex III deficiency, nuclear type 1 | NM_004328.4 | NM_004328.4:c.1057G>A, NM_004328.4:c.830G>A, NM_004328.4:c.133C>T, NM_004328.4:c.103G>C, NM_004328.4:c.696delT, NM_004328.4:c.148A>G, NM_004328.4:c.166C>T, NM_004328.4:c.550C>T, NM_004328.4:c.547C>T | Mitochondrial comlpex III deficiency, nuclear type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal and it is characterized by lactic acidosis, hypotonia, hypoglycemia, failure to thrive, encephalopathy, and delayed psychomotor development. | 250,600 |
| BEST1 | Bestrophinopathy | NM_004183.3 | NM_004183.3:c.934G>A, NM_004183.3:c.598C>T, NM_004183.3:c.752G>A, NM_004183.3:c.949G>A, NM_004183.3:c.521_522delTG | Bestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram. | 250,600 |
| BEST1 | Retinitis pigmentosa type 50 | NM_004183.3 | NM_004183.3:c.1383_1384insGCCTTGATGGA, NM_004183.3:c.1444delG, NM_004183.3:c.1491_1497dupCAAAGAC, NM_004183.3:c.1566_1576dupCTTGATGGAGC, NM_004183.3:c.341_342delTG, NM_004183.3:c.1308_1309insACCAAAG, NM_004183.3:c.1264delG, NM_004183.3:c.418C>G, NM_004183.3:c.614T>C, NM_004183.3:c.682G>A, NM_004183.3:c.344delG, NM_004183.3:c.524delG | Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 50 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q12.3. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000. | 250,600 |
| BEST1 | Vitelliform macular dystrophy type 2 | NM_004183.3 | NM_004183.3:c.122T>C, NM_004183.3:c.422G>A | Vitelliform macular dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q12.3. The age of onset is infancy or adolescence. This disease is characterized by normal vision at birth, then progresses through distinct stages that include an asymptomatic previtelliform phase (stage 1) followed by the formation of a yellow, egg yolk-like (vitelliform) lesion in the macula (stage 2). The contents become less homogenous and develop a "scrambled-egg" appearance (stage 2a). The lesion eventually develops a fluid, yellow-colored vitelline substance (pseudohypopyon or stage 3) and finally breaks down, leaving a scar that causes central visual acuity deterioration (20/200). This may be complicated by a subfoveal choroidal neovascular (CNV) membrane (rare in children). Anomalous color discrimination (mainly the protan axis) and metamorphopsia may be observed but patients retain normal peripheral vision and dark adaptation. Some affected individuals remain asymptomatic. The prevalence is 1/5,000 to 1/67,000. | 250,600 |
| BRCA2 | Fanconi anemia, complementation group D1 | NM_000059.3 | NM_000059.3:c.1514T>C, NM_000059.3:c.4648G>T, NM_000059.3:c.8415A>T, NM_000059.3:c.7544C>T, NM_000059.3:c.7994A>G, NM_000059.3:c.5574_5577delAATT, NM_000059.3:c.4889C>G, NM_000059.3:c.4936_4939delGAAA, NM_000059.3:c.5066_5067insA, NM_000059.3:c.6024dupG, NM_000059.3:c.6860delG, NM_000059.3:c.7235C>A, NM_000059.3:c.9382C>T, NM_000059.3:c.9900dupA, NM_000059.3:c.3847_3848delGT, NM_000059.3:c.5718_5719delCT, NM_000059.3:c.5837_5838delCAinsAG, NM_000059.3:c.6023_6024insG, NM_000059.3:c.8503T>C, NM_000059.3:c.6486_6489delACAA, NM_000059.3:c.657_658delTG, NM_000059.3:c.6997_6998insT | Fanconi anemia, complementation group D1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BRCA2 gene located on chromosomal region 13q12.3. The age of onset is infantile. This disease is characterized by physical abnormalities, bone marrow failure, and increased risk of malignancy. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| BRIP1 | Fanconi anemia, complementation group J | NM_032043.2 | NM_032043.2:c.2990_2993delCAAA, NM_032043.2:c.1045G>C, NM_032043.2:c.2237_2240delTCAA, NM_032043.2:c.3209C>A, NM_032043.2:c.502C>T, NM_032043.2:c.139C>G, NM_032043.2:c.1702_1703delAA, NM_032043.2:c.2392C>T | Fanconi anemia, complementation group J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BRIP1 gene located on chromosomal region 17q22.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:1,000,000- 9:1,000,000. | 250,600 |
| BSCL2 | Berardinelli-Seip congenital lipodystrophy | NM_032667.6 | NM_032667.6:c.634G>C, NM_032667.6:c.412C>T, NM_032667.6:c.782_783insG, NM_032667.6:c.823C>T, NM_032667.6:c.985C>T, NM_032667.6:c.672-3C>G, NM_032667.6:c.974_975insG, NM_032667.6:c.671+5G>A | Berardinelli-Seip congenital lipodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSCL2 gene located on chromosomal region 11q13. The age of onset is neonatal/infantile. This disease is characterized the association of lipoatrophy, hypertriglyceridemia, hepatomegaly and acromegaloid features. The prevalence is 1.27:100,000. | 600 |
| BSCL2 | Severe neurodegenerative syndrome with lipodystrophy | NM_032667.6 | NM_032667.6:c.793C>T | Severe neurodegenerative syndrome with lipodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSCL2 gene located on chromosomal region 11q13. The age of onset is neonatal/infantile. This disease is characterized by developmental regression of motor and cognitive skills in the first years of life, often leading to death in the first decade, hyperactive behavior, seizures, tremor and ataxic gait. Patients may show a mild or typical lipodystrophic appearance. The prevalence is 1.27:100,000. | 600 |
| BSND | Bartter syndrome type 4A | NM_057176.2 | NM_057176.2:c.1A>T, NM_057176.2:c.22C>T, NM_057176.2:c.3G>A, NM_057176.2:c.10G>T, NM_057176.2:c.23G>T, NM_057176.2:c.35T>C, NM_057176.2:c.23G>A, NM_057176.2:c.139G>A | Bartter syndrome type 4A with deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSND gene located on chromosomal region 1p32.3. The age of onset is neonatal/infantile. This disease is characterized by maternal polyhydramnios, premature delivery, polyuria, sensorineural deafness and is associated with hypokalemic alkalosis, increased levels of plasma renin and aldosterone, low blood pressure, and vascular resistance to angiotensin II. | 250,600 |
| BTD | Biotinidase deficiency | NM_000060.3 | NM_000060.3:c.1531C>G, NM_000060.3:c.1508_1512delGGATG, NM_000060.3:c.1339C>T, NM_000060.3:c.1352G>A, NM_000060.3:c.1489C>T, NM_000060.3:c.643C>T, NM_000060.3:c.664G>A, NM_000060.3:c.755A>G, NM_000060.3:c.1368A>C, NM_000060.3:c.933delT, NM_000060.3:c.1595C>T, NM_000060.3:c.1612C>T, NM_000060.3:c.757C>T, NM_000060.3:c.1106C>T, NM_000060.3:c.1321delG, NM_000060.3:c.794A>T, NM_000060.3:c.595G>A, NM_000060.3:c.629A>G, NM_000060.3:c.631C>T, NM_000060.3:c.235C>T, NM_000060.3:c.334G>C, NM_000060.3:c.511G>A, NM_000060.3:c.184G>A, NM_000060.3:c.557G>A, NM_000060.3:c.583A>G, NM_000060.3:c.968A>G, NM_000060.3:c.528G>T, NM_000060.3:c.443G>A | Biotinidase deficiency an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BTD gene located on chromosomal region 3p25. The age of onset is neonatal/infantile. This disease is characterized by seizures, breathing difficulties, hypotonia, skin rash, alopecia, hearing loss and delayed development. | 250,600 |
| BTK | Agammaglobulinemia, X-linked | NM_000061.2 | NM_000061.2:c.1275C>A, NM_000061.2:c.1506C>A, NM_000061.2:c.1125T>G, NM_000061.2:c.1223T>C, NM_000061.2:c.1288A>G, NM_000061.2:c.1082A>G, NM_000061.2:c.763C>T, NM_000061.2:c.1516T>C, NM_000061.2:c.718G>T, NM_000061.2:c.755G>A, NM_000061.2:c.1766A>G, NM_000061.2:c.1773C>A, NM_000061.2:c.1558C>T, NM_000061.2:c.1559G>A, NM_000061.2:c.1889T>A, NM_000061.2:c.1906G>T, NM_000061.2:c.338T>A, NM_000061.2:c.1820C>A, NM_000061.2:c.862C>T, NM_000061.2:c.919A>G, NM_000061.2:c.1838G>A, NM_000061.2:c.1001A>C | X-linked agammaglobulinemia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the BTK gene located on chromosomal region Xq21.33-q22. The age of onset is infantile. This disease is characterized by recurrent bacterial infections during infancy. The prevalence is 3:1,000,000-6:1,000,000 men. | 600 |
| C10orf2 | Infantile onset spinocerebellar ataxia | NM_021830.4 | NM_021830.4:c.1523A>G | La ataxia espinocerebelosa infantil sigue un patrón de herencia autosómico recesivo y está causada por variantes patogénicas en el gen C10orf2 localizado en la región cromosómica 10q24. La edad de aparición es neonatal/infantil con síntomas como inicio temprano ataxia, atetosis y reducción de los reflejos tendinosos. | 600 |
| C10orf2 | Mitochondrial DNA depletion syndrome, hepatocerebrorenal form | NM_021830.4 | NM_021830.4:c.1287C>T, NM_021830.4:c.952G>A, NM_021830.4:c.1370C>T, NM_021830.4:c.524_525insG | Mitochondrial DNA depletion syndrome, hepatocerebrorenal form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C10orf2 gene located on chromosomal region 10q24. The age of onset is neonatal/infantile. It is a severe disease associated with mitochondrial dysfunction. Some patients are affected by progressive atrophy of the cerebellum, brain stem, the spinal cord, and sensory axonal neuropathy. Clinical features include hypotonia, athetosis, ataxia, ophthalmoplegia, sensorineural hearing deficit, sensory axonal neuropathy, epileptic encephalopathy and female hypogonadism. In some individuals liver dysfunction and multi-organ failure is present. | 600 |
| C10orf2 | Sensory ataxic neuropathy - dysarthria - ophthalmoparesis | NM_021830.4 | NM_021830.4:c.955A>G | Sensory ataxic neuropathy - dysarthria - ophthalmoparesis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C10orf2 gene located on chromosomal region 10q24. This syndrome is characterised by adult-onset severe sensory ataxic neuropathy, dysarthria and chronic progressive external ophthalmoplegia. The prevalence is unknown. Other common features include progressive gait unsteadiness, absent deep tendon reflexes, the presence of Romberg's sign, a decreased sense of vibration and proprioception and detection of red ragged fibres on muscle biopsy. | 600 |
| C3 | Atypical hemolytic-uremic syndrome with C3 anomaly | NM_000064.2 | NM_000064.2:c.2562C>G | Atypical hemolytic-uremic syndrome with C3 anomaly follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C3 gene located on chromosomal region 19p13.3-p13.2. An atypical form of hemolytic uremic syndrome. It is a complex genetic disease characterized by microangiopathic hemolytic anemia, thrombocytopenia, renal failure and absence of episodes of enterocolitis and diarrhea. In contrast to typical hemolytic uremic syndrome, atypical forms have a poorer prognosis, with higher death rates and frequent progression to end-stage renal disease. The prevalence is <1:1.000.000. | 600 |
| C3 | C3 deficiency | NM_000064.2 | NM_000064.2:c.2354+1G>A, NM_000064.2:c.4851-1G>A, NM_000064.2:c.1119+1G>T, NM_000064.2:c.3116dupT, NM_000064.2:c.3627_3628insGGGGCCC, NM_000064.2:c.1004-2A>T | C3 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C3 gene located on chromosomal region 19p13.3-p13.2. The age of onset is infantile. It is a rare defect of the complement classical pathway. Patients develop recurrent, severe, pyogenic infections because of ineffective opsonization of pathogens. Some patients may also develop autoimmune disorders, such as arthralgia and vasculitic rashes, lupus-like syndrome and membranoproliferative glomerulonephritis. The prevalence is <1:1.000.000. | 600 |
| CA2 | Osteopetrosis, autosomal recessive, type 3 | NM_000067.2 | NM_000067.2:c.663+2T>C, NM_000067.2:c.319C>T, NM_000067.2:c.120T>G | Osteopetrosis, autosomal recessive, type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CA2 gene located on chromosomal region 8q22. The age of onset is neonatal/infantile. This disease is characterized by osteopetrosis, renal tubular acidosis, and neurological disorders related to cerebral calcifications. The prevalence is <1:1.000.000. | 600 |
| CAPN3 | Limb-girdle muscular dystrophy type 2A | NM_000070.2 | NM_000070.2:c.1838delA, NM_000070.2:c.2120A>G, NM_000070.2:c.1795_1796insA, NM_000070.2:c.1469G>A, NM_000070.2:c.1599_1602delGAGC, NM_000070.2:c.1715G>A, NM_000070.2:c.1743_1745+1delTGAG, NM_000070.2:c.257C>T, NM_000070.2:c.328C>T, NM_000070.2:c.549delA, NM_000070.2:c.2212C>T, NM_000070.2:c.223dupT, NM_000070.2:c.2243G>A, NM_000070.2:c.2251_2254dupGTCA, NM_000070.2:c.2257G>A, NM_000070.2:c.2306G>A, NM_000070.2:c.2361_2363delAGinsTCATCT, NM_000070.2:c.2361_2364delAGinsTCATCT, NM_000070.2:c.2362_2363delAGinsTCATCT, NM_000070.2:c.246G>A, NM_000070.2:c.676G>A, NM_000070.2:c.551C>T, NM_000070.2:c.580delT, NM_000070.2:c.133G>A, NM_000070.2:c.550delA, NM_000070.2:c.1468C>T, NM_000070.2:c.956C>T, NM_000070.2:c.1322delG, NM_000070.2:c.1466G>A, NM_000070.2:c.662G>T, NM_000070.2:c.855_864dupGTTGATTGCA, NM_000070.2:c.1610A>G, NM_000070.2:c.598_612delTTCTGGAGTGCTCTG | Limb-girdle muscular dystrophy type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CAPN3 gene located on chromosomal region 15q15.1. The age of onset is variable. This disease is characterized by symmetrical and selective atrophy and weakness of proximal limb and girdle muscles. The prevalence is 1:100,000- 9:100,000. | 250,600 |
| CBS | Homocystinuria | NM_000071.2 | NM_000071.2:c.1150A>G, NM_000071.2:c.1058C>T, NM_000071.2:c.1136G>A, NM_000071.2:c.341C>T, NM_000071.2:c.1006C>T, NM_000071.2:c.325T>C, NM_000071.2:c.1316G>A, NM_000071.2:c.374G>A, NM_000071.2:c.1265C>T, NM_000071.2:c.1280C>T, NM_000071.2:c.146C>T, NM_000071.2:c.1471C>T, NM_000071.2:c.1616T>C, NM_000071.2:c.162G>A, NM_000071.2:c.833T>C, NM_000071.2:c.904G>A, NM_000071.2:c.919G>A, NM_000071.2:c.393G>C, NM_000071.2:c.415G>A, NM_000071.2:c.430G>A, NM_000071.2:c.434C>T, NM_000071.2:c.502G>A, NM_000071.2:c.526G>T, NM_000071.2:c.572C>T, NM_000071.2:c.676G>A, NM_000071.2:c.689delT, NM_000071.2:c.797G>A, NM_000071.2:c.959T>C, NM_000071.2:c.969G>A, NM_000071.2:c.992C>A, NM_000071.2:c.1330G>A, NM_000071.2:c.1379C>T, NM_000071.2:c.1397C>T, NM_000071.2:c.304A>C | Homocystinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CBS gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by the multiple involvement of the eye, skeleton, central nervous system and vascular system. The prevalence is 1:200,000-1:335,000. | 250,600 |
| CC2D2A | Joubert syndrome type 9 | NM_001080522.2 | NM_001080522.2:c.4179delG, NM_001080522.2:c.3594+1G>A, NM_001080522.2:c.3289delG, NM_001080522.2:c.4582C>T, NM_001080522.2:c.4667A>T, NM_001080522.2:c.2848C>T, NM_001080522.2:c.3364C>T, NM_001080522.2:c.4333C>T, NM_001080522.2:c.4181delG | Joubert syndrome type 9 defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized neonatal hypotonia, developmental delay, intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia, primary position nystagmus and congenital hepatic fibrosis. | 250,600 |
| CC2D2A | Meckel syndrome type 6 | NM_001080522.2 | NM_001080522.2:c.3145C>T, NM_001080522.2:c.2486+1G>C | Meckel syndrome type 6 with hepatic defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized by a combination of renal cysts, developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and polydactyly. | 250,600 |
| CD2AP | Focal segmental glomerulosclerosis type 3 | NM_012120.2 | NM_012120.2:c.730-1delGinsCT, NM_012120.2:c.1575_1577delAGA, NM_012120.2:c.1488G>A | Focal segmental glomerulosclerosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CD2AP gene located on chromosomal region 6p12. The age of onset is variable. A renal pathology defined by the presence of segmental sclerosis in glomeruli and resulting in proteinuria, reduced glomerular filtration rate and progressive decline in renal function. Renal insufficiency often progresses to end-stage renal disease, a highly morbid state requiring either dialysis therapy or kidney transplantation. | 600 |
| CD40LG | Hyper IgM syndrome, X-linked | NM_000074.2 | NM_000074.2:c.386A>G, NM_000074.2:c.368C>A, NM_000074.2:c.384T>A, NM_000074.2:c.632C>A, NM_000074.2:c.107T>G | X-linked hyper-IgM syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the CD40LG gene located on chromosomal region Xq26. The age of onset is neonatal/infantile. This disease is characterized by lower-respiratory tract bacterial infections, opportunistic infections, recurrent or protracted diarrhea associated with failure to thrive, neutropenia, thrombocytopenia and anemia. The prevalence is 2:1,000,000 male newborns. | 600 |
| CDH23 | Deafness type 12, autosomal recessive | NM_022124.5 | NM_022124.5:c.6442G>A, NM_022124.5:c.5663T>C, NM_022124.5:c.9565C>T, NM_022124.5:c.7823G>A, NM_022124.5:c.902G>A | Non-syndromic autosomal recessive deafness type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. | 250,600 |
| CDH23 | Usher syndrome type 1D | NM_022124.5 | NM_022124.5:c.288+1G>A, NM_022124.5:c.193delC, NM_022124.5:c.6050-9G>A, NM_022124.5:c.3141C>A, NM_022124.5:c.146-2A>G, NM_022124.5:c.4504C>T, NM_022124.5:c.3516_3519delATCC, NM_022124.5:c.3579+2T>C, NM_022124.5:c.3293A>G, NM_022124.5:c.9319+1_9319+4delGTAA, NM_022124.5:c.5237G>A, NM_022124.5:c.1858+2T>G, NM_022124.5:c.6392delC, NM_022124.5:c.7660G>A | Usher syndrome type 1D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by sensorineural deafness, retinitis pigmentosa and progressive vision loss. | 250,600 |
| CDH3 | Ectodermal dysplasia - ectrodactyly - macular dystrophy | NM_001793.4 | NM_001793.4:c.455_456insC, NM_001793.4:c.981delG, NM_001793.4:c.1508G>A, NM_001793.4:c.965A>T, NM_001793.4:c.830delG, NM_001793.4:c.965A>G | Ectodermal dysplasia - ectrodactyly - macular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH3 gene located on chromosomal region 16q22.1. The age of onset is neonatal/infantile. This disease is characterized by the association of ectodermal dysplasia, ectrodactyly, and macular dystrophy. The prevalence is <1:1,000,000. | 600 |
| CDHR1 | Retinitis pigmentosa type 65 | NM_033100.3 | NM_033100.3:c.1485+2T>C, NM_033100.3:c.1463delG, NM_033100.3:c.1110delC, NM_033100.3:c.338delG, NM_033100.3:c.524dupA, NM_033100.3:c.1485+2T>G, NM_033100.3:c.1112delC, NM_033100.3:c.640delG | Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 65 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDHR1 gene located on chromosomal region 10q23.1. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000. | 250,600 |
| CDK5RAP2 | Microcephaly, primary, type 3, autosomal recessive | NM_018249.5 | NM_018249.5:c.4661_4662insTATT, NM_018249.5:c.246T>A, NM_018249.5:c.4546G>T, NM_018249.5:c.127+1G>C, NM_018249.5:c.4672C>T, NM_018249.5:c.524_528delAGGCA, NM_018249.5:c.700G>T | Primary autosomal recessive microcephaly type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDK5RAP2 gene located on chromosomal region 9q33.2. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. | 600 |
| CENPJ | Microcephaly primary, type 6, autosomal recessive | NM_018451.4 | NM_018451.4:c.3243_3246delTCAG, NM_018451.4:c.2614delT, NM_018451.4:c.3415G>T, NM_018451.4:c.3653C>T, NM_018451.4:c.2462C>T, NM_018451.4:c.3699_3702dupAATA, NM_018451.4:c.3568_3571dupGTCA, NM_018451.4:c.3843_3844insTA, NM_018451.4:c.757_760delGTCT, NM_018451.4:c.1952_1953insAGTG, NM_018451.4:c.3704A>T, NM_018451.4:c.232_236delCAGAA, NM_018451.4:c.2460_2463delGACG, NM_018451.4:c.2968_2972delAAAAA, NM_018451.4:c.40C>T, NM_018451.4:c.289dupA | Primary autosomal recessive microcephaly type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CENPJ gene located on chromosomal region 13q12.12. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. | 250,600 |
| CEP152 | Microcephaly, primary, type 9, autosomal recessive | NM_014985.3 | NM_014985.3:c.794A>C, NM_014985.3:c.749_750delGA | Primary autosomal recessive microcephaly type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP152 gene located on chromosomal region 15q21.1. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. | 600 |
| CEP152 | Seckel syndrome type 5 | NM_014985.3 | NM_014985.3:c.2034T>G, NM_014985.3:c.1578-1G>A | Seckel syndrome type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP152 gene located on chromosomal region 15q21.1. The age of onset is neonatal/infantile. This disease is characterized by proportionate dwarfism of prenatal onset associated with low birth weight, growth retardation, severe microcephaly with a bird-headed like appearance, and mental retardation. | 600 |
| CEP290 | Joubert syndrome, Senior-Loken type | NM_025114.3 | NM_025114.3:c.5611_5614delCAAA, NM_025114.3:c.164_167delCTCA | Joubert syndrome, Senior-Loken type syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infantile. This disease is characterized by symptoms of nephronophthisis such as polyuria, polydipsia, secondary eneuresis and anemia. The progression of the disease can lead to acute or chronic renal insufficiency and finally to end-stage kidney disease. Ocular features include congenital or early-onset severe visual loss, due to retinal dystrophy. In rare occasions, other additional clinical signs may be observed like liver fibrosis, obesity and neurologic disorders.. The prevalence is <1:1,000,000. | 250,600 |
| CEP290 | Joubert syndrome type 5 | NM_025114.3 | NM_025114.3:c.4656delA, NM_025114.3:c.21G>T, NM_025114.3:c.5668G>T | Joubert syndrome with oculorenal defect 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infantile. This disease is characterized by neonatal hypotonia, developmental delay, intellectrual disability, ataxia, abnormal eye movements including oculomotor apraxia, primary position nystagmus and renal and ocular disease. | 250,600 |
| CEP290 | Leber congenital amaurosis type 10 | NM_025114.3 | NM_025114.3:c.7341_7342insA, NM_025114.3:c.4705-1G>T, NM_025114.3:c.4723A>T, NM_025114.3:c.4962_4963delAA, NM_025114.3:c.4916C>A, NM_025114.3:c.6624delG, NM_025114.3:c.6645+1G>A, NM_025114.3:c.7324G>T, NM_025114.3:c.6798G>A, NM_025114.3:c.7394_7395delAG, NM_025114.3:c.1681C>T, NM_025114.3:c.7341delA, NM_025114.3:c.6448_6455delCAGTTGAA, NM_025114.3:c.1665_1666delAA, NM_025114.3:c.384_387delTAGA, NM_025114.3:c.2249T>G, NM_025114.3:c.3185delT, NM_025114.3:c.4393C>T, NM_025114.3:c.1501G>T | Leber congenital amaurosis type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infancy/neonatal. This disease is characterized by retinal dystrophy defined by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. | 250,600 |
| CEP290 | Meckel syndrome type 4 | NM_025114.3 | NM_025114.3:c.613C>T | Meckel syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is neonatal. This disease is characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically occipital encephalocele), hepatic ductal dysplasia and cysts, and postaxial polydactyly. The prevalence is <1 / 1,000,000. | 250,600 |
| CERKL | Retinitis pigmentosa tipo 26 | NM_201548.4 | NM_201548.4:c.1012C>T, NM_201548.4:c.1090C>T, NM_201548.4:c.312delA, NM_201548.4:c.715C>T, NM_201548.4:c.769C>T, NM_201548.4:c.780delT, NM_201548.4:c.847C>T, NM_201548.4:c.1553_1569dupTTATCAGTCTTTATGGA | Retinitis pigmentosa 26 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CERKL gene located on chromosomal region 2q31.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000. | 250,600 |
| CFH | Complement factor H deficiency | NM_000186.3 | NM_000186.3:c.3628C>T, NM_000186.3:c.2876G>A, NM_000186.3:c.380G>T, NM_000186.3:c.481G>T, NM_000186.3:c.1606T>C | Immunodeficiency with factor H anomaly follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFH gene located on chromosomal region 1q32. This disease is characterized by recurrent bacterial infections and renal failure. | 250,600 |
| CFTR | Cystic fibrosis | NM_000492.3 | NM_000492.3:c.1327_1330dupGATA, NM_000492.3:c.1210-7_1210-6delTT, NM_000492.3:c.125C>T, NM_000492.3:c.1301_1307delCACTTCT, NM_000492.3:c.1397C>A, NM_000492.3:c.1340delA, NM_000492.3:c.1364C>A, NM_000492.3:c.1393-1G>A, NM_000492.3:c.1438G>T, NM_000492.3:c.1466C>A, NM_000492.3:c.1475C>T, NM_000492.3:c.1477C>T, NM_000492.3:c.1516A>G, NM_000492.3:c.1519_1521delATC, NM_000492.3:c.1521_1523delCTT, NM_000492.3:c.1545_1546delTA, NM_000492.3:c.1624G>T, NM_000492.3:c.1692delA, NM_000492.3:c.1706A>G, NM_000492.3:c.1721C>A, NM_000492.3:c.178G>T, NM_000492.3:c.1970delG, NM_000492.3:c.200C>T, NM_000492.3:c.2012delT, NM_000492.3:c.2051_2052delAAinsG, NM_000492.3:c.2052_2053insA, NM_000492.3:c.2052delA, NM_000492.3:c.1000C>T, NM_000492.3:c.1007T>A, NM_000492.3:c.1013C>T, NM_000492.3:c.1021T>C, NM_000492.3:c.1022_1023insTC, NM_000492.3:c.1040G>A, NM_000492.3:c.1040G>C, NM_000492.3:c.1055G>A, NM_000492.3:c.1081delT, NM_000492.3:c.115C>T, NM_000492.3:c.2538G>A, NM_000492.3:c.254G>A, NM_000492.3:c.2551C>T, NM_000492.3:c.2583delT, NM_000492.3:c.262_263delTT, NM_000492.3:c.2657+5G>A, NM_000492.3:c.2668C>T, NM_000492.3:c.273+1G>A, NM_000492.3:c.2737_2738insG, NM_000492.3:c.2739T>A, NM_000492.3:c.274-1G>A, NM_000492.3:c.274G>A, NM_000492.3:c.274G>T, NM_000492.3:c.2780T>C, NM_000492.3:c.2834C>T, NM_000492.3:c.2855T>C, NM_000492.3:c.2869_2870insG, NM_000492.3:c.2875delG, NM_000492.3:c.2908G>C, NM_000492.3:c.292C>T, NM_000492.3:c.2939T>A, NM_000492.3:c.2989-1G>A, NM_000492.3:c.3067_3072delATAGTG, NM_000492.3:c.3140-26A>G, NM_000492.3:c.3194T>C, NM_000492.3:c.3196C>T, NM_000492.3:c.3197G>A, NM_000492.3:c.3230T>C, NM_000492.3:c.325_327delTATinsG, NM_000492.3:c.3266G>A, NM_000492.3:c.3276C>A, NM_000492.3:c.3276C>G, NM_000492.3:c.328G>C, NM_000492.3:c.328G>T, NM_000492.3:c.3302T>A, NM_000492.3:c.3310G>T, NM_000492.3:c.349C>T, NM_000492.3:c.350G>T, NM_000492.3:c.3528delC, NM_000492.3:c.3533_3536delCAAC, NM_000492.3:c.3587C>G, NM_000492.3:c.358G>A, NM_000492.3:c.3611G>A, NM_000492.3:c.3612G>A, NM_000492.3:c.3659delC, NM_000492.3:c.366T>A, NM_000492.3:c.3731G>A, NM_000492.3:c.3744delA, NM_000492.3:c.3752G>A, NM_000492.3:c.3761T>G, NM_000492.3:c.3764C>A, NM_000492.3:c.3773_3774insT, NM_000492.3:c.3846G>A, NM_000492.3:c.3909C>G, NM_000492.3:c.3937C>T, NM_000492.3:c.4056G>T, NM_000492.3:c.4077_4080delinsAA, NM_000492.3:c.4077_4080delTGTTinsAA, NM_000492.3:c.4251delA, NM_000492.3:c.4333G>A, NM_000492.3:c.4426C>T, NM_000492.3:c.442delA, NM_000492.3:c.445G>A, NM_000492.3:c.445G>T, NM_000492.3:c.446G>T, NM_000492.3:c.531delT, NM_000492.3:c.532G>A, NM_000492.3:c.571T>G, NM_000492.3:c.577G>T, NM_000492.3:c.579+1G>T, NM_000492.3:c.579+3A>G, NM_000492.3:c.579+5G>A, NM_000492.3:c.592G>A, NM_000492.3:c.595C>T, NM_000492.3:c.613C>T, NM_000492.3:c.617T>G, NM_000492.3:c.650A>G, NM_000492.3:c.658C>T, NM_000492.3:c.708delT, NM_000492.3:c.722_743delGGAGAATGATGATGAAGTACAG, NM_000492.3:c.803delA, NM_000492.3:c.935_937delTCT, NM_000492.3:c.988G>T, NM_000492.3:c.1046C>T, NM_000492.3:c.14C>T, NM_000492.3:c.1558G>A, NM_000492.3:c.1585-1G>A, NM_000492.3:c.1684G>C, NM_000492.3:c.1766+1G>A, NM_000492.3:c.1397C>G, NM_000492.3:c.1399C>T, NM_000492.3:c.1400T>C, NM_000492.3:c.3380G>A, NM_000492.3:c.3409A>G, NM_000492.3:c.3868C>A, NM_000492.3:c.489+1G>T, NM_000492.3:c.2537G>A, NM_000492.3:c.2125C>T, NM_000492.3:c.2128A>T, NM_000492.3:c.2175_2176insA, NM_000492.3:c.2052dupA, NM_000492.3:c.2195T>G, NM_000492.3:c.2215delG, NM_000492.3:c.223C>T, NM_000492.3:c.2175dupA, NM_000492.3:c.221G>A, NM_000492.3:c.2930C>T, NM_000492.3:c.3205G>A, NM_000492.3:c.2249C>T | Cystic fibrosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFTR gene located on chromosomal region 7q31.2. The age of onset of severe form is neonatal or infantile but there are also variants associated with moderate clinical or late onset. This disease is characterized by the production of sweat with a high salt content, mucus secretions with an abnormal viscosity, chronic bronchitis, pancreatic insufficiency, adolescent diabetes and, more rarely, stercoral obstruction and cirrhosis. Male sterility is a constant feature. Late-onset forms, which are usually only mild or monosymptomatic. The prevalence is 1:10,000-9:10,000. | 250,600 |
| CHST6 | Macular corneal dystrophy | NM_021615.4 | NM_021615.4:c.820G>T, NM_021615.4:c.853delC, NM_021615.4:c.993G>T, NM_021615.4:c.327_328delCT, NM_021615.4:c.392C>A | Macular corneal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CHST6 gene located on chromosomal region 16q22. The age of onset is variable. This disease is characterized by bilateral ill-defined cloudy regions within a hazy stroma, and eventually severe visual impairment. The prevalence is 1:100,000-9:100,000. | 250,600 |
| CLCN1 | Myotonia congenita, autosomal recessive | NM_000083.2 | NM_000083.2:c.1453A>G, NM_000083.2:c.409T>G, NM_000083.2:c.568G>A, NM_000083.2:c.899G>A, NM_000083.2:c.1169G>A, NM_000083.2:c.1238T>G, NM_000083.2:c.871G>A, NM_000083.2:c.180+3A>T, NM_000083.2:c.225dupC, NM_000083.2:c.501C>G, NM_000083.2:c.2680C>T | Myotonia congenita (Becker disease) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN1 gene located on chromosomal region 7q35. The age of onset is neonatal/infantile. This disease is characterized by slow muscle relaxation, that it is relieved with exercise, associated with hyperexcitation of the muscle fibres. The prevalence is 1:100,000. | 250,600 |
| CLCN7 | Osteopetrosis type 4, autosomal recessive | NM_001287.5 | NM_001287.5:c.622C>T, NM_001287.5:c.781A>T | Osteopetrosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN7 gene located on chromosomal region 16p13. The age of onset is neonatal/infantile. This disease is characterized bone marrow failure, fractures and visual impairment. The incidence is 1:200,000 live births and the prevalence is 1:100,000. | 600 |
| CLDN14 | Deafness type 29, autosomal recessive | NM_144492.2 | NM_144492.2:c.254T>A, NM_144492.2:c.301G>A, NM_144492.2:c.398delT | Deafness type 29, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN14 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. | 600 |
| CLDN19 | Hypomagnesemia type 5, renal failure with severe ocular abnormalities | NM_148960.2 | NM_148960.2:c.269T>C, NM_148960.2:c.425_437delCCCTGGTGACCCA, NM_148960.2:c.59G>A, NM_148960.2:c.169C>G, NM_148960.2:c.599G>A | Hypomagnesemia type 5, renal failure with severe ocular abnormalities follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN19 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by excessive magnesium and calcium renal wasting, bilateral nephrocalcinosis, progressive renal failure and severe ocular abnormalities. The prevalence is <1:1,000,000. | 250,600 |
| CLN3 | Ceroid-lipofuscinoses neuronal type 3 | NM_001042432.1 | NM_001042432.1:c.883G>A, NM_001042432.1:c.597C>A, NM_001042432.1:c.622_623insT, NM_001042432.1:c.1272delG, NM_001042432.1:c.1210C>A | Juvenile neuronal ceroid lipofuscinosis 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN3 gene located on chromosomal region 16p12.1. The age of onset is infantile. This disease is characterized by onset at early school age with vision loss due to retinopathy, seizures and the decline of mental and motor capacities. The annual birth incidence is 1:217,000-1:450,000 in Sweden and 1:143,000 in Germany, and the prevalence is 1.5:1,000,000-9:1,000,000. | 600 |
| CLN5 | Neuronal ceroid lipofuscinosis type 5 | NM_006493.2 | NM_006493.2:c.619T>C, NM_006493.2:c.335G>A, NM_006493.2:c.377G>A, NM_006493.2:c.620G>C, NM_006493.2:c.669dupC, NM_006493.2:c.335G>C, NM_006493.2:c.565C>T, NM_006493.2:c.575A>G, NM_006493.2:c.593T>C, NM_006493.2:c.595C>T, NM_006493.2:c.613C>T, NM_006493.2:c.919delA, NM_006493.2:c.924_925delAT, NM_006493.2:c.955_970delGGAAATGAAACATCTG, NM_006493.2:c.835G>A, NM_006493.2:c.526dupA, NM_006493.2:c.1026C>A, NM_006493.2:c.524T>G, NM_006493.2:c.433C>T | Neuronal ceroid lipofuscinosis type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN5 gene located on chromosomal region 3q21.1-q32. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy and vision loss through retinal degeneration. The prevalence is <1:1,000,000. | 600 |
| CLN6 | Ceroid lipofuscinosis, neuronal, type 6 | NM_017882.2 | NM_017882.2:c.200T>C, NM_017882.2:c.214G>C, NM_017882.2:c.139C>T, NM_017882.2:c.307C>T, NM_017882.2:c.214G>T, NM_017882.2:c.663C>G | Late infantile neuronal ceroid lipofuscinosis 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN6 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy and vision loss through retinal degeneration. The prevalence is <1:1,000,000. | 600 |
| CLN8 | Ceroid lipofuscinosis, neuronal, type 8 | NM_018941.3 | NM_018941.3:c.88delG, NM_018941.3:c.789G>C, NM_018941.3:c.610C>T, NM_018941.3:c.88G>C | Late infantile neuronal ceroid lipofuscinosis 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN8 gene located on chromosomal region 8p23.3. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy, and vision loss through retinal degeneration. The prevalence is <1:1,000,000. | 600 |
| CLRN1 | Retinitis pigmentosa type 61 | NM_174878.2 | NM_174878.2:c.92C>T | Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 61 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1gene located on chromosomal region 3q25.1. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000. | 250,600 |
| CLRN1 | Usher syndrome type 3A | NM_174878.2 | NM_174878.2:c.591_592insT, NM_174878.2:c.630_631insT, NM_174878.2:c.118T>G, NM_174878.2:c.433+1061A>T, NM_174878.2:c.189C>A, NM_174878.2:c.144T>G | Usher syndrome type 3A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1 gene located on chromosomal region 3q25.1. The age of onset is neonatal/infantile. This disease is characterized by the association of sensorineural deafness with retinitis pigmentosa and progressive vision loss. The prevalence is 1:1.000.000- 9/1.000.000. | 250,600 |
| CNGA1 | Retinitis pigmentosa type 49 | NM_000087.3 | NM_000087.3:c.1747C>T, NM_000087.3:c.1540C>T, NM_000087.3:c.2071T>C, NM_000087.3:c.1927C>T, NM_000087.3:c.1271G>A, NM_000087.3:c.1001G>A, NM_000087.3:c.959C>T, NM_000087.3:c.97_98insA, NM_000087.3:c.449+2T>C, NM_000087.3:c.1972delA, NM_000087.3:c.238G>T, NM_000087.3:c.794G>A, NM_000087.3:c.238G>A | Retinitis pigmentosa 49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGA1 gene located on chromosomal region 4p12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000. | 250,600 |
| CNGB1 | Retinitis pigmentosa tipo 45 | NM_001297.4 | NM_001297.4:c.3150delG, NM_001297.4:c.2762_2765delACGA, NM_001297.4:c.2957A>T, NM_001297.4:c.413-1G>A, NM_001297.4:c.218-2A>G, NM_001297.4:c.2492+2T>G, NM_001297.4:c.3462+1G>A, NM_001297.4:c.2653delG, NM_001297.4:c.3425delT, NM_001297.4:c.1122-2A>T, NM_001297.4:c.1958-1G>A, NM_001297.4:c.952C>T | Retinitis pigmentosa 45 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB1 gene located on chromosomal region 16q13. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000 to 5:10,000. | 250,600 |
| CNGB3 | Achromatopsia type 3 | NM_019098.4 | NM_019098.4:c.2011G>T, NM_019098.4:c.1063C>T, NM_019098.4:c.1208G>A, NM_019098.4:c.1672G>T, NM_019098.4:c.819_826delCAGACTCC, NM_019098.4:c.1148delC, NM_019098.4:c.886_890delACTTC, NM_019098.4:c.2048_2049delCA, NM_019098.4:c.446_447insT, NM_019098.4:c.893_897delCAAAA, NM_019098.4:c.887_896delCTTCTACAAA | Achromatopsia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is neonatal/Infantile. This disease is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, and reduced or complete loss of color discrimination. Most individuals have complete form, with total lack of function in all three types of cones. Rarely, individuals have incomplete form, with similar, but generally less severe symptoms. The prevalence is 1/30,000-1/50,000. | 250,600 |
| CNGB3 | Macular degeneration, juvenile | NM_019098.4 | NM_019098.4:c.1405T>G | Juvenile macular degeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is infancy or adolescence. This disease is characterized by blurred or distorted central vision with dark areas. Normally, side vision is not affected, but the perception of color can vary during the later stages of the disease. | 250,600 |
| COL11A1 | Stickler syndrome type 2 | NM_001854.3 | NM_001854.3:c.1750dupG, NM_001854.3:c.2350G>C, NM_001854.3:c.4606C>G, NM_001854.3:c.4642C>G, NM_001854.3:c.3709-1G>A | Stickler syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL11A1 gene located on chromosomal region 1p21. The age of onset is neonatal/infantile. Autosomal recessive Stickler syndrome is a rare type of Stickler syndrome manifesting with opthalmological (myopia, retinal detachment and cataracts), orofacial (micrognathia, midface hypoplasia and cleft palate) auditory (sensorineural hearing loss) and articular (epiphyseal dysplasia) symptoms. | 600 |
| COL17A1 | Epidermolysis bullosa, junctional, non-Herlitz type | NM_000494.3 | NM_000494.3:c.1898G>A, NM_000494.3:c.3827_3828insC, NM_000494.3:c.2228-3_2235delCAGGTCCTGCTinsTTG, NM_000494.3:c.1706delC, NM_000494.3:c.2336-2A>G, NM_000494.3:c.3897_3900delATCT, NM_000494.3:c.3908G>A, NM_000494.3:c.2336-1G>T, NM_000494.3:c.2965delA, NM_000494.3:c.3043C>T, NM_000494.3:c.3067C>T, NM_000494.3:c.3277+1G>A, NM_000494.3:c.3676C>T, NM_000494.3:c.4319_4320insC, NM_000494.3:c.433C>T, NM_000494.3:c.520_521delAG, NM_000494.3:c.4003_4004delGG, NM_000494.3:c.2551+1G>T, NM_000494.3:c.3800delC, NM_000494.3:c.2564T>G, NM_000494.3:c.2430_2431insCCGA, NM_000494.3:c.2383C>T, NM_000494.3:c.2944_2947+1delGAAGG | Epidermolysis bullosa, junctional, non-Herlitz type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL17A1 gene located on chromosomal region 10q24.3. The age of onset is neonatal/infantile. This disease is characterized by a generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement. | 250,600 |
| COL18A1 | Knobloch syndrome type 1 | NM_030582.3 | NM_030582.3:c.3367_3379delCCCCCAGGCCCAC, NM_030582.3:c.3493_3501delGGCCCCCCA, NM_030582.3:c.2797C>T, NM_030582.3:c.995_996insGACGTGAAAGAGGGG, NM_030582.3:c.3502_3511delGGCCCCCCAG, NM_030582.3:c.3618_3618+1delGG, NM_030582.3:c.994_995insGGACGTGAAAGAGGG, NM_030582.3:c.3517_3518delCC, NM_030582.3:c.1535_1536insGACGTGAAAGAGGGG, NM_030582.3:c.2589_2590delAG, NM_030582.3:c.4054_4055delCT, NM_030582.3:c.4463_4464insG | Knobloch syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL18A1 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by vitreoretinal and macular degeneration, and occipital encephalocele. The prevalence is <1:1,000,000. | 250,600 |
| COL1A2 | Ehlers-Danlos syndrome, cardiac valvular type | NM_000089.3 | NM_000089.3:c.3601G>T, NM_000089.3:c.1404+1G>A, NM_000089.3:c.559G>C, NM_000089.3:c.133-1G>A, NM_000089.3:c.1404+1G>C, NM_000089.3:c.240_247delGTATGATG, NM_000089.3:c.293_294insC | Ehlers-Danlos syndrome, cardiac valvular type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL1A2 gene located on chromosomal region 7q22.1. The age of onset is neonatal/infantile. This disease is characterized by joint hypermobility, skin hyperextensibility and cardiac valvular defects. The prevalence is 6/100,000 to 7/100,000. | 600 |
| COL2A1 | Otospondylomegaepiphyseal dysplasia | NM_001844.4 | NM_001844.4:c.1052delG, NM_001844.4:c.3106C>T | Otospondylomegaepiphyseal dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL2A1 gene located on chromosomal region 12q13.11. The age of onset is neonatal/infantile. This disease is characterized by sensorineural hearing loss, enlarged epiphyses, skeletal dysplasia with disproportionately short limbs, vertebral body anomalies and a characteristic facies. The prevalence is 1:7,500-1:9,000. | 600 |
| COL4A3 | Alport syndrome 3B, autosomal recessive | NM_000091.4 | NM_000091.4:c.345delG, NM_000091.4:c.346C>A, NM_000091.4:c.898G>A, NM_000091.4:c.4421T>C, NM_000091.4:c.2110delC, NM_000091.4:c.343delG, NM_000091.4:c.4420_4424delCTTTT, NM_000091.4:c.5002_*6delAAAAGACACTGAAGCTAA, NM_000091.4:c.2083G>A, NM_000091.4:c.2954G>T, NM_000091.4:c.4484A>G, NM_000091.4:c.4571C>G, NM_000091.4:c.4441C>T | Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn. | 250,600 |
| COL4A4 | Alport syndrome, autosomal recessive | NM_000092.4 | NM_000092.4:c.3713C>A, NM_000092.4:c.4129C>T, NM_000092.4:c.4923C>A, NM_000092.4:c.3601G>A, NM_000092.4:c.2312delG, NM_000092.4:c.71+1G>A | Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn. | 250,600 |
| COL7A1 | Epidermolysis bullosa dystrophica, Hallopeau-Siemens type | NM_000094.3 | NM_000094.3:c.4039G>C, NM_000094.3:c.425A>G, NM_000094.3:c.336C>G, NM_000094.3:c.3809C>T, NM_000094.3:c.4119+1G>T, NM_000094.3:c.6205C>T, NM_000094.3:c.6527_6528insC, NM_000094.3:c.6573+1G>T, NM_000094.3:c.6187C>T, NM_000094.3:c.6752G>A, NM_000094.3:c.6859G>A, NM_000094.3:c.6946G>A, NM_000094.3:c.6670G>T, NM_000094.3:c.1907G>T, NM_000094.3:c.2471_2472insG, NM_000094.3:c.7440+4delC, NM_000094.3:c.7912G>T, NM_000094.3:c.7930-1G>C, NM_000094.3:c.7957G>A, NM_000094.3:c.8245G>A, NM_000094.3:c.8371C>T, NM_000094.3:c.8393T>A, NM_000094.3:c.8440C>T, NM_000094.3:c.8479C>T, NM_000094.3:c.8524_8527+10delGAAGGTGAGGACAG, NM_000094.3:c.887delG, NM_000094.3:c.933C>A, NM_000094.3:c.238G>T, NM_000094.3:c.3831+1G>T, NM_000094.3:c.4373C>T, NM_000094.3:c.6091G>A, NM_000094.3:c.4888C>T, NM_000094.3:c.5052+1G>A, NM_000094.3:c.5096C>T, NM_000094.3:c.4783G>C, NM_000094.3:c.5443G>C, NM_000094.3:c.5532+1G>A, NM_000094.3:c.5821-1G>A, NM_000094.3:c.5287C>T, NM_000094.3:c.706C>T, NM_000094.3:c.7345-1G>A, NM_000094.3:c.592G>A, NM_000094.3:c.7411C>T | Epidermolysis bullosa dystrophica, Hallopeau-Siemens type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL7A1 gene located on chromosomal region 3p21.1. The age of onset is neonatal/infantile. This disease is characterized by generalized cutaneous and mucosal blistering and scarring associated with severe deformities and major extracutaneous involvement. The prevalence is <1:1,000,000. | 250,600 |
| COL9A1 | Stickler syndrome type 4 | NM_001851.4 | NM_001851.4:c.883C>T, NM_001851.4:c.706C>T | Stickler syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL9A1 gene located on chromosomal region 6q13. The age of onset is infantile. This disease is characterized by opthalmological (myopia, retinal detachment and cataracts), orofacial (micrognathia, midface hypoplasia and cleft palate) auditory (sensorineural hearing loss) and articular (epiphyseal dysplasia) symptoms. The prevalence is <1:1,000,000. | 600 |
| COL9A2 | Stickler syndrome type 5 | NM_001852.3 | NM_001852.3:c.1918C>T, NM_001852.3:c.1097_1098insC, NM_001852.3:c.793-1G>C | Stickler syndrome type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL9A2 gene located on chromosomal region 1p33-p32. The age of onset is infantile. This disease is characterized by opthalmological (myopia, retinal detachment and cataracts), orofacial (micrognathia, midface hypoplasia and cleft palate) auditory (sensorineural hearing loss) and articular (epiphyseal dysplasia) symptoms. The prevalence is <1:1,000,000. | 600 |
| COQ2 | Primary coenzyme Q10 deficiency type 1 | NM_015697.7 | NM_015697.7:c.683A>G, NM_015697.7:c.1197delT, NM_015697.7:c.590G>A, NM_015697.7:c.723delT, NM_015697.7:c.890A>G | Coenzyme Q10 deficiency, primary follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ2 gene located on chromosomal region 4q21.23. The age of onset is neonatal/infantile. The phenotypes include an encephalomyopathic form with seizures and ataxia; a multisystem infantile form with encephalopathy, cardiomyopathy and renal failure; a predominantly cerebellar form with ataxia and cerebellar atrophy; Leigh syndrome with growth retardation; and an isolated myopathic form. | 250,600 |
| CPS1 | Carbamoylphosphate synthetase type 1 deficiency | NM_001875.4 | NM_001875.4:c.1912C>T, NM_001875.4:c.697C>T, NM_001875.4:c.1631C>T, NM_001875.4:c.3556delA | Carbamoylphosphate synthetase deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPS1 gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by congenital hyperammonemia and defective citrulline synthesis. The prevalence is 1:800,000 newborn in Japan. | 600 |
| CPT1A | Carnitine palmitoyltransferase type 1A deficiency | NM_001876.3 | NM_001876.3:c.1216C>T, NM_001876.3:c.1241C>T, NM_001876.3:c.1361A>G, NM_001876.3:c.222C>A, NM_001876.3:c.1079A>G, NM_001876.3:c.1436C>T, NM_001876.3:c.1493A>G, NM_001876.3:c.335_336delCC, NM_001876.3:c.1393G>T, NM_001876.3:c.281+1G>A, NM_001876.3:c.1538C>T, NM_001876.3:c.298C>T | Carnitine palmitoyl transferase 1A deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT1A gene located on chromosomal region 11q13.2. The age of onset is neonatal/infantile. This disease is characterized by recurrent attacks of fasting-induced hypoketotic hypoglycemia and risk of liver failure. The prevalence is 1.3:1,000 newborn. | 600 |
| CPT2 | Carnitine palmitoyltransferase deficiency, type 2 | NM_000098.2 | NM_000098.2:c.1239_1240delGA, NM_000098.2:c.1369A>T, NM_000098.2:c.1237C>T, NM_000098.2:c.680C>T, NM_000098.2:c.1437C>G, NM_000098.2:c.149C>A, NM_000098.2:c.1784delC, NM_000098.2:c.886C>T, NM_000098.2:c.1763C>G, NM_000098.2:c.359A>G, NM_000098.2:c.370C>T, NM_000098.2:c.1883A>C, NM_000098.2:c.1891C>T, NM_000098.2:c.1148T>A, NM_000098.2:c.638A>G, NM_000098.2:c.725_726delAC, NM_000098.2:c.452G>A, NM_000098.2:c.338C>T, NM_000098.2:c.481C>T, NM_000098.2:c.464dupT, NM_000098.2:c.520G>A | Carnitine palmitoyl transferase type 2 deficiency, infantile form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT2 gene located on chromosomal region 1p32. The age of onset is neonatal/infantile. This disease is characterized by a severe fasting intolerance leading to metabolic derangements of hypoketotic hypoglycemia, resulting in coma and seizures, and hepatic encephalopathy leading to liver failure. The prevalence is <1:1,000,000. | 250,600 |
| CRB1 | Leber congenital amaurosis type 8 | NM_201253.2 | NM_201253.2:c.3299T>G, NM_201253.2:c.3383delT, NM_201253.2:c.3419T>A, NM_201253.2:c.3094G>A, NM_201253.2:c.936T>G, NM_201253.2:c.493_501delGATGGAATT, NM_201253.2:c.3997G>T, NM_201253.2:c.498_506delAATTGATGG, NM_201253.2:c.2688T>A, NM_201253.2:c.613_619delATAGGAA, NM_201253.2:c.2401A>T, NM_201253.2:c.610_616delGAAATAG | Leber congenital amaurosis follows an autosomal recessive pattern of inheritance. Type 8 is caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. The age of onset is neonatal/infancy. This disease comprises a group of early-onset childhood retinal dystrophies characterized by vision loss, nystagmus, and severe retinal dysfunction. Patients usually present at birth with profound vision loss and pendular nystagmus. Electroretinogram responses are usually nonrecordable. Other clinical findings may include high hypermetropia, photodysphoria, oculodigital sign, keratoconus, cataracts, and a variable appearance to the fundus. | 250,600 |
| CRB1 | Pigmented paravenous chorioretinal atrophy | NM_201253.2 | NM_201253.2:c.484G>A | Pigmented paravenous chorioretinal atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRB1 gene located on chromosomal region 19p12. The age of onset is variable. This disease is characterized by an unusual retinal degeneration characterized by accumulation of pigmentation along retinal veins. | 250,600 |
| CRB1 | Retinitis pigmentosa type 12 | NM_201253.2 | NM_201253.2:c.3053_3054insTTATA, NM_201253.2:c.3122T>C, NM_201253.2:c.2416G>T, NM_201253.2:c.2843G>A, NM_201253.2:c.3299T>C, NM_201253.2:c.2983G>T, NM_201253.2:c.2290C>T | Retinitis pigmentosa 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000. | 250,600 |
| CRLF1 | Cold-induced sweating syndrome | NM_004750.4 | NM_004750.4:c.538C>T, NM_004750.4:c.303delC, NM_004750.4:c.413C>T, NM_004750.4:c.527+5G>A, NM_004750.4:c.226T>G, NM_004750.4:c.829C>T, NM_004750.4:c.397+1G>A, NM_004750.4:c.708_709delCCinsT, NM_004750.4:c.713_714insC, NM_004750.4:c.1125delG, NM_004750.4:c.676dupA, NM_004750.4:c.856-1G>A, NM_004750.4:c.852G>T, NM_004750.4:c.935G>A, NM_004750.4:c.1137C>G, NM_004750.4:c.845_846delTG | Cold-induced sweating syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRLF1 gene located on chromosomal region 19p12. The age of onset is infantile. This disease is characterized by profuse sweating (involving the chest, face, arms and trunk) induced by cold ambient temperature kyphoscoliosis, a high-arched palate, depressed nasal bridge and impaired peripheral sensitivity to pain and temperature. The prevalence is <1:1,000,000. | 600 |
| CRTAP | Osteogenesis imperfecta type 7 | NM_006371.4 | NM_006371.4:c.826C>T, NM_006371.4:c.180G>A, NM_006371.4:c.561T>G, NM_006371.4:c.634C>T | Osteogenesis imperfecta type VII follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRTAP gene located on chromosomal region 3p22.3. The age of onset is variable. This disease is characterized by increased bone fragility, low bone mass, and susceptibility to bone fractures with variable severity. The prevalence is 6:100,000-7:100,000. | 600 |
| CRX | Leber congenital amaurosis type 7 | NM_000554.4 | NM_000554.4:c.425A>G, NM_000554.4:c.196G>A, NM_000554.4:c.898T>C | Leber congenital amaurosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRX gene located on chromosomal region 19q13.3. The age of onset is neonatal/infantile. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. The prevalence is 2:100,000-3:100,000 newborn. | 250,600 |
| CSTB | Progressive myoclonic epilepsy type 1A | NM_000100.3 | NM_000100.3:c.212A>C, NM_000100.3:c.202C>T | Progressive myoclonic epilepsy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CSTB gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by severe, stimulus-sensitive myoclonus and tonic-clonic seizures. The onset, occurring between 6 and 13 years of age, is characterized by convulsions. Myoclonus begins 1 to 5 years later. The twitchings occur predominantly in the proximal muscles of the extremities and are bilaterally symmetrical, although asynchronous. At first small, they become late in the clinical course so violent that the victim is thrown to the floor. Mental deterioration and eventually dementia develop. The prevalence is 1:20,000 newborn. | 600 |
| CTNS | Cystinosis, ocular nonnephropathic | NM_004937.2 | NM_004937.2:c.589G>A, NM_004937.2:c.853-3C>G | Ocular non nephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. It presents typical ocular findings of nephropathic cystinosis. However, systemic manifestations are absent and kidney disease does not occur. The prevalence is 1:100,000-1:200,000. | 250,600 |
| CTNS | Nephropathic cystinosis | NM_004937.2 | NM_004937.2:c.416C>T, NM_004937.2:c.414G>A, NM_004937.2:c.124G>A, NM_004937.2:c.357_360delCAGC, NM_004937.2:c.397_398delAT, NM_004937.2:c.1015G>A, NM_004937.2:c.646dupA, NM_004937.2:c.283G>T, NM_004937.2:c.329G>T, NM_004937.2:c.506G>A | Nephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. This disease is characterized by hypothyroidism, insulin-dependent diabetes, hepatosplenomegaly with portal hypertension, and muscle, cerebral and ocular involvement, caused by cystine deposits in various organs. The prevalence is 1:100,000-1:200,000. | 250,600 |
| CTSD | Ceroid lipofuscinosis, neuronal, type 10 | NM_001909.4 | NM_001909.4:c.685T>A, NM_001909.4:c.1149G>C | Neuronal ceroid lipofuscinosis type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSD gene located on chromosomal region 11p15.5. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 2:100,000-4:100,000 newborn. | 600 |
| CTSK | Pycnodysostosis | NM_000396.3 | NM_000396.3:c.236G>A, NM_000396.3:c.154A>T, NM_000396.3:c.436G>C, NM_000396.3:c.926T>C, NM_000396.3:c.721C>T | Pycnodysostosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSK gene located on chromosomal region 1q21. The age of onset is variable. This disease is characterized by osteosclerosis, short stature or dwarfism, acroosteolysis of the distal phalanges, fragile bones associated with spontaneous fractures and dysplasia of the clavicles. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| CYP21A2 | Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency | - | hybrid 5'CYP21A1P/3'CYP21A2, hybrid 5'CYP21A2/3'CYP21A1P (Detection by MLPA) | Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP21A2 gene located on chromosomal region 6p21.3. The age of onset is neonatal/infantile. This disease is characterized by simple virilizing or salt wasting forms that can manifest with genital ambiguity in females, and in both sexes with adrenal insufficiency with dehydration during the neonatal period, life threatening hypoglycemia and hyperandrogenia. The prevalence is 1/100,000 to 9/100,000. | 600 |
| CYP21A2 | Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency | NM_000500.7 | NM_000500.7:c.518T>A, NM_000500.7:c.955C>T, NM_000500.7:c.1069C>T, NM_000500.7:c.719T>A, NM_000500.7:c.[713T>A;719T>A], NM_000500.7:c.293-13A/C>G, NM_000500.7:c.332_339del, NM_000500.7:c.[710T>A;719T>A], NM_000500.7:c.923_924insT, NM_000500.7:c.[710T>A;713T>A], NM_000500.7:c.713T>A, NM_000500.7:c.[710T>A;713T>A;719T>A], NM_000500.7:c.710T>A (Detection by minisequencing) | Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP21A2 gene located on chromosomal region 6p21.3. The age of onset is neonatal/infantile. This disease is characterized by simple virilizing or salt wasting forms that can manifest with genital ambiguity in females, and in both sexes with adrenal insufficiency with dehydration during the neonatal period, life threatening hypoglycemia and hyperandrogenia. The prevalence is 1/100,000 to 9/100,000. | 600 |
| CYP21A2 | Non-classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency | NM_000500.7 | NM_000500.7:c.92C>T, NM_000500.7:c.844G>T, NM_000500.7:c.1360C>T (Detection by minisequencing) | Nonclassic congenital adrenal hyperplasia due to 21-hydroxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP21A2 gene located on chromosomal region 6p21.3. This is a common milder form of congenital adrenal hyperplasia characterized by a later onset of androgen excess symptoms seen in females and precocious pseudopuberty in both sexes. Cortisol and aldosterone levels are normal but there is an increased amount of androgens. Disease onset occurs in adolescence with variable degrees of postnatal androgen excess (precocious pubarche, hirsutism, acne, alopecia, anovulation and menstrual irregularies and in the post-pubertal period it can mimic polycystic ovary syndrome. It is also sometimes asymptomatic. The prevalence ranges from 1/1,000-1/500 in the general Caucasian population, but up to 1-2% among inbred populations, such as Eastern European (Ashkenazi) Jews. | 600 |
| CYP4V2 | Bietti crystalline corneoretinal dystrophy | NM_207352.3 | NM_207352.3:c.1523G>A, NM_207352.3:c.130T>A, NM_207352.3:c.327+1G>A, NM_207352.3:c.332T>C | Bietti crystalline corneoretinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP4V2 gene located on chromosomal region 4q35.2. The age of onset is adult. This disease is characterized by nightblindness, decreased vision, paracentral scotoma, and, in the end stages of the disease, legal blindness. | 250,600 |
| CYP7B1 | Congenital bile acid synthesis defect type 3 | NM_004820.3 | NM_004820.3:c.1162C>T | Congenital bile acid synthesis defect type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by severe neonatal cholestatic liver disease. The prevalence is below 1,000,000. | 250,600 |
| CYP7B1 | Spastic paraplegia type 5A, autosomal recessive | NM_004820.3 | NM_004820.3:c.1460_1461insT, NM_004820.3:c.321_324delACAA, NM_004820.3:c.825T>A, NM_004820.3:c.889A>G, NM_004820.3:c.1456C>T, NM_004820.3:c.187C>T | Autosomal recessive spastic paraplegia type 5A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. The prevalence is below 1,000,000. | 250,600 |
| D2HGDH | D-2-Hydroxyglutaric aciduria | NM_152783.4 | NM_152783.4:c.1315A>G, NM_152783.4:c.1276G>A, NM_152783.4:c.440T>G, NM_152783.4:c.1333_1334delAC, NM_152783.4:c.1123G>T, NM_152783.4:c.1331T>C | D-2-Hydroxyglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the D2HGDH gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by extremely variable clinical manifestations, with severe cases characterized by neonatal or early infantile-onset epileptic encephalopathy, and marked hypotonia, and cerebral visual failure, developmental delay, seizures, involuntary movements, and cardiomyopathy are also common in these cases. The prevalence is below 1,000,000. | 250,600 |
| DBT | Maple syrup urine disease type 2 | NM_001918.3 | NM_001918.3:c.670G>T, NM_001918.3:c.827T>G, NM_001918.3:c.294C>G, NM_001918.3:c.581C>G, NM_001918.3:c.772+1G>A, NM_001918.3:c.272_275delCAGT, NM_001918.3:c.1281+1G>A, NM_001918.3:c.871C>T, NM_001918.3:c.901C>T, NM_001918.3:c.939G>C, NM_001918.3:c.126T>G | Maple syrup urine disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DBT gene located on chromosomal region 1p31. The age of onset is neonatal/infantile. This disease is characterized by a maple syrup odor in the cerumen at birth, poor feeding, lethargy and focal dystonia, followed by progressive encephalopathy and central respiratory failure if untreated. The prevalence is 1/10,000 to 5/10,000. | 250,600 |
| DCLRE1C | Omenn syndrome | NM_001033855.2 | NM_001033855.2:c.2T>C | Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. | 250,600 |
| DCLRE1C | Severe combined immunodeficiency due to DCLRE1C deficiency | NM_001033855.2 | NM_001033855.2:c.1558_1559insA, NM_001033855.2:c.597C>A, NM_001033855.2:c.780+1delG, NM_001033855.2:c.1639G>T, NM_001033855.2:c.1903_1904insA, NM_001033855.2:c.457G>A, NM_001033855.2:c.1559_1560insA | Severe combined immunodeficiency due to DCLRE1C deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DCLRE1C gene located on chromosomal region 10p13. The age of onset is neonatal/infantile. This disease is characterized by severe and recurrent infections, diarrhea, failure to thrive, and cell sensitivity to ionizing radiation. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| DDB2 | Xeroderma pigmentosum complementation group E | NM_000107.2 | NM_000107.2:c.730A>G, NM_000107.2:c.937C>T, NM_000107.2:c.818G>A, NM_000107.2:c.919G>T | Xeroderma pigmentosum complementation group E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DDB2 gene located on chromosomal region 11p12-p11. The age of onset is variable. This disease is characterized by mild xeroderma pigmentosum symptoms and no neurological abnormalities. The prevalence is 1/1,000,000. | 600 |
| DDC | Aromatic L-amino acid decarboxylase deficiency | NM_000790.3 | NM_000790.3:c.100delG, NM_000790.3:c.1040G>A, NM_000790.3:c.823G>A, NM_000790.3:c.304G>A, NM_000790.3:c.272C>T, NM_000790.3:c.749C>T | Aromatic L-amino acid decarboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DDC gene located on chromosomal region 7p12.2. The age of onset is neonatal/infantile. This disease is characterized by severe developmental delay, weak muscle tone (hypotonia), muscle stiffness, difficulty moving, and involuntary writhing movements of the limbs (athetosis). The prevalence is below 1,000,000. | 600 |
| DFNB31 | Deafness type 31, autosomal recessive | NM_015404.3 | NM_015404.3:c.1135C>T, NM_015404.3:c.817C>T | Deafness, autosomal recessive type 31 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DFNB31 gene located on chromosomal region 9q32. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. | 250,600 |
| DFNB59 | Deafness type 59, autosomal recessive | NM_001042702.3 | NM_001042702.3:c.122delA, NM_001042702.3:c.420delT, NM_001042702.3:c.113dupT, NM_001042702.3:c.988delG, NM_001042702.3:c.726delT, NM_001042702.3:c.161C>T, NM_001042702.3:c.817_818insT | Autosomal recessive nonsyndromic sensorineural deafness type DFNB59 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DFNB59 gene located on chromosomal region 2q31.2. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. | 600 |
| DGUOK | Mitochondrial DNA depletion syndrome type 3 | NM_080916.2 | NM_080916.2:c.137A>G, NM_080916.2:c.707+2T>G, NM_080916.2:c.763G>T, NM_080916.2:c.425G>A, NM_080916.2:c.313C>T, NM_080916.2:c.494A>T | Mitochondrial DNA depletion syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DGUOK gene located on chromosomal region 2p13. The age of onset is neonatal/infantile. This disease is characterized by progressive liver failure, hypoglycemia and neurologic abnormalities including hypotonia, encephalopathy and peripheral neuropathy | 250,600 |
| DHCR7 | Smith-Lemli-Opitz syndrome | NM_001360.2 | NM_001360.2:c.1055G>A, NM_001360.2:c.1210C>T, NM_001360.2:c.1054C>T, NM_001360.2:c.461C>G, NM_001360.2:c.151C>T, NM_001360.2:c.1031G>A, NM_001360.2:c.453G>A, NM_001360.2:c.506C>T, NM_001360.2:c.356A>T, NM_001360.2:c.1228G>A, NM_001360.2:c.1A>G, NM_001360.2:c.976G>T, NM_001360.2:c.964-1G>C, NM_001360.2:c.682C>T, NM_001360.2:c.452G>A, NM_001360.2:c.1337G>A, NM_001360.2:c.1342G>A, NM_001360.2:c.730G>A, NM_001360.2:c.292C>T, NM_001360.2:c.904T>C, NM_001360.2:c.907G>A, NM_001360.2:c.841G>A, NM_001360.2:c.744G>T, NM_001360.2:c.724C>T, NM_001360.2:c.725G>A, NM_001360.2:c.866C>T, NM_001360.2:c.278C>T, NM_001360.2:c.839A>G, NM_001360.2:c.832-1G>C | Smith-Lemli-Opitz syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHCR7 gene located on chromosomal region 11q13.4. The age of onset is neonatal/infantile. This disease is characterized by multiple congenital anomalies, intellectual deficit, and behavioral problems. The prevalence is 1/20,000 to 1/40,000 newborn. | 250,600 |
| DHDDS | Retinitis pigmentosa type 59 | NM_024887.3 | NM_024887.3:c.328delA, NM_024887.3:c.998C>G, NM_024887.3:c.124A>G | Retinitis pigmentosa type 59 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHDDS gene located on chromosomal region 1p36.11. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000. | 600 |
| DKC1 | Dyskeratosis congenita, X-linked | NM_001363.4 | NM_001363.4:c.91C>A, NM_001363.4:c.214_215delCTinsTA, NM_001363.4:c.194G>C, NM_001363.4:c.838A>C, NM_001363.4:c.91C>G, NM_001363.4:c.196A>G | Dyskeratosis congenital, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DKC1 gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by the mucocutaneous triad of abnormal skin pigmentation, nail dystrophy and mucosal leucoplakia. The prevalence is 1-9/1,000,000. | 600 |
| DKC1 | Hoyeraal-Hreidarsson syndrome | NM_001363.4 | NM_001363.4:c.200C>T, NM_001363.4:c.204C>A | Hoyeraal-Hreidarsson syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DKC1 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by intrauterine growth retardation, microcephaly, cerebellar hypoplasia, progressive combined immune deficiency and aplastic anemia. The prevalence is below 1/1,000,000. | 600 |
| DLD | Dihydrolipoamide dehydrogenase deficiency E3 | NM_000108.4 | NM_000108.4:c.916_926delTGTGATGTACT, NM_000108.4:c.105_106insA, NM_000108.4:c.1483A>G | Dihydrolipoamide dehydrogenase deficiency E3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DLD gene located on chromosomal region 7q31-q32. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting and a maple syrup odor in the cerumen (and later in urine) noted soon after birth, followed by progressive encephalopathy and central respiratory failure if untreated. The prevalence is 1/1,000,000 to 9/1,000,000. | 600 |
| DLL3 | Spondylocostal dysostosis type 1 | NM_016941.3 | NM_016941.3:c.231C>A, NM_016941.3:c.712C>T | Spondylocostal dysostosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DLL3 gene located on chromosomal region 19q13. The age of onset is neonatal/infantile. This disease is associated with vertebral and rib segmentation defects and characterised by a short neck with limited mobility, winged scapulae, a short trunk, and short stature with multiple vertebral anomalies at all levels of the spine. The prevalence is below 1/1,000,000. | 600 |
| DMD | Becker muscular dystrophy | NM_004006.2 | NM_004006.2:c.3432+3A>G, NM_004006.2:c.3432+1G>A, NM_004006.2:c.137A>T | Becker muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/18,000 to 1/31,000 male newborns and the prevalence is 1/10,000 to 5/10,000. | 600 |
| DMD | Becker muscular dystrophy | - | insBecker, delBecker (Detection by MLPA) | Becker muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/18,000 to 1/31,000 male newborns and the prevalence is 1/10,000 to 5/10,000. | 600 |
| DMD | Dilated cardiomyopathy type 3B | NM_004006.2 | NM_004006.2:c.5922+3G>C | Dilated cardiomyopathy type 3B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is variable. This disease is characterized by ventricular dilatation and impaired systolic function. Patients with DCM suffer from heart failure, arrhythmia, and are at risk of premature death. The incidence is 1/3,300 male newborns and the prevalence is 1/16,000 to 1/125,000. | 600 |
| DMD | Duchenne muscular dystrophy | NM_004006.2 | NM_004006.2:c.1261C>T, NM_004006.2:c.1286C>A, NM_004006.2:c.1070delC, NM_004006.2:c.10086+1G>A, NM_004006.2:c.1886C>A, NM_004006.2:c.1900A>T, NM_004006.2:c.10774delA, NM_004006.2:c.204dupC, NM_004006.2:c.1900_1903dupAAGT, NM_004006.2:c.10141C>T, NM_004006.2:c.10033C>T, NM_004006.2:c.10453_10454delCT, NM_004006.2:c.1012G>T, NM_004006.2:c.1048G>T, NM_004006.2:c.2302C>T, NM_004006.2:c.1734delA, NM_004006.2:c.2380+1G>C, NM_004006.2:c.2380+2T>C, NM_004006.2:c.2479delG, NM_004006.2:c.2482T>G, NM_004006.2:c.2484T>G, NM_004006.2:c.251delT, NM_004006.2:c.2523delA, NM_004006.2:c.10446_10447delCT, NM_004006.2:c.2650C>T, NM_004006.2:c.10454delT, NM_004006.2:c.2294_2297delCCAT, NM_004006.2:c.2803+1G>A, NM_004006.2:c.2803+1G>T, NM_004006.2:c.2804-1G>A, NM_004006.2:c.2804-2A>T, NM_004006.2:c.2815_2816delTT, NM_004006.2:c.1306dupG, NM_004006.2:c.1332-9A>G, NM_004006.2:c.133C>T, NM_004006.2:c.1341_1342dupAG, NM_004006.2:c.2547delT, NM_004006.2:c.1371delG, NM_004006.2:c.2755A>T, NM_004006.2:c.2758C>T, NM_004006.2:c.1529_1530delTC, NM_004006.2:c.160_162delCTC, NM_004006.2:c.3295C>T, NM_004006.2:c.6182delC, NM_004006.2:c.6226G>T, NM_004006.2:c.3639dupA, NM_004006.2:c.199G>T, NM_004006.2:c.3747delG, NM_004006.2:c.2125delC, NM_004006.2:c.137_138dupAT, NM_004006.2:c.4117C>T, NM_004006.2:c.412_413delAA, NM_004006.2:c.2281_2285delGAAAA, NM_004006.2:c.4375C>T, NM_004006.2:c.4405C>T, NM_004006.2:c.2332C>T, NM_004006.2:c.4471_4472delAA, NM_004006.2:c.4486delG, NM_004006.2:c.4500delA, NM_004006.2:c.4518+5G>A, NM_004006.2:c.4735G>T, NM_004006.2:c.4806A>T, NM_004006.2:c.4843A>T, NM_004006.2:c.489G>A, NM_004006.2:c.5287C>T, NM_004006.2:c.530+1delG, NM_004006.2:c.5313dupT, NM_004006.2:c.5353C>T, NM_004006.2:c.5363C>G, NM_004006.2:c.5530C>T, NM_004006.2:c.5554C>T, NM_004006.2:c.5570_5571dupAA, NM_004006.2:c.5640T>A, NM_004006.2:c.5671A>T, NM_004006.2:c.5697delA, NM_004006.2:c.5773G>T, NM_004006.2:c.5807T>A, NM_004006.2:c.583C>T, NM_004006.2:c.8944C>T, NM_004006.2:c.1489C>T, NM_004006.2:c.6000T>A, NM_004006.2:c.6014_6017delCTCA, NM_004006.2:c.615T>A, NM_004006.2:c.9346C>T, NM_004006.2:c.9361+1G>A, NM_004006.2:c.6238delC, NM_004006.2:c.3697delC, NM_004006.2:c.6292C>T, NM_004006.2:c.3779_3785delCTTTGGAinsGG, NM_004006.2:c.4071G>C, NM_004006.2:c.6391_6392delCA, NM_004006.2:c.6392_6393insCA, NM_004006.2:c.433C>T, NM_004006.2:c.676_678delAAG, NM_004006.2:c.6834delT, NM_004006.2:c.4409_4412dupGTCT, NM_004006.2:c.6936delA, NM_004006.2:c.6943G>T, NM_004006.2:c.6964delG, NM_004006.2:c.6982A>T, NM_004006.2:c.6986dupA, NM_004006.2:c.7682G>A, NM_004006.2:c.7683G>A, NM_004006.2:c.7764dupT, NM_004006.2:c.7771G>T, NM_004006.2:c.7894C>T, NM_004006.2:c.7922delA, NM_004006.2:c.8064_8065delTA, NM_004006.2:c.8069T>G, NM_004006.2:c.8086delC, NM_004006.2:c.8358G>A, NM_004006.2:c.8374_8375delAA, NM_004006.2:c.8443C>T, NM_004006.2:c.8464C>T, NM_004006.2:c.8608C>T, NM_004006.2:c.8652_8653delCT, NM_004006.2:c.8656C>T, NM_004006.2:c.8668G>A, NM_004006.2:c.8713C>T, NM_004006.2:c.3121C>T, NM_004006.2:c.9164-1G>C, NM_004006.2:c.9164-1G>T, NM_004006.2:c.9337C>T, NM_004006.2:c.6906G>A, NM_004006.2:c.9361+1G>C, NM_004006.2:c.9380C>G, NM_004006.2:c.9564-1G>A, NM_004006.2:c.9568C>T, NM_004006.2:c.9612_9613ins341, NM_004006.2:c.9650-2A>G, NM_004006.2:c.9767dupG, NM_004006.2:c.9851G>A, NM_004006.2:c.9854_9863delTGAGACTGGA, NM_004006.2:c.9862G>T, NM_004006.2:c.3276+1G>A, NM_004006.2:c.2866C>T, NM_004006.2:c.2929dupC, NM_004006.2:c.3022A>T, NM_004006.2:c.2816T>A, NM_004006.2:c.3087G>A, NM_004006.2:c.5899C>T, NM_004006.2:c.3124A>T, NM_004006.2:c.3076G>T, NM_004006.2:c.6373C>T, NM_004006.2:c.627delA, NM_004006.2:c.2137C>T, NM_004006.2:c.3246_3247insTTTCTAAAAA, NM_004006.2:c.220delC, NM_004006.2:c.2169-3_2169-1delinsAA, NM_004006.2:c.6340A>T, NM_004006.2:c.6763-2A>G | Duchenne muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/3,300 male newborns and the prevalence is 1/16,000 to 1/125,000. | 600 |
| DMD | Duchenne muscular dystrophy | - | insDuchenne, delDuchenne (Detection by MLPA) | Duchenne muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/3,300 male newborns and the prevalence is 1/16,000 to 1/125,000. | 600 |
| DMP1 | Hypophosphatemic rickets type 1, autosomal recessive | NM_004407.3 | NM_004407.3:c.1A>G, NM_004407.3:c.55-1G>C, NM_004407.3:c.31delT, NM_004407.3:c.362delC | Hypophosphatemic rickets type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DMP1 gene located on chromosomal region 4q21. The age of onset is variable. This disease is associated with vertebral and rib segmentation defects and characterised by hypophosphatemia, rickets and/or osteomalacia and slow growth. The prevalence is below 1/20,000 newborns. | 600 |
| DNAJC19 | Dilated cardiomyopathy with ataxia | NM_145261.3 | NM_145261.3:c.300delA | Dilated cardiomyopathy with ataxia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DNAJC19 gene located on chromosomal region 3q26.33. The age of onset is infantile. This disease is characterised by severe early onset (before the age of three years) dilated cardiomyopathy with conduction defects (long QT syndrome), non-progressive cerebellar ataxia, testicular dysgenesis, and 3-methylglutaconic aciduria. | 600 |
| DPAGT1 | Congenital disorder of glycosylation type 1j | NM_001382.3 | NM_001382.3:c.791T>G, NM_001382.3:c.358C>A, NM_001382.3:c.643+1G>A, NM_001382.3:c.902G>A, NM_001382.3:c.349G>A, NM_001382.3:c.980_981delCT | Congenital disorder of glycosylation type 1j follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPAGT1 gene located on chromosomal region 11q23.3. The age of onset is neonatal/infantile. This disease is characterised by severe psychomotor delay, seizures, hypotonia and dysmorphism (microcephaly, ocular exotropia, micrognathia and clinodactyly). The prevalence is below 1,000,000. | 600 |
| DPM1 | Congenital disorders of glycosylation type 1e | NM_003859.1 | NM_003859.1:c.564-1G>A, NM_003859.1:c.628delC, NM_003859.1:c.274C>G, NM_003859.1:c.679-1G>T, NM_003859.1:c.742T>C | Congenital disorder of glycosylation type 1e follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPM1 gene located on chromosomal region 20q13.13. The age of onset is neonatal/infantile. This disease is characterised by psychomotor delay, seizures, hypotonia, facial dysmorphism and microcephaly. The prevalence is below 1,000,000. | 600 |
| DPYD | Dihydropyrimidine dehydrogenase deficiency | NM_000110.3 | NM_000110.3:c.775A>G, NM_000110.3:c.1679T>G, NM_000110.3:c.299_302delTCAT, NM_000110.3:c.703C>T, NM_000110.3:c.1109_1110delTA, NM_000110.3:c.1905+1G>A, NM_000110.3:c.257C>T | Dihydropyrimidine dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPYD gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterised by mental and motor retardation and convulsions. | 250,600 |
| DSP | Cardiomyopathy, arrhythmogenic | NM_004415.2 | NM_004415.2:c.7000C>T, NM_004415.2:c.88G>A, NM_004415.2:c.6370_6371delCT, NM_004415.2:c.7180_7181delAG, NM_004415.2:c.643G>A, NM_004415.2:c.3098delA, NM_004415.2:c.8188C>T | Cardiomyopathy, arrhythmogenic follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is a heart condition in which the heart muscle fibers are gradually replaced by fibrous or fibro-fatty tissue, causing abnormal heart electrical rhythms and heart failure. Consequently pumping blood to the body is weakened and sometimes leads to sudden cardiac death. The prevalence is below 1,000,000. | 250,600 |
| DSP | Cardiomyopathy, dilated, with woolly hair and keratoderma | NM_004415.2 | NM_004415.2:c.5513G>A | Cardiomyopathy, dilated, with woolly hair and keratoderma follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterized by a generalized striate keratoderma particularly affecting the palmoplantar epidermis, woolly hair, and dilated left ventricular cardiomyopathy. The prevalence is below 1,000,000. | 250,600 |
| DSP | Lethal acantholytic epidermolysis bullosa | NM_004415.2 | NM_004415.2:c.5800C>T | Lethal acantholytic epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterised by generalized oozing erosions, usually in the absence of blisters. The prevalence is below 1,000,000. | 250,600 |
| DYSF | Dysferlinopathy | NM_003494.3 | NM_003494.3:c.1398-2A>G, NM_003494.3:c.1392dupA, NM_003494.3:c.1398-1G>A, NM_003494.3:c.5266C>T, NM_003494.3:c.1620delA, NM_003494.3:c.1481-1G>A, NM_003494.3:c.3041A>G, NM_003494.3:c.3985C>G, NM_003494.3:c.4090C>T, NM_003494.3:c.5713C>T, NM_003494.3:c.1053+1G>A, NM_003494.3:c.200_201delTGinsAT, NM_003494.3:c.2869C>T, NM_003494.3:c.2870_2874delAGACC, NM_003494.3:c.458-390C>T, NM_003494.3:c.757C>T, NM_003494.3:c.3065G>A, NM_003494.3:c.393_394delCC, NM_003494.3:c.3859A>T, NM_003494.3:c.5429G>A, NM_003494.3:c.3130C>T, NM_003494.3:c.3444_3445delTGinsAA, NM_003494.3:c.1638+2T>A, NM_003494.3:c.4108_4109delGT, NM_003494.3:c.3641delC, NM_003494.3:c.1368C>A, NM_003494.3:c.4872_4876delGCCCGinsCCCC, NM_003494.3:c.5341-2A>C, NM_003494.3:c.509C>A, NM_003494.3:c.5836_5839delCAGC, NM_003494.3:c.5644C>T, NM_003494.3:c.1861G>C, NM_003494.3:c.5429+1G>T, NM_003494.3:c.3957delC, NM_003494.3:c.5998C>T, NM_003494.3:c.3724C>T, NM_003494.3:c.5525+1G>A, NM_003494.3:c.3477C>A, NM_003494.3:c.3708delA, NM_003494.3:c.5992G>T, NM_003494.3:c.3113G>C, NM_003494.3:c.1216T>C, NM_003494.3:c.3903delG | Dysferlinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. Dysferlinopathy includes a spectrum of muscle disease characterized by two main phenotypes: Miyoshi myopathy with primarily distal weakness and limb-girdle muscular dystrophy type 2B (LGMD2B) with primarily proximal weakness. Miyoshi myopathy (median age of onset 19 years) is characterized by muscle weakness and atrophy, most marked in the distal parts of the legs, especially the gastrocnemius and soleus muscles. Over a period of years, the weakness and atrophy spread to the thighs and gluteal muscles. The forearms may become mildly atrophic with decrease in grip strength; the small muscles of the hands are spared. LGMD2B is characterized by early weakness and atrophy of the pelvic and shoulder girdle muscles in adolescence or young adulthood, with slow progression. Other phenotypes are scapuloperoneal syndrome, distal myopathy with anterior tibial onset, elevated serum CK concentration only, and congenital muscular dystrophy. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| DYSF | Miyoshi myopathy | NM_003494.3 | NM_003494.3:c.1555G>A, NM_003494.3:c.5509G>A, NM_003494.3:c.5077C>T, NM_003494.3:c.5698_5699delAG, NM_003494.3:c.3892A>G, NM_003494.3:c.286A>C, NM_003494.3:c.1120G>C, NM_003494.3:c.1284+2T>C, NM_003494.3:c.5497G>T, NM_003494.3:c.3478C>T, NM_003494.3:c.2997G>T, NM_003494.3:c.3121C>T, NM_003494.3:c.1813C>T, NM_003494.3:c.3181_3182insAGGCGG, NM_003494.3:c.937+1G>A, NM_003494.3:c.3158T>G, NM_003494.3:c.1276G>A, NM_003494.3:c.701G>A, NM_003494.3:c.610C>T, NM_003494.3:c.5594delG, NM_003494.3:c.3112C>T, NM_003494.3:c.4199C>A, NM_003494.3:c.5999G>A, NM_003494.3:c.4756C>T, NM_003494.3:c.6124C>T, NM_003494.3:c.2966C>T, NM_003494.3:c.663+1G>C, NM_003494.3:c.3175-2A>T, NM_003494.3:c.895G>T, NM_003494.3:c.4985C>T, NM_003494.3:c.6203C>T | Miyoshi myopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. This disease is characterised by weakness in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| DYSF | Muscular dystrophy, limb girdle type 2B | NM_003494.3 | NM_003494.3:c.5979dupA, NM_003494.3:c.565C>G, NM_003494.3:c.1663C>T, NM_003494.3:c.1873G>T, NM_003494.3:c.1834C>T, NM_003494.3:c.5201A>G, NM_003494.3:c.895G>A, NM_003494.3:c.3805G>T, NM_003494.3:c.4003G>A, NM_003494.3:c.4253G>A | Muscular dystrophy, limb girdle type 2B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. This disease is characterised by limb-girdle weakness and atrophy mostly in the shoulder pelvic girdle. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| EDA | Hypohidrotic ectodermal dysplasia, X-linked | NM_001399.4 | NM_001399.4:c.206G>T, NM_001399.4:c.463C>T, NM_001399.4:c.187G>A, NM_001399.4:c.573_574insT, NM_001399.4:c.466C>T, NM_001399.4:c.826C>T, NM_001399.4:c.183C>G, NM_001399.4:c.181T>C, NM_001399.4:c.467G>A, NM_001399.4:c.671G>C, NM_001399.4:c.1045G>A | Hypohidrotic ectodermal dysplasia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EDA gene located on chromosomal region Xq12-q13.1. The age of onset is neonatal/infantile. This disease is characterized by malformation of ectodermal structures such as skin, hair, teeth and sweat glands. The prevalence is 1/5,000 to 1/10,000 newborns. | 250,600 |
| EDN3 | Shah-Waardenburg syndrome type 4B | NM_207034.1 | NM_207034.1:c.277C>G, NM_207034.1:c.568_569delGA, NM_207034.1:c.262_263delGCinsT, NM_207034.1:c.559_560insA, NM_207034.1:c.565_566insA, NM_207034.1:c.476G>T | Waardenburg-Shah syndrome type 4B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EDN3 gene located on chromosomal region 20q13.2-q13.3. The age of onset is neonatal/infantile. This disease is characterised by the association of Waardenburg syndrome (sensorineural hearing loss and pigmentary abnormalities) and Hirschsprung disease (signs of intestinal obstruction). The prevalence is below 1/40,000. | 600 |
| EDNRB | Shah-Waardenburg syndrome type 4A | NM_000115.3 | NM_000115.3:c.914C>A, NM_000115.3:c.548C>G, NM_000115.3:c.828G>T, NM_000115.3:c.-51-946delC | Waardenburg-Shah syndrome type 4A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EDNRB gene located on chromosomal region 13q22. The age of onset is neonatal/infantile. This disease is characterised by the association of Waardenburg syndrome (sensorineural hearing loss and pigmentary abnormalities) and Hirschsprung disease (signs of intestinal obstruction). The prevalence is below 1/1,000,000. | 600 |
| EGR2 | Charcot-Marie-Tooth disease type 4E | NM_000399.3 | NM_000399.3:c.803T>A | Charcot-Marie-Tooth disease type 4E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EGR2 gene located on chromosomal region 10q21.1. The age of onset is neonatal/infantile. This disease is characterised by distal muscle weakness and atrophy associated with sensory loss and, frequently, pes cavus foot deformity. The prevalence is 15/100,000 to 20/100,000. | 600 |
| EIF2AK3 | Wolcott-Rallison syndrome | NM_004836.5 | NM_004836.5:c.994G>T, NM_004836.5:c.1763G>A | Wolcott-Rallison syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EIF2AK3 gene located on chromosomal region 2p12. The age of onset is neonatal/infantile. This disease is characterised by permanent neonatal diabetes mellitus with multiple epiphyseal dysplasia and other clinical manifestations, including recurrent episodes of acute liver failure. The prevalence is above 1/10,000 newborns. | 600 |
| EMD | Emery-Dreifuss muscular dystrophy type 1, X-linked | NM_000117.2 | NM_000117.2:c.547C>A, NM_000117.2:c.631_635delCGTGC | Emery-Dreifuss muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EMD gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by muscular weakness and atrophy, with early joint contractures and cardiomyopathy. The prevalence is 1/100,000. | 600 |
| ENO3 | Glycogen storage disease type 13 | NM_053013.3 | NM_053013.3:c.667+1G>T, NM_053013.3:c.1121G>A, NM_053013.3:c.953delA, NM_053013.3:c.692_707dupTCCAGGCGGCTGGTTA, NM_053013.3:c.467G>A, NM_053013.3:c.1303T>C | Glycogen storage disease type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENO3 gene located on chromosomal region 17p13.2. The age of onset is adult. This disease is characterised by exercise intolerance and myalgia due to severe enolase deficiency in muscle. The prevalence is below 1/1,000,000. | 250,600 |
| ENPP1 | Generalized arterial calcification of infancy and pseudoxanthoma elasticum | NM_006208.2 | NM_006208.2:c.1612G>C | Idiopathic infantile arterial calcification follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENPP1 gene located on chromosomal region 6q22-q23. The age of onset is neonatal/infancy. A severe autosomal recessive disorder characterized by calcification of the internal elastic lamina of muscular arteries and stenosis due to myointimal proliferation. The disorder is often fatal within the first 6 months of life because of myocardial ischemia resulting in refractory heart failure. | 600 |
| ENPP1 | Hypophosphatemic rickets type 2, Autosomal recessive | NM_006208.2 | NM_006208.2:c.797G>T, NM_006208.2:c.2702A>C | Hypophosphatemic rickets type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENPP1 gene located on chromosomal region 6q22-q23. The age of onset is variable. This disease is characterised by hypophosphatemia, rickets and/or osteomalacia and slow growth. | 600 |
| ENPP1 | Idiopathic infantile arterial calcification | NM_006208.2 | NM_006208.2:c.1112A>T, NM_006208.2:c.1025G>T, NM_006208.2:c.783C>G, NM_006208.2:c.2677G>T, NM_006208.2:c.913C>A, NM_006208.2:c.2230C>T, NM_006208.2:c.900G>A | Idiopathic infantile arterial calcification follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENPP1 gene located on chromosomal region 6q22-q23. The age of onset is neonatal/infancy. A severe autosomal recessive disorder characterized by calcification of the internal elastic lamina of muscular arteries and stenosis due to myointimal proliferation. The disorder is often fatal within the first 6 months of life because of myocardial ischemia resulting in refractory heart failure. | 600 |
| ERCC2 | Trichothiodystrophy | NM_000400.3 | NM_000400.3:c.1972C>T | Trichothiodystrophy is a heterogeneous group of disorders that follows an autosomal recessive pattern of inheritance. It is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.32. The age of onset is neonatal or infantile. This disease is characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. The abnormalities are usually obvious at birth, with variable clinical expression. | 250,600 |
| ERCC2 | Xeroderma pigmentosum complementation group D | NM_000400.3 | NM_000400.3:c.1308-1G>A, NM_000400.3:c.1454T>C, NM_000400.3:c.1621A>C, NM_000400.3:c.1703_1704delTT, NM_000400.3:c.1381C>G, NM_000400.3:c.719-1G>A, NM_000400.3:c.2230_2233dupCTAG, NM_000400.3:c.183+2T>A, NM_000400.3:c.567G>A, NM_000400.3:c.1354C>T, NM_000400.3:c.2047C>T, NM_000400.3:c.1304T>G, NM_000400.3:c.2176C>T, NM_000400.3:c.950-2A>G, NM_000400.3:c.949+1G>A | Xeroderma pigmentosum complementation group D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.3. The age of onset is variable. This disease is characterised by typical xeroderma pigmentosum manifestations (photosensitivity of skin with burning, freckling, and dryness of skin, skin cancers) associated with a spectrum of neurological anomalies (from no abnormality to severe neurological disease). | 250,600 |
| ERCC3 | Xeroderma pigmentosum complementation group B | NM_000122.1 | NM_000122.1:c.1633C>T, NM_000122.1:c.1757_1758delAG, NM_000122.1:c.296T>C, NM_000122.1:c.1273C>T, NM_000122.1:c.1757delA, NM_000122.1:c.1858delG | Xeroderma pigmentosum complementation group B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC3 gene located on chromosomal region 2q21. The age of onset is variable. This disease is characterised by classic xeroderma pigmentosum features of varying severity (photosensitivity of skin with burning and freckling, skin and eye tumors) and mild neurological abnormalities, or in other cases classical xeroderma pigmentosum features with systemic and neurological manifestations of Cockayne syndrome such as short stature, bilateral sensorineural hearing loss and hyperreflexia. The prevalence is 1/1,000,000. | 600 |
| ERCC4 | Xeroderma pigmentosum complementation group F | NM_005236.2 | NM_005236.2:c.49G>T, NM_005236.2:c.1467_1468insA, NM_005236.2:c.2281_2284delTTTG, NM_005236.2:c.2T>C, NM_005236.2:c.538_539delAG, NM_005236.2:c.706T>C, NM_005236.2:c.2395C>T | Xeroderma pigmentosum complementation group F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC4 gene located on chromosomal region 16p13.12. The age of onset is variable. This disease is characterised very mild skin symptoms and no ocular or neurological disease. The prevalence is 1/1,000,000. | 250,600 |
| ERCC5 | Xeroderma pigmentosum complementation group G | NM_000123.3 | NM_000123.3:c.2620G>A, NM_000123.3:c.463_464insA, NM_000123.3:c.526C>T, NM_000123.3:c.88+2T>C, NM_000123.3:c.2144dupA, NM_000123.3:c.2375C>T, NM_000123.3:c.381-2A>G, NM_000123.3:c.2573T>C, NM_000123.3:c.406C>T, NM_000123.3:c.215C>A, NM_000123.3:c.787C>T, NM_000123.3:c.2751delA | Xeroderma pigmentosum complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC5 gene located on chromosomal region 13q33. The age of onset is variable. This disease is characterised by variable clinical manifestations, as some patients present with a mild xeroderma pigmentosum phenotype (UV sensitivity, hyper- or hypo-pigmented skin lesions and increased incidence of skin cancer) and others combine symptoms of xeroderma pigmentosum with systemic and neurological manifestations of Cockayne syndrome. The prevalence is 1/1,000,000. | 250,600 |
| ERCC6 | Cerebrooculofacioskeletal syndrome tipo 1 | NM_000124.3 | NM_000124.3:c.2047C>T | Cerebrooculofacioskeletal syndrome tipo 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterised by congenital microcephaly, congenital cataract and/or microphthalmia, arthrogryposis, severe psychomotor developmental delay, height-weight growth delay (principally postnatal) and facial dysmorphism (prominent metopic suture, micrognathism). The prevalence is below 1,000,000. | 250,600 |
| ERCC6 | Cockayne syndrome type B | NM_000124.3 | NM_000124.3:c.207_208insG, NM_000124.3:c.2203C>T, NM_000124.3:c.1357C>T, NM_000124.3:c.48_49delCT, NM_000124.3:c.3592_3593insGA, NM_000124.3:c.422+1G>A, NM_000124.3:c.1550G>A, NM_000124.3:c.3284C>G, NM_000124.3:c.2587C>T, NM_000124.3:c.3862C>T | Cockayne syndrome type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterised by growth failure at birth, with little or no postnatal neurologic development. | 250,600 |
| ERCC8 | Cockayne syndrome type A | NM_000082.3 | NM_000082.3:c.1103_1108delAGTTinsTTATATGAACCTTATATGAA, NM_000082.3:c.618-1G>A, NM_000082.3:c.593_594dupAT, NM_000082.3:c.613G>C, NM_000082.3:c.966C>A, NM_000082.3:c.37G>T | Cockayne syndrome type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC8 gene located on chromosomal region 5q12.1. The age of onset is variable. This disease is characterised by normal prenatal growth with the onset of growth and developmental abnormalities in the first two years. The prevalence is 2.7/1,000,000 newborns in Western Europe. | 600 |
| ESCO2 | Roberts syndrome | NM_001017420.2 | NM_001017420.2:c.1615T>G, NM_001017420.2:c.879_880delAG, NM_001017420.2:c.1597dupT, NM_001017420.2:c.505C>T, NM_001017420.2:c.291_292insGA, NM_001017420.2:c.308_309delAA, NM_001017420.2:c.876_879delCAGA, NM_001017420.2:c.874_877delGACA | Roberts syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESCO2 gene located on chromosomal region 8p21.1. The age of onset is neonatal/infantile. This disease is characterised by pre- and postnatal growth retardation, severe symmetric limb reduction defects, craniofacial anomalies and severe intellectual deficit. | 600 |
| ESCO2 | SC Phocomelia syndrome | NM_001017420.2 | NM_001017420.2:c.1269G>A, NM_001017420.2:c.604C>T | SC phocomelia syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESCO2 gene located on chromosomal region 8p21.1. The age of onset is neonatal/infantile. This disease has a milder phenotype than Roberts syndrome, with a lesser degree of symmetric limb reduction and additionally includes flexion contractures of various joints, midfacial hemangioma, hypoplastic cartilage of ears and nose, scant silvery-blond hair, and cloudy corneae. Although microcephaly is present, mental retardation may be mild and survival into adulthood is common. | 600 |
| ESPN | Deafness type 36, autosomal recessive | NM_031475.2 | NM_031475.2:c.1988_1991delAGAG, NM_031475.2:c.2230G>A, NM_031475.2:c.2470_2473delTCAG | Autosomal recessive nonsyndromic sensorineural deafness type DFNB36 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESPN gene located on chromosomal region 1p36.31. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. | 600 |
| ESRRB | Deafness type 35, autosomal recessive | NM_004452.3 | NM_004452.3:c.329C>T | Autosomal recessive nonsyndromic sensorineural deafness type DFNB35 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESRRB gene located on chromosomal region 14q24.3. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. | 600 |
| ETFA | Glutaric acidemia type 2A | NM_000126.3 | NM_000126.3:c.470T>G, NM_000126.3:c.797C>T | Glutaric acidemia type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFA gene located on chromosomal region 15q23-q25. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure. | 600 |
| ETFB | Glutaric acidemia type 2B | NM_001985.2 | NM_001985.2:c.278_279insG, NM_001985.2:c.490C>T, NM_001985.2:c.491G>A, NM_001985.2:c.382G>A, NM_001985.2:c.58-53_58-52insG, NM_001985.2:c.61C>T, NM_001985.2:c.614_616delAGA | Glutaric acidemia type 2B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFB gene located on chromosomal region 19q13.3. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure. | 600 |
| ETFDH | Glutaric acidemia type 2C | NM_004453.3 | NM_004453.3:c.1823delG, NM_004453.3:c.1570_1571delCT, NM_004453.3:c.2T>C, NM_004453.3:c.1234G>T, NM_004453.3:c.250G>A, NM_004453.3:c.1351G>C, NM_004453.3:c.1367C>T, NM_004453.3:c.524G>T, NM_004453.3:c.1001T>C, NM_004453.3:c.1773_1774delAT, NM_004453.3:c.1832G>A, NM_004453.3:c.508G>T, NM_004453.3:c.413T>G, NM_004453.3:c.643G>A | Glutaric acidemia type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFDH gene located on chromosomal region 4q32-q35. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure. | 600 |
| ETHE1 | Ethylmalonic encephalopathy | NM_014297.3 | NM_014297.3:c.487C>T, NM_014297.3:c.554T>G, NM_014297.3:c.440_450delACAGCATGGCC, NM_014297.3:c.604dupG, NM_014297.3:c.221dupA, NM_014297.3:c.488G>A | Ethylmalonic encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETHE1 gene located on chromosomal region 19q13.31. The age of onset is neonatal/infantile. This disease is characterised by elevated excretion of ethylmalonic acid with recurrent petechiae, orthostatic acrocyanosis and chronic diarrhoea associated with neurodevelopmental delay, psychomotor regression and hypotonia with brain magnetic resonance imaging abnormalities. The prevalence is below 1/1,000,000, with total of 30 cases of patients reported worldwide, mainly for Mediterranean and Arab populations. | 600 |
| EYS | Retinitis pigmentosa type 25 | NM_001142800.1 | NM_001142800.1:c.5044G>T, NM_001142800.1:c.9036delT, NM_001142800.1:c.490C>T, NM_001142800.1:c.5928-2A>G, NM_001142800.1:c.571dupA, NM_001142800.1:c.4597_4613delTCAAGCAACCAGAGACT, NM_001142800.1:c.7822C>T, NM_001142800.1:c.5857G>T, NM_001142800.1:c.6170delA, NM_001142800.1:c.8569G>T, NM_001142800.1:c.232delT, NM_001142800.1:c.6102_6103insT, NM_001142800.1:c.8834G>A, NM_001142800.1:c.1211_1212insA, NM_001142800.1:c.4350_4356delTATAGCT, NM_001142800.1:c.4469_4470insAGCCCCTC, NM_001142800.1:c.8648_8655delCATGCAGA, NM_001142800.1:c.4120C>T, NM_001142800.1:c.863-4_863-3insT, NM_001142800.1:c.8629_8632dupACAG, NM_001142800.1:c.9299_9302delCTCA, NM_001142800.1:c.103C>T, NM_001142800.1:c.2826_2827delAT, NM_001142800.1:c.4045C>T, NM_001142800.1:c.5757_5758insT, NM_001142800.1:c.8408dupA, NM_001142800.1:c.7095T>G, NM_001142800.1:c.3329C>G, NM_001142800.1:c.9405T>A | Retinitis pigmentosa 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EYS gene located on chromosomal region 6q12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000. | 250,600 |
| F11 | Factor 11 deficiency | NM_000128.3 | NM_000128.3:c.1613C>T, NM_000128.3:c.166T>C, NM_000128.3:c.403G>T, NM_000128.3:c.731A>G, NM_000128.3:c.809A>T, NM_000128.3:c.1693G>A, NM_000128.3:c.1211C>A, NM_000128.3:c.901T>C, NM_000128.3:c.595+3A>G, NM_000128.3:c.438C>A | Factor 11 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F11 gene located on chromosomal region 4q35. The age of onset is variable. This disease is characterized by reduced levels and activity of factor XI resulting in moderate bleeding symptoms, usually occurring after trauma or surgery. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| F5 | Factor 5 deficiency | NM_000130.4 | NM_000130.4:c.4876delA, NM_000130.4:c.439G>T, NM_000130.4:c.6419G>A, NM_000130.4:c.2401C>T, NM_000130.4:c.5521G>A, NM_000130.4:c.1083G>A, NM_000130.4:c.5189A>G, NM_000130.4:c.3799delC, NM_000130.4:c.6304C>T | Factor 5 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F5 gene located on chromosomal region 1q23. The age of onset is variable. This disease is characterized by mild to severe bleeding symptoms usually occurring after trauma or surgery. In severe forms of the disease, there can be a risk of intracranial, pulmonary or gastrointestinal bleedings. The severity of the bleeding manifestations correlates with the FV levels. The prevalence is 1/5,000. | 250,600 |
| F5 | Thrombosis | NM_000130.4 | NM_000130.4:c.1000A>G | Deep venous thrombosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F5 gene located on chromosomal region 1q23. The age of onset is variable. This disease is characterized by a poor anticoagulant response to activated Protein C and an increased risk for venous thromboembolism. Deep venous thrombosis and pulmonary embolism are the most common manifestations, but thrombosis in unusual locations also occurs. The prevalence is 1/5,000. | 250,600 |
| F8 | Hemophilia A | NM_000132.3 | NM_000132.3:c.1075_1078delAATG, NM_000132.3:c.1042T>C, NM_000132.3:c.1078_1079delGA, NM_000132.3:c.120delC, NM_000132.3:c.1214T>G, NM_000132.3:c.1090G>A, NM_000132.3:c.1207C>G, NM_000132.3:c.1331_1332delAAinsT, NM_000132.3:c.1175C>A, NM_000132.3:c.1335dupC, NM_000132.3:c.1203G>A, NM_000132.3:c.128dupT, NM_000132.3:c.1331A>C, NM_000132.3:c.1301G>A, NM_000132.3:c.1234T>C, NM_000132.3:c.1316G>A, NM_000132.3:c.1293delG, NM_000132.3:c.1200_1201delTT, NM_000132.3:c.1310delG, NM_000132.3:c.1331_1332delAA, NM_000132.3:c.1410_1413delTTTA, NM_000132.3:c.1420G>T, NM_000132.3:c.143+1G>A, NM_000132.3:c.1432G>A, NM_000132.3:c.1438_1439delCT, NM_000132.3:c.1440_1441insA, NM_000132.3:c.144-11T>G, NM_000132.3:c.1442_1443dupTG, NM_000132.3:c.1175C>G, NM_000132.3:c.1324T>A, NM_000132.3:c.1324T>C, NM_000132.3:c.1325A>G, NM_000132.3:c.144-5C>G, NM_000132.3:c.1463C>G, NM_000132.3:c.1463C>T, NM_000132.3:c.1467_1472dupCAGACC, NM_000132.3:c.1477A>G, NM_000132.3:c.1538-1G>T, NM_000132.3:c.1538-2A>T, NM_000132.3:c.1560delT, NM_000132.3:c.1564_1565delATinsTA, NM_000132.3:c.1585A>G, NM_000132.3:c.1594T>G, NM_000132.3:c.1189_1190insC, NM_000132.3:c.1443+3A>C, NM_000132.3:c.1596G>A, NM_000132.3:c.1618C>A, NM_000132.3:c.1619C>G, NM_000132.3:c.1630G>A, NM_000132.3:c.1639T>C, NM_000132.3:c.1337G>A, NM_000132.3:c.1337G>C, NM_000132.3:c.1338delA, NM_000132.3:c.1348T>G, NM_000132.3:c.1357G>T, NM_000132.3:c.1390G>T, NM_000132.3:c.1595G>A, NM_000132.3:c.1596dupG, NM_000132.3:c.1400T>G, NM_000132.3:c.1406G>C, NM_000132.3:c.1736A>T, NM_000132.3:c.173delC, NM_000132.3:c.1752+5G>C, NM_000132.3:c.185C>G, NM_000132.3:c.1904-1G>A, NM_000132.3:c.1904-37G>A, NM_000132.3:c.1912G>A, NM_000132.3:c.1913G>A, NM_000132.3:c.1924_1927delGATA, NM_000132.3:c.1934A>C, NM_000132.3:c.1941_1944delAGTT, NM_000132.3:c.1943_1946delTTTG, NM_000132.3:c.1952A>C, NM_000132.3:c.195C>A, NM_000132.3:c.1985G>C, NM_000132.3:c.1988C>T, NM_000132.3:c.1990_1991delCA, NM_000132.3:c.1991A>C, NM_000132.3:c.199_200delAA, NM_000132.3:c.1992_1995dupGACT, NM_000132.3:c.1996_1999delGACT, NM_000132.3:c.1999delT, NM_000132.3:c.199A>G, NM_000132.3:c.1A>G, NM_000132.3:c.2009_2011delTCT, NM_000132.3:c.200A>C, NM_000132.3:c.201G>T, NM_000132.3:c.202_203insGA, NM_000132.3:c.202_207delACTCTG, NM_000132.3:c.2029T>C, NM_000132.3:c.2032A>T, NM_000132.3:c.203C>A, NM_000132.3:c.2057C>G, NM_000132.3:c.2058_2059delAC, NM_000132.3:c.2060T>C, NM_000132.3:c.2066T>G, NM_000132.3:c.1394C>G, NM_000132.3:c.1397G>A, NM_000132.3:c.2077_2078delTCinsCT, NM_000132.3:c.2088_2089delTG, NM_000132.3:c.2090T>A, NM_000132.3:c.2095A>C, NM_000132.3:c.2095A>G, NM_000132.3:c.2095A>T, NM_000132.3:c.1086G>A, NM_000132.3:c.2097G>A, NM_000132.3:c.1164delC, NM_000132.3:c.1172G>C, NM_000132.3:c.214G>A, NM_000132.3:c.217T>C, NM_000132.3:c.1187A>T, NM_000132.3:c.224delA, NM_000132.3:c.225T>A, NM_000132.3:c.1202G>A, NM_000132.3:c.2338delA, NM_000132.3:c.2360delA, NM_000132.3:c.2372dupG, NM_000132.3:c.2374delT, NM_000132.3:c.2383A>G, NM_000132.3:c.2384_2388delGAACA, NM_000132.3:c.2397delT, NM_000132.3:c.2404C>T, NM_000132.3:c.2409delT, NM_000132.3:c.2412_2421delCTCCTCTAGT, NM_000132.3:c.2419dupA, NM_000132.3:c.2462_2463delGG, NM_000132.3:c.250_255delAGGCCA, NM_000132.3:c.250A>G, NM_000132.3:c.253_255delCCA, NM_000132.3:c.265+1G>T, NM_000132.3:c.265G>A, NM_000132.3:c.3031A>T, NM_000132.3:c.3034G>C, NM_000132.3:c.3053delA, NM_000132.3:c.3150_3151insTC, NM_000132.3:c.3152delT, NM_000132.3:c.3168_3187delTGAGTTTAAAAAAGTGACAC, NM_000132.3:c.3196C>T, NM_000132.3:c.3202_3203delAG, NM_000132.3:c.3224delC, NM_000132.3:c.3251C>G, NM_000132.3:c.3255_3258delTAAA, NM_000132.3:c.3279G>A, NM_000132.3:c.3289C>T, NM_000132.3:c.3295delA, NM_000132.3:c.3298A>T, NM_000132.3:c.3302_3303delAG, NM_000132.3:c.3344delT, NM_000132.3:c.3371C>A, NM_000132.3:c.144-26A>T, NM_000132.3:c.1443+1G>A, NM_000132.3:c.1443+2T>C, NM_000132.3:c.3409_3410delCT, NM_000132.3:c.3416_3417delCT, NM_000132.3:c.3417dupT, NM_000132.3:c.3421C>T, NM_000132.3:c.3490delT, NM_000132.3:c.3493G>T, NM_000132.3:c.3496A>T, NM_000132.3:c.3500dupA, NM_000132.3:c.3505delG, NM_000132.3:c.3540delA, NM_000132.3:c.3548_3549delAA, NM_000132.3:c.3565dupA, NM_000132.3:c.3607G>T, NM_000132.3:c.3624delT, NM_000132.3:c.3631A>T, NM_000132.3:c.3651delA, NM_000132.3:c.3652delG, NM_000132.3:c.3710delC, NM_000132.3:c.3721_3739del19ins6, NM_000132.3:c.3735_3744delCCTTTTCTTAinsATTTCTTTTTCTTT, NM_000132.3:c.3736delC, NM_000132.3:c.3756delG, NM_000132.3:c.3766G>T, NM_000132.3:c.3771delT, NM_000132.3:c.3827C>G, NM_000132.3:c.3830delC, NM_000132.3:c.3833delA, NM_000132.3:c.3842_3844delAGAinsGG, NM_000132.3:c.3844A>T, NM_000132.3:c.3847_3848delCA, NM_000132.3:c.3858delT, NM_000132.3:c.3860delT, NM_000132.3:c.3863dupC, NM_000132.3:c.3870dupA, NM_000132.3:c.3886delT, NM_000132.3:c.3902delA, NM_000132.3:c.3907_3911delACCAA, NM_000132.3:c.3913C>T, NM_000132.3:c.3922G>T, NM_000132.3:c.3940A>C, NM_000132.3:c.3964C>T, NM_000132.3:c.3967C>T, NM_000132.3:c.3982C>T, NM_000132.3:c.3984dupA, NM_000132.3:c.3991_3992delAA, NM_000132.3:c.3994_3997delAGAG, NM_000132.3:c.4006C>T, NM_000132.3:c.4034delA, NM_000132.3:c.403G>A, NM_000132.3:c.4045delA, NM_000132.3:c.404A>G, NM_000132.3:c.405T>A, NM_000132.3:c.4072C>T, NM_000132.3:c.407A>C, NM_000132.3:c.4093_4099delCATTTGA, NM_000132.3:c.4100delC, NM_000132.3:c.4113_4153dup41, NM_000132.3:c.4156C>T, NM_000132.3:c.415C>T, NM_000132.3:c.4197delC, NM_000132.3:c.4201C>T, NM_000132.3:c.421G>T, NM_000132.3:c.4241C>A, NM_000132.3:c.4242dupA, NM_000132.3:c.4264_4265delTA, NM_000132.3:c.2071C>A, NM_000132.3:c.2072C>T, NM_000132.3:c.4293_4297delCTCTT, NM_000132.3:c.4296_4300delTTCTC, NM_000132.3:c.430G>T, NM_000132.3:c.4318delT, NM_000132.3:c.4336delG, NM_000132.3:c.4339dupG, NM_000132.3:c.2096T>A, NM_000132.3:c.4345delG, NM_000132.3:c.209T>C, NM_000132.3:c.2101_2105delATGGA, NM_000132.3:c.4363C>T, NM_000132.3:c.4382_4383delAC, NM_000132.3:c.223G>T, NM_000132.3:c.4408G>T, NM_000132.3:c.440T>A, NM_000132.3:c.230T>C, NM_000132.3:c.4424_4425delAA, NM_000132.3:c.4426_4427delAG, NM_000132.3:c.4429_4430delGA, NM_000132.3:c.4446dupG, NM_000132.3:c.4450delA, NM_000132.3:c.4458delA, NM_000132.3:c.446delC, NM_000132.3:c.4473C>A, NM_000132.3:c.4473C>G, NM_000132.3:c.4474A>T, NM_000132.3:c.4483delG, NM_000132.3:c.4483G>T, NM_000132.3:c.4491_4492delTG, NM_000132.3:c.4491_4495delTGTTC, NM_000132.3:c.4492_4496delGTTCT, NM_000132.3:c.4492delG, NM_000132.3:c.4512_4513ins32, NM_000132.3:c.4512delG, NM_000132.3:c.4513_4515delCCCinsGCAAAGTTGGTTTGCCAAAACCATGTTGCCG, NM_000132.3:c.4519delA, NM_000132.3:c.4531G>A, NM_000132.3:c.4542delT, NM_000132.3:c.4543_4544delCCinsA, NM_000132.3:c.4549_4550delGT, NM_000132.3:c.4561C>T, NM_000132.3:c.4619delT, NM_000132.3:c.4658delA, NM_000132.3:c.4662_4663delGA, NM_000132.3:c.4665_4688del24insAAGGAA, NM_000132.3:c.4672_4675delAACA, NM_000132.3:c.4683delA, NM_000132.3:c.4687delG, NM_000132.3:c.4694_4697delTTCT, NM_000132.3:c.4697_4701dupTGAGA, NM_000132.3:c.4710_4713delAGAA, NM_000132.3:c.3385delC, NM_000132.3:c.3388delA, NM_000132.3:c.3402delG, NM_000132.3:c.472C>T, NM_000132.3:c.476T>C, NM_000132.3:c.4770T>A, NM_000132.3:c.4794G>T, NM_000132.3:c.4798A>T, NM_000132.3:c.4805_4806delAA, NM_000132.3:c.4805delA, NM_000132.3:c.4814C>A, NM_000132.3:c.4825delA, NM_000132.3:c.4828G>T, NM_000132.3:c.4841delA, NM_000132.3:c.4848delC, NM_000132.3:c.4856delC, NM_000132.3:c.4858delC, NM_000132.3:c.4864G>A, NM_000132.3:c.4895delT, NM_000132.3:c.4895dupT, NM_000132.3:c.4899delT, NM_000132.3:c.489T>A, NM_000132.3:c.4918G>T, NM_000132.3:c.4922dupT, NM_000132.3:c.4925A>G, NM_000132.3:c.4926delA, NM_000132.3:c.4934G>A, NM_000132.3:c.4935G>A, NM_000132.3:c.493C>T, NM_000132.3:c.4942C>T, NM_000132.3:c.4969C>T, NM_000132.3:c.4979C>T, NM_000132.3:c.4987A>T, NM_000132.3:c.4996C>T, NM_000132.3:c.4999delC, NM_000132.3:c.5010delT, NM_000132.3:c.5012G>A, NM_000132.3:c.514_515insTCAAGATA, NM_000132.3:c.514T>C, NM_000132.3:c.515G>A, NM_000132.3:c.519_523delTACCT, NM_000132.3:c.5220-1G>A, NM_000132.3:c.5226_5227delGA, NM_000132.3:c.5243delA, NM_000132.3:c.5251A>T, NM_000132.3:c.5254delG, NM_000132.3:c.525C>A, NM_000132.3:c.5269delT, NM_000132.3:c.5269T>C, NM_000132.3:c.5291A>G, NM_000132.3:c.5301C>A, NM_000132.3:c.5308G>A, NM_000132.3:c.5321A>T, NM_000132.3:c.532C>G, NM_000132.3:c.5330T>C, NM_000132.3:c.5337delG, NM_000132.3:c.5339C>T, NM_000132.3:c.5343T>A, NM_000132.3:c.5345T>G, NM_000132.3:c.5348_5357delGAGCAGAAGT, NM_000132.3:c.535T>C, NM_000132.3:c.545A>T, NM_000132.3:c.553A>G, NM_000132.3:c.556G>A, NM_000132.3:c.557_559delACT, NM_000132.3:c.557A>G, NM_000132.3:c.560T>A, NM_000132.3:c.566C>A, NM_000132.3:c.5674G>A, NM_000132.3:c.5675dupT, NM_000132.3:c.5680G>A, NM_000132.3:c.5686G>C, NM_000132.3:c.5689_5690delCT, NM_000132.3:c.5696dupT, NM_000132.3:c.5697delC, NM_000132.3:c.5712G>C, NM_000132.3:c.5718dupA, NM_000132.3:c.5719A>T, NM_000132.3:c.571C>T, NM_000132.3:c.5721C>G, NM_000132.3:c.5722_5723delTGinsTCATCAAAGTACTTCAAAAA, NM_000132.3:c.5752delT, NM_000132.3:c.5766C>A, NM_000132.3:c.577G>A, NM_000132.3:c.5816-14delGTinsTA, NM_000132.3:c.5816C>A, NM_000132.3:c.5816C>T, NM_000132.3:c.5825G>T, NM_000132.3:c.5833A>G, NM_000132.3:c.5853A>C, NM_000132.3:c.5861_5866delCTCAGG, NM_000132.3:c.5869C>T, NM_000132.3:c.5879G>T, NM_000132.3:c.5881T>A, NM_000132.3:c.5884T>G, NM_000132.3:c.5888T>C, NM_000132.3:c.5891T>C, NM_000132.3:c.5894G>T, NM_000132.3:c.589_591delGTA, NM_000132.3:c.5914_5915delAT, NM_000132.3:c.5923dupA, NM_000132.3:c.5924T>A, NM_000132.3:c.5934T>G, NM_000132.3:c.5939A>C, NM_000132.3:c.5953delC, NM_000132.3:c.5954G>C, NM_000132.3:c.5955_5956delAA, NM_000132.3:c.5955delA, NM_000132.3:c.5964_5967dupGGAG, NM_000132.3:c.5999G>C, NM_000132.3:c.6016G>T, NM_000132.3:c.6037G>A, NM_000132.3:c.6046C>G, NM_000132.3:c.6070dupC, NM_000132.3:c.6078_6079delTG, NM_000132.3:c.6082delG, NM_000132.3:c.6089dupG, NM_000132.3:c.6094C>T, NM_000132.3:c.6099delT, NM_000132.3:c.6107A>G, NM_000132.3:c.6115+1G>A, NM_000132.3:c.6115+2T>C, NM_000132.3:c.6115+3G>T, NM_000132.3:c.6115+4A>G, NM_000132.3:c.6115+6T>A, NM_000132.3:c.6116-2A>G, NM_000132.3:c.6116_6117delAG, NM_000132.3:c.6120_6135delTCAGACTCCCCTGGGA, NM_000132.3:c.6120T>A, NM_000132.3:c.6127delC, NM_000132.3:c.6134G>T, NM_000132.3:c.6135dupA, NM_000132.3:c.6194G>A, NM_000132.3:c.6202_6257dup56, NM_000132.3:c.6213A>T, NM_000132.3:c.6239C>T, NM_000132.3:c.6242G>C, NM_000132.3:c.6243G>C, NM_000132.3:c.6250A>T, NM_000132.3:c.6253G>T, NM_000132.3:c.6263C>T, NM_000132.3:c.6269T>A, NM_000132.3:c.6273+1G>A, NM_000132.3:c.6430-3C>G, NM_000132.3:c.6449A>T, NM_000132.3:c.6464_6465delAA, NM_000132.3:c.6465delA, NM_000132.3:c.6467_6468delAC, NM_000132.3:c.6469_6470delAA, NM_000132.3:c.6473delT, NM_000132.3:c.6482C>A, NM_000132.3:c.6482C>T, NM_000132.3:c.6488T>G, NM_000132.3:c.6489delT, NM_000132.3:c.6494delC, NM_000132.3:c.6497delG, NM_000132.3:c.6501delC, NM_000132.3:c.6515C>G, NM_000132.3:c.6517_6519dupACT, NM_000132.3:c.6520C>G, NM_000132.3:c.6533G>A, NM_000132.3:c.6537C>G, NM_000132.3:c.6544C>G, NM_000132.3:c.6548T>G, NM_000132.3:c.6551A>T, NM_000132.3:c.6565_6566delGA, NM_000132.3:c.6574+1G>A, NM_000132.3:c.6574+1G>T, NM_000132.3:c.6574+3A>C, NM_000132.3:c.6574+5G>C, NM_000132.3:c.65G>C, NM_000132.3:c.6738delA, NM_000132.3:c.6739_6740delGA, NM_000132.3:c.6739G>T, NM_000132.3:c.6743G>C, NM_000132.3:c.6746T>G, NM_000132.3:c.6752T>A, NM_000132.3:c.6760C>T, NM_000132.3:c.6760delC, NM_000132.3:c.676A>T, NM_000132.3:c.6780_6788delAGGAGTAAC, NM_000132.3:c.6786_6787insCAA, NM_000132.3:c.6796G>A, NM_000132.3:c.6797delG, NM_000132.3:c.6797G>A, NM_000132.3:c.6804delA, NM_000132.3:c.680G>A, NM_000132.3:c.6825T>A, NM_000132.3:c.6827T>G, NM_000132.3:c.6836T>C, NM_000132.3:c.6836T>G, NM_000132.3:c.6839T>C, NM_000132.3:c.6842T>C, NM_000132.3:c.684_685delCT, NM_000132.3:c.6856_6866delGATGGCCATCA, NM_000132.3:c.6865C>T, NM_000132.3:c.6869G>T, NM_000132.3:c.6870G>A, NM_000132.3:c.687_688delAG, NM_000132.3:c.6886delA, NM_000132.3:c.6900+1G>A, NM_000132.3:c.6901-2A>G, NM_000132.3:c.6904T>G, NM_000132.3:c.6905T>C, NM_000132.3:c.6912_6916delAAATC, NM_000132.3:c.6915delT, NM_000132.3:c.6919_6920delGA, NM_000132.3:c.6921delC, NM_000132.3:c.693_696delAAAG, NM_000132.3:c.6969_6977delCTACCTTCG, NM_000132.3:c.6976C>G, NM_000132.3:c.6986C>T, NM_000132.3:c.6988delC, NM_000132.3:c.6995G>C, NM_000132.3:c.6996G>A, NM_000132.3:c.6997delG, NM_000132.3:c.7012delC, NM_000132.3:c.7016G>T, NM_000132.3:c.7021G>T, NM_000132.3:c.7030G>A, NM_000132.3:c.7030G>T, NM_000132.3:c.7031G>A, NM_000132.3:c.7033_7040delTGCGAGGC, NM_000132.3:c.7034G>A, NM_000132.3:c.709C>T, NM_000132.3:c.729delT, NM_000132.3:c.73delT, NM_000132.3:c.755C>A, NM_000132.3:c.760A>T, NM_000132.3:c.764G>A, NM_000132.3:c.770_771insCC, NM_000132.3:c.775A>T, NM_000132.3:c.779C>G, NM_000132.3:c.77T>C, NM_000132.3:c.787+2T>C, NM_000132.3:c.787G>C, NM_000132.3:c.788-1G>A, NM_000132.3:c.788-1G>C, NM_000132.3:c.788-1G>T, NM_000132.3:c.788-2A>T, NM_000132.3:c.796G>T, NM_000132.3:c.820T>C, NM_000132.3:c.822G>A, NM_000132.3:c.824A>G, NM_000132.3:c.832G>A, NM_000132.3:c.836T>A, NM_000132.3:c.849delT, NM_000132.3:c.850G>A, NM_000132.3:c.850G>T, NM_000132.3:c.86T>G, NM_000132.3:c.871G>T, NM_000132.3:c.872A>G, NM_000132.3:c.883T>C, NM_000132.3:c.886C>T, NM_000132.3:c.889delG, NM_000132.3:c.88G>A, NM_000132.3:c.899A>C, NM_000132.3:c.899A>T, NM_000132.3:c.902G>C, NM_000132.3:c.906delG, NM_000132.3:c.912C>T, NM_000132.3:c.918delA, NM_000132.3:c.920T>G, NM_000132.3:c.935delT, NM_000132.3:c.941C>T, NM_000132.3:c.943delG, NM_000132.3:c.948_951delAACA, NM_000132.3:c.967G>A, NM_000132.3:c.974_975delTT, NM_000132.3:c.97T>G, NM_000132.3:c.984delT, NM_000132.3:c.985dupT, NM_000132.3:c.986G>A, NM_000132.3:c.986G>C, NM_000132.3:c.986G>T, NM_000132.3:c.98G>A, NM_000132.3:c.1726G>T, NM_000132.3:c.4345G>T, NM_000132.3:c.435_436insTTT, NM_000132.3:c.433G>C, NM_000132.3:c.4719_4729delTGCAAAGACTC, NM_000132.3:c.439_447dupGTCTTCCCT, NM_000132.3:c.4720delG, NM_000132.3:c.1661G>A, NM_000132.3:c.4423C>T, NM_000132.3:c.1703G>T, NM_000132.3:c.1640G>A, NM_000132.3:c.1682A>C, NM_000132.3:c.1681G>A, NM_000132.3:c.1667T>A, NM_000132.3:c.4272delC, NM_000132.3:c.1653T>G, NM_000132.3:c.471G>A, NM_000132.3:c.1688C>G, NM_000132.3:c.4280delT, NM_000132.3:c.1675G>T | Hemophilia A follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F8 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor VIII deficiency. The prevalence is 1/4,000 to 1/ 5,000 male newborns. | 600 |
| F8 | Hemophilia A | - | Inv22 (Detection by PCR) | Hemophilia A follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F8 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor VIII deficiency. The prevalence is 1/4,000 to 1/ 5,000 male newborns. | 600 |
| F9 | Hemophilia B | NM_000133.3 | NM_000133.3:c.1150C>T, NM_000133.3:c.52T>C, NM_000133.3:c.1031T>C, NM_000133.3:c.82T>C, NM_000133.3:c.1136G>A, NM_000133.3:c.79G>A, NM_000133.3:c.19A>T, NM_000133.3:c.80A>T | Hemophilia B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F9 gene located on chromosomal region Xq27.1-q27.2. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor IX deficiency. The prevalence is 1/100,000 to 9/100,000. | 250,600 |
| FAH | Tyrosinemia type 1 | NM_000137.2 | NM_000137.2:c.1141A>G, NM_000137.2:c.1069G>T, NM_000137.2:c.1090G>T, NM_000137.2:c.401C>A, NM_000137.2:c.456G>A, NM_000137.2:c.192G>T, NM_000137.2:c.607-6T>G, NM_000137.2:c.707-1G>A, NM_000137.2:c.939delC, NM_000137.2:c.103G>A, NM_000137.2:c.982C>T, NM_000137.2:c.837+1G>A, NM_000137.2:c.1009G>A, NM_000137.2:c.47A>T, NM_000137.2:c.554-1G>T, NM_000137.2:c.1027G>T, NM_000137.2:c.1062+5G>A, NM_000137.2:c.786G>A, NM_000137.2:c.1021C>T, NM_000137.2:c.782C>T | Tyrosinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAH gene located on chromosomal region 15q25.1. The age of onset is variable. This disease is characterized by progressive liver disease, renal tubular dysfunction, porphyria-like crises and a dramatic improvement in prognosis following treatment with nitisinone. The birth incidence is 1/100,000, notably in Québec, Canada, and the prevalence is 1/100,000 to 1/120,000 newborns. | 250,600 |
| FAM126A | Hypomyelination and congenital cataract | NM_032581.3 | NM_032581.3:c.191A>G, NM_032581.3:c.158T>C | Hypomyelination - congenital cataract follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAM126A gene located on chromosomal region 7p15.3. The age of onset is neonatal/infantile. This disease is characterized by the onset of cataract either at birth or in the first two months of life, delayed psychomotor development by the end of the first year of life and moderate intellectual deficit. The prevalence is below 1/1,000,000. | 600 |
| FAM20C | Osteosclerotic bone dysplasia | NM_020223.3 | NM_020223.3:c.1093G>C, NM_020223.3:c.773T>A, NM_020223.3:c.1364-5C>T, NM_020223.3:c.1163T>G, NM_020223.3:c.838G>A, NM_020223.3:c.1351G>A | Osteosclerotic bone dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAM20C gene located on chromosomal region 7p22.3. The age of onset is neonatal/infantile. This disease is characterized by generalized osteosclerosis with periosteal bone formation, characteristic facial dysmorphism, brain abnormalities including intracerebral calcifications, and neonatal lethal course. The prevalence is below 1/1,000,000. | 600 |
| FANCA | Fanconi anemia, complementation group A | NM_000135.2 | NM_000135.2:c.3788_3790delTCT, NM_000135.2:c.2303T>C, NM_000135.2:c.3558_3559insG, NM_000135.2:c.4130C>G, NM_000135.2:c.233_236delTTGA, NM_000135.2:c.3763G>T, NM_000135.2:c.1115_1118delTTGG, NM_000135.2:c.131_132insA | Fanconi anemia complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCA gene located on chromosomal region 16q24.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| FANCC | Fanconi anemia, complementation group C | NM_000136.2 | NM_000136.2:c.1642C>T, NM_000136.2:c.37C>T, NM_000136.2:c.996+1G>T, NM_000136.2:c.67delG, NM_000136.2:c.416G>A, NM_000136.2:c.1015delA, NM_000136.2:c.1487T>G, NM_000136.2:c.1103_1104delTG | Fanconi anemia complementation group C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCC gene located on chromosomal region 9q22.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| FANCD2 | Fanconi anemia, complementation group D2 | NM_033084.3 | NM_033084.3:c.1278+1delG, NM_033084.3:c.2152C>T, NM_033084.3:c.2494+2T>C, NM_033084.3:c.958C>T, NM_033084.3:c.2444G>A, NM_033084.3:c.782A>T, NM_033084.3:c.904C>T | Fanconi anemia complementation group D2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCD2 gene located on chromosomal region 3p26. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| FANCE | Fanconi anemia, complementation group E | NM_021922.2 | NM_021922.2:c.1501C>T, NM_021922.2:c.929_930insC, NM_021922.2:c.421C>T, NM_021922.2:c.1114-8G>A, NM_021922.2:c.922_923insC, NM_021922.2:c.355C>T | Fanconi anemia complementation group E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCE gene located on chromosomal region 6p22-p21. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 600 |
| FANCG | Fanconi anemia, complementation group G | NM_004629.1 | NM_004629.1:c.1795_1804delTGGATCCGTC, NM_004629.1:c.313G>T, NM_004629.1:c.637_643delTACCGCC, NM_004629.1:c.1480+1G>C, NM_004629.1:c.1852_1853delAA, NM_004629.1:c.510+1G>A, NM_004629.1:c.1077-2A>G, NM_004629.1:c.908_909insCT | Fanconi anemia complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCG gene located on chromosomal region 9p13. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| FANCI | Fanconi anemia, complementation group I | NM_001113378.1 | NM_001113378.1:c.3816+1G>A, NM_001113378.1:c.52C>T, NM_001113378.1:c.989_991delTAA, NM_001113378.1:c.2097C>G, NM_001113378.1:c.3466G>C, NM_001113378.1:c.2292-1G>A, NM_001113378.1:c.3492delG, NM_001113378.1:c.3853C>T, NM_001113378.1:c.3626_3627delGT, NM_001113378.1:c.3854G>A | Fanconi anemia complementation group I follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCI gene located on chromosomal region 15q26.1. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| FANCL | Fanconi anemia, complementation group L | NM_018062.3 | NM_018062.3:c.1051_1052delAG, NM_018062.3:c.1066_1067delAG, NM_018062.3:c.1096_1099dupATTA, NM_018062.3:c.1099_1100insATTA | Fanconi anemia complementation group L follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCL gene located on chromosomal region 2p16.1. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| FANCM | Fanconi anemia, complementation group M | NM_020937.2 | NM_020937.2:c.2171C>A, NM_020937.2:c.5766_5769delGACT, NM_020937.2:c.5101C>T, NM_020937.2:c.1072G>T, NM_020937.2:c.2996_2997insC, NM_020937.2:c.2586_2589delAAAA, NM_020937.2:c.5791C>T, NM_020937.2:c.624_625delAA, NM_020937.2:c.5569G>A, NM_020937.2:c.5764_5767delCTGA | Fanconi anemia complementation group M follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCM gene located on chromosomal region 14q21.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| FGA | Congenital fibrinogen deficiency (gene FGA) | NM_021871.2 | NM_021871.2:c.1039C>T, NM_021871.2:c.1441delG, NM_021871.2:c.*675_*676insC, NM_021871.2:c.1359dupC, NM_021871.2:c.*1086delG, NM_021871.2:c.1906_1907insC | Congenital fibrinogen deficiency (gene FGA) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGA gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000. | 600 |
| FGB | Congenital afibrinogenemia | NM_005141.4 | NM_005141.4:c.1289G>A, NM_005141.4:c.1148T>G, NM_005141.4:c.794C>T | Congenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGB gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| FGD4 | Charcot-Marie-Tooth disease type 4H | NM_139241.2 | NM_139241.2:c.1325G>A, NM_139241.2:c.893T>G, NM_139241.2:c.893T>C, NM_139241.2:c.670C>T | Charcot-Marie-Tooth disease type 4H follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGD4 gene located on chromosomal region 12p11.21. The age of onset is neonatal/infantile. This disease is characterized by slowly progressive muscle weakness in the distal extremities, and other common features include delayed walking, an abnormal gait, scoliosis and pes equines with toe retraction. The prevalence is 1/3,300. | 600 |
| FH | Fumaric aciduria | NM_000143.3 | NM_000143.3:c.1067T>A, NM_000143.3:c.697C>T, NM_000143.3:c.698G>A, NM_000143.3:c.1236+1G>C, NM_000143.3:c.901dupA, NM_000143.3:c.320A>C, NM_000143.3:c.760C>T, NM_000143.3:c.1431_1433dupAAA, NM_000143.3:c.521C>G, NM_000143.3:c.1093A>G, NM_000143.3:c.1189G>A, NM_000143.3:c.1200delT, NM_000143.3:c.1394A>G, NM_000143.3:c.1255T>C, NM_000143.3:c.793G>A, NM_000143.3:c.40_41insC, NM_000143.3:c.1446_1449delAAAG, NM_000143.3:c.1293delA | Fumaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FH gene located on chromosomal region 1q42.1. The age of onset is neonatal/infantile. This disease is characterized by hypotonia, severe psychomotor impairment, convulsions, respiratory distress, feeding difficulties and frequent cerebral malformations, along with a distinctive facies, although some patients present with only moderate intellectual impairment. The prevalence is below 1,000,000. | 600 |
| FHL1 | Emery-Dreifuss muscular dystrophy type 6 | NM_001449.4 | NM_001449.4:c.625T>C | Emery-Dreifuss muscular dystrophy tipe 6 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FHL1 gene located on chromosomal region Xq26. The age of onset is infantile. This disease is by muscular weakness and atrophy, with early joint contractures and cardiomyopathy. The prevalence is 1/1,000,000 to 9/1,000,000. | 600 |
| FHL1 | Myopathy, reducing body | NM_001449.4 | NM_001449.4:c.689-479G>A, NM_001449.4:c.310T>C | Reducing body myopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FH gene located on chromosomal region 1q42.1. The age of onset is neonatal/infantile. This disease is characterized by progressive muscle weakness and the presence of characteristic inclusion bodies in affected muscle fibres. The prevalence is below 1,000,000. | 600 |
| FIG4 | Charcot-Marie-Tooth disease type 4J | NM_014845.5 | NM_014845.5:c.592C>T, NM_014845.5:c.831_838delTAAATTTG, NM_014845.5:c.547C>T, NM_014845.5:c.501C>G, NM_014845.5:c.737G>A, NM_014845.5:c.122T>C, NM_014845.5:c.2296_2297insG | Charcot-Marie-Tooth disease type 4J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by rapidly progressive, asymmetric motor neuron degeneration with slow nerve conduction velocities, weakness and paralysis, without sensory loss. The prevalence is 4/100,000 to 8/100,000. | 250,600 |
| FIG4 | Yunis-Varon syndrome | NM_014845.5 | NM_014845.5:c.311G>A | Yunis-Varon syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by skeletal defects, including cleidocranial dysplasia and digital anomalies, and severe neurologic involvement with neuronal loss. Enlarged cytoplasmic vacuoles are found in neurons, muscle, and cartilage. The disorder is usually lethal in infancy. The prevalence is 4/100,000 to 8/100,000. | 250,600 |
| FKRP | Congenital muscular dystrophy type 5B | NM_024301.4 | NM_024301.4:c.235G>A, NM_024301.4:c.1343C>T, NM_024301.4:c.1387A>G, NM_024301.4:c.1154C>A | Congenital muscular dystrophy type 5B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is neonatal/infantile. This disease is characterized by hypotonia, muscle wasting, weakness or delayed motor milestones. The prevalence is 1/14,500 to 1/123,000. | 250,600 |
| FKRP | Limb-girdle muscular dystrophy type 2I, autosomal recessive | NM_024301.4 | NM_024301.4:c.160C>T | Autosomal recessive limb-girdle muscular dystrophy type 2I follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is infantile. This disease is characterized by proximal limb girdle weakness predominant in the legs, together with bilateral moderate scapulae winging, abdominal muscle weakness, waddling gait, calf hypertrophy, cardiomyopathy and respiratory insufficiency. The prevalence is 1/14,500 to 1/123,000. | 250,600 |
| FKTN | Fukuyama congenital muscular dystrophy | NM_001079802.1 | NM_001079802.1:c.1112A>G, NM_001079802.1:c.509C>A, NM_001079802.1:c.411C>A, NM_001079802.1:c.1167dupA | Fukuyama congenital muscular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKTN gene located on chromosomal region 9q31-q33. The age of onset is infantile. This disease is characterized by brain malformation (cobblestone lissencephaly), dystrophic changes in skeletal muscle, severe intellectual deficit, epilepsy and motor impairment. The annual incidence is 1/50,000 to 2:50,000 live births in Japans and the prevalence is 1:1,000,000- 9:1,000,000. | 600 |
| FKTN | Muscular dystrophy, limb girdle, type 2M | NM_001079802.1 | NM_001079802.1:c.1380dupA, NM_001079802.1:c.766C>T, NM_001079802.1:c.527T>C, NM_001079802.1:c.340G>A | Limb-girdle muscular dystrophy type 2M follows autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKTN gene located on chromosomal region 9q31-q33. The age of onset is from birth to early infancy. This disease is characterized by muscle weakness, joint contractures and spinal deformities. The prevalence is 1.92:100,000-3.68:100,000. | 600 |
| FLNA | Frontometaphyseal dysplasia | NM_001456.3 | NM_001456.3:c.4447_4448insAT, NM_001456.3:c.760G>A, NM_001456.3:c.3476A>C, NM_001456.3:c.3557C>T | Fronto-metaphyseal dysplasia (FMD) follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FLNA gene located on chromosomal region Xq28. The age of onset is neonatal/infancy This disease is characterized by a characteristic face (prominent supraorbital ridges, hypertelorism, downslanted palpebral fissures, broad nasal bridge, and micrognathia with anomalies of teeth) and skeletal anomalies (fusion of carpal bones, increased density of long bone diaphyses, flared metaphyses and scoliosis). The prevalence is <1 / 1,000,000. | 600 |
| FLNA | Periventricular heterotopia | NM_001456.3 | NM_001456.3:c.4543C>T, NM_001456.3:c.7129C>T, NM_001456.3:c.7733-1G>C, NM_001456.3:c.7527_7528+6delAGGTGAGC, NM_001456.3:c.5108_5109delTCinsAA, NM_001456.3:c.2761C>T, NM_001456.3:c.4777_4778dupAA | Periventricular heterotopia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FLNA gene located on chromosomal region Xq28. The age of onset is neonatal/infancy This disease is a brain malformation, due to abnormal neuronal migration, in which a subset of neurons fails to migrate into the developing cerebral cortex and remains as nodules that line the ventricular surface. Classical form is a rare X-linked dominant disorder far more frequent in females who present normal intelligence to borderline intellectual deficit, epilepsy of variable severity and extra-central nervous system signs, especially cardiovascular defects or coagulopathy. The disorder is generally associated with prenatal lethality in males. The prevalence is <1 / 1,000,000. | 600 |
| FLVCR1 | Ataxia, posterior column, with retinitis pigmentosa | NM_014053.3 | NM_014053.3:c.361A>G, NM_014053.3:c.574T>C, NM_014053.3:c.739-2delA | Posterior column ataxia - Retinitis pigmentosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FLVCR1 gene located on chromosomal region 1q32.3. The age of onset is childhood. This disease is characterized by sensory ataxia, proprioceptive loss and blindness. The prevalence is <1 / 1.000.000. | 600 |
| FMR1 | Fragile X syndrome | - | (CGG)n pre-mutated allele (Detection by PCR and TP-PCR) | Fragile X syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FMR1 gene located on chromosomal region Xq27.3. The symptoms are variable depending on the range of CGG triplet expansion. In complete mutation the onset is infantile in men and is characterized by intellectual disability, characteristic appearance (large head, long face, prominent forehead and chin, protruding ears) joint laxity and large testes after puberty. In carrier female, the symptoms are milder and include primary ovarian insufficiency. The prevalence is 1/2,500 (full mutation allele) to 1/4,000 (prevalence of symptomatic cases) for both genders. | 250,600 |
| FOXN1 | T-cell immunodeficiency, congenital alopecia, and nail dystrophy | NM_003593.2 | NM_003593.2:c.763C>T | Severe T-cell immunodeficiency - congenital alopecia - nail dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FOXN1 gene located on chromosomal region 17q11.2. The age of onset is infantile. This disease is characterized by T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. The prevalence is <1:1,000,000. | 600 |
| FRAS1 | Fraser syndrome | NM_025074.6 | NM_025074.6:c.7813C>T, NM_025074.6:c.832_835delTGTG, NM_025074.6:c.11159_11166delAGCTGGAG, NM_025074.6:c.776T>G, NM_025074.6:c.6991_6992insGG, NM_025074.6:c.6433C>T, NM_025074.6:c.3799C>T, NM_025074.6:c.1071+1_1071+4delGTGA, NM_025074.6:c.4969+1_4969+2insTAGC, NM_025074.6:c.5605_5606insT | Fraser syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the genes FRAS1 (located on chromosomal region 4q21.21) and FREM2 (located on chromosomal region 13q13.3). The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000. | 250,600 |
| FREM2 | Fraser syndrome | NM_207361.5 | NM_207361.5:c.2361_2362insC, NM_207361.5:c.8409+1G>A, NM_207361.5:c.5914G>A, NM_207361.5:c.5920G>A, NM_207361.5:c.3792_3795delTTAT | Fraser syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the genes FRAS1 (located on chromosomal region 4q21.21) and FREM2 (located on chromosomal region 13q13.3). The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000. | 600 |
| FUCA1 | Fucosidosis | NM_000147.4 | NM_000147.4:c.244C>T, NM_000147.4:c.1279C>T, NM_000147.4:c.856C>T, NM_000147.4:c.648C>A, NM_000147.4:c.1229T>G, NM_000147.4:c.433T>C | Fucosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FUCA1 gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is characterized by facial dysmorphism, dysostosis multiplex, moderate hepatomegaly, severe intellectual deficit, deafness, and according to age, angiokeratomas. The prevalence is <1:1,000,000. | 600 |
| FXN | Friedreich ataxia | NM_000144.4 | NM_000144.4:c.389G>T, NM_000144.4:c.460A>T, NM_000144.4:c.385-2A>G, NM_000144.4:c.317T>G | Friedreich ataxia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FXN gene located on chromosomal region 9q21.11. The age of onset is between age 10 and 15 years and usually before age 25 years. This disease is characterized by slowly progressive ataxia, dysarthria, muscle weakness, spasticity in the lower limbs, scoliosis, bladder dysfunction, absent lower limb reflexes, and loss of position and vibration sense. The prevalence is 2:100,000-4:100,000. | 600 |
| G6PC | Glycogen storage disease type 1a | NM_000151.3 | NM_000151.3:c.508C>T, NM_000151.3:c.551G>A, NM_000151.3:c.447-1G>A, NM_000151.3:c.1039C>T, NM_000151.3:c.562G>C, NM_000151.3:c.380_381insTA, NM_000151.3:c.497T>G, NM_000151.3:c.247C>T, NM_000151.3:c.113A>T, NM_000151.3:c.229T>C, NM_000151.3:c.230+1G>C, NM_000151.3:c.47C>G, NM_000151.3:c.883C>T, NM_000151.3:c.370G>A, NM_000151.3:c.626A>G, NM_000151.3:c.248G>A | Glycogen storage disease type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000. | 250,600 |
| G6PC3 | Severe congenital neutropenia type 4 | NM_138387.3 | NM_138387.3:c.346A>G, NM_138387.3:c.141C>G, NM_138387.3:c.778G>C, NM_138387.3:c.758G>A, NM_138387.3:c.935_936insT, NM_138387.3:c.784G>C | Severe congenital neutropenia type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC3 gene located on chromosomal region 17q21.31. This disease is characterized by familial pulmonary arterial hypertension, cardiac abnormalities including atrial septal defect, leukopenia including intermittent neutropenia, lymphopenia, monocytosis, and anemia. The prevalence is 1:100,000. | 600 |
| GAA | Glycogen storage disease type 2 | NM_000152.3 | NM_000152.3:c.118C>T, NM_000152.3:c.1316T>A, NM_000152.3:c.1799G>A, NM_000152.3:c.1827_1828insA, NM_000152.3:c.1846_1847insA, NM_000152.3:c.1115A>T, NM_000152.3:c.1552-3C>G, NM_000152.3:c.1445C>T, NM_000152.3:c.2238G>C, NM_000152.3:c.1327-2A>G, NM_000152.3:c.1650dupG, NM_000152.3:c.2238G>A, NM_000152.3:c.307T>G, NM_000152.3:c.230_240delCAGTGCCCACA, NM_000152.3:c.2512C>T, NM_000152.3:c.1431delT, NM_000152.3:c.1561G>A, NM_000152.3:c.1465G>A, NM_000152.3:c.1548G>A, NM_000152.3:c.546G>A, NM_000152.3:c.1064T>C, NM_000152.3:c.877G>A, NM_000152.3:c.925G>A, NM_000152.3:c.768_769insT, NM_000152.3:c.2560C>T, NM_000152.3:c.655G>A, NM_000152.3:c.1408_1410delAAC, NM_000152.3:c.953T>C, NM_000152.3:c.1933G>T, NM_000152.3:c.1935C>A, NM_000152.3:c.1585_1586delTCinsGT, NM_000152.3:c.1927G>A, NM_000152.3:c.2041-1G>A, NM_000152.3:c.2066_2070dupAGCCG, NM_000152.3:c.2105G>T, NM_000152.3:c.2237G>A, NM_000152.3:c.525delT, NM_000152.3:c.546+1_546+4delGTGG, NM_000152.3:c.2544delC, NM_000152.3:c.1912G>T, NM_000152.3:c.1634C>T, NM_000152.3:c.710C>T, NM_000152.3:c.2015G>A, NM_000152.3:c.546G>C, NM_000152.3:c.2012T>G, NM_000152.3:c.853C>T, NM_000152.3:c.697delA | Glycogen storage disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAA gene located on chromosomal region 17q25.3. There are two forms: adult and infantile.The age of onset in this last form is before the age of three months. This disease is characterized by severe hypotonia, hypertrophic cardiomyopathy and progressive hepatomegaly. The incidence is 1/57,000 for the adult form and 1/138,000 for infantile form. | 250,600 |
| GALC | Krabbe disease | NM_000153.3 | NM_000153.3:c.1591C>T, NM_000153.3:c.1161+2T>G, NM_000153.3:c.1586C>T, NM_000153.3:c.1592G>A, NM_000153.3:c.1489+1_1489+2delGT, NM_000153.3:c.582+1G>A, NM_000153.3:c.388G>A, NM_000153.3:c.430delA, NM_000153.3:c.1695delT, NM_000153.3:c.1472delA, NM_000153.3:c.1004A>G, NM_000153.3:c.1153G>T, NM_000153.3:c.658C>T, NM_000153.3:c.1543G>A, NM_000153.3:c.332G>A, NM_000153.3:c.334A>G, NM_000153.3:c.205C>T, NM_000153.3:c.1796T>G, NM_000153.3:c.1814dupA, NM_000153.3:c.1700A>C, NM_000153.3:c.1723_1724insT, NM_000153.3:c.1964delC, NM_000153.3:c.236G>A, NM_000153.3:c.1488_1489+2delTGGT, NM_000153.3:c.453G>A, NM_000153.3:c.1488_1489delTG, NM_000153.3:c.628A>T, NM_000153.3:c.655C>T, NM_000153.3:c.953C>G, NM_000153.3:c.2056T>C | Krabbe disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALC gene located on chromosomal region 14q31.3. There are two forms of the disease: infantile form (2-6 months onset) more severe and adult form less severe. It is a degenerative disorder that affects the nervous system characterized by a muscle stiffness, blindness, deafness, and eventually death. The incidence is 1/100,000-1/250,000 and the prevalence is 1/100,000. | 250,600 |
| GALT | Galactosemia | NM_000155.3 | NM_000155.3:c.130G>A, NM_000155.3:c.132delG, NM_000155.3:c.118G>T, NM_000155.3:c.265T>G, NM_000155.3:c.289_291delAAC, NM_000155.3:c.1138T>C, NM_000155.3:c.113A>C, NM_000155.3:c.152G>A, NM_000155.3:c.1048delA, NM_000155.3:c.290A>G, NM_000155.3:c.221T>C, NM_000155.3:c.253-2A>G, NM_000155.3:c.425T>A, NM_000155.3:c.428C>T, NM_000155.3:c.442C>T, NM_000155.3:c.143G>C, NM_000155.3:c.443G>A, NM_000155.3:c.158G>A, NM_000155.3:c.18delC, NM_000155.3:c.199C>T, NM_000155.3:c.200G>A, NM_000155.3:c.203A>C, NM_000155.3:c.218_219delCT, NM_000155.3:c.512T>C, NM_000155.3:c.547C>A, NM_000155.3:c.552C>A, NM_000155.3:c.563A>G, NM_000155.3:c.565_578delGTATGGGCCAGCAG, NM_000155.3:c.568T>C, NM_000155.3:c.580T>C, NM_000155.3:c.584T>C, NM_000155.3:c.598delC, NM_000155.3:c.601C>T, NM_000155.3:c.602G>A, NM_000155.3:c.1030C>A, NM_000155.3:c.510C>A, NM_000155.3:c.617A>G, NM_000155.3:c.619C>T, NM_000155.3:c.626A>G, NM_000155.3:c.634C>T, NM_000155.3:c.688-2A>C, NM_000155.3:c.692G>A, NM_000155.3:c.292G>A, NM_000155.3:c.329-2A>C, NM_000155.3:c.367C>T, NM_000155.3:c.377+7A>C, NM_000155.3:c.386T>C, NM_000155.3:c.607G>A, NM_000155.3:c.610C>T, NM_000155.3:c.413C>T, NM_000155.3:c.416T>G, NM_000155.3:c.41delinsTT, NM_000155.3:c.904+1G>T, NM_000155.3:c.905-2A>G, NM_000155.3:c.907G>A, NM_000155.3:c.442G>A, NM_000155.3:c.947G>A, NM_000155.3:c.443G>C, NM_000155.3:c.445dupG, NM_000155.3:c.997C>G, NM_000155.3:c.997C>T, NM_000155.3:c.998G>A, NM_000155.3:c.793C>G, NM_000155.3:c.820+13A>G, NM_000155.3:c.1052delC, NM_000155.3:c.844C>G, NM_000155.3:c.855G>T, NM_000155.3:c.719_728delTAGTACTGGT, NM_000155.3:c.772C>T, NM_000155.3:c.939G>A, NM_000155.3:c.71_72insA, NM_000155.3:c.404C>T, NM_000155.3:c.508-1G>C, NM_000155.3:c.775C>T, NM_000155.3:c.400delT, NM_000155.3:c.502_504delGTG, NM_000155.3:c.957C>A, NM_000155.3:c.823C>G, NM_000155.3:c.505C>A, NM_000155.3:c.1006A>T, NM_000155.3:c.985T>C, NM_000155.3:c.790delC, NM_000155.3:c.790_792delinsTAG | Galactosemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALT gene located on chromosomal region 9p13.3. The age of onset is neonatal. This disease is characterized by feeding difficulties, lethargy, and severe liver disease. Long-term complications appear including cognitive impairments, motor deficits, and ovarian dysfunction with reduced fertility in women and diminished bone density. The prevalence is 1/40,000-1/60,000. | 250,600 |
| GAMT | Guanidinoacetate methyltransferase deficiency | NM_000156.5 | NM_000156.5:c.506G>A, NM_000156.5:c.590T>C | Guanidinoacetate methyltransferase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAMT gene located on chromosomal region 19p13.3. The age of onset is infantile. This disease is characterized by intellectual disability, seizures and behavioral problems, often in conjunction with pyramidal and/or extrapyramidal manifestations with muscular hypotony. Biochemical symptoms are also included with high urinary excretion of guanidinoacetate, low urinary excretion of creatinine and creatine depletion in brain and muscles. | 600 |
| GAN | Giant axonal neuropathy | NM_022041.3 | NM_022041.3:c.1447C>T, NM_022041.3:c.1456G>A, NM_022041.3:c.1684C>G, NM_022041.3:c.1429C>T, NM_022041.3:c.601C>T, NM_022041.3:c.413G>A, NM_022041.3:c.505G>A, NM_022041.3:c.1268T>C | Giant axonal neuropathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAN gene located on chromosomal region 16q23.2. The age of onset is infantile. This disease is characterized by a progressive motor and sensitive peripheral and central nervous system neuropathy. Twenty families have been reported with this disease but the frequency is likely to be under-estimated. | 250,600 |
| GBA | Gaucher disease | NM_001005741.2 | NM_001005741.2:c.1093G>A, NM_001005741.2:c.1090G>A, NM_001005741.2:c.1043C>T, NM_001005741.2:c.1274dupA, NM_001005741.2:c.1098dupA, NM_001005741.2:c.1085C>T, NM_001005741.2:c.1102C>T, NM_001005741.2:c.1049A>G, NM_001005741.2:c.1240G>T, NM_001005741.2:c.1246G>A, NM_001005741.2:c.1301G>C, NM_001005741.2:c.1088T>C, NM_001005741.2:c.1348T>A, NM_001005741.2:c.1361C>G, NM_001005741.2:c.1342G>C, NM_001005741.2:c.1448T>C, NM_001005741.2:c.1448T>G, NM_001005741.2:c.1504C>T, NM_001005741.2:c.1447_1466delCTGGACGCAGTGGCACTGATinsTG, NM_001005741.2:c.254G>A, NM_001005741.2:c.259C>T, NM_001005741.2:c.1053G>T, NM_001005741.2:c.160G>T, NM_001005741.2:c.431T>G, NM_001005741.2:c.475C>T, NM_001005741.2:c.476G>A, NM_001005741.2:c.481C>T, NM_001005741.2:c.487delG, NM_001005741.2:c.497A>T, NM_001005741.2:c.508C>T, NM_001005741.2:c.1141T>G, NM_001005741.2:c.115+1G>A, NM_001005741.2:c.1171G>C, NM_001005741.2:c.1174C>G, NM_001005741.2:c.354G>C, NM_001005741.2:c.1060G>C, NM_001005741.2:c.1208G>C, NM_001005741.2:c.1228C>G, NM_001005741.2:c.123A>G, NM_001005741.2:c.1240G>C, NM_001005741.2:c.914delC, NM_001005741.2:c.517A>C, NM_001005741.2:c.1295G>T, NM_001005741.2:c.1307T>C, NM_001005741.2:c.1265_1319del, NM_001005741.2:c.1319C>T, NM_001005741.2:c.1309G>T, NM_001005741.2:c.1226A>G, NM_001005741.2:c.407C>A, NM_001005741.2:c.1343A>T, NM_001005741.2:c.84_85insG, NM_001005741.2:c.518C>T, NM_001005741.2:c.1391A>C, NM_001005741.2:c.509G>T, NM_001005741.2:c.1604G>A, NM_001005741.2:c.84dupG, NM_001005741.2:c.535G>C, NM_001005741.2:c.586A>C, NM_001005741.2:c.1297G>T, NM_001005741.2:c.1184C>T, NM_001005741.2:c.1192C>T | Gaucher disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBA gene located on chromosomal region 1q22. Gaucher disease encompasses a continuum of clinical findings from a perinatal lethal disorder to an asymptomatic type. There are three major clinical types (1, 2, and 3) and two other subtypes (perinatal-lethal and cardiovascular). Type 1 is characterized by the presence of clinical or radiographic evidence of bone disease, hepatosplenomegaly, anemia and thrombocytopenia, lung disease, and the absence of primary central nervous system disease. GD types 2 and 3 are characterized by the presence of primary neurologic disease. Type 2 has an onset before age two years, limited psychomotor development, and a rapidly progressive course with death by age two to four years. Type 3 may have onset before age two years, but often have a more slowly progressive course, with survival into the third or fourth decade. The perinatal-lethal form is associated with ichthyosiform or collodion skin abnormalities or with nonimmune hydrops fetalis. The cardiovascular form is characterized by calcification of the aortic and mitral valves, mild splenomegaly, corneal opacities, and supranuclear ophthalmoplegia. Cardiopulmonary complications have been described with all the clinical subtypes, although varying in frequency and severity. The incidence is 1/60,000 and the prevalence is approximately 1/100,000. | 250,600 |
| GBE1 | Glycogen storage disease type 4 | NM_000158.3 | NM_000158.3:c.1571G>A, NM_000158.3:c.1570C>T, NM_000158.3:c.1774G>T, NM_000158.3:c.771T>A, NM_000158.3:c.1543C>T, NM_000158.3:c.1883A>G, NM_000158.3:c.2052+1G>A, NM_000158.3:c.986A>C, NM_000158.3:c.466_470delCGTAT, NM_000158.3:c.1604A>G | Glycogen storage disease type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is infantile. This disease is characterized by failure to thrive; hepatomegaly, liver dysfunction, and progressive liver cirrhosis; hypotonia; cardiomyopathy and, finally, death. | 250,600 |
| GBE1 | Polyglucosan body disease, adult | NM_000158.3 | NM_000158.3:c.986A>G | Polyglucosan body disease, adult form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is late-onset, slowly progressive disorder affecting the central and peripheral nervous systems. This disease is characterized by a variable combination of cognitive impairment, pyramidal tetraparesis, peripheral neuropathy, and neurogenic bladder. Other manifestations include cerebellar dysfunction and extrapyramidal signs. | 250,600 |
| GCDH | Glutaric acidemia type 1 | NM_000159.3 | NM_000159.3:c.1093G>A, NM_000159.3:c.1060G>C, NM_000159.3:c.542A>G, NM_000159.3:c.442G>A, NM_000159.3:c.1199dupT, NM_000159.3:c.572T>C, NM_000159.3:c.1060G>A, NM_000159.3:c.1247C>T, NM_000159.3:c.74C>A, NM_000159.3:c.947C>A, NM_000159.3:c.1168G>C, NM_000159.3:c.416C>T, NM_000159.3:c.1198G>A, NM_000159.3:c.636-1G>A, NM_000159.3:c.1204C>T, NM_000159.3:c.1244-2A>C, NM_000159.3:c.751C>T, NM_000159.3:c.1262C>T, NM_000159.3:c.1148G>A, NM_000159.3:c.680G>C, NM_000159.3:c.883T>C, NM_000159.3:c.1015A>G, NM_000159.3:c.764C>T, NM_000159.3:c.271+1G>A, NM_000159.3:c.743C>T, NM_000159.3:c.877G>A, NM_000159.3:c.914C>T, NM_000159.3:c.1002_1003delGA, NM_000159.3:c.383G>A, NM_000159.3:c.769C>T | Glutaric acidemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCDH gene located on chromosomal region 19p13.2. The age of onset is infantile or neonatal. This disease is characterized by encephalopathic crises resulting in striatal injury and a severe dystonic dyskinetic movement disorder. The prevalence is 1 in 100,000 births. | 250,600 |
| GCSH | Glycine encephalopathy (GCSH) | NM_004483.4 | NM_004483.4:c.337dupT | Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCSH gene located on chromosomal region 16q23.2. The age of onset is neonatal. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. | 600 |
| GDAP1 | Charcot-Marie-Tooth disease type 4A | NM_018972.2 | NM_018972.2:c.358C>T, NM_018972.2:c.487C>T, NM_018972.2:c.311-1G>A, NM_018972.2:c.844C>T, NM_018972.2:c.715C>T, NM_018972.2:c.92G>A | Charcot-Marie-Tooth disease type 4A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GDAP1 gene located on chromosomal region 8q21.11. It is a severe, early-onset form of demyelinating CMT peripheral sensorimotor polyneuropathy characterized by severe motor retardation and progressive scoliosis. Vocal cord paresis may also occur. | 600 |
| GFM1 | Combined oxidative phosphorylation deficiency type 1 | NM_024996.5 | NM_024996.5:c.1294_1297delACAG, NM_024996.5:c.748C>T, NM_024996.5:c.139C>T, NM_024996.5:c.1528_1529delAG, NM_024996.5:c.521A>G | Combined oxidative phosphorylation deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GFM1 gene located on chromosomal region 3q25.32. The age of onset is from early infancy until adult. This disease is characterized by ptosis, external ophthalmoplegia, proximal myopathy and exercise intolerance, cardiomyopathy, sensorineural deafness, optic atrophy, pigmentary retinopathy, and diabetes mellitus. | 600 |
| GJA1 | Oculodentodigital dysplasia | NM_000165.4 | NM_000165.4:c.227G>A, NM_000165.4:c.97C>T | Oculodentodigital dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJA1 gene located on chromosomal region 6q22.31. The age of onset is infantile. This disease is characterized by craniofacial, neurologic, limb and ocular abnormalities. | 600 |
| GJB2 | Deafness type 1A, autosomal recessive | NM_004004.5 | NM_004004.5:c.176_191delGCTGCAAGAACGTGTG, NM_004004.5:c.169C>T, NM_004004.5:c.270dupA, NM_004004.5:c.239A>C, NM_004004.5:c.269T>C, NM_004004.5:c.427C>T, NM_004004.5:c.299_300delAT, NM_004004.5:c.250G>T, NM_004004.5:c.230G>A, NM_004004.5:c.516G>A, NM_004004.5:c.439G>A, NM_004004.5:c.465T>A, NM_004004.5:c.229T>C, NM_004004.5:c.241C>G, NM_004004.5:c.235delC, NM_004004.5:c.238C>T, NM_004004.5:c.557C>T, NM_004004.5:c.269_270insT, NM_004004.5:c.617A>G, NM_004004.5:c.231G>A, NM_004004.5:c.310_323delAGGAAGTTCATCAA, NM_004004.5:c.313_326delAAGTTCATCAAGGG, NM_004004.5:c.358_360delGAG, NM_004004.5:c.35delG, NM_004004.5:c.249C>G, NM_004004.5:c.334_335delAA, NM_004004.5:c.402delG, NM_004004.5:c.413G>A, NM_004004.5:c.416G>A, NM_004004.5:c.299A>T, NM_004004.5:c.250G>C, NM_004004.5:c.550C>T, NM_004004.5:c.551G>C, NM_004004.5:c.503A>G, NM_004004.5:c.227T>C, NM_004004.5:c.380G>A, NM_004004.5:c.132G>A, NM_004004.5:c.365A>T, NM_004004.5:c.139G>T | Deafness, autosomal recessive type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 and GJB3 genes located on chromosomal regions 13q12.11 and 1p34.3 respectively. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present. | 250,600 |
| GJB3 | Deafness type 1A, autosomal recessive | NM_024009.2 | NM_024009.2:c.529T>G, NM_024009.2:c.580G>A, NM_024009.2:c.94C>T | Deafness, autosomal recessive type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 and GJB3 genes located on chromosomal regions 13q12.11 and 1p34.3 respectively. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present. | 250,600 |
| GJB6 | Deafness type 1B, autosomal recessive | NM_006783.4 | NM_006783.4:c.261dupA, NM_006783.4:c.169C>T, NM_006783.4:c.485dupA, NM_006783.4:c.689dupA, NM_006783.4:c.14C>T, NM_006783.4:c.443delC, NM_006783.4:c.383_384delTA, NM_006783.4:c.689_690insA | Nonsyndromic sensorineural deafness, autosomal recessive type DFNB1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB6 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment. No other associated medical findings are present. | 250,600 |
| GJC2 | Pelizaeus-Merzbacher-like disease type 1 | NM_020435.3 | NM_020435.3:c.857T>C, NM_020435.3:c.814T>G, NM_020435.3:c.613C>T, NM_020435.3:c.787G>A, NM_020435.3:c.718C>T, NM_020435.3:c.268C>T | Pelizaeus-Merzbacher-like disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJC2 gene located on chromosomal region 1q42.13. It is an autosomal recessive leukodystrophy sharing identical clinical and radiological features as X-linked Pelizaeus-Merzbacher disease. The age of onset is early infantile. This disease is characterized by nystagmus, delayed motor milestones, ataxia, progressive spasticity, partial seizures, mild peripheral neuropathy, and diffuse leukodystrophy. The prevalence is <1.27:100,000. | 600 |
| GLB1 | GM1 Gangliosidosis | NM_000404.2 | NM_000404.2:c.1369C>T, NM_000404.2:c.1370G>A, NM_000404.2:c.1452C>G, NM_000404.2:c.176G>A, NM_000404.2:c.276G>A, NM_000404.2:c.1733A>G, NM_000404.2:c.1355dupA, NM_000404.2:c.442C>A, NM_000404.2:c.202C>T, NM_000404.2:c.591_592insT, NM_000404.2:c.622C>T, NM_000404.2:c.1549G>T, NM_000404.2:c.442C>T, NM_000404.2:c.457+2T>C, NM_000404.2:c.947A>G, NM_000404.2:c.438_440delTCT, NM_000404.2:c.601C>T, NM_000404.2:c.602G>A, NM_000404.2:c.1068+1G>T, NM_000404.2:c.1174_1175delCT, NM_000404.2:c.1004C>T, NM_000404.2:c.1051C>T, NM_000404.2:c.171C>G, NM_000404.2:c.1321G>A, NM_000404.2:c.1325G>A, NM_000404.2:c.818G>T, NM_000404.2:c.152T>C, NM_000404.2:c.1456_1466dupGGTGCATATAT, NM_000404.2:c.145C>T, NM_000404.2:c.175C>T, NM_000404.2:c.901G>A, NM_000404.2:c.1646C>T, NM_000404.2:c.1577dupG, NM_000404.2:c.1310A>T | Gangliosidosis GM1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. Although the three types differ in severity, their features can overlap significantly. The age of onset in type 1 is infantile, in type 2 is late-infantile or juvenile and adult in type3. This disease is characterized by arrest/regression of neurological development, hypotonia, visceromegaly, macular cherry-red spots, dysostosis and coarse facial features. The prevalence is 1:100,000 a 200,000 newborn. | 250,600 |
| GLB1 | Mucopolysaccharidosis type 4B | NM_000404.2 | NM_000404.2:c.1444C>T, NM_000404.2:c.1313G>A, NM_000404.2:c.817T>C, NM_000404.2:c.1445G>A, NM_000404.2:c.1223A>C | Mucopolysaccharidosis type 4B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. The age of onset is variable infantile/juvenile. In addition to skeletal involvement, significant morbidity can result from respiratory compromise, obstructive sleep apnea, valvular heart disease, hearing impairment, corneal clouding, and spinal cord compression. The prevalence is 1:200,000-1:300,000. | 250,600 |
| GLDC | Glycine encephalopathy | NM_000170.2 | NM_000170.2:c.322G>T, NM_000170.2:c.1229G>A, NM_000170.2:c.1545G>C, NM_000170.2:c.1691G>T, NM_000170.2:c.1166C>T, NM_000170.2:c.2113G>A, NM_000170.2:c.2284G>A, NM_000170.2:c.1705G>A, NM_000170.2:c.2216G>A, NM_000170.2:c.2405C>T | Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMT and GLDC genes located on chromosomal regions 3p21.31 and 9p24.1 respectively. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| GLE1 | Lethal arthrogryposis with anterior horn cell disease | NM_001003722.1 | NM_001003722.1:c.2051T>C, NM_001003722.1:c.1412_1413delAG, NM_001003722.1:c.898-2A>G, NM_001003722.1:c.2069_2072delTTCT, NM_001003722.1:c.1807C>T | Lethal arthrogryposis with anterior horn cell disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLE1 gene located on chromosomal region 9q34.11. The age of onset is fetal. This disease is characterized by fetal akinesia, arthrogryposis and motor neuron loss. The fetus often survives delivery, but dies early as a result of respiratory failure. Neuropathological findings resemble those of lethal congenital contracture syndrome type 1, but are less severe. | 250,600 |
| GM2A | GM2 Gangliosidosis | NM_000405.4 | NM_000405.4:c.285delC, NM_000405.4:c.160G>T, NM_000405.4:c.506G>C | GM2-gangliosidosis, AB variant follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GM2A gene located on chromosomal region 5q33.1. The age of onset is infantile. This disease is characterized by a group of neurodegenerative disorders: seizures, blindness, spasticity, eventual total incapacitation, and death. The prevalence is <1:100.000. | 600 |
| GNE | Distal myopathy Nonaka type | NM_005476.5 | NM_005476.5:c.2116T>C, NM_005476.5:c.2135T>C, NM_005476.5:c.2086G>A, NM_005476.5:c.478C>T, NM_005476.5:c.1844C>G, NM_005476.5:c.737G>A, NM_005476.5:c.385C>T, NM_005476.5:c.1714G>T, NM_005476.5:c.1798G>A, NM_005476.5:c.2086G>T, NM_005476.5:c.787C>T, NM_005476.5:c.2023T>C, NM_005476.5:c.1993G>A, NM_005476.5:c.673G>A, NM_005476.5:c.909T>A, NM_005476.5:c.1727G>A | Distal myopathy, Nonaka type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNE gene located on chromosomal region 9p13.3. The age of onset is adult. This disease is characterized by progressive muscle weakness and joint deformity. The prevalence is 1:500-1:1,000. | 250,600 |
| GNPTAB | Mucolipidosis type 2/type 3 | NM_024312.4 | NM_024312.4:c.1931C>T, NM_024312.4:c.1799delC, NM_024312.4:c.3503_3504delTC, NM_024312.4:c.3173C>G, NM_024312.4:c.25C>T, NM_024312.4:c.3663delG, NM_024312.4:c.1906dupA, NM_024312.4:c.2383delG, NM_024312.4:c.732_733delAA, NM_024312.4:c.749dupA, NM_024312.4:c.2896delA, NM_024312.4:c.648_651delAGAA, NM_024312.4:c.3326dupA, NM_024312.4:c.3410T>A, NM_024312.4:c.10A>C, NM_024312.4:c.1000C>T, NM_024312.4:c.1196C>T, NM_024312.4:c.1759C>T, NM_024312.4:c.3565C>T, NM_024312.4:c.616_619delACAG, NM_024312.4:c.99delC, NM_024312.4:c.3598G>A, NM_024312.4:c.3560_3561delAG | Mucolipidosis type 2/type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNPTAB gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by growth retardation, skeletal abnormalities, facial dysmorphism, stiff skin, developmental delay and cardiomegaly and that is lethal in childhood. The prevalence is 1:123,500-1:625,500. | 250,600 |
| GNS | Mucopolysaccharidosis type 3D | NM_002076.3 | NM_002076.3:c.1063C>T, NM_002076.3:c.1226dupG, NM_002076.3:c.1169delA, NM_002076.3:c.1168C>T, NM_002076.3:c.413C>G | Mucolipidosis type 3D (Sanfilippo disease) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNS gene located on chromosomal region 12q14.3. The age of onset is infantile. This disease is characterized by joint stiffness and pain initially in the shoulders, hips, and fingers; and gradual mild coarsening of facial features, cardiorespiratory complications and mild cognitive impairment. The incidence is 1:70,000 newborn. | 600 |
| GPR143 | Ocular albinism, X-linked | NM_000273.2 | NM_000273.2:c.992_993insCG, NM_000273.2:c.695C>A | X-linked recessive ocular albinism follows an X-linked pattern of inheritance and is caused by pathogenic variants in the GPR143 gene located on chromosomal region Xp22.2. The age of onset is infantile. This disease is characterized by ocular hypopigmentation, foveal hypoplasia, nystagmus, photodysphoria, and reduced visual acuity. The prevalence is 1/60,000 to 1/150,000 live male births. | 600 |
| GPR179 | Night blindness, congenital stationary type 1E | NM_001004334.3 | NM_001004334.3:c.1784+1G>A, NM_001004334.3:c.1368delT, NM_001004334.3:c.3656_3657delCT, NM_001004334.3:c.6847_6848delCT, NM_001004334.3:c.984delC, NM_001004334.3:c.1807C>T, NM_001004334.3:c.278_279insC, NM_001004334.3:c.5693_5694insT, NM_001004334.3:c.278delC, NM_001004334.3:c.1236G>A, NM_001004334.3:c.376G>C, NM_001004334.3:c.3233_3234delCT, NM_001004334.3:c.5763_5764delGA, NM_001004334.3:c.839_842delATCA, NM_001004334.3:c.4699_4700delAG | Congenital stationary night blindness type 1E follow an autosomal recessive, dominant or X-linked pattern of inheritance and is caused by pathogenic variants in the GPR179 gene located on chromosomal region 17q12. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity. | 250,600 |
| GPR98 | Usher syndrome type 2C | NM_032119.3 | NM_032119.3:c.11377G>T, NM_032119.3:c.8713_8716dupAACA, NM_032119.3:c.2864C>A, NM_032119.3:c.18131A>G, NM_032119.3:c.2258_2270delAAGTGCTGAAATC, NM_032119.3:c.6275-1G>A, NM_032119.3:c.2636C>T, NM_032119.3:c.14973-1G>C, NM_032119.3:c.17668_17669delAT, NM_032119.3:c.5357_5358delAA, NM_032119.3:c.5747C>T, NM_032119.3:c.15196_15199dupCAAA, NM_032119.3:c.3151G>T, NM_032119.3:c.6901C>T, NM_032119.3:c.8790delC, NM_032119.3:c.5830G>A, NM_032119.3:c.6311_6312insT | Usher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR98 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32 respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000. | 250,600 |
| GRHPR | Primary hyperoxaluria type 2 | NM_012203.1 | NM_012203.1:c.103delG, NM_012203.1:c.295C>T, NM_012203.1:c.755dupA, NM_012203.1:c.622C>T, NM_012203.1:c.435G>A | Primary hyperoxaluria type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRHPR gene located on chromosomal region 9p13.2. The age of onset is infantile. This disease is characterized by recurrent nephrolithiasis, nephrocalcinosis and end-stage renal disease with subsequent systemic oxalosis. | 600 |
| GRM6 | Night blindness, congenital stationary type 1B | NM_000843.3 | NM_000843.3:c.2341G>A, NM_000843.3:c.727_728insG, NM_000843.3:c.2213_2219delCCAGAGG, NM_000843.3:c.1861C>T, NM_000843.3:c.2560C>T, NM_000843.3:c.712C>T, NM_000843.3:c.2122C>T, NM_000843.3:c.719_720insG, NM_000843.3:c.1214T>C, NM_000843.3:c.1336C>T, NM_000843.3:c.1258C>T, NM_000843.3:c.1565G>A | Congenital stationary night blindness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRM6 gene located on chromosomal region 5q35.3. The age of onset is early infancy. This disease is characterized by hemeralopia with a moderate loss of visual acuity. | 250,600 |
| GRXCR1 | Deafness type 25, autosomal recessive | NM_001080476.2 | NM_001080476.2:c.229C>T, NM_001080476.2:c.190G>A, NM_001080476.2:c.710_711delAT | Autosomal recessive nonsyndromic sensorineural deafness type DFNB25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRXCR1 gene located on chromosomal region 4p13. The age of onset is infantile. This disease is characterized by hearing loss which is not associated visible abnormalities of the external ear or any related medical problems. | 600 |
| GSS | Glutathione synthetase deficiency | NM_000178.2 | NM_000178.2:c.656A>G, NM_000178.2:c.847C>T, NM_000178.2:c.754C>T, NM_000178.2:c.799C>T, NM_000178.2:c.4delG, NM_000178.2:c.656A>C, NM_000178.2:c.491G>A, NM_000178.2:c.832C>T | Glutathione synthetase deficiency with 5-oxoprolinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GSS gene located on chromosomal region 20q11.22. The severity and age of onset are variable. This disease is characterized by affectation of the neutrophil respiratory burst and can increase host susceptibility to infections, is associated with hemolytic anemia and intellectual disability. The prevalence is <1:1,000,000. | 600 |
| GUCY2D | Leber congenital amaurosis type 1 | NM_000180.3 | NM_000180.3:c.1694T>C, NM_000180.3:c.2735_2736delTT, NM_000180.3:c.456C>A, NM_000180.3:c.622delC, NM_000180.3:c.2734_2735delTT, NM_000180.3:c.2945delG | Leber congenital amaurosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUCY2D gene located on chromosomal region 17p13.1. The age of onset is infantile. This disease is characterized by blindness, nystagmus, roving eye movement and severe visual impairment. | 600 |
| GUSB | Mucopolysaccharidosis type 7 | NM_000181.3 | NM_000181.3:c.1065+1G>T, NM_000181.3:c.1084G>A, NM_000181.3:c.1144C>T, NM_000181.3:c.1337G>A, NM_000181.3:c.1222C>T, NM_000181.3:c.1730G>T, NM_000181.3:c.1831C>T, NM_000181.3:c.1856C>T, NM_000181.3:c.1881G>T, NM_000181.3:c.442C>T, NM_000181.3:c.499C>T, NM_000181.3:c.526C>T, NM_000181.3:c.646C>T, NM_000181.3:c.820_821delAC, NM_000181.3:c.1061C>T, NM_000181.3:c.1050G>C, NM_000181.3:c.1534G>A, NM_000181.3:c.1244C>T, NM_000181.3:c.1219_1220insC, NM_000181.3:c.866G>A, NM_000181.3:c.1244+1G>A, NM_000181.3:c.1521G>A, NM_000181.3:c.1429C>T, NM_000181.3:c.1618G>T, NM_000181.3:c.1338G>A | Mucopolysaccharidosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUSB gene located on chromosomal region 7q11.21. The age of onset is variable. There are prenatal forms with non-immune hydrops fetalis, and severe neonatal forms with dysmorphism, hernias, hepatosplenomegaly, club feet, dysostosis, severe hypotonia and neurological disorders that ultimately lead to profound intellectual deficit and small stature in patients that survive. Finally, there are also very mild cases that are discovered during adolescence or adulthood following presentation with thoracic kyphosis. The prevalence is 1:250,000 in newborn. | 250,600 |
| HADHA | Trifunctional protein deficiency | NM_000182.4 | NM_000182.4:c.1918C>T, NM_000182.4:c.274_278delTCATC, NM_000182.4:c.2131C>A, NM_000182.4:c.1793_1794delAT, NM_000182.4:c.1620+2_1620+6delTAAGG, NM_000182.4:c.2027G>A, NM_000182.4:c.1678C>T, NM_000182.4:c.2132_2133insC, NM_000182.4:c.2146+1G>A, NM_000182.4:c.919-2A>G, NM_000182.4:c.1644delC, NM_000182.4:c.1132C>T, NM_000182.4:c.1528G>C, NM_000182.4:c.499delA, NM_000182.4:c.845T>A, NM_000182.4:c.1422dupT | Mitochondrial trifunctional protein deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA and HADHB genes located on chromosomal region 2p23.3. The age of onset is neonatal/infancy. It is characterized by a wide clinical spectrum ranging from severe neonatal manifestations including cardiomyopathy, hypoglycemia, metabolic acidosis, skeletal myopathy and neuropathy, liver disease and death to a mild phenotype with peripheral polyneuropathy, episodic rhabdomyolysis and pigmentary retinopathy. The prevalence is <1 / 1,000,000. | 250,600 |
| HADHB | Trifunctional protein deficiency | NM_000183.2 | NM_000183.2:c.788A>G, NM_000183.2:c.1364T>G, NM_000183.2:c.1331G>A | Mitochondrial trifunctional protein deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA and HADHB genes located on chromosomal region 2p23.3. The age of onset is neonatal/infancy. It is characterized by a wide clinical spectrum ranging from severe neonatal manifestations including cardiomyopathy, hypoglycemia, metabolic acidosis, skeletal myopathy and neuropathy, liver disease and death to a mild phenotype with peripheral polyneuropathy, episodic rhabdomyolysis and pigmentary retinopathy. The prevalence is <1 / 1,000,000. | 600 |
| HAL | Histidinemia | NM_002108.3 | NM_002108.3:c.890_891insT, NM_002108.3:c.146_152delATGACGC, NM_002108.3:c.1287+2T>C, NM_002108.3:c.102_103insGC, NM_002108.3:c.903+1G>A | Histidinemia follows a pattern of inheritance and is caused by pathogenic variants in the HAL gene located on chromosomal region 12q23.1. The age of onset is infantile ans is characterized by high concentration of Histidine in blood and urine. This disease seems to be benign in most of cases but 2/3 of the patients could show mild development delay. | 600 |
| HBA | Alpha-thalassemia | - | --MED, --SEA, --THAI, -α4.2, -α3.7, --FIL, -(α)20.5 (Detection by PCR) | Alpha-thalassemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBA gene located on chromosomal region 16p13.3. The age of onset is infantile. It is characterized by impaired synthesis of alpha-globin chains leading to a variable clinical picture depending on the number of affected alleles. The disease can be classified into clinical subtypes of increasing severity: silent alpha thalassemia, alpha thalassemia trait (or alpha thalassemia minor), hemoglobin H disease (HbH), and Hb Bart's hydrops fetalis (see these terms). A rare form called alpha-thalassemia-intellectual deficit syndrome has also been identified (see these terms). Alpha thalassemia trait causes microcytosis and hypochromia with absent or mild anemia (often detected on routine blood tests), generally with no other symptoms. HbH patients develop moderate hemolytic anemia with variable amounts of HbH along with occasionally severe splenomegaly, sometimes complicated by hypersplenism. Hb Bart's hydrops fetalis involves a severe deficiency in alpha-globin with serious developmental implications. Alpha-thalassemia-intellectual deficit syndrome is characterized by very mild to severe anemia associated with developmental abnormalities. The prevalence is 1:10,000-5:10,000. | 600 |
| HBB | Beta-thalassemia | NM_000518.4 | NM_000518.4:c.135delC, NM_000518.4:c.118C>T, NM_000518.4:c.217dupA, NM_000518.4:c.92+5G>C, NM_000518.4:c.208G>A, NM_000518.4:c.85_86insC, NM_000518.4:c.92+5G>A, NM_000518.4:c.27dupG, NM_000518.4:c.126_129delCTTT, NM_000518.4:c.93-23T>C, NM_000518.4:c.92+1G>A, NM_000518.4:c.-50-u32C>T, NM_000518.4:c.82G>T, NM_000518.4:c.315+1G>A, NM_000518.4:c.52A>T, NM_000518.4:c.380T>A, NM_000518.4:c.93-21G>A, NM_000518.4:c.79G>A, NM_000518.4:c.112delT, NM_000518.4:c.92+6T>C, NM_000518.4:c.59A>G, NM_000518.4:c.364G>A | Beta-thalassemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBB gene located on chromosomal region 11p15.4. The age of onset is infantile. Three main types of BT have been described, thalassemia minor is usually asymptomatic, thalassemia major is associated with splenomegaly and microcytic and hypochromic anemia and thalassemia intermedia, in which the anemia is less severe. The incidence is 1/100,000. | 250,600 |
| HBB | Sickle cell anaemia | NM_000518.4 | NM_000518.4:c.19G>A, NM_000518.4:c.20A>T | Sickle cell anemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBB gene located on chromosomal region 11p15.4. The age of onset is infantile. This disease is characterized by chronic severe anemia, bacterial infections, and ischemic vaso-occlusive accidents. This results in tissue ischemia leading to acute and chronic pain as well as organ damage that can affect any organ in the body, including the bones, lungs, liver, kidneys, brain, eyes, and joints. The highest frequency of sickle cell disease is found in tropical regions, particularly sub-Saharan Africa, India and the Middle-East. | 250,600 |
| HESX1 | Combined pituitary hormone deficiencies, genetic forms | NM_003865.2 | NM_003865.2:c.374A>G, NM_003865.2:c.77T>C, NM_003865.2:c.445G>A, NM_003865.2:c.450_451delCA, NM_003865.2:c.18G>C | Combined pituitary hormone deficiencies, genetic forms follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the HESX1 gene located on chromosomal region 3p14.3. The age of onset is infantile. These diseases are characterized by short stature, cognitive alterations or delayed puberty. The incidence is 1:3,000 and 1:4,000 births. | 250,600 |
| HEXA | Tay-Sachs disease | NM_000520.4 | NM_000520.4:c.1176G>A, NM_000520.4:c.1495C>T, NM_000520.4:c.1177C>T, NM_000520.4:c.116T>G, NM_000520.4:c.1510delC, NM_000520.4:c.1496G>A, NM_000520.4:c.1260G>C, NM_000520.4:c.1351C>G, NM_000520.4:c.1511G>A, NM_000520.4:c.1499delT, NM_000520.4:c.1510C>T, NM_000520.4:c.380T>G, NM_000520.4:c.459+5G>A, NM_000520.4:c.508C>T, NM_000520.4:c.509G>A, NM_000520.4:c.532C>T, NM_000520.4:c.533G>A, NM_000520.4:c.533G>T, NM_000520.4:c.1528C>T, NM_000520.4:c.173G>A, NM_000520.4:c.1A>G, NM_000520.4:c.1A>T, NM_000520.4:c.1444G>A, NM_000520.4:c.1453T>C, NM_000520.4:c.739C>T, NM_000520.4:c.745C>T, NM_000520.4:c.749G>A, NM_000520.4:c.759_774dupGCTTGCAGAGTTTGAC, NM_000520.4:c.772G>C, NM_000520.4:c.1214_1215delinsG, NM_000520.4:c.78G>A, NM_000520.4:c.538T>C, NM_000520.4:c.540C>G, NM_000520.4:c.805G>A, NM_000520.4:c.915_917delCTT, NM_000520.4:c.254-1G>C, NM_000520.4:c.2T>C, NM_000520.4:c.1537C>T, NM_000520.4:c.1490A>G, NM_000520.4:c.77G>A, NM_000520.4:c.1422G>C, NM_000520.4:c.805+1G>A, NM_000520.4:c.805+1G>C, NM_000520.4:c.672+1G>A, NM_000520.4:c.629C>T, NM_000520.4:c.987G>A, NM_000520.4:c.632T>C, NM_000520.4:c.1278_1279insTATC, NM_000520.4:c.1274_1277dupTATC, NM_000520.4:c.986+3A>G, NM_000520.4:c.611A>G, NM_000520.4:c.1277_1278insTAT | Tay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births. | 250,600 |
| HEXB | Sandhoff disease | NM_000521.3 | NM_000521.3:c.1310_1311delCA, NM_000521.3:c.1380G>A, NM_000521.3:c.1367A>C, NM_000521.3:c.1238_1242delCAAAG, NM_000521.3:c.298delC, NM_000521.3:c.1345delT, NM_000521.3:c.797A>G, NM_000521.3:c.1539_1540delCT, NM_000521.3:c.1375G>T, NM_000521.3:c.508C>T, NM_000521.3:c.1517_1529dupCAAGTGCTGTTGG, NM_000521.3:c.841C>T, NM_000521.3:c.202_203insGG, NM_000521.3:c.1250C>T, NM_000521.3:c.1619_1620insTTCATGTTATCTACAGACGTG, NM_000521.3:c.1537_1538delCT, NM_000521.3:c.170delG, NM_000521.3:c.115delG, NM_000521.3:c.171delG, NM_000521.3:c.850C>T | Sandhoff disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXB gene located on chromosomal region 5q13.3. The age of onset is adult or infantile. This disease is characterized by central nervous system degeneration, with startle reactions, early blindness, progressive motor and mental deterioration, macrocephaly and cherry-red spots on the macula. The prevalence is 1/130.000. | 250,600 |
| HFE | Haemochromatosis | NM_000410.3 | NM_000410.3:c.18G>C, NM_000410.3:c.252G>A, NM_000410.3:c.989G>T, NM_000410.3:c.314T>C, NM_000410.3:c.193A>T, NM_000410.3:c.829G>A, NM_000410.3:c.277G>C | Hemochromatosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HFE gene located on chromosomal region 6p22.2. The age of onset is adult. This disease is characterized by chronic fatigue, bronzed skin pigmentation and tissue damage in the liver, pancreas, joints, bone, endocrine glands, heart. The prevalence is 1/200 - 1/1.000. | 250,600 |
| HGD | Alkaptonuria | NM_000187.3 | NM_000187.3:c.140C>T, NM_000187.3:c.16-1G>A, NM_000187.3:c.342+1G>A, NM_000187.3:c.1111_1112insC, NM_000187.3:c.899T>G, NM_000187.3:c.1189-2A>G, NM_000187.3:c.674G>A, NM_000187.3:c.175delA, NM_000187.3:c.283-5delT, NM_000187.3:c.172A>T, NM_000187.3:c.873C>A, NM_000187.3:c.283-4C>T, NM_000187.3:c.808G>A, NM_000187.3:c.1102A>G, NM_000187.3:c.469+2T>C, NM_000187.3:c.688C>T, NM_000187.3:c.481G>A | Alkaptonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGD gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by darkening of the urine when it is left exposed to air, grey-blue colouration of the eye sclerae and the ear helix (ochronosis), and a disabling joint disease involving both the axial and peripheral joints (ochronotic arthropathy). The prevalence is 1:250,000-1:1.000.000 newborn. | 250,600 |
| HGF | Deafness type 39, autosomal recessive | NM_000601.4 | NM_000601.4:c.2028delA, NM_000601.4:c.1597C>T | Autosomal recessive nonsyndromic sensorineural deafness type DFNB239 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGF gene located on chromosomal region 7q21.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| HGSNAT | Mucopolysaccharidosis type 3C | NM_152419.2 | NM_152419.2:c.1378-1G>A, NM_152419.2:c.1843G>A, NM_152419.2:c.607C>T, NM_152419.2:c.1250+1G>A, NM_152419.2:c.848C>T, NM_152419.2:c.1464+1G>A, NM_152419.2:c.1501delA, NM_152419.2:c.1030C>T, NM_152419.2:c.1503delA, NM_152419.2:c.1553C>T, NM_152419.2:c.1622C>T, NM_152419.2:c.493+1G>A | Mucopolysaccharidosis type 3C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGSNAT gene located on chromosomal region 8p11.21. The age of onset is infantile. This disease is characterized by defective or missing enzymes to break down mucopolysaccharides are missing or are defective. The prevalence is <1:70.000 newborn. | 250,600 |
| HIBCH | 3-Hydroxyisobutryl-CoA hydrolase deficiency | NM_014362.3 | NM_014362.3:c.1012A>T, NM_014362.3:c.79-3C>G, NM_014362.3:c.494_495delTT, NM_014362.3:c.365A>G, NM_014362.3:c.220-9T>G | 3-Hydroxyisobutryl-CoA hydrolase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HIBCH gene located on chromosomal region 2q32.2. The age of onset is infantile. This disease is characterized by delayed motor development, hypotonia and progressive neurodegeneration. The prevalence is <1:1,000,000. | 600 |
| HMGCL | 3-hydroxy-3-methylglutaric aciduria | NM_000191.2 | NM_000191.2:c.835G>A, NM_000191.2:c.230delT, NM_000191.2:c.122G>A, NM_000191.2:c.698A>G, NM_000191.2:c.206_207delCT, NM_000191.2:c.505_506delTC | 3-hydroxy-3-methylglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HMGCL gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is is an organic aciduria, due to deficiency of 3-hydroxy-3-methylglutaryl-CoA-lyase (a key enzyme in ketogenesis and leucine metabolism) usually presenting in infancy with episodes of metabolic decompensation triggered by periods of fasting or infections, which when left untreated are life-threatening and may lead to neurological sequelae. | 600 |
| HPD | Tyrosinemia type 3 | NM_002150.2 | NM_002150.2:c.600C>G, NM_002150.2:c.774T>G, NM_002150.2:c.1005C>G, NM_002150.2:c.987delA | Tyrosinemia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPD gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by intellectual deficit and ataxia. The prevalence is 1:100,000-1:120,000 newborn. | 250,600 |
| HPRT1 | Lesch-Nyhan syndrome | NM_000194.2 | NM_000194.2:c.486-1G>A, NM_000194.2:c.508C>T, NM_000194.2:c.610-2A>G, NM_000194.2:c.532+2T>G | Lesch-Nyhan syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the HPRT1 gene located on chromosomal region Xq26.2-q26.3. The age of onset is infantile. This disease is characterized by acid overproduction, neurological troubles, and behavioral problems. The prevalence is 1:380,000. | 600 |
| HPS1 | Hermansky-Pudlak syndrome type 1 | NM_000195.3 | NM_000195.3:c.972_973insC, NM_000195.3:c.972delC, NM_000195.3:c.1996G>T, NM_000195.3:c.398+5G>A, NM_000195.3:c.1472_1487dupCCAGCAGGGGAGGCCC, NM_000195.3:c.397G>T | Hermansky-Pudlak syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPS1 gene located on chromosomal region 10q24.2. The age of onset is early childhood. This disease is characterized by oculocutaneous albinism, bleeding diathesis and, in some cases, neutropenia, pulmonary fibrosis, or granulomatous colitis. The prevalence is 1/500,000 - 1/1,000,000. | 600 |
| HSD17B4 | D-bifunctional protein deficiency | NM_000414.3 | NM_000414.3:c.1369A>T, NM_000414.3:c.46G>A, NM_000414.3:c.972+1G>T, NM_000414.3:c.317G>C | Bifunctional enzyme deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSD17B4 gene located on chromosomal region 5q23. The age of onset is juvenile. This disease is characterized by slowly progressive cerebellar atrophy and ataxia, intellectual decline, hearing loss, hypogonadism, hyperreflexia, a demyelinating sensorimotor neuropathy. | 600 |
| HSD17B4 | Perrault syndrome | NM_000414.3 | NM_000414.3:c.650A>G | Perrault syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSD17B4 gene located on chromosomal region 5q23.1. The age of onset is adult. This disease is characterized by ovarian dysgenesis in females with sensorineural hearing impairment and other neurological alterations. The prevalence is <1:1,000,000. | 600 |
| HSPD1 | Leukodystrophy hypomyelinating type 4 | NM_002156.4 | NM_002156.4:c.1381C>G, NM_002156.4:c.292G>A | Leukodystrophy hypomyelinating type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSPD1 gene located on chromosomal region 2q33.1. The age of onset is infantile. A severe autosomal recessive hypomyelinating leukodystrophy. Clinically characterized by infantile-onset rotary nystagmus, progressive spastic paraplegia, neurologic regression, motor impairment, profound mental retardation. Death usually occurs within the first two decades of life. | 600 |
| HSPG2 | Schwartz-Jampel syndrome type 1 | NM_005529.6 | NM_005529.6:c.13075delC, NM_005529.6:c.1653_1654insT, NM_005529.6:c.10355G>A, NM_005529.6:c.1125C>A, NM_005529.6:c.9326delA, NM_005529.6:c.8464+4A>G | Schwartz-Jampel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSPG2 gene located on chromosomal region 1p36.12. The age of onset is infantile. This disease is characterized by myotonia and osteoarticular abnormalities. The prevalence is <1:1,000,000. | 600 |
| HTRA1 | CARASIL syndrome | NM_002775.4 | NM_002775.4:c.1108C>T, NM_002775.4:c.883G>A, NM_002775.4:c.904C>T, NM_002775.4:c.754G>A, NM_002775.4:c.889G>A | Cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy (CARASIL syndrome) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HTRA1 gene located on chromosomal region 10q26.13. The age of onset is adult. This disease is characterized by early-onset gait disturbances, premature scalp alopecia, ischemic stroke, acute mid to lower back pain and progressive cognitive disturbances leading to severe dementia. About 50 people diagnosed, mainly in Japan and China. | 600 |
| HYLS1 | Hydrolethalus syndrome type 1 | NM_145014.2 | NM_145014.2:c.632A>G, NM_145014.2:c.724C>T, NM_145014.2:c.669G>A | Hydrolethalus syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HYLS1 gene located on chromosomal region 11q24.2. The age of onset is fetal. This disease is characterized by craniofacial dysmorphic features, central nervous system, cardiac, respiratory tract and limb abnormalities. The incidence is 1/20,000 in Finland and the prevalence is <1:1,000,000. | 600 |
| IDH3B | Retinitis pigmentosa type 46 | NM_006899.3 | NM_006899.3:c.395T>C, NM_006899.3:c.490C>T, NM_006899.3:c.589delA | Retinitis pigmentosa 46 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IDH3B gene located on chromosomal region 20p13. The age of onset is variable. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness. The prevalence is 1/3,000 to 1/5,000. | 600 |
| IDS | Mucopolysaccharidosis type 2 | NM_000202.6 | NM_000202.6:c.1464G>T, NM_000202.6:c.1466G>C, NM_000202.6:c.1505G>C, NM_000202.6:c.283A>G, NM_000202.6:c.208dupC, NM_000202.6:c.596_599delAACA, NM_000202.6:c.597delA, NM_000202.6:c.683C>T, NM_000202.6:c.1148delC, NM_000202.6:c.880-8A>G, NM_000202.6:c.937C>T, NM_000202.6:c.998C>T, NM_000202.6:c.690_691insT, NM_000202.6:c.1122C>T, NM_000202.6:c.587T>C, NM_000202.6:c.314_317dupTCAA, NM_000202.6:c.278delC, NM_000202.6:c.514C>T, NM_000202.6:c.1508T>A, NM_000202.6:c.388_389insG, NM_000202.6:c.240+1G>A, NM_000202.6:c.404A>G | Mucopolysaccharidosis type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IDS gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by distinctive coarse facial features, short stature, cardio-respiratory involvement and skeletal abnormalities. The prevalence is 1:100,000-1:170,000 mannewborn. | 600 |
| IFT80 | Short-rib thoracic dysplasia type 2 with or without polydactyly | NM_020800.2 | NM_020800.2:c.701C>G, NM_020800.2:c.721G>C, NM_020800.2:c.315C>G | Short-rib thoracic dysplasia type 2 with or without polydactyly an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IFT80 gene located on chromosomal region 3q25.33. The age of onset is antenatal/neonatal. This is, a group of autosomal recessive ciliopathies that are characterized by a constricted thoracic cage, short ribs, shortened tubular bones, and a trident appearance of the acetabular roof. Polydactyly is variably present. Non-skeletal involvement can include cleft lip/palate as well as anomalies of major organs such as the brain, eye, heart, kidneys, liver, pancreas, intestines, and genitalia. Some forms of the disease are lethal in the neonatal period due to respiratory insufficiency secondary to a severely restricted thoracic cage, whereas others are compatible with life. Disease spectrum encompasses Ellis-van Creveld syndrome, asphyxiating thoracic dystrophy (Jeune syndrome), Mainzer-Saldino syndrome, and short rib-polydactyly syndrome. The incidence is 1-5/500,000. | 600 |
| IGF1 | Growth delay due to insulin-like growth factor type 1 deficiency | NM_000618.3 | NM_000618.3:c.274G>A | Growth delay due to insulin-like growth factor type 1 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGF1 gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by the association of intrauterine and postnatal growth retardation with sensorineural deafness and intellectual deficit, addition clinical features include microcephaly, adiposity, and insulin resistance. The prevalence is <1:1,000,000. | 600 |
| IGHMBP2 | Spinal muscular atrophy, distal, type 1, autosomal recessive | NM_002180.2 | NM_002180.2:c.1488C>A, NM_002180.2:c.2611+1G>T, NM_002180.2:c.1540G>A, NM_002180.2:c.1738G>A, NM_002180.2:c.661delA, NM_002180.2:c.121C>T, NM_002180.2:c.1101_1116delCTACTTCGACGTGGTG, NM_002180.2:c.2922T>G, NM_002180.2:c.1107C>G, NM_002180.2:c.2362C>T, NM_002180.2:c.638A>G | Autosomal recessive distal spinal muscular atrophy type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGHMBP2 gene located on chromosomal region 11q13.3. The age of onset is infantile. This disease is characterized by neuromuscular disorder characterized by progressive weakness and atrophy of the diaphragm and skeletal muscles, leading to death in childhood. The prevalence is 4:100,000-10:100,000. | 250,600 |
| IKBKAP | Familial dysautonomia | NM_003640.3 | NM_003640.3:c.3332delC, NM_003640.3:c.1460+2T>C, NM_003640.3:c.2204+6T>C, NM_003640.3:c.2328delT, NM_003640.3:c.2741C>T, NM_003640.3:c.2087G>C, NM_003640.3:c.2087G>A | Familial dysautonomia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IKBKAP gene located on chromosomal region 9q31.3. The age of onset is infantile. This disease is characterized by sensory dysfunction and severe impairment of the autonomic nervous system activity, resulting in multisystem dysfunction. The prevalence is <1:1,000,000 | 600 |
| IL2RG | Severe combined immunodeficiency T-B+; X-linked | NM_000206.2 | NM_000206.2:c.454+1G>A, NM_000206.2:c.452T>C, NM_000206.2:c.186T>A, NM_000206.2:c.664C>T, NM_000206.2:c.343T>C, NM_000206.2:c.854G>A, NM_000206.2:c.341G>A, NM_000206.2:c.355A>T | T-B+ severe combined immunodeficiency, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IL2RG gene located on chromosomal region Xq13.1. The age of onset is infantile. This disease is characterized by absent or markedly reduced numbers of T cells, leading to recurrent infections. The prevalence is 1:50,000-1:100,000. | 600 |
| IMPDH1 | Retinitis pigmentosa type 10 | NM_000883.3 | NM_000883.3:c.1057G>A, NM_000883.3:c.1390delC, NM_000883.3:c.931G>A | Retinitis pigmentosa type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IMPDH1 gene located on chromosomal region 7q32.1. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades. The prevalence is 1/4,000. | 250,600 |
| IMPG2 | Retinitis pigmentosa type 56 | NM_016247.3 | NM_016247.3:c.635C>G, NM_016247.3:c.3262C>T, NM_016247.3:c.502-1G>C, NM_016247.3:c.2890C>T | Retinitis pigmentosa type 56 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IMPG2 gene located on chromosomal region 3q12.3. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades. The prevalence is 1/4.000. | 600 |
| INPP5E | Joubert syndrome type 1 | NM_019892.4 | NM_019892.4:c.1132C>T, NM_019892.4:c.855_856insCG, NM_019892.4:c.1688G>A, NM_019892.4:c.1543C>T, NM_019892.4:c.1304G>A | Joubert syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized by congenital malformation of the brainstem and agenesis or hypoplasia of the cerebellar vermis leading to an abnormal respiratory pattern, nystagmus, hypotonia, ataxia, and delay in achieving motor milestones.. The prevalence is 1/100.000. | 250,600 |
| INPP5E | MORM syndrome | NM_019892.4 | NM_019892.4:c.1879C>T | MORM syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized by the association of intellectual deficit, truncal obesity, retinal dystrophy and micropenis. The prevalence is 1/100.000. | 250,600 |
| INSR | Diabetes mellitus, insulin-resistant | NM_000208.2 | NM_000208.2:c.3079C>T, NM_000208.2:c.3680G>C, NM_000208.2:c.3034G>A, NM_000208.2:c.1114C>T, NM_000208.2:c.1378A>G | Diabetes mellitus, insulin-resistant follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by the triad of hyperinsulinemia, acanthosis nigricans (skin lesions associated with insulin resistance), and signs of hyperandrogenism in females without lipodystrophy and who are not overweight. It is generally diagnosed in young women with marked signs of hyperandrogenism, but insulin resistance and acanthosis nigricans may be observed in men and in childhood. Acromegaloid facies or muscular cramps are sometimes associated. Hyperinsulinemia, a biological marker for insulin resistance, is often associated with glucose tolerance defects over the course of the disease, and diabetes progressively sets in. Hyperandrogenism (associated with polycystic ovarian syndrome (see this term) or ovarian hyperthecoses) leads to fertility problems. The prevalence is <1:1,000,000. | 250,600 |
| INSR | Leprechaunism | NM_000208.2 | NM_000208.2:c.2668C>T, NM_000208.2:c.172G>A | Leprechaunism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by intrauterine and mainly postnatal severe growth retardation, extreme insulin resistance. The prevalence is <1:1,000,000. | 250,600 |
| IQCB1 | Senior-Loken syndrome type 5 | NM_001023570.2 | NM_001023570.2:c.1036G>T, NM_001023570.2:c.817G>T, NM_001023570.2:c.1381C>T, NM_001023570.2:c.1465C>T, NM_001023570.2:c.1090C>T, NM_001023570.2:c.1518_1519delCA, NM_001023570.2:c.1069C>T | Senior-Loken syndrome type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IQCB1 gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by the association of nephronophthisis (NPHP), a chronic kidney disease, with retinal dystrophy. The prevalence is 1/1.000.000. | 600 |
| ISCU | Myopathy with deficiency of ISCU | NM_213595.3 | NM_213595.3:c.338_339+2delCGGT, NM_213595.3:c.149G>A | Hereditary myopathy with lactic acidosis due to ISCU deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ISCU gene located on chromosomal region 12q23.3. The age of onset is infantile. This disease is characterized by myopathy with severe exercise intolerance. | 600 |
| ITGA6 | Epidermolysis bullosa, junctional with pyloric atresia | NM_000210.2 | NM_000210.2:c.791delC, NM_000210.2:c.1255dupA | Junctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGA6 and ITGB4 genes located on chromosomal regions 2q31.1 and 17q25.1 respectively. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. | 600 |
| ITGB4 | Epidermolysis bullosa, junctional with pyloric atresia | NM_001005731.1 | NM_001005731.1:c.112T>C, NM_001005731.1:c.1684T>C, NM_001005731.1:c.1150delG, NM_001005731.1:c.1544G>A, NM_001005731.1:c.3977-19T>A, NM_001005731.1:c.4410delG, NM_001005731.1:c.4433G>A, NM_001005731.1:c.5119+2T>C, NM_001005731.1:c.3321_3331delACTGGACCGGA, NM_001005731.1:c.4618C>T, NM_001005731.1:c.182G>A, NM_001005731.1:c.2607delC, NM_001005731.1:c.3801_3802insT, NM_001005731.1:c.3841C>T, NM_001005731.1:c.2608delC, NM_001005731.1:c.3793+1G>A, NM_001005731.1:c.1660C>T, NM_001005731.1:c.3674G>A | Junctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGA6 and ITGB4 genes located on chromosomal regions 2q31.1 and 17q25.1 respectively. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. | 250,600 |
| ITGB4 | Epidermolysis bullosa, without pyloric atresia | NM_001005731.1 | NM_001005731.1:c.2792G>A | Junctional epidermolysis bullosa with piloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGB4 gene located on chromosomal region 17q25.1. The age of onset is neonatal. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. More than 100 cases have been reported around the world. | 250,600 |
| IVD | Isovaleric acidemia | NM_002225.3 | NM_002225.3:c.158G>C, NM_002225.3:c.1208A>G, NM_002225.3:c.157C>T, NM_002225.3:c.1141T>C, NM_002225.3:c.243+1G>A, NM_002225.3:c.1147+1_1147+4delGTGA, NM_002225.3:c.367G>A, NM_002225.3:c.605G>T, NM_002225.3:c.1145_1147+4delTTGGTGA, NM_002225.3:c.559+1G>A, NM_002225.3:c.134T>C, NM_002225.3:c.941C>T, NM_002225.3:c.627delT, NM_002225.3:c.793+1G>A, NM_002225.3:c.2T>G, NM_002225.3:c.1183C>T, NM_002225.3:c.390delT, NM_002225.3:c.406_407delTG, NM_002225.3:c.158G>A, NM_002225.3:c.593G>A, NM_002225.3:c.507delG, NM_002225.3:c.1188delT, NM_002225.3:c.465+2T>C, NM_002225.3:c.434_437dupATGA, NM_002225.3:c.860G>A, NM_002225.3:c.994_995delAT, NM_002225.3:c.1192C>T, NM_002225.3:c.478_479insGT | Isovaleric academia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IVD gene located on chromosomal region 15q15.1. The age of onset is neonatal. This disease is characterized by vomiting, dehydration, coma and abnormal movements. The prevalence is 1/100,000. | 250,600 |
| JAK3 | Severe combined immunodeficiency T-B+NK- | NM_000215.3 | NM_000215.3:c.452C>G, NM_000215.3:c.1765G>A, NM_000215.3:c.1333C>T, NM_000215.3:c.1172_1173insG, NM_000215.3:c.1837C>T, NM_000215.3:c.299A>G, NM_000215.3:c.1695C>A | Severe combined immunodeficiency T-B+NK- follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the JAK3 gene located on chromosomal region 19p13.11. The age of onset is infantile. This disease is characterized by chronic diarrhea, failure to thrive, recurrent respiratory infections and/or generalized infections due to opportunistic pathogens. The incidence is 1/100,000 and 1/1,000,000. | 250,600 |
| KCNJ1 | Bartter syndrome type 2 | NM_000220.4 | NM_000220.4:c.1012C>T, NM_000220.4:c.1070T>C, NM_000220.4:c.592G>A, NM_000220.4:c.322G>C, NM_000220.4:c.372T>A, NM_000220.4:c.500G>A, NM_000220.4:c.237C>G, NM_000220.4:c.1014delA, NM_000220.4:c.641C>T, NM_000220.4:c.657C>G, NM_000220.4:c.996_999delAAAG, NM_000220.4:c.942T>G | Bartter syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ1 gene located on chromosomal region 11q24.3. The age of onset is antenatal. This disease is characterized by severe polyhydramnios in mother leading to premature delivery, postnatally newborns suffer from recurrent episodes of severe dehydration and electrolyte imbalance which can lead to fatal outcome. | 250,600 |
| KCNJ13 | Leber congenital amaurosis type 16 | NM_002242.4 | NM_002242.4:c.722T>C | Leber congenital amaurosis type 16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ13 gene located on chromosomal region 2q37.1. The age of onset is early infantile. This disease is characterized by retinal dystrophy defined by blindness, nystagmus, roving eye movement, leading to severe visual impairment within the first year of life. | 600 |
| KCNV2 | Retinal cone dystrophy type 3B | NM_133497.3 | NM_133497.3:c.1016_1024delACCTGGTGG, NM_133497.3:c.1376G>A, NM_133497.3:c.427G>T, NM_133497.3:c.226C>T, NM_133497.3:c.325C>T, NM_133497.3:c.357_358insC, NM_133497.3:c.1480A>C, NM_133497.3:c.1132_1133insT, NM_133497.3:c.854T>G, NM_133497.3:c.491T>C, NM_133497.3:c.767C>G, NM_133497.3:c.916G>T, NM_133497.3:c.778A>T, NM_133497.3:c.442G>T | Retinal cone dystrophy type 3B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNV2 gene located on 9p24.2. The age of onset is in the first or second decade of life. This disease is characterized by is characterized by onset in the first or second decade of life of very marked photophobia, myopia, reduced color vision along the red-green axis with relatively preserved tritan discrimination, and central scotomata with peripheral widespread sensitivity loss predominating in the superior visual field. Nyctalopia is a later feature of the disorder. There is often retinal pigment epithelium disturbance at the macula with a normal retinal periphery. | 250,600 |
| KIF7 | Acrocallosal syndrome | NM_198525.2 | NM_198525.2:c.2473G>T, NM_198525.2:c.687delG, NM_198525.2:c.3001C>T, NM_198525.2:c.460C>T, NM_198525.2:c.61C>T, NM_198525.2:c.2896_2897delGC, NM_198525.2:c.3778_3779insC | Acrocallosal syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KIF7 gene located on chromosomal region 15q26.1. The age of onset is infantile. This disease is characterized by y agenesis of corpus callosum (CC), distal anomalies of limbs, minor craniofacial anomalies and intellectual deficit. The prevalence is <1:1,000,000. | 600 |
| L1CAM | MASA sindrome/hydrocephalus | NM_000425.4 | NM_000425.4:c.3489_3490delTG, NM_000425.4:c.3201T>G, NM_000425.4:c.719C>T, NM_000425.4:c.3581C>T, NM_000425.4:c.2879delA, NM_000425.4:c.791G>A, NM_000425.4:c.2092G>A, NM_000425.4:c.924C>T, NM_000425.4:c.536T>G, NM_000425.4:c.23delT, NM_000425.4:c.2254G>A, NM_000425.4:c.800dupA, NM_000425.4:c.772C>T, NM_000425.4:c.1354G>A, NM_000425.4:c.551G>A, NM_000425.4:c.1792G>A, NM_000425.4:c.1108G>A | MASA sindrome/hydrocephalus follows an X-linked pattern of inheritance and is caused by pathogenic variants in the L1CAM gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by adducted thumbs, hypotonia progressing to spasticity or spastic paraplegia, delayed development of speech, mild to moderate intellectual deficit, and mild to moderate distension of the cerebral ventricles. Hydrocephalus appears frequently. The prevalence is 1:25,000-1:60,000 male. | 600 |
| LAMA2 | Congenital muscular dystrophy type 1A | NM_000426.3 | NM_000426.3:c.184G>T, NM_000426.3:c.1612C>T, NM_000426.3:c.3718C>T, NM_000426.3:c.2750-1G>C, NM_000426.3:c.2049_2050delAG, NM_000426.3:c.5050G>T, NM_000426.3:c.1634T>A, NM_000426.3:c.2045_2046delAG, NM_000426.3:c.4645C>T, NM_000426.3:c.2962C>T, NM_000426.3:c.2098_2099delTT, NM_000426.3:c.4437-5T>A, NM_000426.3:c.2901C>A, NM_000426.3:c.112+1G>A, NM_000426.3:c.7732C>T, NM_000426.3:c.6038delT, NM_000426.3:c.7888C>T, NM_000426.3:c.825delC, NM_000426.3:c.8314delA, NM_000426.3:c.3976C>T, NM_000426.3:c.9101_9104dupAACA, NM_000426.3:c.9253C>T, NM_000426.3:c.2323-2A>T, NM_000426.3:c.8748delA, NM_000426.3:c.6334A>T, NM_000426.3:c.1050delT, NM_000426.3:c.7536delC, NM_000426.3:c.8705delT, NM_000426.3:c.9221delA, NM_000426.3:c.5227G>T, NM_000426.3:c.6429+1G>A, NM_000426.3:c.6617delT, NM_000426.3:c.2451-2A>G, NM_000426.3:c.6011delA, NM_000426.3:c.7810C>T, NM_000426.3:c.8684C>G, NM_000426.3:c.3630delT, NM_000426.3:c.3215delG, NM_000426.3:c.3623_3645delAGGGCATTGTTTTTCAACATCCA, NM_000426.3:c.6955C>T, NM_000426.3:c.7279_7280delCT, NM_000426.3:c.725G>A, NM_000426.3:c.7147C>T, NM_000426.3:c.3237C>A | Congenital muscular dystrophy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMA2 gene located on chromosomal region 6q22.33. The age of onset is early infancy. This disease is characterized by hypotonia, muscle weakness and muscle wasting and motor development delayed. The prevalence is 1/30,000. | 250,600 |
| LAMA3 | Epidermolysis bullosa, junctional 2A, intermediate;Epidermolysis bullosa, junctional 2B, severe;Epidermolysis bullosa, junctional 2C, laryngoonychocutaneous | NM_000227.3 | NM_000227.3:c.-122061G>T, NM_000227.3:c.335delG, NM_000227.3:c.4878dupT, NM_000227.3:c.2116A>T, NM_000227.3:c.4135C>T, NM_000227.3:c.751G>T, NM_000227.3:c.1981C>T, NM_000227.3:c.3350+2T>G, NM_000227.3:c.1182delG, NM_000227.3:c.4335_4336insA, NM_000227.3:c.2662C>T | Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 and LAMC2 genes located on chromosomal regions 1q32.2 and 1q25.3 respectively. The age of onset is infantile. It is a lethal form of junctional epidermolysis bullosa, a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement. In the Herlitz type, death occurs usually within the first six months of life. Occasionally, children survive to teens. It is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic. | 600 |
| LAMB3 | Epidermolysis bullosa, junctional | NM_000228.2 | NM_000228.2:c.1587_1588delAG, NM_000228.2:c.124C>T, NM_000228.2:c.1438_1442delCCGTG, NM_000228.2:c.1830G>A, NM_000228.2:c.565-2A>G, NM_000228.2:c.2806C>T, NM_000228.2:c.904delT, NM_000228.2:c.1357delT, NM_000228.2:c.3228+1G>T, NM_000228.2:c.628+1delG, NM_000228.2:c.496C>T, NM_000228.2:c.1903C>T, NM_000228.2:c.628G>A, NM_000228.2:c.3228+1G>A, NM_000228.2:c.727C>T | Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 and LAMC2 genes located on chromosomal regions 1q32.2 and 1q25.3 respectively. The age of onset is infantile. It is a lethal form of junctional epidermolysis bullosa, a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement. In the Herlitz type, death occurs usually within the first six months of life. Occasionally, children survive to teens. It is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic. | 250,600 |
| LAMC2 | Epidermolysis bullosa, junctional 3A, intermediate;Epidermolysis bullosa, junctional 3B, severe | NM_005562.2 | NM_005562.2:c.1659C>A, NM_005562.2:c.3069+1G>A, NM_005562.2:c.1782_1783delGC, NM_005562.2:c.2137_2143delCAGAACC, NM_005562.2:c.283C>T, NM_005562.2:c.343C>T, NM_005562.2:c.3512_3513insA, NM_005562.2:c.405-1G>A, NM_005562.2:c.3120_3121insA | Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 and LAMC2 genes located on chromosomal regions 1q32.2 and 1q25.3 respectively. The age of onset is infantile. It is a lethal form of junctional epidermolysis bullosa, a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement. In the Herlitz type, death occurs usually within the first six months of life. Occasionally, children survive to teens. It is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic. | 600 |
| LARGE | Muscular dystrophy-dystroglycanopathy type 6 | NM_004737.4 | NM_004737.4:c.1102C>T, NM_004737.4:c.992C>T, NM_004737.4:c.1525G>A, NM_004737.4:c.1483T>C | Muscular dystrophy-dystroglycanopathy type 6follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LARGE gene located on chromosomal region 22q12.3. The age of onset is infantile. There are two subtypes. Subtype 6A is associated with cobblestone lissencephaly and other brain anomalies, eye malformations, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Subtype 6B is associated with profound mental retardation, white matter changes and structural brain abnormalities. Skeletal muscle biopsies show reduced immunolabeling of alpha-dystroglycan. The prevalence is 1:100,000-9:100,000. | 600 |
| LBR | Greenberg skeletal dysplasia | NM_002296.3 | NM_002296.3:c.1748G>A, NM_002296.3:c.1402delT, NM_002296.3:c.1114C>T, NM_002296.3:c.32_35delTGGT | Greenberg dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LBR gene located on chromosomal region 1q42.12. The age of onset is fetal. This disease is characterized by fetal hydrops, short limbs and abnormal chondro-osseous calcification. The prevalence is <1:1,000,000. | 600 |
| LDHA | Glycogen storage disease type 11 | NM_005566.3 | NM_005566.3:c.126+1_126+4delGTAA, NM_005566.3:c.126+1G>A, NM_005566.3:c.310G>T, NM_005566.3:c.126+1_126+4del, NM_005566.3:c.397G>T, NM_005566.3:c.213+1_213+4delGTAA, NM_005566.3:c.640_641delCT | Glycogen storage disease type 11 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LDHA gene located on chromosomal region 11p15.1. The age of onset is infantile. This disease is characterized by hepatic glycogenosis and renal Fanconi syndrome. | 600 |
| LEPRE1 | Osteogenesis imperfecta type 8 | NM_022356.3 | NM_022356.3:c.2055+13_2055+31del19, NM_022356.3:c.1656C>A, NM_022356.3:c.1365_1366delAGinsC, NM_022356.3:c.2068_2086delCGAGCGGGTGAGAGCAGCT, NM_022356.3:c.747delC, NM_022356.3:c.1102C>T, NM_022356.3:c.1473+1G>T | Osteogenesis imperfecta type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LEPRE1 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by bone fragility, low bone mass and susceptibility to bone fractures. The prevalence is 6:100,000-7:100,000. | 600 |
| LHFPL5 | Deafness type 67, autosomal recessive | NM_182548.3 | NM_182548.3:c.494C>T, NM_182548.3:c.476G>A, NM_182548.3:c.649delG, NM_182548.3:c.250delC, NM_182548.3:c.380A>G | Autosomal recessive nonsyndromic sensorineural deafness type DFNB67 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LHFPL5 gene located on chromosomal region 6p21.31. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| LHX3 | Combined pituitary hormone deficiency type 3 | NM_014564.3 | NM_014564.3:c.687G>A, NM_014564.3:c.347A>G | Combined pituitary hormone deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LHX3 gene located on chromosomal region 9q34.3. The age of onset is infantile, etc/. This disease is characterized by somatolactotroph, thyrotroph and gonadotroph deficiencies, limited head and neck rotation associated with spinal abnormalities. The prevalence is <1 /1,000,000. | 600 |
| LIFR | Stuve-Wiedemann syndrome | NM_002310.5 | NM_002310.5:c.2013_2014insT, NM_002310.5:c.653dupT, NM_002310.5:c.1018_1022delAATTG, NM_002310.5:c.2503G>T, NM_002310.5:c.171_174delTAAC, NM_002310.5:c.1789C>T | Stüve-Wiedemann syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LIFR gene located on chromosomal region 5p13.1. The age of onset is neonatal. This disease is characterized by small stature, congenital bowing of the long bones and campodactyly. | 600 |
| LIG4 | LIG4 syndrome | NM_002312.3 | NM_002312.3:c.1271_1275delAAAGA, NM_002312.3:c.833G>A, NM_002312.3:c.1738C>T, NM_002312.3:c.2440C>T, NM_002312.3:c.1406G>A, NM_002312.3:c.1455_1456delTG, NM_002312.3:c.1369_1372delGGAC, NM_002312.3:c.1512_1513delTC | LIG4 syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LIG4 gene located on chromosomal region 10p13. The age of onset is infantile. It is associated with impaired DNA double-strand break repair mechanisms and characterized by microcephaly, unusual facial features (''bird-like''), growth and developmental delay, skin anomalies including photosensitivity and psoriatic-like lesions, and pancytopenia. The disease is associated with immunodeficiency. Some patients have been reported as having telangiectasias, leukemia, lymphoma, bone marrow abnormalities, and type 2 diabetes. The prevalence 1-9/1.000.000. | 600 |
| LMNA | Cardiomyopathy, dilated type 1A | NM_170707.3 | NM_170707.3:c.1366A>C, NM_170707.3:c.1930C>T, NM_170707.3:c.1567G>A, NM_170707.3:c.1786G>A | Dilated cardiomyopathy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death. | 250,600 |
| LMNA | Hutchinson-Gilford progeria syndrome | NM_170707.3 | NM_170707.3:c.1579C>T, NM_170707.3:c.1411C>T, NM_170707.3:c.1824C>T, NM_170707.3:c.1626G>C | Hutchinson-Gilford progeria syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/infancy. It is characterized by growth reduction, failure to thrive, a typical facial appearance (prominent forehead, protuberant eyes, thin nose with a beaked tip, thin lips, micrognathia and protruding ears) and distinct dermatologic features (generalized alopecia, aged-looking skin, sclerotic and dimpled skin over the abdomen and extremities, prominent cutaneous vasculature, dyspigmentation, nail hypoplasia and loss of subcutaneous fat). | 250,600 |
| LMNA | Lipodystrophy, familial partial, type 2 | NM_170707.3 | NM_170707.3:c.1318G>A | Lipodystrophy, familial partial, type2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by the loss of subcutaneous adipose tissue in the lower parts of the body (limbs, buttocks, trunk). It is accompanied by an accumulation of adipose tissue in the face and neck causing a double chin, fat neck, or cushingoid appearance. Adipose tissue may also accumulate in the axillae, back, labia majora, and intraabdominal region. Affected patients are insulin-resistant and may develop glucose intolerance and diabetes mellitus after age 20 years,hypertriglyceridemia, and low levels of high density lipoprotein cholesterol. | 250,600 |
| LMNA | Mandibuloacral dysplasia | NM_170707.3 | NM_170707.3:c.1586C>T, NM_170707.3:c.1580G>A, NM_170707.3:c.1585G>A, NM_170707.3:c.1228C>T | Mandibuloacral dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/. This disease is characterized by postnatal growth retardation, craniofacial anomalies, skeletal malformations, and mottled cutaneous pigmentation. The prevalence is 1:2,700-1:5,000. | 250,600 |
| LMNA | Muscular dystrophy, Emery-Dreifuss type 3 | NM_170707.3 | NM_170707.3:c.1072G>A, NM_170707.3:c.419T>C, NM_170707.3:c.1488+1G>A, NM_170707.3:c.1583C>A | Emery-Dreifuss muscular dystrophy type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by weakness and atrophy of muscle without involvement of the nervous system, early contractures of the elbows, Achilles tendons and spine, and cardiomyopathy associated with cardiac conduction defects. | 250,600 |
| LOXHD1 | Deafness type 77, autosomal recessive | NM_144612.6 | NM_144612.6:c.2008C>T, NM_144612.6:c.2T>A, NM_144612.6:c.3874C>T, NM_144612.6:c.4526G>A, NM_144612.6:c.3924C>A, NM_144612.6:c.512-1G>A, NM_144612.6:c.4524_4525delAG, NM_144612.6:c.4714C>T, NM_144612.6:c.457_461dupCGCCA | Autosomal recessive nonsyndromic sensorineural deafness type DFNB77 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LOXHD1 gene located on chromosomal region 18q21.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| LRAT | Leber congenital amaurosis type 14 | NM_004744.3 | NM_004744.3:c.217_218delAT, NM_004744.3:c.588dupT | Leber congenital amaurosis 14 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRAT gene located on chromosomal region 4q32.1. The age of onset is infantile. This disease is characterized by blindness, nystagmus, roving eye movement. The prevalence is 2:100,000-3:100,000 newborn. | 600 |
| LRAT | Retinal dystrophy, early-onset severe | NM_004744.3 | NM_004744.3:c.525T>A | Retinal dystrophy, early-onset severe follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRAT gene located on chromosomal region 4q32.1. The age of onset is infantile. It is a mild form of Leber congenital amaurosis that is characterized by a severe night blindness, nystagmus, and sluggish pupil responses. A relatively good central vision well into the second decade of life and blindness by the age of 30 years is generally observed. The prevalence is 2:100,000-3:100,000 newborn. | 600 |
| LRP2 | Donnai-Barrow syndrome | NM_004525.2 | NM_004525.2:c.11469_11472delTTTG, NM_004525.2:c.2640-1G>A, NM_004525.2:c.13139_13140insC, NM_004525.2:c.1093C>T, NM_004525.2:c.11663G>A, NM_004525.2:c.7564T>C, NM_004525.2:c.8519_8522delATTT, NM_004525.2:c.1341+2T>G, NM_004525.2:c.10769-2A>G, NM_004525.2:c.9484_9485delGT, NM_004525.2:c.13388+2T>C, NM_004525.2:c.11636-1G>T | Donnai-Barrow syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP2 gene located on chromosomal region 2q31.1. The age of onset is infantile. This disease is characterized by diaphragmatic hernia, ocular findings, hipertelorism, agenesis of the corpus callosum, hearing loss and facial dimorphism. The prevalence is <1:1,000,000. | 600 |
| LRP5 | Exudative vitreoretinopathy type 4 | NM_002335.3 | NM_002335.3:c.2254C>G, NM_002335.3:c.518C>T, NM_002335.3:c.1709G>A, NM_002335.3:c.804_813delGGGGAAGAGG, NM_002335.3:c.4099G>A | Exudative vitreoretinopathy type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile or juvenile. This disease is characterized by abnormal or incomplete vascularization of the peripheral retina leading to variable clinical manifestations ranging from no effects to minor anomalies, or even retinal detachment with blindness. | 250,600 |
| LRP5 | Isolated polycystic liver disease | NM_002335.3 | NM_002335.3:c.4651G>A | Isolated polycystic liver disease due to LRP5 gene located on chromosomal region 11q13.2 follows an autosomal recessive pattern of inheritance. The age of onset is variable. This disease is characterized by the appearance of numerous cysts spread throughout the liver. | 250,600 |
| LRP5 | Osteoporosis-pseudoglioma syndrome | NM_002335.3 | NM_002335.3:c.1481G>A, NM_002335.3:c.1453G>T, NM_002335.3:c.1468delG, NM_002335.3:c.2305delG, NM_002335.3:c.2202G>A, NM_002335.3:c.1708C>T, NM_002335.3:c.3107G>A, NM_002335.3:c.2557C>T | Osteoporosis-pseudoglioma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by congenital or infancy-onset blindness and severe juvenile-onset osteoporosis and spontaneous fractures. The prevalence is 1:2,000,000. | 250,600 |
| LRPPRC | Leigh syndrome, French-Canadian type | NM_133259.3 | NM_133259.3:c.1061C>T, NM_133259.3:c.3830_3839delGTGGTGCAATinsAG | French-Canadian type Leigh syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRPPRC gene located on chromosomal region 2p21. The age of onset is infantile. This disease is characterized by chronic metabolic acidosis, hypotonia, facial dysmorphism and delayed development. The prevalence is 1:2,000 newborn. | 600 |
| LRTOMT | Deafness type 63, utosomal recessive | NM_001145308.4 | NM_001145308.4:c.242G>A | Autosomal recessive nonsyndromic sensorineural deafness type DFNB63 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRTOMT gene located on chromosomal region 11q13.4. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| MAK | Retinitis pigmentosa type 62 | NM_001242957.1 | NM_001242957.1:c.37G>A, NM_001242957.1:c.719_720dupAG, NM_001242957.1:c.1087_1088delAG, NM_001242957.1:c.718C>T, NM_001242957.1:c.388A>C | Retinitis pigmentosa type 62 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAK gene located on chromosomal region 6p24.2. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades. | 600 |
| MAN2B1 | Alpha-mannosidosis | NM_000528.3 | NM_000528.3:c.215A>T, NM_000528.3:c.2401G>T, NM_000528.3:c.2278C>T, NM_000528.3:c.2368C>T, NM_000528.3:c.2119C>T, NM_000528.3:c.2013delT, NM_000528.3:c.1A>G, NM_000528.3:c.1067C>G, NM_000528.3:c.384G>A, NM_000528.3:c.2398G>A, NM_000528.3:c.1915C>T, NM_000528.3:c.2426T>C, NM_000528.3:c.2436+2T>C, NM_000528.3:c.1259G>T, NM_000528.3:c.1780C>T, NM_000528.3:c.1929G>A, NM_000528.3:c.2686_2687delCTinsG, NM_000528.3:c.1830+1G>C | Alpha-mannosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAN2B1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by immunodeficiency, facial and skeletal abnormalities, hearing impairment and intellectual disability. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| MARVELD2 | Deafness type 49, autosomal recessive | NM_001038603.2 | NM_001038603.2:c.1363C>T, NM_001038603.2:c.1183-1G>A | Autosomal recessive nonsyndromic sensorineural deafness type DFNB49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MARVELD2 gene located on chromosomal region 5q13.2. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| MAT1A | Methionine adenosyltransferase deficiency | NM_000429.2 | NM_000429.2:c.1006G>A, NM_000429.2:c.1070C>T, NM_000429.2:c.595C>T, NM_000429.2:c.1043_1044delTG, NM_000429.2:c.790C>T, NM_000429.2:c.827_828insG, NM_000429.2:c.538_539insTG, NM_000429.2:c.914T>C, NM_000429.2:c.791G>A, NM_000429.2:c.966T>G | Methionine adenosyltransferase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAT1A gene located on chromosomal region 10q23.1. This disease is characterized by brain demyelination (rarely leading to neurological disorders) and isolated hepatic hypermethioninemia. The prevalence is <1:1,000,000. | 600 |
| MATN3 | Multiple epiphyseal dysplasia type 5 | NM_002381.4 | NM_002381.4:c.1405+2T>C, NM_002381.4:c.910T>A, NM_002381.4:c.1303G>A, NM_002381.4:c.693G>C | Multiple epiphyseal dysplasia type 5 type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MATN3 gene located on chromosomal region 2p24.1. The age of onset is infantile. It is relatively mild and clinically variable. It is primarily characterized by delayed and irregular ossification of the epiphyses and early-onset osteoarthritis.The prevalence is <1:1,000,000. | 600 |
| MBTPS2 | Ichthyosis follicularis-atrichia-photophobia | NM_015884.3 | NM_015884.3:c.1286G>A, NM_015884.3:c.1424T>C, NM_015884.3:c.677G>T, NM_015884.3:c.261G>A | Ichthyosis follicularis - alopecia – photophobia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the MBTPS2 gene located on chromosomal region Xp22.12-p22.11. The age of onset is infantile. This disease is characterized by the triad of ichthyosis follicularis, alopecia, and photophobia. The prevalence is 1:200,000. | 600 |
| MCCC1 | 3-Methylcrotonyl-CoA carboxylase type 1 deficiency | NM_020166.4 | NM_020166.4:c.1155A>C, NM_020166.4:c.1930G>T, NM_020166.4:c.2079delA, NM_020166.4:c.388G>A, NM_020166.4:c.559T>C, NM_020166.4:c.343C>T, NM_020166.4:c.640-2A>G, NM_020166.4:c.1942G>A, NM_020166.4:c.1905delA, NM_020166.4:c.640-1G>A, NM_020166.4:c.1074delG, NM_020166.4:c.1114C>T, NM_020166.4:c.558delA, NM_020166.4:c.1277T>C, NM_020166.4:c.1526delG, NM_020166.4:c.1380T>G, NM_020166.4:c.310C>T, NM_020166.4:c.1310T>C | 3-methylcrotonyl-CoA carboxylase deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC1 gene located on chromosomal region 3q27.1. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn. | 600 |
| MCCC2 | 3-Methylcrotonyl-CoA carboxylase 2 deficiency, type 2 | NM_022132.4 | NM_022132.4:c.295G>C, NM_022132.4:c.380C>G, NM_022132.4:c.1309A>G, NM_022132.4:c.515_516insT, NM_022132.4:c.1015G>A, NM_022132.4:c.464G>A, NM_022132.4:c.641delG, NM_022132.4:c.1576_1577insT, NM_022132.4:c.735_736insC, NM_022132.4:c.517_518insT, NM_022132.4:c.838G>T, NM_022132.4:c.499T>C, NM_022132.4:c.1367C>T, NM_022132.4:c.929C>G, NM_022132.4:c.1065A>T, NM_022132.4:c.1580G>A, NM_022132.4:c.994C>T, NM_022132.4:c.1072+1G>A | 3-methylcrotonyl-CoA carboxylase deficiency type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC2 gene located on chromosomal region 5q13.2. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn. | 250,600 |
| MCEE | Methylmalonic acidemia due to methylmalonyl-CoA epimerase deficiency | NM_032601.3 | NM_032601.3:c.178A>C, NM_032601.3:c.2T>C, NM_032601.3:c.139C>T | Methylmalonic acidemia due to methylmalonyl-CoA epimerase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCEE gene located on chromosomal region 2p13.3. The age of onset is neonatal. This disease is characterized by lethargy, vomiting, hypotonia, hypothermia, respiratory distress, severe ketoacidosis, hyperammonemia, neutropenia, and thrombocytopenia. The prevalence is 1:50,000-1:80,000. | 600 |
| MCOLN1 | Mucolipidosis type 4 | NM_020533.2 | NM_020533.2:c.1084G>T, NM_020533.2:c.304C>T, NM_020533.2:c.1207C>T, NM_020533.2:c.964C>T | Mucolipidosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCOLN1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismus. The prevalence is 1:40,000. | 600 |
| MCPH1 | Microcephaly, primary, type 1, autosomal recessive | NM_024596.3 | NM_024596.3:c.1973+1G>A, NM_024596.3:c.2221C>T, NM_024596.3:c.427_428insA, NM_024596.3:c.1561G>T, NM_024596.3:c.1935+1G>T, NM_024596.3:c.215C>T, NM_024596.3:c.1249_1250insT | Autosomal recessive primary microcephaly type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCPH1 gene located on chromosomal region 8p23.1. The age of onset is neonatal. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. The incidence is 1/1,000,000. | 600 |
| MECP2 | Rett syndrome | NM_004992.3 | NM_004992.3:c.1048_1050delAGC, NM_004992.3:c.215dupC, NM_004992.3:c.611C>G, NM_004992.3:c.1282G>A, NM_004992.3:c.916C>T, NM_004992.3:c.806delG, NM_004992.3:c.502C>T, NM_004992.3:c.880C>T, NM_004992.3:c.674C>T, NM_004992.3:c.964C>T, NM_004992.3:c.705G>A, NM_004992.3:c.808C>T, NM_004992.3:c.730C>T, NM_004992.3:c.683C>G, NM_004992.3:c.753delC, NM_004992.3:c.965C>T, NM_004992.3:c.763C>T | Rett syndrome an X -linked pattern of inheritance and is caused by pathogenic variants in the MECP2 gene located on chromosomal region Xq28. The age of onset is neonatal. An X-linked dominant neurodevelopmental disorder, and one of the most common causes of mental retardation in females. Patients appear to develop normally until 6 to 18 months of age, then gradually lose speech and purposeful hand movements, and develop microcephaly, seizures, autism, ataxia, mental retardation and stereotypic hand movements. After initial regression, the condition stabilizes and patients usually survive into adulthood. The prevalence is 1:8,500. | 600 |
| MED12 | Ohdo syndrome | NM_005120.2 | NM_005120.2:c.3493T>C, NM_005120.2:c.5185C>A, NM_005120.2:c.3443G>A | Ohdo syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the MED12 gene located on chromosomal region Xq13.1. The age of onset is infantile. It is characterized by mental retardation, feeding problems, and distinctive facial appearance with coarse facial features, severe blepharophimosis, ptosis, a bulbous nose, micrognathia and a small mouth. Dental hypoplasia and deafness can be considered as common manifestations of the syndrome. Male patients show cryptorchidism and scrotal hypoplasia. | 600 |
| MED25 | Charcot-Marie-Tooth disease type 2B2 | NM_030973.3 | NM_030973.3:c.316delG, NM_030973.3:c.1366C>T, NM_030973.3:c.1004C>T | Charcot-Marie-Tooth disease type 2B2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MED25 gene located on chromosomal region 19q13.33. The age of onset is adult. This disease is characterized by symmetric moderate to severe weakness of the distal muscles, predominantly affecting the lower extremities. Marked sensory deficits were also reported. | 250,600 |
| MEFV | Familial mediterranean fever | NM_000243.2 | NM_000243.2:c.163_164insA, NM_000243.2:c.1437C>G, NM_000243.2:c.2282G>A, NM_000243.2:c.163dupA, NM_000243.2:c.2076_2078delAAT, NM_000243.2:c.1958G>A, NM_000243.2:c.443A>T, NM_000243.2:c.656_657insG, NM_000243.2:c.688G>A, NM_000243.2:c.800C>T, NM_000243.2:c.1223G>A, NM_000243.2:c.501G>C, NM_000243.2:c.2040G>A, NM_000243.2:c.2040G>C, NM_000243.2:c.2084A>G, NM_000243.2:c.1141C>T, NM_000243.2:c.1016C>T, NM_000243.2:c.2177T>C, NM_000243.2:c.1772T>C, NM_000243.2:c.2080A>G, NM_000243.2:c.2082G>A, NM_000243.2:c.2230G>T | Familial Mediterranean fever follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MEFV gene located on chromosomal region 16p13.3. The age of onset is infantile or adult (before the age of 30). This disease is characterized by recurrent short episodes of fever and serositis resulting in pain in the abdomen, chest, joints and muscles. The prevalence is 1:10,000-5:10,000. | 250,600 |
| MERTK | Retinitis pigmentosa type 38 | NM_006343.2 | NM_006343.2:c.2189+1G>T, NM_006343.2:c.1605-2A>G, NM_006343.2:c.2070_2074delAGGAC, NM_006343.2:c.2784_2785insTA, NM_006343.2:c.2785_2786dupTA, NM_006343.2:c.2323C>T, NM_006343.2:c.2207_2210delCTGT | Retinitis pigmentosa type 38 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MERTK gene located on chromosomal region 2q13. The age of onset is infantile. This disease is characterized by. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness. | 250,600 |
| MFRP | Microphthalmia - Retinitis pigmentosa - foveoschisis - optic disc drusen | NM_031433.3 | NM_031433.3:c.498delC, NM_031433.3:c.523C>T, NM_031433.3:c.629G>T, NM_031433.3:c.1150_1151insC, NM_031433.3:c.545T>C, NM_031433.3:c.1124+1G>T | Microphthalmia - Retinitis pigmentosa - foveoschisis - optic disc drusen follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFRP gene located on chromosomal region 11q23.3. The age of onset is infantile. This disease is characterized by posterior microphthalmos, retinitis pigmentosa, foveoschisis, and optic disk drusen. | 250,600 |
| MFSD8 | Ceroid lipofuscinosis, neuronal, type 7 | NM_152778.2 | NM_152778.2:c.1286G>A, NM_152778.2:c.999-2A>G, NM_152778.2:c.1235C>T, NM_152778.2:c.1090delA, NM_152778.2:c.362A>G, NM_152778.2:c.881C>A, NM_152778.2:c.929G>A, NM_152778.2:c.1525_1526delCT, NM_152778.2:c.894T>G | Neuronal ceroid lipofuscinosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFSD8 gene located on chromosomal region 4q28.2. The age of onset is late infantile. This disease is characterized by decline of mental and motor capacities, epilepsy, and vision loss through retinal degeneration. The prevalence is 0.56:100,000-3.9:100,000. | 600 |
| MGAT2 | Congenital disorders of glycosylation 2a type | NM_002408.3 | NM_002408.3:c.869C>T, NM_002408.3:c.785A>G, NM_002408.3:c.1017T>A | Congenital disorder of glycosylation type 2a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MGAT2 gene located on chromosomal region 14q21.3. The age of onset is infantile. This disease is characterized by severe psychomotor delay, postnatal growth retardation, facial dysmorphology and bleeding tendency. It has been described in four children. | 600 |
| MKKS | Bardet-Biedl/McKusick-Kaufman syndrome | NM_018848.3 | NM_018848.3:c.353delG | Bardet-Biedl syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. McKusick-Kaufman syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is fetal. This disease is characterized by hydrometrocolpos, post-axial polydactyly, and to a lesser extent cardiac defects. | 250,600 |
| MKKS | Bardet-Biedl syndrome type 6 | NM_018848.3 | NM_018848.3:c.830T>C, NM_018848.3:c.1436C>G | Bardet-Biedl syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. | 250,600 |
| MKKS | McKusick-Kaufman syndrome | NM_018848.3 | NM_018848.3:c.250C>T, NM_018848.3:c.1225_1226delGG, NM_018848.3:c.724G>T | McKusick-Kaufman syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is fetal. This disease is characterized by hydrometrocolpos, post-axial polydactyly, and to a lesser extent cardiac defects. | 250,600 |
| MKS1 | Bardet-Biedl syndrome type 13 | NM_017777.3 | NM_017777.3:c.1349T>C | Bardet-Biedl syndrome type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. | 250,600 |
| MKS1 | Meckel type 1/Bardet-Biedl syndrome | NM_017777.3 | NM_017777.3:c.1024+1G>A, NM_017777.3:c.857A>G, NM_017777.3:c.1319T>C, NM_017777.3:c.814G>C, NM_017777.3:c.508C>T, NM_017777.3:c.1319G>C | Meckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is infantile, etc/. This disease is characterized by a combination of renal cysts and variably associated features, including developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and cysts, and polydactyly.. The prevalence is 1:1,000,000-9:1,000,000. Bardet-Biedl syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. | 250,600 |
| MLC1 | Megalencephalic leukoencephalopathy with subcortical cysts 1 | NM_015166.3 | NM_015166.3:c.135_136insC, NM_015166.3:c.206C>T, NM_015166.3:c.278C>T, NM_015166.3:c.424-2A>C, NM_015166.3:c.422A>G, NM_015166.3:c.274C>T, NM_015166.3:c.839C>T, NM_015166.3:c.423C>A, NM_015166.3:c.33_34insC | Megalencephalic leukoencephalopathy with subcortical cysts follows an autosomal recessive patternof inheritance and is caused by pathogenic variants in the MLC1 gene located on chromosomal region 22q13.33. The age of onset is infantile. This disease is characterized by ataxia followed by progressive signs of pyramidal tract involvement and mental deterioration. | 600 |
| MLYCD | Malonyl-CoA decarboxylase deficiency | NM_012213.2 | NM_012213.2:c.758delT, NM_012213.2:c.679delinsATGAAGC, NM_012213.2:c.560C>G | Malonyl-CoA decarboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MLYCD gene located on chromosomal region 16q23.3. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000. | 600 |
| MMAA | Vitamin B12-responsive methylmalonic acidemia type cblA | NM_172250.2 | NM_172250.2:c.1034delT, NM_172250.2:c.283C>T, NM_172250.2:c.440G>A, NM_172250.2:c.451delC, NM_172250.2:c.592_595delCTGA, NM_172250.2:c.503delC, NM_172250.2:c.450_451insG, NM_172250.2:c.811G>T, NM_172250.2:c.586C>T, NM_172250.2:c.387C>A, NM_172250.2:c.620A>G | Vitamin B12-responsive methylmalonic acidemia type cblA follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAA gene located on chromosomal region 4q31.21. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000. | 600 |
| MMAB | Vitamin B12-responsive methylmalonic acidemia type cblB | NM_052845.3 | NM_052845.3:c.557G>A, NM_052845.3:c.556C>T, NM_052845.3:c.569G>A, NM_052845.3:c.568C>T, NM_052845.3:c.577G>A, NM_052845.3:c.197-1G>T, NM_052845.3:c.700C>T, NM_052845.3:c.548A>T, NM_052845.3:c.220G>T, NM_052845.3:c.197-1G>A | Vitamin B12-responsive methylmalonic acidemia type cbl B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAB gene located on chromosomal region 12q24.31. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000. | 600 |
| MMACHC | Methylmalonic aciduria cblC type, with homocystinuria | NM_015506.2 | NM_015506.2:c.389A>G, NM_015506.2:c.388T>C, NM_015506.2:c.482G>A, NM_015506.2:c.609G>A, NM_015506.2:c.688C>T, NM_015506.2:c.394C>T, NM_015506.2:c.440G>C, NM_015506.2:c.608G>A, NM_015506.2:c.481C>T, NM_015506.2:c.619_620insG, NM_015506.2:c.547_548delGT, NM_015506.2:c.347T>C, NM_015506.2:c.658_660delAAG, NM_015506.2:c.388_390delTAC, NM_015506.2:c.615C>A, NM_015506.2:c.331C>T, NM_015506.2:c.616C>T, NM_015506.2:c.270_271insA, NM_015506.2:c.271dupA, NM_015506.2:c.615C>G | Methylmalonic acidemia with homocystinuria, type cblC follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMACHC gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by failure to thrive, acute neurological deterioration, intellectual deficit, lethargy, seizures, microcephaly, a salt-and-pepper retinopathy, and signs of megaloblastic anemia. The prevalence is <1:1,000,000. | 250,600 |
| MMADHC | methylmalonic aciduria cblD type, with homocystinuria | NM_015702.2 | NM_015702.2:c.545C>A, NM_015702.2:c.746A>G, NM_015702.2:c.419dupA, NM_015702.2:c.748C>T, NM_015702.2:c.795_796insT, NM_015702.2:c.57_64delCTCTTTAG, NM_015702.2:c.737A>G, NM_015702.2:c.776T>C, NM_015702.2:c.478+1G>T | Methylmalonic acidemia with homocystinuria, type cblD follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMADHC gene located on chromosomal region 2q23.2. The age of onset is variable (infantile to adult). This disease is characterized by developmental delay, severe learning difficulties, seizures, movement and gait abnormalities, behavioral problems and signs of megaloblastic anemia (pallor, fatigue, anorexia). The prevalence is 1:50,000-1:80,000. | 600 |
| MOCS1 | Molybdenum cofactor deficiency type A | NM_005943.5 | NM_005943.5:c.218G>A, NM_005943.5:c.397_406delCCGGACGTGG, NM_005943.5:c.217C>T, NM_005943.5:c.956G>A, NM_005943.5:c.1027C>T | Molybdenum cofactor deficiency type A (gene MOCS1) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS1 gene located on chromosomal region 6p21.2. The age of onset is infantile. This disease is characterized by severe neurological abnormalities, dislocated ocular early death. | 600 |
| MOCS2 | Molybdenum cofactor deficiency type B | NM_176806.3 | NM_176806.3:c.106_107delAT, NM_176806.3:c.*297+1G>A, NM_176806.3:c.58delT, NM_176806.3:c.245delT, NM_176806.3:c.190G>A, NM_176806.3:c.16C>T, NM_176806.3:c.*487A>C, NM_176806.3:c.*422G>A, NM_176806.3:c.*26_*27delAT, NM_176806.3:c.539_540delAA, NM_176806.3:c.*459_*460delAA | Molybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death. | 250,600 |
| MPI | Congenital disorders of glycosylation type 1b | NM_002435.2 | NM_002435.2:c.305C>T, NM_002435.2:c.656G>A, NM_002435.2:c.982C>T, NM_002435.2:c.413T>C, NM_002435.2:c.884G>A, NM_002435.2:c.1016_1019delACCC | Congenital disorder of glycosylation type 1b follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MPI gene located on chromosomal region 15q24.1. The age of onset is infantile. This disease is characterized by hepatic-intestinal manifestations (diarrhoea, vomiting, and hepatomegaly associated with hepatic fibrosis). | 600 |
| MPV17 | Mitochondrial DNA depletion syndrome type 6 | NM_002437.4 | NM_002437.4:c.263_265delAGA, NM_002437.4:c.148C>T, NM_002437.4:c.149G>A, NM_002437.4:c.263A>T, NM_002437.4:c.284_285insG, NM_002437.4:c.498C>A, NM_002437.4:c.462-2A>C, NM_002437.4:c.70G>T, NM_002437.4:c.359G>A | Mitochondrial DNA depletion syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MPV17 gene located on chromosomal region 2p23.3. The age of onset is infantile. It is a disease due to mitochondrial dysfunction. It is characterized by infantile onset of progressive liver failure, often leading to death in the first year of life, peripheral neuropathy, corneal scarring, acral ulceration and osteomyelitis leading to autoamputation, cerebral leukoencephalopathy, failure to thrive, and recurrent metabolic acidosis with intercurrent infections. | 600 |
| MPZ | Dejerine-Sottas syndrome (MPZ) | NM_000530.6 | NM_000530.6:c.661G>A, NM_000530.6:c.380G>A, NM_000530.6:c.123_125delTGT, NM_000530.6:c.407T>A, NM_000530.6:c.560_563dupAGGC, NM_000530.6:c.355_356insTCTACT, NM_000530.6:c.661_662dupGC, NM_000530.6:c.411C>T, NM_000530.6:c.188C>G, NM_000530.6:c.506delT, NM_000530.6:c.190_192delTTC, NM_000530.6:c.496_499delCTCGinsTCC, NM_000530.6:c.372_377delGTTCAC, NM_000530.6:c.89T>C, NM_000530.6:c.499G>C, NM_000530.6:c.368G>A | Dejerine-Sottas syndrome follows autosomal recessive and dominant patterns of inheritance and is caused by pathogenic variants in the MPZ gene located on chromosomal region 1q23.3. The age of onset is infantile. A severe degenerating neuropathy of the demyelinating Charcot-Marie-Tooth disease category, with onset by age 2 years. It is characterized by motor and sensory neuropathy with very slow nerve conduction velocities, increased cerebrospinal fluid protein concentrations, hypertrophic nerve changes, and delayed age of walking as well as areflexia. | 600 |
| MPZ | Neuropathy, congenital hypomyelinating or amyelinating | NM_000530.6 | NM_000530.6:c.588dupT, NM_000530.6:c.626_630delCGTCG, NM_000530.6:c.392A>G, NM_000530.6:c.578G>A, NM_000530.6:c.397C>T, NM_000530.6:c.164G>T, NM_000530.6:c.150C>G, NM_000530.6:c.142C>G, NM_000530.6:c.130_137delTCCCGGGT, NM_000530.6:c.128G>T, NM_000530.6:c.549dupG, NM_000530.6:c.106A>G, NM_000530.6:c.410G>C, NM_000530.6:c.332C>T, NM_000530.6:c.371C>A, NM_000530.6:c.368_382delGCACGTTCACTTGTG, NM_000530.6:c.382G>A, NM_000530.6:c.393C>A, NM_000530.6:c.103G>T, NM_000530.6:c.88A>T, NM_000530.6:c.106A>T, NM_000530.6:c.419C>G | Neuropathy, congenital hypomyelinating or amyelinating follows an autosomal recessive or dominant patterns of inheritance and is caused by pathogenic variants in the MPZ gene located on chromosomal region 1q23.3. The age of onset is infantile. A severe degenerating neuropathy that results from a congenital impairment in myelin formation. It is clinically characterized by early onset of hypotonia, areflexia, distal muscle weakness, and very slow nerve conduction velocities (as low as 3m/s). Some patients manifest nearly complete absence of spontaneous limb movements, respiratory distress at birth, and complete absence of myelin shown by electron microscopy of peripheral nerves. | 600 |
| MRPS16 | Combined oxidative phosphorylation deficiency type 2 | NM_016065.3 | NM_016065.3:c.2T>C, NM_016065.3:c.331C>T | Combined oxidative phosphorylation defect type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MRPS16 gene located on chromosomal region 10q22.2. The age of onset is infantile. This disease is characterized by agenesis of corpus callosum, dismorphism and fatal lactic acidosis. | 600 |
| MRPS22 | Combined oxidative phosphorylation deficiency type 5 | NM_020191.2 | NM_020191.2:c.509G>A, NM_020191.2:c.644T>C, NM_020191.2:c.40_41insA | Combined oxidative phosphorylation defect type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MRPS22 gene located on chromosomal region 3q23. The age of onset is infantile. This disease is characterized by evere hypotonia, lactic academia and congenital hyperammonaemia. | 600 |
| MTHFR | Homocystinuria due to MTHFR deficiency | NM_005957.4 | NM_005957.4:c.1743G>A, NM_005957.4:c.3G>A, NM_005957.4:c.547C>T, NM_005957.4:c.1129C>T, NM_005957.4:c.1768delC, NM_005957.4:c.968T>C, NM_005957.4:c.971A>G, NM_005957.4:c.439C>T | Homocystinuria due to methylene tetrahydrofolate reductase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTHFR gene located on chromosomal region 1p36.22. There are some forms with onset during childhood, adolescence, or adulthood beginning with mental regression, ataxia, and, most often, common psychiatric disorders of the schizophrenic type that may be linked to cerebrovascular accidents. Other symptoms are recurrent apnoea, microcephaly and convulsions. | 600 |
| MTM1 | Myotubular myopathy, X-linked | NM_000252.2 | NM_000252.2:c.1415_1416delGT, NM_000252.2:c.1357_1358delCC, NM_000252.2:c.461T>G, NM_000252.2:c.420C>G, NM_000252.2:c.595_599delCCTGC, NM_000252.2:c.1261-10A>G, NM_000252.2:c.780T>A, NM_000252.2:c.670C>T, NM_000252.2:c.1306_1310dupCCTAT, NM_000252.2:c.969delA, NM_000252.2:c.721C>T, NM_000252.2:c.70C>T, NM_000252.2:c.969dupA | X-linked centronuclear myopathy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the MTM1 gene located on chromosomal region Xq28. The age of onset is infantile, etc/. This disease is characterized by severe phenotype in males presenting at birth with marked weakness, hypotonia and respiratory failure. The incidence is 1/50,000 newborn man. | 600 |
| MTMR2 | Charcot-Marie-Tooth disease type 4B1 | NM_016156.5 | NM_016156.5:c.88C>T, NM_016156.5:c.304C>T, NM_016156.5:c.1276C>T, NM_016156.5:c.88A>T | Charcot-Marie-Tooth disease type 4B1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTMR2 gene located on chromosomal region 11q21. The age of onset is early infantile. This disease is characterized by distal and proximal muscular weakness starting in the lower extremities, sensory loss and cranial nerve involvement, foot deformities and diaphragmatic and facial involvement. | 600 |
| MTTP | Abetalipoproteinemia | NM_000253.3 | NM_000253.3:c.1769G>T, NM_000253.3:c.2030delC, NM_000253.3:c.1619G>A, NM_000253.3:c.2593G>T, NM_000253.3:c.708_709delCA, NM_000253.3:c.1867+1G>A, NM_000253.3:c.703_704delAC | Abetalipoproteinemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTP gene located on chromosomal region 4q23. The age of onset is infantile. This disease is characterized by growth delay, malabsorption, hepatomegaly, and neurological and neuromuscular manifestations. The prevalence is <1:1,000,000. | 250,600 |
| MUT | Methylmalonic acidemia | NM_000255.3 | NM_000255.3:c.1420C>T, NM_000255.3:c.1445-2A>G, NM_000255.3:c.2080C>T, NM_000255.3:c.1867G>A, NM_000255.3:c.607G>A, NM_000255.3:c.1658delT, NM_000255.3:c.1280G>A, NM_000255.3:c.1399C>T, NM_000255.3:c.914T>C, NM_000255.3:c.643G>A, NM_000255.3:c.655A>T, NM_000255.3:c.1741C>T, NM_000255.3:c.1106G>A, NM_000255.3:c.1871A>G, NM_000255.3:c.1924G>C, NM_000255.3:c.682C>T, NM_000255.3:c.572C>A, NM_000255.3:c.313T>C, NM_000255.3:c.1181T>A, NM_000255.3:c.278G>A, NM_000255.3:c.678_679insAATTTATG, NM_000255.3:c.794dupT, NM_000255.3:c.671_678dupAATTTATG, NM_000255.3:c.2150G>T, NM_000255.3:c.280G>A, NM_000255.3:c.91C>T, NM_000255.3:c.1207C>T | Methylmalonic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MUT gene located on chromosomal region 6p12.3. The age of onset is very early infantile. This disease is characterized by recurrent ketoacidotic comas or transient vomiting, dehydration, hypotonia and intellectual deficit, which does not respond to administration of vitamin B12. | 250,600 |
| MVK | Hyper-IgD syndrome | NM_000431.3 | NM_000431.3:c.829C>T, NM_000431.3:c.803T>C, NM_000431.3:c.185G>A, NM_000431.3:c.494C>T, NM_000431.3:c.59A>C, NM_000431.3:c.1129G>A | Hyper IgD syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by periodic attacks of fever and a systemic inflammatory reaction (cervical lymphadenopathy, abdominal pain, vomiting, diarrhea, arthralgias and skin signs). | 250,600 |
| MVK | Mevalonic aciduria | NM_000431.3 | NM_000431.3:c.1000G>A, NM_000431.3:c.902A>C, NM_000431.3:c.928G>A | Mevalonic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by psychomotor retardation, failure to thrive, progressive cerebellar ataxia, dysmorphic features, progressive visual impairment and recurrent febrile crises. The prevalence is <1:1,000,000. | 250,600 |
| MYO15A | Deafness type 3, autosomal recessive | NM_016239.3 | NM_016239.3:c.3385C>T, NM_016239.3:c.6003delG, NM_016239.3:c.6004delG, NM_016239.3:c.10573delA, NM_016239.3:c.3313G>T, NM_016239.3:c.3336delG, NM_016239.3:c.755dupA, NM_016239.3:c.5492G>T, NM_016239.3:c.4351G>A, NM_016239.3:c.6864_6874delGGACCTGGAGC, NM_016239.3:c.4751_4752dupTC, NM_016239.3:c.625G>T, NM_016239.3:c.3693-2A>G, NM_016239.3:c.6614C>T, NM_016239.3:c.6743C>T, NM_016239.3:c.6046+2T>G, NM_016239.3:c.5326C>T, NM_016239.3:c.3756+1G>T, NM_016239.3:c.8410A>T, NM_016239.3:c.8429_8447delGCGGGCAGCTGCGGGTCCT, NM_016239.3:c.8148G>T, NM_016239.3:c.9958_9961delGACT, NM_016239.3:c.4750_4751insTC, NM_016239.3:c.8548C>T | Deafness autosomal recessive type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO15A gene located on chromosomal region 17p11.2. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| MYO3A | Deafness type 30, autosomal recessive | NM_017433.4 | NM_017433.4:c.1086T>G, NM_017433.4:c.2793+2T>A, NM_017433.4:c.4586+2T>G, NM_017433.4:c.4730+1G>A, NM_017433.4:c.1A>G, NM_017433.4:c.2506-1G>A, NM_017433.4:c.1777-12G>A, NM_017433.4:c.1952delC, NM_017433.4:c.1193C>A, NM_017433.4:c.770C>G, NM_017433.4:c.3154C>T, NM_017433.4:c.585+5G>C, NM_017433.4:c.2243delA, NM_017433.4:c.3112-2A>G, NM_017433.4:c.732-2A>G | Deafness autosomal recessive type 30 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO3A gene located on chromosomal region 10p12.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| MYO5A | Griscelli syndrome type 1 | NM_000259.3 | NM_000259.3:c.1145delC, NM_000259.3:c.2332C>T | Griscelli disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO5A gene located on chromosomal region 15q21.2. The age of onset is infantile. This disease is characterized by is characterised by silvery gray sheen of the hair and hypopigmentation of the skin which can be associated to neurological impairment. The prevalence is <1:1,000,000. | 600 |
| MYO6 | Deafness type 37, autosomal recessive | NM_004999.3 | NM_004999.3:c.2897_2899delAAG, NM_004999.3:c.2840G>A, NM_004999.3:c.647A>T, NM_004999.3:c.3496C>T, NM_004999.3:c.3808C>T, NM_004999.3:c.1446_1447insT | Deafness autosomal recessive type 37 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO6 gene located on chromosomal region 6q14.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| MYO7A | Deafness type 2, autosomal recessive | NM_000260.3 | NM_000260.3:c.1797G>A, NM_000260.3:c.2023C>T, NM_000260.3:c.731G>C, NM_000260.3:c.3596dupT, NM_000260.3:c.1184G>A, NM_000260.3:c.133-2A>G | Deafness autosomal recessive type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| MYO7A | Usher syndrome type 1B | NM_000260.3 | NM_000260.3:c.1996C>T, NM_000260.3:c.1884C>A, NM_000260.3:c.448C>T, NM_000260.3:c.2476G>A, NM_000260.3:c.4024delT, NM_000260.3:c.2617C>T, NM_000260.3:c.5227C>T, NM_000260.3:c.1344-1G>A, NM_000260.3:c.5507T>G, NM_000260.3:c.5886_5889delCTTT, NM_000260.3:c.3504-1G>C, NM_000260.3:c.3508G>A, NM_000260.3:c.4018G>A, NM_000260.3:c.5392C>T, NM_000260.3:c.640G>A, NM_000260.3:c.3134T>C, NM_000260.3:c.5824G>T, NM_000260.3:c.3G>A, NM_000260.3:c.494C>T, NM_000260.3:c.5618G>A, NM_000260.3:c.5884_5887delTTCT, NM_000260.3:c.634C>T, NM_000260.3:c.3719G>A, NM_000260.3:c.5967C>G, NM_000260.3:c.3763delA, NM_000260.3:c.635G>A, NM_000260.3:c.6025delG | Usher syndrome type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 1:100,000-9:100,000. | 250,600 |
| NAGA | Schindler disease | NM_000262.2 | NM_000262.2:c.973G>A, NM_000262.2:c.985C>T, NM_000262.2:c.986G>A, NM_000262.2:c.577G>T | Schindler disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGA gene located on chromosomal region 22q13.2. The age of onset is infantile. This disease is characterized by early-onset neuroaxonal dystrophy and neurological signs (convulsion during fever, epilepsy, psychomotor retardation and hypotonia). NAGA deficiency is typically classified in three main phenotypes: NAGA deficiency type I (Schindler disease or Schindler disease type I) with severe manifestations; NAGA deficiency type II (Kanzazi disease or Schindler disease type II) which is mild; NAGA deficiency type III (Schindler disease type III) characterized by mild-to-moderate neurologic manifestations. NAGA deficiency results in the increased urinary excretion of glycopeptides and oligosaccharides containing alpha-N-acetylgalactosaminyl moieties. | 250,600 |
| NAGS | Hyperammonemia due to N-acetylglutamate synthetase deficiency | NM_153006.2 | NM_153006.2:c.971G>A, NM_153006.2:c.1289T>C, NM_153006.2:c.1025delG, NM_153006.2:c.916-2A>T, NM_153006.2:c.1307dupT, NM_153006.2:c.1299G>C | Hyperammonemia due to N-acetylglutamate synthetase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGS gene located on chromosomal region 17q21.31. The age of onset is infantile, etc/. This disease is characterized by vomiting, hyperactivity or lethargy, diarrhoea, poor feeding, seizures, hypotonia, delayed psychomotor development and respiratory distress. The prevalence is <1:1,000,000. | 600 |
| NDRG1 | Charcot-Marie-Tooth disease, type 4D | NM_006096.3 | NM_006096.3:c.16C>T, NM_006096.3:c.-18-2_-18-1delAG, NM_006096.3:c.538-1G>A, NM_006096.3:c.-18-2_-18-1del1, NM_006096.3:c.928C>T, NM_006096.3:c.442C>T | Charcot-Marie-Tooth disease type 4D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NDRG1 gene located on chromosomal region 8q24.22. The age of onset is infantile, etc/. This disease is characterized by demyelination and hearing loss. | 600 |
| NEB | Nemaline myopathy type 2 | NM_004543.4 | NM_004543.4:c.11474_11475delTG, NM_004543.4:c.19119_19120delGA, NM_004543.4:c.19306-1G>A, NM_004543.4:c.19606G>T, NM_004543.4:c.6105dupT, NM_004543.4:c.3191A>G, NM_004543.4:c.18318_18319delAG, NM_004543.4:c.11473_11474delAT, NM_004543.4:c.2173G>T, NM_004543.4:c.19097_19098delTT, NM_004543.4:c.19836+1_19836+2insATGGA, NM_004543.4:c.18825+1370C>T, NM_004543.4:c.5567G>A, NM_004543.4:c.6105_6106insT, NM_004543.4:c.16842+1G>A, NM_004543.4:c.843T>G, NM_004543.4:c.8031_8041delAAATAAACGAG, NM_004543.4:c.14182_14183delGCinsAA, NM_004543.4:c.15973C>T | Nemaline myopathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEB gene located on chromosomal region 2q23.3. The age of onset is infantile or adult. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:100,000-9:100,000 and the incidence is 1/50.000 newborn. | 250,600 |
| NEFL | Charcot-Marie-Tooth disease type 1F | NM_006158.3 | NM_006158.3:c.418G>T, NM_006158.3:c.628G>T, NM_006158.3:c.361G>T | Charcot-Marie-Tooth disease type 1F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEFL gene located on chromosomal region 8p21.2. The age of onset is infantile. This disease is characterized by a progressive peripheral motor and sensory neuropathy with variable clinical, distal weakness and wasting of the muscles of the lower limbs. The prevalence is 15:100,000-20:100,000. | 600 |
| NEUROG3 | Diarrhea type 4, malabsorptive, congenital | NM_020999.3 | NM_020999.3:c.319C>A, NM_020999.3:c.278G>T | Congenital malabsorptive diarrhea type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEUROG3 gene located on chromosomal region 10q22.1. The age of onset is early infantile. This disease is characterized by generalized malabsorption, a paucity of enteroendocrine cells, those symptoms lead to vomiting, diarrhea, dehydration, and a severe hyperchloremic metabolic acidosis after the ingestion of standard cow's milk-based formula. The prevalence is <1:1,000,000. | 600 |
| NHP2 | Dyskeratosis congenita type 2, autosomal recessive | NM_017838.3 | NM_017838.3:c.415T>C, NM_017838.3:c.460T>A, NM_017838.3:c.289_290delAT | Dyskeratosis congenita 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NHP2 gene located on chromosomal region 5q35.3. The age of onset is variable from infancy to adult. It is a multisystem disorder caused by defective telomere maintenance. Clinical manifestations include mucocutaneous abnormalities, bone marrow failure, and an increased predisposition to cancer, among other variable features. | 600 |
| NMNAT1 | Leber congenital amaurosis type 9 | NM_022787.3 | NM_022787.3:c.451G>T, NM_022787.3:c.25G>A, NM_022787.3:c.457C>G, NM_022787.3:c.507G>A, NM_022787.3:c.710G>T, NM_022787.3:c.619C>T, NM_022787.3:c.769G>A | Leber congenital amaurosis type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NMNAT1 gene located on chromosomal region 1p36.22. The age of onset is early infantile. This disease is characterized by blindness, nystagmus, roving eye movement, leading to severe visual impairment. | 250,600 |
| NOP10 | Dyskeratosis congenita type 1, autosomal recessive | NM_018648.3 | NM_018648.3:c.34G>C, NM_018648.3:c.100C>T | Dyskeratosis congenita autosomal recessive type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NOP10 gene located on chromosomal region 15q14. The age of onset is infantile. This disease is characterized by the mucocutaneous triad of abnormal skin pigmentation, nail dystrophy and mucosal leucoplakia. The prevalence is 1:1,000,000. | 600 |
| NPC1 | Niemann-Pick disease type C1 | NM_000271.4 | NM_000271.4:c.1042C>T, NM_000271.4:c.2842G>A, NM_000271.4:c.1628C>T, NM_000271.4:c.2974G>T, NM_000271.4:c.3019C>G, NM_000271.4:c.1211G>A, NM_000271.4:c.2072C>T, NM_000271.4:c.2324A>C, NM_000271.4:c.337T>C, NM_000271.4:c.3107C>T, NM_000271.4:c.530G>A, NM_000271.4:c.743G>T, NM_000271.4:c.3611_3614delTTAC, NM_000271.4:c.813_815delCAT, NM_000271.4:c.2932C>T, NM_000271.4:c.3425T>C, NM_000271.4:c.2761C>T, NM_000271.4:c.3104C>T, NM_000271.4:c.3662delT, NM_000271.4:c.2972_2973delAG, NM_000271.4:c.2974G>A, NM_000271.4:c.2873G>A, NM_000271.4:c.352_353delAG, NM_000271.4:c.3182T>C, NM_000271.4:c.3467A>G, NM_000271.4:c.3175C>T, NM_000271.4:c.2861C>T, NM_000271.4:c.2848G>A | Niemann-Pick disease type C1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC1 gene located on chromosomal region 18q11.2. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000. | 250,600 |
| NPC2 | Niemann-Pick disease type C2 | NM_006432.3 | NM_006432.3:c.115G>A, NM_006432.3:c.190+5G>A, NM_006432.3:c.27delG, NM_006432.3:c.352G>T, NM_006432.3:c.58G>T, NM_006432.3:c.358C>T, NM_006432.3:c.295T>C, NM_006432.3:c.441+1G>A, NM_006432.3:c.436C>T | Niemann-Pick disease type C2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC2 gene located on chromosomal region 14q24.3. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000. | 250,600 |
| NPHP1 | Nephronophthisis type 1 | NM_000272.3 | NM_000272.3:c.80T>A, NM_000272.3:c.1delA, NM_000272.3:c.555_556insA, NM_000272.3:c.829C>T, NM_000272.3:c.455C>G, NM_000272.3:c.1884+1G>T, NM_000272.3:c.1184dupC | Nephronophthisis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP1 gene located on chromosomal region 2q13. The age of onset is juvenile. This disease is characterized by anemia, polyuria, polydipsia, isosthenuria and death in uremia. Symmetrical destruction of the kidneys involving both tubules and glomeruli occurs. The underlying pathology is a chronic tubulo-interstitial nephropathy with characteristic tubular basement membrane thickening and medullary cyst formation. Associations with extrarenal symptoms, especially ocular lesions, are frequent. | 600 |
| NPHP3 | Nephronophthisis type 3 | NM_153240.4 | NM_153240.4:c.1817G>A, NM_153240.4:c.434_437delAAAG, NM_153240.4:c.1119-2A>G, NM_153240.4:c.1729C>T, NM_153240.4:c.2694-2A>G, NM_153240.4:c.1985+5G>A, NM_153240.4:c.3406C>T, NM_153240.4:c.3373C>T, NM_153240.4:c.1381G>T, NM_153240.4:c.2694-2_2694-1delAG, NM_153240.4:c.1157A>G, NM_153240.4:c.2369T>C, NM_153240.4:c.3550G>A, NM_153240.4:c.2541delG, NM_153240.4:c.2570+1G>T, NM_153240.4:c.3156_3157insA, NM_153240.4:c.3662C>T | Nephronophthisis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP3 gene located on chromosomal region 3q22.1. The age of onset is adult. This disease is characterized by polyuria, polydipsia, anemia. Onset of terminal renal failure occur significantly later (median age, 19 years) than in juvenile nephronophthisis. Renal pathology is characterized by alterations of tubular basement membranes, tubular atrophy and dilation, sclerosing tubulointerstitial nephropathy, and renal cyst development predominantly at the corticomedullary junction. The prevalence is <1:1,000,000. | 250,600 |
| NPHP4 | Nephronophthisis type 4 | NM_015102.4 | NM_015102.4:c.4179T>A, NM_015102.4:c.3767_3768insAA, NM_015102.4:c.3674C>T, NM_015102.4:c.556_557insT, NM_015102.4:c.2940_2944dupGCTCC, NM_015102.4:c.3231+1G>C, NM_015102.4:c.517C>T, NM_015102.4:c.2335C>T, NM_015102.4:c.2219G>A, NM_015102.4:c.7G>T, NM_015102.4:c.1972C>T, NM_015102.4:c.1120-1G>C | Nephronophthisis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP4 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease results in end-stage renal disease at age ranging between 6 and 35 years. It is a progressive tubulo-interstitial kidney disorder characterized by polydipsia, polyuria, anemia and growth retardation. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| NPHS1 | Nephrotic syndrome type 1 | NM_004646.3 | NM_004646.3:c.59-5C>G, NM_004646.3:c.3109+1G>A, NM_004646.3:c.3478C>T, NM_004646.3:c.121_122delCT, NM_004646.3:c.1481delC, NM_004646.3:c.2456A>T, NM_004646.3:c.2491C>T, NM_004646.3:c.2464G>A, NM_004646.3:c.1307_1308dupAC, NM_004646.3:c.3250delG, NM_004646.3:c.3325C>T, NM_004646.3:c.2928G>T, NM_004646.3:c.3250_3251insG, NM_004646.3:c.2746G>T, NM_004646.3:c.1715G>A | Nephrotic syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHS1 gene located on chromosomal region 19q13.12. The age of onset is fetal- infantile. This disease is characterized by fetal proteinuria and nephritic infantile syndrome. The prevalence is 1 in 8 200 births. | 250,600 |
| NR0B1 | Cytomegalic congenital adrenal hypoplasia | NM_000475.4 | NM_000475.4:c.513G>A, NM_000475.4:c.591C>A, NM_000475.4:c.315G>C, NM_000475.4:c.873G>C, NM_000475.4:c.800G>C, NM_000475.4:c.788T>A, NM_000475.4:c.704G>A, NM_000475.4:c.1319A>T, NM_000475.4:c.388_389delTA, NM_000475.4:c.273C>A, NM_000475.4:c.813C>G, NM_000475.4:c.847C>T, NM_000475.4:c.1107G>A, NM_000475.4:c.890T>C, NM_000475.4:c.1316T>G | Cytomegalic congenital adrenal hypoplasia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the NR0B1 gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by adrenal insufficiency with vomiting, feeding difficulty, dehydration, and shock caused by a salt-wasting episode and hypoglycemia. | 600 |
| NR2E3 | Enhaced S-Cone Syndrome | NM_014249.3 | NM_014249.3:c.119-2A>C, NM_014249.3:c.297_298delGT, NM_014249.3:c.932G>A, NM_014249.3:c.226C>T, NM_014249.3:c.361G>A, NM_014249.3:c.227G>A, NM_014249.3:c.1034_1038delTGCAG | Enhaced S-Cone Syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NR2E3 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by night blindness, reduced bilateral visual acuity, and typical fundus findings (progressive pigmentary degenerative changes, macular edema, retinoschisis). | 250,600 |
| NTRK1 | Hereditary sensory and autonomic neuropathy type 4 | NM_001012331.1 | NM_001012331.1:c.1076A>G, NM_001012331.1:c.1711G>C, NM_001012331.1:c.1741A>G, NM_001012331.1:c.1908_1909insT, NM_001012331.1:c.1709delT, NM_001012331.1:c.1942C>T, NM_001012331.1:c.1852C>T, NM_001012331.1:c.1456G>A, NM_001012331.1:c.2321G>C, NM_001012331.1:c.2066C>T | Hereditary sensory and autonomic neuropathy type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NTRK1 gene located on chromosomal region 1q23.1. The age of onset is infantile. This disease is characterized by anhidrosis, insensitivity to pain, self-mutilating behavior and episodes of fever. | 600 |
| NUP62 | Infantile striatal degeneration | NM_153719.3 | NM_153719.3:c.1172A>C | Infantile striatal degeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NUP62 gene located on chromosomal region 19q13.33. The age of onset is infantile. This disease is characterized by choreoathetosis, dystonia, rigidity, spasticity, dysphagia, optic atrophy, intellectual deficit, developmental regression of motor and verbal skills, failure to thrive, myoclonus, quadriparesis, cerebellar ataxia and nystagmus. The prevalence is <1:1,000,000. | 600 |
| NYX | Night blindness, congenital stationary , type 1A, X-linked | NM_022567.2 | NM_022567.2:c.1049G>A | Congenital stationary night blindness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NYX gene located on chromosomal region Xp11.4. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity. | 600 |
| OAT | Gyrate atrophy of choroid and retina with or without ornithinemia | NM_000274.3 | NM_000274.3:c.1250C>T, NM_000274.3:c.159delC, NM_000274.3:c.1205T>C, NM_000274.3:c.901-2A>G, NM_000274.3:c.533G>A, NM_000274.3:c.1276C>T, NM_000274.3:c.824G>A, NM_000274.3:c.268C>G, NM_000274.3:c.952delG, NM_000274.3:c.994G>A, NM_000274.3:c.955C>T, NM_000274.3:c.677C>T, NM_000274.3:c.278G>T, NM_000274.3:c.627T>A, NM_000274.3:c.812G>A, NM_000274.3:c.952G>A, NM_000274.3:c.539G>C, NM_000274.3:c.596C>A | Gyrate atrophy of choroid and retina follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OAT gene located on chromosomal region 10q26.13. The age of onset is infantile. This disease is characterized by gyrate atrophy of the choroid and retina that begins during childhood with myopia and night blindness, followed by concentric shrinking of the visual field (tunnel vision) and a peculiar aspect of retinopathy on the funduscopy. | 600 |
| OCA2 | Oculocutaneous albinism type 2 | NM_000275.2 | NM_000275.2:c.1610A>G, NM_000275.2:c.1960delG, NM_000275.2:c.2359G>A, NM_000275.2:c.819_822delCTGGinsGGTC, NM_000275.2:c.2228C>T, NM_000275.2:c.1025A>G, NM_000275.2:c.1842+1G>T, NM_000275.2:c.157delA, NM_000275.2:c.1182G>A, NM_000275.2:c.1182+2T>C, NM_000275.2:c.1441G>A, NM_000275.2:c.79G>A, NM_000275.2:c.1465A>G, NM_000275.2:c.1327G>A, NM_000275.2:c.1364+1G>T | Oculocutaneous albinism type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OCA2 gene located on chromosomal region 15q12-q13. The age of onset is infantile. This disease is characterized by variable hypopigmentation of the skin and hair, numerous characteristic ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1/38,000-1/40,000 | 250,600 |
| OCRL | Lowe syndrome | NM_000276.3 | NM_000276.3:c.2299C>T, NM_000276.3:c.909_910delAG, NM_000276.3:c.2535delA, NM_000276.3:c.2403dupA, NM_000276.3:c.1499G>A, NM_000276.3:c.2530C>T | Lowe syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the OCRL gene located on chromosomal region Xq25-q26. The age of onset is infantile. This disease is characterized by proximal tubule dysfunction, hypercalcinuria, mild intellectual impairment, hypotonia and sub-clinical cataract. The prevalence is 1:100,000-10:100,000 newborn. | 600 |
| OFD1 | Joubert syndrome type 10 | NM_003611.2 | NM_003611.2:c.2582dupT, NM_003611.2:c.2321_2322insT, NM_003611.2:c.277G>T | Joubert syndrome type 10 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the OFD1 gene located on chromosomal region Xp22.2. The age of onset is early. A disorder presenting with cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy and renal disease. | 600 |
| OFD1 | Orofaciodigital syndrome type 1 | NM_003611.2 | NM_003611.2:c.43_44delAG, NM_003611.2:c.52G>T, NM_003611.2:c.65dupA, NM_003611.2:c.221C>T, NM_003611.2:c.274T>C, NM_003611.2:c.616_617delGA, NM_003611.2:c.260A>G, NM_003611.2:c.13-10T>A, NM_003611.2:c.312+1delG, NM_003611.2:c.224A>C, NM_003611.2:c.294_312delTGGTTTGGCAAAAGAAAAG, NM_003611.2:c.62_63insT, NM_003611.2:c.275_276delCT, NM_003611.2:c.614_617delGAGA, NM_003611.2:c.225C>G, NM_003611.2:c.602delA, NM_003611.2:c.628C>T, NM_003611.2:c.653delA, NM_003611.2:c.1365_1368delACAA, NM_003611.2:c.619_624delATAGAA, NM_003611.2:c.1303A>C, NM_003611.2:c.1318delC, NM_003611.2:c.654+2_654+3delTA, NM_003611.2:c.1268_1272delAAAAC, NM_003611.2:c.1323_1326delAGAA, NM_003611.2:c.1360_1363delCTTA, NM_003611.2:c.1358T>A, NM_003611.2:c.1840delG, NM_003611.2:c.1612C>T, NM_003611.2:c.1757delG, NM_003611.2:c.1821delG, NM_003611.2:c.1319delT, NM_003611.2:c.1859_1860delCCinsG, NM_003611.2:c.2261-1G>T, NM_003611.2:c.235G>A, NM_003611.2:c.607_610delTATA, NM_003611.2:c.594_598delAAAGC, NM_003611.2:c.247C>T, NM_003611.2:c.2387+1G>C, NM_003611.2:c.290A>G, NM_003611.2:c.454C>T, NM_003611.2:c.312+2_312+7delTAAAGT, NM_003611.2:c.413-10T>G, NM_003611.2:c.2349delC, NM_003611.2:c.518-1G>A, NM_003611.2:c.1322_1326delAAGAA, NM_003611.2:c.541dupG, NM_003611.2:c.243C>G, NM_003611.2:c.241C>G | Orofaciodigital syndrome type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the OFD1 gene located on chromosomal region Xp22.2. It is a group of heterogeneous disorders characterized by abnormalities in the oral cavity, face, and digits and associated phenotypic abnormalities that lead to the delineation of various subtypes. OFD1 is X-linked dominant syndrome, lethal in males. Craniofacial findings consist of facial asymmetry, hypertelorism, median cleft, or pseudocleft of the upper lip, hypoplasia of the alae nasi, oral clefts and abnormal frenulea, tongue anomalies (clefting, cysts, hamartoma), and anomalous dentition involving missing or extra teeth. Asymmetric brachydactyly and/or syndactyly of the fingers and toes occur frequently. Approximately 50% of OFD1 females have some degree of intellectual disability. Some patients have structural central nervous system anomalies such as agenesis of the corpus callosum, cerebellar agenesis, or a Dandy-Walker malformation. Patients with OFD1 can develop fibrocystic disease of the liver and pancreas, in addition to polycystic kidneys. | 600 |
| OPA3 | 3-methylglutaconic aciduria type 3 | NM_025136.3 | NM_025136.3:c.*24136delG, NM_025136.3:c.221delG | 3-methylglutaconic aciduria type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OPA3 gene located on chromosomal region 19q13.32. The age of onset is infantile. This disease is characterized by the association of optic atrophy and choreoathetosis with 3-methylglutaconic aciduria. The prevalence is 1:10,000-5:10,000. | 600 |
| OSTM1 | Osteopetrosis type 5, autosomal recessive | NM_014028.3 | NM_014028.3:c.415_416delAG | Osteopetrosis, autosomal recessive type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OSTM1 gene located on chromosomal region 6p21. The age of onset is infantile. This disease is characterized by osteopetrosis, agenesis del cuerpo calloso, atrofia cerebral e hipocampo pequeño. | 600 |
| OTC | Ornithine transcarbamylase deficiency | NM_000531.5 | NM_000531.5:c.119G>A, NM_000531.5:c.259G>A, NM_000531.5:c.118C>T, NM_000531.5:c.617T>G, NM_000531.5:c.646C>G, NM_000531.5:c.148G>T, NM_000531.5:c.589G>T, NM_000531.5:c.77G>A, NM_000531.5:c.829C>T, NM_000531.5:c.674C>T, NM_000531.5:c.717+2T>C, NM_000531.5:c.563G>T, NM_000531.5:c.275G>A, NM_000531.5:c.245T>G, NM_000531.5:c.460G>T, NM_000531.5:c.134T>C, NM_000531.5:c.332T>C, NM_000531.5:c.238A>G, NM_000531.5:c.421C>T | Ornithine transcarbamylase deficiency follows an X-linked pattern of inheritance and is caused by pathogenic variants in the OTC gene located on chromosomal region Xp11.4. The age of onset is infantile. This disease is characterized by severe neonatal hyperammonemic coma that generally proves to be fatal, in males. Females may be also affected by symptoms with various degrees of intensity, ranging from dislike for proteins to chronic vomiting, growth retardation, hypotonia, psychomotor retardation, hyperammonemic coma, or psychiatric disorders. The prevalence is 1:80,000. | 600 |
| OTOA | Deafness type 22, autosomal recessive | NM_144672.3 | NM_144672.3:c.2301+1G>T, NM_144672.3:c.2359G>T, NM_144672.3:c.121-1G>A, NM_144672.3:c.827delT, NM_144672.3:c.1725_1726delCA | Deafness, autosomal recessive type 22 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOA gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| OTOF | Deaffness type 9, autosomal recessive | NM_194248.2 | NM_194248.2:c.149G>A, NM_194248.2:c.1867G>A, NM_194248.2:c.1669G>A, NM_194248.2:c.2381G>A, NM_194248.2:c.1498C>T, NM_194248.2:c.1544T>C, NM_194248.2:c.5473C>G, NM_194248.2:c.1150G>A, NM_194248.2:c.1778delT, NM_194248.2:c.5103+2T>A, NM_194248.2:c.227+2T>C, NM_194248.2:c.5474_5475delCC, NM_194248.2:c.5332G>A, NM_194248.2:c.584-1G>C, NM_194248.2:c.98G>A, NM_194248.2:c.2348delG, NM_194248.2:c.3032T>C, NM_194248.2:c.4559G>A, NM_194248.2:c.4491T>A, NM_194248.2:c.5816G>A, NM_194248.2:c.766-2A>G, NM_194248.2:c.2485C>T, NM_194248.2:c.2401G>T | Deaffness, autosomal recessive type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| PAH | Phenylketonuria | NM_000277.1 | NM_000277.1:c.1139C>T, NM_000277.1:c.1066-3C>T, NM_000277.1:c.117C>G, NM_000277.1:c.1166delC, NM_000277.1:c.1068C>A, NM_000277.1:c.1315+1G>A, NM_000277.1:c.1162G>A, NM_000277.1:c.143T>C, NM_000277.1:c.1243G>A, NM_000277.1:c.1169A>G, NM_000277.1:c.136G>A, NM_000277.1:c.1184C>A, NM_000277.1:c.194T>C, NM_000277.1:c.1199+17G>A, NM_000277.1:c.232G>A, NM_000277.1:c.1045T>C, NM_000277.1:c.1197A>T, NM_000277.1:c.441+1G>A, NM_000277.1:c.442-1G>A, NM_000277.1:c.442-5C>G, NM_000277.1:c.450_451insA, NM_000277.1:c.472C>T, NM_000277.1:c.204A>T, NM_000277.1:c.482T>C, NM_000277.1:c.250G>T, NM_000277.1:c.261C>A, NM_000277.1:c.1030G>A, NM_000277.1:c.1199+1G>A, NM_000277.1:c.1238G>C, NM_000277.1:c.1241A>G, NM_000277.1:c.673C>G, NM_000277.1:c.688G>A, NM_000277.1:c.721C>T, NM_000277.1:c.722delG, NM_000277.1:c.722G>A, NM_000277.1:c.727C>T, NM_000277.1:c.728G>A, NM_000277.1:c.733G>C, NM_000277.1:c.734T>C, NM_000277.1:c.737C>A, NM_000277.1:c.745C>T, NM_000277.1:c.1042C>G, NM_000277.1:c.638T>C, NM_000277.1:c.764T>C, NM_000277.1:c.782G>A, NM_000277.1:c.806delT, NM_000277.1:c.809G>A, NM_000277.1:c.814G>T, NM_000277.1:c.818C>T, NM_000277.1:c.823C>T, NM_000277.1:c.829T>G, NM_000277.1:c.898G>T, NM_000277.1:c.912+1G>A, NM_000277.1:c.284_286delTCA, NM_000277.1:c.754C>T, NM_000277.1:c.755G>A, NM_000277.1:c.357delC, NM_000277.1:c.1217T>C, NM_000277.1:c.1222C>T, NM_000277.1:c.157C>T, NM_000277.1:c.158G>A, NM_000277.1:c.165T>G, NM_000277.1:c.473G>A, NM_000277.1:c.490A>G, NM_000277.1:c.503delA, NM_000277.1:c.508C>G, NM_000277.1:c.533A>G, NM_000277.1:c.665A>G, NM_000277.1:c.838G>A, NM_000277.1:c.842+5G>A, NM_000277.1:c.896T>G, NM_000277.1:c.320A>G, NM_000277.1:c.441+5G>T, NM_000277.1:c.311C>A, NM_000277.1:c.527G>T, NM_000277.1:c.529G>A, NM_000277.1:c.47_48delCT, NM_000277.1:c.1208C>T, NM_000277.1:c.331C>T, NM_000277.1:c.926C>T, NM_000277.1:c.955G>T, NM_000277.1:c.926C>A, NM_000277.1:c.509+1G>A, NM_000277.1:c.1033G>T, NM_000277.1:c.611A>G, NM_000277.1:c.1066-11G>A, NM_000277.1:c.569T>C | Phenylketonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAH gene located on chromosomal region 12q23.2. The age of onset is neonatal. This disease is characterized by gradual developmental delay, stunted growth, microcephaly, seizures, tremors, eczema, vomiting, and musty odor. Untreated patients subsequently develop intellectual disability, behavioral disorders (hyperactivity) and motor disorders. The prevalence is 1:2,600-1:200,000. | 250,600 |
| PALB2 | Fanconi anemia, complementation group N | NM_024675.3 | NM_024675.3:c.1882_1890delAAGTCCTGC, NM_024675.3:c.2962C>T, NM_024675.3:c.50T>G, NM_024675.3:c.3116delA, NM_024675.3:c.3287A>G, NM_024675.3:c.3549C>G, NM_024675.3:c.3113G>A, NM_024675.3:c.2816T>G, NM_024675.3:c.1240C>T, NM_024675.3:c.557_558insA | Fanconi anemia, complementation group N follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PALB2 gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| PANK2 | Pantothenate kinase-associated neurodegeneration | NM_153638.2 | NM_153638.2:c.1561G>A, NM_153638.2:c.688G>A, NM_153638.2:c.790C>T, NM_153638.2:c.821_822delCT, NM_153638.2:c.1583C>T, NM_153638.2:c.1211A>T | Pantothenate kinase-associated neurodegeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PANK2 gene located on chromosomal region 20p13. The age of onset is infantile. This disease is characterized by progressive extrapyramidal dysfunction (dystonia, rigidity, choreoathetosis), iron accumulation on the brain and axonal spheroids in the central nervous system. The prevalence is 1-2/1,000,000. | 250,600 |
| PAX3 | Waardenburg syndrome type 3 | NM_181457.3 | NM_181457.3:c.268T>C, NM_181457.3:c.251C>T | Waardenburg syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAX3 gene located on chromosomal region 2q36.1. The age of onset is infantile. This disease is characterized by limb anomalies in association with congenital hearing loss, minor defects in structures arising from neural crest resulting in pigmentation anomalies of eyes, hair, and skin. | 600 |
| PAX6 | Aniridia | NM_000280.4 | NM_000280.4:c.1032+3A>T, NM_000280.4:c.978_979delCA, NM_000280.4:c.949C>T, NM_000280.4:c.1124C>A, NM_000280.4:c.1032+3_1032+6delAAGT, NM_000280.4:c.917-2A>T, NM_000280.4:c.1000_1001insTGGCATATAACCT, NM_000280.4:c.891delA, NM_000280.4:c.889dupC, NM_000280.4:c.890_905delAACCAATTCCACAACC, NM_000280.4:c.921_924dupCTCC, NM_000280.4:c.888C>G, NM_000280.4:c.887dupA, NM_000280.4:c.889C>T, NM_000280.4:c.888C>A, NM_000280.4:c.868_871dupAGTT, NM_000280.4:c.847_854dupAGTCATAT, NM_000280.4:c.879dupC, NM_000280.4:c.875G>T, NM_000280.4:c.839delA, NM_000280.4:c.829C>T, NM_000280.4:c.818delA, NM_000280.4:c.844_845delCC, NM_000280.4:c.812_813delTG, NM_000280.4:c.808A>T, NM_000280.4:c.799A>T, NM_000280.4:c.818dupA, NM_000280.4:c.794G>A, NM_000280.4:c.781C>T, NM_000280.4:c.775dupT, NM_000280.4:c.795G>A, NM_000280.4:c.1031A>G, NM_000280.4:c.1016_1019delATAA, NM_000280.4:c.1017delT, NM_000280.4:c.766-1G>C, NM_000280.4:c.766-2delA, NM_000280.4:c.760_765+9delATACAGGTACCGAGA, NM_000280.4:c.765G>C, NM_000280.4:c.765G>T, NM_000280.4:c.763C>T, NM_000280.4:c.742_752delGATCTACCTGA, NM_000280.4:c.745delC, NM_000280.4:c.916+2T>G, NM_000280.4:c.847_848dupAG, NM_000280.4:c.916+1G>C, NM_000280.4:c.689delA, NM_000280.4:c.683-2A>C, NM_000280.4:c.683-5_683-4delTTinsAAC, NM_000280.4:c.683-6T>A, NM_000280.4:c.683-9C>G, NM_000280.4:c.682+2T>A, NM_000280.4:c.673delC, NM_000280.4:c.668delA, NM_000280.4:c.656_665delAAGAGCAAAT, NM_000280.4:c.661C>T, NM_000280.4:c.658G>T, NM_000280.4:c.655C>T, NM_000280.4:c.646T>C, NM_000280.4:c.642A>C, NM_000280.4:c.639_640delTA, NM_000280.4:c.640A>G, NM_000280.4:c.640A>T, NM_000280.4:c.631C>T, NM_000280.4:c.623G>A, NM_000280.4:c.622C>T, NM_000280.4:c.613C>T, NM_000280.4:c.607C>T, NM_000280.4:c.601C>T, NM_000280.4:c.595G>T, NM_000280.4:c.580G>T, NM_000280.4:c.773T>C, NM_000280.4:c.771G>A, NM_000280.4:c.770G>A, NM_000280.4:c.766-1G>A, NM_000280.4:c.535C>T, NM_000280.4:c.534G>T, NM_000280.4:c.532C>T, NM_000280.4:c.524-2A>G, NM_000280.4:c.520C>T, NM_000280.4:c.500_501delCGinsGA, NM_000280.4:c.490_500delCCGGGGACTTCinsTCGGTA, NM_000280.4:c.500C>A, NM_000280.4:c.495delG, NM_000280.4:c.491delC, NM_000280.4:c.489T>G, NM_000280.4:c.480delT, NM_000280.4:c.475delC, NM_000280.4:c.470delG, NM_000280.4:c.468G>A, NM_000280.4:c.467G>A, NM_000280.4:c.464delG, NM_000280.4:c.459dupC, NM_000280.4:c.454C>T, NM_000280.4:c.450delC, NM_000280.4:c.432dupT, NM_000280.4:c.428_431delATGA, NM_000280.4:c.406C>T, NM_000280.4:c.403C>T, NM_000280.4:c.402delG, NM_000280.4:c.397G>T, NM_000280.4:c.383G>C, NM_000280.4:c.382C>T, NM_000280.4:c.366_379delAATAAACAGAGTTC, NM_000280.4:c.377T>A, NM_000280.4:c.375_376delAG, NM_000280.4:c.370_373delAACA, NM_000280.4:c.371delA, NM_000280.4:c.362_368dupCATCAAT, NM_000280.4:c.365C>A, NM_000280.4:c.362C>T, NM_000280.4:c.361T>C, NM_000280.4:c.358-1G>A, NM_000280.4:c.358-1G>C, NM_000280.4:c.357_357+5delCGTAAG, NM_000280.4:c.357+5G>A, NM_000280.4:c.357+2dupT, NM_000280.4:c.357+1G>A, NM_000280.4:c.357+1G>C, NM_000280.4:c.357+1G>T, NM_000280.4:c.349_357delATACCAAGC, NM_000280.4:c.339_357dupCAACGATAACATACCAAGC, NM_000280.4:c.353_357dupCAAGC, NM_000280.4:c.357C>G, NM_000280.4:c.357C>A, NM_000280.4:c.343_356dupGATAACATACCAAG, NM_000280.4:c.342_355delCGATAACATACCAA, NM_000280.4:c.350_354dupTACCA, NM_000280.4:c.353C>G, NM_000280.4:c.353C>A, NM_000280.4:c.348delC, NM_000280.4:c.344delA, NM_000280.4:c.331delG, NM_000280.4:c.331dupG, NM_000280.4:c.316_326delTTACTGTCCGA, NM_000280.4:c.316_326delTTACTGTCCGAinsCCCCCCGTT, NM_000280.4:c.325_326delGAinsCAG, NM_000280.4:c.325G>T, NM_000280.4:c.317T>A, NM_000280.4:c.307C>T, NM_000280.4:c.301delG, NM_000280.4:c.300G>A, NM_000280.4:c.299G>A, NM_000280.4:c.295G>C, NM_000280.4:c.284dupC, NM_000280.4:c.277G>A, NM_000280.4:c.277G>T, NM_000280.4:c.270delT, NM_000280.4:c.265dupC, NM_000280.4:c.265C>T, NM_000280.4:c.260T>G, NM_000280.4:c.260T>A, NM_000280.4:c.251dupT, NM_000280.4:c.236_244delCGACTCCAGinsTTGTAAGCAA, NM_000280.4:c.235_238dupGCGA, NM_000280.4:c.236_237delCGinsTTTGCTTACA, NM_000280.4:c.236C>A, NM_000280.4:c.233T>C, NM_000280.4:c.215_228delGTGGTAGTAAACCG, NM_000280.4:c.222_228dupTAAACCG, NM_000280.4:c.227C>G, NM_000280.4:c.220A>G, NM_000280.4:c.218G>A, NM_000280.4:c.215dupG, NM_000280.4:c.214G>A, NM_000280.4:c.210_213delAATCinsGGTAGTACACCCAG, NM_000280.4:c.202C>T, NM_000280.4:c.199A>T, NM_000280.4:c.191G>T, NM_000280.4:c.181_189delTACGAGACTinsCA, NM_000280.4:c.184_188dupGAGAC, NM_000280.4:c.187A>C, NM_000280.4:c.183delC, NM_000280.4:c.183C>A, NM_000280.4:c.177delG, NM_000280.4:c.175delA, NM_000280.4:c.170_174delTGGGC, NM_000280.4:c.164_170delAAATTCT, NM_000280.4:c.168delT, NM_000280.4:c.167T>C, NM_000280.4:c.164A>G, NM_000280.4:c.158_159delTG, NM_000280.4:c.157G>C, NM_000280.4:c.154T>C, NM_000280.4:c.142-1_153dupGGTGTCCAACGGA, NM_000280.4:c.152G>C, NM_000280.4:c.152G>T, NM_000280.4:c.151G>A, NM_000280.4:c.146C>T, NM_000280.4:c.143T>A, NM_000280.4:c.142delG, NM_000280.4:c.142-1G>T, NM_000280.4:c.555_556delGA, NM_000280.4:c.541G>T, NM_000280.4:c.539delA, NM_000280.4:c.538C>T, NM_000280.4:c.10+5G>C, NM_000280.4:c.10+3_10+4delAAinsGC, NM_000280.4:c.4delC, NM_000280.4:c.4C>T, NM_000280.4:c.3delG, NM_000280.4:c.1_2delATinsCA, NM_000280.4:c.2T>A, NM_000280.4:c.2T>G, NM_000280.4:c.1A>G, NM_000280.4:c.917-1G>C, NM_000280.4:c.736A>T, NM_000280.4:c.916+1G>A, NM_000280.4:c.711_712delGT, NM_000280.4:c.142-99A>G, NM_000280.4:c.901C>T, NM_000280.4:c.924delC, NM_000280.4:c.1032+2T>A, NM_000280.4:c.917-1G>A, NM_000280.4:c.142-3C>G, NM_000280.4:c.142-117T>A, NM_000280.4:c.1032+1G>A, NM_000280.4:c.718C>T, NM_000280.4:c.142-2A>G | Aniridia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAX6 gene located on chromosomal region 11p13. The age of onset is infantile. A congenital, bilateral, panocular disorder characterized by complete absence of the iris or extreme iris hypoplasia. Aniridia is not just an isolated defect in iris development but it is associated with macular and optic nerve hypoplasia, cataract, corneal changes, nystagmus. Visual acuity is generally low but is unrelated to the degree of iris hypoplasia. Glaucoma is a secondary problem causing additional visual loss over time. | 600 |
| PC | Pyruvate carboxylase deficiency | NM_000920.3 | NM_000920.3:c.434T>C, NM_000920.3:c.1748G>T, NM_000920.3:c.496G>A | Pyruvate carboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PC gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by metabolic acidosis, failure to thrive, developmental delay, and recurrent seizures. The prevalence is 1:250,000. | 250,600 |
| PCCA | Propionic acidemia type 1 | NM_000282.3 | NM_000282.3:c.1598_1601delTTGT, NM_000282.3:c.412G>A, NM_000282.3:c.1226_1227delTT, NM_000282.3:c.1891G>C, NM_000282.3:c.1899+1_1899+4delGTAA, NM_000282.3:c.1284+1G>A, NM_000282.3:c.229C>T, NM_000282.3:c.1023dupT, NM_000282.3:c.600+1G>A, NM_000282.3:c.261_262insT, NM_000282.3:c.1118T>A, NM_000282.3:c.862A>T | Propionic acidemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCA gene located on chromosomal region 13q32.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000. | 250,600 |
| PCCB | Propionic acidemia type 2 | NM_000532.4 | NM_000532.4:c.1279_1291delGTTCCCinsAA, NM_000532.4:c.1283C>T, NM_000532.4:c.337C>T, NM_000532.4:c.1538_1540dupCCC, NM_000532.4:c.990dupT, NM_000532.4:c.1304A>G, NM_000532.4:c.1228C>T, NM_000532.4:c.1229_1230insT, NM_000532.4:c.1606A>G, NM_000532.4:c.1223_1226delTCAT, NM_000532.4:c.1490C>T, NM_000532.4:c.1534C>T, NM_000532.4:c.1173_1174insT, NM_000532.4:c.1540_1541insCCC, NM_000532.4:c.331C>T, NM_000532.4:c.683C>T, NM_000532.4:c.797G>T, NM_000532.4:c.737G>T, NM_000532.4:c.1218_1231delinsTAGAGCACAGGA, NM_000532.4:c.502G>A, NM_000532.4:c.562G>A, NM_000532.4:c.1219_1224delGGCATCinsAA | Propionic acidemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCB gene located on chromosomal region 3q22.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy.. The prevalence is 1:100,000. | 250,600 |
| PCDH15 | Usher syndrome type 1F | NM_033056.3 | NM_033056.3:c.1583T>A, NM_033056.3:c.4885delA, NM_033056.3:c.4961_4962insTGAT, NM_033056.3:c.5659A>T, NM_033056.3:c.4937_4940dupTGAT, NM_033056.3:c.785G>A, NM_033056.3:c.5622_5624delAAC, NM_033056.3:c.400C>T, NM_033056.3:c.5724_5755delACGCACAAATGTTTCAGAACTTCAAACTATGT, NM_033056.3:c.4864delA, NM_033056.3:c.1737C>G, NM_033056.3:c.1021C>T, NM_033056.3:c.1088delT, NM_033056.3:c.1006C>T, NM_033056.3:c.1940C>G, NM_033056.3:c.400C>G, NM_033056.3:c.3718-2A>G, NM_033056.3:c.4548_4551dupATCT, NM_033056.3:c.7C>T, NM_033056.3:c.2645_2646delAT | Usher syndrome type 1F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCDH15 gene located on chromosomal region 10q21.1. The age of onset is early. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 4.4:100,000. | 250,600 |
| PDE6A | Retinitis pigmentosa type 43 | NM_000440.2 | NM_000440.2:c.1683G>A, NM_000440.2:c.1113+1G>T, NM_000440.2:c.718-4_718-3insT, NM_000440.2:c.1749C>G, NM_000440.2:c.2053G>A, NM_000440.2:c.1560_1561insA, NM_000440.2:c.304C>A, NM_000440.2:c.1040C>T, NM_000440.2:c.1113+1G>A | Retinitis pigmentosa 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 250,600 |
| PDE6B | Retinitis pigmentosa type 43 | NM_000283.3 | NM_000283.3:c.1580T>C, NM_000283.3:c.655T>C, NM_000283.3:c.1540delC, NM_000283.3:c.1572delC, NM_000283.3:c.1920+2T>C, NM_000283.3:c.1669C>T, NM_000283.3:c.892C>T | Retinitis pigmentosa 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 250,600 |
| PDE6C | Cone dystrophy type 4 | NM_006204.3 | NM_006204.3:c.1682dupA, NM_006204.3:c.1805A>T, NM_006204.3:c.2283+1G>C, NM_006204.3:c.256_257insAG, NM_006204.3:c.1066G>T, NM_006204.3:c.881G>A, NM_006204.3:c.481-12T>A, NM_006204.3:c.1363A>G, NM_006204.3:c.2457T>A, NM_006204.3:c.826C>T, NM_006204.3:c.633G>C, NM_006204.3:c.2036+1G>T, NM_006204.3:c.85C>T, NM_006204.3:c.180_186delCCTGTGC | Progressive cone dystrophy 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6C gene located on chromosomal region 10q23.33. The age of onset is infantile. This disease is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, eccentric fixation, and reduced or complete loss of color discrimination. | 600 |
| PDE6G | Retinitis pigmentosa type 57 | NM_002602.3 | NM_002602.3:c.187+1G>T | Retinitis pigmentosa type 57 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6G gene located on chromosomal region 17q25.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. | 600 |
| PDHA1 | Pyruvate dehydrogenase E1-alpha deficiency | NM_000284.3 | NM_000284.3:c.262C>T, NM_000284.3:c.787C>G, NM_000284.3:c.871G>A, NM_000284.3:c.773A>C | Pyruvate dehydrogenase E1-alpha deficiency follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PDHA1 gene located on chromosomal region Xp22.12. The age of onset is variable. This disease is characterized by primary lactic acidosis in children. It is associated with a broad clinical spectrum ranging from fatal lactic acidosis in the newborn to chronic neurologic dysfunction with structural abnormalities in the central nervous system without systemic acidosis.The prevalence is >1:40,000 newborn. | 600 |
| PDP1 | Pyruvate dehydrogenase phosphatase deficiency | NM_018444.3 | NM_018444.3:c.597_601delCTTTA, NM_018444.3:c.1606C>T, NM_018444.3:c.277G>T, NM_018444.3:c.803delC, NM_018444.3:c.669_673delTTACT, NM_018444.3:c.672_676delCTTTA, NM_018444.3:c.878delC, NM_018444.3:c.851_853delTTC | Pyruvate dehydrogenase phosphatase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDP1 gene located on chromosomal region 8q22.1. The age of onset is neonatal. This disease is characterized by lactic acidosis and hypotonia. | 600 |
| PDSS1 | Coenzyme Q10 deficiency, primary, type 2 | NM_014317.3 | NM_014317.3:c.319dupT, NM_014317.3:c.924T>G | Coenzyme Q10 deficiency, primary, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDSS1 gene located on chromosome 10p12.1. The age of onset is neonatal/infantile. This disease is characterized by multisystem disorder with early-onset deafness, optic atrophy, mild mental retardation, peripheral neuropathy, obesity and cardiac valvulopathy. | 600 |
| PDSS2 | Coenzyme Q10 deficiency, primary, type 3 | NM_020381.3 | NM_020381.3:c.964C>T, NM_020381.3:c.129_130insC, NM_020381.3:c.1145C>T | Coenzyme Q10 deficiency, primary, type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDSS2 gene located on chromosomal region 6q21. The age of onset is infantile. This disease is characterized by onset of symptoms typically between age three and 12 months, often following a viral infection. Neurologic features include hypotonia, spasticity, movement disorders, cerebellar ataxia, and peripheral neuropathy. | 600 |
| PDX1 | Pancreatic agenesis | NM_000209.3 | NM_000209.3:c.532G>A, NM_000209.3:c.533A>G, NM_000209.3:c.492G>T | Pancreatic agenesis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDX1 gene located on chromosomal region 13q12.1. The age of onset is infantile. This disease is characterized by the congenital absence of a critical mass of pancreatic tissue, pancreaticobiliary duct anomalies, leading to acute or chronic pancreatitis, hyperglycemia (50% of cases) and polysplenia. | 600 |
| PDZD7 | Usher syndrome type 2C | NM_001195263.1 | NM_001195263.1:c.1543C>T, NM_001195263.1:c.166_167insC, NM_001195263.1:c.2107delA, NM_001195263.1:c.144_145insA | Usher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR98 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32 respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000. | 600 |
| PEX1 | Peroxisome biogenesis disorder type 1A | NM_000466.2 | NM_000466.2:c.2097dupT, NM_000466.2:c.2916delA, NM_000466.2:c.1842delA, NM_000466.2:c.1991T>C, NM_000466.2:c.1239+1G>T | Peroxisome biogenesis disorder type 1A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. The age of onset is early. This disease is characterized by neuronal migration defects in the brain, dysmorphic craniofacial features, profound hypotonia, neonatal seizures, and liver dysfunction. The prevalence is 1:1,000,000. | 250,600 |
| PEX1 | Peroxisome biogenesis disorder type 1B | NM_000466.2 | NM_000466.2:c.2097_2098insT, NM_000466.2:c.1952_1960dupCAGTGTGGA, NM_000466.2:c.877C>T, NM_000466.2:c.3505_3517delCAGTTGTTTTCAC, NM_000466.2:c.2528G>A | Peroxisome biogenesis disorder type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. The age of onset is early. This disease includes neonatal adrenoleukodystrophy and infantile Refsum disease, two milder manifestations of the Zellweger disease spectrum. The clinical course of patients is variable and may include developmental delay, hypotonia, liver dysfunction, sensorineural hearing loss, retinal dystrophy and vision impairment. | 250,600 |
| PEX12 | Peroxisome biogenesis disorder complementation group 6 | NM_000286.2 | NM_000286.2:c.959C>T, NM_000286.2:c.894delC, NM_000286.2:c.888_889delCT, NM_000286.2:c.538C>T, NM_000286.2:c.455_459dupGGAAA, NM_000286.2:c.771delC | Peroxisome biogenesis disorder complementation group 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX12 gene located on chromosomal region 17q12. The age of onset is early. This is a peroxisomal disorder arising from a failure of protein import into the peroxisomal membrane or matrix. The peroxisome biogenesis disorders are genetically heterogeneous with at least 14 distinct genetic groups as concluded from complementation studies. Include disorders are: Zellweger syndrome, neonatal adrenoleukodystrophy, infantile Refsum disease, and classical rhizomelic chondrodysplasia punctata. | 600 |
| PEX2 | Peroxisome biogenesis disorder complementation group 5 | NM_000318.2 | NM_000318.2:c.163G>A, NM_000318.2:c.789_790delCT | Peroxisome biogenesis disorder complementation group 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX2 gene located on chromosomal region 8q21.11. The age of onset is early. This is a peroxisomal disorder arising from a failure of protein import into the peroxisomal membrane or matrix. The peroxisome biogenesis disorders are genetically heterogeneous with at least 14 distinct genetic groups as concluded from complementation studies. Include disorders are: Zellweger syndrome, neonatal adrenoleukodystrophy, infantile Refsum disease, and classical rhizomelic chondrodysplasia punctata. | 600 |
| PEX26 | Peroxisome biogenesis disorder type 7 | NM_017929.5 | NM_017929.5:c.292C>T, NM_017929.5:c.254dupT, NM_017929.5:c.265G>A, NM_017929.5:c.353C>G | Peroxisome biogenesis disorder complementation group 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX26 gene located on chromosomal region 22q11.21. The age of onset is early. This is a peroxisomal disorder arising from a failure of protein import into the peroxisomal membrane or matrix. The peroxisome biogenesis disorders are genetically heterogeneous with at least 14 distinct genetic groups as concluded from complementation studies. Include disorders are: Zellweger syndrome, neonatal adrenoleukodystrophy, infantile Refsum disease, and classical rhizomelic chondrodysplasia punctata. The prevalence is 1:1,000,000. | 600 |
| PEX5 | Peroxisome biogenesis disorder type 2 | NM_001131025.1 | NM_001131025.1:c.1578T>G, NM_001131025.1:c.1279C>T, NM_001131025.1:c.*20G>C | Peroxisome biogenesis disorder complementation group 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX26 gene located on chromosomal region 22q11.21. The age of onset is early. This is a peroxisomal disorder arising from a failure of protein import into the peroxisomal membrane or matrix. The peroxisome biogenesis disorders are genetically heterogeneous with at least 14 distinct genetic groups as concluded from complementation studies. Include disorders are: Zellweger syndrome, neonatal adrenoleukodystrophy, infantile Refsum disease, and classical rhizomelic chondrodysplasia punctata. The prevalence is 1:1,000,000. | 600 |
| PEX7 | Rhizomelic chondrodysplasia punctata type 1 | NM_000288.3 | NM_000288.3:c.694C>T, NM_000288.3:c.649G>A, NM_000288.3:c.618G>A, NM_000288.3:c.722A>T, NM_000288.3:c.875T>A, NM_000288.3:c.653C>T, NM_000288.3:c.854A>G, NM_000288.3:c.532C>T, NM_000288.3:c.903+1G>C | Rhizomelic chondrodysplasia punctata type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX7 gene located on chromosomal region 6q23.3. The age of onset is early. This disease is characterized by proximal shortening of the humerus and to a lesser degree the femur (rhizomelia), punctate calcifications in cartilage with epiphyseal and metaphyseal abnormalities (chondrodysplasia punctata), coronal clefts of the vertebral bodies, cataracts, postnatal growth deficiency is profound, intellectual disability is severe, seizures. The prevalence is <1:100,000. | 250,600 |
| PGM1 | Congenital disorder of glycosylation, type 1T | NM_002633.2 | NM_002633.2:c.343A>G, NM_002633.2:c.361G>C, NM_002633.2:c.1507C>T, NM_002633.2:c.300+1G>A, NM_002633.2:c.787G>T | Congenital disorder of glycosylation, type 1T follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PGM1 gene located on chromosomal region 1p31.3. The age of onset is infantile. It is a multisystem disorder caused by a defect in glycoprotein biosynthesis and characterized by under-glycosylated serum glycoproteins. Congenital disorders of glycosylation result in a wide variety of clinical features, such as defects in the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. The prevalence is <1:1,000,000. | 600 |
| PHKG2 | Glycogen storage disease type 9C | NM_000294.2 | NM_000294.2:c.958C>T, NM_000294.2:c.553C>T, NM_000294.2:c.130C>T, NM_000294.2:c.393-2A>G | Glycogen storage disease type 9C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHKG2 gene located on chromosomal region 16p12.1-p11.2. The age of onset is infantile. This disease is characterized by hepatomegaly, growth retardation, and mild delay in motor development during childhood. The incidence is <1:100.000 births. | 600 |
| PHYH | Refsum disease | NM_006214.3 | NM_006214.3:c.135-2A>G, NM_006214.3:c.497-2A>G, NM_006214.3:c.135-1G>C, NM_006214.3:c.805A>C, NM_006214.3:c.678+5G>T, NM_006214.3:c.823C>T, NM_006214.3:c.530A>G, NM_006214.3:c.164delT, NM_006214.3:c.678+2T>G, NM_006214.3:c.824G>A | Refsum disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHYH gene located on chromosomal region 10p13. The age of onset is variable. This disease is characterized by hemeralopia (loss of vision in the dark), followed by episods of chronic distal motor polyneuropathy. Other associated signs include perceptive deafness, anosmia, cerebellous ataxia and sometimes, severe intellectual deficiency. Over the course of time cutaneous signs appear (ichtyosis), along with polyepiphyseal dysplasia, myocardiopathy, elevated protein in cerebrospinal fluid, and pigmentary retinitis that may result in blindness. The prevalence is 1:1.000,000-9:1.000,000. | 250,600 |
| PKHD1 | Polycystic kidney disease, autosomal recessive | NM_138694.3 | NM_138694.3:c.10515C>A, NM_138694.3:c.11363_11372delCTTCCCTGGA, NM_138694.3:c.10585G>C, NM_138694.3:c.107C>T, NM_138694.3:c.10452dupT, NM_138694.3:c.2452C>T, NM_138694.3:c.2747A>C, NM_138694.3:c.12027C>G, NM_138694.3:c.11284C>A, NM_138694.3:c.3367G>A, NM_138694.3:c.353delG, NM_138694.3:c.2827_2828delGA, NM_138694.3:c.2854G>A, NM_138694.3:c.1342G>C, NM_138694.3:c.1409G>A, NM_138694.3:c.11611T>C, NM_138694.3:c.3761_3762delCCinsG, NM_138694.3:c.2414C>T, NM_138694.3:c.5895_5896insA, NM_138694.3:c.5895dupA, NM_138694.3:c.6499C>T, NM_138694.3:c.664A>G, NM_138694.3:c.682A>G, NM_138694.3:c.6854G>A, NM_138694.3:c.370C>T, NM_138694.3:c.8407T>C, NM_138694.3:c.3766delC, NM_138694.3:c.3940delA, NM_138694.3:c.1486C>T, NM_138694.3:c.2341C>T, NM_138694.3:c.10219C>T, NM_138694.3:c.9107T>G, NM_138694.3:c.930delC, NM_138694.3:c.9370C>T, NM_138694.3:c.9530T>C, NM_138694.3:c.9689delA, NM_138694.3:c.982C>T, NM_138694.3:c.9866G>T, NM_138694.3:c.10036T>C, NM_138694.3:c.3229-2A>C, NM_138694.3:c.4870C>T, NM_138694.3:c.4165C>A, NM_138694.3:c.9719G>A, NM_138694.3:c.5325_5326delAG, NM_138694.3:c.5498C>T, NM_138694.3:c.8824C>T, NM_138694.3:c.85G>T, NM_138694.3:c.10412T>G, NM_138694.3:c.8518C>T, NM_138694.3:c.8408G>A, NM_138694.3:c.8317G>T, NM_138694.3:c.8870T>C | Autosomal recessive polycystic kidney disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKHD1 gene located on chromosomal region 6p12.3-p12.2. The age of onset is early. This disease is characterized by the development of cysts affecting the collecting ducts. It is frequently associated with hepatic involvement. After birth, in addition to nephromegaly, arterial hypertension and urinary tract infections are common and often severe. The prevalence is 1:10,000-1:40,000. | 250,600 |
| PKLR | Hemolytic anemia due to red cell pyruvate kinase deficiency | NM_000298.5 | NM_000298.5:c.1151C>T, NM_000298.5:c.1706G>A, NM_000298.5:c.1529G>A, NM_000298.5:c.1528C>T, NM_000298.5:c.1595G>A, NM_000298.5:c.721G>T, NM_000298.5:c.1076G>A, NM_000298.5:c.1675C>T, NM_000298.5:c.1261C>A, NM_000298.5:c.1436G>A, NM_000298.5:c.1456C>T | Hemolytic anemia due to red cell pyruvate kinase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKLR gene located on chromosomal region 1q22. The age of onset is early. This disease is characterized by highly variable degree of chronic hemolysis, with severe neonatal jaundice and fatal anemia at birth, severe transfusion-dependent chronic hemolysis, and moderate hemolysis with exacerbation during infection. The prevalence is 1:20,000. | 250,600 |
| PLA2G6 | Infantile neuroaxonal dystrophy | NM_003560.2 | NM_003560.2:c.1634A>C, NM_003560.2:c.238G>A, NM_003560.2:c.1903C>T, NM_003560.2:c.109C>T, NM_003560.2:c.1612C>T, NM_003560.2:c.2370T>G, NM_003560.2:c.929T>A, NM_003560.2:c.1894C>T, NM_003560.2:c.2239C>T | Infantile neuroaxonal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLA2G6 gene located on chromosomal region 22q13.1. The age of onset is infantile. This disease is a type of neurodegeneration with brain iron accumulation characterized by psychomotor delay and regression, increasing neurological involvement with symmetrical pyramidal tract signs and spastic tetraplegia. INAD may be classic or atypical and patients present with symptoms anywhere along a continuum between the two. | 600 |
| PLCE1 | Nephrotic syndrome type 3 | NM_016341.3 | NM_016341.3:c.3346C>T, NM_016341.3:c.4808delA, NM_016341.3:c.3846delG, NM_016341.3:c.3736C>T, NM_016341.3:c.5560C>T, NM_016341.3:c.4451C>T, NM_016341.3:c.5669C>T, NM_016341.3:c.961C>T | Nephrotic syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLCE1 gene located on chromosomal region 10q23.33. The age of onset is variable. This disease is characterized by low blood protein levels, high cholesterol levels, high triglyceride levels, and presence of protein in the urine. The prevalence is 2:100,000-7:100,000 Children; 3:100,000 adults. | 250,600 |
| PLEC | Epidermolysis bullosa simplex with muscular dystrophy | NM_000445.4 | NM_000445.4:c.6955C>T, NM_000445.4:c.9250_9251delCT, NM_000445.4:c.10971_10972delGA, NM_000445.4:c.2493+1G>C | Epidermolysis bullosa simplex with muscular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLEC gene located on chromosomal region 8q24. The age of onset is early. This disease is characterized by generalized blistering associated with muscular dystrophy, dystrophic nails, and focal keratoderma of the palms and soles. The prevalence is 1:30,000-1:50,000. | 600 |
| PLEC | Epidermolysis bullosa simplex with pyloric atresia | NM_000445.4 | NM_000445.4:c.9085C>T, NM_000445.4:c.913C>T, NM_000445.4:c.906+1G>A, NM_000445.4:c.12043_12044insG, NM_000445.4:c.11446G>T | Epidermolysis bullosa simplex with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLEC gene located on chromosomal region 8q24. The age of onset is early. This disease is characterized by generalized severe blistering with widespread congenital absence of skin and pyloric atresia. The prevalence is <1:1,000,000. | 600 |
| PLEKHG5 | Charcot-Marie-Tooth disease, intermediate type C | NM_020631.4 | NM_020631.4:c.440-2A>G, NM_020631.4:c.3166C>T, NM_020631.4:c.1940T>C, NM_020631.4:c.2935C>T | Charcot-Marie-Tooth disease, intermediate type C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLEKHG5 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease is a disorder of the peripheral nervous system, characterized by progressive weakness and atrophy, initially of the peroneal muscles and later of the distal muscles of the arms. Recessive intermediate forms of Charcot-Marie-Tooth disease are characterized by clinical and pathologic features intermediate between demyelinating and axonal peripheral neuropathies, and motor median nerve conduction velocities ranging from 25 to 45 m/sec. | 600 |
| PLG | Congenital plasminogen deficiency type 1 | NM_000301.3 | NM_000301.3:c.704G>A, NM_000301.3:c.1848G>A, NM_000301.3:c.1435G>T, NM_000301.3:c.693_695delGAA, NM_000301.3:c.1120G>T, NM_000301.3:c.112A>G | Plasminogen deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLG gene located on chromosomal region 6q26. The age of onset is infantile.This disease is characterized by markedly impaired extracellular fibrinolysis leading to the formation of ligneous (fibrin-rich) pseudomembranes on mucosae during wound healing. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| PLOD1 | Ehlers-Danlos syndrome, type 6 | NM_000302.3 | NM_000302.3:c.955C>T, NM_000302.3:c.2032G>A, NM_000302.3:c.1533C>G, NM_000302.3:c.1836G>C, NM_000302.3:c.2008C>T, NM_000302.3:c.466+1G>A | Ehlers-Danlos syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLOD1 gene located on chromosomal region 1p36. The age of onset is early. This disease is characterized by progressive scoliosis from birth, severe muscle hypotonia, hyperextensible joints and fragile eyeballs. The weakness can lead to ocular retinal hemorrhage, glaucoma, coloring of the sclera or even to rupture of the globe. The prevalence is <1:5,000. | 600 |
| PLP1 | Pelizaeus-Merzbacher disease | NM_000533.3 | NM_000533.3:c.128C>T, NM_000533.3:c.593delG, NM_000533.3:c.231_232insC, NM_000533.3:c.3G>A, NM_000533.3:c.487T>C, NM_000533.3:c.725C>T, NM_000533.3:c.737G>C, NM_000533.3:c.169G>T | Pelizaeus-Merzbacher disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PLP1 gene located on chromosomal region Xq22.2. The age of onset is infantile. It is a hypomyelinative leukodystrophy in which myelin is not formed properly in the central nervous system. It is characterized clinically by nystagmus, spastic quadriplegia, ataxia, and developmental delay. | 600 |
| PLP1 | Spastic paraplegia type 2, X-linked | NM_000533.3 | NM_000533.3:c.409C>T | Spastic paraplegia type 2, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PLP1 gene located on chromosomal region Xq22.2. The age of onset is infantile. This disease is characterized by spastic gait and autonomic dysfunction. | 600 |
| PMM2 | Congenital disorders of glycosylation type 1a | NM_000303.2 | NM_000303.2:c.349G>C, NM_000303.2:c.357C>A, NM_000303.2:c.255+2T>C, NM_000303.2:c.127G>C, NM_000303.2:c.395T>C, NM_000303.2:c.415G>A, NM_000303.2:c.368G>A, NM_000303.2:c.385G>A, NM_000303.2:c.470T>C, NM_000303.2:c.484C>T, NM_000303.2:c.422G>A, NM_000303.2:c.442G>A, NM_000303.2:c.623G>C, NM_000303.2:c.647A>T, NM_000303.2:c.652C>G, NM_000303.2:c.323C>T, NM_000303.2:c.677C>G, NM_000303.2:c.691G>A, NM_000303.2:c.710C>G, NM_000303.2:c.669C>G, NM_000303.2:c.95_96delTAinsGC, NM_000303.2:c.95T>G, NM_000303.2:c.53C>G, NM_000303.2:c.710C>T, NM_000303.2:c.620T>C, NM_000303.2:c.97C>T, NM_000303.2:c.193G>T, NM_000303.2:c.338C>T, NM_000303.2:c.563A>G, NM_000303.2:c.131T>C, NM_000303.2:c.26G>A, NM_000303.2:c.109C>T, NM_000303.2:c.317A>T, NM_000303.2:c.190delT, NM_000303.2:c.256-1G>C | Congenital disorder of glycosylation type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PMM2 gene located on chromosomal region 16p13.2. The age of onset is infantile. This disease is characterized by highly variable clinical manifestations that may include feeding problems, vomiting, and diarrhea with failure to thrive in infants, and severe encephalopathy with axial hypotonia, abnormal eye movement, marked psychomotor retardation, peripheral neuropathy, cerebellar hypoplasia, stroke-like episodes, and retinitis pigmentosa in late infancy, childhood or adulthood. | 250,600 |
| PNPO | PNPO deficiency | NM_018129.3 | NM_018129.3:c.685C>T, NM_018129.3:c.674G>A | PNPO deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PNPO gene located on chromosomal region 17q21.32. The age of onset is early. This disease is characterized by onset of severe seizures within hours of birth that are not responsive to anticonvulsants. | 600 |
| POLG | Mitochondrial DNA depletion syndrome, Alpers type | NM_002693.2 | NM_002693.2:c.2617G>T, NM_002693.2:c.1120C>T, NM_002693.2:c.830A>T, NM_002693.2:c.3218C>T, NM_002693.2:c.3630dupC | Mitochondrial DNA depletion syndrome, Alpers type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by the clinical triad of psychomotor regression, seizures, and liver disease. The prevalence is 1:1,600 newborn. | 250,600 |
| POLG | Progressive external ophthalmoplegia | NM_002693.2 | NM_002693.2:c.1437C>G, NM_002693.2:c.2591A>G, NM_002693.2:c.1754G>A, NM_002693.2:c.1399G>A, NM_002693.2:c.1491G>C, NM_002693.2:c.3151G>C, NM_002693.2:c.803G>C, NM_002693.2:c.3286C>T, NM_002693.2:c.2794C>T, NM_002693.2:c.752C>T, NM_002693.2:c.3644-1G>A, NM_002693.2:c.1879C>T, NM_002693.2:c.2605C>T, NM_002693.2:c.911T>G, NM_002693.2:c.1760C>T, NM_002693.2:c.2542G>A, NM_002693.2:c.1550G>T, NM_002693.2:c.2557C>T, NM_002693.2:c.2207A>G, NM_002693.2:c.2243G>C, NM_002693.2:c.2209G>C | Progressive external ophthalmoplegia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by ptosis, paralysis of the extraocular muscles, oropharyngeal weakness, and variably severe proximal limb weakness. | 250,600 |
| POMGNT1 | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3 | NM_017739.3 | NM_017739.3:c.1425G>A, NM_017739.3:c.1545delC, NM_017739.3:c.1274G>C, NM_017739.3:c.1864delC, NM_017739.3:c.1411A>T, NM_017739.3:c.1469G>A, NM_017739.3:c.1539+1G>A, NM_017739.3:c.92dupA, NM_017739.3:c.1539+1G>T, NM_017739.3:c.932G>A, NM_017739.3:c.794G>A, NM_017739.3:c.880-1G>A, NM_017739.3:c.652+1G>A, NM_017739.3:c.931C>T, NM_017739.3:c.1666G>A, NM_017739.3:c.1814G>C, NM_017739.3:c.636C>T, NM_017739.3:c.187C>T | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3 which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMGNT1 gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent psychomotor development, eye involvement and seizures. The prevalence is 1-9:100,000. | 250,600 |
| POMT1 | Congenital muscular dystrophy with intellectual disability type B1 | NM_007171.3 | NM_007171.3:c.598G>C, NM_007171.3:c.193G>A, NM_007171.3:c.1770G>C, NM_007171.3:c.2005G>A, NM_007171.3:c.2163C>A, NM_007171.3:c.1746G>C, NM_007171.3:c.793C>T | Congenital muscular dystrophy with intellectual disability type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 gene located on chromosomal region 9q34.13. The age of onset is early. This disease is associated with mental retardation and mild structural brain abnormalities. | 250,600 |
| POMT1 | Walker-Warburg syndrome | NM_007171.3 | NM_007171.3:c.1540C>T, NM_007171.3:c.226G>A, NM_007171.3:c.1611C>G, NM_007171.3:c.1242-2A>G, NM_007171.3:c.907C>T, NM_007171.3:c.2163_2164insG, NM_007171.3:c.2167dupG, NM_007171.3:c.1153C>T, NM_007171.3:c.1261_1262insC, NM_007171.3:c.831C>G, NM_007171.3:c.1545C>G, NM_007171.3:c.1280_1281delAGinsTC | Walker-Warburg syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 and POMT2 genes located on chromosomal regions 9q34.13 and 14q24.3 respectively. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent or very poor psychomotor development, eye involvement and seizures. The prevalence is 1:100,000-9:100,000. | 250,600 |
| POMT2 | Congenital muscular dystrophy with intellectual disability type A2 | NM_013382.5 | NM_013382.5:c.2243G>C, NM_013382.5:c.1997A>G, NM_013382.5:c.2242T>C, NM_013382.5:c.1445G>T, NM_013382.5:c.2177G>A, NM_013382.5:c.1238G>C, NM_013382.5:c.1941G>A, NM_013382.5:c.1057G>A, NM_013382.5:c.551C>T | Congenital muscular dystrophy with intellectual disability type A2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT2 gene located on chromosomal region 14q24.3. The age of onset is early. This disorder characterized by congenital muscular dystrophy associated with cobblestone lissencephaly and other brain anomalies, eye malformations, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. | 250,600 |
| POMT2 | Walker-Warburg syndrome | NM_013382.5 | NM_013382.5:c.1726-2A>G, NM_013382.5:c.1417C>T, NM_013382.5:c.1912C>T, NM_013382.5:c.1608_1609delCA, NM_013382.5:c.1045_1052delinsG | Walker-Warburg syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 and POMT2 genes located on chromosomal regions 9q34.13 and 14q24.3 respectively. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent or very poor psychomotor development, eye involvement and seizures. The prevalence is 1:100,000-9:100,000. | 250,600 |
| POU1F1 | Pituitary hormone deficiency, combined, type 1 | NM_000306.3 | NM_000306.3:c.472G>C, NM_000306.3:c.428G>A, NM_000306.3:c.577T>C, NM_000306.3:c.514C>T, NM_000306.3:c.515G>A, NM_000306.3:c.71C>T, NM_000306.3:c.433A>T, NM_000306.3:c.715C>T, NM_000306.3:c.515G>C, NM_000306.3:c.391G>T, NM_000306.3:c.688G>A, NM_000306.3:c.793C>T, NM_000306.3:c.748G>T, NM_000306.3:c.811C>T, NM_000306.3:c.404T>G | Pituitary hormone deficiency, combined, type 1. Genetic forms follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POU1F1 gene located on chromosomal region 3p11.2. The age of onset is early. This disease is characterized by short stature, cognitive alterations or delayed puberty. The prevalence is 1:8,000. | 600 |
| POU3F4 | Deafness type 2, X-linked | NM_000307.4 | NM_000307.4:c.604A>T, NM_000307.4:c.499C>T | X-linked deafness type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the POU3F4 gene located on chromosomal region Xq21.1. The age of onset is infantile. This disease is characterized by both conductive hearing loss resulting from stapes (perilymphatic gusher) fixation, and progressive sensorineural deafness. | 600 |
| PPT1 | Neuronal ceroid-lipofuscinoses type 1 | NM_000310.3 | NM_000310.3:c.29T>A, NM_000310.3:c.223A>C, NM_000310.3:c.627+1G>T, NM_000310.3:c.169_170insA, NM_000310.3:c.451C>T, NM_000310.3:c.541G>T, NM_000310.3:c.840_841insA | Neuronal ceroid lipofuscinoses, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PPT1 gene located on chromosomal region 1p32. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 1.5:1,000,000-9:1,000,000. | 250,600 |
| PRCD | Retinitis pigmentosa 36 | NM_001077620.2 | NM_001077620.2:c.64C>T, NM_001077620.2:c.52C>T | Retinitis pigmentosa 36 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRCD gene located on chromosomal region 17q25.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. | 600 |
| PRKRA | Dystonia tipo 16 | NM_003690.4 | NM_003690.4:c.665C>T | Dystonia 16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRKRA gene located on chromosomal region 2q31.2. The age of onset is early. This disease is characterized by progressive limb dystonia, laryngeal and oromandibular dystonia and parkinsonism. | 600 |
| PRODH | Hyperprolinemia type 1 | NM_016335.4 | NM_016335.4:c.865T>A, NM_016335.4:c.1331G>A | Hyperprolinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRODH gene located on chromosomal region 22q11.2. The age of onset is variable. This disease is characterized by benign symptoms, but associations with renal abnormalities, epileptic seizures, and other neurological manifestations, as well as certain forms of schizophrenia have been reported. | 250,600 |
| PROM1 | Retinitis pigmentosa type 41 | NM_006017.2 | NM_006017.2:c.1841delG, NM_006017.2:c.1354_1355insT, NM_006017.2:c.1726C>T, NM_006017.2:c.199C>T, NM_006017.2:c.2490-2A>G, NM_006017.2:c.1177_1178delAT | Retinitis pigmentosa 41 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROM1 gene located on chromosomal region 4p15.32. The age of onset is early. This disease is characterized by night blindness often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 19:100,000-27:100,000. | 250,600 |
| PROP1 | Pituitary hormone deficiency, combined, type 2 | NM_006261.4 | NM_006261.4:c.2T>C, NM_006261.4:c.150delA, NM_006261.4:c.349T>A, NM_006261.4:c.112_124delTCGAGTGCTCCAC, NM_006261.4:c.310delC, NM_006261.4:c.343-11C>G, NM_006261.4:c.217C>T, NM_006261.4:c.218G>A, NM_006261.4:c.373C>T, NM_006261.4:c.157delA, NM_006261.4:c.295C>T, NM_006261.4:c.469_470insT, NM_006261.4:c.301_302delAG, NM_006261.4:c.358C>T, NM_006261.4:c.247C>T, NM_006261.4:c.263T>C, NM_006261.4:c.4delG | Pituitary hormone deficiency, combined, type 2, genetic forms follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROP1 gene located on chromosomal region 5q35.3. The age of onset is early. This disease is characterized by short stature, cognitive alterations or delayed puberty. | 600 |
| PRPS1 | Charcot-Marie-Tooth disease type 5, X-linked recessive | NM_002764.3 | NM_002764.3:c.344T>C | X-linked Charcot-Marie-Tooth disease type 5 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PRPS1 gene located on chromosomal region Xq22.3. The age of onset is infantile. This disease is characterized by peripheral neuropathy, early-onset (prelingual) bilateral profound sensorineural hearing loss, and optic neuropathy. The prevalence is <1:1,000,000. | 600 |
| PRPS1 | Deafness, X-linked | NM_002764.3 | NM_002764.3:c.916G>A, NM_002764.3:c.869T>C | Sensorineural deafness, nonsyndromic, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PRPS1 gene located on chromosomal region Xq22.1-q24. The age of onset is early. This is a form of deafness characterized by progressive, severe-to-profound sensorineural hearing loss in males. Females manifest mild to moderate hearing loss. | 600 |
| PRPS1 | Phosphoribosylpyrophosphate synthetase superactivity | NM_002764.3 | NM_002764.3:c.398A>C, NM_002764.3:c.455T>C | Phosphoribosylpyrophosphate synthetase superactivity follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PRPS1 gene located on chromosomal region Xq22.1-q24. This disease is characterized by excessive purine production, gout and uric acid urolithiasis. | 600 |
| PRPS1 | Sensorineural deafness, nonsyndromic, X-linked | NM_002764.3 | NM_002764.3:c.193G>A | Sensorineural deafness, nonsyndromic, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PRPS1 gene located on chromosomal region Xq22.1-q24. The age of onset is early. This is a form of deafness characterized by progressive, severe-to-profound sensorineural hearing loss in males. Females manifest mild to moderate hearing loss. | 600 |
| PRX | Charcot-Marie-Tooth disease type 4F | NM_181882.2 | NM_181882.2:c.2553_2556delTCTC, NM_181882.2:c.1362delA, NM_181882.2:c.1951G>A, NM_181882.2:c.3208C>T, NM_181882.2:c.2145T>A, NM_181882.2:c.2098delG | Charcot-Marie-Tooth disease, type 4F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRX gene located on chromosomal region 19q13.2. The age of onset is infantile. This disease is characterized by delayed motor milestones, and proximal and distal muscle weakness. The prevalence is <1:1,000,000. | 600 |
| PRX | Dejerine-Sottas syndrome (PRX) | NM_181882.2 | NM_181882.2:c.247delC, NM_181882.2:c.1102C>T, NM_181882.2:c.2857C>T | There are both autosomal dominant and autosomal recessive forms of Dejerine-Sottas syndrome. Autosomal recessive form is caused by pathogenic variants in the PRX gene located on chromosomal region 19q13.2. The age of onset is infantile. This disease is characterized by motor and sensory neuropathy with very slow nerve conduction velocities, increased cerebrospinal fluid protein concentrations, hypertrophic nerve changes, and delayed age of walking as well as areflexia. The prevalence is <1:1,000,000. | 600 |
| PSAP | Atypical Gaucher disease due to saposin C deficiency | NM_002778.2 | NM_002778.2:c.643A>C, NM_002778.2:c.607C>T, NM_002778.2:c.1A>T, NM_002778.2:c.1046T>C, NM_002778.2:c.1288C>T | Gaucher disease, atypical, due to saposin C deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PSAP gene located on chromosomal region 10q21. The age of onset is early. This disease is characterized by marked glucosylceramide accumulation in the spleen without having a deficiency of glucosylceramide-beta glucosidase characteristic of classic Gaucher disease. Gaucher disease is a lysosomal storage disorder characterized by skeletal deterioration, hepatosplenomegaly, and organ dysfunction. There are several subtypes based on the presence and severity of neurological involvement. | 600 |
| PSAT1 | Phosphoserine aminotransferase deficiency | NM_058179.3 | NM_058179.3:c.1029_1030delCT, NM_058179.3:c.299A>C | Phosphoserine aminotransferase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PSAT1 gene located on chromosomal region 9q21.2. The age of onset is early. This disease is characterized by acquired microcephaly, psychomotor retardation, intractable seizures and hypertonia. The prevalence is <1:1,000,000. | 600 |
| PYGM | McArdle disease | NM_005609.2 | NM_005609.2:c.1628A>C, NM_005609.2:c.1466C>G, NM_005609.2:c.1094C>T, NM_005609.2:c.1827G>A, NM_005609.2:c.13_14delCT, NM_005609.2:c.1A>G, NM_005609.2:c.2009C>T, NM_005609.2:c.2128_2130delTTC, NM_005609.2:c.393delG, NM_005609.2:c.2392T>C, NM_005609.2:c.148C>T, NM_005609.2:c.1621G>T, NM_005609.2:c.613G>A, NM_005609.2:c.1963G>A, NM_005609.2:c.2262delA, NM_005609.2:c.1722T>G, NM_005609.2:c.255C>A, NM_005609.2:c.280C>T, NM_005609.2:c.1768+1G>A, NM_005609.2:c.501dupT, NM_005609.2:c.481C>T, NM_005609.2:c.1726C>T | McArdle disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PYGM gene located on chromosomal region 11q13.1. The age of onset is infantile. This disease is characterized by muscular exercise intolerance with myalgia, cramps, fatigue, and muscle weakness. | 250,600 |
| RAB23 | Carpenter syndrome | NM_183227.2 | NM_183227.2:c.407dupC, NM_183227.2:c.434T>A | Carpenter syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB23 gene located on chromosomal region 6p11.2. The age of onset is early. This disease is characterized by acrocephaly, peculiar facies, brachydactyly and syndactyly in the hands, and preaxial polydactyly and syndactyly of the toes. The prevalence is <1:1,000,000. | 600 |
| RAB27A | Griscelli syndrome, type 2 | NM_004580.4 | NM_004580.4:c.259G>C, NM_004580.4:c.382dupA, NM_004580.4:c.217T>G, NM_004580.4:c.352C>T, NM_004580.4:c.389T>C, NM_004580.4:c.454G>C | Griscelli disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB27A gene located on chromosome 15q15-q21.1. The age of onset is infantile. This disease is characterized by immune system abnormalities in addition to having hypopigmented skin and hair. Affected individuals are prone to recurrent infections. They also develop an immune condition called hemophagocytic lymphohistiocytosis, in which the immune system produces too many activated immune cells called T-lymphocytes and macrophages (histiocytes). | 600 |
| RAB3GAP1 | Warburg micro syndrome type 1 | NM_012233.2 | NM_012233.2:c.1734G>A, NM_012233.2:c.496_497delTT, NM_012233.2:c.937dupA, NM_012233.2:c.1393_1396delTGTA, NM_012233.2:c.1410C>A, NM_012233.2:c.899+1G>A, NM_012233.2:c.2011C>T, NM_012233.2:c.748+1G>A | Warburg micro syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB3GAP1 gene located on chromosomal region 2q21.3. The age of onset is infantile. This disease is characterized by microcephaly, microphthalmia, microcornia, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. The prevalence is <1:1,000,000. | 600 |
| RAB3GAP2 | Warburg micro syndrome type 2 | NM_012414.3 | NM_012414.3:c.1648C>T, NM_012414.3:c.1485C>A, NM_012414.3:c.325_328delAAAG, NM_012414.3:c.1276C>T | Warburg micro syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB3GAP2 gene located on chromosomal region 1q41. The age of onset is early. This disease is characterized by microcephaly, microphthalmia, microcornia, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. The prevalence is <1:1,000,000. | 600 |
| RAD51C | Fanconi anemia, complementation group O | NM_058216.2 | NM_058216.2:c.706-2A>G, NM_058216.2:c.838-2A>T, NM_058216.2:c.133G>A, NM_058216.2:c.773G>A | Fanconi anemia complementation group O follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAD51C gene located on chromosomal region 17q22. The age of onset is early. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:360,000 newborn. | 600 |
| RAG1 | Immunodeficiency severe combined B cell-negative | NM_000448.2 | NM_000448.2:c.2333G>A, NM_000448.2:c.2320G>T, NM_000448.2:c.2164G>A, NM_000448.2:c.940C>T, NM_000448.2:c.2814T>G, NM_000448.2:c.2923C>T, NM_000448.2:c.2326C>T | Severe combined immunodeficiency, autosomal recessive, T cell-negative, B cell negative, NK cell positive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 gene located on chromosomal region 11p13. The age of onset is early. This disease is characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development. | 250,600 |
| RAG1 | Omenn syndrome | NM_000448.2 | NM_000448.2:c.983G>A, NM_000448.2:c.3016A>G, NM_000448.2:c.256_257delAA, NM_000448.2:c.1682G>A, NM_000448.2:c.1681C>T | Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. | 250,600 |
| RAG2 | Combined immunodeficiency with skin granulomas | NM_000536.3 | NM_000536.3:c.115A>G, NM_000536.3:c.686G>A, NM_000536.3:c.283G>A, NM_000536.3:c.601C>T, NM_000536.3:c.230C>A, NM_000536.3:c.1352G>C | Combined immunodeficiency with skin granulomas follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG2 gene located on chromosome 11p13. This disease is characterized by severe infections, hypogammaglobulinemia and defective T-cell function, multiple facial papulonodular. | 600 |
| RAG2 | Omenn syndrome | NM_000536.3 | NM_000536.3:c.685C>T, NM_000536.3:c.1504A>G | Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. | 600 |
| RAPSN | Congenital myasthenic syndrome | NM_005055.4 | NM_005055.4:c.484G>A, NM_005055.4:c.264C>A, NM_005055.4:c.807C>A, NM_005055.4:c.848T>C, NM_005055.4:c.490C>T, NM_005055.4:c.603C>A | Congenital myasthenic syndromes follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by fatigable weakness of skeletal muscle (e.g., ocular, bulbar, limb muscles) with onset at or shortly after birth or in early childhood; rarely, symptoms may not manifest until later in childhood. Cardiac and smooth muscle are not involved. Severity and course of disease are highly variable, ranging from minor symptoms to progressive disabling weakness. The prevalence is 1:3,000. | 250,600 |
| RAPSN | Fetal akinesia deformation sequence | NM_005055.4 | NM_005055.4:c.416T>C, NM_005055.4:c.566C>T | Fetal akinesia deformation sequence follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by multiple joint contractures, facial anomalies and pulmonary hypoplasia. The prevalence is 1:3,000. | 250,600 |
| RAX | Isolated microphthalmia type 3 | NM_013435.2 | NM_013435.2:c.909C>G, NM_013435.2:c.18C>A, NM_013435.2:c.197G>C, NM_013435.2:c.439C>T, NM_013435.2:c.383_384delAG | Isolated microphthalmia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAX gene located on chromosomal region 18q21.32. Microphthalmia designates a heterogeneous group of ocular malformations with a more or less evident reduction in the size of the eyeball. Additional features include high hypermetropia and a short axial length. | 250,600 |
| RDH12 | Leber congenital amaurosis type 13 | NM_152443.2 | NM_152443.2:c.184C>T, NM_152443.2:c.146C>T, NM_152443.2:c.152T>A, NM_152443.2:c.451C>A, NM_152443.2:c.295C>A, NM_152443.2:c.377C>T, NM_152443.2:c.379G>T, NM_152443.2:c.565C>T, NM_152443.2:c.677A>G, NM_152443.2:c.805_809delGCCCT, NM_152443.2:c.164C>T, NM_152443.2:c.210dupC, NM_152443.2:c.448+1_448+4delGTAA, NM_152443.2:c.451C>G, NM_152443.2:c.464C>T, NM_152443.2:c.523T>C | Leber congenital amaurosis type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDH12 gene located on chromosomal region 14q24.1. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. | 250,600 |
| RDX | Deafness type 24, autosomal recessive | NM_002906.3 | NM_002906.3:c.1405dupG, NM_002906.3:c.342_346delGATAT | Autosomal recessive nonsyndromic sensorineural deafness type DFNB24 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDX gene located on chromosomal region 11q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| RELN | Lissencephaly syndrome, Norman-Roberts type | NM_005045.3 | NM_005045.3:c.6646C>T, NM_005045.3:c.5615-1G>A | Lissencephaly syndrome, Norman-Roberts type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RELN gene located on chromosomal region 7q22. The age of onset is early. This disease is characterized by craniofacial anomalies (severe microcephaly, a low sloping forehead, a broad and prominent nasal bridge and widely set eyes) and postnatal growth retardation, severe intellectual deficit, spasticity and epilepsy. The prevalence is 1:1,000,000-9:1,000,000. | 600 |
| REN | Renal tubular dysgenesis | NM_000537.3 | NM_000537.3:c.404C>A, NM_000537.3:c.127C>T, NM_000537.3:c.145C>T | Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects. | 600 |
| RGR | Retinitis pigmentosa type 44 | NM_001012720.1 | NM_001012720.1:c.196A>C, NM_001012720.1:c.249_250insGGCTCGGA, NM_001012720.1:c.261_262insGGCTCGGA, NM_001012720.1:c.454C>A, NM_001012720.1:c.865C>T, NM_001012720.1:c.877C>T | Retinitis pigmentosa type 44 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RGR gene located on chromosomal region 10q23.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 250,600 |
| RHO | Retinitis pigmentosa type 4 | NM_000539.3 | NM_000539.3:c.152G>C, NM_000539.3:c.173C>T, NM_000539.3:c.448G>A, NM_000539.3:c.620T>G, NM_000539.3:c.670G>A, NM_000539.3:c.745G>T, NM_000539.3:c.659T>G | Retinitis pigmentosa type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RHO gene located on chromosomal region 3q22.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 250,600 |
| RLBP1 | Retinitis punctata albescens | NM_000326.4 | NM_000326.4:c.333T>G, NM_000326.4:c.452G>A, NM_000326.4:c.700C>T, NM_000326.4:c.875C>T | Retinitis punctata albescens follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RLBP1 gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by night blindness from early childhood, delay in the regeneration of cone and rod photopigments in young adults, followed by macular degeneration and a decrease in visual acuity that led to legal blindness in early adulthood. | 250,600 |
| RP2 | Retinitis pigmentosa type 2 | NM_006915.2 | NM_006915.2:c.235delG, NM_006915.2:c.305_306insT, NM_006915.2:c.352delC, NM_006915.2:c.353G>A, NM_006915.2:c.353G>T, NM_006915.2:c.358C>T, NM_006915.2:c.453C>G, NM_006915.2:c.453delC, NM_006915.2:c.631delC | Retinitis pigmentosa type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the RP2 gene located on chromosomal region Xp11.23. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 600 |
| RPE65 | Leber congenital amaurosis type 2 | NM_000329.2 | NM_000329.2:c.1067delA, NM_000329.2:c.1301C>T, NM_000329.2:c.1292A>G, NM_000329.2:c.272G>A, NM_000329.2:c.907A>T, NM_000329.2:c.514_515delGT | Leber congenital amaurosis 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus. | 250,600 |
| RPE65 | Retinitis pigmentosa type 20 | NM_000329.2 | NM_000329.2:c.1022T>C, NM_000329.2:c.1087C>A, NM_000329.2:c.1102T>C, NM_000329.2:c.271C>T, NM_000329.2:c.1355T>G, NM_000329.2:c.1543C>T, NM_000329.2:c.394G>A, NM_000329.2:c.881A>C | Retinitis pigmentosa type 20 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 250,600 |
| RPGR | Retinitis pigmentosa type 3 | NM_001034853.1 | NM_001034853.1:c.155-2A>G, NM_001034853.1:c.173_174insA, NM_001034853.1:c.179G>T, NM_001034853.1:c.296C>A, NM_001034853.1:c.389T>G, NM_001034853.1:c.505G>T, NM_001034853.1:c.517G>C, NM_001034853.1:c.642_656delTGGAGAACCTGAGAAinsC, NM_001034853.1:c.654_655delGA, NM_001034853.1:c.674_675delCC, NM_001034853.1:c.703C>T, NM_001034853.1:c.806G>A, NM_001034853.1:c.823G>A, NM_001034853.1:c.846_847delAA | Retinitis pigmentosa type 3 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the RPGR gene located on chromosomal region Xp11.4. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 600 |
| RPGRIP1L | Joubert syndrome type 7 | NM_015272.2 | NM_015272.2:c.1177G>A, NM_015272.2:c.1326_1329delAAAA, NM_015272.2:c.1329_1330insA, NM_015272.2:c.1843A>C, NM_015272.2:c.1975T>C, NM_015272.2:c.2030C>T, NM_015272.2:c.2050C>T, NM_015272.2:c.2413C>T, NM_015272.2:c.757C>T, NM_015272.2:c.3548C>G, NM_015272.2:c.697A>T, NM_015272.2:c.3634_3637delGAAA, NM_015272.2:c.776+1G>A, NM_015272.2:c.2794_2795delTT | Joubert syndrome type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. This disease is characterized by cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy and renal disease. | 250,600 |
| RPGRIP1L | Meckel syndrome type 5 | NM_015272.2 | NM_015272.2:c.394A>T, NM_015272.2:c.3706C>T, NM_015272.2:c.2614C>T | Meckel syndrome, type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. This disease is characterized by a combination of renal cysts and variably associated features, including developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and cysts, and polydactyly. The prevalence is <1:1,000,000. | 250,600 |
| RYR1 | Central core disease | NM_000540.2 | NM_000540.2:c.1021G>A, NM_000540.2:c.10343C>T, NM_000540.2:c.10579C>T, NM_000540.2:c.10616G>A, NM_000540.2:c.11798A>G, NM_000540.2:c.1205T>C, NM_000540.2:c.13480G>T, NM_000540.2:c.13513G>C, NM_000540.2:c.14365-2A>T, NM_000540.2:c.14511+1_14511+2delGT, NM_000540.2:c.14545G>A, NM_000540.2:c.1739_1742dupATCA, NM_000540.2:c.1841G>T, NM_000540.2:c.325C>T, NM_000540.2:c.4076delG, NM_000540.2:c.4178A>G, NM_000540.2:c.4405C>T, NM_000540.2:c.487C>T, NM_000540.2:c.5036G>A, NM_000540.2:c.5333C>A, NM_000540.2:c.5726_5727delAG, NM_000540.2:c.6082C>T, NM_000540.2:c.6104A>T, NM_000540.2:c.631+2T>C, NM_000540.2:c.6961A>G, NM_000540.2:c.7025A>G, NM_000540.2:c.7268T>A, NM_000540.2:c.7300G>A, NM_000540.2:c.7360C>T, NM_000540.2:c.7373G>A, NM_000540.2:c.738T>G, NM_000540.2:c.7463_7475delCAAAGATGTCAGC, NM_000540.2:c.9000+1G>T, NM_000540.2:c.14126C>T, NM_000540.2:c.1655G>A, NM_000540.2:c.4729G>A, NM_000540.2:c.7781C>A, NM_000540.2:c.7836-1G>A, NM_000540.2:c.8360C>G, NM_000540.2:c.9868G>A, NM_000540.2:c.9905_9906insC, NM_000540.2:c.1186G>T, NM_000540.2:c.6721C>T | Central core disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RYR1 gene located on chromosomal region 19q13.2. Typical central core disease is a relatively mild congenital myopathy, usually characterized by motor developmental delay and signs of mild proximal weakness most pronounced in the hip girdle musculature. Orthopedic complications, particularly congenital dislocation of the hips and scoliosis, are common, and patients are at risk of having malignant hyperthermia. Onset is usually in childhood, although adult onset has also been reported. | 250,600 |
| SACS | Spastic ataxia, Charlevoix-Saguenay type | NM_014363.5 | NM_014363.5:c.10907G>A, NM_014363.5:c.10954C>A, NM_014363.5:c.11624G>A, NM_014363.5:c.12160C>T, NM_014363.5:c.517C>T, NM_014363.5:c.6355C>T, NM_014363.5:c.6781C>A, NM_014363.5:c.7504C>T, NM_014363.5:c.8107C>T, NM_014363.5:c.8844delT, NM_014363.5:c.994A>T, NM_014363.5:c.13237C>T, NM_014363.5:c.3198T>A, NM_014363.5:c.4933C>T, NM_014363.5:c.5618_5619delAT, NM_014363.5:c.6563T>A | Spastic ataxia, Charlevoix-Saguenay type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SACS gene located on chromosomal region 13q11. The age of onset is early. This disease is characterized by early-onset cerebellar ataxia with spasticity, a pyramidal syndrome and peripheral neuropathy. The prevalence is 1:1,500-1:2,000. | 250,600 |
| SAG | Oguchi disease | NM_000541.4 | NM_000541.4:c.293_294insG, NM_000541.4:c.523C>T, NM_000541.4:c.577C>T, NM_000541.4:c.874C>T, NM_000541.4:c.916G>T, NM_000541.4:c.926delA, NM_000541.4:c.993C>G | Oguchi disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SAG gene located on chromosomal region 2q37. The age of onset is infantile. This disease is characterized by congenital stationary night blindness and the Mizuo-Nakamura phenomenon which is a unique morphological and functional abnormality of the retina that presents with a typical golden-yellow or silver-gray discoloration of the fundus in the presence of light that disappears after dark-adaptation and appears again after the onset of light. | 250,600 |
| SBDS | Shwachman-Diamond syndrome | NM_016038.2 | NM_016038.2:c.120delG, NM_016038.2:c.127G>T, NM_016038.2:c.183_184delTAinsCT, NM_016038.2:c.184A>T, NM_016038.2:c.377G>C, NM_016038.2:c.505C>T, NM_016038.2:c.652C>T, NM_016038.2:c.258+2T>C | Shwachman-Diamond syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBDS gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by chronic and usually mild neutropenia, pancreatic exocrine insufficiency associated with steatorrhea and growth failure, skeletal dysplasia with short stature, and an increased risk of bone marrow aplasia or leukemic transformation, cutaneous (eczema or ichthyosis) and dental anomalies, and psychomotor retardation. The prevalence is 1:76,000 newborn. | 250,600 |
| SBF2 | Charcot-Marie-Tooth disease type 4B2 | NM_030962.3 | NM_030962.3:c.1459C>T, NM_030962.3:c.2875C>T, NM_030962.3:c.3586C>T, NM_030962.3:c.3154A>T, NM_030962.3:c.5539_5540insATCT | Charcot-Marie-Tooth disease, type 4B2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBF2 gene located on chromosomal region 11p15.4. The age of onset is infantile. This disease is characterized by muscle weakness, sensory loss, reduced nerve conduction velocities, characteristic myelin outfoldings and a severe disease course. | 600 |
| SC5D | Lathosterolosis | NM_006918.4 | NM_006918.4:c.86G>A | Lathosterolosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SC5D gene located on chromosomal region 11q23.3. The age of onset is early. This disease is characterized by malformations, intellectual deficit and liver disease. The prevalence is <1:1,000,000. | 600 |
| SCNN1A | Pseudohypoaldosteronism, type 1 | NM_001038.5 | NM_001038.5:c.1305delC, NM_001038.5:c.1482delC, NM_001038.5:c.1522C>T, NM_001038.5:c.1765C>T, NM_001038.5:c.1834C>T, NM_001038.5:c.203_204delTC, NM_001038.5:c.340G>A | Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest. | 600 |
| SCNN1B | Pseudohypoaldosteronism, type 1 | NM_000336.2 | NM_000336.2:c.109G>A | Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest. | 250,600 |
| SCNN1G | Pseudohypoaldosteronism, type 1 | NM_001039.3 | NM_001039.3:c.1373+2T>C, NM_001039.3:c.1570-1G>A, NM_001039.3:c.1627delG, NM_001039.3:c.598_599insA | Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest. | 250,600 |
| SEMA4A | Retinitis pigmentosa type 35 | NM_022367.3 | NM_022367.3:c.1033G>C, NM_022367.3:c.1049T>G | Retinitis pigmentosa type 35 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SEMA4A gene located on chromosomal region 1q22. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. | 600 |
| SEPN1 | Muscular dystrophy, rigid spine, type 1 | NM_020451.2 | NM_020451.2:c.1315C>T, NM_020451.2:c.818G>A, NM_020451.2:c.883G>A, NM_020451.2:c.943G>A, NM_020451.2:c.943G>C, NM_020451.2:c.1384T>G, NM_020451.2:c.713_714insA, NM_020451.2:c.871C>T | Rigid spine syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SEPN1 gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is characterized by contractures of the spinal extensor muscles associated with abnormal posture (limitation of neck and trunk flexure), progressive scoliosis of the spine, early marked cervico-axial muscle weakness with relatively preserved strength and function of the extremities and progressive respiratory insufficiency. The prevalence is 3.5:100,000–5:100,000. | 600 |
| SERPINA1 | Alpha1-antitrypsin deficiency | NM_000295.4 | NM_000295.4:c.1177C>T, NM_000295.4:c.187C>T, NM_000295.4:c.194T>C, NM_000295.4:c.230C>T, NM_000295.4:c.250G>A, NM_000295.4:c.272G>A, NM_000295.4:c.347T>A, NM_000295.4:c.415G>A, NM_000295.4:c.514G>A, NM_000295.4:c.514G>T, NM_000295.4:c.739C>T, NM_000295.4:c.839A>T, NM_000295.4:c.1093G>A, NM_000295.4:c.848A>T | Alpha-1-antitrypsin deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SERPINA1 gene located on chromosomal region 14q32.13. The age of onset is variable. This disease is characterized by emphysema, which becomes evident by the third to fourth decade. A less common manifestation of the deficiency is liver disease, which occurs in children and adults, and may result in cirrhosis and liver failure. Environmental factors, particularly cigarette smoking, greatly increase the risk of emphysema at an earlier age. The prevalence is 1:1,500-1:3,500 in European. | 250,600 |
| SETX | Spinocerebellar ataxia with axonal neuropathy type 2 | NM_015046.5 | NM_015046.5:c.1027G>T, NM_015046.5:c.1166T>C, NM_015046.5:c.1807A>G, NM_015046.5:c.2602C>T, NM_015046.5:c.3880C>T, NM_015046.5:c.4087C>T, NM_015046.5:c.5630delG, NM_015046.5:c.5927T>G, NM_015046.5:c.6848_6851delCAGA, NM_015046.5:c.994C>T, NM_015046.5:c.5308_5311delGAGA, NM_015046.5:c.5549-1G>T, NM_015046.5:c.6834_6839delAACAAA | Spinocerebellar ataxia with axonal neuropathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SETX gene located on chromosomal region 9q34.13. The age of onset is infantile. This disease is characterized by progressive cerebellar ataxia, axonal sensorimotor neuropathy with oculomotor apraxia, fixation instability, extrapyramidal features and an elevated serum alpha-fetoprotein level. The prevalence is 4:100,000-8:100,000. | 250,600 |
| SGCA | Limb-girdle muscular dystrophy type 2D | NM_000023.2 | NM_000023.2:c.101G>A, NM_000023.2:c.229C>T, NM_000023.2:c.371T>C, NM_000023.2:c.518T>C, NM_000023.2:c.574C>T, NM_000023.2:c.850C>T, NM_000023.2:c.662G>A, NM_000023.2:c.739G>A, NM_000023.2:c.904_905insCC | Autosomal recessive limb-girdle muscular dystrophy type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCA gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness and calf pseudohypertrophy. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| SGCB | Muscular dystrophy, limb-girdle, type 2E | NM_000232.4 | NM_000232.4:c.272G>C, NM_000232.4:c.272G>T, NM_000232.4:c.299T>A, NM_000232.4:c.323T>G, NM_000232.4:c.341C>T, NM_000232.4:c.452C>G, NM_000232.4:c.552T>G | Autosomal recessive limb-girdle muscular dystrophy type 2E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCB gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness, particularly of the pelvic girdle muscles. | 600 |
| SGCG | Limb-girdle muscular dystrophy type 2C | NM_000231.2 | NM_000231.2:c.195+4_195+7delAGTA, NM_000231.2:c.505+1G>A, NM_000231.2:c.787G>A, NM_000231.2:c.848G>A, NM_000231.2:c.88delG, NM_000231.2:c.521delT | Autosomal recessive limb-girdle muscular dystrophy type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCG gene located on chromosomal region 13q12.12. The age of onset is variable. This disease is characterized by limb-girdle weakness, calf hypertrophy, diaphragmatic weakness, and variable cardiac abnormalities. | 250,600 |
| SGSH | Mucopolysaccharidosis type 3A (Sanfilippo disease type A) | NM_000199.3 | NM_000199.3:c.1167C>A, NM_000199.3:c.1298G>A, NM_000199.3:c.130G>A, NM_000199.3:c.1339G>A, NM_000199.3:c.1380delT, NM_000199.3:c.197C>G, NM_000199.3:c.220C>T, NM_000199.3:c.235A>C, NM_000199.3:c.320delT, NM_000199.3:c.337_345delinsGCACAGGTGAG, NM_000199.3:c.364G>A, NM_000199.3:c.383C>T, NM_000199.3:c.416C>T, NM_000199.3:c.449G>A, NM_000199.3:c.466A>T, NM_000199.3:c.617G>C, NM_000199.3:c.752G>C, NM_000199.3:c.757delG, NM_000199.3:c.877C>T, NM_000199.3:c.892T>C | Mucopolysaccharidosis type 3A (Sanfilippo syndrome type A) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGSH gene located on chromosomal region 17q25.3. The age of onset is infantile. This disease is characterized by behavioural disorders (hyperkinesia, aggressiveness) and intellectual deterioration, sleep disorders and very mild dysmorphism. The prevalence is >1:70,000 newborn. | 250,600 |
| SH2D1A | Lymphoproliferative syndrome type 1, X-linked | NM_002351.4 | NM_002351.4:c.163C>T, NM_002351.4:c.164G>T, NM_002351.4:c.172C>T, NM_002351.4:c.203C>T, NM_002351.4:c.302C>T, NM_002351.4:c.3G>T, NM_002351.4:c.95G>C | X-linked lymphoproliferative disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the SH2D1A gene located on chromosomal region Xq25. The age of onset is infantile. This disease is characterized by an inadequate immune response to infection with the Epstein-Barr virus: fulminant infectious mononucleosis, macrophage-activation syndrome or hemophagocytic lymphohistiocytosis (HLH) (see these terms), and/or progressive hypogammaglobulinemia and/or lymphomas. The prevalence is 1:1, 000,000 men. | 600 |
| SH3TC2 | Charcot-Marie-Tooth disease type 4C | NM_024577.3 | NM_024577.3:c.1586G>A, NM_024577.3:c.1747_1748delAG, NM_024577.3:c.1969G>A, NM_024577.3:c.1972C>T, NM_024577.3:c.1982T>C, NM_024577.3:c.217_227delGCTGCTCGGAGinsCCAGTAA, NM_024577.3:c.2191delG, NM_024577.3:c.2491_2492delAG, NM_024577.3:c.2710C>T, NM_024577.3:c.2829T>G, NM_024577.3:c.2860C>T, NM_024577.3:c.28delG, NM_024577.3:c.2993_2994insC, NM_024577.3:c.3325C>T, NM_024577.3:c.3326G>C, NM_024577.3:c.3341delC, NM_024577.3:c.3601C>T, NM_024577.3:c.3686A>T, NM_024577.3:c.505T>C, NM_024577.3:c.52+1delG, NM_024577.3:c.530-2A>G, NM_024577.3:c.735G>A, NM_024577.3:c.920G>A, NM_024577.3:c.3676-1G>A, NM_024577.3:c.1724T>A, NM_024577.3:c.53-1G>C | Charcot-Marie-Tooth disease, type 4C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SH3TC2 gene located on chromosomal region 5q32. The age of onset is infantile. This disease is characterized by scoliosis or kyphoscoliosis, neuropathy, foot deformities, respiratory insufficiency, hypoacousis and deafness. | 250,600 |
| SIL1 | Marinesco-Sjögren syndrome | NM_022464.4 | NM_022464.4:c.1312C>T, NM_022464.4:c.274C>T, NM_022464.4:c.331C>T | Marinesco-Sjögren syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SIL1 gene located on chromosomal region 5q31.2. The age of onset is infantile. This disease is characterized by dysarthria, nystagmus, muscle weakness and hypotonia. The prevalence is <1:1,000,000. | 600 |
| SIX6 | Anophthalmia or microphthalmia, isolated | NM_007374.2 | NM_007374.2:c.493A>G, NM_007374.2:c.532_536delAACCG, NM_007374.2:c.635C>T, NM_007374.2:c.725G>T | Anophthalmia or microphthalmia, isolated follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SIX6 gene located on chromosomal region 14q23.1. The age of onset is infantile. A disorder of eye formation, ranging from small size of a single eye to complete bilateral absence of ocular tissues. Ocular abnormalities like opacities of the cornea and lens, scarring of the retina and choroid, and other abnormalities may also be present. | 600 |
| SLC12A1 | Bartter syndrome type 1 | NM_000338.2 | NM_000338.2:c.1875G>A, NM_000338.2:c.1942G>A, NM_000338.2:c.2805_2806insA, NM_000338.2:c.347G>A, NM_000338.2:c.611T>C, NM_000338.2:c.628+2T>C, NM_000338.2:c.814G>T, NM_000338.2:c.223C>T, NM_000338.2:c.2952_2955delCAAA | Bartter syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A1 gene located on chromosomal region 15q15-21. The age of onset is infantile. This disease is characterized by polyhydramnios, premature delivery, polyuria, dehydration, hypercalciuria and nephrocalcinosis. The prevalence is 1:1,000,000. | 250,600 |
| SLC12A6 | Agenesis of the corpus callosum with neuropathy | NM_133647.1 | NM_133647.1:c.1584_1585delCTinsG, NM_133647.1:c.2023C>T, NM_133647.1:c.3031C>T, NM_133647.1:c.619C>T, NM_133647.1:c.316+1G>A, NM_133647.1:c.366T>G | Corpus callosum agenesis with neuronopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A6 gene located on chromosomal region 15q13-q14. The age of onset is early. This disease is characterized by a delay in developmental milestones, a severe sensory-motor polyneuropathy with areflexia, a variable degree of agenesis of the corpus callosum, amyotrophy, hypotonia, and cognitive impairment. The prevalence is 1:2,117. | 600 |
| SLC17A5 | Sialic acid storage disease | NM_012434.4 | NM_012434.4:c.115C>T, NM_012434.4:c.406A>G, NM_012434.4:c.43G>T, NM_012434.4:c.918T>G, NM_012434.4:c.1259+1G>A, NM_012434.4:c.500T>C | Sialic acid storage diseases, follow an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC17A5 gene located on chromosomal region 6q13. The age of onset is from infantile to adult forms. The main symptoms are hypotonia, cerebellar ataxia, and mental retardation; visceromegaly and coarse features are also present in the infantile cases. | 250,600 |
| SLC24A1 | Night blindness, congenital stationary type 1D | NM_004727.2 | NM_004727.2:c.1963C>T | Night blindness, congenital stationary type 1D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC24A1 gene located on chromosomal region 15q22.31. The age of onset is early. This disease is characterized by hemeralopia with a moderate loss of visual acuity. | 250,600 |
| SLC25A13 | Citrullinemia type 2 | NM_014251.2 | NM_014251.2:c.1078C>T, NM_014251.2:c.1177+1G>A, NM_014251.2:c.1311+1G>A, NM_014251.2:c.1592G>A, NM_014251.2:c.1799dupA, NM_014251.2:c.1801G>A, NM_014251.2:c.1801G>T, NM_014251.2:c.1813C>T, NM_014251.2:c.615+1G>C, NM_014251.2:c.615+5G>A, NM_014251.2:c.674C>A, NM_014251.2:c.674C>T, NM_014251.2:c.852_855delTATG, NM_014251.2:c.1231-1G>A, NM_014251.2:c.1411_1412delCT | Citrullinemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A13 gene located on chromosomal region 7q21.3. The age of onset is early. This disease is characterized by hyperammonemia and associated neuropsychiatric symptoms such as nocturnal delirium, confusion, restlessness, disorientation, drowsiness, memory loss, abnormal behavior (aggression, irritability, and hyperactivity), seizures, and coma. The prevalence is 1:17,000-1:230,000. | 600 |
| SLC25A15 | Hyperornithinemia - hyperammonemia - homocitrullinuria syndrome | NM_014252.3 | NM_014252.3:c.110T>G, NM_014252.3:c.212T>A, NM_014252.3:c.535C>T, NM_014252.3:c.538G>A, NM_014252.3:c.562_564delTTC, NM_014252.3:c.569G>A, NM_014252.3:c.658G>A, NM_014252.3:c.815C>T, NM_014252.3:c.824G>A, NM_014252.3:c.44C>T | Hyperornithinemia-hyperammonemia-homocitrullinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A15 gene located on chromosomal region 13q14.11. The age of onset is early. This disease is characterized by coma due to hyperammonemia, convulsions, and hypotonia. The prevalence is 1:5,500. | 600 |
| SLC25A22 | Epileptic encephalopathy, early infantile, type 3 | NM_024698.5 | NM_024698.5:c.617C>T, NM_024698.5:c.706G>T | Early infantile epileptic encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A22 gene located on chromosomal region 11p15.5. The age of onset is early. This disease is characterized by the onset of tonic spasms within the first 3 months of life leading to psychomotor impairment and death. The prevalence is <1:1,000,000. | 600 |
| SLC26A2 | Achondrogenesis type 1B | NM_000112.3 | NM_000112.3:c.1020_1022delTGT, NM_000112.3:c.1273A>G, NM_000112.3:c.532C>T, NM_000112.3:c.2033G>T | Achondrogenesis type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by severe micromelia with very short fingers and toes, a flat face, a short neck, thickened soft tissue around the neck, hypoplasia of the thorax, protuberant abdomen, a hydropic fetal appearance and distinctive histological features of the cartilage. The prevalence is 1:20,000. | 250,600 |
| SLC26A2 | Atelosteogenesis type 2 | NM_000112.3 | NM_000112.3:c.1535C>A, NM_000112.3:c.835C>T | Atelosteogenesis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by limb shortening, normal sized skull with cleft palate, hitchhiker thumbs, distinctive facial dysmorphism and radiographic skeletal features. The prevalence is 1:20,000. | 250,600 |
| SLC26A2 | Diastrophic dysplasia | NM_000112.3 | NM_000112.3:c.1724delA, NM_000112.3:c.1878delG, NM_000112.3:c.1361A>C, NM_000112.3:c.767T>C, NM_000112.3:c.833delC, NM_000112.3:c.496G>A, NM_000112.3:c.1957T>A | Diastrophic dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by short stature with short extremities (final adult height is 120cm), and joint malformations leading to multiple joint contractures (principally involving the shoulders, elbows, interphalangeal joints and hips). The prevalence is 1:20,000. | 250,600 |
| SLC26A4 | Deafness type 4, autosomal recessive | NM_000441.1 | NM_000441.1:c.1001G>T, NM_000441.1:c.1034T>A, NM_000441.1:c.2162C>T, NM_000441.1:c.1975G>C, NM_000441.1:c.1174A>T, NM_000441.1:c.2131G>A, NM_000441.1:c.1454C>T, NM_000441.1:c.1468A>C, NM_000441.1:c.2211G>C, NM_000441.1:c.269C>T, NM_000441.1:c.916dupG, NM_000441.1:c.281C>T, NM_000441.1:c.1634T>G, NM_000441.1:c.1707+5G>A, NM_000441.1:c.1489G>A, NM_000441.1:c.961A>T, NM_000441.1:c.2048T>C, NM_000441.1:c.898A>C, NM_000441.1:c.918+2T>C, NM_000441.1:c.1001+1G>T, NM_000441.1:c.970A>T, NM_000441.1:c.563T>C | Autosomal recessive nonsyndromic sensorineural deafness type DFNB4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| SLC26A4 | Pendred syndrome | NM_000441.1 | NM_000441.1:c.1246A>C, NM_000441.1:c.1826T>G, NM_000441.1:c.1229C>T, NM_000441.1:c.1263+1G>A, NM_000441.1:c.1061T>C, NM_000441.1:c.1790T>C, NM_000441.1:c.2168A>G, NM_000441.1:c.1151A>G, NM_000441.1:c.1226G>A, NM_000441.1:c.1003T>C, NM_000441.1:c.919-2A>G, NM_000441.1:c.554G>C, NM_000441.1:c.626G>T, NM_000441.1:c.1334T>G, NM_000441.1:c.1198delT, NM_000441.1:c.412G>T, NM_000441.1:c.707T>C | Pendred syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. The main presenting clinical sign is prelingual sensorineural deafness, although occasionally the hearing loss develops later in childhood. The degree of hearing loss is variable: it can be mild-to-moderate and progressive in some patients, and severe-to-profound in others. Fluctuations in hearing are also common and may be associated with or preceded by vertigo. The onset and presentation of euthyroid goiter (75%) is highly variable within and between families, with thyroid enlargement usually developing in late childhood or early adulthood. The thyromegaly reflects a defect in iodide transport from the thyrocyte to the colloid, although organification itself is not impaired. Hypothyroidism may develop if nutritional iodide intake is low. | 250,600 |
| SLC26A5 | Deafness type 61, autosomal recessive | NM_198999.2 | NM_198999.2:c.209G>A, NM_198999.2:c.390A>C, NM_198999.2:c.152+1G>A, NM_198999.2:c.1A>G | Autosomal recessive nonsyndromic sensorineural deafness type DFNB16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A5 gene located on chromosomal region 7q22.1. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| SLC35A1 | Congenital disorder of glycosylation type 2F | NM_006416.4 | NM_006416.4:c.277_280delGTGCinsTG | Congenital disorder of glycosylation type 2F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35A1 gene located on chromosomal region 6q15. The age of onset is early. This disease is characterized by repeated hemorrhagic incidents, including severe pulmonary hemorrhage. | 600 |
| SLC35C1 | Congenital disorder of glycosylation 2c | NM_018389.4 | NM_018389.4:c.439C>T, NM_018389.4:c.91G>T, NM_018389.4:c.923C>G, NM_018389.4:c.290dupG, NM_018389.4:c.503_505delTCT | Congenital disorder of glycosylation type 2c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35C1 gene located on chromosomal region 11p11.2. The age of onset is infantile. This disease is characterized by recurrent bacterial infections, severe growth delay and severe intellectual deficit. | 600 |
| SLC35D1 | Schneckenbecken dysplasia | NM_015139.2 | NM_015139.2:c.319C>T, NM_015139.2:c.932G>A | Schneckenbecken dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35D1 gene located on chromosomal region 1p31.3. The age of onset is fetal. This disease is characterized by nail-like configuration of the hypoplastic iliac bone, flattened hypoplastic vertebral bodies, short ribs, short and wide fibulae, short and broad long bones with a dumbbell-like appearance, and precocious ossification of the tarsus. | 600 |
| SLC37A4 | Glycogen storage disease types 1b, 1c and 1d | NM_001164278.1 | NM_001164278.1:c.1042_1043delCT, NM_001164278.1:c.1081G>T, NM_001164278.1:c.1082G>A, NM_001164278.1:c.1108_1109delCT, NM_001164278.1:c.1129G>T, NM_001164278.1:c.1190-2_1190-1delAG, NM_001164278.1:c.1309C>T, NM_001164278.1:c.287G>A, NM_001164278.1:c.352T>C, NM_001164278.1:c.593A>T, NM_001164278.1:c.706_708delGTG, NM_001164278.1:c.83G>A, NM_001164278.1:c.899G>A | Glycogen storage disease due to glucose-6-phosphatase deficiency types 1b, 1c and 1d follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC37A4 gene located on chromosomal region 11q23. The age of onset is early. This disease is characterized by impairment of terminal steps of glycogenolysis and gluconeogenesis. Patients manifest a wide range of clinical symptoms and biochemical abnormalities, including hypoglycemia, severe hepatomegaly due to excessive accumulation of glycogen, kidney enlargement, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. Glycogen storage disease type 1B patients also present a tendency towards infections associated with neutropenia, relapsing aphthous gingivostomatitis, and inflammatory bowel disease. The incidence is 1:100,000. | 250,600 |
| SLC45A2 | Albinism, oculocutaneous, type 4 | NM_016180.3 | NM_016180.3:c.1121delT, NM_016180.3:c.469G>A, NM_016180.3:c.986delC | Oculocutaneous albinism type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC45A2 gene located on chromosomal region 5p13.2. The age of onset is early. This disease is characterized by skin and hair hypopigmentation, numerous ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1:100.000. | 600 |
| SLC4A11 | Congenital hereditary endothelial dystrophy type 2 | NM_032034.3 | NM_032034.3:c.1038_1039insA, NM_032034.3:c.1391G>A, NM_032034.3:c.2318C>T, NM_032034.3:c.1466C>T, NM_032034.3:c.1813C>T, NM_032034.3:c.2264G>A, NM_032034.3:c.2605C>T, NM_032034.3:c.2399C>T, NM_032034.3:c.554_561delGCTTCGCC, NM_032034.3:c.2606G>A | Congenital hereditary endothelial dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by a diffuse ground-glass appearance of the corneas and marked corneal thickening from birth with nystagmus, and blurred vision. | 250,600 |
| SLC4A11 | Corneal dystrophy and perceptive deafness | NM_032034.3 | NM_032034.3:c.2528T>C, NM_032034.3:c.1463G>A, NM_032034.3:c.473_480delGCTTCGCC, NM_032034.3:c.2566A>G, NM_032034.3:c.637T>C, NM_032034.3:c.625C>T, NM_032034.3:c.2224G>A, NM_032034.3:c.2240_2240+1insTATGACAC | Corneal dystrophy - perceptive deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by the association of congenital hereditary endothelial dystrophy with progressive, postlingual sensorineural hearing loss. | 250,600 |
| SLC6A8 | Cerebral creatine deficiency syndrome type 1 | NM_005629.3 | NM_005629.3:c.1011C>G, NM_005629.3:c.1141G>C, NM_005629.3:c.1222_1224delTTC, NM_005629.3:c.1540C>T, NM_005629.3:c.321_323delCTT, NM_005629.3:c.395G>T | X-linked creatine transporter deficiency follows an X-linked pattern of inheritance and is caused by pathogenic variants in the SLC6A8 gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by intellectual deficit, seizures, severe speech delay and sometimes midface hypoplasia, microcephaly, long, thin face, and prominent chin in the cases of affected male patients reported to date. The prevalence is 11:1,000. | 600 |
| SLX4 | Fanconi anemia, complementation group P | NM_032444.2 | NM_032444.2:c.1093delC, NM_032444.2:c.286delA, NM_032444.2:c.4921_4922insG, NM_032444.2:c.5097_5098delTC, NM_032444.2:c.5408_5409insAC, NM_032444.2:c.4739+1G>T, NM_032444.2:c.2808_2809delAG | Fanconi anemia complementation group P follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLX4 gene located on chromosomal region 16p13.3. The age of onset is early. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:160,000. | 250,600 |
| SMN1 | Spinal muscular atrophy | - | del ex7, del ex7-8, del ex8 (Detection by MLPA) | Spinal muscular atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMN1 gene located on chromosomal region 5q13.2. The age of onset is variable. This disease comprise a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. Autosomal recessive forms are classified according to the age of onset, the maximum muscular activity achieved, and survivorship. The severity of the disease is mainly determined by the copy number of SMN2, a copy gene which predominantly produces exon 7-skipped transcripts and only low amount of full-length transcripts that encode for a protein identical to SMN1. Only about 4% of patients bear one SMN1 copy with an intragenic mutation. Type 1 is a severe form, with onset before 6 months of age. Patients never achieve the ability to sit. Type 2 has intermediate severity, with onset between 6 and 18 months. Patients do not reach the motor milestone of standing, and survive into adulthood. Type 3 onset is after 18 months. Patients develop ability to stand and walk and survive into adulthood. Type 4 onset is in adulthood, disease progression is slow, and patients can stand and walk. The incidence is 1:10,000 and the prevalence is 1:80,000. | 250,600 |
| SMPD1 | Niemann-Pick disease | NM_000543.4 | NM_000543.4:c.103_118delCTGGTGCTGGCGCTGG, NM_000543.4:c.103_119delCTGGTGCTGGCGCTGGC, NM_000543.4:c.103_107delCTGGT, NM_000543.4:c.103_113delCTGGTGCTGGCGinsCTGGTG, NM_000543.4:c.1092-1G>C, NM_000543.4:c.1117C>T, NM_000543.4:c.106delG, NM_000543.4:c.108_124delGCTGGCGCTGGCGCTGGC, NM_000543.4:c.1267C>T, NM_000543.4:c.1299T>G, NM_000543.4:c.1327C>T, NM_000543.4:c.1420_1421delCT, NM_000543.4:c.1426C>T, NM_000543.4:c.1624C>T, NM_000543.4:c.1630delA, NM_000543.4:c.1805G>A, NM_000543.4:c.354delC, NM_000543.4:c.475T>C, NM_000543.4:c.551C>T, NM_000543.4:c.557C>T, NM_000543.4:c.558_559insC, NM_000543.4:c.558_574delGCCCCCCAAACCCCCTA, NM_000543.4:c.564delC, NM_000543.4:c.573delT, NM_000543.4:c.689G>A, NM_000543.4:c.730G>A, NM_000543.4:c.739G>A, NM_000543.4:c.740delG, NM_000543.4:c.742G>A, NM_000543.4:c.757G>C, NM_000543.4:c.785_807delTGTTGAGTGGGCTGGGCCCAGCC, NM_000543.4:c.788T>A, NM_000543.4:c.842_849dupTCCCCGCA, NM_000543.4:c.911T>C, NM_000543.4:c.940G>A, NM_000543.4:c.96G>A, NM_000543.4:c.996delC, NM_000543.4:c.688C>T, NM_000543.4:c.995C>G, NM_000543.4:c.1829_1831delGCC, NM_000543.4:c.1264-1G>T, NM_000543.4:c.1152G>A | Niemann-Pick disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMPD1 gene located on chromosomal region 11p15.4. The clinical phenotype ranges from a severe infantile form with neurologic degeneration resulting in death usually by 3 years of age (type A) to a later-onset nonneurologic form (type B) that is compatible with survival into adulthood. | 250,600 |
| SNAI2 | Waardenburg syndrome type 2 | NM_003068.4 | NM_003068.4:c.357C>A | Waardenburg syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SNAI2 gene located on chromosome 8q11.21. The age of onset is early. This disease is characterized by pigmentary abnormalities of the hair, skin, and eyes, congenital sensorineural hearing loss and the lateral displacement of the inner canthus of each eye. The prevalence is 1:100,000-9:100,000. | 600 |
| SNAP29 | Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome | NM_004782.3 | NM_004782.3:c.487dupA | Cerebral dysgenesis-neuropathy-ichthyosis-palmoplantar keratoderma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SNAP29 gene located on chromosomal region 22q11.2. The age of onset is early. This disease is characterized by severe developmental abnormalities of the nervous system and aberrant differentiation of the epidermis. The prevalence is <1:1,000,000. | 600 |
| SPG11 | Spastic paraplegia type 11 | NM_025137.3 | NM_025137.3:c.118C>T, NM_025137.3:c.529_533delATATT, NM_025137.3:c.5623C>T, NM_025137.3:c.1339_1342dupGGCT, NM_025137.3:c.342delT, NM_025137.3:c.7152-1G>C, NM_025137.3:c.733_734delAT, NM_025137.3:c.6805_6806delCT, NM_025137.3:c.1736-1G>C, NM_025137.3:c.6100C>T, NM_025137.3:c.6848_6849insTC | Spastic paraplegia type 11 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG11 gene located on chromosomal region 13q13.3. The age of onset is infantile. This disease is characterized by progressive spasticity and weakness of the lower limbs frequently associated with the following: mild intellectual disability with learning difficulties in childhood and/or progressive cognitive decline; peripheral neuropathy; pseudobulbar involvement; and increased reflexes in the upper limbs. The prevalence is 5:100.000. | 250,600 |
| SPG20 | Spastic paraplegia type 20, autosomal recessive | NM_015087.4 | NM_015087.4:c.1110delA, NM_015087.4:c.364_365delAT | Autosomal recessive spastic paraplegia type 20 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG20 gene located on chromosomal region 13q13.3. The age of onset is infantile. This disease is characterized by progressive spastic paraparesis, dysarthria, and pseudobulbar palsy; distal amyotrophy; motor and cognitive delays; short stature; and subtle skeletal abnormalities. | 600 |
| SPG7 | Spastic paraplegia type 7 | NM_003119.3 | NM_003119.3:c.1457G>A, NM_003119.3:c.1529C>T, NM_003119.3:c.2075G>C, NM_003119.3:c.233T>A, NM_003119.3:c.1676delA, NM_003119.3:c.1749G>C, NM_003119.3:c.773_774delTG, NM_003119.3:c.1045G>A, NM_003119.3:c.1124delG, NM_003119.3:c.679C>T, NM_003119.3:c.758+2T>C, NM_003119.3:c.286+1G>T | Spastic paraplegia type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG7 gene located on chromosomal region 16q24.3. The age of onset is adult. This disease is characterized by insidiously progressive bilateral lower limb weakness and spasticity. The prevalence is 1:100,000-9:100,000. | 250,600 |
| STAR | Lipoid adrenal hyperplasia | NM_000349.2 | NM_000349.2:c.545G>T, NM_000349.2:c.559G>A, NM_000349.2:c.545G>A, NM_000349.2:c.749G>A, NM_000349.2:c.772C>T, NM_000349.2:c.562C>T, NM_000349.2:c.577C>T | Congenital lipoid adrenal hyperplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STAR gene located on chromosomal region 8p11.23. The age of onset is early. This disease is characterized by severe adrenal insufficiency and sex reversal in males. The prevalence is 1:300,000. | 600 |
| STIL | Microcephaly primary, type 7, autosomal recessive | NM_003035.2 | NM_003035.2:c.3655delG, NM_003035.2:c.3715C>T, NM_003035.2:c.3843_3846delACAG, NM_003035.2:c.2392T>G, NM_003035.2:c.2826+1G>A | Autosomal recessive primary microcephaly type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STIL gene located on chromosomal region 1p33. The age of onset is early. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. The incidence is 1:1,000,000. | 600 |
| STRA6 | Syndromic microphthalmia type 9 | NM_022369.3 | NM_022369.3:c.1678G>C, NM_022369.3:c.1699C>T, NM_022369.3:c.147delC, NM_022369.3:c.1521-1G>A, NM_022369.3:c.1964G>A, NM_022369.3:c.277_278insCC, NM_022369.3:c.1931C>T, NM_022369.3:c.1963C>T, NM_022369.3:c.69G>A, NM_022369.3:c.878C>T, NM_022369.3:c.910_911delGGinsAA, NM_022369.3:c.52_53delTAinsC, NM_022369.3:c.527_528insG | Syndromic microphthalmia type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRA6 gene located on chromosomal region 15q24.1. The age of onset is early. This disease is characterized by anophthalmia or severe microphthalmia, and pulmonary hypoplasia or aplasia. The prevalence is 1:10,000. | 600 |
| STRC | Deafness type 16, autosomal recessive | NM_153700.2 | NM_153700.2:c.4561_4562insC, NM_153700.2:c.5188C>T, NM_153700.2:c.3556C>T, NM_153700.2:c.5168_5171delTTCT, NM_153700.2:c.5185C>T, NM_153700.2:c.4545+1G>C | Autosomal recessive nonsyndromic sensorineural deafness type DFNB16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRC gene located on chromosomal region 15q15.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| SUCLG1 | Fatal infantile lactic acidosis with methylmalonic aciduria | NM_003849.3 | NM_003849.3:c.152_153delAT, NM_003849.3:c.626C>A | Fatal infantile lactic acidosis with methylmalonic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SUCLG1 gene located on chromosomal region 2p11.2. The age of onset is early. This disease is characterized by polypnea, severe hypotonia, lethargy, and vomiting, after a silent period during which the children were considered as normal. Facial dysmorphism and cerebral malformations may be noted, as well as diverse organ involvement such as hypertrophic myocardiopathy, tubulopathy, or liver insufficiency. | 600 |
| SUOX | Sulfocysteinuria | NM_000456.2 | NM_000456.2:c.37C>T, NM_000456.2:c.894_895delCT, NM_000456.2:c.650G>A, NM_000456.2:c.794C>A | Sulfocysteinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SUOX gene located on chromosome 12q13.13. The age of onset is early. This disease is characterized by seizures, reduced muscle tone, psychomotor retardation, lens dislocation. | 600 |
| TAF1 | Dystonia-Parkinsonism, X-linked | NM_004606.4 | NM_004606.4:c.417_418insCATAATCTATGATAATGATAAT | X-linked dystonia-parkinsonism follows an X-linked pattern of inheritance and is caused by pathogenic variants in the TAF1 gene located on chromosomal region Xq13.1. The age of onset is adult. This disease is characterized by adult-onset Parkinsonism that is frequently accompanied by focal dystonia, which becomes generalized over time, and that has a highly variable clinical course. The prevalence is 1:300,000. | 600 |
| TAT | Tyrosinemia type 2 | NM_000353.2 | NM_000353.2:c.1249C>T, NM_000353.2:c.236-5A>G, NM_000353.2:c.668C>G, NM_000353.2:c.1297C>T, NM_000353.2:c.169C>T | Tyrosinemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TAT gene located on chromosomal region 16q22.1. The age of onset is early. This disease is characterized by hypertyrosinemia with oculocutaneous manifestations and, in some cases, intellectual deficit. The prevalence is 1:100,000-1:120,000 newborn. | 600 |
| TBCE | Hypoparathyroidism-retardation-dysmorphism syndrome | NM_003193.4 | NM_003193.4:c.1491_1492insGTAAA | Hypoparathyroidism - retardation - dysmorphism syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TBCE gene located on chromosomal region 1q42.3. The age of onset is early. This disease is characterized by congenital hypoparathyroidism, growth retardation, intellectual deficit, seizures, and dysmorphic features including microcephaly, facial, ocular and dental abnormalities, and short hands and feet. | 600 |
| TCAP | Cardiomyopathy, hypertrophic, type 25 | NM_003673.3 | NM_003673.3:c.260G>A, NM_003673.3:c.316C>T | Cardiomyopathy, hypertrophic, type 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by dyspnea, syncope, collapse, palpitations, and chest pain. They can be readily provoked by exercise. The disorder has inter- and intrafamilial variability ranging from benign to malignant forms with high risk of cardiac failure and sudden cardiac death. | 250,600 |
| TCAP | Limb-girdle muscular dystrophy type 2G | NM_003673.3 | NM_003673.3:c.157C>T | Autosomal recessive limb-girdle muscular dystrophy type 2G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by muscle weakness in the four limbs, mild scapular winging, severe atrophy of the quadriceps and anterior tibialis muscles, calf hypertrophy, and lack of respiratory and cardiac involvement. | 250,600 |
| TCIRG1 | Osteopetrosis type 1, autosomal recessive | NM_006019.3 | NM_006019.3:c.1331G>T, NM_006019.3:c.1674-1G>A, NM_006019.3:c.179A>G, NM_006019.3:c.2236+1G>A, NM_006019.3:c.2415-3C>G, NM_006019.3:c.112_113delAG, NM_006019.3:c.1213G>A | Autosomal recessive osteopetrosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCIRG1 gene located on chromosomal region 11q13.2. The age of onset is early. This disease is characterized by bone marrow failure, fractures and visual impairment. The incidence is 1:200.000 live births and the prevalence is 1:250,000. | 250,600 |
| TECTA | Deafness type 21, autosomal recessive | NM_005422.2 | NM_005422.2:c.2428C>T, NM_005422.2:c.2941+1G>A, NM_005422.2:c.651_652insC, NM_005422.2:c.4370_4371insTCAGTGCGACCCGC, NM_005422.2:c.4601G>A | Autosomal recessive nonsyndromic sensorineural deafness type DFNB21 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TECTA gene located on chromosomal region 11q23.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| TERT | Dyskeratosis congenita, autosomal recessive | NM_198253.2 | NM_198253.2:c.1234C>T, NM_198253.2:c.835G>A, NM_198253.2:c.2701C>T, NM_198253.2:c.2431C>T | Dyskeratosis congenita, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TERT gene located on chromosomal region 5p15.33. The age of onset is early. This disease has a wide phenotypic spectrum and age onset. It usually manifests during childhood with the triad of dysplastic nails, lacy reticular pigmentation and atrophy of the skin at the level of the neck and upper chest, and oral leukoplakia. Patients show an increased risk for progressive bone marrow failure and may develop myelodysplastic syndrome or acute myelogenous leukemia at any age (the risk increasing with age). There is also an increased risk for solid tumors, typically squamous cell carcinoma of head and neck (see this term) or anogenital cancer. Various additional clinical findings have been reported and may include: developmental delay, short stature, microcephaly, blepharitis, epiphora, periodontal disease, taurodontism, decreased teeth/root ratio, esophageal stenosis, liver disease, urethral stenosis, osteoporosis, avascular necrosis of femur and/or humerus, premature hair greying/alopecia, or abnormal eyelashes. Individuals with DC are at high risk of pulmonary fibrosis. The prevalence is 1:1.000.000. | 250,600 |
| TFR2 | Hemochromatosis, type 3 | NM_003227.3 | NM_003227.3:c.1330G>A, NM_003227.3:c.1403G>A, NM_003227.3:c.1469T>G, NM_003227.3:c.1235_1237delACA, NM_003227.3:c.1861_1872delGCCGTGGCCCAG, NM_003227.3:c.2343G>A, NM_003227.3:c.313C>T, NM_003227.3:c.1665delC, NM_003227.3:c.750C>G, NM_003227.3:c.840C>G, NM_003227.3:c.949C>T, NM_003227.3:c.515T>A, NM_003227.3:c.1632_1633delGA, NM_003227.3:c.2014C>T, NM_003227.3:c.2374G>A, NM_003227.3:c.1473+1G>A, NM_003227.3:c.1186C>T | Hemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000. | 250,600 |
| TH | Segawa syndrome, autosomal recessive | NM_000360.3 | NM_000360.3:c.1141C>A, NM_000360.3:c.614T>C, NM_000360.3:c.733A>C, NM_000360.3:c.1388C>T, NM_000360.3:c.605G>A, NM_000360.3:c.917G>A | Segawa syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TH gene located on chromosomal region 11p15.5. This disease is characterized by dystonia presenting in infancy or early childhood. Dystonia is defined by the presence of sustained involuntary muscle contractions, often leading to abnormal postures. Some cases present with parkinsonian symptoms in infancy. Unlike all other forms of dystonia, it is an eminently treatable condition, due to a favorable response to L-DOPA. The prevalence is 1:1,000,000-9:1,000,000. | 600 |
| TIMM8A | Mohr-Tranebjaerg syndrome | NM_004085.3 | NM_004085.3:c.198C>G, NM_004085.3:c.238C>T, NM_004085.3:c.112C>T | Mohr-Tranebjaerg syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the TIMM8A gene located on chromosomal region Xq22. The age of onset is infantile. This disease is characterized by hearing loss, followed by adolescent onset progressive dystonia or ataxia, visual impairment from early adulthood onwards and dementia from the 4th decade onwards. The prevalence is <1:1,000,000. | 600 |
| TK2 | Mitochondrial DNA depletion syndrome type 2 | NM_004614.4 | NM_004614.4:c.323C>T, NM_004614.4:c.361C>A, NM_004614.4:c.373C>T, NM_004614.4:c.500G>A, NM_004614.4:c.604_606delAAG, NM_004614.4:c.635T>A, NM_004614.4:c.623A>G, NM_004614.4:c.159C>G, NM_004614.4:c.268C>T | Mitochondrial DNA depletion syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TK2 gene located on chromosomal region 16q21. The age of onset is infantile. This disease is characterized by generalized hypotonia, proximal muscle weakness, loss of previously acquired motor skills, poor feeding, and respiratory difficulties leading to respiratory failure and death within a few years after diagnosis. The prevalence is 1.2:100,000. | 250,600 |
| TMC1 | Deafness type 7, autosomal recessive | NM_138691.2 | NM_138691.2:c.1763+3A>G, NM_138691.2:c.1842G>A, NM_138691.2:c.100C>T, NM_138691.2:c.1165C>T, NM_138691.2:c.425G>A, NM_138691.2:c.454-1G>C, NM_138691.2:c.1960A>G | Autosomal recessive nonsyndromic sensorineural deafness type DFNB7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMC1 gene located on chromosomal region 9q21.13. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| TMEM216 | Joubert syndrome type 2 | NM_001173990.2 | NM_001173990.2:c.218G>T, NM_001173990.2:c.218G>A, NM_001173990.2:c.79_82delAACG | Joubert syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM216 gene located on chromosomal region 11q12.2. The age of onset is early. This disease is characterized by the neurological features associated with both renal and ocular disease; retinal involvement (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:80,000-1:100,000. | 600 |
| TMEM216 | Meckel syndrome type 2 | NM_001173990.2 | NM_001173990.2:c.230G>C, NM_001173990.2:c.253C>T, NM_001173990.2:c.341T>G | Meckel syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM216 gene located on chromosomal region 11q12.2. The age of onset is antenatal. It is a disorder characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically encephalocele), hepatic ductal dysplasia and cysts, and polydactyly. The prevalence is 1:80,000-1:100,000. | 600 |
| TMEM67 | COACH syndrome | NM_153704.5 | NM_153704.5:c.1769T>C, NM_153704.5:c.2498T>C | COACH syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is variable. This disease is characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable. | 250,600 |
| TMEM67 | Joubert syndrome type 6 | NM_153704.5 | NM_153704.5:c.130C>T, NM_153704.5:c.148_149insTAAT, NM_153704.5:c.1538A>G | Joubert syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is infantile. This disease is characterized by an irregular breathing pattern (episodic tachypnea and/or apnea), and nystagmus. During infancy, hypotonia may appear. Cerebellar ataxia (staggering gait and imbalance) may develop later. Delayed acquisition of motor milestones is common. Cognitive abilities are variable, ranging from severe intellectual deficit to normal intelligence. Neuro-ophthalmologic examination may show oculomotor apraxia. In some cases, seizures occur. Careful examination of the face shows a characteristic appearance: large head, prominent forehead, high rounded eyebrows, epicanthal folds, ptosis (occasionally), an upturned nose with prominent nostrils, an open mouth (which tends to have an oval shape early on, a 'rhomboid' appearance later, and finally can appear triangular with downturned angles), tongue protrusion and rhythmic tongue motions, and occasionally low-set and tilted ears. Other features sometimes present in Joubert syndrome include retinal dystrophy, nephronophthisis, and polydactyly. The prevalence is 1:80,000-1:100,000. | 250,600 |
| TMEM67 | Meckel syndrome type 3 | NM_153704.5 | NM_153704.5:c.1309C>G, NM_153704.5:c.755T>C, NM_153704.5:c.1046T>C, NM_153704.5:c.653G>C, NM_153704.5:c.406+1402_406+1403insTAAT, NM_153704.5:c.622A>T | Meckel syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is variable. This disease is characterized multiple congenital anomaly disorder characterized by the triad of brain malformation mainly occipital encephalocele (see this term), large polycystic kidneys, and polydactyly as well as associated abnormalities that may include cleft lip/palate (see these terms), cardiac and genital anomalies, central nervous system (CNS) malformations, liver fibrosis, and bone dysplasia. | 250,600 |
| TMIE | Deafness type 6, autosomal recessive | NM_147196.2 | NM_147196.2:c.241C>T, NM_147196.2:c.250C>T, NM_147196.2:c.170G>A, NM_147196.2:c.257G>A | Autosomal recessive nonsyndromic sensorineural deafness type DFNB6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMIE gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness. | 600 |
| TMPRSS3 | Deafness types 8/10, autosomal recessive | NM_024022.2 | NM_024022.2:c.1211C>T, NM_024022.2:c.1276G>A, NM_024022.2:c.1159G>A, NM_024022.2:c.413C>A, NM_024022.2:c.446+1G>T, NM_024022.2:c.647G>T, NM_024022.2:c.753G>C, NM_024022.2:c.646C>T, NM_024022.2:c.208delC, NM_024022.2:c.242C>G | Autosomal recessive nonsyndromic sensorineural deafness type DFNB10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMPRSS3 gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness. | 250,600 |
| TNNT1 | Nemaline myopathy type 5 | NM_003283.5 | NM_003283.5:c.538G>T | Nemaline myopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TNNT1 gene located on chromosomal region 19q13.4. The age of onset is from birth to adulthood. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:50,000 newborn. | 600 |
| TPP1 | Neuronal ceroid-lipofuscinoses type 2 | NM_000391.3 | NM_000391.3:c.1093T>C, NM_000391.3:c.616C>T, NM_000391.3:c.622C>T, NM_000391.3:c.1340G>A, NM_000391.3:c.141_144delGAGT, NM_000391.3:c.827A>T, NM_000391.3:c.509-1G>C, NM_000391.3:c.851G>T | Neuronal ceroid lipofuscinosis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPP1 gene located on chromosomal region 11p15.4. Age of onset is infantile. This disease is characterized by epilepsy, followed by regression of developmental milestones, myoclonic ataxia, and pyramidal signs. Visual impairment typically appears at age four to six years and rapidly progresses to light/dark awareness only. Life expectancy ranges from age six years to early teenage. The prevalence is 1.5:1,000,000-9:1,000,000. | 250,600 |
| TPRN | Deafness type 79, autosomal recessive | NM_001128228.2 | NM_001128228.2:c.1427delC, NM_001128228.2:c.1239G>A | Autosomal recessive nonsyndromic sensorineural deafness type DFNB79 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPRN gene located on chromosomal region 9q34.3. The age of onset is early. This disease is characterized by hearing loss and deafness. | 600 |
| TREX1 | Aicardi-Goutieres syndrome type 1 | NM_033629.4 | NM_033629.4:c.341G>A, NM_033629.4:c.144_145insC, NM_033629.4:c.490C>T, NM_033629.4:c.506G>A | Aicardi-Goutières syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TREX1 gene located on chromosomal region 3p21.31. The age of onset is early. This disease is characterized by subacute encephalopathy (feeding problems, irritability and psychomotor regression or delay) associated with epilepsy (53% of cases), chilblain skin lesions on the extremities (43% of cases) and episodes of aseptic febrile illness (40% of cases). The prevalence is <1:1,000,000. | 600 |
| TRIM32 | Limb-girdle muscular dystrophy type 2H | NM_012210.3 | NM_012210.3:c.1459G>A, NM_012210.3:c.1560delC | Autosomal recessive limb-girdle muscular dystrophy type 2H follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIM32 gene located on chromosomal region 9q31-q33. The age of onset is variable. This disease is characterized by proximal muscle weakness and facial muscle wasting. | 600 |
| TRIM37 | Mulibrey nanism | NM_015294.3 | NM_015294.3:c.1346_1347insA, NM_015294.3:c.1411C>T, NM_015294.3:c.1037_1040dupAGAT, NM_015294.3:c.2056C>T, NM_015294.3:c.2212delG, NM_015294.3:c.227T>C, NM_015294.3:c.326G>C, NM_015294.3:c.496_500delAGGAA, NM_015294.3:c.745C>T, NM_015294.3:c.965G>T, NM_015294.3:c.1478_1479delAG, NM_015294.3:c.1668-1G>C | Mulibrey nanism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIM37 gene located on chromosomal region 17q22. The age of onset is prenatal. This disease is characterized by pre- and postnatal growth restriction, characteristic craniofacial features with scaphocephaly, triangular face, high and broad forehead, low nasal bridge and yellowish dots in retinal mid peripheral region. The prevalence is <1:1,000,000. | 600 |
| TRIOBP | Deafness type 28, autosomal recessive | NM_001039141.2 | NM_001039141.2:c.2362C>T, NM_001039141.2:c.3194delT, NM_001039141.2:c.1039C>T, NM_001039141.2:c.1741C>T, NM_001039141.2:c.4577C>G, NM_001039141.2:c.2639_2640insTCAC, NM_001039141.2:c.5316G>A, NM_001039141.2:c.3202C>T, NM_001039141.2:c.4429_4430insG | Deafness autosomal recessive type 28 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIOBP gene located on chromosomal region 22q13.1. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| TSEN54 | Pontocerebellar hypoplasia | NM_207346.2 | NM_207346.2:c.670_671delAA, NM_207346.2:c.736C>T, NM_207346.2:c.1027C>T, NM_207346.2:c.1039A>T, NM_207346.2:c.887G>A, NM_207346.2:c.919G>T | Pontocerebellar hypoplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSEN54 gene located on chromosomal region 17q25.1. Pontocerebellar hypoplasia (PCH) refers to a group of severe neurodegenerative disorders affecting growth and function of the brainstem and cerebellum, resulting in little or no development. Different types were classified based on the clinical picture and the spectrum of pathologic changes. | 250,600 |
| TSFM | Combined oxidative phosphorylation deficiency type 3 | NM_001172696.1 | NM_001172696.1:c.1_2delAT, NM_001172696.1:c.580delC, NM_001172696.1:c.919C>T, NM_001172696.1:c.21_22delGC | Combined oxidative phosphorylation deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSFM gene located on chromosomal region 12q14.1. The age of onset is early. This disease is characterized by hypotonia, lactic acidosis, and hepatic insufficiency, with progressive encephalomyopathy or hypertrophic cardiomyopathy. | 250,600 |
| TSHB | Isolated thyroid-stimulating hormone deficiency | NM_000549.4 | NM_000549.4:c.94G>T, NM_000549.4:c.205C>T, NM_000549.4:c.145G>A | Isolated thyroid-stimulating hormone deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSHB gene located on chromosomal region 1p13. The age of onset is early. This disease is characterized by decreased activity and increased sleep, feeding difficulty and constipation, prolonged jaundice, myxedematous facies, large fontanels (especially posterior), macroglossia, a distended abdomen with umbilical hernia and hypotonia. Slow linear growth and developmental delay are usually apparent by 4-6 months of age. | 600 |
| TSHR | Hypothyroidism | NM_000369.2 | NM_000369.2:c.100G>A, NM_000369.2:c.1170T>G, NM_000369.2:c.484C>G, NM_000369.2:c.500T>A, NM_000369.2:c.122G>C, NM_000369.2:c.326G>A, NM_000369.2:c.1741_1742insC, NM_000369.2:c.202C>T | Hypothyroidism due to TSH receptor mutations follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSHR gene located on chromosomal region 14q31. The age of onset is early. This disease is characterized by decreased activity and increased sleep, feeding difficulty and constipation, prolonged jaundice, myxedematous facies, large fontanels (especially posterior), macroglossia, a distended abdomen with umbilical hernia, and hypotonia. Slow linear growth and developmental delay are usually apparent by 4-6 months of age. Without treatment CH results in severe intellectual deficit and short stature. The prevalence is 1:3,000-1:4,000 newborn. | 250,600 |
| TTN | Cardiomyopathy, dilated/Tibial muscular dystrophy | NM_133378.4 | NM_133378.4:c.13149C>A, NM_133378.4:c.22246G>A, NM_133378.4:c.31780G>A, NM_133378.4:c.40211dupT, NM_133378.4:c.44668delG, NM_133378.4:c.52977dupT, NM_133378.4:c.61640C>G, NM_133378.4:c.84669_84675delTGAATTC, NM_133378.4:c.94567C>T, NM_133378.4:c.96388C>T, NM_133378.4:c.96388delC, NM_133378.4:c.98366_98367delAT, NM_133378.4:c.12064C>T, NM_133378.4:c.28739-1G>A, NM_133378.4:c.3165-1G>T, NM_133378.4:c.4724_4728delTGAAA, NM_133378.4:c.48944-1G>A, NM_133378.4:c.91114_91117delTCCA, NM_133378.4:c.100185delA, NM_133378.4:c.40549delA, NM_133378.4:c.24568_24571delAGCA | Cardiomyopathy, dilated/Tibial muscular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTN gene located on chromosomal region 2q31.2. The age of onset is variable. This disease is characterized by slowly progressive weakness and atrophy of the anterior tibial muscles with decreased dorsiflexion. Sometimes it could be companied by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death. The prevalence is >9:100,000. | 250,600 |
| TTPA | Ataxia with vitamin E deficiency | NM_000370.3 | NM_000370.3:c.661C>T, NM_000370.3:c.744delA, NM_000370.3:c.575G>A | Ataxia with vitamin E deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTPA gene located on chromosomal region 8q13. The age of onset is variable. This disease is characterized by progressive spino-cerebellar ataxia, loss of proprioception, areflexia, and is associated with a marked deficiency in vitamin E. The prevalence is 0.56:1,000,000-3.5:1,000,000. | 250,600 |
| TULP1 | Leber congenital amaurosis type 15 | NM_003322.4 | NM_003322.4:c.1198C>T, NM_003322.4:c.1204G>T | Leber congenital amaurosis 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TULP1 gene located on chromosomal region 6p21.31. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. | 600 |
| TULP1 | Retinitis pigmentosa type 14 | NM_003322.4 | NM_003322.4:c.1259G>C, NM_003322.4:c.1318C>T, NM_003322.4:c.1471T>C, NM_003322.4:c.1511_1521delTGCAGTTCGGC, NM_003322.4:c.1376T>A, NM_003322.4:c.1444C>T | Retinitis pigmentosa type 14 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TULP1 gene located on chromosomal region 6p21.31. The age of onset is early. This disease is characterized by night blindness often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1/4,000. | 600 |
| TYR | Oculocutaneous albinism type 1 | NM_000372.4 | NM_000372.4:c.1012_1013insC, NM_000372.4:c.1146C>A, NM_000372.4:c.1164delT, NM_000372.4:c.1177delG, NM_000372.4:c.1147G>A, NM_000372.4:c.115T>G, NM_000372.4:c.1255G>A, NM_000372.4:c.1265G>A, NM_000372.4:c.1209G>T, NM_000372.4:c.1217C>T, NM_000372.4:c.140G>A, NM_000372.4:c.1467dupT, NM_000372.4:c.1501dupC, NM_000372.4:c.164G>A, NM_000372.4:c.1A>G, NM_000372.4:c.230G>A, NM_000372.4:c.242C>T, NM_000372.4:c.265T>C, NM_000372.4:c.272G>A, NM_000372.4:c.286dupA, NM_000372.4:c.533G>A, NM_000372.4:c.1336G>A, NM_000372.4:c.1342G>A, NM_000372.4:c.646T>A, NM_000372.4:c.650G>A, NM_000372.4:c.823G>T, NM_000372.4:c.896G>A, NM_000372.4:c.1111A>G, NM_000372.4:c.1118C>A, NM_000372.4:c.325G>A, NM_000372.4:c.572delG, NM_000372.4:c.616G>A | Oculocutaneous albinism type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYR gene located on chromosomal region 11q14.2. The age of onset is early. This disease is characterized by white hair and skin, blue, fully translucent irises, nystagmus and misrouting of the optic nerves. | 250,600 |
| TYRP1 | Oculocutaneous albinism type 3 | NM_000550.2 | NM_000550.2:c.107delT, NM_000550.2:c.1103delA, NM_000550.2:c.1057_1060delAACA, NM_000550.2:c.1067G>A, NM_000550.2:c.1557T>G, NM_000550.2:c.176C>G, NM_000550.2:c.497C>G, NM_000550.2:c.1120C>T, NM_000550.2:c.1369_1370insCAGA | Type 3 oculocutaneous albinism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYRP1 gene located on chromosomal region 9p23. The age of onset is early. This disease is characterized by rufous or brown albinism and occurring mainly in the African population. The prevalence is of 1/8,500 individuals in Africa. | 250,600 |
| UBA1 | Spinal muscular atrophy type 2, X-linked | NM_003334.3 | NM_003334.3:c.1731C>T | X-linked spinal muscular atrophy type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the UBA1 gene located on chromosomal region Xp11.23. The age of onset is infantile. This disease is characterized by congenital hypotonia and areflexia and evidence of degeneration and loss of anterior horn cells (i.e., lower motor neurons) in the spinal cord and brain stem. Often congenital contractures and/or fractures are present. Life span is shortened because of progressive ventilatory insufficiency resulting from chest muscle involvement. | 600 |
| UBR1 | Johanson-Blizzard syndrome | NM_174916.2 | NM_174916.2:c.869C>G, NM_174916.2:c.4254G>A, NM_174916.2:c.1281+1G>T, NM_174916.2:c.1537C>T | Johanson-Blizzard syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UBR1 gene located on chromosomal region 15q15.2. The age of onset is early. This disease is characterized by congenital exocrine pancreatic insufficiency and aplasia/hypoplasia of alae nasi, together with a variety of other abnormalities including aplasia cutis, anorectal anomalies and failure to thrive. The prevalence is <1:1,000,000. | 600 |
| UGT1A1 | Crigler-Najjar syndrome type 1 | NM_000463.2 | NM_000463.2:c.1021C>T, NM_000463.2:c.1070A>G | Crigler-Najjar syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by severe neonatal unconjugated hyperbilirubinemia, persistent jaundice and bilirubin encephalopathy manifesting as hypotonia, deafness, oculomotor palsy and lethargy. Neurologic defects can occur, generally associated with intellectual and motor impairment. | 250,600 |
| UGT1A1 | Crigler-Najjar syndrome type 2 | NM_000463.2 | NM_000463.2:c.1207C>T, NM_000463.2:c.674T>G, NM_000463.2:c.1130G>T, NM_000463.2:c.524T>A, NM_000463.2:c.44T>G | Crigler-Najjar syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by unconjugated hyperbilirubinemia due to reduced and inducible activity of hepatic bilirubin glucuronosyltransferase with pigmented bile that contains bilirubin glucuronides, and generally do not present neurologic or intellectual impairment. Bilirubin encephalopathy may develop in later life when patients experience a superimposed infection or stress. | 250,600 |
| UGT1A1 | Gilbert syndrome | NM_000463.2 | NM_000463.2:c.1211T>C, NM_000463.2:c.1456T>G | Gilbert syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by jaundice due to unconjugated hyperbilirubinemia, resulting a partial deficiency in hepatic bilirubin glucuronosyltransferase activity. | 250,600 |
| UQCRB | Mitochondrial complex III deficiency, nuclear type 3 | NM_006294.4 | NM_006294.4:c.306_309delAAAA | Mitochondrial complex III deficiency, nuclear type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UQCRB gene located on chromosomal region 8q22.1. The age of onset is infantile. This disease is characterized by a highly variable phenotype depending on which tissues are affected. Clinical features include mitochondrial encephalopathy, psychomotor retardation, ataxia, severe failure to thrive, liver dysfunction, renal tubulopathy, muscle weakness and exercise intolerance. | 600 |
| UQCRQ | Mitochondrial complex III deficiency, nuclear type 4 | NM_014402.4 | NM_014402.4:c.134C>T | Mitochondrial complex III deficiency, nuclear type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UQCRQ gene located on chromosomal region 5q31.1. The age of onset is infantile. This disease is characterized by severe psychomotor retardation and extrapyramidal signs. Neurologic features included dystonia, athetoid movements, ataxia, mild axial hypotonia, increased tone, hyperreflexia, and inability to walk unsupported. | 600 |
| USH1C | Usher syndrome type 1C | NM_153676.3 | NM_153676.3:c.216G>A, NM_153676.3:c.2362G>A, NM_153676.3:c.2622_2623delCA, NM_153676.3:c.2688_2695dupAATTCACC, NM_153676.3:c.238_239insC, NM_153676.3:c.238delC, NM_153676.3:c.2547-1G>T, NM_153676.3:c.2695_2696insAATTCACC, NM_153676.3:c.388G>A | Usher syndrome type 1C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1C gene located on chromosomal region 11p15.1. The age of onset is infantile. This disease is characterized by the association of sensorineural deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 3:100,000-4:100,000. | 250,600 |
| USH1G | Usher syndrome type 1G | NM_173477.4 | NM_173477.4:c.186_187delCA, NM_173477.4:c.394_395insG, NM_173477.4:c.832_851delTCGGACGAGGACAGCGTCTC, NM_173477.4:c.649C>T, NM_173477.4:c.805C>T | Usher syndrome type 1G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1G gene located on chromosomal region 17q25.1. The age of onset is infantile. This disease is characterized by the association of sensorineural deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 4.4:100,000. | 600 |
| USH2A | Retinitis pigmentosa type 39 | NM_206933.2 | NM_206933.2:c.10073G>A, NM_206933.2:c.2296T>C, NM_206933.2:c.14519T>C, NM_206933.2:c.7364G>A, NM_206933.2:c.12574C>T, NM_206933.2:c.2276G>T | Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 39 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000. | 250,600 |
| USH2A | Usher syndrome type 2A | NM_206933.2 | NM_206933.2:c.10636G>A, NM_206933.2:c.10561T>C, NM_206933.2:c.15371delT, NM_206933.2:c.2167+5G>A, NM_206933.2:c.11864G>A, NM_206933.2:c.14803C>T, NM_206933.2:c.2898delG, NM_206933.2:c.3491_3492delCT, NM_206933.2:c.11549-5_11549-4insT, NM_206933.2:c.2299delG, NM_206933.2:c.5975A>G, NM_206933.2:c.6670G>T, NM_206933.2:c.6862G>T, NM_206933.2:c.5743_5744delAG, NM_206933.2:c.779T>G, NM_206933.2:c.820C>T, NM_206933.2:c.8981G>A, NM_206933.2:c.956G>A, NM_206933.2:c.9799T>C, NM_206933.2:c.15089C>A, NM_206933.2:c.2135delC, NM_206933.2:c.4338_4339delCT, NM_206933.2:c.5573-2A>G, NM_206933.2:c.920_923dupGCCA, NM_206933.2:c.13709delG, NM_206933.2:c.14926G>A, NM_206933.2:c.15520-1G>A, NM_206933.2:c.8431C>A, NM_206933.2:c.12234_12235delGA, NM_206933.2:c.14442C>A | Usher syndrome type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. The age of onset is infantile. This disease is characterized by the association of sensorineural deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 3:100,000-4:100,000. | 250,600 |
| VDR | Rickets, vitamin D-resistant, type 2A | NM_001017535.1 | NM_001017535.1:c.137G>A, NM_001017535.1:c.149G>A, NM_001017535.1:c.885C>A, NM_001017535.1:c.88C>T, NM_001017535.1:c.239G>A, NM_001017535.1:c.821G>T, NM_001017535.1:c.88C>G, NM_001017535.1:c.915C>G, NM_001017535.1:c.985G>A | Vitamin D-dependent rickets type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VDR gene located on chromosomal region 12q13.11. The age of onset is early. This disease is characterized by hypocalcemia, severe rickets and in many cases alopecia. The prevalence is 1:10,000-5:10,000. | 600 |
| VLDLR | Cerebellar ataxia, mental retardation, and dysequilibrium syndrome type 1 | NM_003383.3 | NM_003383.3:c.2339delT, NM_003383.3:c.2302_2303delGA, NM_003383.3:c.844C>T, NM_003383.3:c.769C>T | Cerebellar ataxia - intellectual deficit - dysequilibrium syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VLDLR gene located on chromosomal region 9p24.2. The age of onset is early. This disease is characterized by non-progressive congenital ataxia that is predominantly truncal and results in delayed ambulation, moderate-to-profound intellectual disability, dysarthria, strabismus, and seizures. The prevalence is 1:100,000-9:100,000. | 600 |
| VPS13A | Choreoacanthocytosis | NM_033305.2 | NM_033305.2:c.622C>T, NM_033305.2:c.9109C>T, NM_033305.2:c.2898T>G, NM_033305.2:c.3091delG, NM_033305.2:c.9275+1G>T | Chorea-acanthocytosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VPS13A gene located on chromosomal region 9q21. The age of onset is adult. This disease is characterized by progressive neurological symptoms including movement disorders, psychiatric manifestations and cognitive disturbances. | 600 |
| VPS33B | Arthrogryposis-renal dysfunction-cholestasis type 1 | NM_018668.4 | NM_018668.4:c.1246C>T, NM_018668.4:c.1312C>T, NM_018668.4:c.1498G>A, NM_018668.4:c.440_449delCTCTTGATGT, NM_018668.4:c.1594C>T, NM_018668.4:c.1480-1G>T, NM_018668.4:c.603+2T>A | Arthrogryposis - renal dysfunction – cholestasis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VPS33B gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by neurogenic arthrogryposis multiplex congenita, renal tubular dysfunction and neonatal cholestasis. The prevalence is <1:1,000,000. | 600 |
| WAS | Neutropenia, severe congenital, X-linked | NM_000377.2 | NM_000377.2:c.881T>C, NM_000377.2:c.809T>C, NM_000377.2:c.814T>C | X-linked severe congenital neutropenia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the WAS gene located on chromosomal region Xp11.23. The age of onset is early. This disease is characterized by recurrent major bacterial infections, severe congenital neutropenia, and monocytopenia. The prevalence is <1:1,000,000. | 600 |
| WAS | Thrombocytopaenia type 1 | NM_000377.2 | NM_000377.2:c.167C>T, NM_000377.2:c.173C>G, NM_000377.2:c.1442T>A | Thrombocytopaenia type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the WAS gene located on chromosomal region Xp11.23. The age of onset is early. Thrombocytopenia is defined by a decrease in the number of platelets in circulating blood, resulting in the potential for increased bleeding and decreased ability for clotting. The prevalence is <1:1,000,000. | 600 |
| WAS | Wiskott-Aldrich syndrome | NM_000377.2 | NM_000377.2:c.134C>T | Wiskott-Aldrich síndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the WAS gene located on chromosomal region Xp11.23. The age of onset is infantile. This disease is characterized by microthrombocytopenia, eczema, infections and an increased risk for autoimmune manifestations and malignancies. The incidence is less than 1 in 100,000 live births and the prevalence is 1:1,000,000-10:1,000,000 men. | 600 |
| WDR62 | Microcephaly primary, type 2, autosomal recessive | NM_001083961.1 | NM_001083961.1:c.1313G>A, NM_001083961.1:c.3514+1delG, NM_001083961.1:c.3574delA, NM_001083961.1:c.1408C>T, NM_001083961.1:c.193G>A, NM_001083961.1:c.702dupG, NM_001083961.1:c.671G>C, NM_001083961.1:c.557G>A | Autosomal recessive primary microcephalyc type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WDR62 gene located on chromosomal region 19q13.12. The age of onset is early. This disease is characterized by reduced head circumference at birth without gross anomalies of brain architecture and variable degrees of intellectual impairment. The incidence is 1:1,000,000. | 600 |
| WFS1 | Wolfram syndrome | NM_006005.3 | NM_006005.3:c.1234_1237delGTCT, NM_006005.3:c.1511C>T, NM_006005.3:c.2168T>C, NM_006005.3:c.2171C>T, NM_006005.3:c.1944G>A, NM_006005.3:c.2084G>T, NM_006005.3:c.577A>C, NM_006005.3:c.676C>T, NM_006005.3:c.2327A>T, NM_006005.3:c.407_408insGGGCCGTCGCGAGGCT, NM_006005.3:c.2576G>A, NM_006005.3:c.2643_2644delCT, NM_006005.3:c.616C>T, NM_006005.3:c.1060_1062delTTC, NM_006005.3:c.400G>A, NM_006005.3:c.1943G>A, NM_006005.3:c.1230_1233delCTCT | Wolfram syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WFS1 gene located on chromosomal region 4p16.1. The age of onset is infantile. This disease is characterized by diabetes mellitus type I, diabetes insipidus, optical atrophy and neurological signs. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| WNT10A | Hypohidrotic ectodermal dysplasia, autosomal recessive | NM_025216.2 | NM_025216.2:c.347T>C, NM_025216.2:c.383G>A, NM_025216.2:c.321C>A | Hypohidrotic ectodermal displasia, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by sparse hair (atrichosis or hypotrichosis), abnormal or missing teeth and the inability to sweat due to the absence of sweat glands. The prevalence is <1:1,000,000. | 250,600 |
| WNT10A | Odontoonychodermal dysplasia | NM_025216.2 | NM_025216.2:c.697G>T | Odonto-onycho-dermal dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by hyperkeratosis and hyperhidrosis of the palms and soles, atrophic malar patches, hypodontia, conical teeth, onychodysplasia, and dry and sparse hair. The prevalence is <1:1,000,000. | 250,600 |
| WNT7A | Fuhrmann syndrome | NM_004625.3 | NM_004625.3:c.874C>T | Fuhrmann syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT7A gene located on chromosomal region 3p25.1. The age of onset is neonatal/infancy. This disease is characterized by bowing of the femora, aplasia or hypoplasia of the fibulae and poly-, oligo-, and syndactyly. Most of the patients also have a hypoplastic pelvis and hypoplasia of the fingers and fingernails. Some had congenital dislocation of the hip, absence or fusion of tarsal bones, absence of various metatarsals, and hypoplasia and aplasia of the toes. The prevalence is <1:1,000,000. | 600 |
| WNT7A | Ulna and fibula, absence of, with sever limb deficiency | NM_004625.3 | NM_004625.3:c.325G>A | Aplasia/hypoplasia of limbs and pelvis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT7A gene located on chromosomal region 3p25.1. The age of onset is early. This disease is characterized by intercalary limb deficiencies (phocomelia sometimes combined with polydactyly, oligodactyly or ectrodactyly), absent or hypoplastic pelvic bones (including sacral agenesis or hypoplasia), skull defects (frequently a defect of the occipital bone with or without meningocele) | 600 |
| XPA | Xeroderma pigmentosum Group A | NM_000380.3 | NM_000380.3:c.323G>T, NM_000380.3:c.619C>T, NM_000380.3:c.727C>T, NM_000380.3:c.731A>G, NM_000380.3:c.348T>A, NM_000380.3:c.501delG | Xeroderma pigmentosum complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the gene XPA located on chromosomal region 9q22.33. The age of onset is variable. This disease is characterized by photosensitivity of skin with burning, freckling, and skin cancers. It is associated with a spectrum of mild to severe neurological anomalies (e.g. cognitive deterioration, dysarthria, balance disturbance, areflexia) and sometimes delay of growth and sexual development. The prevalence is 1:1,000,000. | 600 |
| ZFYVE26 | Spastic paraplegia type 15, autosomal recessive | NM_015346.3 | NM_015346.3:c.3206G>A, NM_015346.3:c.3642_3643insCCACACTTAG, NM_015346.3:c.1477C>T, NM_015346.3:c.2887G>C, NM_015346.3:c.5422C>T, NM_015346.3:c.5485-1G>A, NM_015346.3:c.4312C>T, NM_015346.3:c.4936C>T, NM_015346.3:c.3182delT, NM_015346.3:c.2114_2115insC | Spastic paraplegia type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZFYVE26 gene located on chromosomal region 14q24.1. The age of onset is infancy. This disease is characterized by progressive spasticity primarily affecting the lower limbs. It is a complex form of spastic paraplegia, associated with other neurologic dysfunction, including variable mental retardation, hearing and visual defects, and thin corpus callosum. The prevalence is <1 / 1,000,000. | 250,600 |
| ZMPSTE24 | Mandibuloacral dysplasia with type B lipodystrophy | NM_005857.4 | NM_005857.4:c.121C>T, NM_005857.4:c.1263dupT, NM_005857.4:c.1018T>C, NM_005857.4:c.955-1G>A, NM_005857.4:c.1349G>A | Mandibuloacral dysplasia with type B lipodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZMPSTE24 gene located on chromosomal region 1p34.2. The age of onset is early. This disease is characterized by postnatal growth retardation, craniofacial anomalies and skeletal malformations, such as mandibular and clavicular hypoplasia; mottled cutaneous pigmentation and generalized lipoatrophy. | 600 |
| ZMPSTE24 | Restrictive dermopathy, lethal | NM_005857.4 | NM_005857.4:c.1076_1077insT, NM_005857.4:c.54dupT, NM_005857.4:c.1085_1086insT | Lethal restrictive dermopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZMPSTE24 gene located on chromosomal region 1p34.2. The age of onset is early. This disease is characterized by the skin being drawn tightly over the face causing a narrow, pinched nose, small mouth, limited jaw mobility, and entropion. Ears are malformed, with the auricle attached to the skin of scalp. Most infants die after a few hours from pulmonary distress. The prevalence is <1:1,000,000. | 600 |
| ZNF469 | Brittle cornea syndrome | NM_001127464.1 | NM_001127464.1:c.6673delC, NM_001127464.1:c.11452_11453insC, NM_001127464.1:c.4174G>T | Brittle cornea syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZNF469 gene located on chromosomal region 16q24.2. The age of onset is infantile. This disease is characterized by severe ocular manifestations due to extreme corneal thinning and fragility with rupture in the absence of significant trauma. BCS generally progresses to blindness. The prevalence is <1:1,000,000. | 600 |
| Gene | Disease | Transcript | Mutations | Disease.description | products |
|---|---|---|---|---|---|
| ABCA4 | Stargardt disease type 1; Cone-rod dystrophy type 3 | NM_000350.2 | NM_000350.2:c.6449G>A, NM_000350.2:c.6394G>T, NM_000350.2:c.6320G>A, NM_000350.2:c.6118C>T, NM_000350.2:c.6089G>A, NM_000350.2:c.5912T>G, NM_000350.2:c.5882G>A, NM_000350.2:c.5881G>A, NM_000350.2:c.5819T>C, NM_000350.2:c.5714+5G>A, NM_000350.2:c.5512delC, NM_000350.2:c.5461-10T>C, NM_000350.2:c.5338C>G, NM_000350.2:c.4793C>A, NM_000350.2:c.4469G>A, NM_000350.2:c.4457C>T, NM_000350.2:c.4429C>T, NM_000350.2:c.4139C>T, NM_000350.2:c.3970delG, NM_000350.2:c.3364G>A, NM_000350.2:c.3322C>T, NM_000350.2:c.3210_3211dupGT, NM_000350.2:c.3106G>A, NM_000350.2:c.3083C>T, NM_000350.2:c.2791G>A, NM_000350.2:c.2616_2617delCT, NM_000350.2:c.2588G>C, NM_000350.2:c.2300T>A, NM_000350.2:c.2160+1G>T, NM_000350.2:c.1964T>G, NM_000350.2:c.1938-1G>A, NM_000350.2:c.1848delA, NM_000350.2:c.1804C>T, NM_000350.2:c.1771delT, NM_000350.2:c.1755delA, NM_000350.2:c.1622T>C, NM_000350.2:c.1225delA, NM_000350.2:c.1222C>T, NM_000350.2:c.1018T>G, NM_000350.2:c.763C>T, NM_000350.2:c.634C>T, NM_000350.2:c.286A>G, NM_000350.2:c.67-2A>G, NM_000350.2:c.52C>T | Stargardt disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by progressive central vision loss, mild loss of color vision, delayed dark adaptation and macular atrophy with or without paramacular flecks and degeneration of the underlying retinal pigment ephitelium. The estimated prevalence is 1:8,000-10,000. Mutations in the ABCA4 gene account also for 30 to 60 percent of cases of cone-rod dystrophy that are inherited in an autosomal recessive pattern. The problems associated with this condition include a loss of visual sharpness (acuity), an increased sensitivity to light (photophobia), and impaired color vision. These vision problems worsen over time. | 600,25 |
| ABCB7 | X-linked sideroblastic anemia and ataxia (XLSA/A) | NM_004299.4 | NM_004299.4:c.1300G>A, NM_004299.4:c.1234G>C, NM_004299.4:c.1203T>G | XLSA/A is caused by pathogenic variants in the ABCB7 gene located on chromosomal region Xq13.3. The age of onset is neonatal/infantile. XLSA/A is a rare condition characterized by a blood disorder called sideroblastic anemia and movement problems known as ataxia. This condition occurs only in males. People with X-linked sideroblastic anemia and ataxia have mature red blood cells that are smaller than normal (microcytic) and appear pale (hypochromic) because of the shortage of hemoglobin. This disorder also leads to an abnormal accumulation of iron in red blood cells but does not cause a potentially dangerous buildup of iron in the body. The anemia is typically mild and usually does not cause any symptoms. The prevalence is very rare, estimated at <1:1,000,000. | 600 |
| ACAD9 | Mitochondrial complex I deficiency due to ACAD9 | NM_014049.4 | NM_014049.4:c.23delT, NM_014049.4:c.130T>A, NM_014049.4:c.359delT, NM_014049.4:c.453+1G>A, NM_014049.4:c.797G>A, NM_014049.4:c.976G>C, NM_014049.4:c.1240C>T, NM_014049.4:c.1249C>T, NM_014049.4:c.1594C>T | Mitochondrial complex I deficiency due to ACAD9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAD9 gene located on chromosomal region 3q21.3. The age of onset is neonatal/infantile. This disease is a multisystem disorder characterized by infantile onset of acute metabolic acidosis, hypertrophic cardiomyopathy, and muscle weakness associated with a deficiency of mitochondrial complex I activity in muscle, liver, and fibroblasts (summary by Haack et al., 2010). | 600,25 |
| ACADM | Medium-chain acyl-CoA dehydrogenase deficiency | NM_001286043.1 | NM_001286043.1:c.250C>T, NM_001286043.1:c.386-2A>G, NM_001286043.1:c.461C>T, NM_001286043.1:c.548_551delCTGA, NM_001286043.1:c.546G>A, NM_001286043.1:c.715C>T, NM_001286043.1:c.716G>A, NM_001286043.1:c.833C>T, NM_001286043.1:c.896A>G, NM_001286043.1:c.898G>A, NM_001286043.1:c.916_928delGCAATGGGAGCTT, NM_001286043.1:c.1083delG, NM_001286043.1:c.1084A>G, NM_001286043.1:c.1201_1204delTTAG | Medium-chain acyl-CoA dehydrogenase (MCAD) deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADM gene located on chromosomal region 1p31. Inherited deficiency of MCAD is a condition that prevents the body from converting certain fats to energy, particularly during periods without food (fasting). Signs and symptoms of MCAD deficiency typically appear during infancy or early childhood and can include vomiting, lack of energy (lethargy), and low blood sugar (hypoglycemia). Individuals with MCAD deficiency are at risk of serious complications such as seizures, breathing difficulties, liver problems, brain damage, coma, and sudden death. The estimated prevalence is 1:4,900-1:27,000 in Caucasian populations and 1:14,600 in worldwide populations. | 600,25 |
| ACADS | Short-chain acyl-CoA dehydrogenase deficiency | NM_000017.3 | NM_000017.3:c.136C>T, NM_000017.3:c.319C>T, NM_000017.3:c.417G>C, NM_000017.3:c.529T>C, NM_000017.3:c.561_568delCAATGCCT, NM_000017.3:c.1095G>T, NM_000017.3:c.1147C>T | Short-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADS gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by seizures, developmental delay, failure to grow with poor feeding, and usually muscle weakness and hypotonia. The prevalence is <1:50,000. | 600,25 |
| ACADSB | Short/branched-chain acyl-CoA dehydrogenase deficiency | NM_001609.3 | NM_001609.3:c.303+1G>A, NM_001609.3:c.443C>T, NM_001609.3:c.621G>A, NM_001609.3:c.763C>T | Short/branched-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADSB gene located on chromosomal region 10q26.3. The age of onset is neonatal/infantile. This disease is characterized by muscle hypotonia, cerebral palsy, developmental delay, lethargy, hypoglycemia, and metabolic acidosis. The prevalence is <1:1,000,000. | 600,25 |
| ACADVL | Very long-chain acyl-CoA dehydrogenase deficiency | NM_001270447.1 | NM_001270447.1:c.347-1G>A, NM_001270447.1:c.367_368delCA, NM_001270447.1:c.412delG, NM_001270447.1:c.469C>T, NM_001270447.1:c.546+1G>C, NM_001270447.1:c.589G>A, NM_001270447.1:c.754C>T, NM_001270447.1:c.822-2A>C, NM_001270447.1:c.917T>C, NM_001270447.1:c.965_967delAGA, NM_001270447.1:c.1165C>T, NM_001270447.1:c.1166G>A, NM_001270447.1:c.1175T>C, NM_001270447.1:c.1210_1212delGAG, NM_001270447.1:c.1251+1G>A, NM_001270447.1:c.1426C>T, NM_001270447.1:c.1444dupC, NM_001270447.1:c.1458dupG, NM_001270447.1:c.1475G>A, NM_001270447.1:c.1537G>C, NM_001270447.1:c.1601+1G>A, NM_001270447.1:c.1906C>T, NM_001270447.1:c.1912C>T, NM_001270447.1:c.1951delC | Very long-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADVL gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by cardiomyopathy, hypoketotic hypoglycemia, liver disease, exercise intolerance and rhabdomyolysis. The prevalence is 1:100,000-9:100,000. | 600,25 |
| ACAT1 | Alpha-methylacetoacetic aciduria | NM_000019.3 | NM_000019.3:c.2T>A, NM_000019.3:c.412_419delCAAAGTCT, NM_000019.3:c.547G>A, NM_000019.3:c.622C>T, NM_000019.3:c.905delA, NM_000019.3:c.1035_1037delAGA, NM_000019.3:c.1083dupA, NM_000019.3:c.1136G>T, NM_000019.3:c.1138G>A | Alpha-methylacetoacetic aciduria, also known as 3-ketothiolase deficiency, is an inborn error of isoleucine catabolism characterized by urinary excretion of 2-methyl-3-hydroxybutyric acid, 2-methylacetoacetic acid, tiglylglycine, and 2-butanone. This deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAT1 gene located on chromosomal region 11q22.3. The age of onset is neonatal/infantile. This disease is characterized by normal early development followed by a progressive loss of mental and motor skills. The prevalence is < 1:1,000,000. | 600 |
| ACE | Renal tubular dysgenesis | NM_000789.3 | NM_000789.3:c.798C>G, NM_000789.3:c.1319_1322delTGGA, NM_000789.3:c.1486C>T, NM_000789.3:c.1511delC, NM_000789.3:c.1587-2A>G, NM_000789.3:c.2371C>T | Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and the most common cause are pathogenic variants in the ACE (chromosomal region 17q23.3). The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects. | 600,25 |
| ACOX1 | Peroxisomal acyl-CoA oxidase deficiency | NM_004035.6 | NM_004035.6:c.832A>G, NM_004035.6:c.591delG, NM_004035.6:c.532G>T | Peroxisomal acyl-CoA oxidase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACOX1 gene located on chromosomal region 17q25.1. The age of onset is neonatal/infantile. This disease is characterized by hypotonia and seizures in the neonatal period and neurological regression in early infancy. The prevalence is < 1:1,000,000. | 600 |
| ADA | Adenosine deaminase deficiency / Severe combined immunodeficiency due to ADA deficiency | NM_000022.3 | NM_000022.3:c.986C>T, NM_000022.3:c.956_960delAAGAG, NM_000022.3:c.890C>A, NM_000022.3:c.872C>T, NM_000022.3:c.632G>A, NM_000022.3:c.320T>C | Adenosine deaminase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADA gene located on chromosomal region 20q13.12. The age of onset is neonatal/infantile. This disease is characterized by profound lymphopenia and very low immunoglobulin levels of all isotypes resulting in severe and recurrent opportunistic infections. The annual incidence is 1:200,000-1:1,000,000. The prevalence is 1:100,000-9:100,000. | 600,25 |
| ADAMTS2 | Ehlers-Danlos syndrome, dermatosparaxis type | NM_014244.4 | NM_014244.4:c.2384G>A | Ehlers-Danlos syndrome dermatosparaxis type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADAMTS2 gene located on chromosomal region 5q35.3. The age of onset is neonatal/infantile. This disease is characterized by extremely fragile tissues, hyperextensible skin and easy bruising. The prevalence is <1:1,000,000. | 600 |
| ADAMTSL2 | Geleophysic dysplasia type 1 | NM_001145320.1 | NM_001145320.1:c.338G>A, NM_001145320.1:c.340G>A, NM_001145320.1:c.440C>T, NM_001145320.1:c.661C>T | Geleophysic dysplasia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADAMTSL2 gene located on chromosomal region 9q34.2. The age of onset is infantile. This disease is characterized by extremely by short stature, prominent abnormalities in hands and feet, and a characteristic facial appearance. The prevalence is <1:1,000,000. | 600 |
| ADGRV1 | Usher syndrome, type 2C | NM_032119.3 | NM_032119.3:c.2258_2270delAAGTGCTGAAATC, NM_032119.3:c.2864C>A, NM_032119.3:c.5357_5358delAA, NM_032119.3:c.6275-1G>A, NM_032119.3:c.6312dupT, NM_032119.3:c.6901C>T, NM_032119.3:c.8713_8716dupAACA, NM_032119.3:c.8790delC, NM_032119.3:c.11377G>T, NM_032119.3:c.14973-1G>C, NM_032119.3:c.15196_15199dupCAAA, NM_032119.3:c.17668_17669delAT, NM_032119.3:c.18131A>G | Usher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADGRV1 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32 respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000. | 600,25 |
| AGA | Aspartylglucosaminuria | NM_000027.3 | NM_000027.3:c.904G>A, NM_000027.3:c.800dupT, NM_000027.3:c.755G>A, NM_000027.3:c.488G>C, NM_000027.3:c.302C>T, NM_000027.3:c.214T>C | Aspartylglucosaminuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGA gene located on chromosomal region 4q34.3. The age of onset is infantile. This disease is characterized by slowly developping mental retardation, beginning with clumsiness, late speech, and hyperkinesia, mild facial dysmorphism, and slight kyphoscoliosis. | 600 |
| AGL | Glycogen storage disease type 3 | NM_000028.2 | NM_000028.2:c.16C>T, NM_000028.2:c.18_19delGA, NM_000028.2:c.294-2A>T, NM_000028.2:c.1222C>T, NM_000028.2:c.1485delT, NM_000028.2:c.1783C>T, NM_000028.2:c.1999delC, NM_000028.2:c.2039G>A, NM_000028.2:c.2590C>T, NM_000028.2:c.3216_3217delGA, NM_000028.2:c.3980G>A, NM_000028.2:c.4260-12A>G, NM_000028.2:c.4260-1G>T, NM_000028.2:c.4342G>C, NM_000028.2:c.4456delT, NM_000028.2:c.4529dupA | Glycogen storage disease (GSD) type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGL gene located on chromosomal region 1p21.2. The age of onset is infantile. This metabolic disorder is caused by deficiency of the glycogen debrancher enzyme and is associated with an accumulation of abnormal glycogen with short outer chains. Most patients are enzyme-deficient in both liver and muscle (IIIa), but about 15% are enzyme-deficient in liver only (IIIb) (Shen et al., 1996). These subtypes have been explained by differences in tissue expression of the deficient enzyme (Endo et al., 2006). In rare cases, selective loss of only 1 of the 2 debranching activities, glucosidase or transferase, results in type IIIc or IIId, respectively (Van Hoof and Hers, 1967; Ding et al., 1990). Clinically, patients with GSD type 3 present in infancy or early childhood with hepatomegaly, hypoglycemia, and growth retardation. Muscle weakness in those with IIIa is minimal in childhood but can become more severe in adults; some patients develop cardiomyopathy (Shen et al., 1996). | 600,25 |
| AGPS | Rhizomelic chondrodysplasia punctata, type 3 | NM_003659.3 | NM_003659.3:c.926C>T, NM_003659.3:c.1256G>A, NM_003659.3:c.1406T>C, NM_003659.3:c.1703C>T | Rhizomelic chondrodysplasia punctata type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGPS gene located on chromosomal region 2q31.2. The age of onset is neonatal/infantile. This disease is characterized by shortness of the femur and humerus, vertebral disorders, cataract, cutaneous lesions and severe intellectual deficit. The prevalence is 1:100,000-9:100,000. | 600 |
| AGT | Renal tubular dysgenesis | NM_000029.3 | NM_000029.3:c.1290dupT, NM_000029.3:c.1290delT, NM_000029.3:c.1124G>A, NM_000029.3:c.604C>T | Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects. | 600 |
| AGTR1 | Renal tubular dysgenesis | NM_004835.4 | NM_004835.4:c.215dupT, NM_004835.4:c.259dupG, NM_004835.4:c.481delC, NM_004835.4:c.481C>T | Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects. | 600 |
| AGXT | Hyperoxaluria, primary, type 1 | NM_000030.2 | NM_000030.2:c.33dupC, NM_000030.2:c.121G>A, NM_000030.2:c.166-2A>G, NM_000030.2:c.245G>A, NM_000030.2:c.248A>G, NM_000030.2:c.322T>C, NM_000030.2:c.454T>A, NM_000030.2:c.466G>A, NM_000030.2:c.508G>A, NM_000030.2:c.560C>T, NM_000030.2:c.613T>C, NM_000030.2:c.697C>T, NM_000030.2:c.698G>A, NM_000030.2:c.731T>C, NM_000030.2:c.738G>A | Primary hyperoxaluria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGXT gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by variable clinical presentation, ranging from occasional symptomatic nephrolithiasis to nephrocalcinosis and end-stage renal disease with systemic involvement. The prevalence is 1:1,000,000-9:1,000,000. | 600,25 |
| AHI1 | Joubert syndrome type 3 | NM_001134830.1 | NM_001134830.1:c.3263_3264delGG, NM_001134830.1:c.2295dupA, NM_001134830.1:c.2168G>A, NM_001134830.1:c.1484G>A, NM_001134830.1:c.1303C>T, NM_001134830.1:c.1052G>T, NM_001134830.1:c.1051C>T, NM_001134830.1:c.985C>T | Joubert syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AHI1 gene located on chromosomal region 6q23.3. The age of onset is variable. This disease is characterized by the neurological features of Joubert syndrome (neonatal hypotonia, developmental delay, mild to severe intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia and primary position nystagmus) associated with retinal dystrophy. | 600,25 |
| AIPL1 | Leber congenital amaurosis type 4 | NM_014336.4 | NM_014336.4:c.1053_1064delTGCAGAGCCACC, NM_014336.4:c.834G>A, NM_014336.4:c.715T>C, NM_014336.4:c.589G>C | Leber congenital amaurosis type 4 (LCA4) is a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus. Mutations in the AIPL1 gene may cause approximately 20% of recessive LCA. Other conditions caused by pathogenic variants in the AIPL1 gene are cone rod dystrophy and the less agressive form, juvenile retinitis pigmentosa. Cone-rod dystropy is characterized by decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness. | 600,25 |
| ALAS2 | X-linked sideroblastic anemia, type 1 (XLSA or SIDBA1) | NM_000032.4 | NM_000032.4:c.1706_1709delAGTG, NM_000032.4:c.1699_1700delAT, NM_000032.4:c.1354C>T | X-linked sideroblastic anemia type 1 is caused by pathogenic variants in the ALAS2 gene, located on chromosomal region Xp11.21. This disease is characterized by clinical features of anemia and/or iron overload such as pallor, fatigue, weakness, and more rarely breathlessness, mild splenomegaly, cardiac problems, abnormal liver function, hyperglycemia, glucose intolerance and skin hyperpigmentation. The age of clinical onset of the disorder can vary from in utero to the ninth decade. Whereas males are preferentially affected, females may present with clinically severe anemia. More commonly, female carriers of the disease have an increased red blood cell distribution width and sometimes erythrocyte dimorphism. | 600 |
| ALDH4A1 | Hyperprolinemia, type 2 | NM_003748.3 | NM_003748.3:c.1055C>T | Hyperprolinemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDH4A1 gene located on chromosomal region 1p36. The age of onset is variable. This disease is characterized by seizures, intellectual deficit and mild developmental delay. | 600 |
| ALDH5A1 | Succinic semialdehyde dehydrogenase deficiency | NM_170740.1 | NM_170740.1:c.612G>A, NM_170740.1:c.842G>A, NM_170740.1:c.1265G>A, NM_170740.1:c.1273C>T, NM_170740.1:c.1579C>T | Succinic semialdehyde dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDH451 gene located on chromosomal region 6p22. The age of onset is infantile. This disease is characterized by psychomotor retardation, delayed speech development, hypotonia and ataxia. It is a rare disease with around 350 cases reported. | 600 |
| ALDOA | Glycogen storage disease type 12 | NM_001243177.1 | NM_001243177.1:c.548A>G, NM_001243177.1:c.781G>A | Glycogen storage disease type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOA gene located on chromosomal region 16p11.2. The age of onset is neonatal/infantile. This disease is characterized by myopathy with exercise intolerance and rhabdomyolysis associated with hemolytic anaemia.ᅠ | 600 |
| ALDOB | Fructose intolerance, hereditary | NM_000035.3 | NM_000035.3:c.1067C>A, NM_000035.3:c.1013C>T, NM_000035.3:c.1005C>G, NM_000035.3:c.720C>A, NM_000035.3:c.612T>A, NM_000035.3:c.524C>A, NM_000035.3:c.448G>C, NM_000035.3:c.442T>C, NM_000035.3:c.360_363delCAAA, NM_000035.3:c.178C>T, NM_000035.3:c.113-1_115delGGTA, NM_000035.3:c.10C>T, NM_000035.3:c.2T>C | Hereditary fructose intolerance follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOB gene located on chromosomal region 9q21.3-q22.2. The age of onset is neonatal/infantile. This disease is characterized by severe abdominal pain, vomiting, and hypoglycemia following ingestion of fructose or other sugars metabolised through fructose-1-phosphate. The prevalence is 1:100,000-9:100,000. | 600,25 |
| ALG1 | Congenital disorder of glycosylation, type 1k | NM_019109.4 | NM_019109.4:c.434G>A, NM_019109.4:c.450C>G, NM_019109.4:c.773C>T, NM_019109.4:c.1079C>T, NM_019109.4:c.1129A>G, NM_019109.4:c.1187+1G>A | Congenital disorder of glycosylation type 1k follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG1 gene located on chromosomal region 16p13.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay, seizures, microcephaly and coagulation anomalies. The prevalence is <1:1,000,000. | 600 |
| ALG6 | Congenital disorder of glycosylation, type 1c | NM_013339.3 | NM_013339.3:c.316C>T, NM_013339.3:c.897_899delAAT, NM_013339.3:c.998C>T, NM_013339.3:c.1432T>C | Congenital disorder of glycosylation type 1c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG6 gene located on chromosomal region 1p31.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay and muscular hypotonia, and possible coagulation anomalies, hormonal abnormalities and seizures. The prevalence is <1:1,000,000. | 600,25 |
| ALMS1 | Alstr�m syndrome | NM_015120.4 | NM_015120.4:c.2323C>T, NM_015120.4:c.4246delC, NM_015120.4:c.5584C>T, NM_015120.4:c.8383C>T, NM_015120.4:c.9614_9618delCAGAA, NM_015120.4:c.11443C>T, NM_015120.4:c.11453dupA, NM_015120.4:c.11612_11613delCT, NM_015120.4:c.12439C>T, NM_015120.4:c.12445C>T | Alstr�m syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALMS1 gene located on chromosomal region 2p13.1. The age of onset is neonatal/infantile. This disease is characterized by cone-rod dystrophy, hearing loss, obesity, insulin resistance and hyperinsulinemia, type 2 diabetes mellitus, dilated cardiomyopathy and progressive hepatic and renal dysfunction. The prevalence is 1:10,000-1:1,000,000. | 600,25 |
| ALPL | Hypophosphatasia, childhood/infantile | NM_000478.5 | NM_000478.5:c.98C>T, NM_000478.5:c.211C>T, NM_000478.5:c.212G>C, NM_000478.5:c.323C>T, NM_000478.5:c.346G>A, NM_000478.5:c.407G>A, NM_000478.5:c.526G>A, NM_000478.5:c.535G>A, NM_000478.5:c.571G>A, NM_000478.5:c.620A>C, NM_000478.5:c.814C>T, NM_000478.5:c.881A>C, NM_000478.5:c.892G>A, NM_000478.5:c.1001G>A, NM_000478.5:c.1133A>T, NM_000478.5:c.1250A>G, NM_000478.5:c.1306T>C, NM_000478.5:c.1366G>A | Childhood-onset hypophosphatasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALPL gene located on chromosomal region 1p36.12. The age of onset is infantile. This inborn error of metabolism is characterized clinically by defective bone mineralization ranging from stillbirth without mineralized bone to pathologic fractures of the lower extremities in later adulthood; biochemically is characterized by deficient activity of the tissue-nonspecific isoenzyme of alkaline phosphatase. | 600 |
| AMT | Glycine encephalopathy | NM_000481.3 | NM_000481.3:c.959G>A, NM_000481.3:c.826G>C, NM_000481.3:c.806G>A, NM_000481.3:c.574C>T, NM_000481.3:c.259-1G>C, NM_000481.3:c.125A>G | Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMT and GLDC genes located on chromosomal regions 3p21.31 and 9p24.1 respectively. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000. | 600 |
| ANO5 | Limb-girdle muscular dystrophy type 12 (LGMDR12; formerly LGMD2L) | NM_213599.2 | NM_213599.2:c.172C>T, NM_213599.2:c.191dupA, NM_213599.2:c.206_207delAT, NM_213599.2:c.692G>T, NM_213599.2:c.1210C>T, NM_213599.2:c.1295C>G, NM_213599.2:c.1407+5G>A, NM_213599.2:c.1627dupA, NM_213599.2:c.1733T>C, NM_213599.2:c.1887delA, NM_213599.2:c.1898+1G>A, NM_213599.2:c.1914G>A | Limb-girdle muscular dystrophy type 12 (LGMDR12, formerly LGMD2L) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ANO5 gene located on chromosomal region 11p14.3. This disease is characterized by weakness and wasting restricted to the limb musculature. Most often is characterized by an adult onset (but ranging from 11 to 51 years) of mainly proximal lower limb weakness, with difficulties standing on tiptoes being one of the initial signs. Proximal upper limb and distal lower limb weakness is also common, as well as atrophy of the quadriceps (most commonly), biceps brachii, and lower leg muscles. Calf hypertrophy has also been reported in some cases. LGMDR12 progresses slowly, with most patients remaining ambulatory until late adulthood. The estimated prevalence is <1:1,000,000. | 600,25 |
| APTX | Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia | NM_001195248.1 | NM_001195248.1:c.917-1G>A, NM_001195248.1:c.879G>A, NM_001195248.1:c.830T>G, NM_001195248.1:c.659C>T, NM_001195248.1:c.362delC, NM_001195248.1:c.209delT, NM_001195248.1:c.176-2A>G, NM_001195248.1:c.166C>T | Ataxia, early-onset, with oculomotor apraxia and hipoalbuminemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the APTX gene located on chromosomal region 9p13.1. Ataxia-oculomotor apraxia syndrome is an early-onset autosomal recessive, progressive, cerebellar ataxia with peripheral axonal neuropathy, oculomotor apraxia (defined as the limitation of ocular movements on command), and hypoalbuminemia. The prevalence is unknown. | 600,25 |
| AR | Androgen insensitivity syndrome, complete | NM_000044.3 | NM_000044.3:c.340C>T, NM_000044.3:c.1771A>T, NM_000044.3:c.2323C>T, NM_000044.3:c.2391G>A, NM_000044.3:c.2395C>G, NM_000044.3:c.2567G>A, NM_000044.3:c.2650A>T | The complete androgen insensitivity syndrome (CAIS) follows an X-linked pattern of inheritance and is caused by pathogenic variants in the AR gene located on chromosomal region Xq12. Affected males have female external genitalia, female breast development, blind vagina, absent uterus and female adnexa, and abdominal or inguinal testes, despite a normal male 46,XY karyotype. There is unresponsiveness to age-appropriate levels of androgens. There is also a partial androgen insensitivity syndrome (PAIS; OMIM 312300) caused by mutations in the AR gene, called Reifenstein syndrome, which results in hypospadias and micropenis with gynecomastia. Note: A specific type of mutation in the AR gene (a CAG repeat expansion) also cause a rare condition known as Spinal and bulbar muscular atrophy or Kennedy disease; this mutation is not tested by this carrier test. | 600,25 |
| ARG1 | Argininemia | NM_001244438.1 | NM_001244438.1:c.32T>C, NM_001244438.1:c.61C>T, NM_001244438.1:c.389G>A, NM_001244438.1:c.437G>T, NM_001244438.1:c.727G>C, NM_001244438.1:c.895C>T | Argininemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARG1 gene located on chromosomal region 6q23. The age of onset is neonatal/infantile. This disease is characterized by variable degrees of hyperammonemia, developing from about 3 years of age, and leading to progressive loss of developmental milestones and spasticity in the absence of treatment. The prevalence is 1:350,000-1:1,000,000. | 600 |
| ARL13B | Joubert syndrome type 8 | NM_001174150.1 | NM_001174150.1:c.246G>A, NM_001174150.1:c.598C>T, NM_001174150.1:c.1252C>T | Joubert syndrome type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL13B gene located on chromosomal region 3q11.1. The age of onset is neonatal/infantile. This disease is characterized by congenital malformation of the brainstem and agenesis or hypoplasia of the cerebellar vermis leading to an abnormal respiratory pattern, nystagmus, hypotonia, ataxia and delay in achieving motor milestones. The prevalence is 1/80,000 to 1/100,000. | 600 |
| ARL6 | Bardet-Biedl syndrome type 3 | NM_001323513.1 | NM_001323513.1:c.4G>T, NM_001323513.1:c.92C>G, NM_001323513.1:c.92C>T, NM_001323513.1:c.266C>T, NM_001323513.1:c.281T>C, NM_001323513.1:c.364C>T | Bardet-Biedl syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARL6 gene located on chromosomal region 3q11.2. The age of onset is early. A syndrome characterized by usually severe pigmentary retinopathy, early-onset obesity, polydactyly, hypogenitalism, renal malformation and mental retardation. Secondary features include diabetes mellitus, hypertension and congenital heart disease. | 600 |
| ARSA | Metachromatic leukodystrophy | NM_000487.5 | NM_000487.5:c.1408_1418delGCAGCTGTGAC, NM_000487.5:c.1401_1411delGTTAGACGCAG, NM_000487.5:c.1283C>T, NM_000487.5:c.1241delC, NM_000487.5:c.1232C>T, NM_000487.5:c.1210+1G>A, NM_000487.5:c.1175G>A, NM_000487.5:c.1174C>T, NM_000487.5:c.1150G>A, NM_000487.5:c.1125_1126delCT, NM_000487.5:c.1108-2A>G, NM_000487.5:c.991G>T, NM_000487.5:c.986C>T, NM_000487.5:c.979G>A, NM_000487.5:c.938G>A, NM_000487.5:c.937C>T, NM_000487.5:c.931G>A, NM_000487.5:c.899T>C, NM_000487.5:c.883G>A, NM_000487.5:c.869G>A, NM_000487.5:c.854+1G>A, NM_000487.5:c.827C>T, NM_000487.5:c.763G>A, NM_000487.5:c.739G>A, NM_000487.5:c.737G>A, NM_000487.5:c.641C>T, NM_000487.5:c.583delT, NM_000487.5:c.582delC, NM_000487.5:c.542dupT, NM_000487.5:c.542T>G, NM_000487.5:c.465+1G>A, NM_000487.5:c.346C>T, NM_000487.5:c.302G>A, NM_000487.5:c.293C>T, NM_000487.5:c.257G>A, NM_000487.5:c.195delC, NM_000487.5:c.34delG | Metachromatic leukodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSA gene located on chromosomal region 22q13.33. The age of onset is variable. This disease is characterized by hypotonia, walking difficulties, optic atrophy and motor regression preceding mental impairment in the late infantile form, arrested intellectual development, followed by motor regression, epileptic seizures and ataxia in the juvenile form, and motor or psychiatric disorders, but with slow progression in the adult form. The incidence is 0.5:5,000-1:50,000ᅠand the prevalence is 1:10,000 -5/10,000. | 600,25 |
| ARSB | Mucopolysaccharidosis type 6 (Maroteaux-Lamy) | NM_000046.3 | NM_000046.3:c.1438dupG, NM_000046.3:c.1366C>T, NM_000046.3:c.1214G>A, NM_000046.3:c.1178A>C, NM_000046.3:c.1161dupC, NM_000046.3:c.1143-1G>C, NM_000046.3:c.1143-8T>G, NM_000046.3:c.979C>T, NM_000046.3:c.971G>T, NM_000046.3:c.944G>A, NM_000046.3:c.937C>G, NM_000046.3:c.921delA, NM_000046.3:c.753C>G, NM_000046.3:c.629A>G, NM_000046.3:c.589C>T, NM_000046.3:c.571C>T, NM_000046.3:c.427delG, NM_000046.3:c.349T>C | Mucopolysaccharidosis type 6 (Maroteaux-Lamy) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSB gene located on chromosomal region 5q14.1. The age of onset is infantile. This lysosomal storage disorder resulting from a deficiency of arylsulfatase B is characterized by educed pulmonary function, hepatosplenomegaly, hearing loss, sleep apnea, corneal clouding, carpal tunnel disease and occasionally central nervous system findings may include cervical cord compression caused by cervical spinal instability, meningeal thickening and/or bony stenosis, communicating hydrocephalus, optic nerve atrophy and blindness. The prevalence is 1:250,000-1:600,000 newborns. | 600,25 |
| ARSE | Chondrodysplasia punctata, X-linked recessive | NM_001282628.1 | NM_001282628.1:c.1807C>T, NM_001282628.1:c.1517C>T, NM_001282628.1:c.1504delG, NM_001282628.1:c.485G>T, NM_001282628.1:c.194T>G, NM_001282628.1:c.99-1G>A | X-linked chondrodysplasia punctata follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARSE gene located on chromosomal region Xp22.33. The age of onset is neonatal. Thisᅠis a disorder of cartilage and bone development that occurs almost exclusively in males. Include short stature and unusually short fingertips and ends of the toes. This condition is also associated with distinctive facial features, particularly a flattened-appearing nose with crescent-shaped nostrils and a flat nasal bridge. People with X-linked chondrodysplasia punctata 1 typically have normal intelligence and a normal life expectancy. However, some affected individuals have had serious or life-threatening complications including abnormal thickening (stenosis) of the cartilage that makes up the airways, which restricts breathing. Also, abnormalities of spinal bones in the neck can lead to pinching (compression) of the spinal cord, which can cause pain, numbness, and weakness. Other, less common features of X-linked chondrodysplasia punctata 1 include delayed development, hearing loss, vision abnormalities, and heart defects. The prevalence is 1:500,000. | 600,25 |
| ARX | Epileptic encephalopathy, early infantile, type 1; ARX-related developmental disorders | NM_139058.2 | NM_139058.2:c.1058C>T, NM_139058.2:c.980_983delAACA | Early infantile epileptic encephalopathy type 1 (EIEE1) follows an X-linked recessive pattern of inheritance and is caused by pathogenic variants in the ARX gene located on chromosomal region Xp21.3. The age of onset is early. This severe disease is characterized by the onset of tonic spasms within the first 3 months of life leading to psychomotor impairment and death. Particularly,it is characterized by frequent tonic seizures or spasms beginning in infancy with a specific EEG finding of suppression-burst patterns, with high-voltage bursts alternating with almost flat suppression phases. Approximately 75% of EIEE patients progress to 'West syndrome,' which is characterized by tonic spasms with clustering, arrest of psychomotor development, and hypsarrhythmia on EEG (Kato et al., 2007). EIEE1 is part of a phenotypic spectrum of disorders caused by mutation in the ARX gene comprising a nearly continuous series of developmental disorders ranging from lissencephaly (LISX2; 300215) to Proud syndrome (300004) to infantile spasms without brain malformations (EIEE1) to syndromic (Partington syndrome; 309510) and nonsyndromic (Mental retardation, X-linked type 29; 300419) mental retardation. Although males with ARX mutations are often more severely affected, female mutation carriers may also be affected (Kato et al., 2004; Wallerstein et al., 2008). The prevalence is <1:1,000,000. | 600 |
| ASL | Argininosuccinic aciduria | NM_000048.3 | NM_000048.3:c.35G>A, NM_000048.3:c.337C>T, NM_000048.3:c.346C>T, NM_000048.3:c.446+1G>A, NM_000048.3:c.525-2A>T, NM_000048.3:c.532G>A, NM_000048.3:c.539T>G, NM_000048.3:c.544C>T, NM_000048.3:c.578G>A, NM_000048.3:c.602+1G>A, NM_000048.3:c.857A>G, NM_000048.3:c.1045_1057delGTCATCTCTACGC, NM_000048.3:c.1060C>T, NM_000048.3:c.1135C>T, NM_000048.3:c.1144-2A>G, NM_000048.3:c.1153C>T, NM_000048.3:c.1255_1256delCT, NM_000048.3:c.1369dupG | Argininosuccinic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASL gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by severe hyperammonemic coma, hypotonia, growth failure, anorexia and chronic vomiting or behavioral disorders during childhood, and hyperammonemic coma or behavioral disorders that simulate psychiatric disorders later in life. The prevalence is 1:70,000 newborns. | 600,25 |
| ASPA | Canavan disease | NM_000049.2 | NM_000049.2:c.212G>A, NM_000049.2:c.433-2A>G, NM_000049.2:c.654C>A, NM_000049.2:c.693C>A, NM_000049.2:c.854A>C, NM_000049.2:c.914C>A | Canavan disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPA gene located on chromosomal region 17p13.3. The age of onset is neonatal/infantile. This disease is characterized by a variable spectrum between severe forms with leukodystrophy, macrocephaly and severe developmental delay, and a very rare mild/juvenile form characterized by mild developmental delay. The prevalence is 1:6,400- 1:13,500 in Askenazis Jewis. | 600,25 |
| ASPM | Primary microcephaly type 5, autosomal recessive | NM_018136.4 | NM_018136.4:c.10059C>A, NM_018136.4:c.9789T>A, NM_018136.4:c.9754delA, NM_018136.4:c.9747_9748delCT, NM_018136.4:c.9730C>T, NM_018136.4:c.9697C>T, NM_018136.4:c.9685delA, NM_018136.4:c.9677dupG, NM_018136.4:c.9557C>G, NM_018136.4:c.9492T>G, NM_018136.4:c.9319C>T, NM_018136.4:c.9238A>T, NM_018136.4:c.9190C>T, NM_018136.4:c.9178C>T, NM_018136.4:c.9159delA, NM_018136.4:c.9115_9118dupCATT, NM_018136.4:c.8844delC, NM_018136.4:c.8711_8712delAA, NM_018136.4:c.8668C>T, NM_018136.4:c.8508_8509delGA, NM_018136.4:c.8378delT, NM_018136.4:c.8230dupA, NM_018136.4:c.8131_8132delAA, NM_018136.4:c.7894C>T, NM_018136.4:c.7860_7861delGA, NM_018136.4:c.7782_7783delGA, NM_018136.4:c.7761T>G, NM_018136.4:c.7491_7495delTATTA, NM_018136.4:c.6732delA, NM_018136.4:c.6337_6338delAT, NM_018136.4:c.6232C>T, NM_018136.4:c.6189T>G, NM_018136.4:c.6073delG, NM_018136.4:c.5439_5440delAG, NM_018136.4:c.5149delA, NM_018136.4:c.5136C>A, NM_018136.4:c.4858_4859delAT, NM_018136.4:c.4795C>T, NM_018136.4:c.4583delA, NM_018136.4:c.4195dupA, NM_018136.4:c.3979C>T, NM_018136.4:c.3978G>A, NM_018136.4:c.3811C>T, NM_018136.4:c.3796G>T, NM_018136.4:c.3710C>G, NM_018136.4:c.3663delG, NM_018136.4:c.3527C>G, NM_018136.4:c.3477_3481delCGCTA, NM_018136.4:c.3188T>G, NM_018136.4:c.3082G>A, NM_018136.4:c.3055C>T, NM_018136.4:c.2967G>A, NM_018136.4:c.2389C>T, NM_018136.4:c.1990C>T, NM_018136.4:c.1959_1962delCAAA, NM_018136.4:c.1729_1730delAG, NM_018136.4:c.1590delA, NM_018136.4:c.1406_1413delATCCTAAA, NM_018136.4:c.1366G>T, NM_018136.4:c.1260_1266delTCAAGTC, NM_018136.4:c.1179delT, NM_018136.4:c.1154_1155delAG, NM_018136.4:c.1002delA, NM_018136.4:c.719_720delCT, NM_018136.4:c.577C>T, NM_018136.4:c.349C>T | Primary autosomal recessive microcephaly type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPM gene located on chromosomal region 1q31. The age of onset is neonatal/infantile. This disease is characterized by a reduction in head circumference at birth, mild to moderate non-progressive intellectual impairment and delay in early motor milestones, speech delay and hyperactive behavior are common.ᅠThe annual incidence is 1:1,000,000. | 600,25 |
| ASS1 | Citrullinemia type 1 | NM_000050.4 | NM_000050.4:c.40G>A, NM_000050.4:c.256C>T, NM_000050.4:c.257G>A, NM_000050.4:c.349G>A, NM_000050.4:c.421-2A>G, NM_000050.4:c.470G>A, NM_000050.4:c.496-2A>G, NM_000050.4:c.535T>C, NM_000050.4:c.539G>A, NM_000050.4:c.571G>A, NM_000050.4:c.787G>A, NM_000050.4:c.793C>T, NM_000050.4:c.794G>A, NM_000050.4:c.805G>A, NM_000050.4:c.814C>T, NM_000050.4:c.835C>T, NM_000050.4:c.836G>A, NM_000050.4:c.910C>T, NM_000050.4:c.919C>T, NM_000050.4:c.970G>A, NM_000050.4:c.970+5G>A, NM_000050.4:c.1085G>T, NM_000050.4:c.1087C>T, NM_000050.4:c.1088G>A, NM_000050.4:c.1168G>A, NM_000050.4:c.1194-1G>C | Citrullinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASS1 gene located on chromosomal region 9q34.1. The age of onset is variable. This disease is characterized by hyperammonemia, progressive lethargy, poor feeding and vomiting in the neonatal form and by variable hyperammonemia in the later-onset form. The prevalence is 1:100,000-9:100,000. | 600,25 |
| ATIC | AICA-ribosiduria due to ATIC deficiency | NM_004044.6 | NM_004044.6:c.1277A>G | AICA-ribosiduria due to ATIC deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATIC gene located on chromosomal region 2q35. The age of onset is neonatal/infantile. This disease is characterized by profound intellectual deficit, epilepsy, dysmorphic features of the knees, elbows, and shoulders and congenital blindness. The prevalence is <1:1,000,000. | 600,25 |
| ATP7A | Menkes disease | NM_000052.6 | NM_000052.6:c.1639C>T, NM_000052.6:c.1974_1977dupGTTT, NM_000052.6:c.2938C>T, NM_000052.6:c.2981C>T, NM_000052.6:c.3257_3258delAC, NM_000052.6:c.3294+2T>G, NM_000052.6:c.3911A>G, NM_000052.6:c.3915_3921delCTCCCCA | Menkes disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ATP7A gene located on chromosomal region Xq21.1. The age of onset is neonatal/infantile. This disease is characterized by progressive neurodegeneration and marked connective tissue anomalies as well as typical sparse abnormal steely hair. The birth incidence is 1:300,000 in Europe, 1:360,000 in Japan and 1:50,000-1:100,000 in Australia, and the prevalence is 1:100,000 newborns. Mutations in the ATP7A can also cause Occipital horn syndrome, which is considered a mild form of Menkes syndrome. | 600 |
| ATP7B | Wilson disease | NM_000053.3 | NM_000053.3:c.4088C>T, NM_000053.3:c.4058G>A, NM_000053.3:c.3990_3993delTTAT, NM_000053.3:c.3955C>T, NM_000053.3:c.3809A>G, NM_000053.3:c.3796G>A, NM_000053.3:c.3694A>C, NM_000053.3:c.3359T>A, NM_000053.3:c.3207C>A, NM_000053.3:c.3083delA, NM_000053.3:c.2975C>T, NM_000053.3:c.2972C>T, NM_000053.3:c.2930C>T, NM_000053.3:c.2906G>A, NM_000053.3:c.2807T>A, NM_000053.3:c.2804C>T, NM_000053.3:c.2795C>A, NM_000053.3:c.2755C>T, NM_000053.3:c.2755C>G, NM_000053.3:c.2621C>T, NM_000053.3:c.2605G>A, NM_000053.3:c.2532delA, NM_000053.3:c.2356-2A>G, NM_000053.3:c.2305A>G, NM_000053.3:c.2297C>G, NM_000053.3:c.2123T>C, NM_000053.3:c.2071G>A, NM_000053.3:c.1934T>G, NM_000053.3:c.1846C>T, NM_000053.3:c.1745_1746delTA, NM_000053.3:c.1512dupT, NM_000053.3:c.1145_1151delCCCAACT, NM_000053.3:c.915T>A, NM_000053.3:c.562C>T, NM_000053.3:c.19_20delCA | Wilson disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATP7B gene located on chromosomal region 13q14.3. The age of onset is infantile. This disease is characterized by the toxic accumulation of copper, mainly in the liver and central nervous system, and symptomatic patients may present with hepatic, neurologic or psychiatric forms. The birth incidence is 1:30,000-1:100,000 in France and The prevalence is 1:10,000-1:30,000. | 600,25 |
| ATR | Seckel syndrome type 1 | NM_001184.3 | NM_001184.3:c.6488delT, NM_001184.3:c.6037dupA, NM_001184.3:c.5645delA, NM_001184.3:c.5635G>T, NM_001184.3:c.2341+1G>A, NM_001184.3:c.975_976delCT | Seckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATR gene located on chromosomal region 3q23. The age of onset is neonatal/infantile. This disease is characterized by a proportionate dwarfism of prenatal onset, a severe microcephaly with a bird-headed like appearance and mental retardation.ᅠThe prevalence is <1:1,000,000. | 600,25 |
| AUH | 3-methylglutaconic aciduria, type 1 | NM_001698.2 | NM_001698.2:c.991A>T, NM_001698.2:c.943-2A>G, NM_001698.2:c.895-1G>A, NM_001698.2:c.656-2A>G, NM_001698.2:c.650G>A, NM_001698.2:c.589C>T, NM_001698.2:c.559G>A, NM_001698.2:c.471delT | 3-Methylglutaconic aciduria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AUH gene located on chromosomal region 9q22.31. The age of onset is neonatal/infantile. This disease is characterized by a variable clinical phenotype ranging from mildly delayed speech to psychomotor retardation, coma, failure to thrive, metabolic acidosis and dystonia.ᅠThe prevalence is <1:1,000,000. | 600 |
| B4GALT1 | Congenital disorder of glycosylation, type 2d | NM_001497.3 | NM_001497.3:c.1031dupC | Congenital disorder of glycosylation type 2d follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the B4GALT1 gene located on chromosomal region 9p13. The age of onset is neonatal/infantile. This disease is characterized by macrocephaly, hydrocephaly, hypotonia, myopathy and coagulation anomalies. The prevalence is <1:1,000,000. | 600 |
| B9D2 | Joubert syndrome type 34; Meckel syndrome type 10 | NM_030578.3 | NM_030578.3:c.301A>C | Joubert syndrome (JBTS) 34 is an autosomal recessive disorder presenting with cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy, renal disease, liver fibrosis, and polydactyly. On the other side, Meckel syndrome (MKS) type 10 (MKS10) is a very rare autosomal-recessive disorder resulting in perinatal lethality and characterized by renal cysts, hepatic ductal plate malformation, and central nervous system defects, such as occipital encephalocele. JBST34 and MKS10 are caused by pathogenic variants in the B9D2 gene located on chromosomal region 19q13.2. | 600 |
| BCKDHA | Maple syrup urine disease, type 1a | NM_000709.3 | NM_000709.3:c.14delT, NM_000709.3:c.632C>T, NM_000709.3:c.659C>T, NM_000709.3:c.741dupT, NM_000709.3:c.797delA, NM_000709.3:c.853G>C, NM_000709.3:c.868G>A, NM_000709.3:c.905A>C, NM_000709.3:c.909_910delGT, NM_000709.3:c.917delT, NM_000709.3:c.929C>G, NM_000709.3:c.964C>T, NM_000709.3:c.979G>A, NM_000709.3:c.1036C>T, NM_000709.3:c.1037G>A, NM_000709.3:c.1234G>A | Maple syrup urine disease type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHA gene located on chromosomal region 19q13.1-13.2. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:1,000,000-9:1,000,000. | 600,25 |
| BCKDHB | Maple syrup urine disease, type 1b | NM_000056.4 | NM_000056.4:c.302G>A, NM_000056.4:c.342T>G, NM_000056.4:c.344-1G>A, NM_000056.4:c.356T>G, NM_000056.4:c.479T>G, NM_000056.4:c.488A>T, NM_000056.4:c.508C>A, NM_000056.4:c.508C>G, NM_000056.4:c.508C>T, NM_000056.4:c.509G>A, NM_000056.4:c.526A>T, NM_000056.4:c.547C>T, NM_000056.4:c.548G>C, NM_000056.4:c.748G>T, NM_000056.4:c.752T>C, NM_000056.4:c.799C>T, NM_000056.4:c.832G>A, NM_000056.4:c.853C>T, NM_000056.4:c.885delT, NM_000056.4:c.902T>G, NM_000056.4:c.952-1G>A, NM_000056.4:c.970C>T, NM_000056.4:c.1046G>A, NM_000056.4:c.1114G>T | Maple syrup urine disease type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHB gene located on chromosomal region 6q14.1. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:10,000-5:10,000. | 600 |
| BCS1L | BCS1L-related disorders, including Leigh syndrome | NM_001079866.1 | NM_001079866.1:c.103G>C, NM_001079866.1:c.133C>T, NM_001079866.1:c.148A>G, NM_001079866.1:c.166C>T, NM_001079866.1:c.232A>G, NM_001079866.1:c.547C>T, NM_001079866.1:c.548G>A, NM_001079866.1:c.550C>T, NM_001079866.1:c.696delT, NM_001079866.1:c.830G>A, NM_001079866.1:c.1057G>A | Leigh syndrome caused by mutations in the BCS1L gene -located on chromosomal region 2q35- follows an autosomal recessive pattern of inheritance. Leigh syndrome is a clinically and genetically heterogeneous disorder resulting from defective mitochondrial energy generation; It presents extensive genetic heterogeneity (more than 75 different genes) with mutations identified in both nuclear- and mitochondrial-encoded genes involved in energy metabolism, including mitochondrial respiratory chain complexes I, II, III, IV, and V. It most commonly presents as a progressive and severe neurodegenerative disorder with onset within the first months or years of life, and may result in early death. Affected individuals usually show global developmental delay or developmental regression, hypotonia, ataxia, dystonia, and ophthalmologic abnormalities, such as nystagmus or optic atrophy. The BCS1L protein is critical for the formation of mitochondrial complex III. This syndrome affects at least 1 in 40,000 newborns. | 600,25 |
| BEST1 | Bestrophinopathy, AR | NM_001139443.1 | NM_001139443.1:c.242G>A, NM_001139443.1:c.341_342delTG, NM_001139443.1:c.344delG, NM_001139443.1:c.418C>T, NM_001139443.1:c.434T>C, NM_001139443.1:c.502G>A, NM_001139443.1:c.754G>A, NM_001139443.1:c.769G>A, NM_001139443.1:c.1129_1130insCCAAAGA, NM_001139443.1:c.1203_1204insGCCTTGATGGA, NM_001139443.1:c.1311_1317dupCAAAGAC | Bestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram. Genetic heterogeneity: Mutations in this gene may cause dominant phenotypes like Macular dystrophy, vitelliform, 2 ( OMIM 153700) and Vitreoretinochoroidopathy (193220). | 600,25 |
| BEST1 | Bestrophinopathy, AR | NM_004183.3 | NM_004183.3:c.122T>C | Bestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram. Genetic heterogeneity: Mutations in this gene may cause dominant phenotypes like Macular dystrophy, vitelliform, 2 ( OMIM 153700) and Vitreoretinochoroidopathy (193220). | 600,25 |
| BSCL2 | Congenital generalized lipodystrophy, type 2; Encephalopathy, progressive, with or without lipodystrophy | NM_001122955.3 | NM_001122955.3:c.1166_1167insG, NM_001122955.3:c.1015C>T, NM_001122955.3:c.985C>T, NM_001122955.3:c.974dupG, NM_001122955.3:c.864-3C>G, NM_001122955.3:c.863+5G>A, NM_001122955.3:c.826G>C, NM_001122955.3:c.604C>T | Congenital generalized lipodystrophy (also called Berardinelli-Seip congenital lipodystrophy) type 2 is a rare condition caused by pathogenic variants in the BSCL2 gene located on chromosomal region 11q12.3. Its characterized by an almost total absence of adipose tissue and a very muscular appearance. A shortage of adipose tissue leads to multiple health problems, including high levels of fats called triglycerides circulating in the bloodstream (hypertriglyceridemia) and diabetes mellitus. In some cases, this form of the condition is also associated with intellectual disability, which is usually mild to moderate. Progressive encephalopathy follows an autosomal recessive pattern of inheritance and is also caused by pathogenic variants in the BSCL2 gene. This is a severe neurodegenerative disorder characterized by developmental regression of motor and cognitive skills in the first years of life, often leading to death in the first decade. Patients may show a mild or typical lipodystrophic appearance. | 600 |
| BSND | Bartter syndrome, type 4a | NM_057176.2 | NM_057176.2:c.1A>T, NM_057176.2:c.3G>A, NM_057176.2:c.10G>T, NM_057176.2:c.22C>T, NM_057176.2:c.23G>T, NM_057176.2:c.35T>C, NM_057176.2:c.139G>A | Bartter syndrome type 4A with deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSND gene located on chromosomal region 1p32.3. The age of onset is neonatal/infantile. This disease is characterized by maternal polyhydramnios, premature delivery, polyuria, sensorineural deafness and is associated with hypokalemic alkalosis, increased levels of plasma renin and aldosterone, low blood pressure, and vascular resistance to angiotensin II. | 600,25 |
| BTD | Biotinidase deficiency | NM_001281723.2 | NM_001281723.2:c.190G>A, NM_001281723.2:c.241C>T, NM_001281723.2:c.340G>C, NM_001281723.2:c.449G>A, NM_001281723.2:c.517G>A, NM_001281723.2:c.534G>T, NM_001281723.2:c.563G>A, NM_001281723.2:c.589A>G, NM_001281723.2:c.601G>A, NM_001281723.2:c.635A>G, NM_001281723.2:c.637C>T, NM_001281723.2:c.649C>T, NM_001281723.2:c.670G>A, NM_001281723.2:c.761A>G, NM_001281723.2:c.800A>T, NM_001281723.2:c.939delT, NM_001281723.2:c.1330delG, NM_001281723.2:c.1345C>T, NM_001281723.2:c.1358G>A, NM_001281723.2:c.1374A>C, NM_001281723.2:c.1495C>T, NM_001281723.2:c.1514_1518delGGATG, NM_001281723.2:c.1601C>T, NM_001281723.2:c.1618C>T | Biotinidase deficiency an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BTD gene located on chromosomal region 3p25. The age of onset is neonatal/infantile. This disease is characterized by seizures, breathing difficulties, hypotonia, skin rash, alopecia, hearing loss and delayed development. | 600,25 |
| BTK | Agammaglobulinemia X-linked, type 1 | NM_001287344.1 | NM_001287344.1:c.2008G>T, NM_001287344.1:c.1991T>A, NM_001287344.1:c.1940G>A, NM_001287344.1:c.1922C>A, NM_001287344.1:c.1875C>A, NM_001287344.1:c.1868A>G, NM_001287344.1:c.1661G>A, NM_001287344.1:c.1660C>T, NM_001287344.1:c.1618T>C, NM_001287344.1:c.1608C>A, NM_001287344.1:c.1390A>G, NM_001287344.1:c.1377C>A, NM_001287344.1:c.1325T>C, NM_001287344.1:c.1227T>G, NM_001287344.1:c.1184A>G, NM_001287344.1:c.1103A>C, NM_001287344.1:c.1021A>G, NM_001287344.1:c.964C>T, NM_001287344.1:c.865C>T, NM_001287344.1:c.857G>A, NM_001287344.1:c.820G>T, NM_001287344.1:c.440T>A | Agammaglobulinemia X-linked (XLA), type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the BTK gene located on chromosomal region Xq21.33-q22. The age of onset is neonatal. Individuals with XLA are more susceptible to infections because their body makes very few antibodies. In children with XLA, infections generally take longer to get better and then they come back again, even with antibiotic medications. The most common bacterial infections that occur in people with XLA are lung infections (pneumonia and bronchitis), ear infections (otitis), pink eye (conjunctivitis), and sinus infections (sinusitis). Infections that cause chronic diarrhea are also common. Recurrent infections can lead to organ damage. The X-linked form accounts for approximately 85 to 90% of cases of agammaglobulinemia. The prevalence is 3:1,000,000-6:1,000,000 men. | 600 |
| C3 | Complement C3 deficiency | NM_000064.3 | NM_000064.3:c.4851-1G>A, NM_000064.3:c.3627_3628insGGGGCCC, NM_000064.3:c.3116dupT, NM_000064.3:c.2562C>G, NM_000064.3:c.2354+1G>A, NM_000064.3:c.1119+1G>T, NM_000064.3:c.1004-2A>T | C3 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the C3 gene located on chromosomal region 19p13.3-p13.2. The age of onset is infantile. It is a rare defect of the complement classical pathway. The main clinical manifestation of primary C3 deficiency is childhood-onset of recurrent bacterial infections, mainly caused by gram-negative bacteria, such as Neisseria meningitidis, Enterobacter aerogenes, Haemophilus influenzae, and Escherichia coli; infections with gram-positive bacteria also occur. Infections in the upper and lower respiratory tract, including pneumonia, episodes of sinusitis, tonsillitis, and otitis, are the most frequent consequence of the C3 deficiency. Approximately 26% of patients with C3 deficiency develop immune complex-mediated autoimmune diseases resembling systemic lupus erythematosus, and about 26% of patients develop mesangiocapillary or membranoproliferative glomerulonephritis, resulting in renal failure (summary by Reis et al., 2006). The prevalence is <1:1.000.000. | 600 |
| CA2 | Osteopetrosis, autosomal recessive type 3 | NM_000067.2 | NM_000067.2:c.120T>G, NM_000067.2:c.319C>T, NM_000067.2:c.663+2T>C | Osteopetrosis, autosomal recessive, type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CA2 gene located on chromosomal region 8q22. The age of onset is neonatal/infantile. This disease is characterized by osteopetrosis, renal tubular acidosis, and neurological disorders related to cerebral calcifications. The prevalence is <1:1.000.000. | 600 |
| CAPN3 | Limb-girdle muscular dystrophy type 1 (LGMDR1; formerly LGMD2A) | NM_000070.2 | NM_000070.2:c.133G>A, NM_000070.2:c.223dupT, NM_000070.2:c.257C>T, NM_000070.2:c.328C>T, NM_000070.2:c.550delA, NM_000070.2:c.580delT, NM_000070.2:c.598_612delTTCTGGAGTGCTCTG, NM_000070.2:c.855_864dupGTTGATTGCA, NM_000070.2:c.956C>T, NM_000070.2:c.1322delG, NM_000070.2:c.1466G>A, NM_000070.2:c.1468C>T, NM_000070.2:c.1469G>A, NM_000070.2:c.1599_1602delGAGC, NM_000070.2:c.1715G>A, NM_000070.2:c.1795dupA, NM_000070.2:c.1838delA, NM_000070.2:c.2120A>G, NM_000070.2:c.2212C>T, NM_000070.2:c.2243G>A, NM_000070.2:c.2251_2254dupGTCA, NM_000070.2:c.2306G>A, NM_000070.2:c.2362_2363delAGinsTCATCT | Limb-girdle muscular dystrophy type 1 (LGMDR1; formerly LGMD2A) follows an autosomal recessive pattern of inheritance and is caused by biallelic pathogenic variants in the CAPN3 gene located on chromosomal region 15q15.1. The age of onset is variable. This disease is characterized by a variable age of onset of progressive, typically symmetrical and selective weakness and atrophy of proximal shoulder- and pelvic-girdle muscles (gluteus maximus, thigh adductors, and muscles of the posterior compartment of the limbs are most commonly affected) without cardiac or facial involvement. Clinical manifestations include exercise intolerance, a waddling gait, scapular winging and calf pseudo-hypertrophy.The prevalence is 1:100,000- 9:100,000. Genetic heterogeneity: Heterozygous mutation in the CAPN3 gene can cause autosomal dominant limb-girdle muscular dystrophy-4 (LGMDD4; OMIM 618129), which has a later onset and milder features. | 600,25 |
| CBS | Homocystinuria, B6-responsive and nonresponsive types | NM_000071.2 | NM_000071.2:c.1330G>A, NM_000071.2:c.1280C>T, NM_000071.2:c.1150A>G, NM_000071.2:c.1136G>A, NM_000071.2:c.1058C>T, NM_000071.2:c.1006C>T, NM_000071.2:c.992C>A, NM_000071.2:c.969G>A, NM_000071.2:c.959T>C, NM_000071.2:c.919G>A, NM_000071.2:c.833T>C, NM_000071.2:c.797G>A, NM_000071.2:c.689delT, NM_000071.2:c.676G>A, NM_000071.2:c.572C>T, NM_000071.2:c.526G>T, NM_000071.2:c.502G>A, NM_000071.2:c.434C>T, NM_000071.2:c.430G>A, NM_000071.2:c.415G>A, NM_000071.2:c.393G>C, NM_000071.2:c.374G>A, NM_000071.2:c.341C>T, NM_000071.2:c.325T>C, NM_000071.2:c.162G>A, NM_000071.2:c.146C>T | Homocystinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CBS gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by the multiple involvement of the eye, skeleton, central nervous system and vascular system. The prevalence is 1:200,000-1:335,000. | 600,25 |
| CC2D2A | Joubert syndrome type 9; Meckel syndrome type 6 | NM_001080522.2 | NM_001080522.2:c.2486+1G>C, NM_001080522.2:c.2848C>T, NM_001080522.2:c.3145C>T, NM_001080522.2:c.3289delG, NM_001080522.2:c.3364C>T, NM_001080522.2:c.3594+1G>A, NM_001080522.2:c.4179+1delG, NM_001080522.2:c.4181delG, NM_001080522.2:c.4333C>T, NM_001080522.2:c.4582C>T, NM_001080522.2:c.4667A>T | Joubert syndrome type 9 defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized neonatal hypotonia, developmental delay, intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia, primary position nystagmus and congenital hepatic fibrosis. | 600,25 |
| CD40LG | Immunodeficiency, X-linked, with hyper-IgM | NM_000074.2 | NM_000074.2:c.107T>G, NM_000074.2:c.368C>A | Immunodeficiency, X-linked, with hyper-IgM follows an X-linked pattern of inheritance and is caused by pathogenic variants in the CD40LG gene located on chromosomal region Xq26. The age of onset is neonatal/infantile. This disease is characterized by lower-respiratory tract bacterial infections, opportunistic infections, recurrent or protracted diarrhea associated with failure to thrive, neutropenia, thrombocytopenia and anemia. The prevalence is 2:1,000,000 male newborns. | 600 |
| CDH23 | Usher syndrome, type 1D | NM_022124.5 | NM_022124.5:c.146-2A>G, NM_022124.5:c.193delC, NM_022124.5:c.288+1G>A, NM_022124.5:c.1858+2T>G, NM_022124.5:c.3141C>A, NM_022124.5:c.3516_3519delATCC, NM_022124.5:c.3579+2T>C, NM_022124.5:c.4504C>T, NM_022124.5:c.5237G>A, NM_022124.5:c.5663T>C, NM_022124.5:c.6050-9G>A, NM_022124.5:c.6393delC, NM_022124.5:c.6442G>A | Non-syndromic autosomal recessive deafness type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. | 600,25 |
| CDH3 | Ectodermal dysplasia, ectrodactyly, and macular dystrophy | NM_001793.5 | NM_001793.5:c.461dupC, NM_001793.5:c.830delG, NM_001793.5:c.965A>T, NM_001793.5:c.981delG, NM_001793.5:c.1508G>A | Ectodermal dysplasia, ectrodactyly, and macular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH3 gene located on chromosomal region 16q22.1. The age of onset is neonatal/infantile. This disease is characterized by the association of ectodermal dysplasia, ectrodactyly, and macular dystrophy. The prevalence is <1:1,000,000. | 600 |
| CDHR1 | Cone-rod dystrophy, type 15 | NM_033100.3 | NM_033100.3:c.338delG, NM_033100.3:c.524dupA, NM_033100.3:c.640delG, NM_033100.3:c.1112delC, NM_033100.3:c.1463delG, NM_033100.3:c.1485+2T>C, NM_033100.3:c.1485+2T>G | Cone-rod dystrophy, type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDHR1 gene located on chromosomal region 10q23.1. This disease is characterized by decreased visual acuity and sensitivity in the central visual field, followed by loss of peripheral vision. The overall prevalence of all types of cone-rod dystrophy is 1-9:100,000. | 600,25 |
| CDK5RAP2 | Primary microcephaly type 3, autosomal recessive | NM_018249.5 | NM_018249.5:c.4672C>T, NM_018249.5:c.4658_4661dupTATT, NM_018249.5:c.4546G>T, NM_018249.5:c.700G>T, NM_018249.5:c.524_528delAGGCA, NM_018249.5:c.246T>A, NM_018249.5:c.127+1G>C | Primary autosomal recessive microcephaly type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDK5RAP2 gene located on chromosomal region 9q33.2. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. | 600 |
| CENPJ | Primary microcephaly type 6, autosomal recessive | NM_018451.4 | NM_018451.4:c.3842_3843dupTA, NM_018451.4:c.3704A>T, NM_018451.4:c.3699_3702dupAATA, NM_018451.4:c.3568_3571dupGTCA, NM_018451.4:c.3415G>T, NM_018451.4:c.3243_3246delTCAG, NM_018451.4:c.2968_2972delAAAAA, NM_018451.4:c.2614delT, NM_018451.4:c.2460_2463delGACG, NM_018451.4:c.1949_1952dupAGTG, NM_018451.4:c.757_760delGTCT, NM_018451.4:c.289dupA, NM_018451.4:c.232_236delCAGAA, NM_018451.4:c.40C>T | Primary autosomal recessive microcephaly type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CENPJ gene located on chromosomal region 13q12.12.ᅠThe age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. | 600,25 |
| CEP152 | Primary microcephaly type 9, autosomal recessive | NM_001194998.1 | NM_001194998.1:c.2034T>G, NM_001194998.1:c.1578-1G>A, NM_001194998.1:c.794A>C, NM_001194998.1:c.749_750delGA | Primary autosomal recessive microcephaly type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP152 gene located on chromosomal region 15q21.1. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. | 600 |
| CEP290 | Meckel syndrome type 4; Joubert syndrome type 5 | NM_025114.3 | NM_025114.3:c.7341dupA, NM_025114.3:c.7341delA, NM_025114.3:c.7324G>T, NM_025114.3:c.6798G>A, NM_025114.3:c.6645+1G>A, NM_025114.3:c.6624delG, NM_025114.3:c.6448_6455delCAGTTGAA, NM_025114.3:c.5668G>T, NM_025114.3:c.5611_5614delCAAA, NM_025114.3:c.4962_4963delAA, NM_025114.3:c.4916C>A, NM_025114.3:c.4723A>T, NM_025114.3:c.4705-1G>T, NM_025114.3:c.4656delA, NM_025114.3:c.4393C>T, NM_025114.3:c.3185delT, NM_025114.3:c.2249T>G, NM_025114.3:c.1681C>T, NM_025114.3:c.1665_1666delAA, NM_025114.3:c.1501G>T, NM_025114.3:c.613C>T, NM_025114.3:c.384_387delTAGA, NM_025114.3:c.164_167delCTCA, NM_025114.3:c.21G>T | Meckel syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is neonatal. This disease is characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically occipital encephalocele), hepatic ductal dysplasia and cysts, and postaxial polydactyly. The prevalence is <1/1,000,000. | 600,25 |
| CERKL | Retinitis pigmentosa type 26 | NM_001030311.2 | NM_001030311.2:c.1090C>T, NM_001030311.2:c.858delT, NM_001030311.2:c.847C>T, NM_001030311.2:c.312delA | Retinitis pigmentosa 26 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CERKL gene located on chromosomal region 2q31.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000. | 600,25 |
| CFH | Complement factor H deficiency | NM_000186.3 | NM_000186.3:c.380G>T, NM_000186.3:c.1606T>C, NM_000186.3:c.2876G>A | Complement factor H deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFH gene located on chromosomal region 1q32. This disease is characterized by increased susceptibility to recurrent, usually severe, infections (particularly by Neisseria meningitidis, Escherichia coli, and Haemophilus influenzae), renal impairment and/or autoimmune diseases. | 600,25 |
| CFTR | Cystic fibrosis | NM_000492.3 | NM_000492.3:c.1A>G, NM_000492.3:c.4C>T, NM_000492.3:c.11C>A, NM_000492.3:c.50delT, NM_000492.3:c.44T>C, NM_000492.3:c.53+1G>T, NM_000492.3:c.57G>A, NM_000492.3:c.79G>T, NM_000492.3:c.88C>T, NM_000492.3:c.115C>T, NM_000492.3:c.137C>A, NM_000492.3:c.164+1G>A, NM_000492.3:c.164+1G>T, NM_000492.3:c.164+2T>C, NM_000492.3:c.164+4dupT, NM_000492.3:c.165-3C>T, NM_000492.3:c.165-1G>A, NM_000492.3:c.166G>A, NM_000492.3:c.169T>G, NM_000492.3:c.170G>A, NM_000492.3:c.171G>A, NM_000492.3:c.174_177delTAGA, NM_000492.3:c.175dupA, NM_000492.3:c.178G>A, NM_000492.3:c.178G>T, NM_000492.3:c.200C>T, NM_000492.3:c.223C>T, NM_000492.3:c.233dupT, NM_000492.3:c.254G>A, NM_000492.3:c.262_263delTT, NM_000492.3:c.263T>A, NM_000492.3:c.263T>G, NM_000492.3:c.271G>A, NM_000492.3:c.273+1G>A, NM_000492.3:c.273+3A>C, NM_000492.3:c.274-2A>G, NM_000492.3:c.274-1G>A, NM_000492.3:c.274G>A, NM_000492.3:c.274G>T, NM_000492.3:c.292C>T, NM_000492.3:c.305T>G, NM_000492.3:c.310delA, NM_000492.3:c.313delA, NM_000492.3:c.325_327delTATinsG, NM_000492.3:c.328G>C, NM_000492.3:c.328G>T, NM_000492.3:c.349C>T, NM_000492.3:c.350G>A, NM_000492.3:c.350G>T, NM_000492.3:c.366T>A, NM_000492.3:c.409delC, NM_000492.3:c.413_415dupTAC, NM_000492.3:c.416A>G, NM_000492.3:c.442delA, NM_000492.3:c.445G>A, NM_000492.3:c.445G>T, NM_000492.3:c.446G>T, NM_000492.3:c.489+1G>T, NM_000492.3:c.531delT, NM_000492.3:c.532G>A, NM_000492.3:c.543_546delTAGT, NM_000492.3:c.571T>G, NM_000492.3:c.577G>T, NM_000492.3:c.579+1G>T, NM_000492.3:c.579+3A>G, NM_000492.3:c.579+5G>A, NM_000492.3:c.580-1G>T, NM_000492.3:c.595C>T, NM_000492.3:c.613C>T, NM_000492.3:c.617T>G, NM_000492.3:c.647G>A, NM_000492.3:c.658C>T, NM_000492.3:c.680T>G, NM_000492.3:c.695T>A, NM_000492.3:c.708delT, NM_000492.3:c.717delG, NM_000492.3:c.803delA, NM_000492.3:c.825C>G, NM_000492.3:c.828C>A, NM_000492.3:c.850dupA, NM_000492.3:c.861_865delCTTAA, NM_000492.3:c.935_937delTCT, NM_000492.3:c.933C>G, NM_000492.3:c.948delT, NM_000492.3:c.987delA, NM_000492.3:c.988G>T, NM_000492.3:c.1000C>T, NM_000492.3:c.1001G>T, NM_000492.3:c.1006_1007insG, NM_000492.3:c.1007T>A, NM_000492.3:c.1013C>T, NM_000492.3:c.1021_1022dupTC, NM_000492.3:c.1021T>C, NM_000492.3:c.1029delC, NM_000492.3:c.1037T>C, NM_000492.3:c.1040G>A, NM_000492.3:c.1040G>C, NM_000492.3:c.1055G>A, NM_000492.3:c.1075C>A, NM_000492.3:c.1079C>A, NM_000492.3:c.1081delT, NM_000492.3:c.1116+1G>A, NM_000492.3:c.1117-1G>A, NM_000492.3:c.1130dupA, NM_000492.3:c.1155_1156dupTA, NM_000492.3:c.1202G>A, NM_000492.3:c.1203G>A, NM_000492.3:c.1209+1G>A, NM_000492.3:c.1211delG, NM_000492.3:c.1240C>T, NM_000492.3:c.1301_1307delCACTTCT, NM_000492.3:c.1327_1330dupGATA, NM_000492.3:c.1340delA, NM_000492.3:c.1364C>A, NM_000492.3:c.1365_1366delGG, NM_000492.3:c.1393-2A>G, NM_000492.3:c.1393-1G>A, NM_000492.3:c.1397C>A, NM_000492.3:c.1397C>G, NM_000492.3:c.1400T>C, NM_000492.3:c.1418delG, NM_000492.3:c.1420G>A, NM_000492.3:c.1438G>T, NM_000492.3:c.1466C>A, NM_000492.3:c.1475C>T, NM_000492.3:c.1477_1478delCA, NM_000492.3:c.1477C>T, NM_000492.3:c.1487G>A, NM_000492.3:c.1505T>C, NM_000492.3:c.1519_1521delATC, NM_000492.3:c.1516A>G, NM_000492.3:c.1519A>G, NM_000492.3:c.1521_1523delCTT, NM_000492.3:c.1523T>G, NM_000492.3:c.1538A>G, NM_000492.3:c.1545_1546delTA, NM_000492.3:c.1558G>T, NM_000492.3:c.1572C>A, NM_000492.3:c.1573C>T, NM_000492.3:c.1584+1G>A, NM_000492.3:c.1585-8G>A, NM_000492.3:c.1585-1G>A, NM_000492.3:c.1624G>T, NM_000492.3:c.1645A>C, NM_000492.3:c.1646G>A, NM_000492.3:c.1647T>G, NM_000492.3:c.1648G>T, NM_000492.3:c.1650delA, NM_000492.3:c.1651G>A, NM_000492.3:c.1652G>A, NM_000492.3:c.1654C>T, NM_000492.3:c.1657C>T, NM_000492.3:c.1670delC, NM_000492.3:c.1673T>C, NM_000492.3:c.1675G>A, NM_000492.3:c.1679G>A, NM_000492.3:c.1679G>C, NM_000492.3:c.1679+1G>A, NM_000492.3:c.1679+1G>C, NM_000492.3:c.1680-886A>G, NM_000492.3:c.1680-1G>A, NM_000492.3:c.1682C>A, NM_000492.3:c.1692delA, NM_000492.3:c.1703delT, NM_000492.3:c.1705T>G, NM_000492.3:c.1721C>A, NM_000492.3:c.1753G>T, NM_000492.3:c.1766+1G>A, NM_000492.3:c.1766+1G>C, NM_000492.3:c.1766+1G>T, NM_000492.3:c.1766+3A>G, NM_000492.3:c.1766+5G>T, NM_000492.3:c.1792_1798delAAAACTA, NM_000492.3:c.1826A>G, NM_000492.3:c.1882G>C, NM_000492.3:c.1923_1931delCTCAAAACTinsA, NM_000492.3:c.1973_1985delGAAATTCAATCCTinsAGAAA, NM_000492.3:c.1986_1989delAACT, NM_000492.3:c.2012delT, NM_000492.3:c.2017G>T, NM_000492.3:c.2052dupA, NM_000492.3:c.2052delA, NM_000492.3:c.2051_2052delAAinsG, NM_000492.3:c.2053dupC, NM_000492.3:c.2053C>T, NM_000492.3:c.2125C>T, NM_000492.3:c.2128A>T, NM_000492.3:c.2143C>T, NM_000492.3:c.2158C>T, NM_000492.3:c.2175dupA, NM_000492.3:c.2195T>G, NM_000492.3:c.2215delG, NM_000492.3:c.2241_2248delGATACTGC, NM_000492.3:c.2290C>T, NM_000492.3:c.2353C>T, NM_000492.3:c.2374C>T, NM_000492.3:c.2423_2424dupAT, NM_000492.3:c.2453delT, NM_000492.3:c.2463_2464delTG, NM_000492.3:c.2464G>T, NM_000492.3:c.2490+1G>A, NM_000492.3:c.2491G>T, NM_000492.3:c.2537G>A, NM_000492.3:c.2538G>A, NM_000492.3:c.2547C>A, NM_000492.3:c.2551C>T, NM_000492.3:c.2583delT, NM_000492.3:c.2589_2599delAATTTGGTGCT, NM_000492.3:c.2601dupA, NM_000492.3:c.2645G>A, NM_000492.3:c.2657+5G>A, NM_000492.3:c.2658-1G>C, NM_000492.3:c.2668C>T, NM_000492.3:c.2735C>A, NM_000492.3:c.2737_2738insG, NM_000492.3:c.2739T>A, NM_000492.3:c.2763_2764dupAG, NM_000492.3:c.2780T>C, NM_000492.3:c.2810dupT, NM_000492.3:c.2825delT, NM_000492.3:c.2834C>T, NM_000492.3:c.2869_2870insG, NM_000492.3:c.2875delG, NM_000492.3:c.2896delA, NM_000492.3:c.2908G>C, NM_000492.3:c.2930C>T, NM_000492.3:c.2936A>T, NM_000492.3:c.2988G>A, NM_000492.3:c.2988+1G>A, NM_000492.3:c.2989-2A>G, NM_000492.3:c.2989-1G>A, NM_000492.3:c.3002_3003delTG, NM_000492.3:c.3011_3019delCTATAGCAG, NM_000492.3:c.3017C>A, NM_000492.3:c.3039dupC, NM_000492.3:c.3039delC, NM_000492.3:c.3067_3072delATAGTG, NM_000492.3:c.3080T>C, NM_000492.3:c.3107C>A, NM_000492.3:c.3124C>T, NM_000492.3:c.3139_3139+1delGG, NM_000492.3:c.3140-26A>G, NM_000492.3:c.3160C>G, NM_000492.3:c.3181G>C, NM_000492.3:c.3194T>C, NM_000492.3:c.3196C>T, NM_000492.3:c.3197G>A, NM_000492.3:c.3205G>A, NM_000492.3:c.3209G>A, NM_000492.3:c.3230T>C, NM_000492.3:c.3266G>A, NM_000492.3:c.3276C>A, NM_000492.3:c.3276C>G, NM_000492.3:c.3292T>C, NM_000492.3:c.3293G>A, NM_000492.3:c.3294G>A, NM_000492.3:c.3294G>C, NM_000492.3:c.3294G>T, NM_000492.3:c.3302T>A, NM_000492.3:c.3302T>G, NM_000492.3:c.3304A>T, NM_000492.3:c.3310G>T, NM_000492.3:c.3353C>T, NM_000492.3:c.3368-2A>G, NM_000492.3:c.3435G>A, NM_000492.3:c.3454G>C, NM_000492.3:c.3468G>A, NM_000492.3:c.3468+5G>A, NM_000492.3:c.3472C>T, NM_000492.3:c.3484C>T, NM_000492.3:c.3528delC, NM_000492.3:c.3532_3535dupTCAA, NM_000492.3:c.3536_3539delCCAA, NM_000492.3:c.3587C>G, NM_000492.3:c.3605delA, NM_000492.3:c.3611G>A, NM_000492.3:c.3612G>A, NM_000492.3:c.3659delC, NM_000492.3:c.3691delT, NM_000492.3:c.3700A>G, NM_000492.3:c.3717+4A>G, NM_000492.3:c.3717+5G>A, NM_000492.3:c.3717+40A>G, NM_000492.3:c.3718-2477C>T, NM_000492.3:c.3718-3T>G, NM_000492.3:c.3718-1G>A, NM_000492.3:c.3719T>G, NM_000492.3:c.3731G>A, NM_000492.3:c.3744delA, NM_000492.3:c.3747delG, NM_000492.3:c.3752G>A, NM_000492.3:c.3761T>G, NM_000492.3:c.3763T>C, NM_000492.3:c.3764C>A, NM_000492.3:c.3773dupT, NM_000492.3:c.3846G>A, NM_000492.3:c.3848G>T, NM_000492.3:c.3873+1G>A, NM_000492.3:c.3873+2T>C, NM_000492.3:c.3883_3886delATTT, NM_000492.3:c.3883delA, NM_000492.3:c.3889dupT, NM_000492.3:c.3891dupT, NM_000492.3:c.3908delA, NM_000492.3:c.3909C>G, NM_000492.3:c.3937C>T, NM_000492.3:c.3971T>C, NM_000492.3:c.4036_4042delCTAAGCC, NM_000492.3:c.4046G>A, NM_000492.3:c.4077_4080delTGTTinsAA, NM_000492.3:c.4086dupT, NM_000492.3:c.4111G>T, NM_000492.3:c.4127_4131delTGGAT, NM_000492.3:c.4144C>T, NM_000492.3:c.4147dupA, NM_000492.3:c.4197_4198delCT, NM_000492.3:c.4231C>T, NM_000492.3:c.4234C>T, NM_000492.3:c.4242+1G>A, NM_000492.3:c.4242+1G>T, NM_000492.3:c.4251delA, NM_000492.3:c.4300_4301dupAG, NM_000492.3:c.4426C>T | Cystic fibrosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFTR gene located on chromosomal region 7q31.2. The age of onset of severe form is neonatal or infantile but there are also variants associated with moderate clinical or late onset. This disease is characterized by the production of sweat with a high salt content, mucus secretions with an abnormal viscosity, chronic bronchitis, pancreatic insufficiency, adolescent diabetes and, more rarely, stercoral obstruction and cirrhosis. Male sterility is a constant feature. Late-onset forms, which are usually only mild or monosymptomatic. The prevalence is 1:10,000-9:10,000. | 600,25 |
| CHST6 | Macular corneal dystrophy | NM_021615.4 | NM_021615.4:c.853delC, NM_021615.4:c.820G>T, NM_021615.4:c.392C>A, NM_021615.4:c.327_328delCT | Macular corneal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CHST6 gene located on chromosomal region 16q22. The age of onset is variable. This disease is characterized by bilateral ill-defined cloudy regions within a hazy stroma, and eventually severe visual impairment. The prevalence is 1:100,000-9:100,000. | 600,25 |
| CLCN1 | Myotonia congenita, recessive | NM_000083.2 | NM_000083.2:c.180+3A>T, NM_000083.2:c.225dupC, NM_000083.2:c.409T>G, NM_000083.2:c.871G>A, NM_000083.2:c.1238T>G, NM_000083.2:c.1453A>G, NM_000083.2:c.2680C>T | Myotonia congenita follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN1 gene located on chromosomal region 7q35. The age of onset is neonatal/infantile. This is a nondystrophic skeletal muscle disorder characterized by muscle stiffness and an inability of the muscle to relax after voluntary contraction. Most patients have symptom onset in the legs, which later progresses to the arms, neck, and facial muscles. Many patients show marked hypertrophy of the lower limb muscles. The prevalence is 1:100,000. | 600,25 |
| CLCN7 | Osteopetrosis, autosomal recessive type 4 | NM_001287.5 | NM_001287.5:c.781A>T, NM_001287.5:c.622C>T | Osteopetrosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN7 gene located on chromosomal region 16p13. The age of onset is neonatal/infantile. This disease is characterized bone marrow failure, fractures and visual impairment. The incidence is 1:200,000 live births and the prevalence is 1:100,000. | 600 |
| CLDN14 | Deafness type 29, autosomal recessive | NM_001146077.1 | NM_001146077.1:c.398delT, NM_001146077.1:c.301G>A, NM_001146077.1:c.254T>A | Deafness type 29, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN14 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. | 600 |
| CLDN19 | Rena hypomagnesemia type 5, with ocular involvement | NM_148960.2 | NM_148960.2:c.425_437delCCCTGGTGACCCA, NM_148960.2:c.269T>C, NM_148960.2:c.169C>G, NM_148960.2:c.59G>A | Renal hypomagnesemia type 5, with ocular involvement follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN19 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by excessive magnesium and calcium renal wasting, bilateral nephrocalcinosis, progressive renal failure and severe ocular abnormalities. The prevalence is <1:1,000,000. | 600,25 |
| CLN3 | Ceroid lipofuscinosis, neuronal, type 3 | NM_000086.2 | NM_000086.2:c.1272delG, NM_000086.2:c.883G>A, NM_000086.2:c.622dupT, NM_000086.2:c.597C>A | Juvenile neuronal ceroid lipofuscinosis 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN3 gene located on chromosomal region 16p12.1. The age of onset is infantile. This disease is characterized by onset at early school age with vision loss due to retinopathy, seizures and the decline of mental and motor capacities. The annual birth incidence is 1:217,000-1:450,000 in Sweden and 1:143,000 in Germany, and the prevalence is 1.5:1,000,000-9:1,000,000. | 600 |
| CLN5 | Ceroid lipofuscinosis, neuronal, type 5 | NM_006493.2 | NM_006493.2:c.335G>C, NM_006493.2:c.377G>A, NM_006493.2:c.433C>T, NM_006493.2:c.524T>G, NM_006493.2:c.526dupA, NM_006493.2:c.565C>T, NM_006493.2:c.575A>G, NM_006493.2:c.593T>C, NM_006493.2:c.595C>T, NM_006493.2:c.613C>T, NM_006493.2:c.620G>C, NM_006493.2:c.669dupC, NM_006493.2:c.835G>A, NM_006493.2:c.919delA, NM_006493.2:c.924_925delAT, NM_006493.2:c.1026C>A | Neuronal ceroid lipofuscinosis type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN5 gene located on chromosomal region 3q21.1-q32. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy and vision loss through retinal degeneration. The prevalence is <1:1,000,000. | 600 |
| CLN6 | Ceroid lipofuscinosis, neuronal, type 6 | NM_017882.2 | NM_017882.2:c.663C>G, NM_017882.2:c.214G>T, NM_017882.2:c.200T>C | Neuronal ceroid lipofuscinosis 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN6 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy and vision loss through retinal degeneration. The prevalence is <1:1,000,000. | 600 |
| CLN8 | Ceroid lipofuscinosis, neuronal, type 8 | NM_018941.3 | NM_018941.3:c.88delG, NM_018941.3:c.88G>C, NM_018941.3:c.610C>T, NM_018941.3:c.789G>C | Neuronal ceroid lipofuscinosis 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLN8 gene located on chromosomal region 8p23.3. The age of onset is infantile. This disease is characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy, and vision loss through retinal degeneration. The prevalence is <1:1,000,000. | 600 |
| CLRN1 | Usher syndrome, type 3A | NM_001195794.1 | NM_001195794.1:c.669_670insT, NM_001195794.1:c.630dupT, NM_001195794.1:c.189C>A, NM_001195794.1:c.144T>G, NM_001195794.1:c.118T>G, NM_001195794.1:c.92C>T | Usher syndrome type 3A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1 gene located on chromosomal region 3q25.1. The age of onset is neonatal/infantile. This disease is characterized by the association of sensorineural deafness with retinitis pigmentosa and progressive vision loss. The prevalence is 1:1.000.000- 9/1.000.000. | 600,25 |
| CNGA1 | Retinitis pigmentosa type 49 | NM_001142564.1 | NM_001142564.1:c.2179delA, NM_001142564.1:c.2134C>T, NM_001142564.1:c.1747C>T, NM_001142564.1:c.1166C>T, NM_001142564.1:c.1001G>A, NM_001142564.1:c.656+2T>C, NM_001142564.1:c.445G>T, NM_001142564.1:c.304dupA | Retinitis pigmentosa 49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGA1 gene located on chromosomal region 4p12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000. | 600,25 |
| CNGB1 | Retinitis pigmentosa type 45 | NM_001297.4 | NM_001297.4:c.3462+1G>A, NM_001297.4:c.3425delT, NM_001297.4:c.3150delG, NM_001297.4:c.2762_2765delACGA, NM_001297.4:c.2653delG, NM_001297.4:c.2492+2T>G, NM_001297.4:c.1958-1G>A, NM_001297.4:c.1122-2A>T, NM_001297.4:c.952C>T, NM_001297.4:c.413-1G>A, NM_001297.4:c.218-2A>G | Retinitis pigmentosa 45 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB1 gene located on chromosomal region 16q13. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000 to 5:10,000. | 600,25 |
| CNGB3 | Achromatopsia type 3 | NM_019098.4 | NM_019098.4:c.2048_2049delCA, NM_019098.4:c.2011G>T, NM_019098.4:c.1148delC, NM_019098.4:c.1063C>T, NM_019098.4:c.893_897delCAAAA, NM_019098.4:c.887_896delCTTCTACAAA, NM_019098.4:c.886_890delACTTC, NM_019098.4:c.819_826delCAGACTCC, NM_019098.4:c.446_447insT | Achromatopsia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is neonatal/Infantile. This disease is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, and reduced or complete loss of color discrimination. Most individuals have complete form, with total lack of function in all three types of cones. Rarely, individuals have incomplete form, with similar, but generally less severe symptoms. The prevalence is 1/30,000-1/50,000. | 600,25 |
| COL11A1 | Fibrochondrogenesis type 1 | NM_080629.2 | NM_080629.2:c.3745-1G>A, NM_080629.2:c.2386G>C, NM_080629.2:c.1786dupG | Fibrochondrogenesis type 1 (FBCG1) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL11A1 gene located on chromosomal region 1p21. The age of onset is neonatal. Fibrochondrogenesis is a severe short-limbed skeletal dysplasia clinically characterized by a flat midface with a small nose and anteverted nares, significant shortening of all limb segments but relatively normal hands and feet, and a small bell-shaped thorax with a protuberant abdomen. Radiographically, the long bones are short and have broad metaphyseal ends, giving them a dumb-bell shape. The vertebral bodies are flat and, on lateral view, have a distinctive pinched appearance, with a hypoplastic posterior end and a rounded anterior end. The ribs are typically short and wide and have metaphyseal cupping at both ends (Tompson et al., 2010). Genetic heterogeneity: Fibrochondrogenesis type 2 (FBCG2; OMIM 614524) is caused by mutations in the COL11A2 gene on chromosome 6p21.3. | 600 |
| COL17A1 | Epidermolysis bullosa, junctional, non-Herlitz type | NM_000494.3 | NM_000494.3:c.4319dupC, NM_000494.3:c.4003_4004delGG, NM_000494.3:c.3908G>A, NM_000494.3:c.3897_3900delATCT, NM_000494.3:c.3827dupC, NM_000494.3:c.3795delC, NM_000494.3:c.3676C>T, NM_000494.3:c.3277+1G>A, NM_000494.3:c.3067C>T, NM_000494.3:c.3043C>T, NM_000494.3:c.2965delA, NM_000494.3:c.2944_2947+1delGAAGG, NM_000494.3:c.2564T>G, NM_000494.3:c.2551+1G>T, NM_000494.3:c.2430_2431insCCGA, NM_000494.3:c.2383C>T, NM_000494.3:c.2336-1G>T, NM_000494.3:c.2336-2A>G, NM_000494.3:c.2228-3_2235delCAGGTCCTGCTinsTTG, NM_000494.3:c.1898G>A, NM_000494.3:c.1706delC, NM_000494.3:c.520_521delAG, NM_000494.3:c.433C>T | Epidermolysis bullosa, junctional, non-Herlitz type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL17A1 gene located on chromosomal region 10q24.3. The age of onset is neonatal/infantile. This disease is characterized by a generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement. | 600,25 |
| COL18A1 | Knobloch syndrome, type 1 | NM_130444.2 | NM_130444.2:c.1700_1701insGACGTGAAAGAGGGG, NM_130444.2:c.2240_2241insGACGTGAAAGAGGGG, NM_130444.2:c.3294_3295delAG, NM_130444.2:c.3502C>T, NM_130444.2:c.4072_4084delCCCCCAGGCCCAC, NM_130444.2:c.4214_4223delCAGGGCCCCC, NM_130444.2:c.4222_4223delCC, NM_130444.2:c.4323_4323+1delGG, NM_130444.2:c.4759_4760delCT, NM_130444.2:c.5168dupG | Knobloch syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL18A1 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by vitreoretinal and macular degeneration, and occipital encephalocele.ᅠThe prevalence is <1:1,000,000. | 600,25 |
| COL1A2 | Ehlers-Danlos syndrome, cardiac valvular type | NM_000089.3 | NM_000089.3:c.133-1G>A, NM_000089.3:c.241_248delTATGATGG, NM_000089.3:c.293dupC, NM_000089.3:c.1404+1G>A, NM_000089.3:c.1404+1G>C, NM_000089.3:c.3601G>T | Ehlers-Danlos syndrome, cardiac valvular type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL1A2 gene located on chromosomal region 7q22.1. The age of onset is neonatal/infantile. This disease is characterized by joint hypermobility, skin hyperextensibility and cardiac valvular defects.ᅠThe prevalence is 6/100,000 to 7/100,000. | 600 |
| COL4A3 | Alport syndrome 3B, autosomal recessive | NM_000091.4 | NM_000091.4:c.345delG, NM_000091.4:c.898G>A, NM_000091.4:c.2083G>A, NM_000091.4:c.2111delC, NM_000091.4:c.2954G>T, NM_000091.4:c.4420_4424delCTTTT, NM_000091.4:c.4441C>T, NM_000091.4:c.4571C>G | Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn. | 600,25 |
| COL4A4 | Alport syndrome, autosomal recessive | NM_000092.4 | NM_000092.4:c.4923C>A, NM_000092.4:c.4129C>T, NM_000092.4:c.3713C>A, NM_000092.4:c.3601G>A, NM_000092.4:c.2312delG, NM_000092.4:c.71+1G>A | Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn. | 600,25 |
| COL7A1 | Epidermolysis bullosa dystrophica, AR | NM_000094.3 | NM_000094.3:c.8524_8527+10delGAAGGTGAGGACAG, NM_000094.3:c.8479C>T, NM_000094.3:c.8440C>T, NM_000094.3:c.8393T>A, NM_000094.3:c.8245G>A, NM_000094.3:c.7957G>A, NM_000094.3:c.7930-1G>C, NM_000094.3:c.7912G>T, NM_000094.3:c.7411C>T, NM_000094.3:c.7345-1G>A, NM_000094.3:c.6946G>A, NM_000094.3:c.6859G>A, NM_000094.3:c.6752G>A, NM_000094.3:c.6670G>T, NM_000094.3:c.6573+1G>T, NM_000094.3:c.6527dupC, NM_000094.3:c.6205C>T, NM_000094.3:c.6187C>T, NM_000094.3:c.6091G>A, NM_000094.3:c.5821-1G>A, NM_000094.3:c.5532+1G>A, NM_000094.3:c.5287C>T, NM_000094.3:c.5096C>T, NM_000094.3:c.5052+1G>A, NM_000094.3:c.4888C>T, NM_000094.3:c.4783G>C, NM_000094.3:c.4373C>T, NM_000094.3:c.4119+1G>T, NM_000094.3:c.4039G>C, NM_000094.3:c.3831+1G>T, NM_000094.3:c.2471dupG, NM_000094.3:c.933C>A, NM_000094.3:c.887delG, NM_000094.3:c.706C>T, NM_000094.3:c.425A>G, NM_000094.3:c.336C>G | Epidermolysis bullosa dystrophica follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL7A1 gene located on chromosomal region 3p21.1. The age of onset is neonatal/infantile. This disease is characterized by generalized cutaneous and mucosal blistering and scarring associated with severe deformities and major extracutaneous involvement. The prevalence is <1:1,000,000. | 600,25 |
| COL9A1 | Stickler syndrome, type 4 | NM_001851.4 | NM_001851.4:c.883C>T, NM_001851.4:c.706C>T | Stickler syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL9A1 gene located on chromosomal region 6q13. The age of onset is infantile. This disease is characterized by opthalmological (myopia, retinal detachment and cataracts), orofacial (micrognathia, midface hypoplasia and cleft palate) auditory (sensorineural hearing loss) and articular (epiphyseal dysplasia) symptoms. The prevalence is <1:1,000,000. | 600 |
| COQ2 | Primary coenzyme Q10 deficiency, type 1 | NM_015697.7 | NM_015697.7:c.1197delT, NM_015697.7:c.890A>G, NM_015697.7:c.723delT, NM_015697.7:c.683A>G, NM_015697.7:c.590G>A | Primary coenzyme Q10 deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ2 gene located on chromosomal region 4q21.23. The age of onset is neonatal/infantile. The phenotypes include an encephalomyopathic form with seizures and ataxia; a multisystem infantile form with encephalopathy, cardiomyopathy and renal failure; a predominantly cerebellar form with ataxia and cerebellar atrophy; Leigh syndrome with growth retardation; and an isolated myopathic form. | 600,25 |
| COQ8A | Primary coenzyme Q10 deficiency, type 4 | NM_020247.4 | NM_020247.4:c.589-3C>G, NM_020247.4:c.637C>T, NM_020247.4:c.815G>A, NM_020247.4:c.815G>T, NM_020247.4:c.911C>T, NM_020247.4:c.1541A>G, NM_020247.4:c.1645G>A, NM_020247.4:c.1651G>A, NM_020247.4:c.1750_1752delACC, NM_020247.4:c.1813dupG | Primary coenzyme Q10 deficiency type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ8A gene located on chromosomal region 1q42.13. The age of onset is infantile. This disease is characterized by progressive ataxia, cerebellar atrophy, and often exercise intolerance with elevated lactate levels and mild intellectual deficit. | 600,25 |
| CPS1 | Carbamoylphosphate synthetase 1 deficiency | NM_001122633.2 | NM_001122633.2:c.1649C>T, NM_001122633.2:c.1930C>T, NM_001122633.2:c.3574delA | Carbamoylphosphate synthetase deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPS1 gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by congenital hyperammonemia and defective citrulline synthesis. The prevalence is 1:800,000 newborn in Japan. | 600 |
| CPT1A | Carnitine palmitoyltransferase type 1A deficiency, hepatic | NM_001876.3 | NM_001876.3:c.1436C>T, NM_001876.3:c.1393G>T, NM_001876.3:c.1361A>G, NM_001876.3:c.1241C>T, NM_001876.3:c.1216C>T, NM_001876.3:c.1079A>G, NM_001876.3:c.335_336delCC, NM_001876.3:c.298C>T, NM_001876.3:c.281+1G>A, NM_001876.3:c.222C>A | Carnitine palmitoyl transferase 1A deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT1A gene located on chromosomal region 11q13.2. The age of onset is neonatal/infantile. This disease is characterized by recurrent attacks of fasting-induced hypoketotic hypoglycemia and risk of liver failure. The prevalence is 1.3:1,000 newborn. | 600 |
| CPT2 | Carnitine palmitoyltransferase type 2 deficiency, lethal neonatal | NM_000098.2 | NM_000098.2:c.149C>A, NM_000098.2:c.338C>T, NM_000098.2:c.359A>G, NM_000098.2:c.370C>T, NM_000098.2:c.452G>A, NM_000098.2:c.464dupT, NM_000098.2:c.520G>A, NM_000098.2:c.638A>G, NM_000098.2:c.680C>T, NM_000098.2:c.725_726delAC, NM_000098.2:c.886C>T, NM_000098.2:c.1148T>A, NM_000098.2:c.1237C>T, NM_000098.2:c.1239_1240delGA, NM_000098.2:c.1369A>T, NM_000098.2:c.1437C>G, NM_000098.2:c.1784delC, NM_000098.2:c.1883A>C, NM_000098.2:c.1891C>T | Carnitine palmitoyltransferase deficiency, type 2, lethal neonatal form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT2 gene located on chromosomal region 1p32. The age of onset is neonatal/infantile. This disease is characterized by a severe fasting intolerance leading to metabolic derangements of hypoketotic hypoglycemia, resulting in coma and seizures, and hepatic encephalopathy leading to liver failure.ᅠThe prevalence is <1:1,000,000. | 600,25 |
| CRB1 | Retinitis pigmentosa type 12, AR; Leber congenital amaurosis type 8 | NM_201253.2 | NM_201253.2:c.498_506delAATTGATGG, NM_201253.2:c.613_619delATAGGAA, NM_201253.2:c.2290C>T, NM_201253.2:c.2401A>T, NM_201253.2:c.2416G>T, NM_201253.2:c.2688T>A, NM_201253.2:c.2983G>T, NM_201253.2:c.3055_3059dupTATAT, NM_201253.2:c.3122T>C, NM_201253.2:c.3299T>C, NM_201253.2:c.3299T>G, NM_201253.2:c.3383delT, NM_201253.2:c.3419T>A, NM_201253.2:c.3997G>T | Retinitis pigmentosa type 12 and leber congenital amaurosis type 8 follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. Retinitis pigmentosa type 12 is characterized by night blindness, peripheral visual field impairment and over time loss of central visionm, and its prevalence is 1-5:10,000. Leber congenital amaurosis, with a neonatal/infantile age of onset, comprises a group of early-onset childhood retinal dystrophies characterized by vision loss, nystagmus, and severe retinal dysfunction. Patients usually present at birth with profound vision loss and pendular nystagmus. Other clinical findings of this disease may include high hypermetropia, photodysphoria, oculodigital sign, keratoconus, cataracts, and a variable appearance to the fundus. | 600,25 |
| CRLF1 | Cold-induced sweating syndrome type 1 | NM_004750.4 | NM_004750.4:c.1137C>G, NM_004750.4:c.1125delG, NM_004750.4:c.935G>A, NM_004750.4:c.856-1G>A, NM_004750.4:c.852G>T, NM_004750.4:c.845_846delTG, NM_004750.4:c.829C>T, NM_004750.4:c.713dupC, NM_004750.4:c.708_709delCCinsT, NM_004750.4:c.676dupA, NM_004750.4:c.538C>T, NM_004750.4:c.527+5G>A, NM_004750.4:c.413C>T, NM_004750.4:c.397+1G>A, NM_004750.4:c.303delC, NM_004750.4:c.226T>G | Cold-induced sweating syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRLF1 gene located on chromosomal region 19p12. The age of onset is infantile. This disease is characterized by profuse sweating (involving the chest, face, arms and trunk) induced by cold ambient temperature kyphoscoliosis, a high-arched palate, depressed nasal bridge and impaired peripheral sensitivity to pain and temperature. The prevalence is <1:1,000,000. | 600 |
| CRTAP | Osteogenesis imperfecta, type 7 | NM_006371.4 | NM_006371.4:c.180G>A, NM_006371.4:c.561T>G, NM_006371.4:c.634C>T, NM_006371.4:c.826C>T | Osteogenesis imperfecta type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRTAP gene located on chromosomal region 3p22.3. The age of onset is variable. This disease is characterized by increased bone fragility, low bone mass, and susceptibility to bone fractures with variable severity. The prevalence is 6:100,000-7:100,000. | 600 |
| CSTB | Epilepsy, progressive myoclonic type 1A (Unverricht and Lundborg) | NM_000100.3 | NM_000100.3:c.212A>C, NM_000100.3:c.202C>T | Progressive myoclonic epilepsy type 1A (Unverricht and Lundborg) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CSTB gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by severe, stimulus-sensitive myoclonus and tonic-clonic seizures. The onset, occurring between 6 and 13 years of age, is characterized by convulsions. Myoclonus begins 1 to 5 years later. The twitchings occur predominantly in the proximal muscles of the extremities and are bilaterally symmetrical, although asynchronous. At first small, they become late in the clinical course so violent that the victim is thrown to the floor. Mental deterioration and eventually dementia develop. The prevalence is 1:20,000 newborn. | 600 |
| CTNS | Cystinosis (atypical/juvenile/ocular) nephropathic | NM_001031681.2 | NM_001031681.2:c.283G>T, NM_001031681.2:c.329G>T, NM_001031681.2:c.357_360delCAGC, NM_001031681.2:c.397_398delAT, NM_001031681.2:c.414G>A, NM_001031681.2:c.416C>T, NM_001031681.2:c.506G>A, NM_001031681.2:c.589G>A, NM_001031681.2:c.646dupA, NM_001031681.2:c.853-3C>G, NM_001031681.2:c.1015G>A | Nephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. This disease is characterized by hypothyroidism, insulin-dependent diabetes, hepatosplenomegaly with portal hypertension, and muscle, cerebral and ocular involvement, caused by cystine deposits in various organs. The prevalence is 1:100,000-1:200,000. | 600,25 |
| CTSD | Ceroid lipofuscinosis, neuronal, type 10 | NM_001909.4 | NM_001909.4:c.1149G>C, NM_001909.4:c.685T>A | Neuronal ceroid lipofuscinosis type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSD gene located on chromosomal region 11p15.5. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 2:100,000-4:100,000 newborn. | 600 |
| CTSK | Pycnodysostosis | NM_000396.3 | NM_000396.3:c.926T>C, NM_000396.3:c.721C>T, NM_000396.3:c.436G>C, NM_000396.3:c.236G>A, NM_000396.3:c.154A>T | Pycnodysostosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSK gene located on chromosomal region 1q21. The age of onset is variable. This disease is characterized by osteosclerosis, short stature or dwarfism, acroosteolysis of the distal phalanges, fragile bones associated with spontaneous fractures and dysplasia of the clavicles. The prevalence is 1/1,000,000 to 9/1,000,000. | 600,25 |
| CYP21A2 | Congenital adrenal hyperplasia due to 21-hydroxylase deficiency | -0 | NM_000500.7:c.92C>T, NM_000500.7:c.293-13A/C>G, NM_000500.7:c.332_339del, NM_000500.7:c.518T>A, NM_000500.7:c.[710T>A;713T>A;719T>A], NM_000500.7:c.710T>A, NM_000500.7:c.713T>A, NM_000500.7:c.844G>T, NM_000500.7:c.923_924insT, NM_000500.7:c.955C>T, NM_000500.7:c.1069C>T, NM_000500.7:c.1360C>T, NM_000500.7:c.[710T>A;713T>A], NM_000500.7:c.[710T>A;719T>A], NM_000500.7:c.[713T>A;719T>A], Abnormal CNV, Large gene conversion, NM_000500.7:c.955C>T+CYP21A2dup | Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP21A2 gene located on chromosomal region 6p21.3. The age of onset is neonatal/infantile. This disease is characterized by simple virilizing or salt wasting forms that can manifest with genital ambiguity in females, and in both sexes with adrenal insufficiency with dehydration during the neonatal period, life threatening hypoglycemia and hyperandrogenia. The prevalence is 1/100,000 to 9/100,000. There is a common milder form of congenital adrenal hyperplasia (Nonclassic) characterized by a later onset of androgen excess symptoms seen in females and precocious pseudopuberty in both sexes. Cortisol and aldosterone levels are normal but there is an increased amount of androgens. Nonclassic form onset occurs in adolescence with variable degrees of postnatal androgen excess (precocious pubarche, hirsutism, acne, alopecia, anovulation and menstrual irregularies and in the post-pubertal period it can mimic polycystic ovary syndrome. It is also sometimes asymptomatic. The prevalence ranges from 1/1,000-1/500 in the general Caucasian population, but up to 1-2% among inbred populations, such as Eastern European (Ashkenazi) Jews. | 600 |
| CYP4V2 | Bietti crystalline corneoretinal dystrophy | NM_207352.3 | NM_207352.3:c.130T>A, NM_207352.3:c.327+1G>A, NM_207352.3:c.332T>C, NM_207352.3:c.1523G>A | Bietti crystalline corneoretinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP4V2 gene located on chromosomal region 4q35.2. The age of onset is adult. This disease is characterized by nightblindness, decreased vision, paracentral scotoma, and, in the end stages of the disease, legal blindness. | 600,25 |
| CYP7B1 | Spastic paraplegia type 5A, autosomal recessive | NM_004820.4 | NM_004820.4:c.1460dupT, NM_004820.4:c.1456C>T, NM_004820.4:c.1162C>T, NM_004820.4:c.889A>G, NM_004820.4:c.825T>A, NM_004820.4:c.321_324delACAA, NM_004820.4:c.187C>T | Spastic paraplegia type 5A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. The prevalence is below 1,000,000. | 600,25 |
| D2HGDH | D-2-hydroxyglutaric aciduria | NM_152783.4 | NM_152783.4:c.440T>G, NM_152783.4:c.1123G>T, NM_152783.4:c.1315A>G, NM_152783.4:c.1331T>C, NM_152783.4:c.1333_1334delAC | D-2-Hydroxyglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the D2HGDH gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by extremely variable clinical manifestations, with severe cases characterized by neonatal or early infantile-onset epileptic encephalopathy, and marked hypotonia, and cerebral visual failure, developmental delay, seizures, involuntary movements, and cardiomyopathy are also common in these cases. The prevalence is below 1,000,000. | 600,25 |
| DBT | Maple syrup urine disease, type 2 | NM_001918.3 | NM_001918.3:c.1281+1G>A, NM_001918.3:c.939G>C, NM_001918.3:c.901C>T, NM_001918.3:c.871C>T, NM_001918.3:c.827T>G, NM_001918.3:c.772+1G>A, NM_001918.3:c.670G>T, NM_001918.3:c.581C>G, NM_001918.3:c.294C>G, NM_001918.3:c.272_275delCAGT, NM_001918.3:c.126T>G | Maple syrup urine disease, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DBT gene located on chromosomal region 1p21.2. The age of onset in neonatal/infantil. This disease is characterized by a maple syrup odor to the urine, deficient diet, lethargy and focal dystonia, followed by progressive encephalopathy and central respiratory failure if not treated. The prevalence is 1-5/10,000. | 600,25 |
| DCLRE1C | Omenn syndrome; Severe combined immunodeficiency, Athabascan type | NM_001033855.2 | NM_001033855.2:c.1639G>T, NM_001033855.2:c.1558dupA, NM_001033855.2:c.780+1delG, NM_001033855.2:c.597C>A, NM_001033855.2:c.2T>C | Omenn syndrome and Athabascan type severe combined immunodeficiency follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the DCLRE1C gene located on chromosomal region 10p13. Omenn syndrome has an early age of onset and it is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. The age of onset of Athabascan type severe combined immunodeficiency is neonatal/infantile and it is characterized by severe and recurrent infections, diarrhea, failure to thrive, and cell sensitivity to ionizing radiation. The prevalence is 1-9/1,000,000. | 600,25 |
| DDB2 | Xeroderma pigmentosum, group E | NM_000107.2 | NM_000107.2:c.730A>G, NM_000107.2:c.818G>A, NM_000107.2:c.919G>T, NM_000107.2:c.937C>T | Xeroderma pigmentosum complementation group E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DDB2 gene located on chromosomal region 11p12-p11. The age of onset is variable. This disease is characterized by mild xeroderma pigmentosum symptoms and no neurological abnormalities. The prevalence is 1/1,000,000. | 600 |
| DDC | Aromatic L-amino acid decarboxylase deficiency | NM_000790.3 | NM_000790.3:c.1040G>A, NM_000790.3:c.823G>A, NM_000790.3:c.749C>T, NM_000790.3:c.304G>A, NM_000790.3:c.272C>T, NM_000790.3:c.100delG | Aromatic L-amino acid decarboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DDC gene located on chromosomal region 7p12.2. The age of onset is neonatal/infantile. This disease is characterized by severe developmental delay, weak muscle tone (hypotonia), muscle stiffness, difficulty moving, and involuntary writhing movements of the limbs (athetosis). The prevalence is below 1,000,000. | 600 |
| DGUOK | DGUOK-related mitochondrial DNA depletion syndrome | NM_080916.2 | NM_080916.2:c.137A>G, NM_080916.2:c.313C>T, NM_080916.2:c.425G>A, NM_080916.2:c.494A>T, NM_080916.2:c.707+2T>G, NM_080916.2:c.763G>T | Mitochondrial DNA depletion syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DGUOK gene located on chromosomal region 2p13. The age of onset is neonatal/infantile. This disease is characterized by progressive liver failure, hypoglycemia and neurologic abnormalities including hypotonia, encephalopathy and peripheral neuropathy | 600,25 |
| DHCR7 | Smith-Lemli-Opitz syndrome | NM_001163817.1 | NM_001163817.1:c.1342G>A, NM_001163817.1:c.1337G>A, NM_001163817.1:c.1228G>A, NM_001163817.1:c.1210C>T, NM_001163817.1:c.1055G>A, NM_001163817.1:c.1054C>T, NM_001163817.1:c.976G>T, NM_001163817.1:c.964-1G>C, NM_001163817.1:c.907G>A, NM_001163817.1:c.866C>T, NM_001163817.1:c.841G>A, NM_001163817.1:c.839A>G, NM_001163817.1:c.832-1G>C, NM_001163817.1:c.744G>T, NM_001163817.1:c.730G>A, NM_001163817.1:c.725G>A, NM_001163817.1:c.724C>T, NM_001163817.1:c.506C>T, NM_001163817.1:c.461C>G, NM_001163817.1:c.453G>A, NM_001163817.1:c.452G>A, NM_001163817.1:c.356A>T, NM_001163817.1:c.292C>T, NM_001163817.1:c.278C>T, NM_001163817.1:c.151C>T, NM_001163817.1:c.1A>G | Smith-Lemli-Opitz syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHCR7 gene located on chromosomal region 11q13.4. The age of onset is neonatal/infantile. This disease is characterized by multiple congenital anomalies, intellectual deficit, and behavioral problems.ᅠThe prevalence is 1/20,000 to 1/40,000 newborn. | 600,25 |
| DHDDS | Retinitis pigmentosa type 59 | NM_024887.3 | NM_024887.3:c.124A>G, NM_024887.3:c.330delA, NM_024887.3:c.998C>G | Retinitis pigmentosa type 59 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHDDS gene located on chromosomal region 1p36.11. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000. | 600 |
| DKC1 | Dyskeratosis congenita, X-linked | NM_001363.4 | NM_001363.4:c.91C>A, NM_001363.4:c.91C>G, NM_001363.4:c.194G>C, NM_001363.4:c.196A>G, NM_001363.4:c.200C>T, NM_001363.4:c.204C>A, NM_001363.4:c.214_215delCTinsTA | X-linked dyskeratosis congenita follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DKC1 gene located on chromosomal region Xq28. Tha age of onset is infantile. This disease is classically defined by the triad of abnormal skin pigmentation, nail dystrophy, and leukoplakia of the oral mucosa. Progressive bone marrow failure occurs in over 80% of cases and is the main cause of early mortality. The phenotype is highly variable, and affected individuals may have multiple additional features. | 600 |
| DLD | Dihydrolipoamide dehydrogenase deficiency | NM_000108.4 | NM_000108.4:c.105_106insA, NM_000108.4:c.916_926delTGTGATGTACT, NM_000108.4:c.1483A>G | Dihydrolipoamide dehydrogenase deficiency E3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DLD gene located on chromosomal region 7q31-q32. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting and a maple syrup odor in the cerumen (and later in urine) noted soon after birth, followed by progressive encephalopathy and central respiratory failure if untreated. The prevalence is 1/1,000,000 to 9/1,000,000. | 600 |
| DLL3 | Spondylocostal dysostosis type 1 | NM_016941.3 | NM_016941.3:c.231C>A, NM_016941.3:c.712C>T | Spondylocostal dysostosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DLL3 gene located on chromosomal region 19q13. The age of onset is neonatal/infantile. This disease is associated with vertebral and rib segmentation defects and characterised by a short neck with limited mobility, winged scapulae, a short trunk, and short stature with multiple vertebral anomalies at all levels of the spine. The prevalence is below 1/1,000,000. | 600 |
| DMD | Duchenne/Becker muscular dystrophy | -0 | NM_004006.2:c.10774delA, NM_004006.2:c.10454delT, NM_004006.2:c.10453_10454delCT, NM_004006.2:c.10447_10448delTC, NM_004006.2:c.10141C>T, NM_004006.2:c.10086+1G>A, NM_004006.2:c.10033C>T, NM_004006.2:c.9854_9863delTGAGACTGGA, NM_004006.2:c.9862G>T, NM_004006.2:c.9851G>A, NM_004006.2:c.9767dupG, NM_004006.2:c.9650-2A>G, NM_004006.2:c.9568C>T, NM_004006.2:c.9564-1G>A, NM_004006.2:c.9380C>G, NM_004006.2:c.9361+1G>C, NM_004006.2:c.9361+1G>A, NM_004006.2:c.9346C>T, NM_004006.2:c.9337C>T, NM_004006.2:c.9164-1G>T, NM_004006.2:c.9164-1G>C, NM_004006.2:c.8944C>T, NM_004006.2:c.8713C>T, NM_004006.2:c.8656C>T, NM_004006.2:c.8652_8653delCT, NM_004006.2:c.8608C>T, NM_004006.2:c.8464C>T, NM_004006.2:c.8443C>T, NM_004006.2:c.8374_8375delAA, NM_004006.2:c.8358G>A, NM_004006.2:c.8086delC, NM_004006.2:c.8069T>G, NM_004006.2:c.8064_8065delTA, NM_004006.2:c.7922delA, NM_004006.2:c.7894C>T, NM_004006.2:c.7771G>T, NM_004006.2:c.7764dupT, NM_004006.2:c.7683G>A, NM_004006.2:c.7682G>A, NM_004006.2:c.6986dupA, NM_004006.2:c.6982A>T, NM_004006.2:c.6964delG, NM_004006.2:c.6943G>T, NM_004006.2:c.6936delA, NM_004006.2:c.6906G>A, NM_004006.2:c.6834delT, NM_004006.2:c.6763-2A>G, NM_004006.2:c.6391_6392dupCA, NM_004006.2:c.6391_6392delCA, NM_004006.2:c.6373C>T, NM_004006.2:c.6340A>T, NM_004006.2:c.6292C>T, NM_004006.2:c.6238delC, NM_004006.2:c.6226G>T, NM_004006.2:c.6182delC, NM_004006.2:c.6014_6017delCTCA, NM_004006.2:c.6000T>A, NM_004006.2:c.5899C>T, NM_004006.2:c.5807T>A, NM_004006.2:c.5773G>T, NM_004006.2:c.5697delA, NM_004006.2:c.5671A>T, NM_004006.2:c.5640T>A, NM_004006.2:c.5570_5571dupAA, NM_004006.2:c.5554C>T, NM_004006.2:c.5530C>T, NM_004006.2:c.5363C>G, NM_004006.2:c.5353C>T, NM_004006.2:c.5313dupT, NM_004006.2:c.5287C>T, NM_004006.2:c.4843A>T, NM_004006.2:c.4735G>T, NM_004006.2:c.4518+5G>A, NM_004006.2:c.4500delA, NM_004006.2:c.4486delG, NM_004006.2:c.4471_4472delAA, NM_004006.2:c.4409_4412dupGTCT, NM_004006.2:c.4405C>T, NM_004006.2:c.4375C>T, NM_004006.2:c.4117C>T, NM_004006.2:c.3779_3785delCTTTGGAinsGG, NM_004006.2:c.3747delG, NM_004006.2:c.3697delC, NM_004006.2:c.3639dupA, NM_004006.2:c.3432+3A>G, NM_004006.2:c.3432+1G>A, NM_004006.2:c.3295C>T, NM_004006.2:c.3276+1G>A, NM_004006.2:c.3246_3247insTTTCTAAAAA, NM_004006.2:c.3124A>T, NM_004006.2:c.3121C>T, NM_004006.2:c.3087G>A, NM_004006.2:c.3076G>T, NM_004006.2:c.3022A>T, NM_004006.2:c.2929dupC, NM_004006.2:c.2866C>T, NM_004006.2:c.2815_2816delTT, NM_004006.2:c.2816T>A, NM_004006.2:c.2804-1G>A, NM_004006.2:c.2804-2A>T, NM_004006.2:c.2803+1G>T, NM_004006.2:c.2803+1G>A, NM_004006.2:c.2758C>T, NM_004006.2:c.2755A>T, NM_004006.2:c.2650C>T, NM_004006.2:c.2547delT, NM_004006.2:c.2523delA, NM_004006.2:c.2484T>G, NM_004006.2:c.2479delG, NM_004006.2:c.2380+2T>C, NM_004006.2:c.2380+1G>C, NM_004006.2:c.2332C>T, NM_004006.2:c.2302C>T, NM_004006.2:c.2294_2297delCCAT, NM_004006.2:c.2281_2285delGAAAA, NM_004006.2:c.2137C>T, NM_004006.2:c.2125delC, NM_004006.2:c.1900_1903dupAAGT, NM_004006.2:c.1900A>T, NM_004006.2:c.1886C>A, NM_004006.2:c.1734delA, NM_004006.2:c.1529_1530delTC, NM_004006.2:c.1489C>T, NM_004006.2:c.1371delG, NM_004006.2:c.1341_1342dupAG, NM_004006.2:c.1332-9A>G, NM_004006.2:c.1306dupG, NM_004006.2:c.1286C>A, NM_004006.2:c.1261C>T, NM_004006.2:c.1070delC, NM_004006.2:c.1048G>T, NM_004006.2:c.1012G>T, NM_004006.2:c.676_678delAAG, NM_004006.2:c.627delA, NM_004006.2:c.615T>A, NM_004006.2:c.583C>T, NM_004006.2:c.530+1delG, NM_004006.2:c.489G>A, NM_004006.2:c.433C>T, NM_004006.2:c.412_413delAA, NM_004006.2:c.251delT, NM_004006.2:c.220delC, NM_004006.2:c.204dupC, NM_004006.2:c.199G>T, NM_004006.2:c.160_162delCTC, NM_004006.2:c.137_138dupAT, NM_004006.2:c.133C>T, delDuchenne, insDuchenne, delBecker, insBecker | Duchenne muscular dystrophy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the DMD gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/3,300 male newborns and the prevalence is 1/16,000 to 1/125,000. Becker muscular dystrophy is characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle. The incidence is 1/18,000 to 1/31,000 male newborns and the prevalence is 1/10,000 to 5/10,000. | 600 |
| DMP1 | Hypophosphatemic rickets, autosomal recessive | NM_004407.3 | NM_004407.3:c.1A>G, NM_004407.3:c.31delT, NM_004407.3:c.55-1G>C, NM_004407.3:c.362delC | Hypophosphatemic rickets follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DMP1 gene located on chromosomal region 4q21. The age of onset is variable. This disease is associated with vertebral and rib segmentation defects and characterised by hypophosphatemia, rickets and/or osteomalacia and slow growth. The prevalence is below 1/20,000 newborns. | 600 |
| DNAJC19 | 3-methylglutaconic aciduria, type 5 | NM_145261.3 | NM_145261.3:c.300delA | 3-methylglutaconic aciduria, type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DNAJC19 gene located on chromosomal region 3q26.33. The age of onset is infantile. This disease is characterized by severe early onset (before the age of three years) dilated cardiomyopathy with conduction defects (long QT syndrome), non-progressive cerebellar ataxia, testicular dysgenesis, and 3-methylglutaconic aciduria. | 600 |
| DPAGT1 | Congenital disorder of glycosylation, type 1j | NM_001382.3 | NM_001382.3:c.980_981delCT, NM_001382.3:c.791T>G, NM_001382.3:c.643+1G>A, NM_001382.3:c.358C>A, NM_001382.3:c.349G>A | Congenital disorder of glycosylation, type 1j follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPAGT1 gene located on chromosomal region 11q23.3. The age of onset is neonatal/infantile. This disease is characterized by severe psychomotor delay, seizures, hypotonia and dysmorphism (microcephaly, ocular exotropia, micrognathia and clinodactyly). The prevalence is below 1,000,000. | 600 |
| DPM1 | Congenital disorder of glycosylation, type 1e | NM_001317034.1 | NM_001317034.1:c.847T>C, NM_001317034.1:c.784-1G>T, NM_001317034.1:c.733delC, NM_001317034.1:c.669-1G>A, NM_001317034.1:c.274C>G | Congenital disorder of glycosylation, type 1e follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPM1 gene located on chromosomal region 20q13.13. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay, seizures, hypotonia, facial dysmorphism and microcephaly. The prevalence is below 1,000,000. | 600 |
| DPYD | Dihydropyrimidine dehydrogenase deficiency | NM_000110.3 | NM_000110.3:c.1905+1G>A, NM_000110.3:c.1679T>G, NM_000110.3:c.1109_1110delTA, NM_000110.3:c.299_302delTCAT | Dihydropyrimidine dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPYD gene located on chromosomal region 1p22. This disease shows large phenotypic variability, ranging from no symptoms to a convulsive disorder with motor and mental retardation in homozygous patients. In people with severe dihydropyrimidine dehydrogenase deficiency, the disorder becomes apparent in infancy. These affected individuals have recurrent seizures (epilepsy), intellectual disability, a small head size (microcephaly), increased muscle tone (hypertonia), delayed development of motor skills such as walking, and autistic behaviors that affect communication and social interaction. The prevalence is unknow. In addition, homozygous and heterozygous mutation carriers can develop severe toxicity after the administration of the antineoplastic drug 5-fluorouracil (5FU). | 600,25 |
| DSP | Cardiomyopathy, dilated, with woolly hair and keratoderma; Epidermolysis bullosa, lethal acantholytic | NM_004415.3 | NM_004415.3:c.3098delA, NM_004415.3:c.5800C>T, NM_004415.3:c.6370_6371delCT, NM_004415.3:c.7000C>T, NM_004415.3:c.7180_7181delAG, NM_004415.3:c.8188C>T | Dilated cardiomyopathy with woolly hair and keratoderma, known as Carvajal syndrome, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterized by woolly hair is present at birth and the palmoplantar keratoderma appears during the first year of life. The cardiac anomaly presents during childhood and is marked by dilation of the left ventricle accompanied by alterations in muscle contractility. The dilated cardiomyopathy may lead to life-threatening congestive heart failure and death. The prevalence is below 1,000,000. Furthermore, mutations in the DSP gene have been identified in people with an autosomal recessive disorder called lethal acantholytic epidermolysis bullosa. Features of this condition include very fragile skin that blisters and detaches easily, a complete absence of hair (alopecia), abnormal or missing fingernails, teeth that are present from birth (neonatal teeth), and abnormalities of the heart muscle (cardiomyopathy). The skin abnormalities lead to a severe loss of fluids and death in early infancy. | 600,25 |
| DYSF | Miyoshi muscular dystrophy, type 1; Muscular dystrophy, limb-girdle, autosomal recessive, type 2 | NM_001130978.1 | NM_001130978.1:c.1481-1G>A | Miyoshi muscular dystrophy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is young adulthood. This disease is characterized by weakness and atrophy in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000. Mutations in the DYSF gene can also cause muscular dystrophy, limb-girdle, autosomal recessive, type 2. This disease is characterized by an onset in late adolescence or early adulthood of slowly progressive, proximal weakness and atrophy of shoulder and pelvic girdle muscles. Cardiac and respiratory muscles are not involved. Hypertrophy of the calf muscles and highly elevated serum creatine kinase levels are frequently observed. | 600,25 |
| DYSF | Miyoshi muscular dystrophy, type 1; Muscular dystrophy, limb-girdle, autosomal recessive, type 2 | NM_001130987.1 | NM_001130987.1:c.203_204delTGinsAT, NM_001130987.1:c.396_397delCC, NM_001130987.1:c.706C>T, NM_001130987.1:c.759+1G>C, NM_001130987.1:c.797G>A, NM_001130987.1:c.853C>T, NM_001130987.1:c.991G>A, NM_001130987.1:c.991G>T, NM_001130987.1:c.1033+1G>A, NM_001130987.1:c.1149+1G>A, NM_001130987.1:c.1372G>A, NM_001130987.1:c.1380+2T>C, NM_001130987.1:c.1464C>A, NM_001130987.1:c.1488dupA, NM_001130987.1:c.1494-2A>G, NM_001130987.1:c.1494-1G>A, NM_001130987.1:c.1609G>A, NM_001130987.1:c.1674delA, NM_001130987.1:c.1692+2T>A, NM_001130987.1:c.1717C>T, NM_001130987.1:c.1867C>T, NM_001130987.1:c.1888C>T, NM_001130987.1:c.1927G>T, NM_001130987.1:c.2924_2928delAGACC, NM_001130987.1:c.2923C>T, NM_001130987.1:c.3051G>T, NM_001130987.1:c.3095A>G, NM_001130987.1:c.3166C>T, NM_001130987.1:c.3229-2A>T, NM_001130987.1:c.3498_3499delTGinsAA, NM_001130987.1:c.3531C>A, NM_001130987.1:c.3532C>T, NM_001130987.1:c.3695delC, NM_001130987.1:c.3762delA, NM_001130987.1:c.3859G>T, NM_001130987.1:c.3957+1delG, NM_001130987.1:c.4011delC, NM_001130987.1:c.4144C>T, NM_001130987.1:c.4162_4163delGT, NM_001130987.1:c.4307G>A, NM_001130987.1:c.4873C>T, NM_001130987.1:c.4989_4993delGCCCGinsCCCC, NM_001130987.1:c.5194C>T, NM_001130987.1:c.5318A>G, NM_001130987.1:c.5383C>T, NM_001130987.1:c.5458-2A>C, NM_001130987.1:c.5546G>A, NM_001130987.1:c.5546+1G>T, NM_001130987.1:c.5614G>T, NM_001130987.1:c.5626G>A, NM_001130987.1:c.5642+1G>A, NM_001130987.1:c.5711delG, NM_001130987.1:c.5761C>T, NM_001130987.1:c.5815_5816delAG, NM_001130987.1:c.5830C>T, NM_001130987.1:c.5953_5956delCAGC, NM_001130987.1:c.6096dupA, NM_001130987.1:c.6109G>T, NM_001130987.1:c.6241C>T | Miyoshi muscular dystrophy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is young adulthood. This disease is characterized by weakness and atrophy in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000. Mutations in the DYSF gene can also cause muscular dystrophy, limb-girdle, autosomal recessive, type 2. This disease is characterized by an onset in late adolescence or early adulthood of slowly progressive, proximal weakness and atrophy of shoulder and pelvic girdle muscles. Cardiac and respiratory muscles are not involved. Hypertrophy of the calf muscles and highly elevated serum creatine kinase levels are frequently observed. | 600,25 |
| EDA | Ectodermal dysplasia, type 1, hypohidrotic, X-linked | NM_001399.4 | NM_001399.4:c.181T>C, NM_001399.4:c.183C>G, NM_001399.4:c.187G>A, NM_001399.4:c.463C>T, NM_001399.4:c.466C>T, NM_001399.4:c.467G>A, NM_001399.4:c.573_574insT, NM_001399.4:c.671G>C, NM_001399.4:c.826C>T, NM_001399.4:c.1045G>A | Hypohidrotic ectodermal dysplasia, type 1, hypohidrotic, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EDA gene located on chromosomal region Xq12-q13.1. The age of onset is neonatal/infantile. This disease is characterized by malformation of ectodermal structures such as skin, hair, teeth and sweat glands. The prevalence is 1/5,000 to 1/10,000 newborns. | 600,25 |
| EDN3 | Waardenburg syndrome, type 4B | NM_207034.2 | NM_207034.2:c.262_263delGCinsT, NM_207034.2:c.277C>G, NM_207034.2:c.476G>T, NM_207034.2:c.568_569delGA | Waardenburg-Shah syndrome, type 4B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EDN3 gene located on chromosomal region 20q13.2-q13.3. The age of onset is neonatal/infantile. This disease is characterized by the association of Waardenburg syndrome (sensorineural hearing loss and pigmentary abnormalities) and Hirschsprung disease (signs of intestinal obstruction). The prevalence is below 1/40,000. | 600 |
| EDNRB | ABCD syndrome | NM_001201397.1 | NM_001201397.1:c.1098G>T, NM_001201397.1:c.818C>G, NM_001201397.1:c.46delC | ABCD syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EDNRB gene located on chromosomal region 13q22.3. This disease is characterized by albinism, black lock at temporal occipital region, bilateral deafness, aganglionosis of the large intestine and total absence of neurocytes and nerve fibers in the small intestine. ABCD syndrome is not a separate entity, but rather an expression of Shah-Waardenburg syndrome (WS4) | 600 |
| EIF2AK3 | Wolcott-Rallison syndrome | NM_004836.6 | NM_004836.6:c.1763G>A, NM_004836.6:c.994G>T | Wolcott-Rallison syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EIF2AK3 gene located on chromosomal region 2p12. The age of onset is neonatal/infantile. This disease is characterized by permanent neonatal diabetes mellitus with multiple epiphyseal dysplasia and other clinical manifestations, including recurrent episodes of acute liver failure. The prevalence is above 1/10,000 newborns. | 600 |
| ELP1 | Dysautonomia, familial | NM_003640.4 | NM_003640.4:c.3332delC, NM_003640.4:c.2741C>T, NM_003640.4:c.2328delT, NM_003640.4:c.2204+6T>C, NM_003640.4:c.2087G>C, NM_003640.4:c.1460+2T>C | Familial dysautonomia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ELP1 gene located on chromosomal region 9q31.3. The age of onset is infantile. This disease is characterized by sensory dysfunction and severe impairment of the autonomic nervous system activity, resulting in multisystem dysfunction. The prevalence is <1:1,000,000 | 600 |
| EMD | Emery-Dreifuss muscular dystrophy, type 1, X-linked | NM_000117.2 | NM_000117.2:c.547C>A, NM_000117.2:c.631_635delCGTGC | Emery-Dreifuss muscular dystrophy, type 1, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EMD gene located on chromosomal region Xq28. ᅠThis is a condition that primarily affects muscles used for movement (skeletalᅠmuscles) and the heart (cardiac muscle). Among the earliest features of this disorder are joint deformities called contractures. Contractures restrict the movement of certain joints, most often the elbows, ankles, and neck, and usually become noticeable in early childhood. Most affected individuals also experience muscle weakness andᅠwastingᅠthat worsen slowly over time, beginning in muscles of the upper arms and lower legs and later also affecting muscles in the shoulders and hips. Almost all people with Emery-Dreifuss muscular dystrophy develop heart problems by adulthood. The X-linked type of this disorder affects an estimated 1 in 100,000 people. | 600 |
| ENPP1 | Arterial calcification, generalized, of infancy, type 1 | NM_006208.2 | NM_006208.2:c.783C>G, NM_006208.2:c.797G>T, NM_006208.2:c.900G>A, NM_006208.2:c.913C>A, NM_006208.2:c.1025G>T, NM_006208.2:c.1112A>T, NM_006208.2:c.1612G>C, NM_006208.2:c.2230C>T, NM_006208.2:c.2677G>T, NM_006208.2:c.2702A>C | Arterial calcification, generalized, of infancy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENPP1 gene located on chromosomal region 6q22-q23. The age of onset is neonatal/infancy. A severe autosomal recessive disorder characterized by calcification of the internal elastic lamina of muscular arteries and stenosis due to myointimal proliferation. The disorder is often fatal within the first 6 months of life because of myocardial ischemia resulting in refractory heart failure. | 600 |
| ERCC2 | Trichothiodystrophy, type 1 | NM_000400.3 | NM_000400.3:c.2230_2233dupCTAG, NM_000400.3:c.2176C>T, NM_000400.3:c.2047C>T, NM_000400.3:c.1972C>T, NM_000400.3:c.1703_1704delTT, NM_000400.3:c.1621A>C, NM_000400.3:c.1454T>C, NM_000400.3:c.1381C>G, NM_000400.3:c.1354C>T, NM_000400.3:c.1308-1G>A, NM_000400.3:c.950-2A>G, NM_000400.3:c.949+1G>A, NM_000400.3:c.719-1G>A, NM_000400.3:c.567G>A, NM_000400.3:c.183+2T>A | Trichothiodystrophy (TTD), type 1 is a heterogeneous group of disorders that follows an autosomal recessive pattern of inheritance. It is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.32. The age of onset is neonatal or infantile. This disease, with variable clinical expression, is characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. About half of the patients with TTD exhibit marked photosensitivity. | 600,25 |
| ERCC3 | Trichothiodystrophy, type 2 | NM_000122.1 | NM_000122.1:c.1858delG, NM_000122.1:c.1757_1758delAG, NM_000122.1:c.1757delA, NM_000122.1:c.1633C>T, NM_000122.1:c.1273C>T, NM_000122.1:c.296T>C | Trichothiodystrophy (TTD), type 2 is a heterogeneous group of disorders that follows an autosomal recessive pattern of inheritance. It is caused by pathogenic variants in the ERCC3 gene located on chromosomal region 2q14.3. The age of onset is neonatal or infantile. This disease, with variable clinical expression, is characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. About half of the patients with TTD exhibit marked photosensitivity. | 600 |
| ERCC5 | Cerebrooculofacioskeletal syndrome, type 3 | NM_000123.3 | NM_000123.3:c.88+2T>C, NM_000123.3:c.215C>A, NM_000123.3:c.381-2A>G, NM_000123.3:c.406C>T, NM_000123.3:c.464dupA, NM_000123.3:c.526C>T, NM_000123.3:c.787C>T, NM_000123.3:c.2144dupA, NM_000123.3:c.2375C>T, NM_000123.3:c.2573T>C, NM_000123.3:c.2751delA | Cerebrooculofacioskeletal syndrome type 3, also known as COFS syndrome, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC5 gene located on chromosomal region 13q33.1. COFS syndrome is characterized by prenatal onset of arthrogryposis, microcephaly and growth failure. Postnatal features include severe developmental delay, congenital cataracts (in some), and marked UV sensitivity of the skin. Survival beyond 6 years of age is rare. The prevalence is below 1/1,000,000. | 600,25 |
| ERCC6 | Cockayne syndrome, type B; Cerebrooculofacioskeletal syndrome, type 1 | NM_000124.3 | NM_000124.3:c.3862C>T, NM_000124.3:c.3591_3592dupGA, NM_000124.3:c.2587C>T, NM_000124.3:c.2203C>T, NM_000124.3:c.2047C>T, NM_000124.3:c.1550G>A, NM_000124.3:c.1357C>T, NM_000124.3:c.422+1G>A, NM_000124.3:c.207dupG, NM_000124.3:c.48_49delCT | Cockayne syndrome (CS), type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterized by short stature, a characteristic facial appearance, premature aging, photosensitivity, progressive neurological dysfunction, and intellectual deficit. Mutations in the ERRC6 gene have been also found in patients with COFS syndrome type 1, an extreme prenatal form of the CS clinical spectrum. This autosomal recessive progressive neurodegenerative disorder is characterized by microcephaly, congenital cataracts, severe mental retardation, facial dysmorphism, and arthrogryposis. | 600,25 |
| ERCC8 | Cockayne syndrome, type A | NM_000082.3 | NM_000082.3:c.966C>A, NM_000082.3:c.618-1G>A, NM_000082.3:c.593_594dupAT, NM_000082.3:c.37G>T | Cockayne syndrome, type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC8 gene located on chromosomal region 5q12.1. The age of onset is variable. This disease is characterized by short stature, a characteristic facial appearance, premature aging, photosensitivity, progressive neurological dysfunction, and intellectual deficit. The prevalence is 2.7/1,000,000 newborns in Western Europe. | 600 |
| ESCO2 | Roberts syndrome | NM_001017420.2 | NM_001017420.2:c.296_297dupGA, NM_001017420.2:c.308_309delAA, NM_001017420.2:c.505C>T, NM_001017420.2:c.604C>T, NM_001017420.2:c.876_879delCAGA, NM_001017420.2:c.879_880delAG, NM_001017420.2:c.1269G>A, NM_001017420.2:c.1597dupT, NM_001017420.2:c.1615T>G | Roberts syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESCO2 gene located on chromosomal region 8p21.1. The age of onset is neonatal/infantile. This disease is characterized by pre- and postnatal growth retardation, severe symmetric limb reduction defects, craniofacial anomalies and severe intellectual deficit. | 600 |
| ESPN | Deafness, autosomal recessive, type 36 | NM_031475.2 | NM_031475.2:c.1988_1991delAGAG, NM_031475.2:c.2470_2473delTCAG | Autosomal recessive nonsyndromic sensorineural deafness type 36 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESPN gene located on chromosomal region 1p36.31. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. | 600 |
| ESRRB | Deafness, autosomal recessive, type 35 | NM_004452.3 | NM_004452.3:c.329C>T | Autosomal recessive nonsyndromic sensorineural deafness type 35 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ESRRB gene located on chromosomal region 14q24.3. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. | 600 |
| ETFA | Glutaric acidemia, type 2A | NM_000126.3 | NM_000126.3:c.797C>T, NM_000126.3:c.470T>G | Glutaric acidemia, type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFA gene located on chromosomal region 15q23-q25. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure. | 600 |
| ETFB | Glutaric acidemia, type 2B | NM_001014763.1 | NM_001014763.1:c.887_889delAGA, NM_001014763.1:c.764G>A, NM_001014763.1:c.655G>A, NM_001014763.1:c.551_552insG, NM_001014763.1:c.334C>T, NM_001014763.1:c.278_279insG | Glutaric acidemia, type 2B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFB gene located on chromosomal region 19q13.3. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure. | 600 |
| ETFDH | Glutaric acidemia, type 2C | NM_004453.3 | NM_004453.3:c.2T>C, NM_004453.3:c.250G>A, NM_004453.3:c.413T>G, NM_004453.3:c.524G>T, NM_004453.3:c.1001T>C, NM_004453.3:c.1234G>T, NM_004453.3:c.1367C>T, NM_004453.3:c.1570_1571delCT, NM_004453.3:c.1823delG, NM_004453.3:c.1832G>A | Glutaric acidemia, type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETFDH gene located on chromosomal region 4q32-q35. The age of onset is variable. This disease is characterized by clinically heterogeneous symptoms disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure. | 600 |
| ETHE1 | Ethylmalonic encephalopathy | NM_014297.4 | NM_014297.4:c.604dupG, NM_014297.4:c.554T>G, NM_014297.4:c.488G>A, NM_014297.4:c.487C>T, NM_014297.4:c.440_450delACAGCATGGCC, NM_014297.4:c.221dupA | Ethylmalonic encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ETHE1 gene located on chromosomal region 19q13.31. The age of onset is neonatal/infantile. This disease is characterized by elevated excretion of ethylmalonic acid with recurrent petechiae, orthostatic acrocyanosis and chronic diarrhoea associated with neurodevelopmental delay, psychomotor regression and hypotonia with brain magnetic resonance imaging abnormalities. The prevalence is below 1/1,000,000, with total of 30 cases of patients reported worldwide, mainly for Mediterranean and Arab populations. | 600 |
| EYS | Retinitis pigmentosa, type 25 | NM_001292009.1 | NM_001292009.1:c.9468T>A, NM_001292009.1:c.9362_9365delCTCA, NM_001292009.1:c.9099delT, NM_001292009.1:c.8711_8718delCATGCAGA, NM_001292009.1:c.8692_8695dupACAG, NM_001292009.1:c.8632G>T, NM_001292009.1:c.8471dupA, NM_001292009.1:c.7822C>T, NM_001292009.1:c.7095T>G, NM_001292009.1:c.6170delA, NM_001292009.1:c.6102dupT, NM_001292009.1:c.5928-2A>G, NM_001292009.1:c.5857G>T, NM_001292009.1:c.5757dupT, NM_001292009.1:c.4462_4469dupAGCCCCTC, NM_001292009.1:c.4350_4356delTATAGCT, NM_001292009.1:c.4120C>T, NM_001292009.1:c.4045C>T, NM_001292009.1:c.2826_2827delAT, NM_001292009.1:c.1211dupA, NM_001292009.1:c.571dupA, NM_001292009.1:c.490C>T, NM_001292009.1:c.232delT, NM_001292009.1:c.103C>T | Retinitis pigmentosa, type 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EYS gene located on chromosomal region 6q12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000. | 600,25 |
| F11 | Factor XI deficiency, autosomal recessive | NM_000128.3 | NM_000128.3:c.166T>C, NM_000128.3:c.403G>T, NM_000128.3:c.438C>A, NM_000128.3:c.595+3A>G, NM_000128.3:c.901T>C, NM_000128.3:c.1211C>A, NM_000128.3:c.1613C>T, NM_000128.3:c.1693G>A | Factor XI deficiency, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F11 gene located on chromosomal region 4q35. The age of onset is variable. This disease is characterized by reduced levels and activity of factor XI resulting in moderate bleeding symptoms, usually occurring after trauma or surgery. The prevalence is 1/1,000,000 to 9/1,000,000. | 600,25 |
| F8 | Hemophilia A | -0 | Inv22 | Hemophilia A follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F8 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor VIII deficiency. The prevalence is 1/4,000 to 1/ 5,000 male newborns. | 600 |
| F8 | Hemophilia A | NM_000132.3 | NM_000132.3:c.7033_7040delTGCGAGGC, NM_000132.3:c.7034G>A, NM_000132.3:c.7031G>A, NM_000132.3:c.7030G>T, NM_000132.3:c.7030G>A, NM_000132.3:c.7021G>T, NM_000132.3:c.7016G>T, NM_000132.3:c.7012delC, NM_000132.3:c.6997delG, NM_000132.3:c.6996G>A, NM_000132.3:c.6995G>C, NM_000132.3:c.6988delC, NM_000132.3:c.6986C>T, NM_000132.3:c.6976C>G, NM_000132.3:c.6914_6918delATCAA, NM_000132.3:c.6915delT, NM_000132.3:c.6905T>C, NM_000132.3:c.6904T>G, NM_000132.3:c.6901-2A>G, NM_000132.3:c.6900+1G>A, NM_000132.3:c.6887delA, NM_000132.3:c.6870G>A, NM_000132.3:c.6869G>T, NM_000132.3:c.6857_6867delATGGCCATCAG, NM_000132.3:c.6865C>T, NM_000132.3:c.6842T>C, NM_000132.3:c.6839T>C, NM_000132.3:c.6836T>G, NM_000132.3:c.6836T>C, NM_000132.3:c.6825T>A, NM_000132.3:c.6804delA, NM_000132.3:c.6797delG, NM_000132.3:c.6797G>A, NM_000132.3:c.6796G>A, NM_000132.3:c.6780_6788delAGGAGTAAC, NM_000132.3:c.6786_6787insCAA, NM_000132.3:c.6760delC, NM_000132.3:c.6760C>T, NM_000132.3:c.6752T>A, NM_000132.3:c.6746T>G, NM_000132.3:c.6743G>C, NM_000132.3:c.6740_6741delAG, NM_000132.3:c.6739G>T, NM_000132.3:c.6738delA, NM_000132.3:c.6574+5G>C, NM_000132.3:c.6574+3A>C, NM_000132.3:c.6574+1G>T, NM_000132.3:c.6574+1G>A, NM_000132.3:c.6565_6566delGA, NM_000132.3:c.6551A>T, NM_000132.3:c.6548T>G, NM_000132.3:c.6544C>G, NM_000132.3:c.6537C>G, NM_000132.3:c.6533G>A, NM_000132.3:c.6520C>G, NM_000132.3:c.6515C>G, NM_000132.3:c.6501delC, NM_000132.3:c.6497delG, NM_000132.3:c.6494delC, NM_000132.3:c.6489delT, NM_000132.3:c.6488T>G, NM_000132.3:c.6482C>T, NM_000132.3:c.6482C>A, NM_000132.3:c.6477delT, NM_000132.3:c.6469_6470delAA, NM_000132.3:c.6465delA, NM_000132.3:c.6464_6465delAA, NM_000132.3:c.6449A>T, NM_000132.3:c.6430-3C>G, NM_000132.3:c.6273+1G>A, NM_000132.3:c.6269T>A, NM_000132.3:c.6263C>T, NM_000132.3:c.6253G>T, NM_000132.3:c.6250A>T, NM_000132.3:c.6243G>C, NM_000132.3:c.6242G>C, NM_000132.3:c.6239C>T, NM_000132.3:c.6213A>T, NM_000132.3:c.6194G>A, NM_000132.3:c.6136dupA, NM_000132.3:c.6134G>T, NM_000132.3:c.6130delC, NM_000132.3:c.6120T>A, NM_000132.3:c.6116-2A>G, NM_000132.3:c.6115+6T>A, NM_000132.3:c.6115+4A>G, NM_000132.3:c.6115+3G>T, NM_000132.3:c.6115+2T>C, NM_000132.3:c.6115+1G>A, NM_000132.3:c.6107A>G, NM_000132.3:c.6099delT, NM_000132.3:c.6089dupG, NM_000132.3:c.6084delG, NM_000132.3:c.6078_6079delTG, NM_000132.3:c.6070dupC, NM_000132.3:c.6046C>G, NM_000132.3:c.6037G>A, NM_000132.3:c.6016G>T, NM_000132.3:c.5999G>C, NM_000132.3:c.5964_5967dupGGAG, NM_000132.3:c.5961delA, NM_000132.3:c.5960_5961delAA, NM_000132.3:c.5954G>C, NM_000132.3:c.5953delC, NM_000132.3:c.5939A>C, NM_000132.3:c.5934T>G, NM_000132.3:c.5923dupA, NM_000132.3:c.5924T>A, NM_000132.3:c.5914_5915delAT, NM_000132.3:c.5894G>T, NM_000132.3:c.5888T>C, NM_000132.3:c.5884T>G, NM_000132.3:c.5881T>A, NM_000132.3:c.5879G>T, NM_000132.3:c.5869C>T, NM_000132.3:c.5861_5866delCTCAGG, NM_000132.3:c.5853A>C, NM_000132.3:c.5833A>G, NM_000132.3:c.5825G>T, NM_000132.3:c.5816C>A, NM_000132.3:c.5766C>A, NM_000132.3:c.5752delT, NM_000132.3:c.5721C>G, NM_000132.3:c.5719dupA, NM_000132.3:c.5719A>T, NM_000132.3:c.5712G>C, NM_000132.3:c.5697delC, NM_000132.3:c.5696dupT, NM_000132.3:c.5689_5690delCT, NM_000132.3:c.5686G>C, NM_000132.3:c.5680G>A, NM_000132.3:c.5675dupT, NM_000132.3:c.5674G>A, NM_000132.3:c.5348_5357delGAGCAGAAGT, NM_000132.3:c.5345T>G, NM_000132.3:c.5343T>A, NM_000132.3:c.5339C>T, NM_000132.3:c.5337delG, NM_000132.3:c.5330T>C, NM_000132.3:c.5321A>T, NM_000132.3:c.5308G>A, NM_000132.3:c.5301C>A, NM_000132.3:c.5291A>G, NM_000132.3:c.5269delT, NM_000132.3:c.5269T>C, NM_000132.3:c.5254delG, NM_000132.3:c.5251A>T, NM_000132.3:c.5243delA, NM_000132.3:c.5227_5228delAG, NM_000132.3:c.5220-1G>A, NM_000132.3:c.5012G>A, NM_000132.3:c.5010delT, NM_000132.3:c.4999delC, NM_000132.3:c.4996C>T, NM_000132.3:c.4987A>T, NM_000132.3:c.4979C>T, NM_000132.3:c.4969C>T, NM_000132.3:c.4942C>T, NM_000132.3:c.4935G>A, NM_000132.3:c.4934G>A, NM_000132.3:c.4926delA, NM_000132.3:c.4922dupT, NM_000132.3:c.4918G>T, NM_000132.3:c.4899delT, NM_000132.3:c.4895dupT, NM_000132.3:c.4895delT, NM_000132.3:c.4864G>A, NM_000132.3:c.4858delC, NM_000132.3:c.4848delC, NM_000132.3:c.4841delA, NM_000132.3:c.4828G>T, NM_000132.3:c.4825delA, NM_000132.3:c.4814C>A, NM_000132.3:c.4806delA, NM_000132.3:c.4805_4806delAA, NM_000132.3:c.4798A>T, NM_000132.3:c.4794G>T, NM_000132.3:c.4770T>A, NM_000132.3:c.4719_4729delTGCAAAGACTC, NM_000132.3:c.4720delG, NM_000132.3:c.4712_4715delAAAG, NM_000132.3:c.4694_4697delTTCT, NM_000132.3:c.4687delG, NM_000132.3:c.4686delA, NM_000132.3:c.4662_4663delGA, NM_000132.3:c.4658delA, NM_000132.3:c.4619delT, NM_000132.3:c.4561C>T, NM_000132.3:c.4542delT, NM_000132.3:c.4519delA, NM_000132.3:c.4512delG, NM_000132.3:c.4492_4496delGTTCT, NM_000132.3:c.4492_4493delGT, NM_000132.3:c.4492delG, NM_000132.3:c.4483delG, NM_000132.3:c.4483G>T, NM_000132.3:c.4474A>T, NM_000132.3:c.4473C>G, NM_000132.3:c.4473C>A, NM_000132.3:c.4460delA, NM_000132.3:c.4450delA, NM_000132.3:c.4446dupG, NM_000132.3:c.4430_4431delAG, NM_000132.3:c.4425_4426delAA, NM_000132.3:c.4423C>T, NM_000132.3:c.4408G>T, NM_000132.3:c.4382_4383delAC, NM_000132.3:c.4363C>T, NM_000132.3:c.4345G>T, NM_000132.3:c.4339dupG, NM_000132.3:c.4339delG, NM_000132.3:c.4318delT, NM_000132.3:c.4296_4300delTTCTC, NM_000132.3:c.4280delT, NM_000132.3:c.4272delC, NM_000132.3:c.4265_4266delAT, NM_000132.3:c.4242dupA, NM_000132.3:c.4241C>A, NM_000132.3:c.4201C>T, NM_000132.3:c.4199delC, NM_000132.3:c.4156C>T, NM_000132.3:c.4103delC, NM_000132.3:c.4094_4100delATTTGAC, NM_000132.3:c.4072C>T, NM_000132.3:c.4045delA, NM_000132.3:c.4035delA, NM_000132.3:c.4006C>T, NM_000132.3:c.3994_3997delAGAG, NM_000132.3:c.3991_3992delAA, NM_000132.3:c.3984dupA, NM_000132.3:c.3982C>T, NM_000132.3:c.3967C>T, NM_000132.3:c.3964C>T, NM_000132.3:c.3922G>T, NM_000132.3:c.3913C>T, NM_000132.3:c.3907_3911delACCAA, NM_000132.3:c.3902delA, NM_000132.3:c.3870dupA, NM_000132.3:c.3863dupC, NM_000132.3:c.3860delT, NM_000132.3:c.3851_3852delCA, NM_000132.3:c.3844A>T, NM_000132.3:c.3842_3844delAGAinsGG, NM_000132.3:c.3833delA, NM_000132.3:c.3830delC, NM_000132.3:c.3827C>G, NM_000132.3:c.3772delT, NM_000132.3:c.3766G>T, NM_000132.3:c.3756delG, NM_000132.3:c.3735_3744delCCTTTTCTTAinsATTTCTTTTTCTTT, NM_000132.3:c.3736delC, NM_000132.3:c.3710delC, NM_000132.3:c.3652delG, NM_000132.3:c.3631A>T, NM_000132.3:c.3624delT, NM_000132.3:c.3607G>T, NM_000132.3:c.3565dupA, NM_000132.3:c.3548_3549delAA, NM_000132.3:c.3500dupA, NM_000132.3:c.3496A>T, NM_000132.3:c.3493G>T, NM_000132.3:c.3490delT, NM_000132.3:c.3421C>T, NM_000132.3:c.3417dupT, NM_000132.3:c.3416_3417delCT, NM_000132.3:c.3409_3410delCT, NM_000132.3:c.3388delA, NM_000132.3:c.3385delC, NM_000132.3:c.3371C>A, NM_000132.3:c.3344delT, NM_000132.3:c.3302_3303delAG, NM_000132.3:c.3300delA, NM_000132.3:c.3298A>T, NM_000132.3:c.3289C>T, NM_000132.3:c.3251C>G, NM_000132.3:c.3224delC, NM_000132.3:c.3203_3204delGA, NM_000132.3:c.3196C>T, NM_000132.3:c.3152delT, NM_000132.3:c.3150_3151insTC, NM_000132.3:c.3053delA, NM_000132.3:c.3034G>C, NM_000132.3:c.3031A>T, NM_000132.3:c.2412_2421delCTCCTCTAGT, NM_000132.3:c.2419dupA, NM_000132.3:c.2409delT, NM_000132.3:c.2404C>T, NM_000132.3:c.2397delT, NM_000132.3:c.2384_2388delGAACA, NM_000132.3:c.2373dupG, NM_000132.3:c.2360delA, NM_000132.3:c.2102_2106delTGGAA, NM_000132.3:c.2097G>A, NM_000132.3:c.2096T>A, NM_000132.3:c.2095A>T, NM_000132.3:c.2095A>G, NM_000132.3:c.2095A>C, NM_000132.3:c.2089_2090delGT, NM_000132.3:c.2090T>A, NM_000132.3:c.2066T>G, NM_000132.3:c.2060T>C, NM_000132.3:c.2058_2059delAC, NM_000132.3:c.2057C>G, NM_000132.3:c.2032A>T, NM_000132.3:c.2029T>C, NM_000132.3:c.2015_2017delTCT, NM_000132.3:c.2000delT, NM_000132.3:c.1996_1999dupGACT, NM_000132.3:c.1996_1999delGACT, NM_000132.3:c.1990_1991delCA, NM_000132.3:c.1991A>C, NM_000132.3:c.1988C>T, NM_000132.3:c.1985G>C, NM_000132.3:c.1952A>C, NM_000132.3:c.1947_1950delTTTG, NM_000132.3:c.1941_1944delAGTT, NM_000132.3:c.1934A>C, NM_000132.3:c.1913G>A, NM_000132.3:c.1912G>A, NM_000132.3:c.1904-1G>A, NM_000132.3:c.1904-37G>A, NM_000132.3:c.1752+5G>C, NM_000132.3:c.1736A>T, NM_000132.3:c.1726G>T, NM_000132.3:c.1703G>T, NM_000132.3:c.1688C>G, NM_000132.3:c.1682A>C, NM_000132.3:c.1681G>A, NM_000132.3:c.1675G>T, NM_000132.3:c.1667T>A, NM_000132.3:c.1661G>A, NM_000132.3:c.1653T>G, NM_000132.3:c.1640G>A, NM_000132.3:c.1639T>C, NM_000132.3:c.1630G>A, NM_000132.3:c.1619C>G, NM_000132.3:c.1618C>A, NM_000132.3:c.1596dupG, NM_000132.3:c.1596G>A, NM_000132.3:c.1595G>A, NM_000132.3:c.1594T>G, NM_000132.3:c.1585A>G, NM_000132.3:c.1560delT, NM_000132.3:c.1538-1G>T, NM_000132.3:c.1538-2A>T, NM_000132.3:c.1477A>G, NM_000132.3:c.1463C>T, NM_000132.3:c.1463C>G, NM_000132.3:c.1443+3A>C, NM_000132.3:c.1443+2T>C, NM_000132.3:c.1442_1443dupTG, NM_000132.3:c.1443+1G>A, NM_000132.3:c.1432G>A, NM_000132.3:c.1420G>T, NM_000132.3:c.1410_1413delTTTA, NM_000132.3:c.1406G>C, NM_000132.3:c.1400T>G, NM_000132.3:c.1397G>A, NM_000132.3:c.1394C>G, NM_000132.3:c.1390G>T, NM_000132.3:c.1357G>T, NM_000132.3:c.1348T>G, NM_000132.3:c.1338delA, NM_000132.3:c.1336dupC, NM_000132.3:c.1337G>C, NM_000132.3:c.1337G>A, NM_000132.3:c.1331_1332delAA, NM_000132.3:c.1331_1332delAAinsT, NM_000132.3:c.1331A>C, NM_000132.3:c.1325A>G, NM_000132.3:c.1324T>C, NM_000132.3:c.1324T>A, NM_000132.3:c.1316G>A, NM_000132.3:c.1311delG, NM_000132.3:c.1301G>A, NM_000132.3:c.1293delG, NM_000132.3:c.1234T>C, NM_000132.3:c.1214T>G, NM_000132.3:c.1207C>G, NM_000132.3:c.1203G>A, NM_000132.3:c.1202G>A, NM_000132.3:c.1200_1201delTT, NM_000132.3:c.1189dupC, NM_000132.3:c.1175C>G, NM_000132.3:c.1175C>A, NM_000132.3:c.1172G>C, NM_000132.3:c.1165delC, NM_000132.3:c.1077_1080delTGAA, NM_000132.3:c.1078_1079delGA, NM_000132.3:c.1042T>C, NM_000132.3:c.986G>T, NM_000132.3:c.985dupT, NM_000132.3:c.986G>C, NM_000132.3:c.986G>A, NM_000132.3:c.984delT, NM_000132.3:c.974_975delTT, NM_000132.3:c.967G>A, NM_000132.3:c.948_951delAACA, NM_000132.3:c.943delG, NM_000132.3:c.941C>T, NM_000132.3:c.935delT, NM_000132.3:c.920T>G, NM_000132.3:c.919delA, NM_000132.3:c.907delG, NM_000132.3:c.902G>C, NM_000132.3:c.899A>T, NM_000132.3:c.899A>C, NM_000132.3:c.889delG, NM_000132.3:c.886C>T, NM_000132.3:c.883T>C, NM_000132.3:c.872A>G, NM_000132.3:c.871G>T, NM_000132.3:c.850G>T, NM_000132.3:c.850G>A, NM_000132.3:c.849delT, NM_000132.3:c.836T>A, NM_000132.3:c.832G>A, NM_000132.3:c.824A>G, NM_000132.3:c.822G>A, NM_000132.3:c.796G>T, NM_000132.3:c.788-1G>T, NM_000132.3:c.788-1G>C, NM_000132.3:c.788-1G>A, NM_000132.3:c.788-2A>T, NM_000132.3:c.787+2T>C, NM_000132.3:c.787G>C, NM_000132.3:c.779C>G, NM_000132.3:c.775A>T, NM_000132.3:c.770_771insCC, NM_000132.3:c.764G>A, NM_000132.3:c.760A>T, NM_000132.3:c.755C>A, NM_000132.3:c.729delT, NM_000132.3:c.709C>T, NM_000132.3:c.695_698delAGAA, NM_000132.3:c.688_689delGA, NM_000132.3:c.685_686delTC, NM_000132.3:c.680G>A, NM_000132.3:c.676A>T, NM_000132.3:c.577G>A, NM_000132.3:c.571C>T, NM_000132.3:c.566C>A, NM_000132.3:c.560T>A, NM_000132.3:c.557A>G, NM_000132.3:c.556G>A, NM_000132.3:c.553A>G, NM_000132.3:c.545A>T, NM_000132.3:c.535T>C, NM_000132.3:c.532C>G, NM_000132.3:c.525C>A, NM_000132.3:c.519_523delTACCT, NM_000132.3:c.514_515insTCAAGATA, NM_000132.3:c.515G>A, NM_000132.3:c.514T>C, NM_000132.3:c.493C>T, NM_000132.3:c.489T>A, NM_000132.3:c.476T>C, NM_000132.3:c.472C>T, NM_000132.3:c.471G>A, NM_000132.3:c.446delC, NM_000132.3:c.440T>A, NM_000132.3:c.435_436insTTT, NM_000132.3:c.433G>C, NM_000132.3:c.430G>T, NM_000132.3:c.421G>T, NM_000132.3:c.415C>T, NM_000132.3:c.407A>C, NM_000132.3:c.405T>A, NM_000132.3:c.404A>G, NM_000132.3:c.403G>A, NM_000132.3:c.265+1G>T, NM_000132.3:c.265G>A, NM_000132.3:c.255_257delACC, NM_000132.3:c.250A>G, NM_000132.3:c.230T>C, NM_000132.3:c.225T>A, NM_000132.3:c.224delA, NM_000132.3:c.223G>T, NM_000132.3:c.217T>C, NM_000132.3:c.214G>A, NM_000132.3:c.209T>C, NM_000132.3:c.201_202dupGA, NM_000132.3:c.203C>A, NM_000132.3:c.201G>T, NM_000132.3:c.199_200delAA, NM_000132.3:c.200A>C, NM_000132.3:c.199A>G, NM_000132.3:c.195C>A, NM_000132.3:c.185C>G, NM_000132.3:c.173delC, NM_000132.3:c.144-5C>G, NM_000132.3:c.144-11T>G, NM_000132.3:c.144-26A>T, NM_000132.3:c.143+1G>A, NM_000132.3:c.120delC, NM_000132.3:c.98G>A, NM_000132.3:c.97T>G, NM_000132.3:c.88G>A, NM_000132.3:c.86T>G, NM_000132.3:c.77T>C, NM_000132.3:c.65G>C, NM_000132.3:c.1A>G | Hemophilia A follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F8 gene located on chromosomal region Xq28. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor VIII deficiency. The prevalence is 1/4,000 to 1/ 5,000 male newborns. | 600 |
| F9 | Hemophilia B | NM_000133.3 | NM_000133.3:c.82T>C, NM_000133.3:c.1031T>C, NM_000133.3:c.1136G>A, NM_000133.3:c.1150C>T | Hemophilia B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F9 gene located on chromosomal region Xq27.1-q27.2. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor IX deficiency. The prevalence is 1/100,000 to 9/100,000. | 600,25 |
| FAH | Tyrosinemia, type 1 | NM_000137.2 | NM_000137.2:c.47A>T, NM_000137.2:c.192G>T, NM_000137.2:c.401C>A, NM_000137.2:c.456G>A, NM_000137.2:c.554-1G>T, NM_000137.2:c.707-1G>A, NM_000137.2:c.782C>T, NM_000137.2:c.786G>A, NM_000137.2:c.837+1G>A, NM_000137.2:c.939delC, NM_000137.2:c.982C>T, NM_000137.2:c.1009G>A, NM_000137.2:c.1027G>T, NM_000137.2:c.1062+5G>A, NM_000137.2:c.1069G>T, NM_000137.2:c.1090G>T, NM_000137.2:c.1141A>G | Tyrosinemia, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAH gene located on chromosomal region 15q25.1. The age of onset is variable. This disease is characterized by progressive liver disease, renal tubular dysfunction, porphyria-like crises and a dramatic improvement in prognosis following treatment with nitisinone. The birth incidence is 1/100,000, notably in Qu�bec, Canada, and the prevalence is 1/100,000 to 1/120,000 newborns. | 600,25 |
| FAM126A | Hypomyelinating leukodystrophy, type 5 | NM_032581.3 | NM_032581.3:c.158T>C | Hypomyelinating leukodystrophy, type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAM126A gene located on chromosomal region 7p15.3. The age of onset is neonatal/infantile. This disease is characterized by the onset of cataract either at birth or in the first two months of life, delayed psychomotor development by the end of the first year of life and moderate intellectual deficit. The prevalence is below 1/1,000,000. | 600 |
| FAM20C | Raine syndrome | NM_020223.3 | NM_020223.3:c.1093G>C, NM_020223.3:c.1163T>G | Raine syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAM20C gene located on chromosomal region 7p22.3. The age of onset is neonatal/infantile. This disease is characterized by generalized osteosclerosis with periosteal bone formation, characteristic facial dysmorphism, brain abnormalities including intracerebral calcifications, and neonatal lethal course. The prevalence is below 1/1,000,000. | 600 |
| FANCA | Fanconi anemia, complementation group A | NM_000135.2 | NM_000135.2:c.4130C>G, NM_000135.2:c.3788_3790delTCT, NM_000135.2:c.3763G>T, NM_000135.2:c.3558dupG, NM_000135.2:c.2303T>C, NM_000135.2:c.1115_1118delTTGG, NM_000135.2:c.233_236delTTGA, NM_000135.2:c.131dupA | Fanconi anemia, complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCA gene located on chromosomal region 16q24.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 600,25 |
| FANCC | Fanconi anemia, complementation group C | NM_000136.2 | NM_000136.2:c.1642C>T, NM_000136.2:c.1487T>G, NM_000136.2:c.1103_1104delTG, NM_000136.2:c.1015delA, NM_000136.2:c.996+1G>T, NM_000136.2:c.67delG, NM_000136.2:c.37C>T | Fanconi anemia, complementation group C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCC gene located on chromosomal region 9q22.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 600,25 |
| FANCG | Fanconi anemia, complementation group G | NM_004629.1 | NM_004629.1:c.1852_1853delAA, NM_004629.1:c.1795_1804delTGGATCCGTC, NM_004629.1:c.1480+1G>C, NM_004629.1:c.1077-2A>G, NM_004629.1:c.907_908dupCT, NM_004629.1:c.637_643delTACCGCC, NM_004629.1:c.510+1G>A, NM_004629.1:c.313G>T | Fanconi anemia, complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCG gene located on chromosomal region 9p13. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 600,25 |
| FGA | Afibrinogenemia, congenital | NM_000508.4 | NM_000508.4:c.1441delG, NM_000508.4:c.1359dupC, NM_000508.4:c.1039C>T | Congenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGA gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000. | 600 |
| FGA | Afibrinogenemia, congenital | NM_021871.3 | NM_021871.3:c.1906dupC | Congenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGA gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000. | 600 |
| FGB | Congenital afibrinogenemia | NM_005141.4 | NM_005141.4:c.1148T>G, NM_005141.4:c.1289G>A | Congenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGB gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000. | 600,25 |
| FGD4 | Charcot-Marie-Tooth disease, type 4H | NM_001304480.1 | NM_001304480.1:c.1006C>T, NM_001304480.1:c.1229T>C, NM_001304480.1:c.1229T>G, NM_001304480.1:c.1661G>A | Charcot-Marie-Tooth disease, type 4H follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGD4 gene located on chromosomal region 12p11.21. The age of onset is neonatal/infantile. This disease is characterized by slowly progressive muscle weakness in the distal extremities, and other common features include delayed walking, an abnormal gait, scoliosis and pes equines with toe retraction. The prevalence is 1/3,300. | 600 |
| FH | Fumarase deficiency | NM_000143.3 | NM_000143.3:c.1446_1449delAAAG, NM_000143.3:c.1431_1433dupAAA, NM_000143.3:c.1394A>G, NM_000143.3:c.1293delA, NM_000143.3:c.1255T>C, NM_000143.3:c.1236+1G>C, NM_000143.3:c.1200delT, NM_000143.3:c.1189G>A, NM_000143.3:c.1093A>G, NM_000143.3:c.1067T>A, NM_000143.3:c.901dupA, NM_000143.3:c.793G>A, NM_000143.3:c.760C>T, NM_000143.3:c.698G>A, NM_000143.3:c.697C>T, NM_000143.3:c.521C>G, NM_000143.3:c.320A>C, NM_000143.3:c.40dupC | Fumarase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FH gene located on chromosomal region 1q42.1. The age of onset is neonatal/infantile. This disease is characterized byᅠhypotonia, severe psychomotor impairment, convulsions, respiratory distress, feeding difficulties and frequent cerebral malformations, along with a distinctive facies, although some patients present with only moderate intellectual impairment. The prevalence is below 1,000,000. | 600 |
| FHL1 | Emery-Dreifuss muscular dystrophy, type 6, X-linked | NM_001159702.2 | NM_001159702.2:c.310T>C, NM_001159702.2:c.625T>C, NM_001159702.2:c.838G>A | Emery-Dreifuss muscular dystrophy, type 6, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FHL1 gene located on chromosomal region Xq26. ᅠThis is a condition that primarily affects muscles used for movement (skeletalᅠmuscles) and the heart (cardiac muscle). Among the earliest features of this disorder are joint deformities called contractures. Contractures restrict the movement of certain joints, most often the elbows, ankles, and neck, and usually become noticeable in early childhood. Most affected individuals also experience muscle weakness andᅠwastingᅠthat worsen slowly over time, beginning in muscles of the upper arms and lower legs and later also affecting muscles in the shoulders and hips. Almost all people with Emery-Dreifuss muscular dystrophy develop heart problems by adulthood. The X-linked type of this disorder affects an estimated 1 in 100,000 people. | 600 |
| FIG4 | Charcot-Marie-Tooth disease, type 4J; Yunis-Varon syndrome | NM_014845.5 | NM_014845.5:c.122T>C, NM_014845.5:c.311G>A, NM_014845.5:c.501C>G, NM_014845.5:c.547C>T, NM_014845.5:c.592C>T, NM_014845.5:c.737G>A, NM_014845.5:c.831_838delTAAATTTG, NM_014845.5:c.2299dupG | Charcot-Marie-Tooth disease, type 4J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by rapidly progressive, asymmetric motor neuron degeneration with slow nerve conduction velocities, weakness and paralysis, without sensory loss. The prevalence is 4/100,000 to 8/100,000. Mutations in the FIG4 gene have been also found in patient with Yunis-Varon syndrome. This disease is a severe autosomal recessive disorder characterized by skeletal defects, including cleidocranial dysplasia and digital anomalies, and severe neurologic involvement with neuronal loss. Enlarged cytoplasmic vacuoles are found in neurons, muscle, and cartilage. The disorder is usually lethal in infancy. | 600,25 |
| FKRP | Muscular dystrophy-dystroglycanopathy, type 5A, 5B and 5C | NM_001039885.2 | NM_001039885.2:c.160C>T, NM_001039885.2:c.1154C>A, NM_001039885.2:c.1343C>T, NM_001039885.2:c.1387A>G | Muscular dystrophy-dystroglycanopathy type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is neonatal or early infancy. There are three subtypes of dystroglycanopathies related to FKRP gene: subtype 5A, 5B and 5C. Subtype 5A is the most severe phenotype and is associated with congenital brain and eye anomalies, cobblestone lissencephaly, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Subtype 5B represents an intermediate phenotype with or without congenital mental retardation, white matter changes and structural brain abnormalities. Finally, subtype 5C is the less severe phenotype characterized by limb-girdle muscular dystrophy, variable age at onset, normal cognition, and no structural brain changes. | 600,25 |
| FKTN | Muscular dystrophy-dystroglycanopathy, type 4A, 4B and 4C | NM_001079802.1 | NM_001079802.1:c.411C>A, NM_001079802.1:c.509C>A, NM_001079802.1:c.527T>C, NM_001079802.1:c.766C>T, NM_001079802.1:c.1112A>G, NM_001079802.1:c.1167dupA, NM_001079802.1:c.1380dupA | Muscular dystrophy-dystroglycanopathy type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKTN gene located on chromosomal region 9q31.2. The age of onset is neonatal or early infancy. There are three subtypes of dystroglycanopathies related to FKTN gene: subtype 4A, 4B and 4C. Subtype 4A is the most severe phenotype and is associated with congenital brain and eye anomalies, seizures, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Subtype 4B represents an intermediate phenotype and congenital mental retardation is not a feature. Finally, subtype 4C is the less severe phenotype characterized by limb-girdle muscular dystrophy, onset in early childhood and cognition and brain structure are usually normal. | 600 |
| FLNA | FLNA-related disorders | NM_001110556.1 | NM_001110556.1:c.7757-1G>C, NM_001110556.1:c.7551_7552+6delAGGTGAGC, NM_001110556.1:c.7153C>T, NM_001110556.1:c.5132_5133delTCinsAA, NM_001110556.1:c.4777_4778dupAA, NM_001110556.1:c.4543C>T, NM_001110556.1:c.4446_4447dupAT, NM_001110556.1:c.3557C>T, NM_001110556.1:c.3476A>C, NM_001110556.1:c.2761C>T, NM_001110556.1:c.760G>A | Mutation in FLNA causes a wide spectrum of disease including skeletal dysplasia, neuronal migration abnormality, cardiovascular malformation, intellectual disability and intestinal obstruction. FLNA-related disorders can be X-linked recessive (XLR) or X-linked dominant (XLD). Frontometaphyseal dysplasia-1 (FMD1;XLR) is 1 of 4 otopalatodigital syndromes caused by mutations in the FLNA gene. The disorders, which include otopalatodigital syndrome-1 (OPD1; XLD; OMIMᅠ311300), otopalatodigital syndrome-2 (OPD2; XLD;ᅠ304120), and Melnick-Needles syndrome (MNS; XLD;ᅠ309350), constitute a phenotypic spectrum. At the mild end of the spectrum, males with OPD1 have cleft palate and mild skeletal anomalies with conductive deafness caused by ossicular anomalies. FMD1 is characterized by a generalized skeletal dysplasia, deafness, and urogenital defects. Males with OPD2 have disabling skeletal anomalies in addition to variable malformations in the hindbrain, heart, intestines, and kidneys that frequently lead to perinatal death. The most severe phenotype, MNS, is characterized by a skeletal dysplasia in the heterozygote. Affected males exhibit severe malformations similar to those observed in individuals with OPD2, resulting in prenatal lethality or death in the first few months of life (review byᅠRobertson, 2005).ᅠVerloes et al. (2000)ᅠsuggested that these disorders constitute a single entity, which they termed 'frontootopalatodigital osteodysplasia.' Other studies confirm an association between FLNA gene mutation and lung disease, seen in more than 80% of patients with cerebral periventricular nodular heterotopia (PVNH; XLD; 300049); FLNA mutation also cause cardiac valvular dysplasia (XLR; 314400). De novo mutations and mosaic cases have been described. | 600 |
| FLVCR1 | Posterior column ataxia-retinitis pigmentosa syndrome | NM_014053.3 | NM_014053.3:c.361A>G, NM_014053.3:c.574T>C, NM_014053.3:c.739-2delA | Posterior column ataxia-retinitis pigmentosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FLVCR1 gene located on chromosomal region 1q32.3. The age of onset is childhood. This disease is characterized by sensory ataxia, proprioceptive loss and blindness. The prevalence is <1 / 1.000.000. | 600 |
| FMR1 | Fragile X syndrome | -0 | (CGG)n pre-mutated allele | Fragile X syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FMR1 gene located on chromosomal region Xq27.3. The symptoms are variable depending on the range of CGG triplet expansion. In complete mutation the onset is infantile in men and is characterized by intellectual disability, characteristic appearance (large head, long face, prominent forehead and chin, protruding ears) joint laxity and large testes after puberty. In carrier female, the symptoms are milder and include primary ovarian insufficiency. The prevalence is 1/2,500 (full mutation allele) to 1/4,000 (prevalence of symptomatic cases) for both genders. | 600,25 |
| FOXN1 | T-cell immunodeficiency, congenital alopecia and nail dystrophy | NM_003593.2 | NM_003593.2:c.763C>T | T-cell immunodeficiency, congenital alopecia and nail dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FOXN1 gene located on chromosomal region 17q11.2. The age of onset is infantile. This disease is characterized by T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. The prevalence is <1:1,000,000. | 600 |
| FRAS1 | Fraser syndrome, type 1 | NM_025074.6 | NM_025074.6:c.835_838delGTGT, NM_025074.6:c.3799C>T, NM_025074.6:c.5605_5606insT, NM_025074.6:c.6433C>T, NM_025074.6:c.6991_6992insGG, NM_025074.6:c.7813C>T, NM_025074.6:c.11160_11167delGCTGGAGA | Fraser syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the gene FRAS1 located on chromosomal region 4q21.21. The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000. | 600,25 |
| FREM2 | Fraser syndrome, type 2 | NM_207361.5 | NM_207361.5:c.2366dupC, NM_207361.5:c.3792_3795delTTAT, NM_207361.5:c.5920G>A, NM_207361.5:c.8409+1G>A | Fraser syndrome, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the gene FREM2 located on chromosomal region 13q13.3. The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000. | 600 |
| FUCA1 | Fucosidosis | NM_000147.4 | NM_000147.4:c.1279C>T, NM_000147.4:c.1229T>G, NM_000147.4:c.856C>T, NM_000147.4:c.648C>A, NM_000147.4:c.244C>T | Fucosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FUCA1 gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is characterized by facial dysmorphism, dysostosis multiplex, moderate hepatomegaly, severe intellectual deficit, deafness, and according to age, angiokeratomas. The prevalence is <1:1,000,000. | 600 |
| G6PC | Glycogen storage disease, type 1A | NM_000151.3 | NM_000151.3:c.113A>T, NM_000151.3:c.229T>C, NM_000151.3:c.230+1G>C, NM_000151.3:c.247C>T, NM_000151.3:c.248G>A, NM_000151.3:c.370G>A, NM_000151.3:c.379_380dupTA, NM_000151.3:c.447-1G>A, NM_000151.3:c.497T>G, NM_000151.3:c.508C>T, NM_000151.3:c.562G>C, NM_000151.3:c.883C>T, NM_000151.3:c.1039C>T | Glycogen storage disease, type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000. | 600,25 |
| G6PC | Glycogen storage disease, type 1A | NM_001270397.1 | NM_001270397.1:c.474G>A | Glycogen storage disease, type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000. | 600,25 |
| G6PC3 | Dursun syndrome | NM_138387.3 | NM_138387.3:c.141C>G, NM_138387.3:c.346A>G, NM_138387.3:c.758G>A, NM_138387.3:c.778G>C, NM_138387.3:c.784G>C, NM_138387.3:c.935dupT | Dursun syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC3 gene located on chromosomal region 17q21.31. This disease is characterized by familial pulmonary arterial hypertension, cardiac abnormalities including atrial septal defect, leukopenia including intermittent neutropenia, lymphopenia, monocytosis, and anemia. The prevalence is 1:100,000. | 600 |
| GAA | Glycogen storage disease 2 | NM_000152.4 | NM_000152.4:c.118C>T, NM_000152.4:c.236_246delCCACACAGTGC, NM_000152.4:c.307T>G, NM_000152.4:c.525delT, NM_000152.4:c.546+2_546+5delTGGG, NM_000152.4:c.546G>A, NM_000152.4:c.546G>C, NM_000152.4:c.655G>A, NM_000152.4:c.698delA, NM_000152.4:c.768dupT, NM_000152.4:c.853C>T, NM_000152.4:c.877G>A, NM_000152.4:c.925G>A, NM_000152.4:c.1064T>C, NM_000152.4:c.1115A>T, NM_000152.4:c.1316T>A, NM_000152.4:c.1327-2A>G, NM_000152.4:c.1431delT, NM_000152.4:c.1465G>A, NM_000152.4:c.1548G>A, NM_000152.4:c.1552-3C>G, NM_000152.4:c.1561G>A, NM_000152.4:c.1585_1586delTCinsGT, NM_000152.4:c.1634C>T, NM_000152.4:c.1650dupG, NM_000152.4:c.1799G>A, NM_000152.4:c.1827_1828insA, NM_000152.4:c.1847dupA, NM_000152.4:c.1912G>T, NM_000152.4:c.1927G>A, NM_000152.4:c.1933G>T, NM_000152.4:c.1935C>A, NM_000152.4:c.2012T>G, NM_000152.4:c.2015G>A, NM_000152.4:c.2041-1G>A, NM_000152.4:c.2066_2070dupAGCCG, NM_000152.4:c.2105G>T, NM_000152.4:c.2237G>A, NM_000152.4:c.2238G>A, NM_000152.4:c.2238G>C, NM_000152.4:c.2512C>T, NM_000152.4:c.2544delC, NM_000152.4:c.2560C>T | Glycogen storage disease, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAA gene located on chromosomal region 17q25.3. There are two forms: adult and infantile.The age of onset in this last form is before the age of three months. This disease is characterized by severe hypotonia, hypertrophic cardiomyopathy and progressive hepatomegaly. The incidence is 1/57,000 for the adult form and 1/138,000 for infantile form. | 600,25 |
| GALC | Krabbe disease | NM_000153.3 | NM_000153.3:c.2056T>C, NM_000153.3:c.1964delC, NM_000153.3:c.1814dupA, NM_000153.3:c.1796T>G, NM_000153.3:c.1723_1724insT, NM_000153.3:c.1700A>C, NM_000153.3:c.1695delT, NM_000153.3:c.1592G>A, NM_000153.3:c.1591C>T, NM_000153.3:c.1586C>T, NM_000153.3:c.1543G>A, NM_000153.3:c.1489+1_1489+2delGT, NM_000153.3:c.1488_1489+2delTGGT, NM_000153.3:c.1488_1489delTG, NM_000153.3:c.1472delA, NM_000153.3:c.1161+2T>G, NM_000153.3:c.1153G>T, NM_000153.3:c.953C>G, NM_000153.3:c.658C>T, NM_000153.3:c.655C>T, NM_000153.3:c.628A>T, NM_000153.3:c.582+1G>A, NM_000153.3:c.453G>A, NM_000153.3:c.430delA, NM_000153.3:c.388G>A, NM_000153.3:c.205C>T | Krabbe disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALC gene located on chromosomal region 14q31.3. There are two forms of the disease: infantile form (2-6 months onset) more severe and adult form less severe. It is a degenerative disorder that affects the nervous system characterized by a muscle stiffness, blindness, deafness, and eventually death. The incidence is 1/100,000-1/250,000 and the prevalence is 1/100,000. | 600,25 |
| GALT | Galactosemia | NM_000155.3 | NM_000155.3:c.18delC, NM_000155.3:c.41delCinsTT, NM_000155.3:c.71_72insA, NM_000155.3:c.113A>C, NM_000155.3:c.118G>T, NM_000155.3:c.130G>A, NM_000155.3:c.132delG, NM_000155.3:c.152G>A, NM_000155.3:c.158G>A, NM_000155.3:c.199C>T, NM_000155.3:c.203A>C, NM_000155.3:c.220_221delCT, NM_000155.3:c.221T>C, NM_000155.3:c.253-2A>G, NM_000155.3:c.265T>G, NM_000155.3:c.289_291delAAC, NM_000155.3:c.290A>G, NM_000155.3:c.292G>A, NM_000155.3:c.329-2A>C, NM_000155.3:c.367C>T, NM_000155.3:c.386T>C, NM_000155.3:c.400delT, NM_000155.3:c.404C>T, NM_000155.3:c.413C>T, NM_000155.3:c.425T>A, NM_000155.3:c.428C>T, NM_000155.3:c.445dupG, NM_000155.3:c.442C>T, NM_000155.3:c.443G>A, NM_000155.3:c.502_504delGTG, NM_000155.3:c.505C>A, NM_000155.3:c.508-1G>C, NM_000155.3:c.512T>C, NM_000155.3:c.547C>A, NM_000155.3:c.552C>A, NM_000155.3:c.563A>G, NM_000155.3:c.565_578delGTATGGGCCAGCAG, NM_000155.3:c.568T>C, NM_000155.3:c.580T>C, NM_000155.3:c.584T>C, NM_000155.3:c.598delC, NM_000155.3:c.601C>T, NM_000155.3:c.602G>A, NM_000155.3:c.607G>A, NM_000155.3:c.610C>T, NM_000155.3:c.619C>T, NM_000155.3:c.626A>G, NM_000155.3:c.634C>T, NM_000155.3:c.688-2A>C, NM_000155.3:c.692G>A, NM_000155.3:c.719_728delTAGTACTGGT, NM_000155.3:c.772C>T, NM_000155.3:c.775C>T, NM_000155.3:c.790delC, NM_000155.3:c.790_792delCTAinsTAG, NM_000155.3:c.820+13A>G, NM_000155.3:c.844C>G, NM_000155.3:c.855G>T, NM_000155.3:c.904+1G>T, NM_000155.3:c.905-2A>G, NM_000155.3:c.939G>A, NM_000155.3:c.947G>A, NM_000155.3:c.957C>A, NM_000155.3:c.985T>C, NM_000155.3:c.997C>G, NM_000155.3:c.997C>T, NM_000155.3:c.998G>A, NM_000155.3:c.1006A>T, NM_000155.3:c.1030C>A, NM_000155.3:c.1048delA, NM_000155.3:c.1052delC, NM_000155.3:c.1138T>C | Galactosemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALT gene located on chromosomal region 9p13.3. The age of onset is neonatal. This disease is characterized by feeding difficulties, lethargy, and severe liver disease. Long-term complications appear including cognitive impairments, motor deficits, and ovarian dysfunction with reduced fertility in women and diminished bone density. The prevalence is 1/40,000-1/60,000. | 600,25 |
| GAMT | Cerebral creatine deficiency syndrome type 2 | NM_138924.2 | NM_138924.2:c.506G>A | Cerebral creatine deficiency syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAMT gene located on chromosomal region 19p13.3. The age of onset is infantile. This disease is characterized by intellectual disability, seizures and behavioral problems, often in conjunction with pyramidal and/or extrapyramidal manifestations with muscular hypotony. Biochemical symptoms are also included with high urinary excretion of guanidinoacetate, low urinary excretion of creatinine and creatine depletion in brain and muscles. | 600 |
| GAN | Giant axonal neuropathy, type 1 | NM_022041.3 | NM_022041.3:c.413G>A, NM_022041.3:c.505G>A, NM_022041.3:c.601C>T, NM_022041.3:c.1268T>C, NM_022041.3:c.1429C>T, NM_022041.3:c.1447C>T, NM_022041.3:c.1456G>A | Giant axonal neuropathy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAN gene located on chromosomal region 16q23.2. The age of onset is infantile. This disease is characterized by a progressive motor and sensitive peripheral and central nervous system neuropathy. Twenty families have been reported with this disease but the frequency is likely to be under-estimated. | 600,25 |
| GBA | Gaucher disease | NM_000157.3 | NM_000157.3:c.1604G>A, NM_000157.3:c.1504C>T, NM_000157.3:c.1448T>G, NM_000157.3:c.1448T>C, NM_000157.3:c.1361C>G, NM_000157.3:c.1348T>A, NM_000157.3:c.1343A>T, NM_000157.3:c.1342G>C, NM_000157.3:c.1319C>T, NM_000157.3:c.1309G>T, NM_000157.3:c.1307T>C, NM_000157.3:c.1301G>C, NM_000157.3:c.1297G>T, NM_000157.3:c.1295G>T, NM_000157.3:c.1274dupA, NM_000157.3:c.1246G>A, NM_000157.3:c.1240G>T, NM_000157.3:c.1240G>C, NM_000157.3:c.1228C>G, NM_000157.3:c.1226A>G, NM_000157.3:c.1208G>C, NM_000157.3:c.1192C>T, NM_000157.3:c.1184C>T, NM_000157.3:c.1174C>G, NM_000157.3:c.1171G>C, NM_000157.3:c.1141T>G, NM_000157.3:c.1098dupA, NM_000157.3:c.1090G>A, NM_000157.3:c.1085C>T, NM_000157.3:c.1060G>C, NM_000157.3:c.1053G>T, NM_000157.3:c.1049A>G, NM_000157.3:c.1043C>T, NM_000157.3:c.914delC, NM_000157.3:c.586A>C, NM_000157.3:c.509G>T, NM_000157.3:c.508C>T, NM_000157.3:c.487delG, NM_000157.3:c.481C>T, NM_000157.3:c.476G>A, NM_000157.3:c.475C>T, NM_000157.3:c.431T>G, NM_000157.3:c.407C>A, NM_000157.3:c.354G>C, NM_000157.3:c.259C>T, NM_000157.3:c.254G>A, NM_000157.3:c.160G>T, NM_000157.3:c.115+1G>A, NM_000157.3:c.84dupG | Gaucher disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBA gene located on chromosomal region 1q22. Gaucher disease encompasses a continuum of clinical findings from a perinatal lethal disorder to an asymptomatic type. There are three major clinical types (1, 2, and 3) and two other subtypes (perinatal-lethal and cardiovascular). Type 1 is characterized by the presence of clinical or radiographic evidence of bone disease, hepatosplenomegaly, anemia and thrombocytopenia, lung disease, and the absence of primary central nervous system disease. GD types 2 and 3 are characterized by the presence of primary neurologic disease. Type 2 has an onset before age two years, limited psychomotor development, and a rapidly progressive course with death by age two to four years. Type 3 may have onset before age two years, but often have a more slowly progressive course, with survival into the third or fourth decade. The perinatal-lethal form is associated with ichthyosiform or collodion skin abnormalities or with nonimmune hydrops fetalis. The cardiovascular form is characterized by calcification of the aortic and mitral valves, mild splenomegaly, corneal opacities, and supranuclear ophthalmoplegia. Cardiopulmonary complications have been described with all the clinical subtypes, although varying in frequency and severity. The incidence is 1/60,000 and the prevalence is approximately 1/100,000. | 600,25 |
| GBE1 | Glycogen storage disease, type 4 | NM_000158.3 | NM_000158.3:c.2052+1G>A, NM_000158.3:c.1883A>G, NM_000158.3:c.1774G>T, NM_000158.3:c.1604A>G, NM_000158.3:c.1571G>A, NM_000158.3:c.1570C>T, NM_000158.3:c.1543C>T, NM_000158.3:c.986A>C, NM_000158.3:c.771T>A, NM_000158.3:c.466_470delCGTAT | Glycogen storage disease, type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is infantile. This disease is characterized by failure to thrive; hepatomegaly, liver dysfunction, and progressive liver cirrhosis; hypotonia; cardiomyopathy and, finally, death. | 600,25 |
| GCDH | Glutaricaciduria, type 1 | NM_000159.3 | NM_000159.3:c.74C>A, NM_000159.3:c.271+1G>A, NM_000159.3:c.383G>A, NM_000159.3:c.416C>T, NM_000159.3:c.542A>G, NM_000159.3:c.572T>C, NM_000159.3:c.636-1G>A, NM_000159.3:c.680G>C, NM_000159.3:c.743C>T, NM_000159.3:c.751C>T, NM_000159.3:c.764C>T, NM_000159.3:c.769C>T, NM_000159.3:c.877G>A, NM_000159.3:c.883T>C, NM_000159.3:c.914C>T, NM_000159.3:c.1002_1003delGA, NM_000159.3:c.1060G>A, NM_000159.3:c.1093G>A, NM_000159.3:c.1168G>C, NM_000159.3:c.1198G>A, NM_000159.3:c.1199dupT, NM_000159.3:c.1204C>T, NM_000159.3:c.1244-2A>C, NM_000159.3:c.1247C>T, NM_000159.3:c.1262C>T | Glutaricaciduria, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCDH gene located on chromosomal region 19p13.2. The age of onset is infantile or neonatal. This disease is characterized by encephalopathic crises resulting in striatal injury and a severe dystonic dyskinetic movement disorder. The prevalence is 1 in 100,000 births. | 600,25 |
| GDAP1 | Charcot-Marie-Tooth disease, recessive intermediate, type A | NM_018972.2 | NM_018972.2:c.92G>A, NM_018972.2:c.311-1G>A, NM_018972.2:c.358C>T, NM_018972.2:c.487C>T, NM_018972.2:c.715C>T, NM_018972.2:c.844C>T | Autosomal recessive intermediate Charcot-Marie-Tooth disease type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GDAP1 gene located on chromosomal region 8q21.11. The age of onset is usually in early childhood. This disease is characterized by by distal sensory impairment predominantly affecting the lower limbs and resulting in walking difficulties due to muscle weakness and atrophy. The upper limbs may also be affected. The prevalence is below 1/1,000,000. | 600 |
| GFM1 | Combined oxidative phosphorylation deficiency, type 1 | NM_001308164.1 | NM_001308164.1:c.139C>T, NM_001308164.1:c.521A>G, NM_001308164.1:c.805C>T, NM_001308164.1:c.1354_1357delGACA, NM_001308164.1:c.1589_1590delAG | Combined oxidative phosphorylation deficiency, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GFM1 gene located on chromosomal region 3q25.32. The age of onset is from early infancy until adult. This disease is characterized by ptosis, external ophthalmoplegia, proximal myopathy and exercise intolerance, cardiomyopathy, sensorineural deafness, optic atrophy, pigmentary retinopathy, and diabetes mellitus. | 600 |
| GJA1 | Craniometaphyseal dysplasia, autosomal recessive | NM_000165.4 | NM_000165.4:c.97C>T, NM_000165.4:c.227G>A | Craniometaphyseal dysplasia, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJA1 gene located on chromosomal region 6q22.31. The age of onset is infantile. This disease is characterized by hyperostosis and sclerosis of the craniofacial bones associated with abnormal modeling of the metaphyses. Sclerosis of the skull may lead to asymmetry of the mandible, as well as to cranial nerve compression, that may finally result in hearing loss and facial pals. The prevalence is below 1/1,000,000. | 600 |
| GJB2 | Deafness, autosomal recessive, type 1A | NM_004004.5 | NM_004004.5:c.617A>G, NM_004004.5:c.551G>C, NM_004004.5:c.550C>T, NM_004004.5:c.516G>A, NM_004004.5:c.465T>A, NM_004004.5:c.439G>A, NM_004004.5:c.427C>T, NM_004004.5:c.416G>A, NM_004004.5:c.402delG, NM_004004.5:c.365A>T, NM_004004.5:c.358_360delGAG, NM_004004.5:c.334_335delAA, NM_004004.5:c.313_326delAAGTTCATCAAGGG, NM_004004.5:c.310_323delAGGAAGTTCATCAA, NM_004004.5:c.299_300delAT, NM_004004.5:c.299A>T, NM_004004.5:c.270dupA, NM_004004.5:c.269dupT, NM_004004.5:c.269T>C, NM_004004.5:c.250G>T, NM_004004.5:c.250G>C, NM_004004.5:c.239A>C, NM_004004.5:c.238C>T, NM_004004.5:c.235delC, NM_004004.5:c.231G>A, NM_004004.5:c.230G>A, NM_004004.5:c.229T>C, NM_004004.5:c.169C>T, NM_004004.5:c.139G>T, NM_004004.5:c.132G>A, NM_004004.5:c.35delG | Autosomal recessive nonsyndromic sensorineural deafness type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present. | 600,25 |
| GJB6 | Deafness, autosomal recessive, type 1B | NM_001110219.2 | NM_001110219.2:c.485dupA, NM_001110219.2:c.443delC, NM_001110219.2:c.383_384delTA, NM_001110219.2:c.261dupA, NM_001110219.2:c.169C>T, NM_001110219.2:c.14C>T | Autosomal recessive nonsyndromic sensorineural deafness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB6 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment. No other associated medical findings are present. | 600,25 |
| GJC2 | Spastic paraplegia, type 44, autosomal recessive | NM_020435.3 | NM_020435.3:c.268C>T, NM_020435.3:c.613C>T, NM_020435.3:c.718C>T, NM_020435.3:c.787G>A, NM_020435.3:c.814T>G, NM_020435.3:c.857T>C | Autosomal recessive spastic paraplegia type 44 (SPG44) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJC2 gene located on chromosomal region 1q42.13. This disease is characterized by a late-onset, slowly progressive spastic paraplegia associated with mild ataxia and dysarthria, upper extremity involvement (i.e. loss of finger dexterity, dysmetria), and mild cognitive impairment, without the presence of nystagmus. A hypomyelinating leukodystrophy and thin corpus callosum is observed in all cases and psychomotor development is normal or near normal. The prevalence is below 1/1,000,000. | 600 |
| GLB1 | GM1-gangliosidosis, type 1 | NM_001317040.1 | NM_001317040.1:c.1877A>G, NM_001317040.1:c.1790C>T, NM_001317040.1:c.1721dupG, NM_001317040.1:c.1693G>T, NM_001317040.1:c.1600_1610dupGGTGCATATAT, NM_001317040.1:c.1589G>A, NM_001317040.1:c.1514G>A, NM_001317040.1:c.1513C>T, NM_001317040.1:c.1499dupA, NM_001317040.1:c.1469G>A, NM_001317040.1:c.1465G>A, NM_001317040.1:c.1457G>A, NM_001317040.1:c.1318_1319delCT, NM_001317040.1:c.1212+1G>T, NM_001317040.1:c.1195C>T, NM_001317040.1:c.1148C>T, NM_001317040.1:c.1091A>G, NM_001317040.1:c.1045G>A, NM_001317040.1:c.962G>T, NM_001317040.1:c.766C>T, NM_001317040.1:c.746G>A, NM_001317040.1:c.745C>T, NM_001317040.1:c.735dupT, NM_001317040.1:c.601+2T>C, NM_001317040.1:c.586C>T, NM_001317040.1:c.586C>A, NM_001317040.1:c.582_584delTCT, NM_001317040.1:c.420G>A, NM_001317040.1:c.346C>T, NM_001317040.1:c.320G>A, NM_001317040.1:c.319C>T, NM_001317040.1:c.315C>G, NM_001317040.1:c.296T>C, NM_001317040.1:c.289C>T | Gangliosidosis GM1, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. Although the three types differ in severity, their features can overlap significantly. The age of onset in type 1 is infantile, in type 2 is late-infantile or juvenile and adult in type3. This disease is characterized by arrest/regression of neurological development, hypotonia, visceromegaly, macular cherry-red spots, dysostosis and coarse facial features. The prevalence is 1:100,000 a 200,000 newborn. | 600,25 |
| GLDC | Glycine encephalopathy | NM_000170.2 | NM_000170.2:c.2405C>T, NM_000170.2:c.2284G>A, NM_000170.2:c.2216G>A, NM_000170.2:c.1691G>T, NM_000170.2:c.1545G>C, NM_000170.2:c.1166C>T, NM_000170.2:c.322G>T | Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in GLDC gene located on chromosomal region 9p24.1. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000. | 600,25 |
| GLE1 | Lethal congenital contracture syndrome, type 1 | NM_001003722.1 | NM_001003722.1:c.898-2A>G, NM_001003722.1:c.1412_1413delAG, NM_001003722.1:c.2051T>C, NM_001003722.1:c.2069_2072delTTCT | Lethal congenital contracture syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLE1 gene located on chromosomal region 9q34.11. The age of onset is neonatal. This disease is characterized by total fetal akinesia (detectable since the 13th week of gestation) accompanied by hydrops, micrognathia, pulmonary hypoplasia, pterygia and multiple joint contractures (usually flexion contractures in the elbows and extension in the knees), leading invariably to death before the 32nd week of gestation. Lack of anterior horn motoneurons, severe atrophy of the ventral spinal cord and severe skeletal muscle hypoplasia are characteristic neuropathological findings, with no evidence of other organ structural anomalies. | 600,25 |
| GM2A | GM2-gangliosidosis, AB variant | NM_000405.4 | NM_000405.4:c.160G>T, NM_000405.4:c.285delC, NM_000405.4:c.506G>C | GM2-gangliosidosis, AB variant follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GM2A gene located on chromosomal region 5q33.1. The age of onset is infantile. This disease is characterized by a group of neurodegenerative disorders: seizures, blindness, spasticity, eventual total incapacitation, and death. The prevalence is <1:100.000. | 600 |
| GNE | Inclusion body myopathy, type 2 (Nonaka myopathy) | NM_001128227.2 | NM_001128227.2:c.2228T>C, NM_001128227.2:c.2179G>A, NM_001128227.2:c.1937C>G, NM_001128227.2:c.1891G>A, NM_001128227.2:c.1820G>A, NM_001128227.2:c.1002T>A, NM_001128227.2:c.880C>T, NM_001128227.2:c.830G>A, NM_001128227.2:c.478C>T | Inclusion body myopathy, type 2 (Nonaka myopathy) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNE gene located on chromosomal region 9p13.3. The age of onset is adult. This disease is characterized by progressive muscle weakness and joint deformity. The prevalence is 1:500-1:1,000. | 600,25 |
| GNPTAB | Mucolipidosis 2 alpha/beta | NM_024312.4 | NM_024312.4:c.3663delG, NM_024312.4:c.3565C>T, NM_024312.4:c.3560_3561delAG, NM_024312.4:c.3503_3504delTC, NM_024312.4:c.3410T>A, NM_024312.4:c.3326dupA, NM_024312.4:c.3173C>G, NM_024312.4:c.2896delA, NM_024312.4:c.2383delG, NM_024312.4:c.1906dupA, NM_024312.4:c.1759C>T, NM_024312.4:c.1196C>T, NM_024312.4:c.1000C>T, NM_024312.4:c.749dupA, NM_024312.4:c.732_733delAA, NM_024312.4:c.648_651delAGAA, NM_024312.4:c.616_619delACAG, NM_024312.4:c.99delC, NM_024312.4:c.25C>T, NM_024312.4:c.10A>C | Mucolipidosis type 2 alpha/beta follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNPTAB gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by growth retardation, short stature, skeletal abnormalities, facial dysmorphism, stiff skin, developmental delay and cardiomegaly and that is lethal in childhood. The prevalence is 1:123,500-1:625,500. | 600,25 |
| GNS | Mucopolysaccharidosis, type 3D (Sanfilippo D) | NM_002076.3 | NM_002076.3:c.1226dupG, NM_002076.3:c.1169delA, NM_002076.3:c.1168C>T, NM_002076.3:c.1063C>T, NM_002076.3:c.413C>G | Mucolipidosis type 3D (Sanfilippo disease) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNS gene located on chromosomal region 12q14.3. The age of onset is infantile. This disease is characterized by joint stiffness and pain initially in the shoulders, hips, and fingers; and gradual mild coarsening of facial features, cardiorespiratory complications and mild cognitive impairment. The incidence is 1:70,000 newborn. | 600 |
| GPR143 | Ocular albinism, type 1 (Nettleship-Falls type) | NM_000273.2 | NM_000273.2:c.992_993insCG, NM_000273.2:c.695C>A | X-linked recessive ocular albinism follows an X-linked pattern of inheritance and is caused by pathogenic variants in the GPR143 gene located on chromosomal region Xp22.2. The age of onset is infantile. This condition reduces the coloring (pigmentation) of the iris, which is the colored part of the eye, and the retina, which is the light-sensitive tissue at the back of the eye. Pigmentation in the eye is essential for normal vision. Ocular albinism type I (OA1) is the most common form of ocular albinism. Clinical presentation of OA1 in Caucasians is characterized by nystagmus, impaired visual acuity, iris hypopigmentation with translucency, albinotic fundus, macular hypoplasia, and normally pigmented skin and hair. Carrier females usually have punctate iris translucency and a mottled pattern of fundus pigmentation. In contrast to Caucasian patients, black or Japanese patients with OA1 often have brown irides with little or no translucency and varying degrees of fundus hypopigmentation, the so-called 'nonalbinotic fundus' (summary by Xiao and Zhang, 2009). The prevalence is 1/60,000 to 1/150,000 live male births. | 600 |
| GPR179 | Night blindness, congenital stationary (complete), type 1E, autosomal recessive | NM_001004334.3 | NM_001004334.3:c.6847_6848delCT, NM_001004334.3:c.5763_5764delGA, NM_001004334.3:c.5693dupT, NM_001004334.3:c.4699_4700delAG, NM_001004334.3:c.3233_3234delCT, NM_001004334.3:c.1807C>T, NM_001004334.3:c.1784+1G>A, NM_001004334.3:c.1368delT, NM_001004334.3:c.1236G>A, NM_001004334.3:c.984delC, NM_001004334.3:c.839_842delATCA, NM_001004334.3:c.278dupC, NM_001004334.3:c.278delC | Congenital stationary night blindness type 1E follow an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR179 gene located on chromosomal region 17q12. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity. | 600,25 |
| GRHPR | Hyperoxaluria, primary, type 2 | NM_012203.1 | NM_012203.1:c.103delG, NM_012203.1:c.295C>T, NM_012203.1:c.435G>A, NM_012203.1:c.622C>T, NM_012203.1:c.755dupA | Primary hyperoxaluria, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRHPR gene located on chromosomal region 9p13.2. The age of onset is infantile. This disease is characterized by recurrent nephrolithiasis, nephrocalcinosis and end-stage renal disease with subsequent systemic oxalosis. | 600 |
| GRM6 | Night blindness, congenital stationary (complete), type 1B, autosomal recessive | NM_000843.3 | NM_000843.3:c.2560C>T, NM_000843.3:c.2341G>A, NM_000843.3:c.2213_2219delCCAGAGG, NM_000843.3:c.2122C>T, NM_000843.3:c.1861C>T, NM_000843.3:c.1565G>A, NM_000843.3:c.1336C>T, NM_000843.3:c.1258C>T, NM_000843.3:c.1214T>C, NM_000843.3:c.727dupG, NM_000843.3:c.719_720insG, NM_000843.3:c.712C>T | Congenital stationary night blindness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRM6 gene located on chromosomal region 5q35.3. The age of onset is early infancy. This disease is characterized by hemeralopia with a moderate loss of visual acuity. | 600,25 |
| GRXCR1 | Deafness, autosomal recessive, type 25 | NM_001080476.2 | NM_001080476.2:c.229C>T, NM_001080476.2:c.710_711delAT | Autosomal recessive nonsyndromic sensorineural deafness type 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRXCR1 gene located on chromosomal region 4p13. The age of onset is infantile. This disease is characterized by hearing loss which is not associated visible abnormalities of the external ear or any related medical problems. | 600 |
| GSS | Glutathione synthetase deficiency | NM_000178.3 | NM_000178.3:c.847C>T, NM_000178.3:c.832C>T, NM_000178.3:c.799C>T, NM_000178.3:c.754C>T, NM_000178.3:c.656A>G, NM_000178.3:c.656A>C, NM_000178.3:c.491G>A | Glutathione synthetase deficiency with 5-oxoprolinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GSS gene located on chromosomal region 20q11.22. The severity and age of onset are variable. This disease is characterized by affectation of the neutrophil respiratory burst and can increase host susceptibility to infections, is associated with hemolytic anemia and intellectual disability. The prevalence is <1:1,000,000. | 600 |
| GUCY2D | Leber congenital amaurosis, type 1 | NM_000180.3 | NM_000180.3:c.456C>A, NM_000180.3:c.622delC, NM_000180.3:c.1694T>C, NM_000180.3:c.2735_2736delTT, NM_000180.3:c.2945delG | Leber congenital amaurosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUCY2D gene located on chromosomal region 17p13.1. The age of onset is infantile. This disease is characterized by blindness, nystagmus, roving eye movement and severe visual impairment. | 600 |
| GUSB | Mucopolysaccharidosis, type 7 | NM_000181.3 | NM_000181.3:c.1881G>T, NM_000181.3:c.1856C>T, NM_000181.3:c.1831C>T, NM_000181.3:c.1730G>T, NM_000181.3:c.1618G>T, NM_000181.3:c.1534G>A, NM_000181.3:c.1521G>A, NM_000181.3:c.1429C>T, NM_000181.3:c.1338G>A, NM_000181.3:c.1337G>A, NM_000181.3:c.1244+1G>A, NM_000181.3:c.1219_1220insC, NM_000181.3:c.1144C>T, NM_000181.3:c.1084G>A, NM_000181.3:c.1065+1G>T, NM_000181.3:c.1061C>T, NM_000181.3:c.1050G>C, NM_000181.3:c.866G>A, NM_000181.3:c.820_821delAC, NM_000181.3:c.646C>T, NM_000181.3:c.526C>T, NM_000181.3:c.499C>T, NM_000181.3:c.442C>T | Mucopolysaccharidosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUSB gene located on chromosomal region 7q11.21. The age of onset is variable. There are prenatal forms with non-immune hydrops fetalis, and severe neonatal forms with dysmorphism, hernias, hepatosplenomegaly, club feet, dysostosis, severe hypotonia and neurological disorders that ultimately lead to profound intellectual deficit and small stature in patients that survive. Finally, there are also very mild cases that are discovered during adolescence or adulthood following presentation with thoracic kyphosis. The prevalence is 1:250,000 in newborn. | 600,25 |
| HADHA | LCHAD deficiency | NM_000182.4 | NM_000182.4:c.2146+1G>A, NM_000182.4:c.2132dupC, NM_000182.4:c.1918C>T, NM_000182.4:c.1793_1794delAT, NM_000182.4:c.1678C>T, NM_000182.4:c.1644delC, NM_000182.4:c.1620+2_1620+6delTAAGG, NM_000182.4:c.1528G>C, NM_000182.4:c.1422dupT, NM_000182.4:c.1132C>T, NM_000182.4:c.919-2A>G, NM_000182.4:c.845T>A, NM_000182.4:c.499delA, NM_000182.4:c.274_278delTCATC | Isolated deficiency of long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD deficiency) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA gene located on chromosomal region 2p23.3. This disease is characterized in infancy/early childhood of hypoketotic hypoglycemia, metabolic acidosis, liver disease, hypotonia and, frequently, cardiac involvement with arrhythmias and/or cardiomyopathy. The prevalence is 1/250,000. | 600,25 |
| HADHB | Trifunctional protein deficiency | NM_000183.2 | NM_000183.2:c.788A>G, NM_000183.2:c.1331G>A, NM_000183.2:c.1364T>G | Mitochondrial trifunctional protein deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in HADHB gene located on chromosomal region 2p23.3. The age of onset is neonatal/infancy. It is characterized by a wide clinical spectrum ranging from severe neonatal manifestations including cardiomyopathy, hypoglycemia, metabolic acidosis, skeletal myopathy and neuropathy, liver disease and death to a mild phenotype with peripheral polyneuropathy, episodic rhabdomyolysis and pigmentary retinopathy. The prevalence is <1 / 1,000,000. | 600 |
| HBA1/HBA2 | Thalassemia, alpha- | -0 | -?3.7, -?4.2, -(?)20.5, --SEA, --MED, --FIL, --THAI | Alpha-thalassemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBA1 gene located on chromosomal region 16p13.3. The age of onset is infantile. It is characterized by impaired synthesis of alpha-globin chains leading to a variable clinical picture depending on the number of affected alleles. The disease can be classified into clinical subtypes of increasing severity: silent alpha thalassemia, alpha thalassemia trait (or alpha thalassemia minor), hemoglobin H disease (HbH), and Hb Bart's hydrops fetalis (see these terms). A rare form called alpha-thalassemia-intellectual deficit syndrome has also been identified (see these terms). Alpha thalassemia trait causes microcytosis and hypochromia with absent or mild anemia (often detected on routine blood tests), generally with no other symptoms. HbH patients develop moderate hemolytic anemia with variable amounts of HbH along with occasionally severe splenomegaly, sometimes complicated by hypersplenism. Hb Bart's hydrops fetalis involves a severe deficiency in alpha-globin with serious developmental implications. Alpha-thalassemia-intellectual deficit syndrome is characterized by very mild to severe anemia associated with developmental abnormalities. The prevalence is 1:10,000-5:10,000. | 600 |
| HBB | HBB-related hemoglobinopathy | NM_000518.4 | NM_000518.4:c.*110T>C, NM_000518.4:c.440_441dupAC, NM_000518.4:c.440A>T, NM_000518.4:c.440A>C, NM_000518.4:c.439C>G, NM_000518.4:c.438T>A, NM_000518.4:c.437A>G, NM_000518.4:c.436T>C, NM_000518.4:c.435G>C, NM_000518.4:c.431A>C, NM_000518.4:c.428C>A, NM_000518.4:c.421G>A, NM_000518.4:c.383A>C, NM_000518.4:c.371_378delCCCCACCA, NM_000518.4:c.364G>T, NM_000518.4:c.364G>A, NM_000518.4:c.347C>A, NM_000518.4:c.344T>C, NM_000518.4:c.343_344delCTinsG, NM_000518.4:c.341T>A, NM_000518.4:c.332T>C, NM_000518.4:c.328delG, NM_000518.4:c.328G>A, NM_000518.4:c.323dupG, NM_000518.4:c.320T>G, NM_000518.4:c.316-1G>T, NM_000518.4:c.316-1G>A, NM_000518.4:c.316-2A>G, NM_000518.4:c.316-2A>C, NM_000518.4:c.316-3C>A, NM_000518.4:c.316-106C>G, NM_000518.4:c.316-146T>G, NM_000518.4:c.316-197C>T, NM_000518.4:c.315+2T>G, NM_000518.4:c.315+1G>C, NM_000518.4:c.315+1G>A, NM_000518.4:c.312C>G, NM_000518.4:c.306G>C, NM_000518.4:c.305A>G, NM_000518.4:c.304G>A, NM_000518.4:c.302C>T, NM_000518.4:c.299A>T, NM_000518.4:c.299A>G, NM_000518.4:c.299A>C, NM_000518.4:c.298G>T, NM_000518.4:c.298G>C, NM_000518.4:c.298G>A, NM_000518.4:c.295G>A, NM_000518.4:c.293A>T, NM_000518.4:c.287dupA, NM_000518.4:c.282_283dupTG, NM_000518.4:c.283G>C, NM_000518.4:c.277C>T, NM_000518.4:c.277C>A, NM_000518.4:c.275T>C, NM_000518.4:c.271G>T, NM_000518.4:c.269G>A, NM_000518.4:c.268A>C, NM_000518.4:c.257T>C, NM_000518.4:c.251delG, NM_000518.4:c.248A>T, NM_000518.4:c.248A>C, NM_000518.4:c.247A>G, NM_000518.4:c.230delC, NM_000518.4:c.226delC, NM_000518.4:c.217_221delAGTGAinsT, NM_000518.4:c.217dupA, NM_000518.4:c.216dupT, NM_000518.4:c.208G>A, NM_000518.4:c.206T>A, NM_000518.4:c.203_204delTG, NM_000518.4:c.201delA, NM_000518.4:c.199A>G, NM_000518.4:c.194delG, NM_000518.4:c.190C>T, NM_000518.4:c.184A>T, NM_000518.4:c.182T>A, NM_000518.4:c.179A>C, NM_000518.4:c.176C>G, NM_000518.4:c.162delT, NM_000518.4:c.143_146dupATCT, NM_000518.4:c.143dupA, NM_000518.4:c.135delC, NM_000518.4:c.134C>G, NM_000518.4:c.130G>T, NM_000518.4:c.126_129delCTTT, NM_000518.4:c.128T>C, NM_000518.4:c.127T>G, NM_000518.4:c.127T>C, NM_000518.4:c.114_120delGACCCAG, NM_000518.4:c.117_118delCC, NM_000518.4:c.118C>T, NM_000518.4:c.114G>A, NM_000518.4:c.113G>A, NM_000518.4:c.112delT, NM_000518.4:c.110delC, NM_000518.4:c.108C>A, NM_000518.4:c.103G>T, NM_000518.4:c.93G>T, NM_000518.4:c.93-1G>C, NM_000518.4:c.93-1G>A, NM_000518.4:c.93-2A>C, NM_000518.4:c.93-21G>A, NM_000518.4:c.92+6T>C, NM_000518.4:c.92+5G>T, NM_000518.4:c.92+5G>C, NM_000518.4:c.92+5G>A, NM_000518.4:c.92+2T>C, NM_000518.4:c.92+2T>A, NM_000518.4:c.92+1G>T, NM_000518.4:c.92+1G>A, NM_000518.4:c.92G>C, NM_000518.4:c.92G>A, NM_000518.4:c.91A>C, NM_000518.4:c.90C>T, NM_000518.4:c.86T>A, NM_000518.4:c.85dupC, NM_000518.4:c.82G>T, NM_000518.4:c.80A>G, NM_000518.4:c.79_80insT, NM_000518.4:c.79G>T, NM_000518.4:c.79G>A, NM_000518.4:c.75T>A, NM_000518.4:c.68_74delAAGTTGG, NM_000518.4:c.64dupG, NM_000518.4:c.59A>G, NM_000518.4:c.52A>T, NM_000518.4:c.51delC, NM_000518.4:c.48G>A, NM_000518.4:c.47G>A, NM_000518.4:c.46delT, NM_000518.4:c.45dupG, NM_000518.4:c.36delT, NM_000518.4:c.27dupG, NM_000518.4:c.25_26delAA, NM_000518.4:c.20delA, NM_000518.4:c.20A>T, NM_000518.4:c.19G>A, NM_000518.4:c.17_18delCT, NM_000518.4:c.8A>C, NM_000518.4:c.4delG, NM_000518.4:c.4G>T, NM_000518.4:c.3G>A, NM_000518.4:c.2T>G, NM_000518.4:c.2T>C, NM_000518.4:c.2T>A, NM_000518.4:c.1A>G, NM_000518.4:c.-50A>C, NM_000518.4:c.-75G>C, NM_000518.4:c.-78A>G, NM_000518.4:c.-78A>C, NM_000518.4:c.-79A>G, NM_000518.4:c.-80T>A, NM_000518.4:c.-137C>G, NM_000518.4:c.-137C>A, NM_000518.4:c.-138C>T, NM_000518.4:c.-151C>T | DNA variations in the HBB gene result in the production of different versions of beta-globin. Some of these variations may affect a person's health while other variations cause no noticeable signs or symptoms. Two of the most common HBB-related conditions are beta-thalassemia and sickle cell anemia (SCA). Beta thalassemia is caused by HBB gene mutations that prevent or decrease beta-globin production, subunits that make up hemoglobin. A lack of hemoglobin disrupts the normal development of red blood cells. A shortage of mature red blood cells can reduce the amount of oxygen that is delivered to tissues to below what is needed to satisfy the body's energy needs. A lack of oxygen in the body's tissues can lead to poor growth, organ damage, and other health problems associated with beta thalassemia. SCA is a multisystem disease associated with episodes of acute illness and progressive organ damage. SCA-associated mutations cause red blood cells assuming an abnormal, rigid, sickle shape promoting cell break down prematurely, which can lead to anemia. Anemia can cause shortness of breath, fatigue, and delayed growth and development in children. | 600,25 |
| HESX1 | Growth hormone deficiency with pituitary anomalies | NM_003865.2 | NM_003865.2:c.450_451delCA, NM_003865.2:c.445G>A, NM_003865.2:c.77T>C, NM_003865.2:c.18G>C | Growth hormone deficiency with pituitary anomalies follows an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the HESX1 gene located on chromosomal region 3p14.3. The age of onset is infantile. These diseases are characterized by short stature, cognitive alterations or delayed puberty. The incidence is 1:3,000 and 1:4,000 births. | 600,25 |
| HEXA | Tay-Sachs disease | NM_000520.5 | NM_000520.5:c.254-1G>C | Tay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births. | 600,25 |
| HEXA | Tay-Sachs disease | NM_001318825.1 | NM_001318825.1:c.1570C>T, NM_001318825.1:c.1561C>T, NM_001318825.1:c.1544G>A, NM_001318825.1:c.1543delC, NM_001318825.1:c.1543C>T, NM_001318825.1:c.1532delT, NM_001318825.1:c.1529G>A, NM_001318825.1:c.1528C>T, NM_001318825.1:c.1477G>A, NM_001318825.1:c.1455G>C, NM_001318825.1:c.1311_1312insTATC, NM_001318825.1:c.1307_1310dupTATC, NM_001318825.1:c.1293G>C, NM_001318825.1:c.1247_1248delAAinsG, NM_001318825.1:c.1210C>T, NM_001318825.1:c.1209G>A, NM_001318825.1:c.1020G>A, NM_001318825.1:c.1019+3A>G, NM_001318825.1:c.948_950delCTT, NM_001318825.1:c.838+1G>C, NM_001318825.1:c.838+1G>A, NM_001318825.1:c.838G>A, NM_001318825.1:c.805G>C, NM_001318825.1:c.782G>A, NM_001318825.1:c.705+1G>A, NM_001318825.1:c.665T>C, NM_001318825.1:c.662C>T, NM_001318825.1:c.573C>G, NM_001318825.1:c.571T>C, NM_001318825.1:c.566G>T, NM_001318825.1:c.566G>A, NM_001318825.1:c.565C>T, NM_001318825.1:c.542G>A, NM_001318825.1:c.541C>T, NM_001318825.1:c.492+5G>A, NM_001318825.1:c.413T>G, NM_001318825.1:c.173G>A, NM_001318825.1:c.116T>G, NM_001318825.1:c.78G>A, NM_001318825.1:c.77G>A, NM_001318825.1:c.2T>C, NM_001318825.1:c.1A>T, NM_001318825.1:c.1A>G | Tay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births. | 600,25 |
| HEXB | Sandhoff disease, infantile, juvenile, and adult forms | NM_000521.3 | NM_000521.3:c.115delG, NM_000521.3:c.171delG, NM_000521.3:c.202_203insGG, NM_000521.3:c.298delC, NM_000521.3:c.508C>T, NM_000521.3:c.797A>G, NM_000521.3:c.841C>T, NM_000521.3:c.850C>T, NM_000521.3:c.1238_1242delCAAAG, NM_000521.3:c.1250C>T, NM_000521.3:c.1310_1311delCA, NM_000521.3:c.1345delT, NM_000521.3:c.1375G>T, NM_000521.3:c.1380G>A, NM_000521.3:c.1517_1529dupCAAGTGCTGTTGG, NM_000521.3:c.1539_1540delCT | Sandhoff disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXB gene located on chromosomal region 5q13.3. The age of onset is adult or infantile. This disease is characterized by central nervous system degeneration, with startle reactions, early blindness, progressive motor and mental deterioration, macrocephaly and cherry-red spots on the macula. The prevalence is 1/130.000. | 600,25 |
| HGD | Alkaptonuria | NM_000187.3 | NM_000187.3:c.1189-2A>G, NM_000187.3:c.1111dupC, NM_000187.3:c.1102A>G, NM_000187.3:c.899T>G, NM_000187.3:c.808G>A, NM_000187.3:c.688C>T, NM_000187.3:c.674G>A, NM_000187.3:c.481G>A, NM_000187.3:c.469+2T>C, NM_000187.3:c.342+1G>A, NM_000187.3:c.175delA, NM_000187.3:c.172A>T, NM_000187.3:c.140C>T, NM_000187.3:c.16-1G>A | Alkaptonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGD gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by darkening of the urine when it is left exposed to air, grey-blue colouration of the eye sclerae and the ear helix (ochronosis), and a disabling joint disease involving both the axial and peripheral joints (ochronotic arthropathy). The prevalence is 1:250,000-1:1.000.000 newborn. | 600,25 |
| HGF | Deafness, autosomal recessive, type 39 | NM_000601.5 | NM_000601.5:c.2028delA, NM_000601.5:c.1597C>T | Autosomal recessive nonsyndromic sensorineural deafness type 39 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGF gene located on chromosomal region 7q21.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| HGSNAT | Mucopolysaccharidosis type 3C (Sanfilippo C) | NM_152419.2 | NM_152419.2:c.493+1G>A, NM_152419.2:c.607C>T, NM_152419.2:c.848C>T, NM_152419.2:c.1030C>T, NM_152419.2:c.1250+1G>A, NM_152419.2:c.1378-1G>A, NM_152419.2:c.1464+1G>A, NM_152419.2:c.1503delA, NM_152419.2:c.1553C>T, NM_152419.2:c.1622C>T | Mucopolysaccharidosis type 3C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGSNAT gene located on chromosomal region 8p11.21. The age of onset is infantile. This disease is characterized by defective or missing enzymes to break down mucopolysaccharides are missing or are defective. The prevalence is <1:70.000 newborn. | 600,25 |
| HIBCH | 3-hydroxyisobutryl-CoA hydrolase deficiency | NM_014362.3 | NM_014362.3:c.1012A>T, NM_014362.3:c.494_495delTT, NM_014362.3:c.365A>G, NM_014362.3:c.220-9T>G, NM_014362.3:c.79-3C>G | 3-Hydroxyisobutryl-CoA hydrolase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HIBCH gene located on chromosomal region 2q32.2. The age of onset is infantile. This disease is characterized by delayed motor development, hypotonia and progressive neurodegeneration. The prevalence is <1:1,000,000. | 600 |
| HMGCL | HMG-CoA lyase deficiency | NM_000191.2 | NM_000191.2:c.835G>A, NM_000191.2:c.698A>G, NM_000191.2:c.505_506delTC, NM_000191.2:c.230delT, NM_000191.2:c.206_207delCT, NM_000191.2:c.122G>A | 3-hydroxy-3-methylglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HMGCL gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is is an organic aciduria, due to deficiency of 3-hydroxy-3-methylglutaryl-CoA-lyase (a key enzyme in ketogenesis and leucine metabolism) usually presenting in infancy with episodes of metabolic decompensation triggered by periods of fasting or infections, which when left untreated are life-threatening and may lead to neurological sequelae. | 600 |
| HPD | Tyrosinemia, type 3 | NM_002150.2 | NM_002150.2:c.987delA, NM_002150.2:c.774T>G, NM_002150.2:c.600C>G | Tyrosinemia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPD gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by intellectual deficit and ataxia. The prevalence is 1:100,000-1:120,000 newborn. | 600,25 |
| HPRT1 | Lesch-Nyhan syndrome | NM_000194.2 | NM_000194.2:c.486-1G>A, NM_000194.2:c.508C>T, NM_000194.2:c.532+2T>G, NM_000194.2:c.610-2A>G | Lesch-Nyhan syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the HPRT1 gene located on chromosomal region Xq26.2-q26.3. The age of onset is infantile. This disease is characterized by acid overproduction, neurological troubles, and behavioral problems. The prevalence is 1:380,000. | 600 |
| HPS1 | Hermansky-Pudlak syndrome, type 1 | NM_000195.4 | NM_000195.4:c.1996G>T, NM_000195.4:c.972dupC, NM_000195.4:c.972delC, NM_000195.4:c.398+5G>A, NM_000195.4:c.397G>T | Hermansky-Pudlak syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPS1 gene located on chromosomal region 10q24.2. The age of onset is early childhood. This disease is characterized by oculocutaneous albinism, bleeding diathesis and, in some cases, neutropenia, pulmonary fibrosis, or granulomatous colitis. The prevalence is 1/500,000 - 1/1,000,000. | 600 |
| HSD17B4 | D-bifunctional protein deficiency | NM_000414.3 | NM_000414.3:c.46G>A | Bifunctional enzyme deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSD17B4 gene located on chromosomal region 5q23. The age of onset is juvenile. This disease is characterized by slowly progressive cerebellar atrophy and ataxia, intellectual decline, hearing loss, hypogonadism, hyperreflexia, a demyelinating sensorimotor neuropathy. | 600 |
| HSD17B4 | D-bifunctional protein deficiency | NM_001199291.2 | NM_001199291.2:c.392G>C, NM_001199291.2:c.725A>G, NM_001199291.2:c.1047+1G>T, NM_001199291.2:c.1444A>T | Bifunctional enzyme deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSD17B4 gene located on chromosomal region 5q23. The age of onset is juvenile. This disease is characterized by slowly progressive cerebellar atrophy and ataxia, intellectual decline, hearing loss, hypogonadism, hyperreflexia, a demyelinating sensorimotor neuropathy. | 600 |
| HSPD1 | Leukodystrophy, hypomyelinating, type 4 | NM_002156.4 | NM_002156.4:c.292G>A | Leukodystrophy hypomyelinating, type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSPD1 gene located on chromosomal region 2q33.1. The age of onset is infantile. A severe autosomal recessive hypomyelinating leukodystrophy. Clinically characterized by infantile-onset rotary nystagmus, progressive spastic paraplegia, neurologic regression, motor impairment, profound mental retardation. Death usually occurs within the first two decades of life. | 600 |
| HSPG2 | Dyssegmental dysplasia, Silverman-Handmaker type | NM_001291860.1 | NM_001291860.1:c.13078delC, NM_001291860.1:c.9329delA, NM_001291860.1:c.8467+4A>G, NM_001291860.1:c.1656_1657insT, NM_001291860.1:c.1125C>A | Dyssegmental dysplasia, Silverman-Handmaker type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HSPG2 gene located on chromosomal region 1p36.12. The age of onset is prenatal/neonatal. This disease is characterized by anisospondyly, severe short stature and limb shortening, metaphyseal flaring and distinct dysmorphic features (i.e. flat facial appearance, abnormal ears, short neck, narrow thorax). Additional features may include other skeletal findings (e.g. joint contractures, bowed limbs, talipes equinovarus) and urogenital and cardiovascular abnormalities. The prevalence is below 1/1,000,000. | 600 |
| HTRA1 | CARASIL syndrome | NM_002775.4 | NM_002775.4:c.754G>A, NM_002775.4:c.883G>A, NM_002775.4:c.889G>A, NM_002775.4:c.904C>T, NM_002775.4:c.1108C>T | Cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy (CARASIL syndrome) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HTRA1 gene located on chromosomal region 10q26.13. The age of onset is adult. This disease is characterized by early-onset gait disturbances, premature scalp alopecia, ischemic stroke, acute mid to lower back pain and progressive cognitive disturbances leading to severe dementia. About 50 people diagnosed, mainly in Japan and China. | 600 |
| HYLS1 | Hydrolethalus syndrome | NM_001134793.1 | NM_001134793.1:c.632A>G, NM_001134793.1:c.669G>A, NM_001134793.1:c.724C>T | Hydrolethalus syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HYLS1 gene located on chromosomal region 11q24.2. The age of onset is fetal. This disease is characterized by craniofacial dysmorphic features, central nervous system, cardiac, respiratory tract and limb abnormalities. The incidence is 1/20,000 in Finland and the prevalence is <1:1,000,000. | 600 |
| IDH3B | Retinitis pigmentosa, type 46 | NM_006899.4 | NM_006899.4:c.589delA, NM_006899.4:c.490C>T, NM_006899.4:c.395T>C | Retinitis pigmentosa, type 46 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IDH3B gene located on chromosomal region 20p13. The age of onset is variable. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness. The prevalence is 1/3,000 to 1/5,000. | 600 |
| IDS | Mucopolysaccharidosis, type 2 | NM_000202.7 | NM_000202.7:c.1508T>A, NM_000202.7:c.1505G>C, NM_000202.7:c.1148delC, NM_000202.7:c.1122C>T, NM_000202.7:c.998C>T, NM_000202.7:c.880-8A>G, NM_000202.7:c.690_691insT, NM_000202.7:c.683C>T, NM_000202.7:c.596_599delAACA, NM_000202.7:c.597delA, NM_000202.7:c.587T>C, NM_000202.7:c.514C>T, NM_000202.7:c.404A>G, NM_000202.7:c.388_389insG, NM_000202.7:c.314_317dupTCAA, NM_000202.7:c.278delC, NM_000202.7:c.240+1G>A, NM_000202.7:c.208dupC | Mucopolysaccharidosis, type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IDS gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by distinctive coarse facial features, short stature, cardio-respiratory involvement and skeletal abnormalities. The prevalence is 1:100,000-1:170,000 mannewborn. | 600 |
| IDS | Mucopolysaccharidosis, type 2 | NM_001166550.3 | NM_001166550.3:c.15-2A>G | Mucopolysaccharidosis, type 2 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IDS gene located on chromosomal region Xq28. The age of onset is infantile. This disease is characterized by distinctive coarse facial features, short stature, cardio-respiratory involvement and skeletal abnormalities. The prevalence is 1:100,000-1:170,000 mannewborn. | 600 |
| IFT80 | Short-rib thoracic dysplasia, type 2, with or without polydactyly | NM_020800.2 | NM_020800.2:c.701C>G, NM_020800.2:c.315C>G | Short-rib thoracic dysplasia type 2 with or without polydactyly an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IFT80 gene located on chromosomal region 3q25.33. The age of onset is antenatal/neonatal. This is, a group of autosomal recessive ciliopathies that are characterized by a constricted thoracic cage, short ribs, shortened tubular bones, and a trident appearance of the acetabular roof. Polydactyly is variably present. Non-skeletal involvement can include cleft lip/palate as well as anomalies of major organs such as the brain, eye, heart, kidneys, liver, pancreas, intestines, and genitalia. Some forms of the disease are lethal in the neonatal period due to respiratory insufficiency secondary to a severely restricted thoracic cage, whereas others are compatible with life. Disease spectrum encompasses Ellis-van Creveld syndrome, asphyxiating thoracic dystrophy (Jeune syndrome), Mainzer-Saldino syndrome, and short rib-polydactyly syndrome. The incidence is 1-5/500,000. | 600 |
| IGF1 | Growth retardation with deafness and mental retardation due to IGF1 deficiency | NM_001111285.2 | NM_001111285.2:c.274G>A | Growth retardation with deafness and mental retardation due to IGF1 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGF1 gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by the association of intrauterine and postnatal growth retardation with sensorineural deafness and intellectual deficit, addition clinical features include microcephaly, adiposity, and insulin resistance. The prevalence is <1:1,000,000. | 600 |
| IGHMBP2 | Charcot-Marie-Tooth disease, axonal, type 2S | NM_002180.2 | NM_002180.2:c.121C>T, NM_002180.2:c.638A>G, NM_002180.2:c.661delA, NM_002180.2:c.1107C>G, NM_002180.2:c.1488C>A, NM_002180.2:c.1540G>A, NM_002180.2:c.1738G>A, NM_002180.2:c.2362C>T, NM_002180.2:c.2611+1G>T | Charcot-Marie-Tooth disease, axonal, type 2S follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGHMBP2 gene located on chromosomal region 11q13.3. The age of onset can be infancy, childhood, adult or adolescent. This disease is characterized by progressive distal muscle weakness and atrophy of both the lower and upper limbs, absent or reduced deep tendon reflexes, mild sensory loss, foot drop, and pes cavus leading eventually to wheelchair dependence. Some patients present with early hypotonia and delayed motor development. Scoliosis and variable autonomic disturbances may be associated. The prevalence is below 1/1,000,000. | 600,25 |
| IL2RG | Severe combined immunodeficiency, X-linked | NM_000206.2 | NM_000206.2:c.854G>A, NM_000206.2:c.664C>T, NM_000206.2:c.454+1G>A, NM_000206.2:c.452T>C, NM_000206.2:c.355A>T, NM_000206.2:c.343T>C, NM_000206.2:c.341G>A, NM_000206.2:c.186T>A | Severe combined immunodeficiency, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the IL2RG gene located on chromosomal region Xq13.1. The age of onset is infantile. This disease is characterized by absent or markedly reduced numbers of T cells, leading to recurrent infections. The prevalence is 1:50,000-1:100,000. | 600 |
| IMPG2 | Retinitis pigmentosa, type 56 | NM_016247.3 | NM_016247.3:c.3262C>T, NM_016247.3:c.2890C>T, NM_016247.3:c.635C>G, NM_016247.3:c.502-1G>C | Retinitis pigmentosa type 56 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IMPG2 gene located on chromosomal region 3q12.3. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades. The prevalence is 1/4.000. | 600 |
| INPP5E | Joubert syndrome, type 1 | NM_019892.5 | NM_019892.5:c.1879C>T, NM_019892.5:c.1688G>A, NM_019892.5:c.1543C>T, NM_019892.5:c.1304G>A, NM_019892.5:c.1132C>T, NM_019892.5:c.855_856insCG | Joubert syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. | 600,25 |
| INSR | Diabetes mellitus, insulin-resistant, with acanthosis nigricans, type A | NM_000208.3 | NM_000208.3:c.3680G>C, NM_000208.3:c.3079C>T, NM_000208.3:c.2668C>T, NM_000208.3:c.1114C>T, NM_000208.3:c.172G>A | Diabetes mellitus, insulin-resistant, with acanthosis nigricans type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by the triad of hyperinsulinemia, acanthosis nigricans (skin lesions associated with insulin resistance), and signs of hyperandrogenism in females without lipodystrophy and who are not overweight. It is generally diagnosed in young women with marked signs of hyperandrogenism, but insulin resistance and acanthosis nigricans may be observed in men and in childhood. Acromegaloid facies or muscular cramps are sometimes associated. Hyperinsulinemia, a biological marker for insulin resistance, is often associated with glucose tolerance defects over the course of the disease, and diabetes progressively sets in. Hyperandrogenism (associated with polycystic ovarian syndrome (see this term) or ovarian hyperthecoses) leads to fertility problems. The prevalence is <1:1,000,000. | 600,25 |
| IQCB1 | Senior-Loken syndrome, type 5 | NM_001023570.3 | NM_001023570.3:c.1518_1519delCA, NM_001023570.3:c.1465C>T, NM_001023570.3:c.1381C>T, NM_001023570.3:c.1090C>T, NM_001023570.3:c.1069C>T, NM_001023570.3:c.1036G>T, NM_001023570.3:c.817G>T | Senior-Loken syndrome, type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IQCB1 gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by the association of nephronophthisis (NPHP), a chronic kidney disease, with retinal dystrophy. The prevalence is 1/1.000.000. | 600 |
| ISCU | Myopathy with lactic acidosis, hereditary | NM_213595.3 | NM_213595.3:c.149G>A, NM_213595.3:c.338_339+2delCGGT | Hereditary myopathy with lactic acidosis due to ISCU deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ISCU gene located on chromosomal region 12q23.3. The age of onset is infantile. This disease is characterized by myopathy with severe exercise intolerance. | 600 |
| ITGA6 | Epidermolysis bullosa, junctional, with pyloric stenosis | NM_001079818.2 | NM_001079818.2:c.791delC, NM_001079818.2:c.1255dupA | Junctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGA6 gene located on chromosomal region 2q31.1 . The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. | 600 |
| ITGB4 | Epidermolysis bullosa, junctional, with pyloric atresia | NM_000213.4 | NM_000213.4:c.112T>C, NM_000213.4:c.182G>A, NM_000213.4:c.1150delG, NM_000213.4:c.1660C>T, NM_000213.4:c.1684T>C, NM_000213.4:c.2608delC, NM_000213.4:c.2792G>A, NM_000213.4:c.3321_3331delACTGGACCGGA, NM_000213.4:c.3674G>A, NM_000213.4:c.3793+1G>A, NM_000213.4:c.3801dupT, NM_000213.4:c.3841C>T, NM_000213.4:c.4620delG, NM_000213.4:c.4643G>A, NM_000213.4:c.4828C>T, NM_000213.4:c.5329+2T>C | Junctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGB4 gene located on chromosomal region 17q25.1. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. More than 100 cases have been reported around the world. | 600,25 |
| IVD | Isovaleric acidemia | NM_002225.3 | NM_002225.3:c.2T>G, NM_002225.3:c.134T>C, NM_002225.3:c.157C>T, NM_002225.3:c.158G>A, NM_002225.3:c.158G>C, NM_002225.3:c.243+1G>A, NM_002225.3:c.367G>A, NM_002225.3:c.390delT, NM_002225.3:c.406_407delTG, NM_002225.3:c.434_437dupATGA, NM_002225.3:c.465+2T>C, NM_002225.3:c.478_479insGT, NM_002225.3:c.507delG, NM_002225.3:c.559+1G>A, NM_002225.3:c.593G>A, NM_002225.3:c.605G>T, NM_002225.3:c.627delT, NM_002225.3:c.793+1G>A, NM_002225.3:c.941C>T, NM_002225.3:c.994_995delAT, NM_002225.3:c.1141T>C, NM_002225.3:c.1145_1147+4delTTGGTGA, NM_002225.3:c.1183C>T, NM_002225.3:c.1188delT, NM_002225.3:c.1192C>T, NM_002225.3:c.1208A>G | Isovaleric academia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IVD gene located on chromosomal region 15q15.1. The age of onset is neonatal. This disease is characterized by vomiting, dehydration, coma and abnormal movements. The prevalence is 1/100,000. | 600,25 |
| JAK3 | Severe Combined Immunodeficiency, autosomal recessive, T-negative/B-positive type | NM_000215.3 | NM_000215.3:c.1837C>T, NM_000215.3:c.1765G>A, NM_000215.3:c.1695C>A, NM_000215.3:c.1333C>T, NM_000215.3:c.1172_1173insG, NM_000215.3:c.299A>G | Severe combined immunodeficiency, T-B+ type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the JAK3 gene located on chromosomal region 19p13.11. The age of onset is infantile. This disease is characterized by chronic diarrhea, failure to thrive, recurrent respiratory infections and/or generalized infections due to opportunistic pathogens. The incidence is 1/100,000 and 1/1,000,000. | 600,25 |
| KCNJ1 | Bartter syndrome, type 2 | NM_000220.4 | NM_000220.4:c.1014delA, NM_000220.4:c.1012C>T, NM_000220.4:c.996_999delAAAG, NM_000220.4:c.942T>G, NM_000220.4:c.657C>G, NM_000220.4:c.641C>T, NM_000220.4:c.592G>A, NM_000220.4:c.500G>A, NM_000220.4:c.372T>A, NM_000220.4:c.322G>C, NM_000220.4:c.237C>G | Bartter syndrome, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ1 gene located on chromosomal region 11q24.3. The age of onset is antenatal. This disease is characterized by severe polyhydramnios in mother leading to premature delivery, postnatally newborns suffer from recurrent episodes of severe dehydration and electrolyte imbalance which can lead to fatal outcome. | 600,25 |
| KCNJ13 | Leber congenital amaurosis, type 16 | NM_002242.4 | NM_002242.4:c.722T>C | Leber congenital amaurosis, type 16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ13 gene located on chromosomal region 2q37.1. The age of onset is early infantile. This disease is characterized by retinal dystrophy defined by blindness, nystagmus, roving eye movement, leading to severe visual impairment within the first year of life. | 600 |
| KCNV2 | Retinal cone dystrophy, type 3B | NM_133497.3 | NM_133497.3:c.226C>T, NM_133497.3:c.325C>T, NM_133497.3:c.357dupC, NM_133497.3:c.427G>T, NM_133497.3:c.442G>T, NM_133497.3:c.491T>C, NM_133497.3:c.767C>G, NM_133497.3:c.778A>T, NM_133497.3:c.916G>T, NM_133497.3:c.1016_1024delACCTGGTGG, NM_133497.3:c.1133dupT, NM_133497.3:c.1376G>A | Retinal cone dystrophy, type 3B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNV2 gene located on 9p24.2. The age of onset is in the first or second decade of life. This disease is characterized by is characterized by onset in the first or second decade of life of very marked photophobia, myopia, reduced color vision along the red-green axis with relatively preserved tritan discrimination, and central scotomata with peripheral widespread sensitivity loss predominating in the superior visual field. Nyctalopia is a later feature of the disorder. There is often retinal pigment epithelium disturbance at the macula with a normal retinal periphery. | 600,25 |
| KIF7 | Acrocallosal syndrome; Joubert syndrome, type 12 | NM_198525.2 | NM_198525.2:c.3772_3773insC, NM_198525.2:c.3001C>T, NM_198525.2:c.2896_2897delGC, NM_198525.2:c.2473G>T, NM_198525.2:c.687delG, NM_198525.2:c.460C>T, NM_198525.2:c.61C>T | Acrocallosal syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KIF7 gene located on chromosomal region 15q26.1. The age of onset is infantile. This disease is considered a ciliopathy and is characterized by mental retardation, brain abnormalities such as corpus callosum agenesis and/or Dandy-Walker malformation as well as dysmorphic features, postaxial polydactyly of the hands, and preaxial polydactyly of the feet. The prevalence is below 1/1,000,000. Mutations in KIF7 gene are also associated with Joubert syndrome type 12, a disorder with an acrocallosal syndrome overlapping phenotype characterized by the hallmark finding of the molar tooth sign (MTS) on brain MRI. | 600 |
| L1CAM | L1 Syndrome | NM_000425.4 | NM_000425.4:c.3581C>T, NM_000425.4:c.3489_3490delTG, NM_000425.4:c.3201T>G, NM_000425.4:c.2879delA, NM_000425.4:c.2254G>A, NM_000425.4:c.2092G>A, NM_000425.4:c.1792G>A, NM_000425.4:c.1354G>A, NM_000425.4:c.1108G>A, NM_000425.4:c.924C>T, NM_000425.4:c.800dupA, NM_000425.4:c.791G>A, NM_000425.4:c.772C>T, NM_000425.4:c.719C>T, NM_000425.4:c.551G>A, NM_000425.4:c.536T>G, NM_000425.4:c.23delT | L1 syndromeᅠdescribes a group of conditions that primarily affect the nervous system and occur almost exclusively in males. These conditions vary in severity and include, from most severe to least, X-linked hydrocephalus with stenosis of the aqueduct of Sylvius (HSAS), MASA syndrome, spastic paraplegia type 1, and X-linked complicated corpus callosum agenesis. HSAS is an acronym for the characteristic features of the condition: fluid in the brain (hydrocephalus), muscle stiffness (spasticity), thumbs that are permanently bent toward the palms (adducted thumbs), and narrowing (stenosis) of the aqueduct of Sylvius in the brain. Individuals with HSAS often have severe intellectual disability and may have seizures. MASA syndrome include intellectual disability (mental retardation), mild to moderate, delayed speech (aphasia), spasticity, and adducted thumbs. Individuals with MASA syndrome may have mild enlargement of the ventricles. Spastic paraplegia type 1 is characterized by progressive muscle stiffness (spasticity) and the development of paralysis of the limbs (paraplegia). Affected individuals also have mild to moderate intellectual disability. X-linked complicated corpus callosum agenesis is defined by underdevelopment (hypoplasia) or absence (agenesis) of the tissue that connects the left and right halves of the brain (the corpus callosum). The life expectancy of individuals with L1 syndrome varies depending on the severity of the signs and symptoms. | 600 |
| LAMA2 | LAMA2-related muscular dystrophy | NM_000426.3 | NM_000426.3:c.112+1G>A, NM_000426.3:c.184G>T, NM_000426.3:c.825delC, NM_000426.3:c.1050delT, NM_000426.3:c.1612C>T, NM_000426.3:c.2049_2050delAG, NM_000426.3:c.2098_2099delTT, NM_000426.3:c.2323-2A>T, NM_000426.3:c.2451-2A>G, NM_000426.3:c.2750-1G>C, NM_000426.3:c.2901C>A, NM_000426.3:c.2962C>T, NM_000426.3:c.3215delG, NM_000426.3:c.3237C>A, NM_000426.3:c.3630delT, NM_000426.3:c.3718C>T, NM_000426.3:c.3976C>T, NM_000426.3:c.4645C>T, NM_000426.3:c.5050G>T, NM_000426.3:c.5227G>T, NM_000426.3:c.6011delA, NM_000426.3:c.6038delT, NM_000426.3:c.6334A>T, NM_000426.3:c.6429+1G>A, NM_000426.3:c.6617delT, NM_000426.3:c.6955C>T, NM_000426.3:c.7147C>T, NM_000426.3:c.7279_7280delCT, NM_000426.3:c.7536delC, NM_000426.3:c.7732C>T, NM_000426.3:c.7810C>T, NM_000426.3:c.7888C>T, NM_000426.3:c.8314delA, NM_000426.3:c.8705delT, NM_000426.3:c.8748delA, NM_000426.3:c.9101_9104dupAACA, NM_000426.3:c.9221delA, NM_000426.3:c.9253C>T | LAMA2-related muscular dystrophy 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMA2 gene located on chromosomal region 6q22.33. LAMA2-related muscular dystrophy is a disorder that causes weakness and atrophy of skeletal muscles. This condition varies in severity, from a severe, early-onset type to a milder, late-onset form. Early-onset LAMA2-related muscular dystrophy is apparent at birth or within the first few months of life, called merosin-deficient congenital muscular dystrophy type 1A (607855). Patients show hypotonia, poor suck and cry, and delayed motor development; most never achieve independent ambulation. Most patients also have periventricular white matter abnormalities on brain imaging, but mental retardation and/or seizures occur only rarely. Symptoms of late-onset LAMA2-related muscular dystrophy become evident later in childhood or adulthood, and are similar to those of a group of muscle disorders classified as autosomal recessive limb-girdle muscular dystrophies, type 23. This group is characterized by slowly progressive proximal muscle weakness primarily affecting the lower limbs and resulting in gait difficulties. Additional features include white matter abnormalities on brain imaging, increased serum creatine kinase, and dystrophic features, with partial LAMA2 deficiency on muscle biopsy. Some patients may have additional neurologic features, including executive deficits, seizures, and peripheral neuropathy. Patients remain ambulatory well into adulthood. The prevalence is 1/30,000. | 600,25 |
| LAMA3 | Epidermolysis bullosa, junctional 2A, intermediate;Epidermolysis bullosa, junctional 2B, severe;Epidermolysis bullosa, junctional 2C, laryngoonychocutaneous | NM_198129.2 | NM_198129.2:c.5162delG, NM_198129.2:c.6009delG, NM_198129.2:c.6808C>T, NM_198129.2:c.6943A>T, NM_198129.2:c.7489C>T, NM_198129.2:c.8177+2T>G, NM_198129.2:c.8962C>T, NM_198129.2:c.9162dupA, NM_198129.2:c.9705dupT | Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMA3 gene located on chromosomal region 18q11.2. The age of onset is neonatal/infancy. Junctional epidermolysis bullosa (JEB) is a group of genetic conditions that cause the skin to be very fragile and to blister easily. Blisters and skin erosions form in response to minor injury or friction, such as rubbing or scratching. Researchers classify junctional epidermolysis bullosa into two main types based on severity: Herlitz JEB and non-Herlitz JEB. Herlitz type is more severe phenotype characterized by blisters and erosions, localized to the skin and mucous membranes and often results in early death. More than 30 mutations in the LAMA3 gene have been identified in people with Herlitz JEB. Other LAMA3 gene mutations cause the milder form non-Herlitz JEB, phenotype characterized by generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement. | 600 |
| LAMB3 | Junctional epidermolysis bullosa, Herlitz and non-Herlitz type | NM_000228.2 | NM_000228.2:c.3228+1G>T, NM_000228.2:c.3228+1G>A, NM_000228.2:c.2806C>T, NM_000228.2:c.1903C>T, NM_000228.2:c.1830G>A, NM_000228.2:c.1587_1588delAG, NM_000228.2:c.1438_1442delCCGTG, NM_000228.2:c.1357delT, NM_000228.2:c.904delT, NM_000228.2:c.727C>T, NM_000228.2:c.628+1delG, NM_000228.2:c.628G>A, NM_000228.2:c.565-2A>G, NM_000228.2:c.496C>T, NM_000228.2:c.124C>T | Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 gene located on chromosomal region 1q32.2. The age of onset is neonatal/infancy. Junctional epidermolysis bullosa (JEB) is a group of genetic conditions that cause the skin to be very fragile and to blister easily. Blisters and skin erosions form in response to minor injury or friction, such as rubbing or scratching. Researchers classify junctional epidermolysis bullosa into two main types based on severity: Herlitz JEB and non-Herlitz JEB. Herlitz type is more severe phenotype characterized by blisters and erosions, localized to the skin and mucous membranes and often results in early death. More than 80 mutations in the LAMB3 gene have been identified in people with Herlitz JEB. Other LAMB3 gene mutations cause the milder form non-Herlitz JEB, disease characterized by generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement. | 600,25 |
| LAMC2 | Epidermolysis bullosa, junctional 3A, intermediate;Epidermolysis bullosa, junctional 3B, severe | NM_005562.2 | NM_005562.2:c.283C>T, NM_005562.2:c.343C>T, NM_005562.2:c.405-1G>A, NM_005562.2:c.1659C>A, NM_005562.2:c.1782_1783delGC, NM_005562.2:c.2137_2143delCAGAACC, NM_005562.2:c.3069+1G>A, NM_005562.2:c.3120_3121insA, NM_005562.2:c.3512dupA | Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMC2 gene located on chromosomal region 1q25.3. The age of onset is neonatal/infancy. Junctional epidermolysis bullosa (JEB) is a group of genetic conditions that cause the skin to be very fragile and to blister easily. Blisters and skin erosions form in response to minor injury or friction, such as rubbing or scratching. Researchers classify junctional epidermolysis bullosa into two main types based on severity: Herlitz JEB and non-Herlitz JEB. Herlitz type is more severe phenotype characterized by blisters and erosions, localized to the skin and mucous membranes and often results in early death. More than 30 mutations in the LAMC2 gene have been identified in people with Herlitz JEB. Other LAMC2 gene mutations cause the milder form non-Herlitz JEB, disease characterized by generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement. | 600 |
| LARGE1 | Muscular dystrophy-dystroglycanopathy, type 6A and 6B | NM_004737.4 | NM_004737.4:c.1525G>A, NM_004737.4:c.1483T>C, NM_004737.4:c.1102C>T, NM_004737.4:c.992C>T | Muscular dystrophy-dystroglycanopathy, type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LARGE1 gene located on chromosomal region 22q12.3. The age of onset is infantile. There are two subtypes of dystroglycanopathies related to LARGE1 gene: subtype 6A and 6B. Subtype 6A is the most severe phenotype and is associated with congenital brain and eye anomalies, cobblestone lissencephaly, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Subtype 6B represents an intermediate phenotype with or without congenital mental retardation, white matter changes and structural brain abnormalities. The prevalence is 1:100,000-9:100,000. | 600 |
| LBR | Greenberg skeletal dysplasia | NM_002296.3 | NM_002296.3:c.1748G>A, NM_002296.3:c.1402delT, NM_002296.3:c.1114C>T, NM_002296.3:c.32_35delTGGT | Greenberg dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LBR gene located on chromosomal region 1q42.12. The age of onset is fetal. This disease is characterized by fetal hydrops, short limbs and abnormal chondro-osseous calcification. The prevalence is <1:1,000,000. | 600 |
| LDHA | Glycogen storage disease type 11 | NM_001165414.1 | NM_001165414.1:c.213+1G>A, NM_001165414.1:c.727_728delCT | Glycogen storage disease type 11 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LDHA gene located on chromosomal region 11p15.1. The age of onset is infantile. This disease is characterized by hepatic glycogenosis and renal Fanconi syndrome. | 600 |
| LHFPL5 | Deafness, autosomal recessive type 67 | NM_182548.3 | NM_182548.3:c.250delC, NM_182548.3:c.380A>G, NM_182548.3:c.494C>T, NM_182548.3:c.649+1delG | Autosomal recessive nonsyndromic sensorineural deafness type 67 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LHFPL5 gene located on chromosomal region 6p21.31. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| LHX3 | Pituitary hormone deficiency, combined, type 3 | NM_014564.4 | NM_014564.4:c.687G>A, NM_014564.4:c.347A>G | Combined pituitary hormone deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LHX3 gene located on chromosomal region 9q34.3. The age of onset is infantile, etc/. This disease is characterized by somatolactotroph, thyrotroph and gonadotroph deficiencies, limited head and neck rotation associated with spinal abnormalities. The prevalence is <1 /1,000,000. | 600 |
| LIFR | Stuve-Wiedemann syndrome / Schwartz-Jampel type 2 syndrome | NM_001127671.1 | NM_001127671.1:c.2503G>T, NM_001127671.1:c.2013dupT, NM_001127671.1:c.1789C>T, NM_001127671.1:c.1018_1022delAATTG, NM_001127671.1:c.653dupT, NM_001127671.1:c.171_174delTAAC | St�ve-Wiedemann syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LIFR gene located on chromosomal region 5p13.1. The age of onset is neonatal. This disease is characterized by small stature, congenital bowing of the long bones and campodactyly. | 600 |
| LIG4 | LIG4 syndrome | NM_001098268.1 | NM_001098268.1:c.2440C>T, NM_001098268.1:c.1738C>T, NM_001098268.1:c.1512_1513delTC, NM_001098268.1:c.1455_1456delTG, NM_001098268.1:c.1406G>A, NM_001098268.1:c.1369_1372delGGAC, NM_001098268.1:c.1271_1275delAAAGA, NM_001098268.1:c.833G>A | LIG4 syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LIG4 gene located on chromosomal region 10p13. The age of onset is infantile. It is associated with impaired DNA double-strand break repair mechanisms and characterized by microcephaly, unusual facial features (''bird-like''), growth and developmental delay, skin anomalies including photosensitivity and psoriatic-like lesions, and pancytopenia. The disease is associated with immunodeficiency. Some patients have been reported as having telangiectasias, leukemia, lymphoma, bone marrow abnormalities, and type 2 diabetes. The prevalence 1-9/1.000.000. | 600 |
| LMNA | LMNA-related disorders, autosomal recessive | NM_001282626.1 | NM_001282626.1:c.1818+6C>T | LMNA-related disorders, autosomal recessive, are caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22, and include Charcot-Marie-Tooth disease, type 2B1, Emery-Dreifuss muscular dystrophy type 3, mandibuloacral dysplasia, lethal restrictive dermopathy among others. Charcot-Marie-Tooth disease constitutes a clinically and genetically heterogeneous group of hereditary motor and sensory neuropathies. Emery-Dreifuss muscular dystrophy is characterized classically by the triad of weakness of the shoulder and pelvic girdle muscles, contractures of the elbows, neck, and Achilles tendon, and cardiac involvement, most commonly arrhythmias. Mandibuloacral dysplasia is characterized by growth retardation, craniofacial anomalies with mandibular hypoplasia, skeletal abnormalities with progressive osteolysis of the distal phalanges and clavicles, and pigmentary skin changes. Restrictive dermopathy is a rare, lethal genodermatosis characterized by thin, tightly adherent translucent skin with erosions at flexure sites, superficial vessels, typical facial dysmorphism, and generalized joint ankylosis. | 600,25 |
| LMNA | LMNA-related disorders, autosomal recessive | NM_170707.3 | NM_170707.3:c.419T>C, NM_170707.3:c.1072G>A, NM_170707.3:c.1228C>T, NM_170707.3:c.1366A>C, NM_170707.3:c.1411C>T, NM_170707.3:c.1488+1G>A, NM_170707.3:c.1579C>T, NM_170707.3:c.1580G>A, NM_170707.3:c.1583C>A, NM_170707.3:c.1585G>A, NM_170707.3:c.1586C>T, NM_170707.3:c.1626G>C | LMNA-related disorders, autosomal recessive, are caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22, and include Charcot-Marie-Tooth disease, type 2B1, Emery-Dreifuss muscular dystrophy type 3, mandibuloacral dysplasia, lethal restrictive dermopathy among others. Charcot-Marie-Tooth disease constitutes a clinically and genetically heterogeneous group of hereditary motor and sensory neuropathies. Emery-Dreifuss muscular dystrophy is characterized classically by the triad of weakness of the shoulder and pelvic girdle muscles, contractures of the elbows, neck, and Achilles tendon, and cardiac involvement, most commonly arrhythmias. Mandibuloacral dysplasia is characterized by growth retardation, craniofacial anomalies with mandibular hypoplasia, skeletal abnormalities with progressive osteolysis of the distal phalanges and clavicles, and pigmentary skin changes. Restrictive dermopathy is a rare, lethal genodermatosis characterized by thin, tightly adherent translucent skin with erosions at flexure sites, superficial vessels, typical facial dysmorphism, and generalized joint ankylosis. | 600,25 |
| LOXHD1 | Deafness, autosomal recessive type 77 | NM_144612.6 | NM_144612.6:c.4714C>T, NM_144612.6:c.4524_4525delAG, NM_144612.6:c.3924C>A, NM_144612.6:c.2008C>T, NM_144612.6:c.512-1G>A, NM_144612.6:c.457_461dupCGCCA | Autosomal recessive nonsyndromic sensorineural deafness type 77 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LOXHD1 gene located on chromosomal region 18q21.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| LRAT | Leber congenital amaurosis type 14 | NM_001301645.1 | NM_001301645.1:c.217_218delAT, NM_001301645.1:c.525T>A, NM_001301645.1:c.588dupT | Leber congenital amaurosis type 14 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRAT gene located on chromosomal region 4q32.1. The age of onset is infantile. This disease is characterized by blindness, nystagmus, roving eye movement. The prevalence is 2:100,000-3:100,000 newborn. | 600 |
| LRP2 | Donnai-Barrow syndrome | NM_004525.2 | NM_004525.2:c.13388+2T>C, NM_004525.2:c.13139dupC, NM_004525.2:c.11636-1G>T, NM_004525.2:c.11469_11472delTTTG, NM_004525.2:c.10769-2A>G, NM_004525.2:c.9484_9485delGT, NM_004525.2:c.8519_8522delATTT, NM_004525.2:c.7564T>C, NM_004525.2:c.2640-1G>A, NM_004525.2:c.1341+2T>G, NM_004525.2:c.1093C>T | Donnai-Barrow syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP2 gene located on chromosomal region 2q31.1. The age of onset is infantile. This disease is characterized by diaphragmatic hernia, ocular findings, hipertelorism, agenesis of the corpus callosum, hearing loss and facial dimorphism. The prevalence is <1:1,000,000. | 600 |
| LRP5 | Osteoporosis-pseudoglioma syndrome | NM_002335.3 | NM_002335.3:c.804_813delGGGGAAGAGG, NM_002335.3:c.1453G>T, NM_002335.3:c.1468delG, NM_002335.3:c.1481G>A, NM_002335.3:c.1708C>T, NM_002335.3:c.1709G>A, NM_002335.3:c.2202G>A, NM_002335.3:c.2254C>G, NM_002335.3:c.2305delG, NM_002335.3:c.2557C>T, NM_002335.3:c.4099G>A, NM_002335.3:c.4651G>A | Osteoporosis-pseudoglioma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by congenital or infancy-onset blindness and severe juvenile-onset osteoporosis and spontaneous fractures. The prevalence is 1:2,000,000. | 600,25 |
| LRPPRC | Leigh syndrome, French-Canadian type | NM_133259.3 | NM_133259.3:c.3830_3839delGTGGTGCAATinsAG, NM_133259.3:c.1061C>T | French-Canadian type Leigh syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRPPRC gene located on chromosomal region 2p21. The age of onset is infantile. This disease is characterized by chronic metabolic acidosis, hypotonia, facial dysmorphism and delayed development. The prevalence is 1:2,000 newborn. | 600 |
| LRTOMT | Deafness, autosomal recessive type 63 | NM_001145308.4 | NM_001145308.4:c.242G>A | Autosomal recessive nonsyndromic sensorineural deafness type 63 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRTOMT gene located on chromosomal region 11q13.4. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| MAK | Retinitis pigmentosa type 62 | NM_001242957.2 | NM_001242957.2:c.1087_1088delAG, NM_001242957.2:c.719_720dupAG, NM_001242957.2:c.718C>T, NM_001242957.2:c.388A>C, NM_001242957.2:c.37G>A | Retinitis pigmentosa type 62 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAK gene located on chromosomal region 6p24.2. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades. | 600 |
| MAN2B1 | Mannosidosis, alpha-, types I and II | NM_000528.3 | NM_000528.3:c.2686_2687delCTinsG, NM_000528.3:c.2436+2T>C, NM_000528.3:c.2426T>C, NM_000528.3:c.2398G>A, NM_000528.3:c.2368C>T, NM_000528.3:c.2278C>T, NM_000528.3:c.2119C>T, NM_000528.3:c.2013delT, NM_000528.3:c.1929G>A, NM_000528.3:c.1915C>T, NM_000528.3:c.1830+1G>C, NM_000528.3:c.1780C>T, NM_000528.3:c.384G>A, NM_000528.3:c.1A>G | Alpha-mannosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAN2B1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by immunodeficiency, facial and skeletal abnormalities, hearing impairment and intellectual disability. The prevalence is 1:1,000,000-9:1,000,000. | 600,25 |
| MARVELD2 | Deafness, autosomal recessive type 49 | NM_001038603.2 | NM_001038603.2:c.1183-1G>A, NM_001038603.2:c.1363C>T | Autosomal recessive nonsyndromic sensorineural deafness type 49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MARVELD2 gene located on chromosomal region 5q13.2. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| MAT1A | Methionine adenosyltransferase deficiency, autosomal recessive | NM_000429.2 | NM_000429.2:c.1070C>T, NM_000429.2:c.1043_1044delTG, NM_000429.2:c.1006G>A, NM_000429.2:c.966T>G, NM_000429.2:c.914T>C, NM_000429.2:c.827_828insG, NM_000429.2:c.791G>A, NM_000429.2:c.790C>T, NM_000429.2:c.538_539insTG | Methionine adenosyltransferase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAT1A gene located on chromosomal region 10q23.1. This disease is characterized by brain demyelination (rarely leading to neurological disorders) and isolated hepatic hypermethioninemia. The prevalence is <1:1,000,000. | 600 |
| MBTPS2 | IFAP/BRESHECK syndrome; Osteogenesis imperfecta, type 19 | NM_015884.3 | NM_015884.3:c.261G>A, NM_015884.3:c.677G>T, NM_015884.3:c.1286G>A, NM_015884.3:c.1424T>C | IFAP/BRESHECK syndrome and Osteogenesis imperfecta, type 19 follow an X-linked pattern of inheritance and are caused by pathogenic variants in the MBTPS2 gene located on chromosomal region Xp22.12-p22.11. IFAP/ BRESHECK syndrome's age of onset is infantile and it is characterized by the triad of ichthyosis follicularis, alopecia, and photophobia. Some patients have additional features, including mental retardation, brain anomalies, Hirschsprung disease, corneal opacifications, kidney dysplasia, cryptorchidism, cleft palate, and skeletal malformations, which constitutes BRESHECK syndrom . The prevalence of this syndrome is 1:200,000. Osteogenesis imperfecta type 19 is characterized by prenatal fractures and generalized osteopenia, with severe short stature in adulthood, as well as variable scoliosis and pectal deformity, and marked anterior angulation of the tibia. | 600 |
| MCCC1 | 3-Methylcrotonyl-CoA carboxylase type 1 deficiency | NM_020166.4 | NM_020166.4:c.2079delA, NM_020166.4:c.1930G>T, NM_020166.4:c.1905delA, NM_020166.4:c.1526delG, NM_020166.4:c.1380T>G, NM_020166.4:c.1310T>C, NM_020166.4:c.1277T>C, NM_020166.4:c.1155A>C, NM_020166.4:c.1114C>T, NM_020166.4:c.1074delG, NM_020166.4:c.640-1G>A, NM_020166.4:c.640-2A>G, NM_020166.4:c.558delA, NM_020166.4:c.343C>T, NM_020166.4:c.310C>T | 3-methylcrotonyl-CoA carboxylase deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC1 gene located on chromosomal region 3q27.1. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn. | 600 |
| MCCC2 | 3-Methylcrotonyl-CoA carboxylase type 2, deficiency | NM_022132.4 | NM_022132.4:c.295G>C, NM_022132.4:c.380C>G, NM_022132.4:c.464G>A, NM_022132.4:c.499T>C, NM_022132.4:c.517dupT, NM_022132.4:c.641delG, NM_022132.4:c.735dupC, NM_022132.4:c.838G>T, NM_022132.4:c.929C>G, NM_022132.4:c.994C>T, NM_022132.4:c.1015G>A, NM_022132.4:c.1065A>T, NM_022132.4:c.1072+1G>A, NM_022132.4:c.1577dupT, NM_022132.4:c.1580G>A | 3-methylcrotonyl-CoA carboxylase deficiency type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC2 gene located on chromosomal region 5q13.2. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn. | 600,25 |
| MCEE | Methylmalonyl-CoA epimerase deficiency | NM_032601.3 | NM_032601.3:c.139C>T, NM_032601.3:c.2T>C | Methylmalonic acidemia due to methylmalonyl-CoA epimerase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCEE gene located on chromosomal region 2p13.3. The age of onset is neonatal. This disease is characterized by lethargy, vomiting, hypotonia, hypothermia, respiratory distress, severe ketoacidosis, hyperammonemia, neutropenia, and thrombocytopenia. The prevalence is 1:50,000-1:80,000. | 600 |
| MCOLN1 | Mucolipidosis type 4 | NM_020533.2 | NM_020533.2:c.304C>T, NM_020533.2:c.964C>T, NM_020533.2:c.1084G>T, NM_020533.2:c.1207C>T | Mucolipidosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCOLN1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismus. The prevalence is 1:40,000. | 600 |
| MCPH1 | Microcephaly type 1, primary, autosomal recessive | NM_001322042.1 | NM_001322042.1:c.215C>T, NM_001322042.1:c.427dupA, NM_001322042.1:c.1249dupT, NM_001322042.1:c.1935+1G>T, NM_001322042.1:c.1973+1G>A, NM_001322042.1:c.2221C>T | Autosomal recessive primary microcephaly type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCPH1 gene located on chromosomal region 8p23.1. The age of onset is neonatal. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. The incidence is 1/1,000,000. | 600 |
| MECP2 | Encephalopathy, neonatal severe | NM_001110792.1 | NM_001110792.1:c.1001C>T, NM_001110792.1:c.1000C>T, NM_001110792.1:c.952C>T, NM_001110792.1:c.916C>T, NM_001110792.1:c.844C>T, NM_001110792.1:c.842delG, NM_001110792.1:c.799C>T, NM_001110792.1:c.789delC, NM_001110792.1:c.766C>T, NM_001110792.1:c.710C>T, NM_001110792.1:c.647C>G, NM_001110792.1:c.538C>T, NM_001110792.1:c.251dupC | Encephalopathy, neonatal severe follows an X -linked pattern of inheritance and is caused by pathogenic variants in the MECP2 gene located on chromosomal region Xq28. The age of onset is neonatal. This neurological disorder primarily affects males and causes brain dysfunction (encephalopathy). Affected males have microcephaly, poor muscle tone (hypotonia), movement disorders, rigidity, and seizures. Individuals with MECP2-related severe neonatal encephalopathy have severe to profound intellectual disability. Genetic heterogeneity: Many of the mutations causing male's phenotype also cause Rett syndrome, a severe neurodevelopmental disorder that almost always occurs in females. Most severe neonatal encephalopathy cases are surviving male sibs of patients with Rett syndrome. Males with non-Rett syndrome mutations in the MECP2 gene can demonstrate a wide variety of phenotypes. Note: other conditions are also associated to the MECP2 gene, like MECP2 duplication syndrome, a condition characterized by intellectual disability, delayed development, and seizures. It is caused by a duplication of the MECP2 gene and surrounding DNA; this duplication is not tested in the CGT analysis. | 600 |
| MED12 | Lujan-Fryns syndrome | NM_005120.2 | NM_005120.2:c.3443G>A, NM_005120.2:c.3493T>C, NM_005120.2:c.5185C>A | Lujan-Fryns syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the MED12 gene located on chromosomal region Xq13.1. The age of onset is neonatal. It is characterized by mild to moderate intellectual disability, behavioral problems (such as hyperactivity, aggressiveness, extreme shyness, and excessive attention-seeking), and certain physical features such as tall, thin body and an unusually large head (macrocephaly). Almost all people with this condition have weak muscle tone (hypotonia). | 600 |
| MED25 | Basel-Vanagait-Smirin-Yosef syndrome | NM_030973.3 | NM_030973.3:c.320delG, NM_030973.3:c.1366C>T | Basel-Vanagait-Smirin-Yosef syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MED25 gene located on chromosomal region 19q13.33. The age of onset neonatal/infantile. This syndrome is characterized by eye, brain, cardiac and palatal abnormalities as well as growth retardation, microcephaly and severe intellectual disability. | 600,25 |
| MEFV | Familial Mediterranean fever, AR | NM_000243.2 | NM_000243.2:c.2282G>A, NM_000243.2:c.2230G>T, NM_000243.2:c.2177T>C, NM_000243.2:c.2084A>G, NM_000243.2:c.2082G>A, NM_000243.2:c.2080A>G, NM_000243.2:c.2076_2078delAAT, NM_000243.2:c.2040G>C, NM_000243.2:c.2040G>A, NM_000243.2:c.1958G>A, NM_000243.2:c.1437C>G, NM_000243.2:c.1141C>T, NM_000243.2:c.656dupG, NM_000243.2:c.501G>C, NM_000243.2:c.163dupA | Familial Mediterranean fever follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MEFV gene located on chromosomal region 16p13.3. The age of onset is infantile or adult (before the age of 30). This disease is characterized by recurrent short episodes of fever and serositis resulting in pain in the abdomen, chest, joints and muscles. The prevalence is 1:10,000-5:10,000. | 600,25 |
| MERTK | Retinitis pigmentosa type 38 | NM_006343.2 | NM_006343.2:c.1605-2A>G, NM_006343.2:c.2070_2074delAGGAC, NM_006343.2:c.2189+1G>T, NM_006343.2:c.2211_2214delCTGT, NM_006343.2:c.2323C>T, NM_006343.2:c.2785_2786dupTA | Retinitis pigmentosa type 38 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MERTK gene located on chromosomal region 2q13. The age of onset is infantile. This disease is characterized by. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness. | 600,25 |
| MFRP | Microphthalmia, isolated type 5 | NM_031433.3 | NM_031433.3:c.1149dupC, NM_031433.3:c.1124+1G>T, NM_031433.3:c.545T>C, NM_031433.3:c.523C>T, NM_031433.3:c.498delC | Microphthalmia, isolated type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFRP gene located on chromosomal region 11q23.3. The age of onset is infantile. This disease is characterized by posterior microphthalmos, retinitis pigmentosa, foveoschisis, and optic disk drusen. | 600,25 |
| MFSD8 | Ceroid lipofuscinosis, neuronal, type 7 | NM_152778.2 | NM_152778.2:c.1525_1526delCT, NM_152778.2:c.1286G>A, NM_152778.2:c.1235C>T, NM_152778.2:c.1090delA, NM_152778.2:c.999-2A>G, NM_152778.2:c.929G>A, NM_152778.2:c.894T>G, NM_152778.2:c.881C>A, NM_152778.2:c.362A>G | Neuronal ceroid lipofuscinosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFSD8 gene located on chromosomal region 4q28.2. The age of onset is late infantile. This disease is characterized by decline of mental and motor capacities, epilepsy, and vision loss through retinal degeneration. The prevalence is 0.56:100,000-3.9:100,000. | 600 |
| MGAT2 | Congenital disorder of glycosylation, type 2a | NM_002408.3 | NM_002408.3:c.785A>G, NM_002408.3:c.869C>T, NM_002408.3:c.1017T>A | Congenital disorder of glycosylation type 2a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MGAT2 gene located on chromosomal region 14q21.3. The age of onset is infantile. This disease is characterized by severe psychomotor delay, postnatal growth retardation, facial dysmorphology and bleeding tendency. It has been described in four children. | 600 |
| MKKS | Bardet-Biedl syndrome type 6 | NM_018848.3 | NM_018848.3:c.1436C>G, NM_018848.3:c.1225_1226delGG, NM_018848.3:c.830T>C, NM_018848.3:c.353delG | Bardet-Biedl syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. | 600,25 |
| MKS1 | Bardet-Biedl syndrome type 13 | NM_001321269.1 | NM_001321269.1:c.1024+1G>A, NM_001321269.1:c.508C>T | Bardet-Biedl syndrome type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. | 600,25 |
| MLC1 | Megalencephalic leukoencephalopathy with subcortical cysts | NM_015166.3 | NM_015166.3:c.424-2A>C, NM_015166.3:c.423C>A, NM_015166.3:c.422A>G, NM_015166.3:c.278C>T, NM_015166.3:c.274C>T, NM_015166.3:c.206C>T, NM_015166.3:c.135dupC, NM_015166.3:c.33dupC | Megalencephalic leukoencephalopathy with subcortical cysts follows an autosomal recessive patternof inheritance and is caused by pathogenic variants in the MLC1 gene located on chromosomal region 22q13.33. The age of onset is infantile. This disease is characterized by ataxia followed by progressive signs of pyramidal tract involvement and mental deterioration. | 600 |
| MLYCD | Malonyl-CoA decarboxylase deficiency | NM_012213.2 | NM_012213.2:c.560C>G, NM_012213.2:c.680_685dupTGAAGC, NM_012213.2:c.758delT | Malonyl-CoA decarboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MLYCD gene located on chromosomal region 16q23.3. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000. | 600 |
| MMAA | Methylmalonic aciduria, vitamin B12-responsive | NM_172250.2 | NM_172250.2:c.283C>T, NM_172250.2:c.387C>A, NM_172250.2:c.450dupG, NM_172250.2:c.455delC, NM_172250.2:c.503delC, NM_172250.2:c.586C>T, NM_172250.2:c.620A>G, NM_172250.2:c.811G>T, NM_172250.2:c.1034delT | Vitamin B12-responsive methylmalonic acidemia type cblA follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAA gene located on chromosomal region 4q31.21. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000. | 600 |
| MMAB | Methylmalonic aciduria, vitamin B12-responsive, type cblB | NM_052845.3 | NM_052845.3:c.700C>T, NM_052845.3:c.569G>A, NM_052845.3:c.568C>T, NM_052845.3:c.556C>T, NM_052845.3:c.220G>T, NM_052845.3:c.197-1G>T, NM_052845.3:c.197-1G>A | Vitamin B12-responsive methylmalonic acidemia type cbl B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAB gene located on chromosomal region 12q24.31. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000. | 600 |
| MMACHC | Methylmalonic aciduria and homocystinuria, cblC type | NM_015506.2 | NM_015506.2:c.271dupA, NM_015506.2:c.331C>T, NM_015506.2:c.347T>C, NM_015506.2:c.388_390delTAC, NM_015506.2:c.394C>T, NM_015506.2:c.440G>C, NM_015506.2:c.481C>T, NM_015506.2:c.482G>A, NM_015506.2:c.547_548delGT, NM_015506.2:c.608G>A, NM_015506.2:c.609G>A, NM_015506.2:c.615C>A, NM_015506.2:c.615C>G, NM_015506.2:c.619dupG, NM_015506.2:c.616C>T, NM_015506.2:c.658_660delAAG, NM_015506.2:c.688C>T | Vitamin B12-responsive methylmalonic acidemia type cbl B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAB gene located on chromosomal region 12q24.31. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000. | 600,25 |
| MMADHC | Homocystinuria, cblD type, variant 1 | NM_015702.2 | NM_015702.2:c.795dupT, NM_015702.2:c.776T>C, NM_015702.2:c.748C>T, NM_015702.2:c.746A>G, NM_015702.2:c.545C>A, NM_015702.2:c.478+1G>T, NM_015702.2:c.419dupA, NM_015702.2:c.57_64delCTCTTTAG | Homocystinuria, cblD type, variant 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMADHC gene located on chromosomal region 2q23.2. The age of onset is variable (infantile to adult). This disease is characterized by developmental delay, severe learning difficulties, seizures, movement and gait abnormalities, behavioral problems and signs of megaloblastic anemia (pallor, fatigue, anorexia). The prevalence is 1:50,000-1:80,000. | 600 |
| MOCS1 | Molybdenum cofactor deficiency A | NM_001075098.3 | NM_001075098.3:c.1027C>T, NM_001075098.3:c.956G>A, NM_001075098.3:c.397_406delCCGGACGTGG, NM_001075098.3:c.217C>T | Molybdenum cofactor deficiency type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS1 gene located on chromosomal region 6p21.2. The age of onset is infantile. This disease is characterized by severe neurological abnormalities, dislocated ocular early death. | 600 |
| MOCS2 | Molybdenum cofactor deficiency B | NM_004531.4 | NM_004531.4:c.567A>C, NM_004531.4:c.539_540delAA, NM_004531.4:c.502G>A, NM_004531.4:c.377+1G>A, NM_004531.4:c.106_107delAT, NM_004531.4:c.58delT, NM_004531.4:c.3G>A | Molybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death. | 600,25 |
| MOCS2 | Molybdenum cofactor deficiency B | NM_176806.3 | NM_176806.3:c.16C>T | Molybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death. | 600,25 |
| MPI | Congenital disorder of glycosylation, type 1b | NM_002435.2 | NM_002435.2:c.305C>T, NM_002435.2:c.413T>C, NM_002435.2:c.656G>A, NM_002435.2:c.884G>A, NM_002435.2:c.1016_1019delACCC | Congenital disorder of glycosylation type 1b follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MPI gene located on chromosomal region 15q24.1. The age of onset is infantile. This disease is characterized by hepatic-intestinal manifestations (diarrhoea, vomiting, and hepatomegaly associated with hepatic fibrosis). | 600 |
| MPV17 | Mitochondrial DNA depletion syndrome type 6 (hepatocerebral) | NM_002437.4 | NM_002437.4:c.498C>A, NM_002437.4:c.462-2A>C, NM_002437.4:c.359G>A, NM_002437.4:c.284dupG, NM_002437.4:c.263_265delAGA, NM_002437.4:c.149G>A, NM_002437.4:c.148C>T, NM_002437.4:c.70G>T | Mitochondrial DNA depletion syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MPV17 gene located on chromosomal region 2p23.3. The age of onset is infantile. It is a disease due to mitochondrial dysfunction. It is characterized by infantile onset of progressive liver failure, often leading to death in the first year of life, peripheral neuropathy, corneal scarring, acral ulceration and osteomyelitis leading to autoamputation, cerebral leukoencephalopathy, failure to thrive, and recurrent metabolic acidosis with intercurrent infections. | 600 |
| MRPS16 | Combined oxidative phosphorylation deficiency 2 | NM_016065.3 | NM_016065.3:c.331C>T, NM_016065.3:c.2T>C | Combined oxidative phosphorylation defect type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MRPS16 gene located on chromosomal region 10q22.2. The age of onset is infantile. This disease is characterized by agenesis of corpus callosum, dismorphism and fatal lactic acidosis. | 600 |
| MRPS22 | Combined oxidative phosphorylation deficiency type 5 | NM_020191.2 | NM_020191.2:c.40_41insA, NM_020191.2:c.509G>A, NM_020191.2:c.644T>C | Combined oxidative phosphorylation defect type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MRPS22 gene located on chromosomal region 3q23. The age of onset is infantile. This disease is characterized by evere hypotonia, lactic academia and congenital hyperammonaemia. | 600 |
| MTM1 | Myotubular myopathy, X-linked | NM_000252.2 | NM_000252.2:c.70C>T, NM_000252.2:c.420C>G, NM_000252.2:c.461T>G, NM_000252.2:c.595_599delCCTGC, NM_000252.2:c.670C>T, NM_000252.2:c.721C>T, NM_000252.2:c.780T>A, NM_000252.2:c.969dupA, NM_000252.2:c.969delA, NM_000252.2:c.1261-10A>G, NM_000252.2:c.1306_1310dupCCTAT, NM_000252.2:c.1357_1358delCC, NM_000252.2:c.1415_1416delGT | X-linked centronuclear myopathy follows an X-linked pattern of inheritance and is caused by pathogenic variants in the MTM1 gene located on chromosomal region Xq28. The age of onset is infantile, etc/. This disease is characterized by severe phenotype in males presenting at birth with marked weakness, hypotonia and respiratory failure. The incidence is 1/50,000 newborn man. | 600 |
| MTMR2 | Charcot-Marie-Tooth disease, type 4B1 | NM_016156.5 | NM_016156.5:c.1276C>T, NM_016156.5:c.304C>T | Charcot-Marie-Tooth disease type 4B1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTMR2 gene located on chromosomal region 11q21. The age of onset is early infantile. This disease is characterized by distal and proximal muscular weakness starting in the lower extremities, sensory loss and cranial nerve involvement, foot deformities and diaphragmatic and facial involvement. | 600 |
| MTTP | Abetalipoproteinemia | NM_001300785.1 | NM_001300785.1:c.789_790delCA, NM_001300785.1:c.1700G>A, NM_001300785.1:c.1850G>T, NM_001300785.1:c.1948+1G>A, NM_001300785.1:c.2112delC, NM_001300785.1:c.2674G>T | Abetalipoproteinemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTTP gene located on chromosomal region 4q23. The age of onset is infantile. This disease is characterized by growth delay, malabsorption, hepatomegaly, and neurological and neuromuscular manifestations. The prevalence is <1:1,000,000. | 600,25 |
| MUT | Methylmalonic aciduria, mut(0) type | NM_000255.3 | NM_000255.3:c.2150G>T, NM_000255.3:c.2080C>T, NM_000255.3:c.1924G>C, NM_000255.3:c.1871A>G, NM_000255.3:c.1867G>A, NM_000255.3:c.1741C>T, NM_000255.3:c.1658delT, NM_000255.3:c.1445-2A>G, NM_000255.3:c.1420C>T, NM_000255.3:c.1399C>T, NM_000255.3:c.1280G>A, NM_000255.3:c.1207C>T, NM_000255.3:c.1181T>A, NM_000255.3:c.1106G>A, NM_000255.3:c.914T>C, NM_000255.3:c.682C>T, NM_000255.3:c.671_678dupAATTTATG, NM_000255.3:c.655A>T, NM_000255.3:c.643G>A, NM_000255.3:c.607G>A, NM_000255.3:c.572C>A, NM_000255.3:c.313T>C, NM_000255.3:c.280G>A, NM_000255.3:c.278G>A, NM_000255.3:c.91C>T | Methylmalonic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MUT gene located on chromosomal region 6p12.3. The age of onset is very early infantile. This disease is characterized by recurrent ketoacidotic comas or transient vomiting, dehydration, hypotonia and intellectual deficit, which does not respond to administration of vitamin B12. | 600,25 |
| MVK | Mevalonic aciduria | NM_000431.3 | NM_000431.3:c.59A>C, NM_000431.3:c.185G>A, NM_000431.3:c.494C>T, NM_000431.3:c.803T>C, NM_000431.3:c.902A>C, NM_000431.3:c.928G>A, NM_000431.3:c.1000G>A, NM_000431.3:c.1129G>A | Mevalonic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by psychomotor retardation, failure to thrive, progressive cerebellar ataxia, dysmorphic features, progressive visual impairment and recurrent febrile crises. The prevalence is <1:1,000,000. | 600,25 |
| MYO15A | Deafness, autosomal recessive type 3 | NM_016239.3 | NM_016239.3:c.625G>T, NM_016239.3:c.755dupA, NM_016239.3:c.3313G>T, NM_016239.3:c.3336delG, NM_016239.3:c.3385C>T, NM_016239.3:c.3693-2A>G, NM_016239.3:c.3756+1G>T, NM_016239.3:c.4751_4752dupTC, NM_016239.3:c.5326C>T, NM_016239.3:c.5492G>T, NM_016239.3:c.6004delG, NM_016239.3:c.6864_6874delGGACCTGGAGC, NM_016239.3:c.8148G>T, NM_016239.3:c.8410A>T, NM_016239.3:c.8548C>T, NM_016239.3:c.9958_9961delGACT, NM_016239.3:c.10573delA | Deafness autosomal recessive type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO15A gene located on chromosomal region 17p11.2. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 600,25 |
| MYO3A | Deafness, autosomal recessive type 30 | NM_017433.4 | NM_017433.4:c.1A>G, NM_017433.4:c.732-2A>G, NM_017433.4:c.770C>G, NM_017433.4:c.1086T>G, NM_017433.4:c.1193C>A, NM_017433.4:c.1777-12G>A, NM_017433.4:c.1953delC, NM_017433.4:c.2243delA, NM_017433.4:c.2506-1G>A, NM_017433.4:c.2793+2T>A, NM_017433.4:c.3112-2A>G, NM_017433.4:c.3154C>T, NM_017433.4:c.4586+2T>G, NM_017433.4:c.4730+1G>A | Deafness autosomal recessive type 30 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO3A gene located on chromosomal region 10p12.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 600,25 |
| MYO5A | Griscelli syndrome, type 1 | NM_000259.3 | NM_000259.3:c.2332C>T, NM_000259.3:c.1145delC | Griscelli disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO5A gene located on chromosomal region 15q21.2. The age of onset is infantile. This disease is characterized by is characterised by silvery gray sheen of the hair and hypopigmentation of the skin which can be associated to neurological impairment. The prevalence is <1:1,000,000. | 600 |
| MYO6 | Deafness, autosomal recessive type 37 | NM_004999.3 | NM_004999.3:c.1452dupT, NM_004999.3:c.2907_2909delAGA, NM_004999.3:c.3496C>T, NM_004999.3:c.3808C>T | Deafness autosomal recessive type 37 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO6 gene located on chromosomal region 6q14.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 600,25 |
| MYO7A | Usher syndrome, type 1B | NM_000260.3 | NM_000260.3:c.3G>A, NM_000260.3:c.133-2A>G, NM_000260.3:c.448C>T, NM_000260.3:c.494C>T, NM_000260.3:c.634C>T, NM_000260.3:c.635G>A, NM_000260.3:c.640G>A, NM_000260.3:c.731G>C, NM_000260.3:c.1184G>A, NM_000260.3:c.1344-1G>A, NM_000260.3:c.1797G>A, NM_000260.3:c.1884C>A, NM_000260.3:c.1996C>T, NM_000260.3:c.2476G>A, NM_000260.3:c.3504-1G>C, NM_000260.3:c.3508G>A, NM_000260.3:c.3596dupT, NM_000260.3:c.3719G>A, NM_000260.3:c.3764delA, NM_000260.3:c.4024delT, NM_000260.3:c.5392C>T, NM_000260.3:c.5618G>A, NM_000260.3:c.5824G>T, NM_000260.3:c.5886_5889delCTTT, NM_000260.3:c.5967C>G, NM_000260.3:c.6025delG | Usher syndrome type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 1:100,000-9:100,000. | 600,25 |
| NAGA | Schindler disease, type I | NM_000262.2 | NM_000262.2:c.986G>A, NM_000262.2:c.985C>T, NM_000262.2:c.973G>A, NM_000262.2:c.577G>T | Schindler disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGA gene located on chromosomal region 22q13.2. The age of onset is infantile. This disease is characterized by early-onset neuroaxonal dystrophy and neurological signs (convulsion during fever, epilepsy, psychomotor retardation and hypotonia). NAGA deficiency is typically classified in three main phenotypes: NAGA deficiency type I (Schindler disease or Schindler disease type I) with severe manifestations; NAGA deficiency type II (Kanzazi disease or Schindler disease type II) which is mild; NAGA deficiency type III (Schindler disease type III) characterized by mild-to-moderate neurologic manifestations. NAGA deficiency results in the increased urinary excretion of glycopeptides and oligosaccharides containing alpha-N-acetylgalactosaminyl moieties. | 600,25 |
| NAGS | N-acetylglutamate synthase deficiency | NM_153006.2 | NM_153006.2:c.916-2A>T, NM_153006.2:c.971G>A, NM_153006.2:c.1025delG, NM_153006.2:c.1289T>C, NM_153006.2:c.1299G>C, NM_153006.2:c.1307dupT | N-acetylglutamate synthetase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGS gene located on chromosomal region 17q21.31. The age of onset is infantile, etc/. This disease is characterized by hyperammonemia, vomiting, hyperactivity or lethargy, diarrhoea, poor feeding, seizures, hypotonia, delayed psychomotor development and respiratory distress. The prevalence is <1:1,000,000. | 600 |
| NDRG1 | Charcot-Marie-Tooth disease, type 4D | NM_001135242.1 | NM_001135242.1:c.928C>T, NM_001135242.1:c.538-1G>A, NM_001135242.1:c.442C>T, NM_001135242.1:c.16C>T | Charcot-Marie-Tooth disease type 4D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NDRG1 gene located on chromosomal region 8q24.22. The age of onset is infantile, etc/. This disease is characterized by demyelination and hearing loss. | 600 |
| NEB | Nemaline myopathy type 2, autosomal recessive | NM_001271208.1 | NM_001271208.1:c.12238_12239delAT, NM_001271208.1:c.8031_8041delAAATAAACGAG, NM_001271208.1:c.6105dupT, NM_001271208.1:c.2173G>T, NM_001271208.1:c.843T>G | Nemaline myopathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEB gene located on chromosomal region 2q23.3. The age of onset is infantile or adult. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:100,000-9:100,000 and the incidence is 1/50.000 newborn. | 600,25 |
| NEFL | Charcot-Marie-Tooth disease, type 1F | NM_006158.4 | NM_006158.4:c.628G>T, NM_006158.4:c.418G>T, NM_006158.4:c.361G>T | Charcot-Marie-Tooth disease type 1F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEFL gene located on chromosomal region 8p21.2. The age of onset is infantile. This disease is characterized by a progressive peripheral motor and sensory neuropathy with variable clinical, distal weakness and wasting of the muscles of the lower limbs. The prevalence is 15:100,000-20:100,000. | 600 |
| NEUROG3 | Diarrhea type 4, malabsorptive, congenital | NM_020999.3 | NM_020999.3:c.319C>A, NM_020999.3:c.278G>T | Congenital malabsorptive diarrhea type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEUROG3 gene located on chromosomal region 10q22.1. The age of onset is early infantile. This disease is characterized by severe, life-threatening watery diarrhea associated with generalized malabsorption and a paucity of enteroendocrine cells. The prevalence is <1:1,000,000. | 600 |
| NHP2 | Dyskeratosis congenita, autosomal recessive type 2 | NM_017838.3 | NM_017838.3:c.460T>A, NM_017838.3:c.415T>C, NM_017838.3:c.289_290delAT | Dyskeratosis congenita type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NHP2 gene located on chromosomal region 5q35.3. The age of onset is variable from infancy to adult. It is a multisystem disorder caused by defective telomere maintenance. Clinical manifestations include mucocutaneous abnormalities, bone marrow failure, and an increased predisposition to cancer, among other variable features. | 600 |
| NMNAT1 | Leber congenital amaurosis type 9 | NM_001297778.1 | NM_001297778.1:c.25G>A, NM_001297778.1:c.451G>T, NM_001297778.1:c.457C>G, NM_001297778.1:c.507G>A, NM_001297778.1:c.619C>T, NM_001297778.1:c.710G>T, NM_001297778.1:c.769G>A | Leber congenital amaurosis type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NMNAT1 gene located on chromosomal region 1p36.22. The age of onset is early infantile. This disease is characterized by blindness, nystagmus, roving eye movement, leading to severe visual impairment. | 600,25 |
| NOP10 | Dyskeratosis congenita, autosomal recessive type 1 | NM_018648.3 | NM_018648.3:c.100C>T | Dyskeratosis congenita autosomal recessive type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NOP10 gene located on chromosomal region 15q14. The age of onset is infantile. This disease is characterized by the mucocutaneous triad of abnormal skin pigmentation, nail dystrophy and mucosal leucoplakia. The prevalence is 1:1,000,000. | 600 |
| NPC1 | Niemann-Pick disease, type C1 | NM_000271.4 | NM_000271.4:c.3662delT, NM_000271.4:c.3611_3614delTTAC, NM_000271.4:c.3467A>G, NM_000271.4:c.3425T>C, NM_000271.4:c.3182T>C, NM_000271.4:c.3175C>T, NM_000271.4:c.3107C>T, NM_000271.4:c.3104C>T, NM_000271.4:c.3019C>G, NM_000271.4:c.2974G>T, NM_000271.4:c.2974G>A, NM_000271.4:c.2972_2973delAG, NM_000271.4:c.2932C>T, NM_000271.4:c.2873G>A, NM_000271.4:c.2861C>T, NM_000271.4:c.2848G>A, NM_000271.4:c.2842G>A, NM_000271.4:c.2761C>T, NM_000271.4:c.2324A>C, NM_000271.4:c.2072C>T, NM_000271.4:c.1628C>T, NM_000271.4:c.1211G>A, NM_000271.4:c.1042C>T, NM_000271.4:c.813_815delCAT, NM_000271.4:c.530G>A, NM_000271.4:c.352_353delAG, NM_000271.4:c.337T>C | Niemann-Pick disease type C1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC1 gene located on chromosomal region 18q11.2. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000. | 600,25 |
| NPC2 | Niemann-pick disease, type C2 | NM_006432.3 | NM_006432.3:c.436C>T, NM_006432.3:c.358C>T, NM_006432.3:c.352G>T, NM_006432.3:c.295T>C, NM_006432.3:c.190+5G>A, NM_006432.3:c.115G>A, NM_006432.3:c.58G>T, NM_006432.3:c.27delG | Niemann-Pick disease type C2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC2 gene located on chromosomal region 14q24.3. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000. | 600,25 |
| NPHP1 | Joubert syndrome type 4 | NM_000272.3 | NM_000272.3:c.1884+1G>T, NM_000272.3:c.1184dupC, NM_000272.3:c.829C>T, NM_000272.3:c.555dupA, NM_000272.3:c.455C>G, NM_000272.3:c.80T>A, NM_000272.3:c.1delA | Joubert syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP1 gene located on chromosomal region 2q13. This is a disorder presenting with cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Additional variable features include retinal dystrophy and renal disease. Joubert syndrome type 4 is a phenotypically mild form. | 600 |
| NPHP3 | Meckel syndrome type 7 | NM_153240.4 | NM_153240.4:c.3406C>T, NM_153240.4:c.3373C>T, NM_153240.4:c.3156dupA, NM_153240.4:c.2694-2_2694-1delAG, NM_153240.4:c.2694-2A>G, NM_153240.4:c.2570+1G>T, NM_153240.4:c.2541delG, NM_153240.4:c.2369T>C, NM_153240.4:c.1985+5G>A, NM_153240.4:c.1817G>A, NM_153240.4:c.1729C>T, NM_153240.4:c.1381G>T, NM_153240.4:c.1119-2A>G, NM_153240.4:c.434_437delAAAG | Meckel syndrome type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP3 gene located on chromosomal region 3q22.1. The age of onset is infantile. This is a disorder characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically encephalocele), hepatic ductal dysplasia and cysts, and polydactyly. | 600,25 |
| NPHP4 | Nephronophthisis type 4 | NM_015102.4 | NM_015102.4:c.3767_3768insAA, NM_015102.4:c.3231+1G>C, NM_015102.4:c.2940_2944dupGCTCC, NM_015102.4:c.2335C>T, NM_015102.4:c.1972C>T, NM_015102.4:c.1120-1G>C, NM_015102.4:c.556_557insT, NM_015102.4:c.517C>T | Nephronophthisis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP4 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease results in end-stage renal disease at age ranging between 6 and 35 years. It is a progressive tubulo-interstitial kidney disorder characterized by polydipsia, polyuria, anemia and growth retardation. The prevalence is 1:1,000,000-9:1,000,000. | 600,25 |
| NPHS1 | Nephrotic syndrome, type 1 | NM_004646.3 | NM_004646.3:c.3478C>T, NM_004646.3:c.3325C>T, NM_004646.3:c.3250dupG, NM_004646.3:c.3250delG, NM_004646.3:c.3109+1G>A, NM_004646.3:c.2928G>T, NM_004646.3:c.2491C>T, NM_004646.3:c.1715G>A, NM_004646.3:c.1481delC, NM_004646.3:c.1307_1308dupAC, NM_004646.3:c.121_122delCT | Nephrotic syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHS1 gene located on chromosomal region 19q13.12. The age of onset is fetal- infantile. This disease is characterized by fetal proteinuria and nephritic infantile syndrome. The prevalence is 1 in 8 200 births. | 600,25 |
| NR0B1 | Adrenal hypoplasia, congenital | NM_000475.4 | NM_000475.4:c.1319A>T, NM_000475.4:c.1316T>G, NM_000475.4:c.1107G>A, NM_000475.4:c.890T>C, NM_000475.4:c.873G>C, NM_000475.4:c.847C>T, NM_000475.4:c.813C>G, NM_000475.4:c.800G>C, NM_000475.4:c.788T>A, NM_000475.4:c.704G>A, NM_000475.4:c.591C>A, NM_000475.4:c.513G>A, NM_000475.4:c.388_389delTA, NM_000475.4:c.273C>A | Congenital adrenal hypoplasia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the NR0B1 gene located on chromosomal region Xp21.2. The age of onset is infantile. This disease is characterized by adrenal insufficiency with vomiting, feeding difficulty, dehydration, and shock caused by a salt-wasting episode and hypoglycemia. | 600 |
| NR2E3 | Enhanced S-cone syndrome | NM_014249.3 | NM_014249.3:c.119-2A>C, NM_014249.3:c.226C>T, NM_014249.3:c.298_299delTG, NM_014249.3:c.932G>A, NM_014249.3:c.1034_1038delTGCAG | Enhaced S-Cone Syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NR2E3 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by night blindness, reduced bilateral visual acuity, and typical fundus findings (progressive pigmentary degenerative changes, macular edema, retinoschisis). | 600,25 |
| NTRK1 | Insensitivity to pain, congenital, with anhidrosis | NM_002529.3 | NM_002529.3:c.1076A>G, NM_002529.3:c.1727delT, NM_002529.3:c.1729G>C, NM_002529.3:c.1759A>G, NM_002529.3:c.1926_1927insT, NM_002529.3:c.2084C>T, NM_002529.3:c.2339G>C | Insensitivity to pain, congenital, with anhidrosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NTRK1 gene located on chromosomal region 1q23.1. The age of onset is infantile. This disease is characterized by anhidrosis, insensitivity to pain, self-mutilating behavior and episodes of fever. | 600 |
| NUP62 | Striatonigral degeneration, infantile | NM_001193357.1 | NM_001193357.1:c.1172A>C | Infantile striatal degeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NUP62 gene located on chromosomal region 19q13.33. The age of onset is infantile. This disease is characterized by choreoathetosis, dystonia, rigidity, spasticity, dysphagia, optic atrophy, intellectual deficit, developmental regression of motor and verbal skills, failure to thrive, myoclonus, quadriparesis, cerebellar ataxia and nystagmus. The prevalence is <1:1,000,000. | 600 |
| NYX | Night blindness, congenital stationary (complete), type 1A, X-linked | NM_022567.2 | NM_022567.2:c.1049G>A | Congenital stationary night blindness follows an X-linked pattern of inheritance and is caused by pathogenic variants in the NYX gene located on chromosomal region Xp11.4. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity. | 600 |
| OAT | Gyrate atrophy of choroid and retina | NM_000274.3 | NM_000274.3:c.1276C>T, NM_000274.3:c.1250C>T, NM_000274.3:c.1205T>C, NM_000274.3:c.994G>A, NM_000274.3:c.955C>T, NM_000274.3:c.952delG, NM_000274.3:c.952G>A, NM_000274.3:c.901-2A>G, NM_000274.3:c.824G>A, NM_000274.3:c.812G>A, NM_000274.3:c.677C>T, NM_000274.3:c.627T>A, NM_000274.3:c.596C>A, NM_000274.3:c.539G>C, NM_000274.3:c.533G>A, NM_000274.3:c.278G>T, NM_000274.3:c.268C>G, NM_000274.3:c.159delC | Gyrate atrophy of choroid and retina follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OAT gene located on chromosomal region 10q26.13. The age of onset is infantile. This disease is characterized by gyrate atrophy of the choroid and retina that begins during childhood with myopia and night blindness, followed by concentric shrinking of the visual field (tunnel vision) and a peculiar aspect of retinopathy on the funduscopy. Patients can also present with ornithinemia. | 600 |
| OCA2 | Oculocutaneous albinism type 2 | NM_000275.2 | NM_000275.2:c.2228C>T, NM_000275.2:c.1960delG, NM_000275.2:c.1842+1G>T, NM_000275.2:c.1465A>G, NM_000275.2:c.1364+1G>T, NM_000275.2:c.1327G>A, NM_000275.2:c.1182+2T>C, NM_000275.2:c.1182G>A, NM_000275.2:c.1025A>G, NM_000275.2:c.819_822delCTGGinsGGTC, NM_000275.2:c.157delA, NM_000275.2:c.79G>A | Oculocutaneous albinism type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OCA2 gene located on chromosomal region 15q12-q13. The age of onset is infantile. This disease is characterized by variable hypopigmentation of the skin and hair, numerous characteristic ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1/38,000-1/40,000 | 600,25 |
| OCRL | Lowe Syndrome; Dent disease type 2 | NM_001318784.1 | NM_001318784.1:c.912_913delAG, NM_001318784.1:c.1502G>A, NM_001318784.1:c.2302C>T, NM_001318784.1:c.2406dupA, NM_001318784.1:c.2533C>T, NM_001318784.1:c.2538delA | Dent disease type 2 and Lowe syndrome follow an X-linked pattern of inheritance and are caused by pathogenic variants in the OCRL gene located on chromosomal region Xq25-q26. Dent disease type 2 is a type of Dent disease in which patients have the manifestations of Dent disease type 1 associated with extra-renal features: hypercalciuria and low-molecular-weight (LMW) proteinuria. In addition, these patients may also have nephrocalcinosis, nephrolithiasis, hematuria, hypophosphatemia and/or renal insufficiency. The features of Lowe syndrome are hydrophthalmia, cataract, mental retardation, vitamin D-resistant rickets, amino aciduria, and reduced ammonia production by the kidney. | 600 |
| OFD1 | Joubert syndrome type 10; Orofaciodigital syndrome type 1 | NM_003611.2 | NM_003611.2:c.43_44delAG, NM_003611.2:c.52G>T, NM_003611.2:c.65dupA, NM_003611.2:c.62_63insT, NM_003611.2:c.221C>T, NM_003611.2:c.224A>C, NM_003611.2:c.235G>A, NM_003611.2:c.241C>G, NM_003611.2:c.243C>G, NM_003611.2:c.247C>T, NM_003611.2:c.260A>G, NM_003611.2:c.275_276delCT, NM_003611.2:c.274T>C, NM_003611.2:c.277G>T, NM_003611.2:c.290A>G, NM_003611.2:c.312+1delG, NM_003611.2:c.312+2_312+7delTAAAGT, NM_003611.2:c.413-10T>G, NM_003611.2:c.454C>T, NM_003611.2:c.518-1G>A, NM_003611.2:c.541dupG, NM_003611.2:c.594_598delAAAGC, NM_003611.2:c.602delA, NM_003611.2:c.607_610delTATA, NM_003611.2:c.616_617delGA, NM_003611.2:c.614_617delGAGA, NM_003611.2:c.619_624delATAGAA, NM_003611.2:c.628C>T, NM_003611.2:c.653delA, NM_003611.2:c.654+2_654+3delTA, NM_003611.2:c.1268_1272delAAAAC, NM_003611.2:c.1303A>C, NM_003611.2:c.1318delC, NM_003611.2:c.1319delT, NM_003611.2:c.1322_1326delAAGAA, NM_003611.2:c.1323_1326delAGAA, NM_003611.2:c.1360_1363delCTTA, NM_003611.2:c.1358T>A, NM_003611.2:c.1365_1368delACAA, NM_003611.2:c.1612C>T, NM_003611.2:c.1757delG, NM_003611.2:c.1821delG, NM_003611.2:c.1840delG, NM_003611.2:c.1859_1860delCCinsG, NM_003611.2:c.2261-1G>T, NM_003611.2:c.2321_2322insT, NM_003611.2:c.2349delC, NM_003611.2:c.2387+1G>C, NM_003611.2:c.2582dupT | Joubert syndrome type 10 and Orofaciodigital syndrome type 1 follow an X-linked pattern of inheritance and are caused by pathogenic variants in the OFD1 gene located on chromosomal region Xp22.2. Joubert syndrome type 10 is a disorder presenting with cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy and renal disease. Orofaciodigital syndrome type 1 is characterized by malformations of the face, oral cavity, and digits and is transmitted as an X-linked dominant condition with lethality in males. The central nervous system may also be involved in as many as 40% of cases. | 600 |
| OPA3 | 3-methylglutaconic aciduria, type 3 | NM_001017989.2 | NM_001017989.2:c.221delG | 3-methylglutaconic aciduria type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OPA3 gene located on chromosomal region 19q13.32. The age of onset is infantile. This disease is characterized by the association of optic atrophy and choreoathetosis with 3-methylglutaconic aciduria. The prevalence is 1:10,000-5:10,000. | 600 |
| OSTM1 | Osteopetrosis, autosomal recessive type 5 | NM_014028.3 | NM_014028.3:c.415_416delAG | Osteopetrosis, autosomal recessive type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OSTM1 gene located on chromosomal region 6p21. The age of onset is infantile. This disease is characterized by osteopetrosis, agenesis del cuerpo calloso, atrofia cerebral e hipocampo peque�o. | 600 |
| OTC | Ornithine transcarbamylase deficiency | NM_000531.5 | NM_000531.5:c.77G>A, NM_000531.5:c.118C>T, NM_000531.5:c.119G>A, NM_000531.5:c.134T>C, NM_000531.5:c.148G>T, NM_000531.5:c.238A>G, NM_000531.5:c.245T>G, NM_000531.5:c.259G>A, NM_000531.5:c.275G>A, NM_000531.5:c.332T>C, NM_000531.5:c.421C>T, NM_000531.5:c.460G>T, NM_000531.5:c.563G>T, NM_000531.5:c.589G>T, NM_000531.5:c.617T>G, NM_000531.5:c.646C>G, NM_000531.5:c.674C>T, NM_000531.5:c.717+2T>C, NM_000531.5:c.829C>T | Ornithine transcarbamylase deficiency follows an X-linked pattern of inheritance and is caused by pathogenic variants in the OTC gene located on chromosomal region Xp11.4. The age of onset is infantile. This disease is characterized by severe neonatal hyperammonemic coma that generally proves to be fatal, in males. Females may be also affected by symptoms with various degrees of intensity, ranging from dislike for proteins to chronic vomiting, growth retardation, hypotonia, psychomotor retardation, hyperammonemic coma, or psychiatric disorders. The prevalence is 1:80,000. | 600 |
| OTOA | Deafness, autosomal recessive type 22 | NM_144672.3 | NM_144672.3:c.121-1G>A, NM_144672.3:c.828delT, NM_144672.3:c.1725_1726delCA | Deafness, autosomal recessive type 22 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOA gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems. | 600,25 |
| OTOF | Auditory neuropathy, autosomal recessive, type 1 | NM_001287489.1 | NM_001287489.1:c.5474_5475delCC, NM_001287489.1:c.5473C>G, NM_001287489.1:c.5103+2T>A, NM_001287489.1:c.4559G>A, NM_001287489.1:c.4491T>A, NM_001287489.1:c.3032T>C, NM_001287489.1:c.2485C>T, NM_001287489.1:c.2348delG, NM_001287489.1:c.1778delT, NM_001287489.1:c.1544T>C, NM_001287489.1:c.1498C>T, NM_001287489.1:c.766-2A>G, NM_001287489.1:c.584-1G>C, NM_001287489.1:c.227+2T>C, NM_001287489.1:c.149G>A | Auditory neuropathy, autosomal recessive type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. Patients can have varying degrees of hearing loss with poor speech reception out of proportion to the degree of hearing loss. | 600,25 |
| OTOF | Auditory neuropathy, autosomal recessive, type 1 | NM_004802.3 | NM_004802.3:c.3515G>A | Auditory neuropathy, autosomal recessive type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. Patients can have varying degrees of hearing loss with poor speech reception out of proportion to the degree of hearing loss. | 600,25 |
| P3H1 | Osteogenesis imperfecta, type 8 | NM_001243246.1 | NM_001243246.1:c.1656C>A, NM_001243246.1:c.1473+1G>T, NM_001243246.1:c.1365_1366delAGinsC, NM_001243246.1:c.1102C>T, NM_001243246.1:c.747delC | Osteogenesis imperfecta type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the P3H1 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by bone fragility, low bone mass and susceptibility to bone fractures. The prevalence is 6:100,000-7:100,000. | 600 |
| PAH | Phenylketonuria | NM_000277.1 | NM_000277.1:c.1315+1G>A, NM_000277.1:c.1243G>A, NM_000277.1:c.1241A>G, NM_000277.1:c.1238G>C, NM_000277.1:c.1222C>T, NM_000277.1:c.1217T>C, NM_000277.1:c.1208C>T, NM_000277.1:c.1199+17G>A, NM_000277.1:c.1199+1G>A, NM_000277.1:c.1197A>T, NM_000277.1:c.1184C>A, NM_000277.1:c.1169A>G, NM_000277.1:c.1166delC, NM_000277.1:c.1162G>A, NM_000277.1:c.1139C>T, NM_000277.1:c.1068C>A, NM_000277.1:c.1066-3C>T, NM_000277.1:c.1066-11G>A, NM_000277.1:c.1045T>C, NM_000277.1:c.1042C>G, NM_000277.1:c.1033G>T, NM_000277.1:c.1030G>A, NM_000277.1:c.955G>T, NM_000277.1:c.926C>T, NM_000277.1:c.926C>A, NM_000277.1:c.912+1G>A, NM_000277.1:c.898G>T, NM_000277.1:c.896T>G, NM_000277.1:c.842+5G>A, NM_000277.1:c.838G>A, NM_000277.1:c.829T>G, NM_000277.1:c.823C>T, NM_000277.1:c.818C>T, NM_000277.1:c.814G>T, NM_000277.1:c.809G>A, NM_000277.1:c.806delT, NM_000277.1:c.782G>A, NM_000277.1:c.764T>C, NM_000277.1:c.755G>A, NM_000277.1:c.754C>T, NM_000277.1:c.745C>T, NM_000277.1:c.737C>A, NM_000277.1:c.734T>C, NM_000277.1:c.733G>C, NM_000277.1:c.728G>A, NM_000277.1:c.727C>T, NM_000277.1:c.722delG, NM_000277.1:c.722G>A, NM_000277.1:c.721C>T, NM_000277.1:c.688G>A, NM_000277.1:c.673C>G, NM_000277.1:c.665A>G, NM_000277.1:c.638T>C, NM_000277.1:c.611A>G, NM_000277.1:c.569T>C, NM_000277.1:c.533A>G, NM_000277.1:c.529G>A, NM_000277.1:c.527G>T, NM_000277.1:c.509+1G>A, NM_000277.1:c.508C>G, NM_000277.1:c.503delA, NM_000277.1:c.490A>G, NM_000277.1:c.482T>C, NM_000277.1:c.473G>A, NM_000277.1:c.472C>T, NM_000277.1:c.450dupA, NM_000277.1:c.442-1G>A, NM_000277.1:c.442-5C>G, NM_000277.1:c.441+5G>T, NM_000277.1:c.441+1G>A, NM_000277.1:c.357delC, NM_000277.1:c.331C>T, NM_000277.1:c.320A>G, NM_000277.1:c.311C>A, NM_000277.1:c.284_286delTCA, NM_000277.1:c.261C>A, NM_000277.1:c.250G>T, NM_000277.1:c.204A>T, NM_000277.1:c.194T>C, NM_000277.1:c.165T>G, NM_000277.1:c.143T>C, NM_000277.1:c.136G>A, NM_000277.1:c.117C>G, NM_000277.1:c.47_48delCT | Phenylketonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAH gene located on chromosomal region 12q23.2. The age of onset is neonatal. This disease is characterized by gradual developmental delay, stunted growth, microcephaly, seizures, tremors, eczema, vomiting, and musty odor. Untreated patients subsequently develop intellectual disability, behavioral disorders (hyperactivity) and motor disorders. The prevalence is 1:2,600-1:200,000. | 600,25 |
| PANK2 | Neurodegeneration with brain iron accumulation type 1 | NM_153638.3 | NM_153638.3:c.790C>T, NM_153638.3:c.823_824delCT, NM_153638.3:c.1561G>A, NM_153638.3:c.1583C>T | Neurodegeneration with brain iron accumulation type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PANK2 gene located on chromosomal region 20p13. The age of onset is infantile. This disease is characterized by progressive extrapyramidal dysfunction (dystonia, rigidity, choreoathetosis), iron accumulation on the brain and axonal spheroids in the central nervous system. The prevalence is 1-2/1,000,000. | 600,25 |
| PC | Pyruvate carboxylase deficiency | NM_000920.3 | NM_000920.3:c.1748G>T, NM_000920.3:c.434T>C | Pyruvate carboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PC gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by metabolic acidosis, failure to thrive, developmental delay, and recurrent seizures. The prevalence is 1:250,000. | 600,25 |
| PCCA | Propionic acidemia | NM_000282.3 | NM_000282.3:c.229C>T, NM_000282.3:c.261dupT, NM_000282.3:c.412G>A, NM_000282.3:c.600+1G>A, NM_000282.3:c.862A>T, NM_000282.3:c.1023dupT, NM_000282.3:c.1118T>A, NM_000282.3:c.1226_1227delTT, NM_000282.3:c.1284+1G>A, NM_000282.3:c.1598_1601delTTGT, NM_000282.3:c.1891G>C, NM_000282.3:c.1899+4_1899+7delAGTA | Propionic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCA gene located on chromosomal region 13q32.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000. | 600,25 |
| PCCB | Propionic acidemia | NM_001178014.1 | NM_001178014.1:c.331C>T, NM_001178014.1:c.337C>T, NM_001178014.1:c.562G>A, NM_001178014.1:c.622G>A, NM_001178014.1:c.743C>T, NM_001178014.1:c.1050dupT, NM_001178014.1:c.1233dupT, NM_001178014.1:c.1278_1291delGGGCATCATCCGGCinsTAGAGCACAGGA, NM_001178014.1:c.1279_1284delGGCATCinsAA, NM_001178014.1:c.1283_1286delTCAT, NM_001178014.1:c.1288C>T, NM_001178014.1:c.1289_1290insT, NM_001178014.1:c.1343C>T, NM_001178014.1:c.1364A>G, NM_001178014.1:c.1594C>T, NM_001178014.1:c.1598_1600dupCCC, NM_001178014.1:c.1666A>G | Propionic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCB gene located on chromosomal region 3q22.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000. | 600,25 |
| PCDH15 | Deafness, autosomal recessive type 23 | NM_001142763.1 | NM_001142763.1:c.5680A>T, NM_001142763.1:c.4982_4983insTGAT, NM_001142763.1:c.4958_4961dupTGAT, NM_001142763.1:c.4885delA, NM_001142763.1:c.4569_4572dupATCT, NM_001142763.1:c.3733-2A>G, NM_001142763.1:c.2660_2661delAT, NM_001142763.1:c.1955C>G, NM_001142763.1:c.1752C>G, NM_001142763.1:c.1598T>A, NM_001142763.1:c.1103delT, NM_001142763.1:c.1021C>T, NM_001142763.1:c.800G>A, NM_001142763.1:c.415C>T, NM_001142763.1:c.415C>G, NM_001142763.1:c.7C>T | Deafness, autosomal recessive 23 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCDH15 gene located on chromosomal region 10q21.1. This is a form of non-syndromic sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information. | 600,25 |
| PDE6A | Retinitis pigmentosa type 43 | NM_000440.2 | NM_000440.2:c.2053G>A, NM_000440.2:c.1749C>G, NM_000440.2:c.1683G>A, NM_000440.2:c.1560dupA, NM_000440.2:c.1113+1G>T, NM_000440.2:c.1113+1G>A | Retinitis pigmentosa type 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 600,25 |
| PDE6B | Retinitis pigmentosa type 40 | NM_000283.3 | NM_000283.3:c.892C>T, NM_000283.3:c.1540delC, NM_000283.3:c.1572delC, NM_000283.3:c.1580T>C, NM_000283.3:c.1669C>T, NM_000283.3:c.1920+2T>C | Retinitis pigmentosa 40 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6B gene located on chromosomal region 4p16.3. The age of onset is variable. Retinitis pigmentosa 40 is a retinal dystrophy belonging to the group of pigmentary retinopathies.This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness. | 600,25 |
| PDE6C | Cone dystrophy type 4 | NM_006204.3 | NM_006204.3:c.85C>T, NM_006204.3:c.180_186delCCTGTGC, NM_006204.3:c.256_257insAG, NM_006204.3:c.481-12T>A, NM_006204.3:c.633G>C, NM_006204.3:c.826C>T, NM_006204.3:c.881G>A, NM_006204.3:c.1066G>T, NM_006204.3:c.1363A>G, NM_006204.3:c.1682dupA, NM_006204.3:c.1805A>T, NM_006204.3:c.2036+1G>T, NM_006204.3:c.2283+1G>C, NM_006204.3:c.2457T>A | Cone dystrophy type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6C gene located on chromosomal region 10q23.33. The age of onset is infantile. This disease is characterized by reduced visual acuity, achromatopsia, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, eccentric fixation, and reduced or complete loss of color discrimination. | 600 |
| PDE6G | Retinitis pigmentosa type 57 | NM_002602.3 | NM_002602.3:c.187+1G>T | Retinitis pigmentosa type 57 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6G gene located on chromosomal region 17q25.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. | 600 |
| PDHA1 | Pyruvate dehydrogenase E1-alpha deficiency | NM_001173454.1 | NM_001173454.1:c.887A>C, NM_001173454.1:c.901C>G | Pyruvate dehydrogenase E1-alpha deficiency follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PDHA1 gene located on chromosomal region Xp22.12. The age of onset is variable. This disease is characterized by primary lactic acidosis in children. It is associated with a broad clinical spectrum ranging from fatal lactic acidosis in the newborn to chronic neurologic dysfunction with structural abnormalities in the central nervous system without systemic acidosis.The prevalence is >1:40,000 newborn. | 600 |
| PDP1 | Pyruvate dehydrogenase phosphatase deficiency | NM_001161779.1 | NM_001161779.1:c.352G>T, NM_001161779.1:c.672_676delCTTTA, NM_001161779.1:c.878delC, NM_001161779.1:c.926_928delTTC, NM_001161779.1:c.1681C>T | Pyruvate dehydrogenase phosphatase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDP1 gene located on chromosomal region 8q22.1. The age of onset is neonatal. This disease is characterized by lactic acidosis and hypotonia. | 600 |
| PDSS1 | Coenzyme Q10 deficiency, primary, type 2 | NM_014317.4 | NM_014317.4:c.319dupT, NM_014317.4:c.924T>G | Coenzyme Q10 deficiency, primary, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDSS1 gene located on chromosome 10p12.1. The age of onset is neonatal/infantile. This disease is characterized by multisystem disorder with early-onset deafness, optic atrophy, mild mental retardation, peripheral neuropathy, obesity and cardiac valvulopathy. | 600 |
| PDSS2 | Coenzyme Q10 deficiency, primary, type 3 | NM_020381.3 | NM_020381.3:c.1145C>T, NM_020381.3:c.964C>T, NM_020381.3:c.129dupC | Coenzyme Q10 deficiency, primary, type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDSS2 gene located on chromosomal region 6q21. The age of onset is infantile. This disease is characterized by onset of symptoms typically between age three and 12 months, often following a viral infection. Neurologic features include hypotonia, spasticity, movement disorders, cerebellar ataxia, and peripheral neuropathy. | 600 |
| PDX1 | Pancreatic agenesis type 1 | NM_000209.3 | NM_000209.3:c.492G>T, NM_000209.3:c.532G>A, NM_000209.3:c.533A>G | Pancreatic agenesis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDX1 gene located on chromosomal region 13q12.1. The age of onset is infantile. This disease is characterized by isolated hypoplasia or agenesis of the pancreas, pancreatic beta-cell failure resulting in neonatal insulin-dependent diabetes mellitus, and exocrine pancreatic insufficiency. | 600 |
| PDZD7 | Usher syndrome, type 2C, GPR98/PDZD7 digenic | NM_001195263.1 | NM_001195263.1:c.2107delA, NM_001195263.1:c.1543C>T, NM_001195263.1:c.166dupC, NM_001195263.1:c.144dupA | Usher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR98 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32, respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000. | 600 |
| PEX1 | Heimler syndrome type 1 | NM_000466.2 | NM_000466.2:c.3505_3517delCAGTTGTTTTCAC, NM_000466.2:c.2916delA, NM_000466.2:c.2528G>A, NM_000466.2:c.2097dupT, NM_000466.2:c.1991T>C, NM_000466.2:c.1952_1960dupCAGTGTGGA, NM_000466.2:c.1842delA, NM_000466.2:c.1239+1G>T, NM_000466.2:c.877C>T | Heimler syndrome 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. This disease is characterized by sensorineural hearing loss, enamel hyoplasia of the secondary dentition, and nail abnormalities. | 600,25 |
| PEX12 | Peroxisome biogenesis disorder type 3A (Zellweger) | NM_000286.2 | NM_000286.2:c.959C>T, NM_000286.2:c.894delC, NM_000286.2:c.888_889delCT, NM_000286.2:c.771delC, NM_000286.2:c.538C>T, NM_000286.2:c.455_459dupGGAAA | Peroxisome biogenesis disorder 3A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX12 gene located on chromosomal region 17q12. The peroxisomal biogenesis disorder (PBD) Zellweger syndrome (ZS) is an autosomal recessive multiple congenital anomaly syndrome resulting from disordered peroxisome biogenesis. Affected children present in the newborn period with profound hypotonia, seizures, and inability to feed. Characteristic craniofacial anomalies, eye abnormalities, neuronal migration defects, hepatomegaly, and chondrodysplasia punctata are present. Children with this condition do not show any significant development and usually die in the first year of lifeᅠ | 600 |
| PEX2 | Peroxisome biogenesis disorder type 5A (Zellweger) | NM_000318.2 | NM_000318.2:c.789_790delCT, NM_000318.2:c.163G>A | Peroxisome biogenesis disorder 5A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX2 gene located on chromosomal region 8q21.13. The peroxisomal biogenesis disorder (PBD) Zellweger syndrome (ZS) is an autosomal recessive multiple congenital anomaly syndrome resulting from disordered peroxisome biogenesis. Affected children present in the newborn period with profound hypotonia, seizures, and inability to feed. Characteristic craniofacial anomalies, eye abnormalities, neuronal migration defects, hepatomegaly, and chondrodysplasia punctata are present. Children with this condition do not show any significant development and usually die in the first year of lifeᅠ | 600 |
| PEX26 | Peroxisome biogenesis disorder type 7A (Zellweger) | NM_001127649.2 | NM_001127649.2:c.254dupT, NM_001127649.2:c.265G>A, NM_001127649.2:c.292C>T | Peroxisome biogenesis disorder 7A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX26 gene located on chromosomal region 22q11.21. The peroxisomal biogenesis disorder (PBD) Zellweger syndrome (ZS) is an autosomal recessive multiple congenital anomaly syndrome resulting from disordered peroxisome biogenesis. Affected children present in the newborn period with profound hypotonia, seizures, and inability to feed. Characteristic craniofacial anomalies, eye abnormalities, neuronal migration defects, hepatomegaly, and chondrodysplasia punctata are present. Children with this condition do not show any significant development and usually die in the first year of lifeᅠ | 600 |
| PEX5 | Peroxisome biogenesis disorder type 2A (Zellweger) | NM_001300789.1 | NM_001300789.1:c.1342C>T, NM_001300789.1:c.1641T>G | Peroxisome biogenesis disorder 2A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX5 gene located on chromosomal region 12p13.31. The peroxisomal biogenesis disorder (PBD) Zellweger syndrome (ZS) is an autosomal recessive multiple congenital anomaly syndrome resulting from disordered peroxisome biogenesis. Affected children present in the newborn period with profound hypotonia, seizures, and inability to feed. Characteristic craniofacial anomalies, eye abnormalities, neuronal migration defects, hepatomegaly, and chondrodysplasia punctata are present. Children with this condition do not show any significant development and usually die in the first year of lifeᅠ | 600 |
| PEX7 | Rhizomelic chondrodysplasia punctata, type 1 | NM_000288.3 | NM_000288.3:c.532C>T, NM_000288.3:c.618G>A, NM_000288.3:c.649G>A, NM_000288.3:c.653C>T, NM_000288.3:c.694C>T, NM_000288.3:c.854A>G, NM_000288.3:c.875T>A, NM_000288.3:c.903+1G>C | Rhizomelic chondrodysplasia punctata type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX7 gene located on chromosomal region 6q23.3. The age of onset is early. This disease is characterized by proximal shortening of the humerus and to a lesser degree the femur (rhizomelia), punctate calcifications in cartilage with epiphyseal and metaphyseal abnormalities (chondrodysplasia punctata), coronal clefts of the vertebral bodies, cataracts, postnatal growth deficiency is profound, intellectual disability is severe, seizures. The prevalence is <1:100,000. | 600,25 |
| PGM1 | Congenital disorder of glycosylation, type 1t | NM_001172818.1 | NM_001172818.1:c.397A>G, NM_001172818.1:c.415G>C, NM_001172818.1:c.841G>T, NM_001172818.1:c.1561C>T | Congenital disorder of glycosylation, type 1T follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PGM1 gene located on chromosomal region 1p31.3. The age of onset is infantile. It is a multisystem disorder caused by a defect in glycoprotein biosynthesis and characterized by under-glycosylated serum glycoproteins. Congenital disorders of glycosylation result in a wide variety of clinical features, such as defects in the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. The prevalence is <1:1,000,000. | 600 |
| PHKG2 | Glycogen storage disease type 9c | NM_000294.2 | NM_000294.2:c.130C>T, NM_000294.2:c.393-2A>G, NM_000294.2:c.553C>T, NM_000294.2:c.958C>T | Glycogen storage disease type 9C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHKG2 gene located on chromosomal region 16p12.1-p11.2. The age of onset is infantile. This disease is characterized by hepatomegaly, growth retardation, and mild delay in motor development during childhood. The incidence is <1:100.000 births. | 600 |
| PHYH | Refsum disease | NM_001323082.1 | NM_001323082.1:c.830G>A, NM_001323082.1:c.829C>T, NM_001323082.1:c.811A>C, NM_001323082.1:c.684+5G>T, NM_001323082.1:c.684+2T>G, NM_001323082.1:c.503-2A>G, NM_001323082.1:c.164delT, NM_001323082.1:c.135-1G>C, NM_001323082.1:c.135-2A>G | Refsum disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHYH gene located on chromosomal region 10p13. The age of onset is variable. This disease is characterized by hemeralopia (loss of vision in the dark), followed by episods of chronic distal motor polyneuropathy. Other associated signs include perceptive deafness, anosmia, cerebellous ataxia and sometimes, severe intellectual deficiency. Over the course of time cutaneous signs appear (ichtyosis), along with polyepiphyseal dysplasia, myocardiopathy, elevated protein in cerebrospinal fluid, and pigmentary retinitis that may result in blindness. The prevalence is 1:1.000,000-9:1.000,000. | 600,25 |
| PJVK | Deafness, autosomal recessive type 59 | NM_001042702.3 | NM_001042702.3:c.113dupT, NM_001042702.3:c.122delA, NM_001042702.3:c.161C>T, NM_001042702.3:c.420delT, NM_001042702.3:c.726delT, NM_001042702.3:c.823dupT, NM_001042702.3:c.988delG | Autosomal recessive nonsyndromic sensorineural deafness type 59 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PJVK gene located on chromosomal region 2q31.2. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. | 600 |
| PKHD1 | Polycystic kidney disease type 4 | NM_138694.3 | NM_138694.3:c.12027C>G, NM_138694.3:c.11363_11372delCTTCCCTGGA, NM_138694.3:c.10452dupT, NM_138694.3:c.10412T>G, NM_138694.3:c.10219C>T, NM_138694.3:c.9719G>A, NM_138694.3:c.9689delA, NM_138694.3:c.9530T>C, NM_138694.3:c.9370C>T, NM_138694.3:c.8870T>C, NM_138694.3:c.8824C>T, NM_138694.3:c.8408G>A, NM_138694.3:c.8407T>C, NM_138694.3:c.8317G>T, NM_138694.3:c.6499C>T, NM_138694.3:c.5895dupA, NM_138694.3:c.5325_5326delAG, NM_138694.3:c.4870C>T, NM_138694.3:c.3940delA, NM_138694.3:c.3766delC, NM_138694.3:c.3761_3762delCCinsG, NM_138694.3:c.3367G>A, NM_138694.3:c.3229-2A>C, NM_138694.3:c.2854G>A, NM_138694.3:c.2827_2828delGA, NM_138694.3:c.2452C>T, NM_138694.3:c.2414C>T, NM_138694.3:c.2341C>T, NM_138694.3:c.1486C>T, NM_138694.3:c.982C>T, NM_138694.3:c.930delC, NM_138694.3:c.682A>G, NM_138694.3:c.664A>G, NM_138694.3:c.370C>T, NM_138694.3:c.353delG, NM_138694.3:c.107C>T, NM_138694.3:c.85G>T | Polycystic kidney disease type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKHD1 gene located on chromosomal region 6p12.3-p12.2. The age of onset is early. This disease is a severe form of polycystic kidney disease affecting the kidneys and, in some cases, the hepatic biliary tract. Up to 50% of the affected neonates die shortly after birth, as a result of severe pulmonary hypoplasia and secondary respiratory insufficiency. In the subset that survives the perinatal period, morbidity and mortality are mainly related to severe systemic hypertension, renal insufficiency, and portal hypertension due to portal-tract fibrosis. | 600,25 |
| PKLR | Pyruvate kinase deficiency | NM_000298.5 | NM_000298.5:c.1675C>T, NM_000298.5:c.1529G>A, NM_000298.5:c.1528C>T, NM_000298.5:c.1456C>T, NM_000298.5:c.1436G>A, NM_000298.5:c.1261C>A, NM_000298.5:c.1151C>T, NM_000298.5:c.721G>T | Pyruvate kinase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKLR gene located on chromosomal region 1q22. The age of onset is early. This disease is characterized by highly variable degree of chronic hemolysis, with severe neonatal jaundice and fatal anemia at birth, severe transfusion-dependent chronic hemolysis, and moderate hemolysis with exacerbation during infection. The prevalence is 1:20,000. | 600,25 |
| PLA2G6 | Infantile neuroaxonal dystrophy type 1 | NM_003560.2 | NM_003560.2:c.2370T>G, NM_003560.2:c.2239C>T, NM_003560.2:c.1903C>T, NM_003560.2:c.1894C>T, NM_003560.2:c.1634A>C, NM_003560.2:c.1612C>T, NM_003560.2:c.929T>A, NM_003560.2:c.109C>T | Infantile neuroaxonal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLA2G6 gene located on chromosomal region 22q13.1. The age of onset is infantile. This disease is a type of neurodegeneration with brain iron accumulation characterized by psychomotor delay and regression, increasing neurological involvement with symmetrical pyramidal tract signs and spastic tetraplegia. INAD may be classic or atypical and patients present with symptoms anywhere along a continuum between the two. | 600 |
| PLCE1 | Nephrotic syndrome, type 3 | NM_016341.3 | NM_016341.3:c.961C>T, NM_016341.3:c.3346C>T, NM_016341.3:c.3736C>T, NM_016341.3:c.3846delG, NM_016341.3:c.4451C>T, NM_016341.3:c.4809delA, NM_016341.3:c.5560C>T | Nephrotic syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLCE1 gene located on chromosomal region 10q23.33. The age of onset is variable. This disease is characterized by low blood protein levels, high cholesterol levels, high triglyceride levels, and presence of protein in the urine. The prevalence is 2:100,000-7:100,000 Children; 3:100,000 adults. | 600,25 |
| PLEC | Epidermolysis bullosa simplex with muscular dystrophy | NM_201380.3 | NM_201380.3:c.12373dupG, NM_201380.3:c.11776G>T, NM_201380.3:c.11301_11302delGA, NM_201380.3:c.9580_9581delCT, NM_201380.3:c.9415C>T, NM_201380.3:c.7285C>T, NM_201380.3:c.1243C>T, NM_201380.3:c.1236+1G>A | Epidermolysis bullosa simplex with muscular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLEC gene located on chromosomal region 8q24. The age of onset is early. This disease is characterized by generalized blistering associated with muscular dystrophy, dystrophic nails, and focal keratoderma of the palms and soles. The prevalence is 1:30,000-1:50,000. | 600 |
| PLEKHG5 | Charcot-Marie-Tooth disease, recessive intermediate C | NM_001265592.1 | NM_001265592.1:c.3172C>T, NM_001265592.1:c.2177T>C | Charcot-Marie-Tooth disease, intermediate type C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLEKHG5 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease is a disorder of the peripheral nervous system, characterized by progressive weakness and atrophy, initially of the peroneal muscles and later of the distal muscles of the arms. Recessive intermediate forms of Charcot-Marie-Tooth disease are characterized by clinical and pathologic features intermediate between demyelinating and axonal peripheral neuropathies, and motor median nerve conduction velocities ranging from 25 to 45 m/sec. | 600 |
| PLG | Plasminogen deficiency, type I | NM_000301.3 | NM_000301.3:c.112A>G, NM_000301.3:c.693_695delGAA, NM_000301.3:c.704G>A, NM_000301.3:c.1120G>T, NM_000301.3:c.1435G>T, NM_000301.3:c.1848G>A | Plasminogen deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLG gene located on chromosomal region 6q26. The age of onset is infantile.This disease is characterized by markedly impaired extracellular fibrinolysis leading to the formation of ligneous (fibrin-rich) pseudomembranes on mucosae during wound healing. The prevalence is 1:1,000,000-9:1,000,000. | 600,25 |
| PLOD1 | Ehlers-Danlos syndrome, kyphoscoliotic type, 1 | NM_001316320.1 | NM_001316320.1:c.607+1G>A, NM_001316320.1:c.1096C>T, NM_001316320.1:c.1674C>G, NM_001316320.1:c.1977G>C, NM_001316320.1:c.2149C>T, NM_001316320.1:c.2173G>A | Ehlers-Danlos syndrome kyphoscoliotic type, 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLOD1 gene located on chromosomal region 1p36. The age of onset is early. This disease is characterized by progressive scoliosis from birth, severe muscle hypotonia, hyperextensible joints and fragile eyeballs. The weakness can lead to ocular retinal hemorrhage, glaucoma, coloring of the sclera or even to rupture of the globe. The prevalence is <1:5,000. | 600 |
| PLP1 | Pelizaeus-Merzbacher disease | NM_000533.4 | NM_000533.4:c.3G>A, NM_000533.4:c.128C>T, NM_000533.4:c.231_232insC, NM_000533.4:c.487T>C, NM_000533.4:c.593delG, NM_000533.4:c.725C>T, NM_000533.4:c.737G>C | Pelizaeus-Merzbacher disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PLP1 gene located on chromosomal region Xq22.2. The age of onset is infantile. It is a hypomyelinative leukodystrophy in which myelin is not formed properly in the central nervous system. It is characterized clinically by nystagmus, spastic quadriplegia, ataxia, and developmental delay. | 600 |
| PLP1 | Pelizaeus-Merzbacher disease | NM_001305004.1 | NM_001305004.1:c.5-1G>T | Pelizaeus-Merzbacher disease follows an X-linked pattern of inheritance and is caused by pathogenic variants in the PLP1 gene located on chromosomal region Xq22.2. The age of onset is infantile. It is a hypomyelinative leukodystrophy in which myelin is not formed properly in the central nervous system. It is characterized clinically by nystagmus, spastic quadriplegia, ataxia, and developmental delay. | 600 |
| PMM2 | Congenital disorder of glycosylation, type 1a | NM_000303.2 | NM_000303.2:c.26G>A, NM_000303.2:c.53C>G, NM_000303.2:c.95T>G, NM_000303.2:c.95_96delTAinsGC, NM_000303.2:c.97C>T, NM_000303.2:c.109C>T, NM_000303.2:c.131T>C, NM_000303.2:c.190delT, NM_000303.2:c.193G>T, NM_000303.2:c.255+2T>C, NM_000303.2:c.256-1G>C, NM_000303.2:c.323C>T, NM_000303.2:c.338C>T, NM_000303.2:c.349G>C, NM_000303.2:c.357C>A, NM_000303.2:c.368G>A, NM_000303.2:c.385G>A, NM_000303.2:c.395T>C, NM_000303.2:c.415G>A, NM_000303.2:c.422G>A, NM_000303.2:c.442G>A, NM_000303.2:c.470T>C, NM_000303.2:c.484C>T, NM_000303.2:c.563A>G, NM_000303.2:c.620T>C, NM_000303.2:c.623G>C, NM_000303.2:c.647A>T, NM_000303.2:c.652C>G, NM_000303.2:c.669C>G, NM_000303.2:c.677C>G, NM_000303.2:c.691G>A, NM_000303.2:c.710C>G, NM_000303.2:c.710C>T | Congenital disorder of glycosylation type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PMM2 gene located on chromosomal region 16p13.2. The age of onset is infantile. This disease is characterized by highly variable clinical manifestations that may include feeding problems, vomiting, and diarrhea with failure to thrive in infants, and severe encephalopathy with axial hypotonia, abnormal eye movement, marked psychomotor retardation, peripheral neuropathy, cerebellar hypoplasia, stroke-like episodes, and retinitis pigmentosa in late infancy, childhood or adulthood. | 600,25 |
| PNPO | Pyridoxamine 5'-phosphate oxidase deficiency | NM_018129.3 | NM_018129.3:c.674G>A, NM_018129.3:c.685C>T | Pyridoxamine 5'-phosphate oxidase (PNPO) deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PNPO gene located on chromosomal region 17q21.32. The age of onset is early. This disease is characterized by onset of severe seizures within hours of birth that are not responsive to anticonvulsants. | 600 |
| POLG | Mitochondrial DNA depletion syndrome 4A (Alpers type) | NM_001126131.1 | NM_001126131.1:c.3644-1G>A, NM_001126131.1:c.3630dupC, NM_001126131.1:c.3286C>T, NM_001126131.1:c.3218C>T, NM_001126131.1:c.3151G>C, NM_001126131.1:c.2794C>T, NM_001126131.1:c.2617G>T, NM_001126131.1:c.2605C>T, NM_001126131.1:c.2591A>G, NM_001126131.1:c.2557C>T, NM_001126131.1:c.2542G>A, NM_001126131.1:c.2243G>C, NM_001126131.1:c.2209G>C, NM_001126131.1:c.1879C>T, NM_001126131.1:c.1760C>T, NM_001126131.1:c.1754G>A, NM_001126131.1:c.1437C>G, NM_001126131.1:c.1399G>A, NM_001126131.1:c.1120C>T, NM_001126131.1:c.911T>G, NM_001126131.1:c.752C>T | Mitochondrial DNA depletion syndrome, Alpers type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by the clinical triad of psychomotor regression, seizures, and liver disease. The prevalence is 1:1,600 newborn. | 600,25 |
| POMGNT1 | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3 | NM_001243766.1 | NM_001243766.1:c.1864delC, NM_001243766.1:c.1814G>C, NM_001243766.1:c.1545delC, NM_001243766.1:c.1539+1G>T, NM_001243766.1:c.1539+1G>A, NM_001243766.1:c.1469G>A, NM_001243766.1:c.1425G>A, NM_001243766.1:c.1411A>T, NM_001243766.1:c.1274G>C, NM_001243766.1:c.932G>A, NM_001243766.1:c.931C>T, NM_001243766.1:c.880-1G>A, NM_001243766.1:c.652+1G>A, NM_001243766.1:c.636C>T, NM_001243766.1:c.187C>T, NM_001243766.1:c.92dupA | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3 which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMGNT1 gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent psychomotor development, eye involvement and seizures. The prevalence is 1-9:100,000. | 600,25 |
| POMT1 | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1 | NM_007171.3 | NM_007171.3:c.193G>A, NM_007171.3:c.226G>A, NM_007171.3:c.598G>C, NM_007171.3:c.793C>T, NM_007171.3:c.831C>G, NM_007171.3:c.907C>T, NM_007171.3:c.1153C>T, NM_007171.3:c.1242-2A>G, NM_007171.3:c.1261dupC, NM_007171.3:c.1280_1281delAGinsTC, NM_007171.3:c.1540C>T, NM_007171.3:c.1545C>G, NM_007171.3:c.1746G>C, NM_007171.3:c.1770G>C, NM_007171.3:c.2005G>A, NM_007171.3:c.2163C>A, NM_007171.3:c.2167dupG | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 gene located on chromosomal region 9q34.13. Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies (type A), which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), is a genetically heterogeneous disorder with characteristic brain and eye malformations, profound mental retardation, congenital muscular dystrophy, and early death. The phenotype commonly includes cobblestone (type II) lissencephaly, cerebellar malformations, and retinal malformations. | 600,25 |
| POMT2 | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2 | NM_013382.5 | NM_013382.5:c.2243G>C, NM_013382.5:c.2177G>A, NM_013382.5:c.1997A>G, NM_013382.5:c.1941G>A, NM_013382.5:c.1912C>T, NM_013382.5:c.1726-2A>G, NM_013382.5:c.1608_1609delCA, NM_013382.5:c.1445G>T, NM_013382.5:c.1417C>T, NM_013382.5:c.1057G>A, NM_013382.5:c.1045_1052delCGGATGGCinsG, NM_013382.5:c.551C>T | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT2 gene located on chromosomal region 14q24.3. Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies (type A), which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), is a genetically heterogeneous disorder with characteristic brain and eye malformations, profound mental retardation, congenital muscular dystrophy, and early death. The phenotype commonly includes cobblestone (type II) lissencephaly, cerebellar malformations, and retinal malformations. | 600,25 |
| POU1F1 | Pituitary hormone deficiency, combined, type 1 | NM_001122757.2 | NM_001122757.2:c.826G>T, NM_001122757.2:c.793C>T, NM_001122757.2:c.766G>A, NM_001122757.2:c.655T>C, NM_001122757.2:c.593G>A, NM_001122757.2:c.592C>T, NM_001122757.2:c.550G>C, NM_001122757.2:c.511A>T, NM_001122757.2:c.506G>A, NM_001122757.2:c.482T>G, NM_001122757.2:c.469G>T, NM_001122757.2:c.71C>T | Pituitary hormone deficiency, combined, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POU1F1 gene located on chromosomal region 3p11.2. The age of onset is early. This disease is characterized by short stature, cognitive alterations or delayed puberty. The prevalence is 1:8,000. | 600 |
| POU3F4 | Deafness, X-linked type 2 (DFNX2) | NM_000307.4 | NM_000307.4:c.499C>T, NM_000307.4:c.604A>T | X-linked deafness type 2 (DFNX2, also known as DFN3) follows an X-linked pattern of inheritance and is caused by pathogenic variants in the POU3F4 gene located on chromosomal region Xq21.1. The age of onset is infantile. This disease is characterized by progressive conductive and sensorineural hearing loss and a pathognomonic temporal bone deformity that includes dilatation of the inner auditory canal and a fistulous connection between the internal auditory canal and the cochlear basal turn, resulting in a perilymphatic fluid 'gusher' during stapes surgery (summary by de Kok et al., 1995 and Song et al., 2010). Note: Choroideremia, deafness, and mental retardation (OMIM 303110), is caused by a contiguous gene deletion syndrome involving the POU3F4 and CHM genes on Xq21. This deletion is not detected by this CGT test. | 600 |
| PPT1 | Ceroid lipofuscinosis, neuronal, type 1 | NM_000310.3 | NM_000310.3:c.840dupA, NM_000310.3:c.627+1G>T, NM_000310.3:c.541G>T, NM_000310.3:c.451C>T, NM_000310.3:c.223A>C, NM_000310.3:c.169dupA, NM_000310.3:c.29T>A | Neuronal ceroid lipofuscinoses, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PPT1 gene located on chromosomal region 1p32. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 1.5:1,000,000-9:1,000,000. | 600,25 |
| PRCD | Retinitis pigmentosa, type 36 | NM_001077620.2 | NM_001077620.2:c.52C>T, NM_001077620.2:c.64C>T | Retinitis pigmentosa, type 36 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRCD gene located on chromosomal region 17q25.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. | 600 |
| PRKRA | Dystonia, type 16 | NM_003690.4 | NM_003690.4:c.665C>T | Dystonia, type 16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRKRA gene located on chromosomal region 2q31.2. The age of onset is early. This disease is characterized by progressive limb dystonia, laryngeal and oromandibular dystonia and parkinsonism. | 600 |
| PROM1 | Retinitis pigmentosa, type 41 | NM_006017.2 | NM_006017.2:c.2490-2A>G, NM_006017.2:c.1841delG, NM_006017.2:c.1726C>T, NM_006017.2:c.1354dupT, NM_006017.2:c.1177_1178delAT, NM_006017.2:c.199C>T | Retinitis pigmentosa, type 41 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROM1 gene located on chromosomal region 4p15.32. The age of onset is early. This disease is characterized by night blindness often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 19:100,000-27:100,000. | 600,25 |
| PROP1 | Pituitary hormone deficiency, combined, type 2 | NM_006261.4 | NM_006261.4:c.469dupT, NM_006261.4:c.358C>T, NM_006261.4:c.349T>A, NM_006261.4:c.310delC, NM_006261.4:c.301_302delAG, NM_006261.4:c.295C>T, NM_006261.4:c.263T>C, NM_006261.4:c.247C>T, NM_006261.4:c.218G>A, NM_006261.4:c.217C>T, NM_006261.4:c.157delA, NM_006261.4:c.150delA, NM_006261.4:c.112_124delTCGAGTGCTCCAC, NM_006261.4:c.4delG, NM_006261.4:c.2T>C | Pituitary hormone deficiency, combined, type 2, genetic forms follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROP1 gene located on chromosomal region 5q35.3. The age of onset is early. This disease is characterized by short stature, cognitive alterations or delayed puberty. | 600 |
| PRPS1 | Deafness, X-linked 1 (DFNX1); Arts syndrome; PRPS1-related disorders | NM_002764.3 | NM_002764.3:c.193G>A, NM_002764.3:c.344T>C, NM_002764.3:c.398A>C, NM_002764.3:c.869T>C, NM_002764.3:c.916G>A | The DFNX1 locus (PRPS1 gene) is associated with phenotypically heterogeneous non-syndromic hearing loss. In general, hearing impairment in male patients with PRPS1 mutations is bilateral, moderate to profound, and can be pre- or post-lingual, progressive or non-progressive. Female carriers may also be affected by unilateral or bilateral hearing impairment. Mutations in PRPS1 might also result in a spectrum of syndromic conditions, including PRS-I superactivity (OMIM #300661), Charcot-Marie Tooth neuropathy type X-5 (CMTX5 or Rosenberg-Chutorian syndrome, OMIM #311070) and Arts syndrome. Arts syndrome is an X-linked disorder characterized by mental retardation, early-onset hypotonia, ataxia, delayed motor development, hearing impairment, and optic atrophy (de Brouwer et al., 2007). In the Arts syndrome, susceptibility to infections, especially of the upper respiratory tract, can result in early death. | 600 |
| PRX | Charcot-Marie-Tooth disease, type 4F | NM_181882.2 | NM_181882.2:c.3208C>T, NM_181882.2:c.2857C>T, NM_181882.2:c.2553_2556delTCTC, NM_181882.2:c.2145T>A, NM_181882.2:c.2098delG, NM_181882.2:c.1362delA, NM_181882.2:c.1102C>T, NM_181882.2:c.247delC | Charcot-Marie-Tooth disease, type 4F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRX gene located on chromosomal region 19q13.2. The age of onset is infantile. This disease is characterized by delayed motor milestones, and proximal and distal muscle weakness. The prevalence is <1:1,000,000. | 600 |
| PSAP | Combined SAP deficiency | NM_001042465.2 | NM_001042465.2:c.1297C>T, NM_001042465.2:c.1055T>C, NM_001042465.2:c.643A>C, NM_001042465.2:c.607C>T | Combined saposin (SAP) deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PSAP gene located on chromosomal region 10q22.1. The age of onset is neonatal/infancy. This disease is characterized by hypotonia, massive myoclonic bursts, abnormal ocular movements and dystonia. Grand mal seizures and seizures triggered by tactile stimuli have been described. Patients also develop hepatosplenomegaly. Death between 1 and 4 months usually occurs from respiratory failure following repeated pulmonary infections. The prevalence is below 1/1,000,000. | 600 |
| PSAP | Combined SAP deficiency | NM_002778.3 | NM_002778.3:c.1A>T | Combined saposin (SAP) deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PSAP gene located on chromosomal region 10q22.1. The age of onset is neonatal/infancy. This disease is characterized by hypotonia, massive myoclonic bursts, abnormal ocular movements and dystonia. Grand mal seizures and seizures triggered by tactile stimuli have been described. Patients also develop hepatosplenomegaly. Death between 1 and 4 months usually occurs from respiratory failure following repeated pulmonary infections. The prevalence is below 1/1,000,000. | 600 |
| PSAT1 | Neu-Laxova syndrome, type 2 | NM_058179.3 | NM_058179.3:c.299A>C, NM_058179.3:c.1033_1034delCT | Neu-Laxova syndrome, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PSAT1 gene located on chromosomal region 9q21.2. The age of onset is prenatal. This disease is characterized by severe congenital malformations leading to prenatal or early postnatal lethality. Affected patients have abnormal craniofacial features, microcephaly, intrauterine growth retardation, ichthyosis, flexion deformities, limb malformations, and edema of the hands and feet. Some patients have malformations of the central nervous system. The prevalence is below 1/1,000,000. | 600 |
| PYGM | McArdle disease | NM_005609.3 | NM_005609.3:c.2392T>C, NM_005609.3:c.2262delA, NM_005609.3:c.2128_2130delTTC, NM_005609.3:c.1963G>A, NM_005609.3:c.1827G>A, NM_005609.3:c.1768+1G>A, NM_005609.3:c.1726C>T, NM_005609.3:c.1722T>G, NM_005609.3:c.1628A>C, NM_005609.3:c.1621G>T, NM_005609.3:c.1466C>G, NM_005609.3:c.613G>A, NM_005609.3:c.501dupT, NM_005609.3:c.393delG, NM_005609.3:c.280C>T, NM_005609.3:c.255C>A, NM_005609.3:c.148C>T, NM_005609.3:c.13_14delCT, NM_005609.3:c.1A>G | McArdle disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PYGM gene located on chromosomal region 11q13.1. The age of onset is infantile. This disease is characterized by muscular exercise intolerance with myalgia, cramps, fatigue, and muscle weakness. | 600,25 |
| RAB23 | Carpenter syndrome | NM_001278666.1 | NM_001278666.1:c.434T>A, NM_001278666.1:c.407dupC | Carpenter syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB23 gene located on chromosomal region 6p11.2. The age of onset is early. This disease is characterized by acrocephaly, peculiar facies, brachydactyly and syndactyly in the hands, and preaxial polydactyly and syndactyly of the toes. The prevalence is <1:1,000,000. | 600 |
| RAB27A | Griscelli syndrome, type 2 | NM_004580.4 | NM_004580.4:c.454G>C, NM_004580.4:c.389T>C, NM_004580.4:c.382dupA, NM_004580.4:c.352C>T, NM_004580.4:c.259G>C, NM_004580.4:c.217T>G | Griscelli disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB27A gene located on chromosome 15q15-q21.1. The age of onset is infantile. This disease is characterized by immune system abnormalities in addition to having hypopigmented skin and hair. Affected individuals are prone to recurrent infections. They also develop an immune condition called hemophagocytic lymphohistiocytosis, in which the immune system produces too many activated immune cells called T-lymphocytes and macrophages (histiocytes). | 600 |
| RAB3GAP1 | Warburg micro syndrome, type 1 | NM_001172435.1 | NM_001172435.1:c.497_498delTT, NM_001172435.1:c.748+1G>A, NM_001172435.1:c.899+1G>A, NM_001172435.1:c.937dupA, NM_001172435.1:c.1395_1398delTATG, NM_001172435.1:c.1410C>A, NM_001172435.1:c.1734G>A, NM_001172435.1:c.2011C>T | Warburg micro syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB3GAP1 gene located on chromosomal region 2q21.3. The age of onset is infantile. This disease is characterized by microcephaly, microphthalmia, microcornia, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. The prevalence is <1:1,000,000. | 600 |
| RAB3GAP2 | Martsolf syndrome | NM_012414.3 | NM_012414.3:c.1648C>T, NM_012414.3:c.1485C>A, NM_012414.3:c.1276C>T, NM_012414.3:c.325_328delAAAG | Warburg micro syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAB3GAP2 gene located on chromosomal region 1q41. The age of onset is early. This disease is characterized by microcephaly, microphthalmia, microcornia, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. The prevalence is <1:1,000,000. | 600 |
| RAG1 | Omenn syndrome; Severe combined immunodeficiency, B cell-negative | NM_000448.2 | NM_000448.2:c.256_257delAA, NM_000448.2:c.940C>T, NM_000448.2:c.983G>A, NM_000448.2:c.1681C>T, NM_000448.2:c.1682G>A, NM_000448.2:c.2164G>A, NM_000448.2:c.2320G>T, NM_000448.2:c.2326C>T, NM_000448.2:c.2333G>A, NM_000448.2:c.2814T>G, NM_000448.2:c.2923C>T | Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. Severe combined immunodeficiency, autosomal recessive, T cell-negative (T-), B cell negative (B-), NK cell positive (NK+) is also caused by mutation in the RAG1 and RAG2 genes. This disease is characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development. Without treatment, patients usually die within the first year of life. | 600,25 |
| RAG2 | Omenn syndrome; Severe combined immunodeficiency, B cell-negative | NM_000536.3 | NM_000536.3:c.1352G>C, NM_000536.3:c.601C>T, NM_000536.3:c.283G>A, NM_000536.3:c.230C>A, NM_000536.3:c.115A>G | Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. Severe combined immunodeficiency, autosomal recessive, T cell-negative (T-), B cell negative (B-), NK cell positive (NK+) is also caused by mutation in the RAG1 and RAG2 genes. This disease is characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development. Without treatment, patients usually die within the first year of life. | 600 |
| RAPSN | Fetal akinesia deformation sequence | NM_005055.4 | NM_005055.4:c.848T>C, NM_005055.4:c.807C>A, NM_005055.4:c.566C>T, NM_005055.4:c.490C>T, NM_005055.4:c.484G>A, NM_005055.4:c.416T>C, NM_005055.4:c.264C>A | Fetal akinesia deformation sequence follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by multiple joint contractures, facial anomalies and pulmonary hypoplasia. The prevalence is 1:3,000. | 600,25 |
| RAX | Isolated microphthalmia, type 3 | NM_013435.2 | NM_013435.2:c.909C>G, NM_013435.2:c.439C>T, NM_013435.2:c.383_384delAG, NM_013435.2:c.18C>A | Isolated microphthalmia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAX gene located on chromosomal region 18q21.32. Microphthalmia designates a heterogeneous group of ocular malformations with a more or less evident reduction in the size of the eyeball. Additional features include high hypermetropia and a short axial length. | 600,25 |
| RDH12 | Leber congenital amaurosis, type 13 | NM_152443.2 | NM_152443.2:c.146C>T, NM_152443.2:c.152T>A, NM_152443.2:c.184C>T, NM_152443.2:c.210dupC, NM_152443.2:c.295C>A, NM_152443.2:c.377C>T, NM_152443.2:c.379G>T, NM_152443.2:c.451C>A, NM_152443.2:c.451C>G, NM_152443.2:c.464C>T, NM_152443.2:c.523T>C, NM_152443.2:c.565C>T, NM_152443.2:c.677A>G, NM_152443.2:c.806_810delCCCTG | Leber congenital amaurosis type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDH12 gene located on chromosomal region 14q24.1. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. | 600,25 |
| RDX | Deafness, autosomal recessive, type 24 | NM_001260492.1 | NM_001260492.1:c.1405dupG, NM_001260492.1:c.342_346delGATAT | Autosomal recessive nonsyndromic sensorineural deafness type DFNB24 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDX gene located on chromosomal region 11q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| RELN | Lissencephaly 2 (Norman-Roberts type) | NM_005045.3 | NM_005045.3:c.6646C>T, NM_005045.3:c.5615-1G>A | Lissencephaly syndrome 2, Norman-Roberts type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RELN gene located on chromosomal region 7q22. The age of onset is early. This disease is characterized by craniofacial anomalies (severe microcephaly, a low sloping forehead, a broad and prominent nasal bridge and widely set eyes) and postnatal growth retardation, severe intellectual deficit, spasticity and epilepsy. The prevalence is 1:1,000,000-9:1,000,000. | 600 |
| REN | Renal tubular dysgenesis | NM_000537.3 | NM_000537.3:c.404C>A, NM_000537.3:c.145C>T, NM_000537.3:c.127C>T | Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in REN gene located on chromosomal region 1q32.1. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects. | 600 |
| RGR | Retinitis pigmentosa, type 44 | NM_002921.3 | NM_002921.3:c.262_269dupGGCTCGGA, NM_002921.3:c.273_274insGGCTCGGA, NM_002921.3:c.877C>T | Retinitis pigmentosa type 44 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RGR gene located on chromosomal region 10q23.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 600,25 |
| RHO | Retinitis pigmentosa, type 4, autosomal recessive | NM_000539.3 | NM_000539.3:c.173C>T, NM_000539.3:c.448G>A, NM_000539.3:c.620T>G, NM_000539.3:c.745G>T | Retinitis pigmentosa type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RHO gene located on chromosomal region 3q22.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 600,25 |
| RLBP1 | Bothnia retinal dystrophy | NM_000326.4 | NM_000326.4:c.700C>T, NM_000326.4:c.452G>A, NM_000326.4:c.333T>G | Bothnia retinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RLBP1 gene located on chromosomal region 15q26.1. This disease is characterized by night blindness from early childhood with features consistent with retinitis punctata albescens and macular degeneration. The prevalence is unknown. | 600,25 |
| RP2 | Retinitis pigmentosa, type 2, X-linked | NM_006915.2 | NM_006915.2:c.235delG, NM_006915.2:c.305dupT, NM_006915.2:c.352delC, NM_006915.2:c.353G>A, NM_006915.2:c.353G>T, NM_006915.2:c.358C>T, NM_006915.2:c.453delC, NM_006915.2:c.453C>G, NM_006915.2:c.631delC | Retinitis pigmentosa type 2 (RP2) follows an X-linked (XLRP) pattern of inheritance and is caused by pathogenic variants in the RP2 gene located on chromosomal region Xp11.23. The age of onset is variable. This condition primarily affects males, causing night blindness in early childhood followed by progressive daytime vision loss. RP2 gene mutations account for 10 to 15 percent of all cases of X-linked retinitis pigmentosa. A gradual loss of photoreceptors underlies the progressive vision loss characteristic of retinitis pigmentosa (RP). The prevalence of RP2 is 1:3,500. | 600 |
| RPE65 | Leber congenital amaurosis, type 2 | NM_000329.2 | NM_000329.2:c.1543C>T, NM_000329.2:c.1355T>G, NM_000329.2:c.1292A>G, NM_000329.2:c.1102T>C, NM_000329.2:c.1087C>A, NM_000329.2:c.1067delA, NM_000329.2:c.1022T>C, NM_000329.2:c.907A>T, NM_000329.2:c.514_515delGT, NM_000329.2:c.271C>T | Leber congenital amaurosis 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus. | 600,25 |
| RPGR | Retinitis pigmentosa, type 3, X-linked | NM_001034853.1 | NM_001034853.1:c.846_847delAA, NM_001034853.1:c.823G>A, NM_001034853.1:c.806G>A, NM_001034853.1:c.703C>T, NM_001034853.1:c.674_675delCC, NM_001034853.1:c.654_655delGA, NM_001034853.1:c.642_656delTGGAGAACCTGAGAAinsC, NM_001034853.1:c.517G>C, NM_001034853.1:c.505G>T, NM_001034853.1:c.389T>G, NM_001034853.1:c.296C>A, NM_001034853.1:c.179G>T, NM_001034853.1:c.173_174insA, NM_001034853.1:c.155-2A>G | Retinitis pigmentosa type 3 (RP3) follows an X-linked (XLRP) pattern of inheritance and is caused by pathogenic variants in the RPGR gene located on chromosomal region Xp11.4. XLRP are severe forms of inherited retinal degeneration that primarily affects the rod photoreceptors (Demirci et al., 2002). It typically causes an early-onset night blindness and loss of peripheral vision, often causing patients to become legally blind by the age of 30 to 40 years. Mutation in the RPGR gene is believed to account for approximately 70% of XLRP (RP3)(Vervoort et al., 2000). In RP3, affected males have a severe phenotype, and carrier females show a wide spectrum of clinical features ranging from completely asymptomatic to severe RP (Jin et al., 2007). Mutations in the RPGR gene can also cause X-linked cone-rod dystrophy (CORDX1; 304020) and a syndromic form of retinitis pigmentosa (RP) with deafness and sinorespiratory infections (300455). Cone-rod dystrophy is a group of related [to RP] eye disorders that causes vision loss, which becomes more severe over time. These disorders affect the retina, which is the layer of light-sensitive tissue at the back of the eye. In people with cone-rod dystrophy, vision loss occurs as the light-sensing cells of the retina gradually deteriorate. X-linked cone-rod dystrophy is a rare, progressive visual disorder primarily affecting cone photoreceptors (Demirci et al., 2002). Affected individuals, essentially all of whom are males, present with decreased visual acuity, myopia, photophobia, abnormal color vision, full peripheral visual fields, decreased photopic electroretinographic responses, and granularity of the macular retinal pigment epithelium. The degree of rod photoreceptor involvement is variable, with increasing degeneration. Although penetrance appears to be nearly 100%, there is variable expressivity with respect to age at onset, severity of symptoms, and findings (Hong et al., 1994). | 600 |
| RPGRIP1L | Joubert syndrome, type 7; Meckel syndrome, type 5; COACH syndrome | NM_015272.4 | NM_015272.4:c.3634_3637delGAAA, NM_015272.4:c.2794_2795delTT, NM_015272.4:c.2614C>T, NM_015272.4:c.2413C>T, NM_015272.4:c.2050C>T, NM_015272.4:c.1975T>C, NM_015272.4:c.1843A>C, NM_015272.4:c.1329dupA, NM_015272.4:c.1326_1329delAAAA, NM_015272.4:c.776+1G>A, NM_015272.4:c.757C>T, NM_015272.4:c.697A>T, NM_015272.4:c.394A>T | Joubert syndrome (JBTS) type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. JBTS is characterized by congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (less common in JBTS7) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. RPGRIP1L gene is also associated with Meckel syndrome type 5, a rare, autosomal recessive lethal condition characterized by central nervous system malformations, postaxial, polydactyly, multicystic kidney dysplasia, and ductal proliferation in the portal area of the liver. Other phenotype associated is COACH syndrome, an autosomal recessive disorder characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable. COACH syndrome is considered by some to be a subtype of Joubert syndrome with congenital hepatic fibrosis. | 600,25 |
| RYR1 | Minicore myopathy with external ophthalmoplegia | NM_000540.2 | NM_000540.2:c.325C>T, NM_000540.2:c.487C>T, NM_000540.2:c.631+2T>C, NM_000540.2:c.738T>G, NM_000540.2:c.1021G>A, NM_000540.2:c.1186G>T, NM_000540.2:c.1205T>C, NM_000540.2:c.1739_1742dupATCA, NM_000540.2:c.1841G>T, NM_000540.2:c.4076delG, NM_000540.2:c.4405C>T, NM_000540.2:c.5333C>A, NM_000540.2:c.5726_5727delAG, NM_000540.2:c.6082C>T, NM_000540.2:c.6104A>T, NM_000540.2:c.6721C>T, NM_000540.2:c.7268T>A, NM_000540.2:c.7300G>A, NM_000540.2:c.7360C>T, NM_000540.2:c.7373G>A, NM_000540.2:c.7463_7475delCAAAGATGTCAGC, NM_000540.2:c.7781C>A, NM_000540.2:c.7836-1G>A, NM_000540.2:c.9000+1G>T, NM_000540.2:c.9905dupC, NM_000540.2:c.10343C>T, NM_000540.2:c.10579C>T, NM_000540.2:c.13480G>T, NM_000540.2:c.14126C>T, NM_000540.2:c.14365-2A>T, NM_000540.2:c.14545G>A | Multiminicore disease (MMD) is an inherited neuromuscular disorder defined pathologically by the presence of multiple areas of reduced mitochondrial oxidative activity running along a limited extent of the longitudinal axis of the muscle fiber, so-called 'minicores.' These regions show sarcomere disorganization and mitochondria depletion. Typically, no dystrophic signs, such as muscle fiber necrosis or regeneration or significant endomysial fibrosis, are present. MMD is a pathologic diagnosis and shows clinical and genetic heterogeneity. Affected individuals have clinical features of a congenital myopathy, including neonatal hypotonia, delayed motor development, and generalized muscle weakness and amyotrophy, which may progress slowly or remain stable (Ferreiro and Fardeau, 2002).Patients with recessive mutations in the RYR1 gene typically show severe congenital muscular dystrophy with ophthalmoplegia, although there is phenotypic variability. Some patients may present in utero with fetal akinesia, arthrogryposis, and lung hypoplasia resulting in fetal or perinatal death (McKie et al., 2014). Skeletal muscle biopsy of patients with recessive RYR1 mutations show variable features, including central cores (Jungbluth et al., 2007), congenital fiber-type disproportion (CFTD) (Monnier et al., 2009), and centronuclear myopathy (Wilmshurst et al., 2010). | 600,25 |
| SACS | Spastic ataxia, Charlevoix-Saguenay, type | NM_014363.5 | NM_014363.5:c.13237C>T, NM_014363.5:c.12160C>T, NM_014363.5:c.8844delT, NM_014363.5:c.7504C>T, NM_014363.5:c.6563T>A, NM_014363.5:c.6355C>T, NM_014363.5:c.5618_5619delAT, NM_014363.5:c.4933C>T, NM_014363.5:c.3198T>A, NM_014363.5:c.994A>T, NM_014363.5:c.517C>T | Spastic ataxia, Charlevoix-Saguenay type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SACS gene located on chromosomal region 13q11. The age of onset is early. This disease is characterized by early-onset cerebellar ataxia with spasticity, a pyramidal syndrome and peripheral neuropathy. The prevalence is 1:1,500-1:2,000. | 600,25 |
| SAG | Oguchi disease, type 1 | NM_000541.4 | NM_000541.4:c.298dupG, NM_000541.4:c.523C>T, NM_000541.4:c.577C>T, NM_000541.4:c.874C>T, NM_000541.4:c.916G>T, NM_000541.4:c.926delA, NM_000541.4:c.993C>G | Oguchi disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SAG gene located on chromosomal region 2q37. The age of onset is infantile. This disease is characterized by congenital stationary night blindness and the Mizuo-Nakamura phenomenon which is a unique morphological and functional abnormality of the retina that presents with a typical golden-yellow or silver-gray discoloration of the fundus in the presence of light that disappears after dark-adaptation and appears again after the onset of light. | 600,25 |
| SBDS | Shwachman-Diamond syndrome | NM_016038.2 | NM_016038.2:c.377G>C, NM_016038.2:c.258+2T>C, NM_016038.2:c.184A>T, NM_016038.2:c.183_184delTAinsCT, NM_016038.2:c.120delG | Shwachman-Diamond syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBDS gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by chronic and usually mild neutropenia, pancreatic exocrine insufficiency associated with steatorrhea and growth failure, skeletal dysplasia with short stature, and an increased risk of bone marrow aplasia or leukemic transformation, cutaneous (eczema or ichthyosis) and dental anomalies, and psychomotor retardation. The prevalence is 1:76,000 newborn. | 600,25 |
| SBF2 | Charcot-Marie-Tooth disease, type 4B2 | NM_030962.3 | NM_030962.3:c.5536_5539dupATCT, NM_030962.3:c.3586C>T, NM_030962.3:c.3154A>T, NM_030962.3:c.2875C>T, NM_030962.3:c.1459C>T | Charcot-Marie-Tooth disease, type 4B2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBF2 gene located on chromosomal region 11p15.4. The age of onset is infantile. This disease is characterized by muscle weakness, sensory loss, reduced nerve conduction velocities, characteristic myelin outfoldings and a severe disease course. | 600 |
| SC5D | Lathosterolosis | NM_001024956.2 | NM_001024956.2:c.86G>A | Lathosterolosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SC5D gene located on chromosomal region 11q23.3. The age of onset is early. This disease is characterized by malformations, intellectual deficit and liver disease. The prevalence is <1:1,000,000. | 600 |
| SCNN1A | Pseudohypoaldosteronism, type 1 | NM_001159576.1 | NM_001159576.1:c.1942C>T, NM_001159576.1:c.1699C>T, NM_001159576.1:c.1659delC, NM_001159576.1:c.1482delC, NM_001159576.1:c.517G>A, NM_001159576.1:c.380_381delTC | Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest. | 600 |
| SCNN1B | Pseudohypoaldosteronism, type 1 | NM_000336.2 | NM_000336.2:c.109G>A | Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest. | 600,25 |
| SCNN1G | Pseudohypoaldosteronism, type 1 | NM_001039.3 | NM_001039.3:c.600dupA, NM_001039.3:c.1373+2T>C, NM_001039.3:c.1570-1G>A, NM_001039.3:c.1627delG | Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest. | 600,25 |
| SELENON | Muscular dystrophy, rigid spine, type 1 | NM_020451.2 | NM_020451.2:c.713dupA, NM_020451.2:c.818G>A, NM_020451.2:c.943G>A, NM_020451.2:c.1315C>T, NM_020451.2:c.1384T>G | Rigid spine syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SELENON gene located on chromosomal region 1p36.11. The age of onset is infantile. This disease is characterized by contractures of the spinal extensor muscles associated with abnormal posture (limitation of neck and trunk flexure), progressive scoliosis of the spine, early marked cervico-axial muscle weakness with relatively preserved strength and function of the extremities and progressive respiratory insufficiency. The prevalence is 3.5:100,000ヨ5:100,000. | 600 |
| SEMA4A | Cone-rod dystrophy, type 10; Retinitis pigmentosa, type 35 | NM_001193300.1 | NM_001193300.1:c.1033G>C, NM_001193300.1:c.1049T>G | Cone-rod dystrophy, type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SEMA4A gene located on chromosomal region 1q22. The age of onset is childhood/adolescent. This disease is characterized by retinal pigment deposits visible on fundus examination, predominantly in the macular region, and initial loss of cone photoreceptors followed by rod degeneration. This leads to decreased visual acuity and sensitivity in the central visual field, followed by loss of peripheral vision. Severe loss of vision occurs earlier than in retinitis pigmentosa, due to cone photoreceptors degenerating at a higher rate than rod photoreceptors. The prevalence is 1-9/100,000. Retinitis pigmentosa-35 (RP35) can be caused by compound heterozygous mutation in the SEMA4A gene. RP35 is characterized by retinal pigment deposits and primary loss of rod photoreceptor cells followed by secondary loss of cone photoreceptors. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. | 600 |
| SETX | Spinocerebellar ataxia, autosomal recessive, type 1 | NM_015046.5 | NM_015046.5:c.6848_6851delCAGA, NM_015046.5:c.6834_6839delAACAAA, NM_015046.5:c.5927T>G, NM_015046.5:c.5630delG, NM_015046.5:c.5549-1G>T, NM_015046.5:c.5308_5311delGAGA, NM_015046.5:c.4087C>T, NM_015046.5:c.2602C>T, NM_015046.5:c.1166T>C, NM_015046.5:c.1027G>T, NM_015046.5:c.994C>T | Spinocerebellar ataxia with axonal neuropathy type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SETX gene located on chromosomal region 9q34.13. The age of onset is infantile. This disease is characterized by progressive cerebellar ataxia, axonal sensorimotor neuropathy with oculomotor apraxia, fixation instability, extrapyramidal features and an elevated serum alpha-fetoprotein level. The prevalence is 4:100,000-8:100,000. | 600,25 |
| SGCA | Muscular dystrophy, limb-girdle, type 2D | NM_000023.3 | NM_000023.3:c.101G>A, NM_000023.3:c.229C>T, NM_000023.3:c.371T>C, NM_000023.3:c.518T>C, NM_000023.3:c.574C>T, NM_000023.3:c.739G>A, NM_000023.3:c.850C>T, NM_000023.3:c.903_904dupCC | Autosomal recessive limb-girdle muscular dystrophy type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCA gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness and calf pseudohypertrophy. The prevalence is 1:1,000,000-9:1,000,000. | 600,25 |
| SGCB | Muscular dystrophy, limb-girdle, type 2E | NM_000232.4 | NM_000232.4:c.552T>G, NM_000232.4:c.452C>G, NM_000232.4:c.341C>T, NM_000232.4:c.323T>G, NM_000232.4:c.299T>A, NM_000232.4:c.272G>T, NM_000232.4:c.272G>C | Autosomal recessive limb-girdle muscular dystrophy type 2E follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCB gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness, particularly of the pelvic girdle muscles. | 600 |
| SGCG | Muscular dystrophy, limb-girdle, type 2C | NM_000231.2 | NM_000231.2:c.89delG, NM_000231.2:c.195+4_195+7delAGTA, NM_000231.2:c.505+1G>A, NM_000231.2:c.525delT, NM_000231.2:c.787G>A, NM_000231.2:c.848G>A | Autosomal recessive limb-girdle muscular dystrophy type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCG gene located on chromosomal region 13q12.12. The age of onset is variable. This disease is characterized by limb-girdle weakness, calf hypertrophy, diaphragmatic weakness, and variable cardiac abnormalities. | 600,25 |
| SGSH | Mucopolysaccharidosis, type 3A (Sanfilippo A) | NM_000199.3 | NM_000199.3:c.1380delT, NM_000199.3:c.1339G>A, NM_000199.3:c.1298G>A, NM_000199.3:c.1167C>A, NM_000199.3:c.892T>C, NM_000199.3:c.877C>T, NM_000199.3:c.757delG, NM_000199.3:c.617G>C, NM_000199.3:c.466A>T, NM_000199.3:c.449G>A, NM_000199.3:c.383C>T, NM_000199.3:c.364G>A, NM_000199.3:c.337_345delCAAGCTGGTinsGCACAGGTGAG, NM_000199.3:c.320delT, NM_000199.3:c.235A>C, NM_000199.3:c.220C>T, NM_000199.3:c.197C>G, NM_000199.3:c.130G>A | Mucopolysaccharidosis type 3A (Sanfilippo syndrome type A) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGSH gene located on chromosomal region 17q25.3. The age of onset is infantile. This disease is characterized by behavioural disorders (hyperkinesia, aggressiveness) and intellectual deterioration, sleep disorders and very mild dysmorphism. The prevalence is >1:70,000 newborn. | 600,25 |
| SH2D1A | Lymphoproliferative syndrome, X-linked, type 1 | NM_002351.4 | NM_002351.4:c.3G>T, NM_002351.4:c.95G>C, NM_002351.4:c.163C>T, NM_002351.4:c.164G>T, NM_002351.4:c.172C>T, NM_002351.4:c.203C>T, NM_002351.4:c.302C>T | X-linked lymphoproliferative disease type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the SH2D1A gene located on chromosomal region Xq25. The age of onset is infantile. This disease is characterized by an inadequate immune response to infection with the Epstein-Barr virus: fulminant infectious mononucleosis, macrophage-activation syndrome or hemophagocytic lymphohistiocytosis (HLH) (see these terms), and/or progressive hypogammaglobulinemia and/or lymphomas. The prevalence is 1:1, 000,000 men. | 600 |
| SH3TC2 | Charcot-Marie-Tooth disease, type 4C | NM_024577.3 | NM_024577.3:c.3676-1G>A, NM_024577.3:c.3601C>T, NM_024577.3:c.3341delC, NM_024577.3:c.3326G>C, NM_024577.3:c.3325C>T, NM_024577.3:c.2993_2994insC, NM_024577.3:c.2860C>T, NM_024577.3:c.2829T>G, NM_024577.3:c.2710C>T, NM_024577.3:c.2491_2492delAG, NM_024577.3:c.2191delG, NM_024577.3:c.1982T>C, NM_024577.3:c.1972C>T, NM_024577.3:c.1969G>A, NM_024577.3:c.1747_1748delAG, NM_024577.3:c.1724T>A, NM_024577.3:c.1586G>A, NM_024577.3:c.920G>A, NM_024577.3:c.735G>A, NM_024577.3:c.530-2A>G, NM_024577.3:c.217_227delGCTGCTCGGAGinsCCAGTAA, NM_024577.3:c.53-1G>C, NM_024577.3:c.52+1delG, NM_024577.3:c.28delG | Charcot-Marie-Tooth disease, type 4C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SH3TC2 gene located on chromosomal region 5q32. The age of onset is infantile. This disease is characterized by scoliosis or kyphoscoliosis, neuropathy, foot deformities, respiratory insufficiency, hypoacousis and deafness. | 600,25 |
| SIL1 | Marinesco-Sjogren syndrome | NM_001037633.1 | NM_001037633.1:c.1312C>T, NM_001037633.1:c.331C>T | Marinesco-Sj�gren syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SIL1 gene located on chromosomal region 5q31.2. The age of onset is infantile. This disease is characterized by dysarthria, nystagmus, muscle weakness and hypotonia. The prevalence is <1:1,000,000. | 600 |
| SIX6 | Optic disc anomalies with retinal and/or macular dystrophy | NM_007374.2 | NM_007374.2:c.532_536delAACCG | Optic disc anomalies with retinal and/or macular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SIX6 gene located on chromosomal region 14q23.1. The age of onset is neonatal. This disease is characterized by optic nerve dysplasia, optic disk anomalies, chorioretinal dystrophy and macular atrophy. Some patients have microphthalmia. The prevalence is <1/1,000,000. | 600 |
| SLC12A1 | Bartter syndrome, type 1 | NM_000338.2 | NM_000338.2:c.223C>T, NM_000338.2:c.628+2T>C, NM_000338.2:c.814G>T, NM_000338.2:c.1875G>A, NM_000338.2:c.1942G>A, NM_000338.2:c.2805dupA, NM_000338.2:c.2952_2955delCAAA | Bartter syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A1 gene located on chromosomal region 15q15-21. The age of onset is infantile. This disease is characterized by polyhydramnios, premature delivery, polyuria, dehydration, hypercalciuria and nephrocalcinosis. The prevalence is 1:1,000,000. | 600,25 |
| SLC12A6 | Agenesis of the corpus callosum with peripheral neuropathy | NM_133647.1 | NM_133647.1:c.3031C>T, NM_133647.1:c.2023C>T, NM_133647.1:c.1584_1585delCTinsG, NM_133647.1:c.619C>T, NM_133647.1:c.366T>G, NM_133647.1:c.316+1G>A | Corpus callosum agenesis with neuronopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A6 gene located on chromosomal region 15q13-q14. The age of onset is early. This disease is characterized by a delay in developmental milestones, a severe sensory-motor polyneuropathy with areflexia, a variable degree of agenesis of the corpus callosum, amyotrophy, hypotonia, and cognitive impairment. The prevalence is 1:2,117. | 600 |
| SLC17A5 | Salla disease | NM_012434.4 | NM_012434.4:c.1259+1G>A, NM_012434.4:c.406A>G, NM_012434.4:c.115C>T, NM_012434.4:c.43G>T | Salla disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC17A5 gene located on chromosomal region 6q13. The age of onset is from infantile to adult forms. The main symptoms are hypotonia, cerebellar ataxia, and mental retardation; visceromegaly and coarse features are also present in the infantile cases. | 600,25 |
| SLC25A13 | Citrullinemia, adult-onset, type 2 | NM_001160210.1 | NM_001160210.1:c.1816C>T, NM_001160210.1:c.1804G>T, NM_001160210.1:c.1804G>A, NM_001160210.1:c.1802dupA, NM_001160210.1:c.1595G>A, NM_001160210.1:c.1414_1415delCT, NM_001160210.1:c.1314+1G>A, NM_001160210.1:c.1234-1G>A, NM_001160210.1:c.1180+1G>A, NM_001160210.1:c.1081C>T, NM_001160210.1:c.852_855delTATG, NM_001160210.1:c.674C>A, NM_001160210.1:c.615+5G>A, NM_001160210.1:c.615+1G>C | Citrullinemia, adult-onset, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A13 gene located on chromosomal region 7q21.3. This disease is characterized by hyperammonemia and associated neuropsychiatric symptoms such as nocturnal delirium, confusion, restlessness, disorientation, drowsiness, memory loss, abnormal behavior (aggression, irritability, and hyperactivity), seizures, and coma. The prevalence is 1:17,000-1:230,000. | 600 |
| SLC25A15 | Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome | NM_014252.3 | NM_014252.3:c.110T>G, NM_014252.3:c.212T>A, NM_014252.3:c.535C>T, NM_014252.3:c.538G>A, NM_014252.3:c.562_564delTTC, NM_014252.3:c.569G>A, NM_014252.3:c.658G>A, NM_014252.3:c.815C>T, NM_014252.3:c.824G>A | Hyperornithinemia-hyperammonemia-homocitrullinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A15 gene located on chromosomal region 13q14.11. The age of onset is early. This disease is characterized by coma due to hyperammonemia, convulsions, and hypotonia. The prevalence is 1:5,500. | 600 |
| SLC25A22 | Epileptic encephalopathy, early infantile, type 3 | NM_001191060.1 | NM_001191060.1:c.706G>T, NM_001191060.1:c.617C>T | Early infantile epileptic encephalopathy, type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC25A22 gene located on chromosomal region 11p15.5. The age of onset is early. This disease is characterized by the onset of tonic spasms within the first 3 months of life leading to psychomotor impairment and death. The prevalence is <1:1,000,000. | 600 |
| SLC26A2 | Achondrogenesis, type 1B (diastrophic dysplasia) | NM_000112.3 | NM_000112.3:c.496G>A, NM_000112.3:c.532C>T, NM_000112.3:c.833delC, NM_000112.3:c.835C>T, NM_000112.3:c.1020_1022delTGT, NM_000112.3:c.1273A>G, NM_000112.3:c.1361A>C, NM_000112.3:c.1535C>A, NM_000112.3:c.1724delA, NM_000112.3:c.1878delG, NM_000112.3:c.1957T>A, NM_000112.3:c.2033G>T | Achondrogenesis type 1B (diastrophic dysplasia) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by severe micromelia with very short fingers and toes, a flat face, a short neck, thickened soft tissue around the neck, hypoplasia of the thorax, protuberant abdomen, a hydropic fetal appearance and distinctive histological features of the cartilage. The prevalence is 1:20,000. | 600,25 |
| SLC26A4 | Deafness, autosomal recessive, type 4 | NM_000441.1 | NM_000441.1:c.269C>T, NM_000441.1:c.281C>T, NM_000441.1:c.412G>T, NM_000441.1:c.554G>C, NM_000441.1:c.563T>C, NM_000441.1:c.626G>T, NM_000441.1:c.707T>C, NM_000441.1:c.916dupG, NM_000441.1:c.918+2T>C, NM_000441.1:c.919-2A>G, NM_000441.1:c.961A>T, NM_000441.1:c.1001G>T, NM_000441.1:c.1001+1G>T, NM_000441.1:c.1003T>C, NM_000441.1:c.1034T>A, NM_000441.1:c.1151A>G, NM_000441.1:c.1174A>T, NM_000441.1:c.1198delT, NM_000441.1:c.1226G>A, NM_000441.1:c.1229C>T, NM_000441.1:c.1246A>C, NM_000441.1:c.1263+1G>A, NM_000441.1:c.1334T>G, NM_000441.1:c.1489G>A, NM_000441.1:c.1707+5G>A, NM_000441.1:c.1975G>C, NM_000441.1:c.2048T>C, NM_000441.1:c.2162C>T, NM_000441.1:c.2168A>G | Autosomal recessive nonsyndromic sensorineural deafness type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 600,25 |
| SLC35A1 | Congenital disorder of glycosylation, type 2f | NM_006416.4 | NM_006416.4:c.277_280delGTGCinsTG | Congenital disorder of glycosylation type 2F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35A1 gene located on chromosomal region 6q15. The age of onset is early. This disease is characterized by repeated hemorrhagic incidents, including severe pulmonary hemorrhage. | 600 |
| SLC35C1 | Congenital disorder of glycosylation, type 2c | NM_018389.4 | NM_018389.4:c.91G>T, NM_018389.4:c.290dupG, NM_018389.4:c.439C>T, NM_018389.4:c.503_505delTCT, NM_018389.4:c.923C>G | Congenital disorder of glycosylation type 2c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35C1 gene located on chromosomal region 11p11.2. The age of onset is infantile. This disease is characterized by recurrent bacterial infections, severe growth delay and severe intellectual deficit. | 600 |
| SLC35D1 | Schneckenbecken dysplasia | NM_015139.2 | NM_015139.2:c.932G>A, NM_015139.2:c.319C>T | Schneckenbecken dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC35D1 gene located on chromosomal region 1p31.3. The age of onset is fetal. This disease is characterized by nail-like configuration of the hypoplastic iliac bone, flattened hypoplastic vertebral bodies, short ribs, short and wide fibulae, short and broad long bones with a dumbbell-like appearance, and precocious ossification of the tarsus. | 600 |
| SLC37A4 | Glycogen storage disease, type 1b | NM_001164278.1 | NM_001164278.1:c.1309C>T, NM_001164278.1:c.1190-2_1190-1delAG, NM_001164278.1:c.1129G>T, NM_001164278.1:c.1108_1109delCT, NM_001164278.1:c.1082G>A, NM_001164278.1:c.1081G>T, NM_001164278.1:c.706_708delGTG, NM_001164278.1:c.352T>C, NM_001164278.1:c.287G>A, NM_001164278.1:c.83G>A | Glycogen storage disease due to glucose-6-phosphatase deficiency type 1b follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC37A4 gene located on chromosomal region 11q23. The age of onset is early. This disease is characterized by impairment of terminal steps of glycogenolysis and gluconeogenesis. Patients manifest a wide range of clinical symptoms and biochemical abnormalities, including hypoglycemia, severe hepatomegaly due to excessive accumulation of glycogen, kidney enlargement, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. Glycogen storage disease type 1B patients also present a tendency towards infections associated with neutropenia, relapsing aphthous gingivostomatitis, and inflammatory bowel disease. The incidence is 1:100,000. | 600,25 |
| SLC45A2 | Albinism, oculocutaneous, type 4 | NM_016180.4 | NM_016180.4:c.1121delT, NM_016180.4:c.986delC, NM_016180.4:c.469G>A | Oculocutaneous albinism type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC45A2 gene located on chromosomal region 5p13.2. The age of onset is early. This disease is characterized by skin and hair hypopigmentation, numerous ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1:100.000. | 600 |
| SLC4A11 | Corneal endothelial dystrophy, autosomal recessive | NM_001174090.1 | NM_001174090.1:c.2687G>A, NM_001174090.1:c.2686C>T, NM_001174090.1:c.2647A>G, NM_001174090.1:c.2609T>C, NM_001174090.1:c.2345G>A, NM_001174090.1:c.2314_2321dupTATGACAC, NM_001174090.1:c.2305G>A, NM_001174090.1:c.1894C>T, NM_001174090.1:c.1547C>T, NM_001174090.1:c.1544G>A, NM_001174090.1:c.1472G>A, NM_001174090.1:c.1119_1120insA, NM_001174090.1:c.718T>C, NM_001174090.1:c.554_561delGCTTCGCC | Congenital hereditary endothelial dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by a diffuse ground-glass appearance of the corneas and marked corneal thickening from birth with nystagmus, and blurred vision. | 600,25 |
| SLC6A8 | Cerebral creatine deficiency syndrome, type 1 | NM_005629.3 | NM_005629.3:c.321_323delCTT, NM_005629.3:c.395G>T, NM_005629.3:c.1011C>G, NM_005629.3:c.1141G>C, NM_005629.3:c.1222_1224delTTC, NM_005629.3:c.1540C>T | Cerebral creatine deficiency syndrome type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the SLC6A8 gene located on chromosomal region Xq28. The age of onset is infantile. People with this disorder have intellectual disability, which can range from mild to severe, and delayed speech development. Some affected individuals develop behavioral disorders such as attention deficit hyperactivity disorder or autistic behaviors that affect communication and social interaction. They may also experience seizures. The disorder has been estimated to account for between 1 and 2 percent of males with intellectual disability. Carrier females may show mild neuropsychologic impairment (summary by van de Kamp et al., 2011). The prevalence is 11:1,000. | 600 |
| SMN1 | Spinal muscular atrophy | -0 | del ex7, del ex7-8 | Spinal muscular atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMN1 gene located on chromosomal region 5q13.2. The age of onset is variable. This disease comprise a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. Autosomal recessive forms are classified according to the age of onset, the maximum muscular activity achieved, and survivorship. The severity of the disease is mainly determined by the copy number of SMN2, a copy gene which predominantly produces exon 7-skipped transcripts and only low amount of full-length transcripts that encode for a protein identical to SMN1. Only about 4% of patients bear one SMN1 copy with an intragenic mutation. Type 1 is a severe form, with onset before 6 months of age. Patients never achieve the ability to sit. Type 2 has intermediate severity, with onset between 6 and 18 months. Patients do not reach the motor milestone of standing, and survive into adulthood. Type 3 onset is after 18 months. Patients develop ability to stand and walk and survive into adulthood. Type 4 onset is in adulthood, disease progression is slow, and patients can stand and walk. The incidence is 1:10,000 and the prevalence is 1:80,000. | 600,25 |
| SMPD1 | Niemann-Pick disease, type A and type B | NM_000543.4 | NM_000543.4:c.96G>A, NM_000543.4:c.103_107delCTGGT, NM_000543.4:c.106delG, NM_000543.4:c.354delC, NM_000543.4:c.475T>C, NM_000543.4:c.557C>T, NM_000543.4:c.564delC, NM_000543.4:c.564dupC, NM_000543.4:c.573delT, NM_000543.4:c.688C>T, NM_000543.4:c.730G>A, NM_000543.4:c.740delG, NM_000543.4:c.739G>A, NM_000543.4:c.742G>A, NM_000543.4:c.757G>C, NM_000543.4:c.788T>A, NM_000543.4:c.842_849dupTCCCCGCA, NM_000543.4:c.911T>C, NM_000543.4:c.996delC, NM_000543.4:c.1092-1G>C, NM_000543.4:c.1117C>T, NM_000543.4:c.1152G>A, NM_000543.4:c.1264-1G>T, NM_000543.4:c.1267C>T, NM_000543.4:c.1299T>G, NM_000543.4:c.1327C>T, NM_000543.4:c.1420_1421delCT, NM_000543.4:c.1426C>T, NM_000543.4:c.1624C>T, NM_000543.4:c.1630delA, NM_000543.4:c.1805G>A, NM_000543.4:c.1829_1831delGCC | Niemann-Pick disease, type A and type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMPD1 gene located on chromosomal region 11p15.4. The clinical phenotype ranges from a severe infantile form with neurologic degeneration resulting in death usually by 3 years of age (type A) to a later-onset nonneurologic form (type B) that is compatible with survival into adulthood. Since intermediate cases also have been reported, the disease is best regarded a single entity with a clinical spectrum. | 600,25 |
| SNAP29 | Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome | NM_004782.3 | NM_004782.3:c.487dupA | Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SNAP29 gene located on chromosomal region 22q11.2. The age of onset is early. This disease is characterized by severe developmental abnormalities of the nervous system and aberrant differentiation of the epidermis. The prevalence is <1:1,000,000. | 600 |
| SPART | Spactic paraplegia, type 20, autosomal recessive | NM_001142294.1 | NM_001142294.1:c.1110delA, NM_001142294.1:c.364_365delAT | Spactic paraplegia, type 20 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPART gene located on chromosomal region 13q13.3. The age of onset is infancy. This disease is characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. SPG20 is characterized by dysarthria, distal amyotrophy, mild developmental delay and short stature. The prevalence is <1/1,000,000. | 600 |
| SPG11 | Amyotrophic lateral sclerosis, type 5, juvenile | NM_025137.3 | NM_025137.3:c.7152-1G>C, NM_025137.3:c.6847_6848dupTC, NM_025137.3:c.6805_6806delCT, NM_025137.3:c.6100C>T, NM_025137.3:c.5623C>T, NM_025137.3:c.1736-1G>C, NM_025137.3:c.1339_1342dupGGCT, NM_025137.3:c.733_734delAT, NM_025137.3:c.529_533delATATT, NM_025137.3:c.342delT, NM_025137.3:c.118C>T | Amyotrophic lateral sclerosis, type 5, juvenile follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG11 gene located on chromosomal region 15q21.1. The age of onset is infancy/childhood. This disease is characterized by progressive upper and lower motor neuron degeneration causing facial spasticity, dysarthria, and gait disorders with onset before 25 years of age. The prevalence is <1/1,000,000. | 600,25 |
| SPG7 | Spastic paraplegia, type 7, autosomal recessive | NM_003119.3 | NM_003119.3:c.233T>A, NM_003119.3:c.286+1G>T, NM_003119.3:c.679C>T, NM_003119.3:c.758+2T>C, NM_003119.3:c.773_774delTG, NM_003119.3:c.1045G>A, NM_003119.3:c.1124delG, NM_003119.3:c.1529C>T, NM_003119.3:c.1676delA, NM_003119.3:c.1749G>C, NM_003119.3:c.2075G>C | Spastic paraplegia type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG7 gene located on chromosomal region 16q24.3. The age of onset is adult. This disease is characterized by by progressive muscle stiffness (spasticity) and the development of paralysis of the lower limbs (paraplegia) due to degeneration of corticospinal axons. The prevalence is 1:100,000-9:100,000. | 600,25 |
| STAR | Lipoid adrenal hyperplasia | NM_000349.2 | NM_000349.2:c.772C>T, NM_000349.2:c.749G>A, NM_000349.2:c.577C>T, NM_000349.2:c.562C>T, NM_000349.2:c.559G>A, NM_000349.2:c.545G>T, NM_000349.2:c.545G>A | Lipoid adrenal hyperplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STAR gene located on chromosomal region 8p11.23. The age of onset is neonatal/infancy. This disease is characterized by a defect in the conversion of cholesterol to pregnenolone, the first step in adrenal and gonadal steroidogenesis. All affected individuals are phenotypic females with a severe salt-losing syndrome that is fatal if not treated in early infancy. The prevalence is unknown. | 600 |
| STIL | Microcephaly, type 7, primary, autosomal recessive | NM_001048166.1 | NM_001048166.1:c.3846_3849delACAG, NM_001048166.1:c.3718C>T, NM_001048166.1:c.3658delG, NM_001048166.1:c.2829+1G>A | Microcephaly, type 7, primary, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STIL gene located on chromosomal region 1p33. The age of onset is prenatal/neonatal. This disease is characterized by a head circumference more than 3 standard deviations below the age-related mean. Brain weight is markedly reduced and the cerebral cortex is disproportionately small. Despite this marked reduction in size, the gyral pattern is relatively well preserved, with no major abnormality in cortical architecture. Affected individuals are mentally retarded. Primary microcephaly is further defined by the absence of other syndromic features or significant neurological deficits due to degenerative brain disorder. The prevalence is unknown. | 600 |
| STRA6 | Microphthalmia, isolated, with coloboma, type 8 | NM_001199042.1 | NM_001199042.1:c.2081G>A, NM_001199042.1:c.2080C>T, NM_001199042.1:c.2048C>T, NM_001199042.1:c.1816C>T, NM_001199042.1:c.1795G>C, NM_001199042.1:c.1638-1G>A, NM_001199042.1:c.1027_1028delGGinsAA, NM_001199042.1:c.995C>T, NM_001199042.1:c.644dupG, NM_001199042.1:c.394_395insCC, NM_001199042.1:c.264delC, NM_001199042.1:c.186G>A, NM_001199042.1:c.169_170delTAinsC | Microphthalmia, isolated, with coloboma, type 8 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRA6 gene located on chromosomal region 15q24.1. This disease is characterized by bilateral clinical anophthalmia, pulmonary hypoplasia/aplasia, cardiac malformations, and diaphragmatic defects. The phenotype is variable, ranging from isolated clinical anophthalmia or microphthalmia to complex presentations involving the cardiac, pulmonary, diaphragmatic, and renal systems. At its most severe, infants are born without pulmonary structures and die soon after birth. | 600 |
| STRC | Deafness, autosomal recessive, type 16 | NM_153700.2 | NM_153700.2:c.5188C>T, NM_153700.2:c.5185C>T, NM_153700.2:c.5168_5171delTTCT, NM_153700.2:c.4560dupC, NM_153700.2:c.4545+1G>C, NM_153700.2:c.3556C>T | Autosomal recessive nonsyndromic sensorineural deafness type DFNB16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRC gene located on chromosomal region 15q15.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 600,25 |
| SUCLG1 | Mitochondrial DNA depletion syndrome, type 9 (encephalomyopathic, type with methylmalonic aciduria) | NM_003849.3 | NM_003849.3:c.152_153delAT | Mitochondrial DNA depletion syndrome, type 9 (encephalomyopathic, type with methylmalonic aciduria) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SUCLG1 gene located on chromosomal region 2p11.2. The age of onset is early. This disease is characterized by polypnea, severe hypotonia, lethargy, and vomiting, after a silent period during which the children were considered as normal. Facial dysmorphism and cerebral malformations may be noted, as well as diverse organ involvement such as hypertrophic myocardiopathy, tubulopathy, or liver insufficiency. | 600 |
| SUOX | Sulfite oxidase deficiency | NM_000456.2 | NM_000456.2:c.37C>T, NM_000456.2:c.650G>A, NM_000456.2:c.794C>A, NM_000456.2:c.894_895delCT | Sulfocysteinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SUOX gene located on chromosome 12q13.13. The age of onset is early. This disease is characterized by seizures, reduced muscle tone, psychomotor retardation, lens dislocation. | 600 |
| TAT | Tyrosinemia, type 2 | NM_000353.2 | NM_000353.2:c.1297C>T, NM_000353.2:c.1249C>T, NM_000353.2:c.668C>G, NM_000353.2:c.236-5A>G, NM_000353.2:c.169C>T | Tyrosinemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TAT gene located on chromosomal region 16q22.1. The age of onset is early. This disease is characterized by hypertyrosinemia with oculocutaneous manifestations and, in some cases, intellectual deficit. The prevalence is 1:100,000-1:120,000 newborn. | 600 |
| TCAP | Muscular dystrophy, limb-girdle, type 2G | NM_003673.3 | NM_003673.3:c.157C>T | Autosomal recessive limb-girdle muscular dystrophy type 2G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by muscle weakness in the four limbs, mild scapular winging, severe atrophy of the quadriceps and anterior tibialis muscles, calf hypertrophy, and lack of respiratory and cardiac involvement. | 600,25 |
| TCIRG1 | Osteopetrosis, autosomal recessive, type 1 | NM_006019.3 | NM_006019.3:c.115_116delGA, NM_006019.3:c.1213G>A, NM_006019.3:c.1331G>T, NM_006019.3:c.1674-1G>A, NM_006019.3:c.2236+1G>A | Autosomal recessive osteopetrosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCIRG1 gene located on chromosomal region 11q13.2. The age of onset is early. This disease is characterized by bone marrow failure, fractures and visual impairment. The incidence is 1:200.000 live births and the prevalence is 1:250,000. | 600,25 |
| TECTA | Deafness, autosomal recessive, type 21 | NM_005422.2 | NM_005422.2:c.651dupC, NM_005422.2:c.2428C>T, NM_005422.2:c.2941+1G>A, NM_005422.2:c.4371_4384dupTCAGTGCGACCCGC, NM_005422.2:c.4601G>A | Autosomal recessive nonsyndromic sensorineural deafness type DFNB21 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TECTA gene located on chromosomal region 11q23.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| TERT | Dyskeratosis congenita, autosomal recessive, type 4 | NM_198253.2 | NM_198253.2:c.2701C>T, NM_198253.2:c.2431C>T | Dyskeratosis congenita, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TERT gene located on chromosomal region 5p15.33. The age of onset is early. This disease has a wide phenotypic spectrum and age onset. It usually manifests during childhood with the triad of dysplastic nails, lacy reticular pigmentation and atrophy of the skin at the level of the neck and upper chest, and oral leukoplakia. Patients show an increased risk for progressive bone marrow failure and may develop myelodysplastic syndrome or acute myelogenous leukemia at any age (the risk increasing with age). There is also an increased risk for solid tumors, typically squamous cell carcinoma of head and neck (see this term) or anogenital cancer. Various additional clinical findings have been reported and may include: developmental delay, short stature, microcephaly, blepharitis, epiphora, periodontal disease, taurodontism, decreased teeth/root ratio, esophageal stenosis, liver disease, urethral stenosis, osteoporosis, avascular necrosis of femur and/or humerus, premature hair greying/alopecia, or abnormal eyelashes. Individuals with DC are at high risk of pulmonary fibrosis. The prevalence is 1:1,000,000. | 600,25 |
| TFR2 | Hemochromatosis, type 3 | NM_001206855.1 | NM_001206855.1:c.2T>A | Hemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000. | 600,25 |
| TFR2 | Hemochromatosis, type 3 | NM_003227.3 | NM_003227.3:c.2374G>A, NM_003227.3:c.2343G>A, NM_003227.3:c.2014C>T, NM_003227.3:c.1861_1872delGCCGTGGCCCAG, NM_003227.3:c.1665delC, NM_003227.3:c.1632_1633delGA, NM_003227.3:c.1473+1G>A, NM_003227.3:c.1469T>G, NM_003227.3:c.1330G>A, NM_003227.3:c.1235_1237delACA, NM_003227.3:c.1186C>T, NM_003227.3:c.949C>T, NM_003227.3:c.750C>G, NM_003227.3:c.313C>T | Hemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000. | 600,25 |
| TH | Segawa syndrome, recessive | NM_199292.2 | NM_199292.2:c.1481C>T, NM_199292.2:c.1234C>A, NM_199292.2:c.826A>C, NM_199292.2:c.707T>C, NM_199292.2:c.698G>A | Segawa syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TH gene located on chromosomal region 11p15.5. This disease is characterized by dystonia presenting in infancy or early childhood. Dystonia is defined by the presence of sustained involuntary muscle contractions, often leading to abnormal postures. Some cases present with parkinsonian symptoms in infancy. Unlike all other forms of dystonia, it is an eminently treatable condition, due to a favorable response to L-DOPA. The prevalence is 1:1,000,000-9:1,000,000. | 600 |
| TIMM8A | Mohr-Tranebjaerg syndrome | NM_004085.3 | NM_004085.3:c.238C>T, NM_004085.3:c.198C>G, NM_004085.3:c.112C>T | Mohr-Tranebjaerg syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the TIMM8A gene located on chromosomal region Xq22. The age of onset is infantile. This disease is characterized by hearing loss, followed by adolescent onset progressive dystonia or ataxia, visual impairment from early adulthood onwards and dementia from the 4th decade onwards. The prevalence is <1:1,000,000. | 600 |
| TK2 | Mitochondrial DNA depletion syndrome , type 2 (myopathic type) | NM_004614.4 | NM_004614.4:c.635T>A, NM_004614.4:c.604_606delAAG, NM_004614.4:c.500G>A, NM_004614.4:c.373C>T, NM_004614.4:c.361C>A, NM_004614.4:c.323C>T, NM_004614.4:c.268C>T, NM_004614.4:c.159C>G | Mitochondrial DNA depletion syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TK2 gene located on chromosomal region 16q21. The age of onset is infantile. This disease is characterized by generalized hypotonia, proximal muscle weakness, loss of previously acquired motor skills, poor feeding, and respiratory difficulties leading to respiratory failure and death within a few years after diagnosis. The prevalence is 1.2:100,000. | 600,25 |
| TMC1 | Deafness, autosomal recessive, type 7 | NM_138691.2 | NM_138691.2:c.100C>T, NM_138691.2:c.425G>A, NM_138691.2:c.454-1G>C, NM_138691.2:c.1165C>T, NM_138691.2:c.1763+3A>G, NM_138691.2:c.1842G>A, NM_138691.2:c.1960A>G | Autosomal recessive nonsyndromic sensorineural deafness type DFNB7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMC1 gene located on chromosomal region 9q21.13. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 600 |
| TMEM216 | Joubert syndrome, type 2; Meckel syndrome, type 2 | NM_001173991.2 | NM_001173991.2:c.79_82delAACG, NM_001173991.2:c.218G>A, NM_001173991.2:c.218G>T, NM_001173991.2:c.230G>C, NM_001173991.2:c.253C>T, NM_001173991.2:c.341T>G | Joubert syndrome (JBTS) type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM216 gene located on chromosomal region 11q12.2. The age of onset is early. JBTS is characterized by congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. The TMEM216 gene is also associated with other ciliopathies, as Meckel syndrome type 2, a rare, autosomal recessive lethal condition characterized by central nervous system malformations, postaxial, polydactyly, multicystic kidney dysplasia, and ductal proliferation in the portal area of the liver. | 600 |
| TMEM67 | Joubert syndrome, type 6; Meckel syndrome, type 3; COACH syndrome | NM_153704.5 | NM_153704.5:c.130C>T, NM_153704.5:c.148_149insTAAT, NM_153704.5:c.622A>T, NM_153704.5:c.755T>C, NM_153704.5:c.1046T>C, NM_153704.5:c.1538A>G, NM_153704.5:c.1769T>C, NM_153704.5:c.2498T>C | Joubert syndrome (JBTS) type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22.1. The age of onset is early. JBTS is characterized by congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. The TMEM67 gene is also associated with Meckel syndrome type 3, a rare, autosomal recessive lethal condition characterized by central nervous system malformations, postaxial, polydactyly, multicystic kidney dysplasia, and ductal proliferation in the portal area of the liver. Other phenotype associated with mutations in the TMEM67 gene is COACH syndrome, an autosomal recessive disorder characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable. COACH syndrome is considered by some to be a subtype of Joubert syndrome with congenital hepatic fibrosis. | 600,25 |
| TMIE | Deafness, autosomal recessive, type 6 | NM_147196.2 | NM_147196.2:c.170G>A, NM_147196.2:c.241C>T, NM_147196.2:c.250C>T | Autosomal recessive nonsyndromic sensorineural deafness type DFNB6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMIE gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness. | 600 |
| TMPRSS3 | Deafness, autosomal recessive, type 8/10 | NM_024022.2 | NM_024022.2:c.1276G>A, NM_024022.2:c.1211C>T, NM_024022.2:c.753G>C, NM_024022.2:c.647G>T, NM_024022.2:c.446+1G>T, NM_024022.2:c.413C>A, NM_024022.2:c.242C>G, NM_024022.2:c.208delC | Autosomal recessive nonsyndromic sensorineural deafness type DFNB10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMPRSS3 gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness. | 600,25 |
| TNNT1 | Nemaline myopathy , type 5, Amish type | NM_003283.5 | NM_003283.5:c.538G>T | Nemaline myopathy 5, Amish type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TNNT1 gene located on chromosomal region 19q13.4. The age of onset is from birth to adulthood. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:50,000 newborn. | 600 |
| TPP1 | Ceroid lipofuscinosis, neuronal, type 2 | NM_000391.3 | NM_000391.3:c.1340G>A, NM_000391.3:c.1093T>C, NM_000391.3:c.851G>T, NM_000391.3:c.827A>T, NM_000391.3:c.622C>T, NM_000391.3:c.616C>T, NM_000391.3:c.509-1G>C, NM_000391.3:c.141_144delGAGT | Neuronal ceroid lipofuscinosis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPP1 gene located on chromosomal region 11p15.4. Age of onset is infantile. This disease is characterized by epilepsy, followed by regression of developmental milestones, myoclonic ataxia, and pyramidal signs. Visual impairment typically appears at age four to six years and rapidly progresses to light/dark awareness only. Life expectancy ranges from age six years to early teenage. The prevalence is 1.5:1,000,000-9:1,000,000. | 600,25 |
| TPRN | Deafness, autosomal recessive, type 79 | NM_001128228.2 | NM_001128228.2:c.1427delC, NM_001128228.2:c.1239G>A | Autosomal recessive nonsyndromic sensorineural deafness type DFNB79 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPRN gene located on chromosomal region 9q34.3. The age of onset is early. This disease is characterized by hearing loss and deafness. | 600 |
| TREX1 | Aicardi-Goutieres syndrome, type 1 | NM_016381.5 | NM_016381.5:c.309dupC, NM_016381.5:c.506G>A, NM_016381.5:c.655C>T | Aicardi-Gouti�res syndrome 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TREX1 gene located on chromosomal region 3p21.31. The age of onset is early. This disease is characterized by subacute encephalopathy (feeding problems, irritability and psychomotor regression or delay) associated with epilepsy (53% of cases), chilblain skin lesions on the extremities (43% of cases) and episodes of aseptic febrile illness (40% of cases). The prevalence is <1:1,000,000. | 600 |
| TRIM32 | Muscular dystrophy, limb-girdle, type 2H | NM_001099679.1 | NM_001099679.1:c.1459G>A, NM_001099679.1:c.1560delC | Autosomal recessive limb-girdle muscular dystrophy type 2H follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIM32 gene located on chromosomal region 9q31-q33. The age of onset is variable. This disease is characterized by proximal muscle weakness and facial muscle wasting. | 600 |
| TRIM37 | Mulibrey nanism | NM_001005207.3 | NM_001005207.3:c.2212delG, NM_001005207.3:c.2056C>T, NM_001005207.3:c.1668-1G>C, NM_001005207.3:c.1478_1479delAG, NM_001005207.3:c.1411C>T, NM_001005207.3:c.1346dupA, NM_001005207.3:c.1037_1040dupAGAT, NM_001005207.3:c.965G>T, NM_001005207.3:c.745C>T, NM_001005207.3:c.496_500delAGGAA, NM_001005207.3:c.326G>C, NM_001005207.3:c.227T>C | Mulibrey nanism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIM37 gene located on chromosomal region 17q22. The age of onset is prenatal. This disease is characterized by pre- and postnatal growth restriction, characteristic craniofacial features with scaphocephaly, triangular face, high and broad forehead, low nasal bridge and yellowish dots in retinal mid peripheral region. The prevalence is <1:1,000,000. | 600 |
| TRIOBP | Deafness, autosomal recessive, type 28 | NM_001039141.2 | NM_001039141.2:c.1039C>T, NM_001039141.2:c.1741C>T, NM_001039141.2:c.2362C>T, NM_001039141.2:c.2639_2640insTCAC, NM_001039141.2:c.3195delT, NM_001039141.2:c.3202C>T, NM_001039141.2:c.4436dupG, NM_001039141.2:c.4577C>G, NM_001039141.2:c.5316G>A | Deafness autosomal recessive type 28 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIOBP gene located on chromosomal region 22q13.1. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 600,25 |
| TSEN54 | Pontocerebellar hypoplasia, type 2A | NM_207346.2 | NM_207346.2:c.670_671delAA, NM_207346.2:c.736C>T, NM_207346.2:c.887G>A, NM_207346.2:c.919G>T, NM_207346.2:c.1027C>T, NM_207346.2:c.1039A>T | Pontocerebellar hypoplasia type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSEN54 gene located on chromosomal region 17q25.1. Pontocerebellar hypoplasia (PCH) refers to a group of severe neurodegenerative disorders affecting growth and function of the brainstem and cerebellum, resulting in little or no development. Different types were classified based on the clinical picture and the spectrum of pathologic changes.ᅠ | 600,25 |
| TSFM | Combined oxidative phosphorylation deficiency, type 3 | NM_001172696.1 | NM_001172696.1:c.1_2delAT, NM_001172696.1:c.24_25delCG, NM_001172696.1:c.581delC, NM_001172696.1:c.919C>T | Combined oxidative phosphorylation deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSFM gene located on chromosomal region 12q14.1. The age of onset is early. This disease is characterized by hypotonia, lactic acidosis, and hepatic insufficiency, with progressive encephalomyopathy or hypertrophic cardiomyopathy. | 600,25 |
| TSHB | Hypothyroidism, congenital, nongoitrous, type 4 | NM_000549.4 | NM_000549.4:c.94G>T, NM_000549.4:c.145G>A, NM_000549.4:c.205C>T | Hypothyroidism, congenital, nongoitrous 4, also known as isolated thyroid-stimulating hormone (TSH) deficiency is a type of central congenital hypothyroidism, a permanent thyroid deficiency that is present from birth, characterized by low levels of thyroid hormones due to a deficiency in TSH synthesis. | 600 |
| TSHR | Hypothyroidism, congenital, nongoitrous, type 1 | NM_000369.2 | NM_000369.2:c.122G>C, NM_000369.2:c.202C>T, NM_000369.2:c.326G>A, NM_000369.2:c.484C>G, NM_000369.2:c.500T>A, NM_000369.2:c.1170T>G, NM_000369.2:c.1742dupC | Hypothyroidism, congenital, nongoitrous, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSHR gene located on chromosomal region 14q31.1. This disease is characterized by increased levels of plasma TSH and low levels of thyroid hormone. Only a subset of patients develop frank hypothyroidism; the remainder are euthyroid and asymptomatic. | 600,25 |
| TTN | Limb-girdle muscular dystrophy type 10 (LGMDR10; formerly LGMD2J); Early-onset myopathy with fatal cardiomyopathy | NM_001267550.2 | NM_001267550.2:c.107889delA, NM_001267550.2:c.106070_106071delAT, NM_001267550.2:c.104092delC, NM_001267550.2:c.104092C>T, NM_001267550.2:c.98818_98821delTCCA, NM_001267550.2:c.92373_92379delTGAATTC, NM_001267550.2:c.69344C>G, NM_001267550.2:c.60681dupT, NM_001267550.2:c.56648-1G>A, NM_001267550.2:c.52372delG, NM_001267550.2:c.48253delA, NM_001267550.2:c.47915dupT, NM_001267550.2:c.32471-1G>A, NM_001267550.2:c.28300_28303delAGCA, NM_001267550.2:c.16881C>A, NM_001267550.2:c.15796C>T, NM_001267550.2:c.3165-1G>T | LGMDR10 is a severe recessive form of LGMD phenotype with onset in the first to third decades involving weakness of all proximal muscles. Severe disability with loss of ambulation may occur within 20 years (third to sixth decades). Most of the cases are without facial muscle involvement or cardiomyopathy. Some patients later developed distal muscle involvement. Early-onset myopathy with fatal cardiomyopathy (EOMFC), known as Salih myopathy, also follows an autosomal recessive pattern of inheritance. This disease is characterized by skeletal muscle weakness and a form of heart disease called dilated cardiomyopathy. Affected individuals have delayed development of motor skills, such as sitting, standing, and walking. The age of onset is neonatal/infancy. LGMDR10 and EOMFC are caused by pathogenic variants in the TTN gene located on chromosomal region 2q31.2. | 600,25 |
| TTPA | Ataxia with isolated vitamin E deficiency | NM_000370.3 | NM_000370.3:c.744delA, NM_000370.3:c.661C>T, NM_000370.3:c.575G>A | Ataxia with vitamin E deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTPA gene located on chromosomal region 8q13. The age of onset is variable. This disease is characterized by progressive spino-cerebellar ataxia, loss of proprioception, areflexia, and is associated with a marked deficiency in vitamin E. The prevalence is 0.56:1,000,000-3.5:1,000,000. | 600,25 |
| TULP1 | Leber congenital amaurosis, type 15 | NM_003322.4 | NM_003322.4:c.1511_1521delTGCAGTTCGGC, NM_003322.4:c.1471T>C, NM_003322.4:c.1444C>T, NM_003322.4:c.1376T>A, NM_003322.4:c.1318C>T, NM_003322.4:c.1259G>C, NM_003322.4:c.1204G>T, NM_003322.4:c.1198C>T | Leber congenital amaurosis 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TULP1 gene located on chromosomal region 6p21.31. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. | 600 |
| TWNK | Mitochondrial DNA depletion syndrome, type 7 (hepatocerebral type); Perrault syndrome type 5 | NM_021830.4 | NM_021830.4:c.526dupG, NM_021830.4:c.952G>A, NM_021830.4:c.955A>G, NM_021830.4:c.1287C>T, NM_021830.4:c.1370C>T, NM_021830.4:c.1523A>G | Mitochondrial DNA depletion syndrome, hepatocerebrorenal form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TWNK gene located on chromosomal region 10q24. The age of onset is neonatal/infantile. It is a severe disease associated with mitochondrial dysfunction. Some patients are affected by progressive atrophy of the cerebellum, brain stem, the spinal cord, and sensory axonal neuropathy. Clinical features include hypotonia, athetosis, ataxia, ophthalmoplegia, sensorineural hearing deficit, sensory axonal neuropathy, epileptic encephalopathy and female hypogonadism. In some individuals liver dysfunction and multi-organ failure is present. On the other hand, Perrault syndrome is a rare condition that causes different patterns of signs and symptoms in affected males and females. A key feature of this condition is hearing loss, which occurs in both males and females. Affected females also have abnormalities of the ovaries. Neurological problems occur in some affected males and females. | 600 |
| TYR | Albinism, oculocutaneous, type 1A | NM_000372.4 | NM_000372.4:c.1A>G, NM_000372.4:c.140G>A, NM_000372.4:c.164G>A, NM_000372.4:c.230G>A, NM_000372.4:c.242C>T, NM_000372.4:c.265T>C, NM_000372.4:c.272G>A, NM_000372.4:c.286dupA, NM_000372.4:c.325G>A, NM_000372.4:c.533G>A, NM_000372.4:c.572delG, NM_000372.4:c.616G>A, NM_000372.4:c.646T>A, NM_000372.4:c.650G>A, NM_000372.4:c.823G>T, NM_000372.4:c.896G>A, NM_000372.4:c.1012_1013insC, NM_000372.4:c.1111A>G, NM_000372.4:c.1118C>A, NM_000372.4:c.1146C>A, NM_000372.4:c.1147G>A, NM_000372.4:c.1164delT, NM_000372.4:c.1177delG, NM_000372.4:c.1209G>T, NM_000372.4:c.1217C>T, NM_000372.4:c.1255G>A, NM_000372.4:c.1265G>A, NM_000372.4:c.1336G>A, NM_000372.4:c.1342G>A, NM_000372.4:c.1467dupT, NM_000372.4:c.1501dupC | Oculocutaneous albinism type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYR gene located on chromosomal region 11q14.2. The age of onset is early. This disease is characterized by white hair and skin, blue, fully translucent irises, nystagmus and misrouting of the optic nerves. | 600,25 |
| TYRP1 | Albinism, oculocutaneous, type 3 | NM_000550.2 | NM_000550.2:c.107delT, NM_000550.2:c.176C>G, NM_000550.2:c.497C>G, NM_000550.2:c.1057_1060delAACA, NM_000550.2:c.1067G>A, NM_000550.2:c.1103delA, NM_000550.2:c.1120C>T, NM_000550.2:c.1372_1375dupGACA | Type 3 oculocutaneous albinism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYRP1 gene located on chromosomal region 9p23. The age of onset is early. This disease is characterized by rufous or brown albinism and occurring mainly in the African population. The prevalence is of 1/8,500 individuals in Africa. | 600,25 |
| UBR1 | Johanson-Blizzard syndrome | NM_174916.2 | NM_174916.2:c.4254G>A, NM_174916.2:c.1537C>T, NM_174916.2:c.1281+1G>T, NM_174916.2:c.869C>G | Johanson-Blizzard syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UBR1 gene located on chromosomal region 15q15.2. The age of onset is early. This disease is characterized by congenital exocrine pancreatic insufficiency and aplasia/hypoplasia of alae nasi, together with a variety of other abnormalities including aplasia cutis, anorectal anomalies and failure to thrive. The prevalence is <1:1,000,000. | 600 |
| UGT1A1 | Crigler-Najjar syndrome, type 2 | NM_000463.2 | NM_000463.2:c.44T>G, NM_000463.2:c.1021C>T, NM_000463.2:c.1070A>G, NM_000463.2:c.1456T>G | Crigler-Najjar syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by unconjugated hyperbilirubinemia due to reduced and inducible activity of hepatic bilirubin glucuronosyltransferase with pigmented bile that contains bilirubin glucuronides, and generally do not present neurologic or intellectual impairment. Bilirubin encephalopathy may develop in later life when patients experience a superimposed infection or stress. | 600,25 |
| UQCRQ | Mitochondrial complex III deficiency, nuclear, type 4 | NM_014402.4 | NM_014402.4:c.134C>T | Mitochondrial complex III deficiency, nuclear type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UQCRQ gene located on chromosomal region 5q31.1. The age of onset is infantile. This disease is characterized by severe psychomotor retardation and extrapyramidal signs. Neurologic features included dystonia, athetoid movements, ataxia, mild axial hypotonia, increased tone, hyperreflexia, and inability to walk unsupported. | 600 |
| USH1C | Usher syndrome, type 1C; Deafness, autosomal recessive, type 18A | NM_153676.3 | NM_153676.3:c.2688_2695dupAATTCACC, NM_153676.3:c.2622_2623delCA, NM_153676.3:c.2547-1G>T, NM_153676.3:c.238dupC, NM_153676.3:c.238delC, NM_153676.3:c.216G>A | Usher syndrome type 1C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1C gene located on chromosomal region 11p15.1. This disease is characterized by the association of sensorineural deafness (usually congenital, severe and stable), progressive vision loss caused by retinitis pigmentosa apparent in childhood and balance problems. The prevalence is 4.4:100,000. The USH1C gene is also associated with autosomal recessive nonsyndromic sensorineural deafness type 18A. This phenotype is characterized by profound, prelingual, nonsyndromic sensorineural deafness with normal vestibular and visual function. | 600,25 |
| USH1G | Usher syndrome, type 1G | NM_173477.4 | NM_173477.4:c.805C>T, NM_173477.4:c.649C>T, NM_173477.4:c.394dupG, NM_173477.4:c.186_187delCA | Usher syndrome type 1G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1G gene located on chromosomal region 17q25.1. This disease is characterized by the association of sensorineural deafness (usually congenital, severe and stable), progressive vision loss caused by retinitis pigmentosa apparent in childhood and balance problems. The prevalence is 4.4:100,000. | 600 |
| USH2A | Usher syndrome, type 2A | NM_206933.2 | NM_206933.2:c.15520-1G>A, NM_206933.2:c.15371delT, NM_206933.2:c.15089C>A, NM_206933.2:c.14803C>T, NM_206933.2:c.14442C>A, NM_206933.2:c.13709delG, NM_206933.2:c.12574C>T, NM_206933.2:c.12234_12235delGA, NM_206933.2:c.11864G>A, NM_206933.2:c.10636G>A, NM_206933.2:c.10561T>C, NM_206933.2:c.10073G>A, NM_206933.2:c.9799T>C, NM_206933.2:c.8981G>A, NM_206933.2:c.7364G>A, NM_206933.2:c.6862G>T, NM_206933.2:c.5743_5744delAG, NM_206933.2:c.5573-2A>G, NM_206933.2:c.4338_4339delCT, NM_206933.2:c.3491_3492delCT, NM_206933.2:c.2898delG, NM_206933.2:c.2299delG, NM_206933.2:c.2276G>T, NM_206933.2:c.2167+5G>A, NM_206933.2:c.2135delC, NM_206933.2:c.920_923dupGCCA, NM_206933.2:c.820C>T, NM_206933.2:c.779T>G | Usher syndrome type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. This disease is characterized by the association of sensorineural deafness (usually congenital, moderate/severe and stable) and progressive vision loss that begins in adolescence or adulthood caused by retinitis pigmentosa. Unlike the other forms of Usher syndrome, type 2 is not associated with vestibular abnormalities that cause difficulties with balance. USH2A accounts for more than half of all cases of Usher syndrome type 2. The estimated prevalence is 3:100,000-4:100,000. | 600,25 |
| VDR | Rickets, vitamin D-resistant, type 2A | NM_001017536.1 | NM_001017536.1:c.1135G>A, NM_001017536.1:c.1065C>G, NM_001017536.1:c.1035C>A, NM_001017536.1:c.971G>T, NM_001017536.1:c.389G>A, NM_001017536.1:c.299G>A, NM_001017536.1:c.287G>A, NM_001017536.1:c.238C>T | Vitamin D-dependent rickets type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VDR gene located on chromosomal region 12q13.11. The age of onset is early. This disease is characterized by hypocalcemia, severe rickets and in many cases alopecia. The prevalence is 1:10,000-5:10,000. | 600 |
| VLDLR | Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion, type 1 | NM_003383.4 | NM_003383.4:c.769C>T, NM_003383.4:c.844C>T, NM_003383.4:c.2302_2303delGA, NM_003383.4:c.2339delT | Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VLDLR gene located on chromosomal region 9p24.2. The age of onset is early. This disease is characterized by non-progressive congenital ataxia that is predominantly truncal and results in delayed ambulation, moderate-to-profound intellectual disability, dysarthria, strabismus, and seizures. The prevalence is 1:100,000-9:100,000. | 600 |
| VPS13A | Choreoacanthocytosis | NM_033305.2 | NM_033305.2:c.622C>T, NM_033305.2:c.2898T>G, NM_033305.2:c.3091delG, NM_033305.2:c.9109C>T, NM_033305.2:c.9275+1G>T | Chorea-acanthocytosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VPS13A gene located on chromosomal region 9q21. The age of onset is adult. This disease is characterized by progressive neurological symptoms including movement disorders, psychiatric manifestations and cognitive disturbances. | 600 |
| VPS33B | Arthrogryposis, renal dysfunction and cholestasis, type 1 | NM_018668.4 | NM_018668.4:c.1594C>T, NM_018668.4:c.1480-1G>T, NM_018668.4:c.1312C>T, NM_018668.4:c.1246C>T, NM_018668.4:c.603+2T>A, NM_018668.4:c.440_449delCTCTTGATGT | Arthrogryposis, renal dysfunction and cholestasis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the VPS33B gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by neurogenic arthrogryposis multiplex congenita, renal tubular dysfunction and neonatal cholestasis. The prevalence is <1:1,000,000. | 600 |
| WAS | Wiskott-Aldrich syndrome; Thrombocytopenia, X-linked | NM_000377.2 | NM_000377.2:c.134C>T, NM_000377.2:c.167C>T, NM_000377.2:c.173C>G, NM_000377.2:c.809T>C, NM_000377.2:c.814T>C, NM_000377.2:c.881T>C, NM_000377.2:c.1442T>A | Wiskott-Aldrich syndrome (WAS) is an X-linked recessive primary immunodeficiency disease characterized by microthrombocytopenia, eczema, recurrent infections and an increased risk for autoinmmune manifestations and malignancies. WAS usually manifests in infancy but onset may also occur during the neonatal period. The incidence of WAS has been estimated at less than 1 in 100,000 live births. Thrombocytopaenia is defined by a decrease in the number of platelets in circulating blood, resulting in the potential for increased bleeding and decreased ability for clotting. Both conditions follow an X-linked pattern of inheritance and are caused by pathogenic variants in the WAS gene located on chromosomal region Xp11.23. | 600 |
| WDR62 | Microcephaly, type 2, primary, autosomal recessive, with or without cortical malformations | NM_001083961.1 | NM_001083961.1:c.193G>A, NM_001083961.1:c.557G>A, NM_001083961.1:c.671G>C, NM_001083961.1:c.702dupG, NM_001083961.1:c.1313G>A, NM_001083961.1:c.1408C>T, NM_001083961.1:c.3514+1delG, NM_001083961.1:c.3574delA | Autosomal recessive primary microcephalyc type 2 with or without cortical malformations follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WDR62 gene located on chromosomal region 19q13.12. The age of onset is early. This disease is characterized by reduced head circumference at birth without gross anomalies of brain architecture and variable degrees of intellectual impairment. The incidence is 1:1,000,000. | 600 |
| WFS1 | Wolfram syndrome, type 1 | NM_001145853.1 | NM_001145853.1:c.616C>T, NM_001145853.1:c.676C>T, NM_001145853.1:c.1060_1062delTTC, NM_001145853.1:c.1230_1233delCTCT, NM_001145853.1:c.1234_1237delGTCT, NM_001145853.1:c.1511C>T, NM_001145853.1:c.1943G>A, NM_001145853.1:c.1944G>A, NM_001145853.1:c.2084G>T, NM_001145853.1:c.2643_2644delCT | Wolfram syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WFS1 gene located on chromosomal region 4p16.1. The age of onset is infantile. This disease is characterized by diabetes mellitus type I, diabetes insipidus, optical atrophy and neurological signs. The prevalence is 1:1,000,000-9:1,000,000. | 600,25 |
| WHRN | Usher syndrome, type 2D; Deafness, autosomal recessive, type 31 | NM_015404.3 | NM_015404.3:c.817C>T | Usher syndrome type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WHRN gene located on chromosomal region 9q32. This disease is characterized by the association of sensorineural deafness (usually congenital, moderate/severe and stable) and progressive vision loss that begins in adolescence or adulthood caused by retinitis pigmentosa. Unlike the other forms of Usher syndrome, type 2 is not associated with vestibular abnormalities that cause difficulties with balance. The WHRN gene is also associated with autosomal recessive nonsyndromic sensorineural deafness type 31. This phenotype is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.ᅠ | 600,25 |
| WNT10A | Odontoonychodermal dysplasia | NM_025216.2 | NM_025216.2:c.321C>A, NM_025216.2:c.383G>A, NM_025216.2:c.697G>T | Odonto-onycho-dermal dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by hyperkeratosis and hyperhidrosis of the palms and soles, atrophic malar patches, hypodontia, conical teeth, onychodysplasia, and dry and sparse hair. The prevalence is <1:1,000,000. | 600,25 |
| WNT7A | Fuhrmann syndrome | NM_004625.3 | NM_004625.3:c.874C>T, NM_004625.3:c.325G>A | Fuhrmann syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT7A gene located on chromosomal region 3p25.1. The age of onset is neonatal/infancy. This disease is characterized by bowing of the femora, aplasia or hypoplasia of the fibulae and poly-, oligo-, and syndactyly. Most of the patients also have a hypoplastic pelvis and hypoplasia of the fingers and fingernails. Some had congenital dislocation of the hip, absence or fusion of tarsal bones, absence of various metatarsals, and hypoplasia and aplasia of the toes. The prevalence is <1:1,000,000. | 600 |
| XPA | Xeroderma pigmentosum, group A | NM_000380.3 | NM_000380.3:c.727C>T, NM_000380.3:c.619C>T, NM_000380.3:c.501delG, NM_000380.3:c.348T>A | Xeroderma pigmentosum complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the gene XPA located on chromosomal region 9q22.33. The age of onset is variable. This disease is characterized by photosensitivity of skin with burning, freckling, and skin cancers. It is associated with a spectrum of mild to severe neurological anomalies (e.g. cognitive deterioration, dysarthria, balance disturbance, areflexia) and sometimes delay of growth and sexual development. The prevalence is 1:1,000,000. | 600 |
| ZFYVE26 | Spastic paraplegia, type 15, autosomal recessive | NM_015346.3 | NM_015346.3:c.5485-1G>A, NM_015346.3:c.5422C>T, NM_015346.3:c.4936C>T, NM_015346.3:c.4312C>T, NM_015346.3:c.3642_3643insCCACACTTAG, NM_015346.3:c.3206G>A, NM_015346.3:c.3182delT, NM_015346.3:c.2114dupC, NM_015346.3:c.1477C>T | Spastic paraplegia type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZFYVE26 gene located on chromosomal region 14q24.1. The age of onset is infancy. This disease is characterized by progressive spasticity primarily affecting the lower limbs. It is a complex form of spastic paraplegia, associated with other neurologic dysfunction, including variable mental retardation, hearing and visual defects, and thin corpus callosum. The prevalence is <1 / 1,000,000. | 600,25 |
| ZMPSTE24 | Mandibuloacral dysplasia with, type B lipodystrophy | NM_005857.4 | NM_005857.4:c.54dupT, NM_005857.4:c.121C>T, NM_005857.4:c.955-1G>A, NM_005857.4:c.1018T>C, NM_005857.4:c.1085dupT, NM_005857.4:c.1263dupT, NM_005857.4:c.1349G>A | Mandibuloacral dysplasia with type B lipodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZMPSTE24 gene located on chromosomal region 1p34.2. The age of onset is early. This disease is characterized by postnatal growth retardation, craniofacial anomalies and skeletal malformations, such as mandibular and clavicular hypoplasia; mottled cutaneous pigmentation and generalized lipoatrophy. | 600 |
| ZNF469 | Brittle cornea syndrome, type 1 | NM_001127464.2 | NM_001127464.2:c.4174G>T | Brittle cornea syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZNF469 gene located on chromosomal region 16q24.2. The age of onset is infantile. This disease is characterized by severe ocular manifestations due to extreme corneal thinning and fragility with rupture in the absence of significant trauma. BCS generally progresses to blindness. The prevalence is <1:1,000,000. | 600 |
- CGT 250 v1
- CGT 250 v2
| Gene | Disease | Transcript | Mutations | Disease.description | products |
|---|---|---|---|---|---|
| ABCA4 | Cone-rod dystrophy type 3 | NM_000350.2 | NM_000350.2:c.3540_3555delGTCTAAGGGTTTCTCC, NM_000350.2:c.2616_2617delCT, NM_000350.2:c.4793C>A, NM_000350.2:c.6179T>G, NM_000350.2:c.1222C>T, NM_000350.2:c.763C>T | Cone rod dystrophy type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness. The prevalence is 1:100,000-9100,000. | 250,600 |
| ABCA4 | Retinitis pigmentosa type 19 | NM_000350.2 | NM_000350.2:c.1848delA | Retinitis pigmentosa type 19 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000. | 250,600 |
| ABCA4 | Stargardt disease type 1 | NM_000350.2 | NM_000350.2:c.1018T>G, NM_000350.2:c.4457C>T, NM_000350.2:c.1225delA, NM_000350.2:c.1622T>C, NM_000350.2:c.1715G>A, NM_000350.2:c.1755delA, NM_000350.2:c.1771delT, NM_000350.2:c.1804C>T, NM_000350.2:c.6449G>A, NM_000350.2:c.1938-1G>A, NM_000350.2:c.1964T>G, NM_000350.2:c.2160+1G>T, NM_000350.2:c.2588G>C, NM_000350.2:c.4469G>A, NM_000350.2:c.2690C>T, NM_000350.2:c.2791G>A, NM_000350.2:c.286A>G, NM_000350.2:c.2971G>C, NM_000350.2:c.3083C>T, NM_000350.2:c.3106G>A, NM_000350.2:c.3210_3211dupGT, NM_000350.2:c.3364G>A, NM_000350.2:c.6320G>A, NM_000350.2:c.3970delG, NM_000350.2:c.4139C>T, NM_000350.2:c.4429C>T, NM_000350.2:c.2300T>A, NM_000350.2:c.3322C>T, NM_000350.2:c.52C>T, NM_000350.2:c.5512delC, NM_000350.2:c.5819T>C, NM_000350.2:c.5881G>A, NM_000350.2:c.5882G>A, NM_000350.2:c.5912T>G, NM_000350.2:c.634C>T, NM_000350.2:c.5714+5G>A, NM_000350.2:c.6394G>T, NM_000350.2:c.67-2A>G, NM_000350.2:c.5461-10T>C, NM_000350.2:c.6089G>A, NM_000350.2:c.6118C>T, NM_000350.2:c.6148G>C, NM_000350.2:c.661G>A, NM_000350.2:c.5338C>G | Stargardt disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by progressive central vision loss, mild loss of color vision, delayed dark adaptation and macular atrophy with or without paramacular flecks and degeneration of the underlying retinal pigment ephitelium. The prevalence is 1:10,000- 5:10,000. | 250,600 |
| ACAD9 | Acyl-CoA dehydrogenase type 9 deficiency | NM_014049.4 | NM_014049.4:c.1240C>T, NM_014049.4:c.1249C>T, NM_014049.4:c.130T>A, NM_014049.4:c.1594C>T, NM_014049.4:c.23delT, NM_014049.4:c.358delT, NM_014049.4:c.797G>A, NM_014049.4:c.976G>C, NM_014049.4:c.453+1G>A | Acyl-CoA dehydrogenase type 9 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAD9 gene located on chromosomal region 3q21.3. The age of onset is neonatal/infantile. This disease is characterized by failure to thrive, hypertrophic cardiomyopathy, exercise intolerance and mild to severe neurological dysfunction. | 250,600 |
| ACADM | Acyl-CoA dehydrogenase deficiency, medium-chain | NM_000016.5 | NM_000016.5:c.1102_1105delTTAG, NM_000016.5:c.1232_1233delAA, NM_000016.5:c.287-2A>G, NM_000016.5:c.362C>T, NM_000016.5:c.447G>A, NM_000016.5:c.447G>T, NM_000016.5:c.449_452delCTGA, NM_000016.5:c.616C>T, NM_000016.5:c.617G>A, NM_000016.5:c.683C>A, NM_000016.5:c.797A>G, NM_000016.5:c.799G>A, NM_000016.5:c.815_827delTTGCAATGGGAGC, NM_000016.5:c.890A>G, NM_000016.5:c.984delG, NM_000016.5:c.985A>G, NM_000016.5:c.127G>A, NM_000016.5:c.734C>T, NM_000016.5:c.250C>T | Medium chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADM gene located on chromosomal region 1p31. The age of onset is neonatal/infantile. This disease is characterized by a rapidly progressive metabolic crisis, often presenting as hypoketotic hypoglycemia, lethargy, vomiting, seizures and coma. The prevalence is 1:4,900-1:27,000 in Caucasian populations and 1:14,600 in worldwide populations. | 250,600 |
| ACADS | Acyl-CoA dehydrogenase deficiency, short-chain | NM_000017.2 | NM_000017.2:c.1095G>T, NM_000017.2:c.1108A>G, NM_000017.2:c.1147C>T, NM_000017.2:c.136C>T, NM_000017.2:c.319C>T, NM_000017.2:c.417G>C, NM_000017.2:c.529T>C, NM_000017.2:c.561_568delCAATGCCT, NM_000017.2:c.826G>A, NM_000017.2:c.314T>A | Short chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADS gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by seizures, developmental delay, failure to grow with poor feeding, and usually muscle weakness and hypotonia. The prevalence is <1:50,000. | 250,600 |
| ACADSB | 2-Methylbutyryl-CoA dehydrogenase deficiency | NM_001609.3 | NM_001609.3:c.1159G>A, NM_001609.3:c.443C>T, NM_001609.3:c.763C>T, NM_001609.3:c.621G>A, NM_001609.3:c.303+1G>A | 2-Methylbutyryl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADSB gene located on chromosomal region 10q26.3. The age of onset is neonatal/infantile. This disease is characterized by muscle hypotonia, cerebral palsy, developmental delay, lethargy, hypoglycemia, and metabolic acidosis. The prevalence is <1:1,000,000. | 250,600 |
| ACADVL | Very long chain acyl-CoA dehydrogenase deficiency | NM_000018.3 | NM_000018.3:c.1096C>T, NM_000018.3:c.1097G>A, NM_000018.3:c.1106T>C, NM_000018.3:c.1141_1143delGAG, NM_000018.3:c.1182+1G>A, NM_000018.3:c.1357C>T, NM_000018.3:c.1360G>A, NM_000018.3:c.1375dupC, NM_000018.3:c.1389dupG, NM_000018.3:c.1406G>A, NM_000018.3:c.1468G>C, NM_000018.3:c.1532+1G>A, NM_000018.3:c.1837C>T, NM_000018.3:c.1843C>T, NM_000018.3:c.1882delC, NM_000018.3:c.278-1G>A, NM_000018.3:c.298_299delCA, NM_000018.3:c.343delG, NM_000018.3:c.400C>T, NM_000018.3:c.477+1G>C, NM_000018.3:c.520G>A, NM_000018.3:c.685C>T, NM_000018.3:c.739A>C, NM_000018.3:c.753-2A>C, NM_000018.3:c.896_898delAGA, NM_000018.3:c.917T>C, NM_000018.3:c.1844G>A, NM_000018.3:c.848T>C | Very long chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADVL gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by cardiomyopathy, hypoketotic hypoglycemia, liver disease, exercise intolerance and rhabdomyolysis. The prevalence is 1:100,000-9:100,000. | 250,600 |
| ACE | Renal tubular dysgenesis | NM_000789.3 | NM_000789.3:c.1319_1322delTGGA, NM_000789.3:c.1510delC, NM_000789.3:c.3381-4C>T, NM_000789.3:c.798C>G, NM_000789.3:c.1486C>T, NM_000789.3:c.2371C>T, NM_000789.3:c.1587-2A>G | Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACE (chromosomal region 17q23.3), AGT (1q42.2) AGTR1 (3q24) and REN (1q32.1) genes. The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects. | 250,600 |
| ADA | Adenosine deaminase deficiency | NM_000022.2 | NM_000022.2:c.226C>T, NM_000022.2:c.632G>A, NM_000022.2:c.890C>A, NM_000022.2:c.247G>A, NM_000022.2:c.320T>C, NM_000022.2:c.872C>T, NM_000022.2:c.956_960delAAGAG, NM_000022.2:c.986C>T | Adenosine deaminase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADA gene located on chromosomal region 20q13.12. The age of onset is neonatal/infantile. This disease is characterized by profound lymphopenia and very low immunoglobulin levels of all isotypes resulting in severe and recurrent opportunistic infections. The annual incidence is 1:200,000-1:1,000,000. The prevalence is 1:100,000-9:100,000. | 250,600 |
| ADCK3 | Primary coenzyme Q10 deficiency type 4 | NM_020247.4 | NM_020247.4:c.911C>T, NM_020247.4:c.815G>T, NM_020247.4:c.993C>T, NM_020247.4:c.1541A>G, NM_020247.4:c.1645G>A, NM_020247.4:c.1651G>A, NM_020247.4:c.1750_1752delACC, NM_020247.4:c.1813_1814insG, NM_020247.4:c.589-3C>G, NM_020247.4:c.637C>T, NM_020247.4:c.815G>A | Primary coenzyme Q10 deficiency type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADCK3 gene located on chromosomal region 1q42.13. The age of onset is infantile. This disease is characterized by progressive ataxia, cerebellar atrophy, and often exercise intolerance with elevated lactate levels and mild intellectual deficit. | 250,600 |
| AGL | Glycogen storage disease type 3 | NM_000642.2 | NM_000642.2:c.1783C>T, NM_000642.2:c.18_19delGA, NM_000642.2:c.112A>G, NM_000642.2:c.1222C>T, NM_000642.2:c.1481G>A, NM_000642.2:c.1485delT, NM_000642.2:c.16C>T, NM_000642.2:c.4260-1G>T, NM_000642.2:c.3214_3215delGA, NM_000642.2:c.1999delC, NM_000642.2:c.2039G>A, NM_000642.2:c.2590C>T, NM_000642.2:c.4456delT, NM_000642.2:c.3216_3217delGA, NM_000642.2:c.3980G>A, NM_000642.2:c.4342G>C, NM_000642.2:c.4529dupA, NM_000642.2:c.294-2A>T, NM_000642.2:c.4260-12A>G | Glycogen storage disease type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGL gene located on chromosomal region 1p21.2. The age of onset is infantile. This disease is characterized by hepatomegaly, growth retardation and occasional seizures related to hypoglycemia and frequently muscular hypotonia and hypertrophic cardiomyopathy. | 250,600 |
| AGXT | Primary hyperoxaluria type 1 | NM_000030.2 | NM_000030.2:c.166-2A>G, NM_000030.2:c.121G>A, NM_000030.2:c.32C>A, NM_000030.2:c.245G>A, NM_000030.2:c.25_26insC, NM_000030.2:c.322T>C, NM_000030.2:c.508G>A, NM_000030.2:c.560C>T, NM_000030.2:c.590G>A, NM_000030.2:c.613T>C, NM_000030.2:c.697C>T, NM_000030.2:c.698G>A, NM_000030.2:c.731T>C, NM_000030.2:c.738G>A, NM_000030.2:c.836T>C, NM_000030.2:c.860G>A, NM_000030.2:c.33_34insC, NM_000030.2:c.454T>A, NM_000030.2:c.466G>A, NM_000030.2:c.248A>G | Primary hyperoxaluria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGXT gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by variable clinical presentation, ranging from occasional symptomatic nephrolithiasis to nephrocalcinosis and end-stage renal disease with systemic involvement. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| AHI1 | Joubert syndrome type 3 | NM_017651.4 | NM_017651.4:c.1303C>T, NM_017651.4:c.1484G>A, NM_017651.4:c.2295_2296insA, NM_017651.4:c.2295dupA, NM_017651.4:c.3257A>G, NM_017651.4:c.2168G>A, NM_017651.4:c.985C>T, NM_017651.4:c.989A>G, NM_017651.4:c.3263_3264delGG, NM_017651.4:c.1051C>T, NM_017651.4:c.1052G>T | El síndrome de Joubert tipo 3 sigue un patrón de herencia autosómico recesivo y está causado por variantes patogénicas en el gen AHI1 localizado en la región cromosómica 6q23.3. La edad de aparición es neonatal/infantil con síntomas como los rasgos neurológicos del síndrome de Joubert (hipotonía neonatal, retraso del desarrollo, discapacidad intelectural de leve a grave, ataxia, movimiento ocular anormal incluyendo apraxia oculomotora y nistagmo en posición primaria) asociados a una distrofia retiniana. | 250,600 |
| AIPL1 | Cone-rod dystrophy | NM_014336.4 | NM_014336.4:c.1053_1064delTGCAGAGCCACC | La distrofia de conos y bastones causada por variantes patogénicas en el gen AIPL1 localizado en la región cromosómica 17p13.2 sigue un patrón de herencia autosómico recesivo. La edad de aparición es temprana. Se caracteriza por una agudeza visual disminuida, defectos en la visión de los colores, fotoaversión y disminución de la sensibilidad en el centro del campo visual, seguido por una pérdida de la visión periférica y ceguera nocturna. | 250,600 |
| AIPL1 | Leber congenital amaurosis type 4 | NM_014336.4 | NM_014336.4:c.905G>T, NM_014336.4:c.834G>A, NM_014336.4:c.589G>C, NM_014336.4:c.715T>C | Leber congenital amaurosis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AIPL1gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. The prevalence is 1:100,000-9:100,000. | 250,600 |
| ALDOB | Hereditary fructose intolerance | NM_000035.3 | NM_000035.3:c.1005C>G, NM_000035.3:c.178C>T, NM_000035.3:c.1027T>C, NM_000035.3:c.10C>T, NM_000035.3:c.136A>T, NM_000035.3:c.448G>C, NM_000035.3:c.2T>C, NM_000035.3:c.360_363delCAAA, NM_000035.3:c.442T>C, NM_000035.3:c.1013C>T, NM_000035.3:c.113-1_115delGGTA, NM_000035.3:c.1067C>A, NM_000035.3:c.612T>A, NM_000035.3:c.720C>A, NM_000035.3:c.524C>A | Hereditary fructose intolerance follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOB gene located on chromosomal region 9q21.3-q22.2. The age of onset is neonatal/infantile. This disease is characterized by severe abdominal pain, vomiting, and hypoglycemia following ingestion of fructose or other sugars metabolised through fructose-1-phosphate. The prevalence is 1:100,000-9:100,000. | 250,600 |
| ALG6 | Congenital disorders of glycosylation type Ic | NM_013339.3 | NM_013339.3:c.897_899delAAT, NM_013339.3:c.998C>T, NM_013339.3:c.495-3C>G, NM_013339.3:c.53G>A, NM_013339.3:c.316C>T, NM_013339.3:c.482A>G, NM_013339.3:c.1432T>C | Congenital disorder of glycosylation type 1c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG6 gene located on chromosomal region 1p31.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay and muscular hypotonia, and possible coagulation anomalies, hormonal abnormalities and seizures. The prevalence is <1:1,000,000. | 250,600 |
| ALMS1 | Alström syndrome | NM_015120.4 | NM_015120.4:c.11443C>T, NM_015120.4:c.10775delC, NM_015120.4:c.11316_11319delAGAG, NM_015120.4:c.2323C>T, NM_015120.4:c.11449C>T, NM_015120.4:c.11452_11453insA, NM_015120.4:c.1574_1576delCTCinsT, NM_015120.4:c.8383C>T, NM_015120.4:c.9612_9616delAACAG, NM_015120.4:c.10579_10580delAT, NM_015120.4:c.11610_11611delCT, NM_015120.4:c.12439C>T, NM_015120.4:c.12445C>T, NM_015120.4:c.891_907delTCAGCACCCGCTTATAG, NM_015120.4:c.9911-1G>A, NM_015120.4:c.11618_11619delCT, NM_015120.4:c.4245delC, NM_015120.4:c.5584C>T, NM_015120.4:c.8164C>T | Alström syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALMS1 gene located on chromosomal region 2p13.1. The age of onset is neonatal/infantile. This disease is characterized by cone-rod dystrophy, hearing loss, obesity, insulin resistance and hyperinsulinemia, type 2 diabetes mellitus, dilated cardiomyopathy and progressive hepatic and renal dysfunction. The prevalence is 1:10,000-1:1,000,000. | 250,600 |
| ANO5 | Limb-girdle muscular dystrophy type 2L, autosomal recessive | NM_213599.2 | NM_213599.2:c.155A>G, NM_213599.2:c.1622_1623insA, NM_213599.2:c.1407+5G>A, NM_213599.2:c.1887delA, NM_213599.2:c.1733T>C, NM_213599.2:c.692G>T, NM_213599.2:c.1627_1628insA, NM_213599.2:c.172C>T, NM_213599.2:c.206_207delAT, NM_213599.2:c.1210C>T, NM_213599.2:c.1295C>G, NM_213599.2:c.1914G>A, NM_213599.2:c.184_185insA, NM_213599.2:c.1898+1G>A, NM_213599.2:c.191_192insA | Autosomal recessive limb-girdle muscular dystrophy type 2L follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ANO5 gene located on chromosomal region 11p14.3. The age of onset is adult. This disease is characterized by weakness and wasting restricted to the limb musculature, proximal greater than distal, and muscle degeneration/regeneration on muscle biopsy. The prevalence is <1:1,000,000. | 250,600 |
| APTX | Ataxia with oculomotor apraxia type 1 | NM_175073.2 | NM_175073.2:c.167delT, NM_175073.2:c.788T>G, NM_175073.2:c.320delC, NM_175073.2:c.617C>T, NM_175073.2:c.659C>T, NM_175073.2:c.134-2A>G, NM_175073.2:c.166C>T, NM_175073.2:c.124C>T, NM_175073.2:c.875-1G>A, NM_175073.2:c.837G>A, NM_175073.2:c.596G>A | Ataxia with oculomotor apraxia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the APTX gene located on chromosomal region 9p13.1. The age of onset is infantile. This disease is characterized by a progressive cerebellar ataxia associated with oculomotor apraxia, choeroathetosis and severe peripheral neuropathy. The prevalence is 0,4:100.000 in Portugal. | 250,600 |
| AR | Androgen insensitivity syndrome | NM_000044.3 | NM_000044.3:c.2650A>T, NM_000044.3:c.340C>T, NM_000044.3:c.1937C>A, NM_000044.3:c.2323C>T, NM_000044.3:c.2391G>A, NM_000044.3:c.2567G>A, NM_000044.3:c.1769-11T>A, NM_000044.3:c.1771A>T, NM_000044.3:c.2395C>G | Androgen insensitivity syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the AR gene located on chromosomal region Xq12. The age of onset is variable. This disease is characterized by the presence of female external genitalia in a 46,XY individual with normal testis development but undescended testes and unresponsiveness to age-appropriate levels of androgens. The prevalence is 2:100,000-5:100,000. | 250,600 |
| ARSA | Metachromatic leukodystrophy | NM_000487.5 | NM_000487.5:c.1241delC, NM_000487.5:c.1283C>T, NM_000487.5:c.346C>T, NM_000487.5:c.34delG, NM_000487.5:c.1210+1G>A, NM_000487.5:c.1232C>T, NM_000487.5:c.582delC, NM_000487.5:c.583delT, NM_000487.5:c.542dupT, NM_000487.5:c.542T>G, NM_000487.5:c.1408_1418delGCAGCTGTGAC, NM_000487.5:c.195delC, NM_000487.5:c.641C>T, NM_000487.5:c.1401_1411delGTTAGACGCAG, NM_000487.5:c.869G>A, NM_000487.5:c.869G>T, NM_000487.5:c.883G>A, NM_000487.5:c.899T>C, NM_000487.5:c.931G>A, NM_000487.5:c.937C>T, NM_000487.5:c.938G>A, NM_000487.5:c.979G>A, NM_000487.5:c.737G>A, NM_000487.5:c.739G>A, NM_000487.5:c.763G>A, NM_000487.5:c.827C>T, NM_000487.5:c.854+1G>A, NM_000487.5:c.1108-2A>G, NM_000487.5:c.1125_1126delCT, NM_000487.5:c.1150G>A, NM_000487.5:c.1174C>T, NM_000487.5:c.1175G>A, NM_000487.5:c.986C>T, NM_000487.5:c.991G>T, NM_000487.5:c.465+1G>A, NM_000487.5:c.257G>A, NM_000487.5:c.293C>T, NM_000487.5:c.302G>A | Metachromatic leukodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSA gene located on chromosomal region 22q13.33. The age of onset is variable. This disease is characterized by hypotonia, walking difficulties, optic atrophy and motor regression preceding mental impairment in the late infantile form, arrested intellectual development, followed by motor regression, epileptic seizures and ataxia in the juvenile form, and motor or psychiatric disorders, but with slow progression in the adult form. The incidence is 0.5:5,000-1:50,000 and the prevalence is 1:10,000 -5/10,000. | 250,600 |
| ARSB | Mucopolysaccharidosis type 6 | NM_000046.3 | NM_000046.3:c.410G>T, NM_000046.3:c.427delG, NM_000046.3:c.349T>C, NM_000046.3:c.389C>T, NM_000046.3:c.937C>G, NM_000046.3:c.944G>A, NM_000046.3:c.971G>T, NM_000046.3:c.979C>T, NM_000046.3:c.1562G>A, NM_000046.3:c.629A>G, NM_000046.3:c.1143-1G>C, NM_000046.3:c.571C>T, NM_000046.3:c.589C>T, NM_000046.3:c.1178A>C, NM_000046.3:c.1214G>A, NM_000046.3:c.1143-8T>G, NM_000046.3:c.1161dupC, NM_000046.3:c.707T>C, NM_000046.3:c.753C>G, NM_000046.3:c.1366C>T, NM_000046.3:c.1438_1439insG, NM_000046.3:c.921delA | Mucopolysaccharidosis type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSB gene located on chromosomal region 5q14.1. The age of onset is infantile. This disease is characterized by educed pulmonary function, hepatosplenomegaly, hearing loss, sleep apnea, corneal clouding, carpal tunnel disease and occasionally central nervous system findings may include cervical cord compression caused by cervical spinal instability, meningeal thickening and/or bony stenosis, communicating hydrocephalus, optic nerve atrophy and blindness. The prevalence is 1:250,000-1:600,000 newborns. | 250,600 |
| ARSE | Chondrodysplasia punctata type 1, X-linked | NM_000047.2 | NM_000047.2:c.119T>G, NM_000047.2:c.1429delG, NM_000047.2:c.1442C>T, NM_000047.2:c.1732C>T, NM_000047.2:c.1743G>A, NM_000047.2:c.24-1G>A, NM_000047.2:c.410G>C, NM_000047.2:c.410G>T | X-linked chondrodysplasia punctata type 1 follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARSE gene located on chromosomal region Xp22.33. The age of onset is neonatal. This disease is characterized by chondrodysplasia punctata (stippled epiphyses), brachytelephalangy (shortening of the distal phalanges), and nasomaxillary hypoplasia. The prevalence is 1:500,000. | 250,600 |
| ASL | Argininosuccinic aciduria | NM_000048.3 | NM_000048.3:c.1135C>T, NM_000048.3:c.1060C>T, NM_000048.3:c.1255_1256delCT, NM_000048.3:c.1366C>T, NM_000048.3:c.1045_1057delGTCATCTCTACGC, NM_000048.3:c.578G>A, NM_000048.3:c.539T>G, NM_000048.3:c.544C>T, NM_000048.3:c.557G>A, NM_000048.3:c.1144-2A>G, NM_000048.3:c.602+1G>A, NM_000048.3:c.857A>G, NM_000048.3:c.925G>A, NM_000048.3:c.446+1G>A, NM_000048.3:c.505T>C, NM_000048.3:c.525-2A>T, NM_000048.3:c.532G>A, NM_000048.3:c.337C>T, NM_000048.3:c.346C>T, NM_000048.3:c.35G>A, NM_000048.3:c.1369dupG, NM_000048.3:c.437G>A, NM_000048.3:c.392C>T, NM_000048.3:c.1153C>T | Argininosuccinic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASL gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by severe hyperammonemic coma, hypotonia, growth failure, anorexia and chronic vomiting or behavioral disorders during childhood, and hyperammonemic coma or behavioral disorders that simulate psychiatric disorders later in life. The prevalence is 1:70,000 newborns. | 250,600 |
| ASPA | Canavan disease | NM_000049.2 | NM_000049.2:c.838C>T, NM_000049.2:c.693C>A, NM_000049.2:c.654C>A, NM_000049.2:c.433-2A>G, NM_000049.2:c.854A>C, NM_000049.2:c.914C>A, NM_000049.2:c.212G>A, NM_000049.2:c.863A>G | Canavan disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPA gene located on chromosomal region 17p13.3. The age of onset is neonatal/infantile. This disease is characterized by a variable spectrum between severe forms with leukodystrophy, macrocephaly and severe developmental delay, and a very rare mild/juvenile form characterized by mild developmental delay. The prevalence is 1:6,400- 1:13,500 in Askenazis Jewis. | 250,600 |
| ASPM | Microcephaly primary, type 5, autosomal recessive | NM_018136.4 | NM_018136.4:c.1002delA, NM_018136.4:c.3055C>T, NM_018136.4:c.2389C>T, NM_018136.4:c.2967G>A, NM_018136.4:c.1260_1266delTCAAGTC, NM_018136.4:c.10059C>A, NM_018136.4:c.1154_1155delAG, NM_018136.4:c.1179delT, NM_018136.4:c.1729_1730delAG, NM_018136.4:c.1959_1962delCAAA, NM_018136.4:c.1990C>T, NM_018136.4:c.3979C>T, NM_018136.4:c.4195dupA, NM_018136.4:c.4583delA, NM_018136.4:c.4795C>T, NM_018136.4:c.4858_4859delAT, NM_018136.4:c.5136C>A, NM_018136.4:c.5149delA, NM_018136.4:c.1366G>T, NM_018136.4:c.1406_1413delATCCTAAA, NM_018136.4:c.1590delA, NM_018136.4:c.6189T>G, NM_018136.4:c.6232C>T, NM_018136.4:c.6337_6338delAT, NM_018136.4:c.6732delA, NM_018136.4:c.719_720delCT, NM_018136.4:c.7491_7495delTATTA, NM_018136.4:c.7565T>G, NM_018136.4:c.7761T>G, NM_018136.4:c.7782_7783delGA, NM_018136.4:c.7860_7861delGA, NM_018136.4:c.7894C>T, NM_018136.4:c.8131_8132delAA, NM_018136.4:c.8230_8231insA, NM_018136.4:c.8378delT, NM_018136.4:c.8508_8509delGA, NM_018136.4:c.8668C>T, NM_018136.4:c.8844delC, NM_018136.4:c.9115_9118dupCATT, NM_018136.4:c.9159delA, NM_018136.4:c.9178C>T, NM_018136.4:c.3082G>A, NM_018136.4:c.3188T>G, NM_018136.4:c.3477_3481delCGCTA, NM_018136.4:c.349C>T, NM_018136.4:c.3527C>G, NM_018136.4:c.3663delG, NM_018136.4:c.3710C>G, NM_018136.4:c.3796G>T, NM_018136.4:c.3811C>T, NM_018136.4:c.3978G>A, NM_018136.4:c.9747_9748delCT, NM_018136.4:c.9754delA, NM_018136.4:c.9789T>A, NM_018136.4:c.8711_8712delAA, NM_018136.4:c.9190C>T, NM_018136.4:c.9238A>T, NM_018136.4:c.9319C>T, NM_018136.4:c.5439_5440delAG, NM_018136.4:c.577C>T, NM_018136.4:c.6073delG, NM_018136.4:c.9677dupG, NM_018136.4:c.9685delA, NM_018136.4:c.9697C>T, NM_018136.4:c.9730C>T, NM_018136.4:c.9557C>G, NM_018136.4:c.9492T>G, NM_018136.4:c.9539A>C | Primary autosomal recessive microcephaly type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPM gene located on chromosomal region 1q31. The age of onset is neonatal/infantile. This disease is characterized by a reduction in head circumference at birth, mild to moderate non-progressive intellectual impairment and delay in early motor milestones, speech delay and hyperactive behavior are common. The annual incidence is 1:1,000,000. | 250,600 |
| ASS1 | Citrullinemia type 1 | NM_000050.4 | NM_000050.4:c.421-2A>G, NM_000050.4:c.40G>A, NM_000050.4:c.1088G>A, NM_000050.4:c.470G>A, NM_000050.4:c.1085G>T, NM_000050.4:c.1087C>T, NM_000050.4:c.257G>A, NM_000050.4:c.323G>T, NM_000050.4:c.349G>A, NM_000050.4:c.380G>A, NM_000050.4:c.836G>A, NM_000050.4:c.910C>T, NM_000050.4:c.928A>C, NM_000050.4:c.496-2A>G, NM_000050.4:c.535T>C, NM_000050.4:c.539G>A, NM_000050.4:c.53C>T, NM_000050.4:c.571G>A, NM_000050.4:c.787G>A, NM_000050.4:c.793C>T, NM_000050.4:c.794G>A, NM_000050.4:c.805G>A, NM_000050.4:c.835C>T, NM_000050.4:c.919C>T, NM_000050.4:c.970G>A, NM_000050.4:c.814C>T, NM_000050.4:c.970+5G>A, NM_000050.4:c.1168G>A, NM_000050.4:c.1194-1G>C, NM_000050.4:c.256C>T | Citrullinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASS1 gene located on chromosomal region 9q34.1. The age of onset is variable. This disease is characterized by hyperammonemia, progressive lethargy, poor feeding and vomiting in the neonatal form and by variable hyperammonemia in the later-onset form. The prevalence is 1:100,000-9:100,000. | 250,600 |
| ATIC | AICA-ribosiduria | NM_004044.6 | NM_004044.6:c.223+1G>A, NM_004044.6:c.1277A>G, NM_004044.6:c.625delG | AICA-ribosiduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATIC gene located on chromosomal region 2q35. The age of onset is neonatal/infantile. This disease is characterized by profound intellectual deficit, epilepsy, dysmorphic features of the knees, elbows, and shoulders and congenital blindness. The prevalence is <1:1,000,000. | 250,600 |
| ATP7B | Wilson disease | NM_000053.3 | NM_000053.3:c.2532delA, NM_000053.3:c.2356-2A>G, NM_000053.3:c.1285+5G>T, NM_000053.3:c.2305A>G, NM_000053.3:c.1145_1151delCCCAACT, NM_000053.3:c.1934T>G, NM_000053.3:c.2071G>A, NM_000053.3:c.2297C>G, NM_000053.3:c.2972C>T, NM_000053.3:c.2975C>T, NM_000053.3:c.3083delA, NM_000053.3:c.2605G>A, NM_000053.3:c.2621C>T, NM_000053.3:c.2755C>G, NM_000053.3:c.2755C>T, NM_000053.3:c.2762G>A, NM_000053.3:c.2795C>A, NM_000053.3:c.2804C>T, NM_000053.3:c.2807T>A, NM_000053.3:c.2906G>A, NM_000053.3:c.2930C>T, NM_000053.3:c.4301C>T, NM_000053.3:c.915T>A, NM_000053.3:c.98T>C, NM_000053.3:c.1745_1746delTA, NM_000053.3:c.2123T>C, NM_000053.3:c.2267C>T, NM_000053.3:c.4088C>T, NM_000053.3:c.4135C>T, NM_000053.3:c.1512_1513insT, NM_000053.3:c.19_20delCA, NM_000053.3:c.1922T>C, NM_000053.3:c.3955C>T, NM_000053.3:c.3990_3993delTTAT, NM_000053.3:c.4058G>A, NM_000053.3:c.3207C>A, NM_000053.3:c.3359T>A, NM_000053.3:c.3688A>G, NM_000053.3:c.3101A>G, NM_000053.3:c.3796G>A, NM_000053.3:c.3809A>G, NM_000053.3:c.562C>T, NM_000053.3:c.3694A>C, NM_000053.3:c.1846C>T | Wilson disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATP7B gene located on chromosomal region 13q14.3. The age of onset is infantile. This disease is characterized by the toxic accumulation of copper, mainly in the liver and central nervous system, and symptomatic patients may present with hepatic, neurologic or psychiatric forms. The birth incidence is 1:30,000-1:100,000 in France and The prevalence is 1:10,000-1:30,000. | 250,600 |
| ATR | Seckel syndrome type 1 | NM_001184.3 | NM_001184.3:c.2341+1G>A, NM_001184.3:c.5645delA, NM_001184.3:c.6037_6038insA, NM_001184.3:c.6488delT, NM_001184.3:c.975_976delCT, NM_001184.3:c.5635G>T | Seckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATR gene located on chromosomal region 3q23. The age of onset is neonatal/infantile. This disease is characterized by a proportionate dwarfism of prenatal onset, a severe microcephaly with a bird-headed like appearance and mental retardation. The prevalence is <1:1,000,000. | 250,600 |
| BCKDHA | Maple syrup urine disease type 1A | NM_000709.3 | NM_000709.3:c.1037G>A, NM_000709.3:c.1036C>T, NM_000709.3:c.1234G>A, NM_000709.3:c.14delT, NM_000709.3:c.761C>A, NM_000709.3:c.929C>G, NM_000709.3:c.964C>T, NM_000709.3:c.979G>A, NM_000709.3:c.905A>C, NM_000709.3:c.632C>T, NM_000709.3:c.659C>T, NM_000709.3:c.740_741insT, NM_000709.3:c.868G>A, NM_000709.3:c.909_910delGT, NM_000709.3:c.917delT, NM_000709.3:c.853G>C, NM_000709.3:c.796delA | Maple syrup urine disease type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHA gene located on chromosomal region 19q13.1-13.2. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| BCS1L | Björnstad syndrome | NM_004328.4 | NM_004328.4:c.548G>A | Björnstadt syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal/infantile. This disease is characterized by congenital sensorineural hearing loss and pili torti. The prevalence is <1:1,000,000. | 250,600 |
| BCS1L | GRACILE syndrome | NM_004328.4 | NM_004328.4:c.232A>G | GRACILE syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal/infantile. This disease is characterized by fetal growth restriction (GR), aminoaciduria (A), cholestasis (C), iron overload (I), lactacidosis (L) and early death (E). The birth incidence is 1:50,000 in Finland and the prevalence is <1:1,000,000. | 250,600 |
| BCS1L | Mitochondrial comlpex III deficiency, nuclear type 1 | NM_004328.4 | NM_004328.4:c.1057G>A, NM_004328.4:c.830G>A, NM_004328.4:c.133C>T, NM_004328.4:c.103G>C, NM_004328.4:c.696delT, NM_004328.4:c.148A>G, NM_004328.4:c.166C>T, NM_004328.4:c.550C>T, NM_004328.4:c.547C>T | Mitochondrial comlpex III deficiency, nuclear type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCS1L gene located on chromosomal region 2q33. The age of onset is neonatal and it is characterized by lactic acidosis, hypotonia, hypoglycemia, failure to thrive, encephalopathy, and delayed psychomotor development. | 250,600 |
| BEST1 | Bestrophinopathy | NM_004183.3 | NM_004183.3:c.934G>A, NM_004183.3:c.598C>T, NM_004183.3:c.752G>A, NM_004183.3:c.949G>A, NM_004183.3:c.521_522delTG | Bestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram. | 250,600 |
| BEST1 | Retinitis pigmentosa type 50 | NM_004183.3 | NM_004183.3:c.1383_1384insGCCTTGATGGA, NM_004183.3:c.1444delG, NM_004183.3:c.1491_1497dupCAAAGAC, NM_004183.3:c.1566_1576dupCTTGATGGAGC, NM_004183.3:c.341_342delTG, NM_004183.3:c.1308_1309insACCAAAG, NM_004183.3:c.1264delG, NM_004183.3:c.418C>G, NM_004183.3:c.614T>C, NM_004183.3:c.682G>A, NM_004183.3:c.344delG, NM_004183.3:c.524delG | Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 50 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q12.3. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000. | 250,600 |
| BEST1 | Vitelliform macular dystrophy type 2 | NM_004183.3 | NM_004183.3:c.122T>C, NM_004183.3:c.422G>A | Vitelliform macular dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q12.3. The age of onset is infancy or adolescence. This disease is characterized by normal vision at birth, then progresses through distinct stages that include an asymptomatic previtelliform phase (stage 1) followed by the formation of a yellow, egg yolk-like (vitelliform) lesion in the macula (stage 2). The contents become less homogenous and develop a "scrambled-egg" appearance (stage 2a). The lesion eventually develops a fluid, yellow-colored vitelline substance (pseudohypopyon or stage 3) and finally breaks down, leaving a scar that causes central visual acuity deterioration (20/200). This may be complicated by a subfoveal choroidal neovascular (CNV) membrane (rare in children). Anomalous color discrimination (mainly the protan axis) and metamorphopsia may be observed but patients retain normal peripheral vision and dark adaptation. Some affected individuals remain asymptomatic. The prevalence is 1/5,000 to 1/67,000. | 250,600 |
| BRCA2 | Fanconi anemia, complementation group D1 | NM_000059.3 | NM_000059.3:c.1514T>C, NM_000059.3:c.4648G>T, NM_000059.3:c.8415A>T, NM_000059.3:c.7544C>T, NM_000059.3:c.7994A>G, NM_000059.3:c.5574_5577delAATT, NM_000059.3:c.4889C>G, NM_000059.3:c.4936_4939delGAAA, NM_000059.3:c.5066_5067insA, NM_000059.3:c.6024dupG, NM_000059.3:c.6860delG, NM_000059.3:c.7235C>A, NM_000059.3:c.9382C>T, NM_000059.3:c.9900dupA, NM_000059.3:c.3847_3848delGT, NM_000059.3:c.5718_5719delCT, NM_000059.3:c.5837_5838delCAinsAG, NM_000059.3:c.6023_6024insG, NM_000059.3:c.8503T>C, NM_000059.3:c.6486_6489delACAA, NM_000059.3:c.657_658delTG, NM_000059.3:c.6997_6998insT | Fanconi anemia, complementation group D1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BRCA2 gene located on chromosomal region 13q12.3. The age of onset is infantile. This disease is characterized by physical abnormalities, bone marrow failure, and increased risk of malignancy. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| BRIP1 | Fanconi anemia, complementation group J | NM_032043.2 | NM_032043.2:c.2990_2993delCAAA, NM_032043.2:c.1045G>C, NM_032043.2:c.2237_2240delTCAA, NM_032043.2:c.3209C>A, NM_032043.2:c.502C>T, NM_032043.2:c.139C>G, NM_032043.2:c.1702_1703delAA, NM_032043.2:c.2392C>T | Fanconi anemia, complementation group J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BRIP1 gene located on chromosomal region 17q22.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:1,000,000- 9:1,000,000. | 250,600 |
| BSND | Bartter syndrome type 4A | NM_057176.2 | NM_057176.2:c.1A>T, NM_057176.2:c.22C>T, NM_057176.2:c.3G>A, NM_057176.2:c.10G>T, NM_057176.2:c.23G>T, NM_057176.2:c.35T>C, NM_057176.2:c.23G>A, NM_057176.2:c.139G>A | Bartter syndrome type 4A with deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSND gene located on chromosomal region 1p32.3. The age of onset is neonatal/infantile. This disease is characterized by maternal polyhydramnios, premature delivery, polyuria, sensorineural deafness and is associated with hypokalemic alkalosis, increased levels of plasma renin and aldosterone, low blood pressure, and vascular resistance to angiotensin II. | 250,600 |
| BTD | Biotinidase deficiency | NM_000060.3 | NM_000060.3:c.1531C>G, NM_000060.3:c.1508_1512delGGATG, NM_000060.3:c.1339C>T, NM_000060.3:c.1352G>A, NM_000060.3:c.1489C>T, NM_000060.3:c.643C>T, NM_000060.3:c.664G>A, NM_000060.3:c.755A>G, NM_000060.3:c.1368A>C, NM_000060.3:c.933delT, NM_000060.3:c.1595C>T, NM_000060.3:c.1612C>T, NM_000060.3:c.757C>T, NM_000060.3:c.1106C>T, NM_000060.3:c.1321delG, NM_000060.3:c.794A>T, NM_000060.3:c.595G>A, NM_000060.3:c.629A>G, NM_000060.3:c.631C>T, NM_000060.3:c.235C>T, NM_000060.3:c.334G>C, NM_000060.3:c.511G>A, NM_000060.3:c.184G>A, NM_000060.3:c.557G>A, NM_000060.3:c.583A>G, NM_000060.3:c.968A>G, NM_000060.3:c.528G>T, NM_000060.3:c.443G>A | Biotinidase deficiency an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BTD gene located on chromosomal region 3p25. The age of onset is neonatal/infantile. This disease is characterized by seizures, breathing difficulties, hypotonia, skin rash, alopecia, hearing loss and delayed development. | 250,600 |
| CAPN3 | Limb-girdle muscular dystrophy type 2A | NM_000070.2 | NM_000070.2:c.1838delA, NM_000070.2:c.2120A>G, NM_000070.2:c.1795_1796insA, NM_000070.2:c.1469G>A, NM_000070.2:c.1599_1602delGAGC, NM_000070.2:c.1715G>A, NM_000070.2:c.1743_1745+1delTGAG, NM_000070.2:c.257C>T, NM_000070.2:c.328C>T, NM_000070.2:c.549delA, NM_000070.2:c.2212C>T, NM_000070.2:c.223dupT, NM_000070.2:c.2243G>A, NM_000070.2:c.2251_2254dupGTCA, NM_000070.2:c.2257G>A, NM_000070.2:c.2306G>A, NM_000070.2:c.2361_2363delAGinsTCATCT, NM_000070.2:c.2361_2364delAGinsTCATCT, NM_000070.2:c.2362_2363delAGinsTCATCT, NM_000070.2:c.246G>A, NM_000070.2:c.676G>A, NM_000070.2:c.551C>T, NM_000070.2:c.580delT, NM_000070.2:c.133G>A, NM_000070.2:c.550delA, NM_000070.2:c.1468C>T, NM_000070.2:c.956C>T, NM_000070.2:c.1322delG, NM_000070.2:c.1466G>A, NM_000070.2:c.662G>T, NM_000070.2:c.855_864dupGTTGATTGCA, NM_000070.2:c.1610A>G, NM_000070.2:c.598_612delTTCTGGAGTGCTCTG | Limb-girdle muscular dystrophy type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CAPN3 gene located on chromosomal region 15q15.1. The age of onset is variable. This disease is characterized by symmetrical and selective atrophy and weakness of proximal limb and girdle muscles. The prevalence is 1:100,000- 9:100,000. | 250,600 |
| CBS | Homocystinuria | NM_000071.2 | NM_000071.2:c.1150A>G, NM_000071.2:c.1058C>T, NM_000071.2:c.1136G>A, NM_000071.2:c.341C>T, NM_000071.2:c.1006C>T, NM_000071.2:c.325T>C, NM_000071.2:c.1316G>A, NM_000071.2:c.374G>A, NM_000071.2:c.1265C>T, NM_000071.2:c.1280C>T, NM_000071.2:c.146C>T, NM_000071.2:c.1471C>T, NM_000071.2:c.1616T>C, NM_000071.2:c.162G>A, NM_000071.2:c.833T>C, NM_000071.2:c.904G>A, NM_000071.2:c.919G>A, NM_000071.2:c.393G>C, NM_000071.2:c.415G>A, NM_000071.2:c.430G>A, NM_000071.2:c.434C>T, NM_000071.2:c.502G>A, NM_000071.2:c.526G>T, NM_000071.2:c.572C>T, NM_000071.2:c.676G>A, NM_000071.2:c.689delT, NM_000071.2:c.797G>A, NM_000071.2:c.959T>C, NM_000071.2:c.969G>A, NM_000071.2:c.992C>A, NM_000071.2:c.1330G>A, NM_000071.2:c.1379C>T, NM_000071.2:c.1397C>T, NM_000071.2:c.304A>C | Homocystinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CBS gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by the multiple involvement of the eye, skeleton, central nervous system and vascular system. The prevalence is 1:200,000-1:335,000. | 250,600 |
| CC2D2A | Joubert syndrome type 9 | NM_001080522.2 | NM_001080522.2:c.4179delG, NM_001080522.2:c.3594+1G>A, NM_001080522.2:c.3289delG, NM_001080522.2:c.4582C>T, NM_001080522.2:c.4667A>T, NM_001080522.2:c.2848C>T, NM_001080522.2:c.3364C>T, NM_001080522.2:c.4333C>T, NM_001080522.2:c.4181delG | Joubert syndrome type 9 defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized neonatal hypotonia, developmental delay, intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia, primary position nystagmus and congenital hepatic fibrosis. | 250,600 |
| CC2D2A | Meckel syndrome type 6 | NM_001080522.2 | NM_001080522.2:c.3145C>T, NM_001080522.2:c.2486+1G>C | Meckel syndrome type 6 with hepatic defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized by a combination of renal cysts, developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and polydactyly. | 250,600 |
| CDH23 | Deafness type 12, autosomal recessive | NM_022124.5 | NM_022124.5:c.6442G>A, NM_022124.5:c.5663T>C, NM_022124.5:c.9565C>T, NM_022124.5:c.7823G>A, NM_022124.5:c.902G>A | Non-syndromic autosomal recessive deafness type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. | 250,600 |
| CDH23 | Usher syndrome type 1D | NM_022124.5 | NM_022124.5:c.288+1G>A, NM_022124.5:c.193delC, NM_022124.5:c.6050-9G>A, NM_022124.5:c.3141C>A, NM_022124.5:c.146-2A>G, NM_022124.5:c.4504C>T, NM_022124.5:c.3516_3519delATCC, NM_022124.5:c.3579+2T>C, NM_022124.5:c.3293A>G, NM_022124.5:c.9319+1_9319+4delGTAA, NM_022124.5:c.5237G>A, NM_022124.5:c.1858+2T>G, NM_022124.5:c.6392delC, NM_022124.5:c.7660G>A | Usher syndrome type 1D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by sensorineural deafness, retinitis pigmentosa and progressive vision loss. | 250,600 |
| CDHR1 | Retinitis pigmentosa type 65 | NM_033100.3 | NM_033100.3:c.1485+2T>C, NM_033100.3:c.1463delG, NM_033100.3:c.1110delC, NM_033100.3:c.338delG, NM_033100.3:c.524dupA, NM_033100.3:c.1485+2T>G, NM_033100.3:c.1112delC, NM_033100.3:c.640delG | Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 65 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDHR1 gene located on chromosomal region 10q23.1. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000. | 250,600 |
| CENPJ | Microcephaly primary, type 6, autosomal recessive | NM_018451.4 | NM_018451.4:c.3243_3246delTCAG, NM_018451.4:c.2614delT, NM_018451.4:c.3415G>T, NM_018451.4:c.3653C>T, NM_018451.4:c.2462C>T, NM_018451.4:c.3699_3702dupAATA, NM_018451.4:c.3568_3571dupGTCA, NM_018451.4:c.3843_3844insTA, NM_018451.4:c.757_760delGTCT, NM_018451.4:c.1952_1953insAGTG, NM_018451.4:c.3704A>T, NM_018451.4:c.232_236delCAGAA, NM_018451.4:c.2460_2463delGACG, NM_018451.4:c.2968_2972delAAAAA, NM_018451.4:c.40C>T, NM_018451.4:c.289dupA | Primary autosomal recessive microcephaly type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CENPJ gene located on chromosomal region 13q12.12. The age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. | 250,600 |
| CEP290 | Joubert syndrome, Senior-Loken type | NM_025114.3 | NM_025114.3:c.5611_5614delCAAA, NM_025114.3:c.164_167delCTCA | Joubert syndrome, Senior-Loken type syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infantile. This disease is characterized by symptoms of nephronophthisis such as polyuria, polydipsia, secondary eneuresis and anemia. The progression of the disease can lead to acute or chronic renal insufficiency and finally to end-stage kidney disease. Ocular features include congenital or early-onset severe visual loss, due to retinal dystrophy. In rare occasions, other additional clinical signs may be observed like liver fibrosis, obesity and neurologic disorders.. The prevalence is <1:1,000,000. | 250,600 |
| CEP290 | Joubert syndrome type 5 | NM_025114.3 | NM_025114.3:c.4656delA, NM_025114.3:c.21G>T, NM_025114.3:c.5668G>T | Joubert syndrome with oculorenal defect 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infantile. This disease is characterized by neonatal hypotonia, developmental delay, intellectrual disability, ataxia, abnormal eye movements including oculomotor apraxia, primary position nystagmus and renal and ocular disease. | 250,600 |
| CEP290 | Leber congenital amaurosis type 10 | NM_025114.3 | NM_025114.3:c.7341_7342insA, NM_025114.3:c.4705-1G>T, NM_025114.3:c.4723A>T, NM_025114.3:c.4962_4963delAA, NM_025114.3:c.4916C>A, NM_025114.3:c.6624delG, NM_025114.3:c.6645+1G>A, NM_025114.3:c.7324G>T, NM_025114.3:c.6798G>A, NM_025114.3:c.7394_7395delAG, NM_025114.3:c.1681C>T, NM_025114.3:c.7341delA, NM_025114.3:c.6448_6455delCAGTTGAA, NM_025114.3:c.1665_1666delAA, NM_025114.3:c.384_387delTAGA, NM_025114.3:c.2249T>G, NM_025114.3:c.3185delT, NM_025114.3:c.4393C>T, NM_025114.3:c.1501G>T | Leber congenital amaurosis type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is infancy/neonatal. This disease is characterized by retinal dystrophy defined by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. | 250,600 |
| CEP290 | Meckel syndrome type 4 | NM_025114.3 | NM_025114.3:c.613C>T | Meckel syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is neonatal. This disease is characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically occipital encephalocele), hepatic ductal dysplasia and cysts, and postaxial polydactyly. The prevalence is <1 / 1,000,000. | 250,600 |
| CERKL | Retinitis pigmentosa tipo 26 | NM_201548.4 | NM_201548.4:c.1012C>T, NM_201548.4:c.1090C>T, NM_201548.4:c.312delA, NM_201548.4:c.715C>T, NM_201548.4:c.769C>T, NM_201548.4:c.780delT, NM_201548.4:c.847C>T, NM_201548.4:c.1553_1569dupTTATCAGTCTTTATGGA | Retinitis pigmentosa 26 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CERKL gene located on chromosomal region 2q31.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000. | 250,600 |
| CFH | Complement factor H deficiency | NM_000186.3 | NM_000186.3:c.3628C>T, NM_000186.3:c.2876G>A, NM_000186.3:c.380G>T, NM_000186.3:c.481G>T, NM_000186.3:c.1606T>C | Immunodeficiency with factor H anomaly follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFH gene located on chromosomal region 1q32. This disease is characterized by recurrent bacterial infections and renal failure. | 250,600 |
| CFTR | Cystic fibrosis | NM_000492.3 | NM_000492.3:c.1327_1330dupGATA, NM_000492.3:c.1210-7_1210-6delTT, NM_000492.3:c.125C>T, NM_000492.3:c.1301_1307delCACTTCT, NM_000492.3:c.1397C>A, NM_000492.3:c.1340delA, NM_000492.3:c.1364C>A, NM_000492.3:c.1393-1G>A, NM_000492.3:c.1438G>T, NM_000492.3:c.1466C>A, NM_000492.3:c.1475C>T, NM_000492.3:c.1477C>T, NM_000492.3:c.1516A>G, NM_000492.3:c.1519_1521delATC, NM_000492.3:c.1521_1523delCTT, NM_000492.3:c.1545_1546delTA, NM_000492.3:c.1624G>T, NM_000492.3:c.1692delA, NM_000492.3:c.1706A>G, NM_000492.3:c.1721C>A, NM_000492.3:c.178G>T, NM_000492.3:c.1970delG, NM_000492.3:c.200C>T, NM_000492.3:c.2012delT, NM_000492.3:c.2051_2052delAAinsG, NM_000492.3:c.2052_2053insA, NM_000492.3:c.2052delA, NM_000492.3:c.1000C>T, NM_000492.3:c.1007T>A, NM_000492.3:c.1013C>T, NM_000492.3:c.1021T>C, NM_000492.3:c.1022_1023insTC, NM_000492.3:c.1040G>A, NM_000492.3:c.1040G>C, NM_000492.3:c.1055G>A, NM_000492.3:c.1081delT, NM_000492.3:c.115C>T, NM_000492.3:c.2538G>A, NM_000492.3:c.254G>A, NM_000492.3:c.2551C>T, NM_000492.3:c.2583delT, NM_000492.3:c.262_263delTT, NM_000492.3:c.2657+5G>A, NM_000492.3:c.2668C>T, NM_000492.3:c.273+1G>A, NM_000492.3:c.2737_2738insG, NM_000492.3:c.2739T>A, NM_000492.3:c.274-1G>A, NM_000492.3:c.274G>A, NM_000492.3:c.274G>T, NM_000492.3:c.2780T>C, NM_000492.3:c.2834C>T, NM_000492.3:c.2855T>C, NM_000492.3:c.2869_2870insG, NM_000492.3:c.2875delG, NM_000492.3:c.2908G>C, NM_000492.3:c.292C>T, NM_000492.3:c.2939T>A, NM_000492.3:c.2989-1G>A, NM_000492.3:c.3067_3072delATAGTG, NM_000492.3:c.3140-26A>G, NM_000492.3:c.3194T>C, NM_000492.3:c.3196C>T, NM_000492.3:c.3197G>A, NM_000492.3:c.3230T>C, NM_000492.3:c.325_327delTATinsG, NM_000492.3:c.3266G>A, NM_000492.3:c.3276C>A, NM_000492.3:c.3276C>G, NM_000492.3:c.328G>C, NM_000492.3:c.328G>T, NM_000492.3:c.3302T>A, NM_000492.3:c.3310G>T, NM_000492.3:c.349C>T, NM_000492.3:c.350G>T, NM_000492.3:c.3528delC, NM_000492.3:c.3533_3536delCAAC, NM_000492.3:c.3587C>G, NM_000492.3:c.358G>A, NM_000492.3:c.3611G>A, NM_000492.3:c.3612G>A, NM_000492.3:c.3659delC, NM_000492.3:c.366T>A, NM_000492.3:c.3731G>A, NM_000492.3:c.3744delA, NM_000492.3:c.3752G>A, NM_000492.3:c.3761T>G, NM_000492.3:c.3764C>A, NM_000492.3:c.3773_3774insT, NM_000492.3:c.3846G>A, NM_000492.3:c.3909C>G, NM_000492.3:c.3937C>T, NM_000492.3:c.4056G>T, NM_000492.3:c.4077_4080delinsAA, NM_000492.3:c.4077_4080delTGTTinsAA, NM_000492.3:c.4251delA, NM_000492.3:c.4333G>A, NM_000492.3:c.4426C>T, NM_000492.3:c.442delA, NM_000492.3:c.445G>A, NM_000492.3:c.445G>T, NM_000492.3:c.446G>T, NM_000492.3:c.531delT, NM_000492.3:c.532G>A, NM_000492.3:c.571T>G, NM_000492.3:c.577G>T, NM_000492.3:c.579+1G>T, NM_000492.3:c.579+3A>G, NM_000492.3:c.579+5G>A, NM_000492.3:c.592G>A, NM_000492.3:c.595C>T, NM_000492.3:c.613C>T, NM_000492.3:c.617T>G, NM_000492.3:c.650A>G, NM_000492.3:c.658C>T, NM_000492.3:c.708delT, NM_000492.3:c.722_743delGGAGAATGATGATGAAGTACAG, NM_000492.3:c.803delA, NM_000492.3:c.935_937delTCT, NM_000492.3:c.988G>T, NM_000492.3:c.1046C>T, NM_000492.3:c.14C>T, NM_000492.3:c.1558G>A, NM_000492.3:c.1585-1G>A, NM_000492.3:c.1684G>C, NM_000492.3:c.1766+1G>A, NM_000492.3:c.1397C>G, NM_000492.3:c.1399C>T, NM_000492.3:c.1400T>C, NM_000492.3:c.3380G>A, NM_000492.3:c.3409A>G, NM_000492.3:c.3868C>A, NM_000492.3:c.489+1G>T, NM_000492.3:c.2537G>A, NM_000492.3:c.2125C>T, NM_000492.3:c.2128A>T, NM_000492.3:c.2175_2176insA, NM_000492.3:c.2052dupA, NM_000492.3:c.2195T>G, NM_000492.3:c.2215delG, NM_000492.3:c.223C>T, NM_000492.3:c.2175dupA, NM_000492.3:c.221G>A, NM_000492.3:c.2930C>T, NM_000492.3:c.3205G>A, NM_000492.3:c.2249C>T | Cystic fibrosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFTR gene located on chromosomal region 7q31.2. The age of onset of severe form is neonatal or infantile but there are also variants associated with moderate clinical or late onset. This disease is characterized by the production of sweat with a high salt content, mucus secretions with an abnormal viscosity, chronic bronchitis, pancreatic insufficiency, adolescent diabetes and, more rarely, stercoral obstruction and cirrhosis. Male sterility is a constant feature. Late-onset forms, which are usually only mild or monosymptomatic. The prevalence is 1:10,000-9:10,000. | 250,600 |
| CHST6 | Macular corneal dystrophy | NM_021615.4 | NM_021615.4:c.820G>T, NM_021615.4:c.853delC, NM_021615.4:c.993G>T, NM_021615.4:c.327_328delCT, NM_021615.4:c.392C>A | Macular corneal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CHST6 gene located on chromosomal region 16q22. The age of onset is variable. This disease is characterized by bilateral ill-defined cloudy regions within a hazy stroma, and eventually severe visual impairment. The prevalence is 1:100,000-9:100,000. | 250,600 |
| CLCN1 | Myotonia congenita, autosomal recessive | NM_000083.2 | NM_000083.2:c.1453A>G, NM_000083.2:c.409T>G, NM_000083.2:c.568G>A, NM_000083.2:c.899G>A, NM_000083.2:c.1169G>A, NM_000083.2:c.1238T>G, NM_000083.2:c.871G>A, NM_000083.2:c.180+3A>T, NM_000083.2:c.225dupC, NM_000083.2:c.501C>G, NM_000083.2:c.2680C>T | Myotonia congenita (Becker disease) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN1 gene located on chromosomal region 7q35. The age of onset is neonatal/infantile. This disease is characterized by slow muscle relaxation, that it is relieved with exercise, associated with hyperexcitation of the muscle fibres. The prevalence is 1:100,000. | 250,600 |
| CLDN19 | Hypomagnesemia type 5, renal failure with severe ocular abnormalities | NM_148960.2 | NM_148960.2:c.269T>C, NM_148960.2:c.425_437delCCCTGGTGACCCA, NM_148960.2:c.59G>A, NM_148960.2:c.169C>G, NM_148960.2:c.599G>A | Hypomagnesemia type 5, renal failure with severe ocular abnormalities follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN19 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by excessive magnesium and calcium renal wasting, bilateral nephrocalcinosis, progressive renal failure and severe ocular abnormalities. The prevalence is <1:1,000,000. | 250,600 |
| CLRN1 | Retinitis pigmentosa type 61 | NM_174878.2 | NM_174878.2:c.92C>T | Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 61 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1gene located on chromosomal region 3q25.1. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000. | 250,600 |
| CLRN1 | Usher syndrome type 3A | NM_174878.2 | NM_174878.2:c.591_592insT, NM_174878.2:c.630_631insT, NM_174878.2:c.118T>G, NM_174878.2:c.433+1061A>T, NM_174878.2:c.189C>A, NM_174878.2:c.144T>G | Usher syndrome type 3A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1 gene located on chromosomal region 3q25.1. The age of onset is neonatal/infantile. This disease is characterized by the association of sensorineural deafness with retinitis pigmentosa and progressive vision loss. The prevalence is 1:1.000.000- 9/1.000.000. | 250,600 |
| CNGA1 | Retinitis pigmentosa type 49 | NM_000087.3 | NM_000087.3:c.1747C>T, NM_000087.3:c.1540C>T, NM_000087.3:c.2071T>C, NM_000087.3:c.1927C>T, NM_000087.3:c.1271G>A, NM_000087.3:c.1001G>A, NM_000087.3:c.959C>T, NM_000087.3:c.97_98insA, NM_000087.3:c.449+2T>C, NM_000087.3:c.1972delA, NM_000087.3:c.238G>T, NM_000087.3:c.794G>A, NM_000087.3:c.238G>A | Retinitis pigmentosa 49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGA1 gene located on chromosomal region 4p12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000. | 250,600 |
| CNGB1 | Retinitis pigmentosa tipo 45 | NM_001297.4 | NM_001297.4:c.3150delG, NM_001297.4:c.2762_2765delACGA, NM_001297.4:c.2957A>T, NM_001297.4:c.413-1G>A, NM_001297.4:c.218-2A>G, NM_001297.4:c.2492+2T>G, NM_001297.4:c.3462+1G>A, NM_001297.4:c.2653delG, NM_001297.4:c.3425delT, NM_001297.4:c.1122-2A>T, NM_001297.4:c.1958-1G>A, NM_001297.4:c.952C>T | Retinitis pigmentosa 45 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB1 gene located on chromosomal region 16q13. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000 to 5:10,000. | 250,600 |
| CNGB3 | Achromatopsia type 3 | NM_019098.4 | NM_019098.4:c.2011G>T, NM_019098.4:c.1063C>T, NM_019098.4:c.1208G>A, NM_019098.4:c.1672G>T, NM_019098.4:c.819_826delCAGACTCC, NM_019098.4:c.1148delC, NM_019098.4:c.886_890delACTTC, NM_019098.4:c.2048_2049delCA, NM_019098.4:c.446_447insT, NM_019098.4:c.893_897delCAAAA, NM_019098.4:c.887_896delCTTCTACAAA | Achromatopsia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is neonatal/Infantile. This disease is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, and reduced or complete loss of color discrimination. Most individuals have complete form, with total lack of function in all three types of cones. Rarely, individuals have incomplete form, with similar, but generally less severe symptoms. The prevalence is 1/30,000-1/50,000. | 250,600 |
| CNGB3 | Macular degeneration, juvenile | NM_019098.4 | NM_019098.4:c.1405T>G | Juvenile macular degeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is infancy or adolescence. This disease is characterized by blurred or distorted central vision with dark areas. Normally, side vision is not affected, but the perception of color can vary during the later stages of the disease. | 250,600 |
| COL17A1 | Epidermolysis bullosa, junctional, non-Herlitz type | NM_000494.3 | NM_000494.3:c.1898G>A, NM_000494.3:c.3827_3828insC, NM_000494.3:c.2228-3_2235delCAGGTCCTGCTinsTTG, NM_000494.3:c.1706delC, NM_000494.3:c.2336-2A>G, NM_000494.3:c.3897_3900delATCT, NM_000494.3:c.3908G>A, NM_000494.3:c.2336-1G>T, NM_000494.3:c.2965delA, NM_000494.3:c.3043C>T, NM_000494.3:c.3067C>T, NM_000494.3:c.3277+1G>A, NM_000494.3:c.3676C>T, NM_000494.3:c.4319_4320insC, NM_000494.3:c.433C>T, NM_000494.3:c.520_521delAG, NM_000494.3:c.4003_4004delGG, NM_000494.3:c.2551+1G>T, NM_000494.3:c.3800delC, NM_000494.3:c.2564T>G, NM_000494.3:c.2430_2431insCCGA, NM_000494.3:c.2383C>T, NM_000494.3:c.2944_2947+1delGAAGG | Epidermolysis bullosa, junctional, non-Herlitz type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL17A1 gene located on chromosomal region 10q24.3. The age of onset is neonatal/infantile. This disease is characterized by a generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement. | 250,600 |
| COL18A1 | Knobloch syndrome type 1 | NM_030582.3 | NM_030582.3:c.3367_3379delCCCCCAGGCCCAC, NM_030582.3:c.3493_3501delGGCCCCCCA, NM_030582.3:c.2797C>T, NM_030582.3:c.995_996insGACGTGAAAGAGGGG, NM_030582.3:c.3502_3511delGGCCCCCCAG, NM_030582.3:c.3618_3618+1delGG, NM_030582.3:c.994_995insGGACGTGAAAGAGGG, NM_030582.3:c.3517_3518delCC, NM_030582.3:c.1535_1536insGACGTGAAAGAGGGG, NM_030582.3:c.2589_2590delAG, NM_030582.3:c.4054_4055delCT, NM_030582.3:c.4463_4464insG | Knobloch syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL18A1 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by vitreoretinal and macular degeneration, and occipital encephalocele. The prevalence is <1:1,000,000. | 250,600 |
| COL4A3 | Alport syndrome 3B, autosomal recessive | NM_000091.4 | NM_000091.4:c.345delG, NM_000091.4:c.346C>A, NM_000091.4:c.898G>A, NM_000091.4:c.4421T>C, NM_000091.4:c.2110delC, NM_000091.4:c.343delG, NM_000091.4:c.4420_4424delCTTTT, NM_000091.4:c.5002_*6delAAAAGACACTGAAGCTAA, NM_000091.4:c.2083G>A, NM_000091.4:c.2954G>T, NM_000091.4:c.4484A>G, NM_000091.4:c.4571C>G, NM_000091.4:c.4441C>T | Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn. | 250,600 |
| COL4A4 | Alport syndrome, autosomal recessive | NM_000092.4 | NM_000092.4:c.3713C>A, NM_000092.4:c.4129C>T, NM_000092.4:c.4923C>A, NM_000092.4:c.3601G>A, NM_000092.4:c.2312delG, NM_000092.4:c.71+1G>A | Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn. | 250,600 |
| COL7A1 | Epidermolysis bullosa dystrophica, Hallopeau-Siemens type | NM_000094.3 | NM_000094.3:c.4039G>C, NM_000094.3:c.425A>G, NM_000094.3:c.336C>G, NM_000094.3:c.3809C>T, NM_000094.3:c.4119+1G>T, NM_000094.3:c.6205C>T, NM_000094.3:c.6527_6528insC, NM_000094.3:c.6573+1G>T, NM_000094.3:c.6187C>T, NM_000094.3:c.6752G>A, NM_000094.3:c.6859G>A, NM_000094.3:c.6946G>A, NM_000094.3:c.6670G>T, NM_000094.3:c.1907G>T, NM_000094.3:c.2471_2472insG, NM_000094.3:c.7440+4delC, NM_000094.3:c.7912G>T, NM_000094.3:c.7930-1G>C, NM_000094.3:c.7957G>A, NM_000094.3:c.8245G>A, NM_000094.3:c.8371C>T, NM_000094.3:c.8393T>A, NM_000094.3:c.8440C>T, NM_000094.3:c.8479C>T, NM_000094.3:c.8524_8527+10delGAAGGTGAGGACAG, NM_000094.3:c.887delG, NM_000094.3:c.933C>A, NM_000094.3:c.238G>T, NM_000094.3:c.3831+1G>T, NM_000094.3:c.4373C>T, NM_000094.3:c.6091G>A, NM_000094.3:c.4888C>T, NM_000094.3:c.5052+1G>A, NM_000094.3:c.5096C>T, NM_000094.3:c.4783G>C, NM_000094.3:c.5443G>C, NM_000094.3:c.5532+1G>A, NM_000094.3:c.5821-1G>A, NM_000094.3:c.5287C>T, NM_000094.3:c.706C>T, NM_000094.3:c.7345-1G>A, NM_000094.3:c.592G>A, NM_000094.3:c.7411C>T | Epidermolysis bullosa dystrophica, Hallopeau-Siemens type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL7A1 gene located on chromosomal region 3p21.1. The age of onset is neonatal/infantile. This disease is characterized by generalized cutaneous and mucosal blistering and scarring associated with severe deformities and major extracutaneous involvement. The prevalence is <1:1,000,000. | 250,600 |
| COQ2 | Primary coenzyme Q10 deficiency type 1 | NM_015697.7 | NM_015697.7:c.683A>G, NM_015697.7:c.1197delT, NM_015697.7:c.590G>A, NM_015697.7:c.723delT, NM_015697.7:c.890A>G | Coenzyme Q10 deficiency, primary follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ2 gene located on chromosomal region 4q21.23. The age of onset is neonatal/infantile. The phenotypes include an encephalomyopathic form with seizures and ataxia; a multisystem infantile form with encephalopathy, cardiomyopathy and renal failure; a predominantly cerebellar form with ataxia and cerebellar atrophy; Leigh syndrome with growth retardation; and an isolated myopathic form. | 250,600 |
| CPT2 | Carnitine palmitoyltransferase deficiency, type 2 | NM_000098.2 | NM_000098.2:c.1239_1240delGA, NM_000098.2:c.1369A>T, NM_000098.2:c.1237C>T, NM_000098.2:c.680C>T, NM_000098.2:c.1437C>G, NM_000098.2:c.149C>A, NM_000098.2:c.1784delC, NM_000098.2:c.886C>T, NM_000098.2:c.1763C>G, NM_000098.2:c.359A>G, NM_000098.2:c.370C>T, NM_000098.2:c.1883A>C, NM_000098.2:c.1891C>T, NM_000098.2:c.1148T>A, NM_000098.2:c.638A>G, NM_000098.2:c.725_726delAC, NM_000098.2:c.452G>A, NM_000098.2:c.338C>T, NM_000098.2:c.481C>T, NM_000098.2:c.464dupT, NM_000098.2:c.520G>A | Carnitine palmitoyl transferase type 2 deficiency, infantile form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT2 gene located on chromosomal region 1p32. The age of onset is neonatal/infantile. This disease is characterized by a severe fasting intolerance leading to metabolic derangements of hypoketotic hypoglycemia, resulting in coma and seizures, and hepatic encephalopathy leading to liver failure. The prevalence is <1:1,000,000. | 250,600 |
| CRB1 | Leber congenital amaurosis type 8 | NM_201253.2 | NM_201253.2:c.3299T>G, NM_201253.2:c.3383delT, NM_201253.2:c.3419T>A, NM_201253.2:c.3094G>A, NM_201253.2:c.936T>G, NM_201253.2:c.493_501delGATGGAATT, NM_201253.2:c.3997G>T, NM_201253.2:c.498_506delAATTGATGG, NM_201253.2:c.2688T>A, NM_201253.2:c.613_619delATAGGAA, NM_201253.2:c.2401A>T, NM_201253.2:c.610_616delGAAATAG | Leber congenital amaurosis follows an autosomal recessive pattern of inheritance. Type 8 is caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. The age of onset is neonatal/infancy. This disease comprises a group of early-onset childhood retinal dystrophies characterized by vision loss, nystagmus, and severe retinal dysfunction. Patients usually present at birth with profound vision loss and pendular nystagmus. Electroretinogram responses are usually nonrecordable. Other clinical findings may include high hypermetropia, photodysphoria, oculodigital sign, keratoconus, cataracts, and a variable appearance to the fundus. | 250,600 |
| CRB1 | Pigmented paravenous chorioretinal atrophy | NM_201253.2 | NM_201253.2:c.484G>A | Pigmented paravenous chorioretinal atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRB1 gene located on chromosomal region 19p12. The age of onset is variable. This disease is characterized by an unusual retinal degeneration characterized by accumulation of pigmentation along retinal veins. | 250,600 |
| CRB1 | Retinitis pigmentosa type 12 | NM_201253.2 | NM_201253.2:c.3053_3054insTTATA, NM_201253.2:c.3122T>C, NM_201253.2:c.2416G>T, NM_201253.2:c.2843G>A, NM_201253.2:c.3299T>C, NM_201253.2:c.2983G>T, NM_201253.2:c.2290C>T | Retinitis pigmentosa 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000. | 250,600 |
| CRX | Leber congenital amaurosis type 7 | NM_000554.4 | NM_000554.4:c.425A>G, NM_000554.4:c.196G>A, NM_000554.4:c.898T>C | Leber congenital amaurosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CRX gene located on chromosomal region 19q13.3. The age of onset is neonatal/infantile. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. The prevalence is 2:100,000-3:100,000 newborn. | 250,600 |
| CTNS | Cystinosis, ocular nonnephropathic | NM_004937.2 | NM_004937.2:c.589G>A, NM_004937.2:c.853-3C>G | Ocular non nephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. It presents typical ocular findings of nephropathic cystinosis. However, systemic manifestations are absent and kidney disease does not occur. The prevalence is 1:100,000-1:200,000. | 250,600 |
| CTNS | Nephropathic cystinosis | NM_004937.2 | NM_004937.2:c.416C>T, NM_004937.2:c.414G>A, NM_004937.2:c.124G>A, NM_004937.2:c.357_360delCAGC, NM_004937.2:c.397_398delAT, NM_004937.2:c.1015G>A, NM_004937.2:c.646dupA, NM_004937.2:c.283G>T, NM_004937.2:c.329G>T, NM_004937.2:c.506G>A | Nephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. This disease is characterized by hypothyroidism, insulin-dependent diabetes, hepatosplenomegaly with portal hypertension, and muscle, cerebral and ocular involvement, caused by cystine deposits in various organs. The prevalence is 1:100,000-1:200,000. | 250,600 |
| CTSK | Pycnodysostosis | NM_000396.3 | NM_000396.3:c.236G>A, NM_000396.3:c.154A>T, NM_000396.3:c.436G>C, NM_000396.3:c.926T>C, NM_000396.3:c.721C>T | Pycnodysostosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSK gene located on chromosomal region 1q21. The age of onset is variable. This disease is characterized by osteosclerosis, short stature or dwarfism, acroosteolysis of the distal phalanges, fragile bones associated with spontaneous fractures and dysplasia of the clavicles. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| CYP4V2 | Bietti crystalline corneoretinal dystrophy | NM_207352.3 | NM_207352.3:c.1523G>A, NM_207352.3:c.130T>A, NM_207352.3:c.327+1G>A, NM_207352.3:c.332T>C | Bietti crystalline corneoretinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP4V2 gene located on chromosomal region 4q35.2. The age of onset is adult. This disease is characterized by nightblindness, decreased vision, paracentral scotoma, and, in the end stages of the disease, legal blindness. | 250,600 |
| CYP7B1 | Congenital bile acid synthesis defect type 3 | NM_004820.3 | NM_004820.3:c.1162C>T | Congenital bile acid synthesis defect type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by severe neonatal cholestatic liver disease. The prevalence is below 1,000,000. | 250,600 |
| CYP7B1 | Spastic paraplegia type 5A, autosomal recessive | NM_004820.3 | NM_004820.3:c.1460_1461insT, NM_004820.3:c.321_324delACAA, NM_004820.3:c.825T>A, NM_004820.3:c.889A>G, NM_004820.3:c.1456C>T, NM_004820.3:c.187C>T | Autosomal recessive spastic paraplegia type 5A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. The prevalence is below 1,000,000. | 250,600 |
| D2HGDH | D-2-Hydroxyglutaric aciduria | NM_152783.4 | NM_152783.4:c.1315A>G, NM_152783.4:c.1276G>A, NM_152783.4:c.440T>G, NM_152783.4:c.1333_1334delAC, NM_152783.4:c.1123G>T, NM_152783.4:c.1331T>C | D-2-Hydroxyglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the D2HGDH gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by extremely variable clinical manifestations, with severe cases characterized by neonatal or early infantile-onset epileptic encephalopathy, and marked hypotonia, and cerebral visual failure, developmental delay, seizures, involuntary movements, and cardiomyopathy are also common in these cases. The prevalence is below 1,000,000. | 250,600 |
| DBT | Maple syrup urine disease type 2 | NM_001918.3 | NM_001918.3:c.670G>T, NM_001918.3:c.827T>G, NM_001918.3:c.294C>G, NM_001918.3:c.581C>G, NM_001918.3:c.772+1G>A, NM_001918.3:c.272_275delCAGT, NM_001918.3:c.1281+1G>A, NM_001918.3:c.871C>T, NM_001918.3:c.901C>T, NM_001918.3:c.939G>C, NM_001918.3:c.126T>G | Maple syrup urine disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DBT gene located on chromosomal region 1p31. The age of onset is neonatal/infantile. This disease is characterized by a maple syrup odor in the cerumen at birth, poor feeding, lethargy and focal dystonia, followed by progressive encephalopathy and central respiratory failure if untreated. The prevalence is 1/10,000 to 5/10,000. | 250,600 |
| DCLRE1C | Omenn syndrome | NM_001033855.2 | NM_001033855.2:c.2T>C | Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. | 250,600 |
| DCLRE1C | Severe combined immunodeficiency due to DCLRE1C deficiency | NM_001033855.2 | NM_001033855.2:c.1558_1559insA, NM_001033855.2:c.597C>A, NM_001033855.2:c.780+1delG, NM_001033855.2:c.1639G>T, NM_001033855.2:c.1903_1904insA, NM_001033855.2:c.457G>A, NM_001033855.2:c.1559_1560insA | Severe combined immunodeficiency due to DCLRE1C deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DCLRE1C gene located on chromosomal region 10p13. The age of onset is neonatal/infantile. This disease is characterized by severe and recurrent infections, diarrhea, failure to thrive, and cell sensitivity to ionizing radiation. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| DFNB31 | Deafness type 31, autosomal recessive | NM_015404.3 | NM_015404.3:c.1135C>T, NM_015404.3:c.817C>T | Deafness, autosomal recessive type 31 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DFNB31 gene located on chromosomal region 9q32. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. | 250,600 |
| DGUOK | Mitochondrial DNA depletion syndrome type 3 | NM_080916.2 | NM_080916.2:c.137A>G, NM_080916.2:c.707+2T>G, NM_080916.2:c.763G>T, NM_080916.2:c.425G>A, NM_080916.2:c.313C>T, NM_080916.2:c.494A>T | Mitochondrial DNA depletion syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DGUOK gene located on chromosomal region 2p13. The age of onset is neonatal/infantile. This disease is characterized by progressive liver failure, hypoglycemia and neurologic abnormalities including hypotonia, encephalopathy and peripheral neuropathy | 250,600 |
| DHCR7 | Smith-Lemli-Opitz syndrome | NM_001360.2 | NM_001360.2:c.1055G>A, NM_001360.2:c.1210C>T, NM_001360.2:c.1054C>T, NM_001360.2:c.461C>G, NM_001360.2:c.151C>T, NM_001360.2:c.1031G>A, NM_001360.2:c.453G>A, NM_001360.2:c.506C>T, NM_001360.2:c.356A>T, NM_001360.2:c.1228G>A, NM_001360.2:c.1A>G, NM_001360.2:c.976G>T, NM_001360.2:c.964-1G>C, NM_001360.2:c.682C>T, NM_001360.2:c.452G>A, NM_001360.2:c.1337G>A, NM_001360.2:c.1342G>A, NM_001360.2:c.730G>A, NM_001360.2:c.292C>T, NM_001360.2:c.904T>C, NM_001360.2:c.907G>A, NM_001360.2:c.841G>A, NM_001360.2:c.744G>T, NM_001360.2:c.724C>T, NM_001360.2:c.725G>A, NM_001360.2:c.866C>T, NM_001360.2:c.278C>T, NM_001360.2:c.839A>G, NM_001360.2:c.832-1G>C | Smith-Lemli-Opitz syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHCR7 gene located on chromosomal region 11q13.4. The age of onset is neonatal/infantile. This disease is characterized by multiple congenital anomalies, intellectual deficit, and behavioral problems. The prevalence is 1/20,000 to 1/40,000 newborn. | 250,600 |
| DPYD | Dihydropyrimidine dehydrogenase deficiency | NM_000110.3 | NM_000110.3:c.775A>G, NM_000110.3:c.1679T>G, NM_000110.3:c.299_302delTCAT, NM_000110.3:c.703C>T, NM_000110.3:c.1109_1110delTA, NM_000110.3:c.1905+1G>A, NM_000110.3:c.257C>T | Dihydropyrimidine dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPYD gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterised by mental and motor retardation and convulsions. | 250,600 |
| DSP | Cardiomyopathy, arrhythmogenic | NM_004415.2 | NM_004415.2:c.7000C>T, NM_004415.2:c.88G>A, NM_004415.2:c.6370_6371delCT, NM_004415.2:c.7180_7181delAG, NM_004415.2:c.643G>A, NM_004415.2:c.3098delA, NM_004415.2:c.8188C>T | Cardiomyopathy, arrhythmogenic follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is a heart condition in which the heart muscle fibers are gradually replaced by fibrous or fibro-fatty tissue, causing abnormal heart electrical rhythms and heart failure. Consequently pumping blood to the body is weakened and sometimes leads to sudden cardiac death. The prevalence is below 1,000,000. | 250,600 |
| DSP | Cardiomyopathy, dilated, with woolly hair and keratoderma | NM_004415.2 | NM_004415.2:c.5513G>A | Cardiomyopathy, dilated, with woolly hair and keratoderma follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterized by a generalized striate keratoderma particularly affecting the palmoplantar epidermis, woolly hair, and dilated left ventricular cardiomyopathy. The prevalence is below 1,000,000. | 250,600 |
| DSP | Lethal acantholytic epidermolysis bullosa | NM_004415.2 | NM_004415.2:c.5800C>T | Lethal acantholytic epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterised by generalized oozing erosions, usually in the absence of blisters. The prevalence is below 1,000,000. | 250,600 |
| DYSF | Dysferlinopathy | NM_003494.3 | NM_003494.3:c.1398-2A>G, NM_003494.3:c.1392dupA, NM_003494.3:c.1398-1G>A, NM_003494.3:c.5266C>T, NM_003494.3:c.1620delA, NM_003494.3:c.1481-1G>A, NM_003494.3:c.3041A>G, NM_003494.3:c.3985C>G, NM_003494.3:c.4090C>T, NM_003494.3:c.5713C>T, NM_003494.3:c.1053+1G>A, NM_003494.3:c.200_201delTGinsAT, NM_003494.3:c.2869C>T, NM_003494.3:c.2870_2874delAGACC, NM_003494.3:c.458-390C>T, NM_003494.3:c.757C>T, NM_003494.3:c.3065G>A, NM_003494.3:c.393_394delCC, NM_003494.3:c.3859A>T, NM_003494.3:c.5429G>A, NM_003494.3:c.3130C>T, NM_003494.3:c.3444_3445delTGinsAA, NM_003494.3:c.1638+2T>A, NM_003494.3:c.4108_4109delGT, NM_003494.3:c.3641delC, NM_003494.3:c.1368C>A, NM_003494.3:c.4872_4876delGCCCGinsCCCC, NM_003494.3:c.5341-2A>C, NM_003494.3:c.509C>A, NM_003494.3:c.5836_5839delCAGC, NM_003494.3:c.5644C>T, NM_003494.3:c.1861G>C, NM_003494.3:c.5429+1G>T, NM_003494.3:c.3957delC, NM_003494.3:c.5998C>T, NM_003494.3:c.3724C>T, NM_003494.3:c.5525+1G>A, NM_003494.3:c.3477C>A, NM_003494.3:c.3708delA, NM_003494.3:c.5992G>T, NM_003494.3:c.3113G>C, NM_003494.3:c.1216T>C, NM_003494.3:c.3903delG | Dysferlinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. Dysferlinopathy includes a spectrum of muscle disease characterized by two main phenotypes: Miyoshi myopathy with primarily distal weakness and limb-girdle muscular dystrophy type 2B (LGMD2B) with primarily proximal weakness. Miyoshi myopathy (median age of onset 19 years) is characterized by muscle weakness and atrophy, most marked in the distal parts of the legs, especially the gastrocnemius and soleus muscles. Over a period of years, the weakness and atrophy spread to the thighs and gluteal muscles. The forearms may become mildly atrophic with decrease in grip strength; the small muscles of the hands are spared. LGMD2B is characterized by early weakness and atrophy of the pelvic and shoulder girdle muscles in adolescence or young adulthood, with slow progression. Other phenotypes are scapuloperoneal syndrome, distal myopathy with anterior tibial onset, elevated serum CK concentration only, and congenital muscular dystrophy. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| DYSF | Miyoshi myopathy | NM_003494.3 | NM_003494.3:c.1555G>A, NM_003494.3:c.5509G>A, NM_003494.3:c.5077C>T, NM_003494.3:c.5698_5699delAG, NM_003494.3:c.3892A>G, NM_003494.3:c.286A>C, NM_003494.3:c.1120G>C, NM_003494.3:c.1284+2T>C, NM_003494.3:c.5497G>T, NM_003494.3:c.3478C>T, NM_003494.3:c.2997G>T, NM_003494.3:c.3121C>T, NM_003494.3:c.1813C>T, NM_003494.3:c.3181_3182insAGGCGG, NM_003494.3:c.937+1G>A, NM_003494.3:c.3158T>G, NM_003494.3:c.1276G>A, NM_003494.3:c.701G>A, NM_003494.3:c.610C>T, NM_003494.3:c.5594delG, NM_003494.3:c.3112C>T, NM_003494.3:c.4199C>A, NM_003494.3:c.5999G>A, NM_003494.3:c.4756C>T, NM_003494.3:c.6124C>T, NM_003494.3:c.2966C>T, NM_003494.3:c.663+1G>C, NM_003494.3:c.3175-2A>T, NM_003494.3:c.895G>T, NM_003494.3:c.4985C>T, NM_003494.3:c.6203C>T | Miyoshi myopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. This disease is characterised by weakness in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| DYSF | Muscular dystrophy, limb girdle type 2B | NM_003494.3 | NM_003494.3:c.5979dupA, NM_003494.3:c.565C>G, NM_003494.3:c.1663C>T, NM_003494.3:c.1873G>T, NM_003494.3:c.1834C>T, NM_003494.3:c.5201A>G, NM_003494.3:c.895G>A, NM_003494.3:c.3805G>T, NM_003494.3:c.4003G>A, NM_003494.3:c.4253G>A | Muscular dystrophy, limb girdle type 2B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is adult. This disease is characterised by limb-girdle weakness and atrophy mostly in the shoulder pelvic girdle. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| EDA | Hypohidrotic ectodermal dysplasia, X-linked | NM_001399.4 | NM_001399.4:c.206G>T, NM_001399.4:c.463C>T, NM_001399.4:c.187G>A, NM_001399.4:c.573_574insT, NM_001399.4:c.466C>T, NM_001399.4:c.826C>T, NM_001399.4:c.183C>G, NM_001399.4:c.181T>C, NM_001399.4:c.467G>A, NM_001399.4:c.671G>C, NM_001399.4:c.1045G>A | Hypohidrotic ectodermal dysplasia follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EDA gene located on chromosomal region Xq12-q13.1. The age of onset is neonatal/infantile. This disease is characterized by malformation of ectodermal structures such as skin, hair, teeth and sweat glands. The prevalence is 1/5,000 to 1/10,000 newborns. | 250,600 |
| ENO3 | Glycogen storage disease type 13 | NM_053013.3 | NM_053013.3:c.667+1G>T, NM_053013.3:c.1121G>A, NM_053013.3:c.953delA, NM_053013.3:c.692_707dupTCCAGGCGGCTGGTTA, NM_053013.3:c.467G>A, NM_053013.3:c.1303T>C | Glycogen storage disease type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ENO3 gene located on chromosomal region 17p13.2. The age of onset is adult. This disease is characterised by exercise intolerance and myalgia due to severe enolase deficiency in muscle. The prevalence is below 1/1,000,000. | 250,600 |
| ERCC2 | Trichothiodystrophy | NM_000400.3 | NM_000400.3:c.1972C>T | Trichothiodystrophy is a heterogeneous group of disorders that follows an autosomal recessive pattern of inheritance. It is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.32. The age of onset is neonatal or infantile. This disease is characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. The abnormalities are usually obvious at birth, with variable clinical expression. | 250,600 |
| ERCC2 | Xeroderma pigmentosum complementation group D | NM_000400.3 | NM_000400.3:c.1308-1G>A, NM_000400.3:c.1454T>C, NM_000400.3:c.1621A>C, NM_000400.3:c.1703_1704delTT, NM_000400.3:c.1381C>G, NM_000400.3:c.719-1G>A, NM_000400.3:c.2230_2233dupCTAG, NM_000400.3:c.183+2T>A, NM_000400.3:c.567G>A, NM_000400.3:c.1354C>T, NM_000400.3:c.2047C>T, NM_000400.3:c.1304T>G, NM_000400.3:c.2176C>T, NM_000400.3:c.950-2A>G, NM_000400.3:c.949+1G>A | Xeroderma pigmentosum complementation group D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.3. The age of onset is variable. This disease is characterised by typical xeroderma pigmentosum manifestations (photosensitivity of skin with burning, freckling, and dryness of skin, skin cancers) associated with a spectrum of neurological anomalies (from no abnormality to severe neurological disease). | 250,600 |
| ERCC4 | Xeroderma pigmentosum complementation group F | NM_005236.2 | NM_005236.2:c.49G>T, NM_005236.2:c.1467_1468insA, NM_005236.2:c.2281_2284delTTTG, NM_005236.2:c.2T>C, NM_005236.2:c.538_539delAG, NM_005236.2:c.706T>C, NM_005236.2:c.2395C>T | Xeroderma pigmentosum complementation group F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC4 gene located on chromosomal region 16p13.12. The age of onset is variable. This disease is characterised very mild skin symptoms and no ocular or neurological disease. The prevalence is 1/1,000,000. | 250,600 |
| ERCC5 | Xeroderma pigmentosum complementation group G | NM_000123.3 | NM_000123.3:c.2620G>A, NM_000123.3:c.463_464insA, NM_000123.3:c.526C>T, NM_000123.3:c.88+2T>C, NM_000123.3:c.2144dupA, NM_000123.3:c.2375C>T, NM_000123.3:c.381-2A>G, NM_000123.3:c.2573T>C, NM_000123.3:c.406C>T, NM_000123.3:c.215C>A, NM_000123.3:c.787C>T, NM_000123.3:c.2751delA | Xeroderma pigmentosum complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC5 gene located on chromosomal region 13q33. The age of onset is variable. This disease is characterised by variable clinical manifestations, as some patients present with a mild xeroderma pigmentosum phenotype (UV sensitivity, hyper- or hypo-pigmented skin lesions and increased incidence of skin cancer) and others combine symptoms of xeroderma pigmentosum with systemic and neurological manifestations of Cockayne syndrome. The prevalence is 1/1,000,000. | 250,600 |
| ERCC6 | Cerebrooculofacioskeletal syndrome tipo 1 | NM_000124.3 | NM_000124.3:c.2047C>T | Cerebrooculofacioskeletal syndrome tipo 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterised by congenital microcephaly, congenital cataract and/or microphthalmia, arthrogryposis, severe psychomotor developmental delay, height-weight growth delay (principally postnatal) and facial dysmorphism (prominent metopic suture, micrognathism). The prevalence is below 1,000,000. | 250,600 |
| ERCC6 | Cockayne syndrome type B | NM_000124.3 | NM_000124.3:c.207_208insG, NM_000124.3:c.2203C>T, NM_000124.3:c.1357C>T, NM_000124.3:c.48_49delCT, NM_000124.3:c.3592_3593insGA, NM_000124.3:c.422+1G>A, NM_000124.3:c.1550G>A, NM_000124.3:c.3284C>G, NM_000124.3:c.2587C>T, NM_000124.3:c.3862C>T | Cockayne syndrome type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterised by growth failure at birth, with little or no postnatal neurologic development. | 250,600 |
| EYS | Retinitis pigmentosa type 25 | NM_001142800.1 | NM_001142800.1:c.5044G>T, NM_001142800.1:c.9036delT, NM_001142800.1:c.490C>T, NM_001142800.1:c.5928-2A>G, NM_001142800.1:c.571dupA, NM_001142800.1:c.4597_4613delTCAAGCAACCAGAGACT, NM_001142800.1:c.7822C>T, NM_001142800.1:c.5857G>T, NM_001142800.1:c.6170delA, NM_001142800.1:c.8569G>T, NM_001142800.1:c.232delT, NM_001142800.1:c.6102_6103insT, NM_001142800.1:c.8834G>A, NM_001142800.1:c.1211_1212insA, NM_001142800.1:c.4350_4356delTATAGCT, NM_001142800.1:c.4469_4470insAGCCCCTC, NM_001142800.1:c.8648_8655delCATGCAGA, NM_001142800.1:c.4120C>T, NM_001142800.1:c.863-4_863-3insT, NM_001142800.1:c.8629_8632dupACAG, NM_001142800.1:c.9299_9302delCTCA, NM_001142800.1:c.103C>T, NM_001142800.1:c.2826_2827delAT, NM_001142800.1:c.4045C>T, NM_001142800.1:c.5757_5758insT, NM_001142800.1:c.8408dupA, NM_001142800.1:c.7095T>G, NM_001142800.1:c.3329C>G, NM_001142800.1:c.9405T>A | Retinitis pigmentosa 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EYS gene located on chromosomal region 6q12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000. | 250,600 |
| F11 | Factor 11 deficiency | NM_000128.3 | NM_000128.3:c.1613C>T, NM_000128.3:c.166T>C, NM_000128.3:c.403G>T, NM_000128.3:c.731A>G, NM_000128.3:c.809A>T, NM_000128.3:c.1693G>A, NM_000128.3:c.1211C>A, NM_000128.3:c.901T>C, NM_000128.3:c.595+3A>G, NM_000128.3:c.438C>A | Factor 11 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F11 gene located on chromosomal region 4q35. The age of onset is variable. This disease is characterized by reduced levels and activity of factor XI resulting in moderate bleeding symptoms, usually occurring after trauma or surgery. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| F5 | Factor 5 deficiency | NM_000130.4 | NM_000130.4:c.4876delA, NM_000130.4:c.439G>T, NM_000130.4:c.6419G>A, NM_000130.4:c.2401C>T, NM_000130.4:c.5521G>A, NM_000130.4:c.1083G>A, NM_000130.4:c.5189A>G, NM_000130.4:c.3799delC, NM_000130.4:c.6304C>T | Factor 5 deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F5 gene located on chromosomal region 1q23. The age of onset is variable. This disease is characterized by mild to severe bleeding symptoms usually occurring after trauma or surgery. In severe forms of the disease, there can be a risk of intracranial, pulmonary or gastrointestinal bleedings. The severity of the bleeding manifestations correlates with the FV levels. The prevalence is 1/5,000. | 250,600 |
| F5 | Thrombosis | NM_000130.4 | NM_000130.4:c.1000A>G | Deep venous thrombosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F5 gene located on chromosomal region 1q23. The age of onset is variable. This disease is characterized by a poor anticoagulant response to activated Protein C and an increased risk for venous thromboembolism. Deep venous thrombosis and pulmonary embolism are the most common manifestations, but thrombosis in unusual locations also occurs. The prevalence is 1/5,000. | 250,600 |
| F9 | Hemophilia B | NM_000133.3 | NM_000133.3:c.1150C>T, NM_000133.3:c.52T>C, NM_000133.3:c.1031T>C, NM_000133.3:c.82T>C, NM_000133.3:c.1136G>A, NM_000133.3:c.79G>A, NM_000133.3:c.19A>T, NM_000133.3:c.80A>T | Hemophilia B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F9 gene located on chromosomal region Xq27.1-q27.2. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor IX deficiency. The prevalence is 1/100,000 to 9/100,000. | 250,600 |
| FAH | Tyrosinemia type 1 | NM_000137.2 | NM_000137.2:c.1141A>G, NM_000137.2:c.1069G>T, NM_000137.2:c.1090G>T, NM_000137.2:c.401C>A, NM_000137.2:c.456G>A, NM_000137.2:c.192G>T, NM_000137.2:c.607-6T>G, NM_000137.2:c.707-1G>A, NM_000137.2:c.939delC, NM_000137.2:c.103G>A, NM_000137.2:c.982C>T, NM_000137.2:c.837+1G>A, NM_000137.2:c.1009G>A, NM_000137.2:c.47A>T, NM_000137.2:c.554-1G>T, NM_000137.2:c.1027G>T, NM_000137.2:c.1062+5G>A, NM_000137.2:c.786G>A, NM_000137.2:c.1021C>T, NM_000137.2:c.782C>T | Tyrosinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAH gene located on chromosomal region 15q25.1. The age of onset is variable. This disease is characterized by progressive liver disease, renal tubular dysfunction, porphyria-like crises and a dramatic improvement in prognosis following treatment with nitisinone. The birth incidence is 1/100,000, notably in Québec, Canada, and the prevalence is 1/100,000 to 1/120,000 newborns. | 250,600 |
| FANCA | Fanconi anemia, complementation group A | NM_000135.2 | NM_000135.2:c.3788_3790delTCT, NM_000135.2:c.2303T>C, NM_000135.2:c.3558_3559insG, NM_000135.2:c.4130C>G, NM_000135.2:c.233_236delTTGA, NM_000135.2:c.3763G>T, NM_000135.2:c.1115_1118delTTGG, NM_000135.2:c.131_132insA | Fanconi anemia complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCA gene located on chromosomal region 16q24.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| FANCC | Fanconi anemia, complementation group C | NM_000136.2 | NM_000136.2:c.1642C>T, NM_000136.2:c.37C>T, NM_000136.2:c.996+1G>T, NM_000136.2:c.67delG, NM_000136.2:c.416G>A, NM_000136.2:c.1015delA, NM_000136.2:c.1487T>G, NM_000136.2:c.1103_1104delTG | Fanconi anemia complementation group C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCC gene located on chromosomal region 9q22.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| FANCD2 | Fanconi anemia, complementation group D2 | NM_033084.3 | NM_033084.3:c.1278+1delG, NM_033084.3:c.2152C>T, NM_033084.3:c.2494+2T>C, NM_033084.3:c.958C>T, NM_033084.3:c.2444G>A, NM_033084.3:c.782A>T, NM_033084.3:c.904C>T | Fanconi anemia complementation group D2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCD2 gene located on chromosomal region 3p26. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| FANCG | Fanconi anemia, complementation group G | NM_004629.1 | NM_004629.1:c.1795_1804delTGGATCCGTC, NM_004629.1:c.313G>T, NM_004629.1:c.637_643delTACCGCC, NM_004629.1:c.1480+1G>C, NM_004629.1:c.1852_1853delAA, NM_004629.1:c.510+1G>A, NM_004629.1:c.1077-2A>G, NM_004629.1:c.908_909insCT | Fanconi anemia complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCG gene located on chromosomal region 9p13. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| FANCI | Fanconi anemia, complementation group I | NM_001113378.1 | NM_001113378.1:c.3816+1G>A, NM_001113378.1:c.52C>T, NM_001113378.1:c.989_991delTAA, NM_001113378.1:c.2097C>G, NM_001113378.1:c.3466G>C, NM_001113378.1:c.2292-1G>A, NM_001113378.1:c.3492delG, NM_001113378.1:c.3853C>T, NM_001113378.1:c.3626_3627delGT, NM_001113378.1:c.3854G>A | Fanconi anemia complementation group I follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCI gene located on chromosomal region 15q26.1. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| FANCL | Fanconi anemia, complementation group L | NM_018062.3 | NM_018062.3:c.1051_1052delAG, NM_018062.3:c.1066_1067delAG, NM_018062.3:c.1096_1099dupATTA, NM_018062.3:c.1099_1100insATTA | Fanconi anemia complementation group L follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCL gene located on chromosomal region 2p16.1. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| FANCM | Fanconi anemia, complementation group M | NM_020937.2 | NM_020937.2:c.2171C>A, NM_020937.2:c.5766_5769delGACT, NM_020937.2:c.5101C>T, NM_020937.2:c.1072G>T, NM_020937.2:c.2996_2997insC, NM_020937.2:c.2586_2589delAAAA, NM_020937.2:c.5791C>T, NM_020937.2:c.624_625delAA, NM_020937.2:c.5569G>A, NM_020937.2:c.5764_5767delCTGA | Fanconi anemia complementation group M follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCM gene located on chromosomal region 14q21.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| FGB | Congenital afibrinogenemia | NM_005141.4 | NM_005141.4:c.1289G>A, NM_005141.4:c.1148T>G, NM_005141.4:c.794C>T | Congenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGB gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000. | 250,600 |
| FIG4 | Charcot-Marie-Tooth disease type 4J | NM_014845.5 | NM_014845.5:c.592C>T, NM_014845.5:c.831_838delTAAATTTG, NM_014845.5:c.547C>T, NM_014845.5:c.501C>G, NM_014845.5:c.737G>A, NM_014845.5:c.122T>C, NM_014845.5:c.2296_2297insG | Charcot-Marie-Tooth disease type 4J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by rapidly progressive, asymmetric motor neuron degeneration with slow nerve conduction velocities, weakness and paralysis, without sensory loss. The prevalence is 4/100,000 to 8/100,000. | 250,600 |
| FIG4 | Yunis-Varon syndrome | NM_014845.5 | NM_014845.5:c.311G>A | Yunis-Varon syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by skeletal defects, including cleidocranial dysplasia and digital anomalies, and severe neurologic involvement with neuronal loss. Enlarged cytoplasmic vacuoles are found in neurons, muscle, and cartilage. The disorder is usually lethal in infancy. The prevalence is 4/100,000 to 8/100,000. | 250,600 |
| FKRP | Congenital muscular dystrophy type 5B | NM_024301.4 | NM_024301.4:c.235G>A, NM_024301.4:c.1343C>T, NM_024301.4:c.1387A>G, NM_024301.4:c.1154C>A | Congenital muscular dystrophy type 5B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is neonatal/infantile. This disease is characterized by hypotonia, muscle wasting, weakness or delayed motor milestones. The prevalence is 1/14,500 to 1/123,000. | 250,600 |
| FKRP | Limb-girdle muscular dystrophy type 2I, autosomal recessive | NM_024301.4 | NM_024301.4:c.160C>T | Autosomal recessive limb-girdle muscular dystrophy type 2I follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is infantile. This disease is characterized by proximal limb girdle weakness predominant in the legs, together with bilateral moderate scapulae winging, abdominal muscle weakness, waddling gait, calf hypertrophy, cardiomyopathy and respiratory insufficiency. The prevalence is 1/14,500 to 1/123,000. | 250,600 |
| FMR1 | Fragile X syndrome | - | (CGG)n pre-mutated allele (Detection by PCR and TP-PCR) | Fragile X syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FMR1 gene located on chromosomal region Xq27.3. The symptoms are variable depending on the range of CGG triplet expansion. In complete mutation the onset is infantile in men and is characterized by intellectual disability, characteristic appearance (large head, long face, prominent forehead and chin, protruding ears) joint laxity and large testes after puberty. In carrier female, the symptoms are milder and include primary ovarian insufficiency. The prevalence is 1/2,500 (full mutation allele) to 1/4,000 (prevalence of symptomatic cases) for both genders. | 250,600 |
| FRAS1 | Fraser syndrome | NM_025074.6 | NM_025074.6:c.7813C>T, NM_025074.6:c.832_835delTGTG, NM_025074.6:c.11159_11166delAGCTGGAG, NM_025074.6:c.776T>G, NM_025074.6:c.6991_6992insGG, NM_025074.6:c.6433C>T, NM_025074.6:c.3799C>T, NM_025074.6:c.1071+1_1071+4delGTGA, NM_025074.6:c.4969+1_4969+2insTAGC, NM_025074.6:c.5605_5606insT | Fraser syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the genes FRAS1 (located on chromosomal region 4q21.21) and FREM2 (located on chromosomal region 13q13.3). The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000. | 250,600 |
| G6PC | Glycogen storage disease type 1a | NM_000151.3 | NM_000151.3:c.508C>T, NM_000151.3:c.551G>A, NM_000151.3:c.447-1G>A, NM_000151.3:c.1039C>T, NM_000151.3:c.562G>C, NM_000151.3:c.380_381insTA, NM_000151.3:c.497T>G, NM_000151.3:c.247C>T, NM_000151.3:c.113A>T, NM_000151.3:c.229T>C, NM_000151.3:c.230+1G>C, NM_000151.3:c.47C>G, NM_000151.3:c.883C>T, NM_000151.3:c.370G>A, NM_000151.3:c.626A>G, NM_000151.3:c.248G>A | Glycogen storage disease type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000. | 250,600 |
| GAA | Glycogen storage disease type 2 | NM_000152.3 | NM_000152.3:c.118C>T, NM_000152.3:c.1316T>A, NM_000152.3:c.1799G>A, NM_000152.3:c.1827_1828insA, NM_000152.3:c.1846_1847insA, NM_000152.3:c.1115A>T, NM_000152.3:c.1552-3C>G, NM_000152.3:c.1445C>T, NM_000152.3:c.2238G>C, NM_000152.3:c.1327-2A>G, NM_000152.3:c.1650dupG, NM_000152.3:c.2238G>A, NM_000152.3:c.307T>G, NM_000152.3:c.230_240delCAGTGCCCACA, NM_000152.3:c.2512C>T, NM_000152.3:c.1431delT, NM_000152.3:c.1561G>A, NM_000152.3:c.1465G>A, NM_000152.3:c.1548G>A, NM_000152.3:c.546G>A, NM_000152.3:c.1064T>C, NM_000152.3:c.877G>A, NM_000152.3:c.925G>A, NM_000152.3:c.768_769insT, NM_000152.3:c.2560C>T, NM_000152.3:c.655G>A, NM_000152.3:c.1408_1410delAAC, NM_000152.3:c.953T>C, NM_000152.3:c.1933G>T, NM_000152.3:c.1935C>A, NM_000152.3:c.1585_1586delTCinsGT, NM_000152.3:c.1927G>A, NM_000152.3:c.2041-1G>A, NM_000152.3:c.2066_2070dupAGCCG, NM_000152.3:c.2105G>T, NM_000152.3:c.2237G>A, NM_000152.3:c.525delT, NM_000152.3:c.546+1_546+4delGTGG, NM_000152.3:c.2544delC, NM_000152.3:c.1912G>T, NM_000152.3:c.1634C>T, NM_000152.3:c.710C>T, NM_000152.3:c.2015G>A, NM_000152.3:c.546G>C, NM_000152.3:c.2012T>G, NM_000152.3:c.853C>T, NM_000152.3:c.697delA | Glycogen storage disease type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAA gene located on chromosomal region 17q25.3. There are two forms: adult and infantile.The age of onset in this last form is before the age of three months. This disease is characterized by severe hypotonia, hypertrophic cardiomyopathy and progressive hepatomegaly. The incidence is 1/57,000 for the adult form and 1/138,000 for infantile form. | 250,600 |
| GALC | Krabbe disease | NM_000153.3 | NM_000153.3:c.1591C>T, NM_000153.3:c.1161+2T>G, NM_000153.3:c.1586C>T, NM_000153.3:c.1592G>A, NM_000153.3:c.1489+1_1489+2delGT, NM_000153.3:c.582+1G>A, NM_000153.3:c.388G>A, NM_000153.3:c.430delA, NM_000153.3:c.1695delT, NM_000153.3:c.1472delA, NM_000153.3:c.1004A>G, NM_000153.3:c.1153G>T, NM_000153.3:c.658C>T, NM_000153.3:c.1543G>A, NM_000153.3:c.332G>A, NM_000153.3:c.334A>G, NM_000153.3:c.205C>T, NM_000153.3:c.1796T>G, NM_000153.3:c.1814dupA, NM_000153.3:c.1700A>C, NM_000153.3:c.1723_1724insT, NM_000153.3:c.1964delC, NM_000153.3:c.236G>A, NM_000153.3:c.1488_1489+2delTGGT, NM_000153.3:c.453G>A, NM_000153.3:c.1488_1489delTG, NM_000153.3:c.628A>T, NM_000153.3:c.655C>T, NM_000153.3:c.953C>G, NM_000153.3:c.2056T>C | Krabbe disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALC gene located on chromosomal region 14q31.3. There are two forms of the disease: infantile form (2-6 months onset) more severe and adult form less severe. It is a degenerative disorder that affects the nervous system characterized by a muscle stiffness, blindness, deafness, and eventually death. The incidence is 1/100,000-1/250,000 and the prevalence is 1/100,000. | 250,600 |
| GALT | Galactosemia | NM_000155.3 | NM_000155.3:c.130G>A, NM_000155.3:c.132delG, NM_000155.3:c.118G>T, NM_000155.3:c.265T>G, NM_000155.3:c.289_291delAAC, NM_000155.3:c.1138T>C, NM_000155.3:c.113A>C, NM_000155.3:c.152G>A, NM_000155.3:c.1048delA, NM_000155.3:c.290A>G, NM_000155.3:c.221T>C, NM_000155.3:c.253-2A>G, NM_000155.3:c.425T>A, NM_000155.3:c.428C>T, NM_000155.3:c.442C>T, NM_000155.3:c.143G>C, NM_000155.3:c.443G>A, NM_000155.3:c.158G>A, NM_000155.3:c.18delC, NM_000155.3:c.199C>T, NM_000155.3:c.200G>A, NM_000155.3:c.203A>C, NM_000155.3:c.218_219delCT, NM_000155.3:c.512T>C, NM_000155.3:c.547C>A, NM_000155.3:c.552C>A, NM_000155.3:c.563A>G, NM_000155.3:c.565_578delGTATGGGCCAGCAG, NM_000155.3:c.568T>C, NM_000155.3:c.580T>C, NM_000155.3:c.584T>C, NM_000155.3:c.598delC, NM_000155.3:c.601C>T, NM_000155.3:c.602G>A, NM_000155.3:c.1030C>A, NM_000155.3:c.510C>A, NM_000155.3:c.617A>G, NM_000155.3:c.619C>T, NM_000155.3:c.626A>G, NM_000155.3:c.634C>T, NM_000155.3:c.688-2A>C, NM_000155.3:c.692G>A, NM_000155.3:c.292G>A, NM_000155.3:c.329-2A>C, NM_000155.3:c.367C>T, NM_000155.3:c.377+7A>C, NM_000155.3:c.386T>C, NM_000155.3:c.607G>A, NM_000155.3:c.610C>T, NM_000155.3:c.413C>T, NM_000155.3:c.416T>G, NM_000155.3:c.41delinsTT, NM_000155.3:c.904+1G>T, NM_000155.3:c.905-2A>G, NM_000155.3:c.907G>A, NM_000155.3:c.442G>A, NM_000155.3:c.947G>A, NM_000155.3:c.443G>C, NM_000155.3:c.445dupG, NM_000155.3:c.997C>G, NM_000155.3:c.997C>T, NM_000155.3:c.998G>A, NM_000155.3:c.793C>G, NM_000155.3:c.820+13A>G, NM_000155.3:c.1052delC, NM_000155.3:c.844C>G, NM_000155.3:c.855G>T, NM_000155.3:c.719_728delTAGTACTGGT, NM_000155.3:c.772C>T, NM_000155.3:c.939G>A, NM_000155.3:c.71_72insA, NM_000155.3:c.404C>T, NM_000155.3:c.508-1G>C, NM_000155.3:c.775C>T, NM_000155.3:c.400delT, NM_000155.3:c.502_504delGTG, NM_000155.3:c.957C>A, NM_000155.3:c.823C>G, NM_000155.3:c.505C>A, NM_000155.3:c.1006A>T, NM_000155.3:c.985T>C, NM_000155.3:c.790delC, NM_000155.3:c.790_792delinsTAG | Galactosemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALT gene located on chromosomal region 9p13.3. The age of onset is neonatal. This disease is characterized by feeding difficulties, lethargy, and severe liver disease. Long-term complications appear including cognitive impairments, motor deficits, and ovarian dysfunction with reduced fertility in women and diminished bone density. The prevalence is 1/40,000-1/60,000. | 250,600 |
| GAN | Giant axonal neuropathy | NM_022041.3 | NM_022041.3:c.1447C>T, NM_022041.3:c.1456G>A, NM_022041.3:c.1684C>G, NM_022041.3:c.1429C>T, NM_022041.3:c.601C>T, NM_022041.3:c.413G>A, NM_022041.3:c.505G>A, NM_022041.3:c.1268T>C | Giant axonal neuropathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAN gene located on chromosomal region 16q23.2. The age of onset is infantile. This disease is characterized by a progressive motor and sensitive peripheral and central nervous system neuropathy. Twenty families have been reported with this disease but the frequency is likely to be under-estimated. | 250,600 |
| GBA | Gaucher disease | NM_001005741.2 | NM_001005741.2:c.1093G>A, NM_001005741.2:c.1090G>A, NM_001005741.2:c.1043C>T, NM_001005741.2:c.1274dupA, NM_001005741.2:c.1098dupA, NM_001005741.2:c.1085C>T, NM_001005741.2:c.1102C>T, NM_001005741.2:c.1049A>G, NM_001005741.2:c.1240G>T, NM_001005741.2:c.1246G>A, NM_001005741.2:c.1301G>C, NM_001005741.2:c.1088T>C, NM_001005741.2:c.1348T>A, NM_001005741.2:c.1361C>G, NM_001005741.2:c.1342G>C, NM_001005741.2:c.1448T>C, NM_001005741.2:c.1448T>G, NM_001005741.2:c.1504C>T, NM_001005741.2:c.1447_1466delCTGGACGCAGTGGCACTGATinsTG, NM_001005741.2:c.254G>A, NM_001005741.2:c.259C>T, NM_001005741.2:c.1053G>T, NM_001005741.2:c.160G>T, NM_001005741.2:c.431T>G, NM_001005741.2:c.475C>T, NM_001005741.2:c.476G>A, NM_001005741.2:c.481C>T, NM_001005741.2:c.487delG, NM_001005741.2:c.497A>T, NM_001005741.2:c.508C>T, NM_001005741.2:c.1141T>G, NM_001005741.2:c.115+1G>A, NM_001005741.2:c.1171G>C, NM_001005741.2:c.1174C>G, NM_001005741.2:c.354G>C, NM_001005741.2:c.1060G>C, NM_001005741.2:c.1208G>C, NM_001005741.2:c.1228C>G, NM_001005741.2:c.123A>G, NM_001005741.2:c.1240G>C, NM_001005741.2:c.914delC, NM_001005741.2:c.517A>C, NM_001005741.2:c.1295G>T, NM_001005741.2:c.1307T>C, NM_001005741.2:c.1265_1319del, NM_001005741.2:c.1319C>T, NM_001005741.2:c.1309G>T, NM_001005741.2:c.1226A>G, NM_001005741.2:c.407C>A, NM_001005741.2:c.1343A>T, NM_001005741.2:c.84_85insG, NM_001005741.2:c.518C>T, NM_001005741.2:c.1391A>C, NM_001005741.2:c.509G>T, NM_001005741.2:c.1604G>A, NM_001005741.2:c.84dupG, NM_001005741.2:c.535G>C, NM_001005741.2:c.586A>C, NM_001005741.2:c.1297G>T, NM_001005741.2:c.1184C>T, NM_001005741.2:c.1192C>T | Gaucher disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBA gene located on chromosomal region 1q22. Gaucher disease encompasses a continuum of clinical findings from a perinatal lethal disorder to an asymptomatic type. There are three major clinical types (1, 2, and 3) and two other subtypes (perinatal-lethal and cardiovascular). Type 1 is characterized by the presence of clinical or radiographic evidence of bone disease, hepatosplenomegaly, anemia and thrombocytopenia, lung disease, and the absence of primary central nervous system disease. GD types 2 and 3 are characterized by the presence of primary neurologic disease. Type 2 has an onset before age two years, limited psychomotor development, and a rapidly progressive course with death by age two to four years. Type 3 may have onset before age two years, but often have a more slowly progressive course, with survival into the third or fourth decade. The perinatal-lethal form is associated with ichthyosiform or collodion skin abnormalities or with nonimmune hydrops fetalis. The cardiovascular form is characterized by calcification of the aortic and mitral valves, mild splenomegaly, corneal opacities, and supranuclear ophthalmoplegia. Cardiopulmonary complications have been described with all the clinical subtypes, although varying in frequency and severity. The incidence is 1/60,000 and the prevalence is approximately 1/100,000. | 250,600 |
| GBE1 | Glycogen storage disease type 4 | NM_000158.3 | NM_000158.3:c.1571G>A, NM_000158.3:c.1570C>T, NM_000158.3:c.1774G>T, NM_000158.3:c.771T>A, NM_000158.3:c.1543C>T, NM_000158.3:c.1883A>G, NM_000158.3:c.2052+1G>A, NM_000158.3:c.986A>C, NM_000158.3:c.466_470delCGTAT, NM_000158.3:c.1604A>G | Glycogen storage disease type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is infantile. This disease is characterized by failure to thrive; hepatomegaly, liver dysfunction, and progressive liver cirrhosis; hypotonia; cardiomyopathy and, finally, death. | 250,600 |
| GBE1 | Polyglucosan body disease, adult | NM_000158.3 | NM_000158.3:c.986A>G | Polyglucosan body disease, adult form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is late-onset, slowly progressive disorder affecting the central and peripheral nervous systems. This disease is characterized by a variable combination of cognitive impairment, pyramidal tetraparesis, peripheral neuropathy, and neurogenic bladder. Other manifestations include cerebellar dysfunction and extrapyramidal signs. | 250,600 |
| GCDH | Glutaric acidemia type 1 | NM_000159.3 | NM_000159.3:c.1093G>A, NM_000159.3:c.1060G>C, NM_000159.3:c.542A>G, NM_000159.3:c.442G>A, NM_000159.3:c.1199dupT, NM_000159.3:c.572T>C, NM_000159.3:c.1060G>A, NM_000159.3:c.1247C>T, NM_000159.3:c.74C>A, NM_000159.3:c.947C>A, NM_000159.3:c.1168G>C, NM_000159.3:c.416C>T, NM_000159.3:c.1198G>A, NM_000159.3:c.636-1G>A, NM_000159.3:c.1204C>T, NM_000159.3:c.1244-2A>C, NM_000159.3:c.751C>T, NM_000159.3:c.1262C>T, NM_000159.3:c.1148G>A, NM_000159.3:c.680G>C, NM_000159.3:c.883T>C, NM_000159.3:c.1015A>G, NM_000159.3:c.764C>T, NM_000159.3:c.271+1G>A, NM_000159.3:c.743C>T, NM_000159.3:c.877G>A, NM_000159.3:c.914C>T, NM_000159.3:c.1002_1003delGA, NM_000159.3:c.383G>A, NM_000159.3:c.769C>T | Glutaric acidemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCDH gene located on chromosomal region 19p13.2. The age of onset is infantile or neonatal. This disease is characterized by encephalopathic crises resulting in striatal injury and a severe dystonic dyskinetic movement disorder. The prevalence is 1 in 100,000 births. | 250,600 |
| GJB2 | Deafness type 1A, autosomal recessive | NM_004004.5 | NM_004004.5:c.176_191delGCTGCAAGAACGTGTG, NM_004004.5:c.169C>T, NM_004004.5:c.270dupA, NM_004004.5:c.239A>C, NM_004004.5:c.269T>C, NM_004004.5:c.427C>T, NM_004004.5:c.299_300delAT, NM_004004.5:c.250G>T, NM_004004.5:c.230G>A, NM_004004.5:c.516G>A, NM_004004.5:c.439G>A, NM_004004.5:c.465T>A, NM_004004.5:c.229T>C, NM_004004.5:c.241C>G, NM_004004.5:c.235delC, NM_004004.5:c.238C>T, NM_004004.5:c.557C>T, NM_004004.5:c.269_270insT, NM_004004.5:c.617A>G, NM_004004.5:c.231G>A, NM_004004.5:c.310_323delAGGAAGTTCATCAA, NM_004004.5:c.313_326delAAGTTCATCAAGGG, NM_004004.5:c.358_360delGAG, NM_004004.5:c.35delG, NM_004004.5:c.249C>G, NM_004004.5:c.334_335delAA, NM_004004.5:c.402delG, NM_004004.5:c.413G>A, NM_004004.5:c.416G>A, NM_004004.5:c.299A>T, NM_004004.5:c.250G>C, NM_004004.5:c.550C>T, NM_004004.5:c.551G>C, NM_004004.5:c.503A>G, NM_004004.5:c.227T>C, NM_004004.5:c.380G>A, NM_004004.5:c.132G>A, NM_004004.5:c.365A>T, NM_004004.5:c.139G>T | Deafness, autosomal recessive type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 and GJB3 genes located on chromosomal regions 13q12.11 and 1p34.3 respectively. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present. | 250,600 |
| GJB3 | Deafness type 1A, autosomal recessive | NM_024009.2 | NM_024009.2:c.529T>G, NM_024009.2:c.580G>A, NM_024009.2:c.94C>T | Deafness, autosomal recessive type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 and GJB3 genes located on chromosomal regions 13q12.11 and 1p34.3 respectively. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present. | 250,600 |
| GJB6 | Deafness type 1B, autosomal recessive | NM_006783.4 | NM_006783.4:c.261dupA, NM_006783.4:c.169C>T, NM_006783.4:c.485dupA, NM_006783.4:c.689dupA, NM_006783.4:c.14C>T, NM_006783.4:c.443delC, NM_006783.4:c.383_384delTA, NM_006783.4:c.689_690insA | Nonsyndromic sensorineural deafness, autosomal recessive type DFNB1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB6 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment. No other associated medical findings are present. | 250,600 |
| GLB1 | GM1 Gangliosidosis | NM_000404.2 | NM_000404.2:c.1369C>T, NM_000404.2:c.1370G>A, NM_000404.2:c.1452C>G, NM_000404.2:c.176G>A, NM_000404.2:c.276G>A, NM_000404.2:c.1733A>G, NM_000404.2:c.1355dupA, NM_000404.2:c.442C>A, NM_000404.2:c.202C>T, NM_000404.2:c.591_592insT, NM_000404.2:c.622C>T, NM_000404.2:c.1549G>T, NM_000404.2:c.442C>T, NM_000404.2:c.457+2T>C, NM_000404.2:c.947A>G, NM_000404.2:c.438_440delTCT, NM_000404.2:c.601C>T, NM_000404.2:c.602G>A, NM_000404.2:c.1068+1G>T, NM_000404.2:c.1174_1175delCT, NM_000404.2:c.1004C>T, NM_000404.2:c.1051C>T, NM_000404.2:c.171C>G, NM_000404.2:c.1321G>A, NM_000404.2:c.1325G>A, NM_000404.2:c.818G>T, NM_000404.2:c.152T>C, NM_000404.2:c.1456_1466dupGGTGCATATAT, NM_000404.2:c.145C>T, NM_000404.2:c.175C>T, NM_000404.2:c.901G>A, NM_000404.2:c.1646C>T, NM_000404.2:c.1577dupG, NM_000404.2:c.1310A>T | Gangliosidosis GM1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. Although the three types differ in severity, their features can overlap significantly. The age of onset in type 1 is infantile, in type 2 is late-infantile or juvenile and adult in type3. This disease is characterized by arrest/regression of neurological development, hypotonia, visceromegaly, macular cherry-red spots, dysostosis and coarse facial features. The prevalence is 1:100,000 a 200,000 newborn. | 250,600 |
| GLB1 | Mucopolysaccharidosis type 4B | NM_000404.2 | NM_000404.2:c.1444C>T, NM_000404.2:c.1313G>A, NM_000404.2:c.817T>C, NM_000404.2:c.1445G>A, NM_000404.2:c.1223A>C | Mucopolysaccharidosis type 4B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. The age of onset is variable infantile/juvenile. In addition to skeletal involvement, significant morbidity can result from respiratory compromise, obstructive sleep apnea, valvular heart disease, hearing impairment, corneal clouding, and spinal cord compression. The prevalence is 1:200,000-1:300,000. | 250,600 |
| GLDC | Glycine encephalopathy | NM_000170.2 | NM_000170.2:c.322G>T, NM_000170.2:c.1229G>A, NM_000170.2:c.1545G>C, NM_000170.2:c.1691G>T, NM_000170.2:c.1166C>T, NM_000170.2:c.2113G>A, NM_000170.2:c.2284G>A, NM_000170.2:c.1705G>A, NM_000170.2:c.2216G>A, NM_000170.2:c.2405C>T | Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AMT and GLDC genes located on chromosomal regions 3p21.31 and 9p24.1 respectively. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| GLE1 | Lethal arthrogryposis with anterior horn cell disease | NM_001003722.1 | NM_001003722.1:c.2051T>C, NM_001003722.1:c.1412_1413delAG, NM_001003722.1:c.898-2A>G, NM_001003722.1:c.2069_2072delTTCT, NM_001003722.1:c.1807C>T | Lethal arthrogryposis with anterior horn cell disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLE1 gene located on chromosomal region 9q34.11. The age of onset is fetal. This disease is characterized by fetal akinesia, arthrogryposis and motor neuron loss. The fetus often survives delivery, but dies early as a result of respiratory failure. Neuropathological findings resemble those of lethal congenital contracture syndrome type 1, but are less severe. | 250,600 |
| GNE | Distal myopathy Nonaka type | NM_005476.5 | NM_005476.5:c.2116T>C, NM_005476.5:c.2135T>C, NM_005476.5:c.2086G>A, NM_005476.5:c.478C>T, NM_005476.5:c.1844C>G, NM_005476.5:c.737G>A, NM_005476.5:c.385C>T, NM_005476.5:c.1714G>T, NM_005476.5:c.1798G>A, NM_005476.5:c.2086G>T, NM_005476.5:c.787C>T, NM_005476.5:c.2023T>C, NM_005476.5:c.1993G>A, NM_005476.5:c.673G>A, NM_005476.5:c.909T>A, NM_005476.5:c.1727G>A | Distal myopathy, Nonaka type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNE gene located on chromosomal region 9p13.3. The age of onset is adult. This disease is characterized by progressive muscle weakness and joint deformity. The prevalence is 1:500-1:1,000. | 250,600 |
| GNPTAB | Mucolipidosis type 2/type 3 | NM_024312.4 | NM_024312.4:c.1931C>T, NM_024312.4:c.1799delC, NM_024312.4:c.3503_3504delTC, NM_024312.4:c.3173C>G, NM_024312.4:c.25C>T, NM_024312.4:c.3663delG, NM_024312.4:c.1906dupA, NM_024312.4:c.2383delG, NM_024312.4:c.732_733delAA, NM_024312.4:c.749dupA, NM_024312.4:c.2896delA, NM_024312.4:c.648_651delAGAA, NM_024312.4:c.3326dupA, NM_024312.4:c.3410T>A, NM_024312.4:c.10A>C, NM_024312.4:c.1000C>T, NM_024312.4:c.1196C>T, NM_024312.4:c.1759C>T, NM_024312.4:c.3565C>T, NM_024312.4:c.616_619delACAG, NM_024312.4:c.99delC, NM_024312.4:c.3598G>A, NM_024312.4:c.3560_3561delAG | Mucolipidosis type 2/type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNPTAB gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by growth retardation, skeletal abnormalities, facial dysmorphism, stiff skin, developmental delay and cardiomegaly and that is lethal in childhood. The prevalence is 1:123,500-1:625,500. | 250,600 |
| GPR179 | Night blindness, congenital stationary type 1E | NM_001004334.3 | NM_001004334.3:c.1784+1G>A, NM_001004334.3:c.1368delT, NM_001004334.3:c.3656_3657delCT, NM_001004334.3:c.6847_6848delCT, NM_001004334.3:c.984delC, NM_001004334.3:c.1807C>T, NM_001004334.3:c.278_279insC, NM_001004334.3:c.5693_5694insT, NM_001004334.3:c.278delC, NM_001004334.3:c.1236G>A, NM_001004334.3:c.376G>C, NM_001004334.3:c.3233_3234delCT, NM_001004334.3:c.5763_5764delGA, NM_001004334.3:c.839_842delATCA, NM_001004334.3:c.4699_4700delAG | Congenital stationary night blindness type 1E follow an autosomal recessive, dominant or X-linked pattern of inheritance and is caused by pathogenic variants in the GPR179 gene located on chromosomal region 17q12. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity. | 250,600 |
| GPR98 | Usher syndrome type 2C | NM_032119.3 | NM_032119.3:c.11377G>T, NM_032119.3:c.8713_8716dupAACA, NM_032119.3:c.2864C>A, NM_032119.3:c.18131A>G, NM_032119.3:c.2258_2270delAAGTGCTGAAATC, NM_032119.3:c.6275-1G>A, NM_032119.3:c.2636C>T, NM_032119.3:c.14973-1G>C, NM_032119.3:c.17668_17669delAT, NM_032119.3:c.5357_5358delAA, NM_032119.3:c.5747C>T, NM_032119.3:c.15196_15199dupCAAA, NM_032119.3:c.3151G>T, NM_032119.3:c.6901C>T, NM_032119.3:c.8790delC, NM_032119.3:c.5830G>A, NM_032119.3:c.6311_6312insT | Usher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR98 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32 respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000. | 250,600 |
| GRM6 | Night blindness, congenital stationary type 1B | NM_000843.3 | NM_000843.3:c.2341G>A, NM_000843.3:c.727_728insG, NM_000843.3:c.2213_2219delCCAGAGG, NM_000843.3:c.1861C>T, NM_000843.3:c.2560C>T, NM_000843.3:c.712C>T, NM_000843.3:c.2122C>T, NM_000843.3:c.719_720insG, NM_000843.3:c.1214T>C, NM_000843.3:c.1336C>T, NM_000843.3:c.1258C>T, NM_000843.3:c.1565G>A | Congenital stationary night blindness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRM6 gene located on chromosomal region 5q35.3. The age of onset is early infancy. This disease is characterized by hemeralopia with a moderate loss of visual acuity. | 250,600 |
| GUSB | Mucopolysaccharidosis type 7 | NM_000181.3 | NM_000181.3:c.1065+1G>T, NM_000181.3:c.1084G>A, NM_000181.3:c.1144C>T, NM_000181.3:c.1337G>A, NM_000181.3:c.1222C>T, NM_000181.3:c.1730G>T, NM_000181.3:c.1831C>T, NM_000181.3:c.1856C>T, NM_000181.3:c.1881G>T, NM_000181.3:c.442C>T, NM_000181.3:c.499C>T, NM_000181.3:c.526C>T, NM_000181.3:c.646C>T, NM_000181.3:c.820_821delAC, NM_000181.3:c.1061C>T, NM_000181.3:c.1050G>C, NM_000181.3:c.1534G>A, NM_000181.3:c.1244C>T, NM_000181.3:c.1219_1220insC, NM_000181.3:c.866G>A, NM_000181.3:c.1244+1G>A, NM_000181.3:c.1521G>A, NM_000181.3:c.1429C>T, NM_000181.3:c.1618G>T, NM_000181.3:c.1338G>A | Mucopolysaccharidosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUSB gene located on chromosomal region 7q11.21. The age of onset is variable. There are prenatal forms with non-immune hydrops fetalis, and severe neonatal forms with dysmorphism, hernias, hepatosplenomegaly, club feet, dysostosis, severe hypotonia and neurological disorders that ultimately lead to profound intellectual deficit and small stature in patients that survive. Finally, there are also very mild cases that are discovered during adolescence or adulthood following presentation with thoracic kyphosis. The prevalence is 1:250,000 in newborn. | 250,600 |
| HADHA | Trifunctional protein deficiency | NM_000182.4 | NM_000182.4:c.1918C>T, NM_000182.4:c.274_278delTCATC, NM_000182.4:c.2131C>A, NM_000182.4:c.1793_1794delAT, NM_000182.4:c.1620+2_1620+6delTAAGG, NM_000182.4:c.2027G>A, NM_000182.4:c.1678C>T, NM_000182.4:c.2132_2133insC, NM_000182.4:c.2146+1G>A, NM_000182.4:c.919-2A>G, NM_000182.4:c.1644delC, NM_000182.4:c.1132C>T, NM_000182.4:c.1528G>C, NM_000182.4:c.499delA, NM_000182.4:c.845T>A, NM_000182.4:c.1422dupT | Mitochondrial trifunctional protein deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA and HADHB genes located on chromosomal region 2p23.3. The age of onset is neonatal/infancy. It is characterized by a wide clinical spectrum ranging from severe neonatal manifestations including cardiomyopathy, hypoglycemia, metabolic acidosis, skeletal myopathy and neuropathy, liver disease and death to a mild phenotype with peripheral polyneuropathy, episodic rhabdomyolysis and pigmentary retinopathy. The prevalence is <1 / 1,000,000. | 250,600 |
| HBB | Beta-thalassemia | NM_000518.4 | NM_000518.4:c.135delC, NM_000518.4:c.118C>T, NM_000518.4:c.217dupA, NM_000518.4:c.92+5G>C, NM_000518.4:c.208G>A, NM_000518.4:c.85_86insC, NM_000518.4:c.92+5G>A, NM_000518.4:c.27dupG, NM_000518.4:c.126_129delCTTT, NM_000518.4:c.93-23T>C, NM_000518.4:c.92+1G>A, NM_000518.4:c.-50-u32C>T, NM_000518.4:c.82G>T, NM_000518.4:c.315+1G>A, NM_000518.4:c.52A>T, NM_000518.4:c.380T>A, NM_000518.4:c.93-21G>A, NM_000518.4:c.79G>A, NM_000518.4:c.112delT, NM_000518.4:c.92+6T>C, NM_000518.4:c.59A>G, NM_000518.4:c.364G>A | Beta-thalassemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBB gene located on chromosomal region 11p15.4. The age of onset is infantile. Three main types of BT have been described, thalassemia minor is usually asymptomatic, thalassemia major is associated with splenomegaly and microcytic and hypochromic anemia and thalassemia intermedia, in which the anemia is less severe. The incidence is 1/100,000. | 250,600 |
| HBB | Sickle cell anaemia | NM_000518.4 | NM_000518.4:c.19G>A, NM_000518.4:c.20A>T | Sickle cell anemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HBB gene located on chromosomal region 11p15.4. The age of onset is infantile. This disease is characterized by chronic severe anemia, bacterial infections, and ischemic vaso-occlusive accidents. This results in tissue ischemia leading to acute and chronic pain as well as organ damage that can affect any organ in the body, including the bones, lungs, liver, kidneys, brain, eyes, and joints. The highest frequency of sickle cell disease is found in tropical regions, particularly sub-Saharan Africa, India and the Middle-East. | 250,600 |
| HESX1 | Combined pituitary hormone deficiencies, genetic forms | NM_003865.2 | NM_003865.2:c.374A>G, NM_003865.2:c.77T>C, NM_003865.2:c.445G>A, NM_003865.2:c.450_451delCA, NM_003865.2:c.18G>C | Combined pituitary hormone deficiencies, genetic forms follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the HESX1 gene located on chromosomal region 3p14.3. The age of onset is infantile. These diseases are characterized by short stature, cognitive alterations or delayed puberty. The incidence is 1:3,000 and 1:4,000 births. | 250,600 |
| HEXA | Tay-Sachs disease | NM_000520.4 | NM_000520.4:c.1176G>A, NM_000520.4:c.1495C>T, NM_000520.4:c.1177C>T, NM_000520.4:c.116T>G, NM_000520.4:c.1510delC, NM_000520.4:c.1496G>A, NM_000520.4:c.1260G>C, NM_000520.4:c.1351C>G, NM_000520.4:c.1511G>A, NM_000520.4:c.1499delT, NM_000520.4:c.1510C>T, NM_000520.4:c.380T>G, NM_000520.4:c.459+5G>A, NM_000520.4:c.508C>T, NM_000520.4:c.509G>A, NM_000520.4:c.532C>T, NM_000520.4:c.533G>A, NM_000520.4:c.533G>T, NM_000520.4:c.1528C>T, NM_000520.4:c.173G>A, NM_000520.4:c.1A>G, NM_000520.4:c.1A>T, NM_000520.4:c.1444G>A, NM_000520.4:c.1453T>C, NM_000520.4:c.739C>T, NM_000520.4:c.745C>T, NM_000520.4:c.749G>A, NM_000520.4:c.759_774dupGCTTGCAGAGTTTGAC, NM_000520.4:c.772G>C, NM_000520.4:c.1214_1215delinsG, NM_000520.4:c.78G>A, NM_000520.4:c.538T>C, NM_000520.4:c.540C>G, NM_000520.4:c.805G>A, NM_000520.4:c.915_917delCTT, NM_000520.4:c.254-1G>C, NM_000520.4:c.2T>C, NM_000520.4:c.1537C>T, NM_000520.4:c.1490A>G, NM_000520.4:c.77G>A, NM_000520.4:c.1422G>C, NM_000520.4:c.805+1G>A, NM_000520.4:c.805+1G>C, NM_000520.4:c.672+1G>A, NM_000520.4:c.629C>T, NM_000520.4:c.987G>A, NM_000520.4:c.632T>C, NM_000520.4:c.1278_1279insTATC, NM_000520.4:c.1274_1277dupTATC, NM_000520.4:c.986+3A>G, NM_000520.4:c.611A>G, NM_000520.4:c.1277_1278insTAT | Tay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births. | 250,600 |
| HEXB | Sandhoff disease | NM_000521.3 | NM_000521.3:c.1310_1311delCA, NM_000521.3:c.1380G>A, NM_000521.3:c.1367A>C, NM_000521.3:c.1238_1242delCAAAG, NM_000521.3:c.298delC, NM_000521.3:c.1345delT, NM_000521.3:c.797A>G, NM_000521.3:c.1539_1540delCT, NM_000521.3:c.1375G>T, NM_000521.3:c.508C>T, NM_000521.3:c.1517_1529dupCAAGTGCTGTTGG, NM_000521.3:c.841C>T, NM_000521.3:c.202_203insGG, NM_000521.3:c.1250C>T, NM_000521.3:c.1619_1620insTTCATGTTATCTACAGACGTG, NM_000521.3:c.1537_1538delCT, NM_000521.3:c.170delG, NM_000521.3:c.115delG, NM_000521.3:c.171delG, NM_000521.3:c.850C>T | Sandhoff disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXB gene located on chromosomal region 5q13.3. The age of onset is adult or infantile. This disease is characterized by central nervous system degeneration, with startle reactions, early blindness, progressive motor and mental deterioration, macrocephaly and cherry-red spots on the macula. The prevalence is 1/130.000. | 250,600 |
| HFE | Haemochromatosis | NM_000410.3 | NM_000410.3:c.18G>C, NM_000410.3:c.252G>A, NM_000410.3:c.989G>T, NM_000410.3:c.314T>C, NM_000410.3:c.193A>T, NM_000410.3:c.829G>A, NM_000410.3:c.277G>C | Hemochromatosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HFE gene located on chromosomal region 6p22.2. The age of onset is adult. This disease is characterized by chronic fatigue, bronzed skin pigmentation and tissue damage in the liver, pancreas, joints, bone, endocrine glands, heart. The prevalence is 1/200 - 1/1.000. | 250,600 |
| HGD | Alkaptonuria | NM_000187.3 | NM_000187.3:c.140C>T, NM_000187.3:c.16-1G>A, NM_000187.3:c.342+1G>A, NM_000187.3:c.1111_1112insC, NM_000187.3:c.899T>G, NM_000187.3:c.1189-2A>G, NM_000187.3:c.674G>A, NM_000187.3:c.175delA, NM_000187.3:c.283-5delT, NM_000187.3:c.172A>T, NM_000187.3:c.873C>A, NM_000187.3:c.283-4C>T, NM_000187.3:c.808G>A, NM_000187.3:c.1102A>G, NM_000187.3:c.469+2T>C, NM_000187.3:c.688C>T, NM_000187.3:c.481G>A | Alkaptonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGD gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by darkening of the urine when it is left exposed to air, grey-blue colouration of the eye sclerae and the ear helix (ochronosis), and a disabling joint disease involving both the axial and peripheral joints (ochronotic arthropathy). The prevalence is 1:250,000-1:1.000.000 newborn. | 250,600 |
| HGSNAT | Mucopolysaccharidosis type 3C | NM_152419.2 | NM_152419.2:c.1378-1G>A, NM_152419.2:c.1843G>A, NM_152419.2:c.607C>T, NM_152419.2:c.1250+1G>A, NM_152419.2:c.848C>T, NM_152419.2:c.1464+1G>A, NM_152419.2:c.1501delA, NM_152419.2:c.1030C>T, NM_152419.2:c.1503delA, NM_152419.2:c.1553C>T, NM_152419.2:c.1622C>T, NM_152419.2:c.493+1G>A | Mucopolysaccharidosis type 3C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGSNAT gene located on chromosomal region 8p11.21. The age of onset is infantile. This disease is characterized by defective or missing enzymes to break down mucopolysaccharides are missing or are defective. The prevalence is <1:70.000 newborn. | 250,600 |
| HPD | Tyrosinemia type 3 | NM_002150.2 | NM_002150.2:c.600C>G, NM_002150.2:c.774T>G, NM_002150.2:c.1005C>G, NM_002150.2:c.987delA | Tyrosinemia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPD gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by intellectual deficit and ataxia. The prevalence is 1:100,000-1:120,000 newborn. | 250,600 |
| IGHMBP2 | Spinal muscular atrophy, distal, type 1, autosomal recessive | NM_002180.2 | NM_002180.2:c.1488C>A, NM_002180.2:c.2611+1G>T, NM_002180.2:c.1540G>A, NM_002180.2:c.1738G>A, NM_002180.2:c.661delA, NM_002180.2:c.121C>T, NM_002180.2:c.1101_1116delCTACTTCGACGTGGTG, NM_002180.2:c.2922T>G, NM_002180.2:c.1107C>G, NM_002180.2:c.2362C>T, NM_002180.2:c.638A>G | Autosomal recessive distal spinal muscular atrophy type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGHMBP2 gene located on chromosomal region 11q13.3. The age of onset is infantile. This disease is characterized by neuromuscular disorder characterized by progressive weakness and atrophy of the diaphragm and skeletal muscles, leading to death in childhood. The prevalence is 4:100,000-10:100,000. | 250,600 |
| IMPDH1 | Retinitis pigmentosa type 10 | NM_000883.3 | NM_000883.3:c.1057G>A, NM_000883.3:c.1390delC, NM_000883.3:c.931G>A | Retinitis pigmentosa type 10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IMPDH1 gene located on chromosomal region 7q32.1. The age of onset is infantile. This disease is characterized by progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades. The prevalence is 1/4,000. | 250,600 |
| INPP5E | Joubert syndrome type 1 | NM_019892.4 | NM_019892.4:c.1132C>T, NM_019892.4:c.855_856insCG, NM_019892.4:c.1688G>A, NM_019892.4:c.1543C>T, NM_019892.4:c.1304G>A | Joubert syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized by congenital malformation of the brainstem and agenesis or hypoplasia of the cerebellar vermis leading to an abnormal respiratory pattern, nystagmus, hypotonia, ataxia, and delay in achieving motor milestones.. The prevalence is 1/100.000. | 250,600 |
| INPP5E | MORM syndrome | NM_019892.4 | NM_019892.4:c.1879C>T | MORM syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized by the association of intellectual deficit, truncal obesity, retinal dystrophy and micropenis. The prevalence is 1/100.000. | 250,600 |
| INSR | Diabetes mellitus, insulin-resistant | NM_000208.2 | NM_000208.2:c.3079C>T, NM_000208.2:c.3680G>C, NM_000208.2:c.3034G>A, NM_000208.2:c.1114C>T, NM_000208.2:c.1378A>G | Diabetes mellitus, insulin-resistant follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by the triad of hyperinsulinemia, acanthosis nigricans (skin lesions associated with insulin resistance), and signs of hyperandrogenism in females without lipodystrophy and who are not overweight. It is generally diagnosed in young women with marked signs of hyperandrogenism, but insulin resistance and acanthosis nigricans may be observed in men and in childhood. Acromegaloid facies or muscular cramps are sometimes associated. Hyperinsulinemia, a biological marker for insulin resistance, is often associated with glucose tolerance defects over the course of the disease, and diabetes progressively sets in. Hyperandrogenism (associated with polycystic ovarian syndrome (see this term) or ovarian hyperthecoses) leads to fertility problems. The prevalence is <1:1,000,000. | 250,600 |
| INSR | Leprechaunism | NM_000208.2 | NM_000208.2:c.2668C>T, NM_000208.2:c.172G>A | Leprechaunism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by intrauterine and mainly postnatal severe growth retardation, extreme insulin resistance. The prevalence is <1:1,000,000. | 250,600 |
| ITGB4 | Epidermolysis bullosa, junctional with pyloric atresia | NM_001005731.1 | NM_001005731.1:c.112T>C, NM_001005731.1:c.1684T>C, NM_001005731.1:c.1150delG, NM_001005731.1:c.1544G>A, NM_001005731.1:c.3977-19T>A, NM_001005731.1:c.4410delG, NM_001005731.1:c.4433G>A, NM_001005731.1:c.5119+2T>C, NM_001005731.1:c.3321_3331delACTGGACCGGA, NM_001005731.1:c.4618C>T, NM_001005731.1:c.182G>A, NM_001005731.1:c.2607delC, NM_001005731.1:c.3801_3802insT, NM_001005731.1:c.3841C>T, NM_001005731.1:c.2608delC, NM_001005731.1:c.3793+1G>A, NM_001005731.1:c.1660C>T, NM_001005731.1:c.3674G>A | Junctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGA6 and ITGB4 genes located on chromosomal regions 2q31.1 and 17q25.1 respectively. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. | 250,600 |
| ITGB4 | Epidermolysis bullosa, without pyloric atresia | NM_001005731.1 | NM_001005731.1:c.2792G>A | Junctional epidermolysis bullosa with piloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGB4 gene located on chromosomal region 17q25.1. The age of onset is neonatal. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. More than 100 cases have been reported around the world. | 250,600 |
| IVD | Isovaleric acidemia | NM_002225.3 | NM_002225.3:c.158G>C, NM_002225.3:c.1208A>G, NM_002225.3:c.157C>T, NM_002225.3:c.1141T>C, NM_002225.3:c.243+1G>A, NM_002225.3:c.1147+1_1147+4delGTGA, NM_002225.3:c.367G>A, NM_002225.3:c.605G>T, NM_002225.3:c.1145_1147+4delTTGGTGA, NM_002225.3:c.559+1G>A, NM_002225.3:c.134T>C, NM_002225.3:c.941C>T, NM_002225.3:c.627delT, NM_002225.3:c.793+1G>A, NM_002225.3:c.2T>G, NM_002225.3:c.1183C>T, NM_002225.3:c.390delT, NM_002225.3:c.406_407delTG, NM_002225.3:c.158G>A, NM_002225.3:c.593G>A, NM_002225.3:c.507delG, NM_002225.3:c.1188delT, NM_002225.3:c.465+2T>C, NM_002225.3:c.434_437dupATGA, NM_002225.3:c.860G>A, NM_002225.3:c.994_995delAT, NM_002225.3:c.1192C>T, NM_002225.3:c.478_479insGT | Isovaleric academia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IVD gene located on chromosomal region 15q15.1. The age of onset is neonatal. This disease is characterized by vomiting, dehydration, coma and abnormal movements. The prevalence is 1/100,000. | 250,600 |
| JAK3 | Severe combined immunodeficiency T-B+NK- | NM_000215.3 | NM_000215.3:c.452C>G, NM_000215.3:c.1765G>A, NM_000215.3:c.1333C>T, NM_000215.3:c.1172_1173insG, NM_000215.3:c.1837C>T, NM_000215.3:c.299A>G, NM_000215.3:c.1695C>A | Severe combined immunodeficiency T-B+NK- follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the JAK3 gene located on chromosomal region 19p13.11. The age of onset is infantile. This disease is characterized by chronic diarrhea, failure to thrive, recurrent respiratory infections and/or generalized infections due to opportunistic pathogens. The incidence is 1/100,000 and 1/1,000,000. | 250,600 |
| KCNJ1 | Bartter syndrome type 2 | NM_000220.4 | NM_000220.4:c.1012C>T, NM_000220.4:c.1070T>C, NM_000220.4:c.592G>A, NM_000220.4:c.322G>C, NM_000220.4:c.372T>A, NM_000220.4:c.500G>A, NM_000220.4:c.237C>G, NM_000220.4:c.1014delA, NM_000220.4:c.641C>T, NM_000220.4:c.657C>G, NM_000220.4:c.996_999delAAAG, NM_000220.4:c.942T>G | Bartter syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ1 gene located on chromosomal region 11q24.3. The age of onset is antenatal. This disease is characterized by severe polyhydramnios in mother leading to premature delivery, postnatally newborns suffer from recurrent episodes of severe dehydration and electrolyte imbalance which can lead to fatal outcome. | 250,600 |
| KCNV2 | Retinal cone dystrophy type 3B | NM_133497.3 | NM_133497.3:c.1016_1024delACCTGGTGG, NM_133497.3:c.1376G>A, NM_133497.3:c.427G>T, NM_133497.3:c.226C>T, NM_133497.3:c.325C>T, NM_133497.3:c.357_358insC, NM_133497.3:c.1480A>C, NM_133497.3:c.1132_1133insT, NM_133497.3:c.854T>G, NM_133497.3:c.491T>C, NM_133497.3:c.767C>G, NM_133497.3:c.916G>T, NM_133497.3:c.778A>T, NM_133497.3:c.442G>T | Retinal cone dystrophy type 3B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNV2 gene located on 9p24.2. The age of onset is in the first or second decade of life. This disease is characterized by is characterized by onset in the first or second decade of life of very marked photophobia, myopia, reduced color vision along the red-green axis with relatively preserved tritan discrimination, and central scotomata with peripheral widespread sensitivity loss predominating in the superior visual field. Nyctalopia is a later feature of the disorder. There is often retinal pigment epithelium disturbance at the macula with a normal retinal periphery. | 250,600 |
| LAMA2 | Congenital muscular dystrophy type 1A | NM_000426.3 | NM_000426.3:c.184G>T, NM_000426.3:c.1612C>T, NM_000426.3:c.3718C>T, NM_000426.3:c.2750-1G>C, NM_000426.3:c.2049_2050delAG, NM_000426.3:c.5050G>T, NM_000426.3:c.1634T>A, NM_000426.3:c.2045_2046delAG, NM_000426.3:c.4645C>T, NM_000426.3:c.2962C>T, NM_000426.3:c.2098_2099delTT, NM_000426.3:c.4437-5T>A, NM_000426.3:c.2901C>A, NM_000426.3:c.112+1G>A, NM_000426.3:c.7732C>T, NM_000426.3:c.6038delT, NM_000426.3:c.7888C>T, NM_000426.3:c.825delC, NM_000426.3:c.8314delA, NM_000426.3:c.3976C>T, NM_000426.3:c.9101_9104dupAACA, NM_000426.3:c.9253C>T, NM_000426.3:c.2323-2A>T, NM_000426.3:c.8748delA, NM_000426.3:c.6334A>T, NM_000426.3:c.1050delT, NM_000426.3:c.7536delC, NM_000426.3:c.8705delT, NM_000426.3:c.9221delA, NM_000426.3:c.5227G>T, NM_000426.3:c.6429+1G>A, NM_000426.3:c.6617delT, NM_000426.3:c.2451-2A>G, NM_000426.3:c.6011delA, NM_000426.3:c.7810C>T, NM_000426.3:c.8684C>G, NM_000426.3:c.3630delT, NM_000426.3:c.3215delG, NM_000426.3:c.3623_3645delAGGGCATTGTTTTTCAACATCCA, NM_000426.3:c.6955C>T, NM_000426.3:c.7279_7280delCT, NM_000426.3:c.725G>A, NM_000426.3:c.7147C>T, NM_000426.3:c.3237C>A | Congenital muscular dystrophy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMA2 gene located on chromosomal region 6q22.33. The age of onset is early infancy. This disease is characterized by hypotonia, muscle weakness and muscle wasting and motor development delayed. The prevalence is 1/30,000. | 250,600 |
| LAMB3 | Epidermolysis bullosa, junctional | NM_000228.2 | NM_000228.2:c.1587_1588delAG, NM_000228.2:c.124C>T, NM_000228.2:c.1438_1442delCCGTG, NM_000228.2:c.1830G>A, NM_000228.2:c.565-2A>G, NM_000228.2:c.2806C>T, NM_000228.2:c.904delT, NM_000228.2:c.1357delT, NM_000228.2:c.3228+1G>T, NM_000228.2:c.628+1delG, NM_000228.2:c.496C>T, NM_000228.2:c.1903C>T, NM_000228.2:c.628G>A, NM_000228.2:c.3228+1G>A, NM_000228.2:c.727C>T | Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 and LAMC2 genes located on chromosomal regions 1q32.2 and 1q25.3 respectively. The age of onset is infantile. It is a lethal form of junctional epidermolysis bullosa, a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement. In the Herlitz type, death occurs usually within the first six months of life. Occasionally, children survive to teens. It is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic. | 250,600 |
| LMNA | Cardiomyopathy, dilated type 1A | NM_170707.3 | NM_170707.3:c.1366A>C, NM_170707.3:c.1930C>T, NM_170707.3:c.1567G>A, NM_170707.3:c.1786G>A | Dilated cardiomyopathy type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death. | 250,600 |
| LMNA | Hutchinson-Gilford progeria syndrome | NM_170707.3 | NM_170707.3:c.1579C>T, NM_170707.3:c.1411C>T, NM_170707.3:c.1824C>T, NM_170707.3:c.1626G>C | Hutchinson-Gilford progeria syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/infancy. It is characterized by growth reduction, failure to thrive, a typical facial appearance (prominent forehead, protuberant eyes, thin nose with a beaked tip, thin lips, micrognathia and protruding ears) and distinct dermatologic features (generalized alopecia, aged-looking skin, sclerotic and dimpled skin over the abdomen and extremities, prominent cutaneous vasculature, dyspigmentation, nail hypoplasia and loss of subcutaneous fat). | 250,600 |
| LMNA | Lipodystrophy, familial partial, type 2 | NM_170707.3 | NM_170707.3:c.1318G>A | Lipodystrophy, familial partial, type2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by the loss of subcutaneous adipose tissue in the lower parts of the body (limbs, buttocks, trunk). It is accompanied by an accumulation of adipose tissue in the face and neck causing a double chin, fat neck, or cushingoid appearance. Adipose tissue may also accumulate in the axillae, back, labia majora, and intraabdominal region. Affected patients are insulin-resistant and may develop glucose intolerance and diabetes mellitus after age 20 years,hypertriglyceridemia, and low levels of high density lipoprotein cholesterol. | 250,600 |
| LMNA | Mandibuloacral dysplasia | NM_170707.3 | NM_170707.3:c.1586C>T, NM_170707.3:c.1580G>A, NM_170707.3:c.1585G>A, NM_170707.3:c.1228C>T | Mandibuloacral dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/. This disease is characterized by postnatal growth retardation, craniofacial anomalies, skeletal malformations, and mottled cutaneous pigmentation. The prevalence is 1:2,700-1:5,000. | 250,600 |
| LMNA | Muscular dystrophy, Emery-Dreifuss type 3 | NM_170707.3 | NM_170707.3:c.1072G>A, NM_170707.3:c.419T>C, NM_170707.3:c.1488+1G>A, NM_170707.3:c.1583C>A | Emery-Dreifuss muscular dystrophy type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22. The age of onset is neonatal/fetal. This disease is characterized by weakness and atrophy of muscle without involvement of the nervous system, early contractures of the elbows, Achilles tendons and spine, and cardiomyopathy associated with cardiac conduction defects. | 250,600 |
| LRP5 | Exudative vitreoretinopathy type 4 | NM_002335.3 | NM_002335.3:c.2254C>G, NM_002335.3:c.518C>T, NM_002335.3:c.1709G>A, NM_002335.3:c.804_813delGGGGAAGAGG, NM_002335.3:c.4099G>A | Exudative vitreoretinopathy type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile or juvenile. This disease is characterized by abnormal or incomplete vascularization of the peripheral retina leading to variable clinical manifestations ranging from no effects to minor anomalies, or even retinal detachment with blindness. | 250,600 |
| LRP5 | Isolated polycystic liver disease | NM_002335.3 | NM_002335.3:c.4651G>A | Isolated polycystic liver disease due to LRP5 gene located on chromosomal region 11q13.2 follows an autosomal recessive pattern of inheritance. The age of onset is variable. This disease is characterized by the appearance of numerous cysts spread throughout the liver. | 250,600 |
| LRP5 | Osteoporosis-pseudoglioma syndrome | NM_002335.3 | NM_002335.3:c.1481G>A, NM_002335.3:c.1453G>T, NM_002335.3:c.1468delG, NM_002335.3:c.2305delG, NM_002335.3:c.2202G>A, NM_002335.3:c.1708C>T, NM_002335.3:c.3107G>A, NM_002335.3:c.2557C>T | Osteoporosis-pseudoglioma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by congenital or infancy-onset blindness and severe juvenile-onset osteoporosis and spontaneous fractures. The prevalence is 1:2,000,000. | 250,600 |
| MAN2B1 | Alpha-mannosidosis | NM_000528.3 | NM_000528.3:c.215A>T, NM_000528.3:c.2401G>T, NM_000528.3:c.2278C>T, NM_000528.3:c.2368C>T, NM_000528.3:c.2119C>T, NM_000528.3:c.2013delT, NM_000528.3:c.1A>G, NM_000528.3:c.1067C>G, NM_000528.3:c.384G>A, NM_000528.3:c.2398G>A, NM_000528.3:c.1915C>T, NM_000528.3:c.2426T>C, NM_000528.3:c.2436+2T>C, NM_000528.3:c.1259G>T, NM_000528.3:c.1780C>T, NM_000528.3:c.1929G>A, NM_000528.3:c.2686_2687delCTinsG, NM_000528.3:c.1830+1G>C | Alpha-mannosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAN2B1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by immunodeficiency, facial and skeletal abnormalities, hearing impairment and intellectual disability. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| MCCC2 | 3-Methylcrotonyl-CoA carboxylase 2 deficiency, type 2 | NM_022132.4 | NM_022132.4:c.295G>C, NM_022132.4:c.380C>G, NM_022132.4:c.1309A>G, NM_022132.4:c.515_516insT, NM_022132.4:c.1015G>A, NM_022132.4:c.464G>A, NM_022132.4:c.641delG, NM_022132.4:c.1576_1577insT, NM_022132.4:c.735_736insC, NM_022132.4:c.517_518insT, NM_022132.4:c.838G>T, NM_022132.4:c.499T>C, NM_022132.4:c.1367C>T, NM_022132.4:c.929C>G, NM_022132.4:c.1065A>T, NM_022132.4:c.1580G>A, NM_022132.4:c.994C>T, NM_022132.4:c.1072+1G>A | 3-methylcrotonyl-CoA carboxylase deficiency type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC2 gene located on chromosomal region 5q13.2. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn. | 250,600 |
| MED25 | Charcot-Marie-Tooth disease type 2B2 | NM_030973.3 | NM_030973.3:c.316delG, NM_030973.3:c.1366C>T, NM_030973.3:c.1004C>T | Charcot-Marie-Tooth disease type 2B2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MED25 gene located on chromosomal region 19q13.33. The age of onset is adult. This disease is characterized by symmetric moderate to severe weakness of the distal muscles, predominantly affecting the lower extremities. Marked sensory deficits were also reported. | 250,600 |
| MEFV | Familial mediterranean fever | NM_000243.2 | NM_000243.2:c.163_164insA, NM_000243.2:c.1437C>G, NM_000243.2:c.2282G>A, NM_000243.2:c.163dupA, NM_000243.2:c.2076_2078delAAT, NM_000243.2:c.1958G>A, NM_000243.2:c.443A>T, NM_000243.2:c.656_657insG, NM_000243.2:c.688G>A, NM_000243.2:c.800C>T, NM_000243.2:c.1223G>A, NM_000243.2:c.501G>C, NM_000243.2:c.2040G>A, NM_000243.2:c.2040G>C, NM_000243.2:c.2084A>G, NM_000243.2:c.1141C>T, NM_000243.2:c.1016C>T, NM_000243.2:c.2177T>C, NM_000243.2:c.1772T>C, NM_000243.2:c.2080A>G, NM_000243.2:c.2082G>A, NM_000243.2:c.2230G>T | Familial Mediterranean fever follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MEFV gene located on chromosomal region 16p13.3. The age of onset is infantile or adult (before the age of 30). This disease is characterized by recurrent short episodes of fever and serositis resulting in pain in the abdomen, chest, joints and muscles. The prevalence is 1:10,000-5:10,000. | 250,600 |
| MERTK | Retinitis pigmentosa type 38 | NM_006343.2 | NM_006343.2:c.2189+1G>T, NM_006343.2:c.1605-2A>G, NM_006343.2:c.2070_2074delAGGAC, NM_006343.2:c.2784_2785insTA, NM_006343.2:c.2785_2786dupTA, NM_006343.2:c.2323C>T, NM_006343.2:c.2207_2210delCTGT | Retinitis pigmentosa type 38 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MERTK gene located on chromosomal region 2q13. The age of onset is infantile. This disease is characterized by. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness. | 250,600 |
| MFRP | Microphthalmia - Retinitis pigmentosa - foveoschisis - optic disc drusen | NM_031433.3 | NM_031433.3:c.498delC, NM_031433.3:c.523C>T, NM_031433.3:c.629G>T, NM_031433.3:c.1150_1151insC, NM_031433.3:c.545T>C, NM_031433.3:c.1124+1G>T | Microphthalmia - Retinitis pigmentosa - foveoschisis - optic disc drusen follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFRP gene located on chromosomal region 11q23.3. The age of onset is infantile. This disease is characterized by posterior microphthalmos, retinitis pigmentosa, foveoschisis, and optic disk drusen. | 250,600 |
| MKKS | Bardet-Biedl/McKusick-Kaufman syndrome | NM_018848.3 | NM_018848.3:c.353delG | Bardet-Biedl syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. McKusick-Kaufman syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is fetal. This disease is characterized by hydrometrocolpos, post-axial polydactyly, and to a lesser extent cardiac defects. | 250,600 |
| MKKS | Bardet-Biedl syndrome type 6 | NM_018848.3 | NM_018848.3:c.830T>C, NM_018848.3:c.1436C>G | Bardet-Biedl syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. | 250,600 |
| MKKS | McKusick-Kaufman syndrome | NM_018848.3 | NM_018848.3:c.250C>T, NM_018848.3:c.1225_1226delGG, NM_018848.3:c.724G>T | McKusick-Kaufman syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is fetal. This disease is characterized by hydrometrocolpos, post-axial polydactyly, and to a lesser extent cardiac defects. | 250,600 |
| MKS1 | Bardet-Biedl syndrome type 13 | NM_017777.3 | NM_017777.3:c.1349T>C | Bardet-Biedl syndrome type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. | 250,600 |
| MKS1 | Meckel type 1/Bardet-Biedl syndrome | NM_017777.3 | NM_017777.3:c.1024+1G>A, NM_017777.3:c.857A>G, NM_017777.3:c.1319T>C, NM_017777.3:c.814G>C, NM_017777.3:c.508C>T, NM_017777.3:c.1319G>C | Meckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is infantile, etc/. This disease is characterized by a combination of renal cysts and variably associated features, including developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and cysts, and polydactyly.. The prevalence is 1:1,000,000-9:1,000,000. Bardet-Biedl syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. | 250,600 |
| MMACHC | Methylmalonic aciduria cblC type, with homocystinuria | NM_015506.2 | NM_015506.2:c.389A>G, NM_015506.2:c.388T>C, NM_015506.2:c.482G>A, NM_015506.2:c.609G>A, NM_015506.2:c.688C>T, NM_015506.2:c.394C>T, NM_015506.2:c.440G>C, NM_015506.2:c.608G>A, NM_015506.2:c.481C>T, NM_015506.2:c.619_620insG, NM_015506.2:c.547_548delGT, NM_015506.2:c.347T>C, NM_015506.2:c.658_660delAAG, NM_015506.2:c.388_390delTAC, NM_015506.2:c.615C>A, NM_015506.2:c.331C>T, NM_015506.2:c.616C>T, NM_015506.2:c.270_271insA, NM_015506.2:c.271dupA, NM_015506.2:c.615C>G | Methylmalonic acidemia with homocystinuria, type cblC follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMACHC gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by failure to thrive, acute neurological deterioration, intellectual deficit, lethargy, seizures, microcephaly, a salt-and-pepper retinopathy, and signs of megaloblastic anemia. The prevalence is <1:1,000,000. | 250,600 |
| MOCS2 | Molybdenum cofactor deficiency type B | NM_176806.3 | NM_176806.3:c.106_107delAT, NM_176806.3:c.*297+1G>A, NM_176806.3:c.58delT, NM_176806.3:c.245delT, NM_176806.3:c.190G>A, NM_176806.3:c.16C>T, NM_176806.3:c.*487A>C, NM_176806.3:c.*422G>A, NM_176806.3:c.*26_*27delAT, NM_176806.3:c.539_540delAA, NM_176806.3:c.*459_*460delAA | Molybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death. | 250,600 |
| MTTP | Abetalipoproteinemia | NM_000253.3 | NM_000253.3:c.1769G>T, NM_000253.3:c.2030delC, NM_000253.3:c.1619G>A, NM_000253.3:c.2593G>T, NM_000253.3:c.708_709delCA, NM_000253.3:c.1867+1G>A, NM_000253.3:c.703_704delAC | Abetalipoproteinemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTP gene located on chromosomal region 4q23. The age of onset is infantile. This disease is characterized by growth delay, malabsorption, hepatomegaly, and neurological and neuromuscular manifestations. The prevalence is <1:1,000,000. | 250,600 |
| MUT | Methylmalonic acidemia | NM_000255.3 | NM_000255.3:c.1420C>T, NM_000255.3:c.1445-2A>G, NM_000255.3:c.2080C>T, NM_000255.3:c.1867G>A, NM_000255.3:c.607G>A, NM_000255.3:c.1658delT, NM_000255.3:c.1280G>A, NM_000255.3:c.1399C>T, NM_000255.3:c.914T>C, NM_000255.3:c.643G>A, NM_000255.3:c.655A>T, NM_000255.3:c.1741C>T, NM_000255.3:c.1106G>A, NM_000255.3:c.1871A>G, NM_000255.3:c.1924G>C, NM_000255.3:c.682C>T, NM_000255.3:c.572C>A, NM_000255.3:c.313T>C, NM_000255.3:c.1181T>A, NM_000255.3:c.278G>A, NM_000255.3:c.678_679insAATTTATG, NM_000255.3:c.794dupT, NM_000255.3:c.671_678dupAATTTATG, NM_000255.3:c.2150G>T, NM_000255.3:c.280G>A, NM_000255.3:c.91C>T, NM_000255.3:c.1207C>T | Methylmalonic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MUT gene located on chromosomal region 6p12.3. The age of onset is very early infantile. This disease is characterized by recurrent ketoacidotic comas or transient vomiting, dehydration, hypotonia and intellectual deficit, which does not respond to administration of vitamin B12. | 250,600 |
| MVK | Hyper-IgD syndrome | NM_000431.3 | NM_000431.3:c.829C>T, NM_000431.3:c.803T>C, NM_000431.3:c.185G>A, NM_000431.3:c.494C>T, NM_000431.3:c.59A>C, NM_000431.3:c.1129G>A | Hyper IgD syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by periodic attacks of fever and a systemic inflammatory reaction (cervical lymphadenopathy, abdominal pain, vomiting, diarrhea, arthralgias and skin signs). | 250,600 |
| MVK | Mevalonic aciduria | NM_000431.3 | NM_000431.3:c.1000G>A, NM_000431.3:c.902A>C, NM_000431.3:c.928G>A | Mevalonic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by psychomotor retardation, failure to thrive, progressive cerebellar ataxia, dysmorphic features, progressive visual impairment and recurrent febrile crises. The prevalence is <1:1,000,000. | 250,600 |
| MYO15A | Deafness type 3, autosomal recessive | NM_016239.3 | NM_016239.3:c.3385C>T, NM_016239.3:c.6003delG, NM_016239.3:c.6004delG, NM_016239.3:c.10573delA, NM_016239.3:c.3313G>T, NM_016239.3:c.3336delG, NM_016239.3:c.755dupA, NM_016239.3:c.5492G>T, NM_016239.3:c.4351G>A, NM_016239.3:c.6864_6874delGGACCTGGAGC, NM_016239.3:c.4751_4752dupTC, NM_016239.3:c.625G>T, NM_016239.3:c.3693-2A>G, NM_016239.3:c.6614C>T, NM_016239.3:c.6743C>T, NM_016239.3:c.6046+2T>G, NM_016239.3:c.5326C>T, NM_016239.3:c.3756+1G>T, NM_016239.3:c.8410A>T, NM_016239.3:c.8429_8447delGCGGGCAGCTGCGGGTCCT, NM_016239.3:c.8148G>T, NM_016239.3:c.9958_9961delGACT, NM_016239.3:c.4750_4751insTC, NM_016239.3:c.8548C>T | Deafness autosomal recessive type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO15A gene located on chromosomal region 17p11.2. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| MYO3A | Deafness type 30, autosomal recessive | NM_017433.4 | NM_017433.4:c.1086T>G, NM_017433.4:c.2793+2T>A, NM_017433.4:c.4586+2T>G, NM_017433.4:c.4730+1G>A, NM_017433.4:c.1A>G, NM_017433.4:c.2506-1G>A, NM_017433.4:c.1777-12G>A, NM_017433.4:c.1952delC, NM_017433.4:c.1193C>A, NM_017433.4:c.770C>G, NM_017433.4:c.3154C>T, NM_017433.4:c.585+5G>C, NM_017433.4:c.2243delA, NM_017433.4:c.3112-2A>G, NM_017433.4:c.732-2A>G | Deafness autosomal recessive type 30 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO3A gene located on chromosomal region 10p12.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| MYO6 | Deafness type 37, autosomal recessive | NM_004999.3 | NM_004999.3:c.2897_2899delAAG, NM_004999.3:c.2840G>A, NM_004999.3:c.647A>T, NM_004999.3:c.3496C>T, NM_004999.3:c.3808C>T, NM_004999.3:c.1446_1447insT | Deafness autosomal recessive type 37 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO6 gene located on chromosomal region 6q14.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| MYO7A | Deafness type 2, autosomal recessive | NM_000260.3 | NM_000260.3:c.1797G>A, NM_000260.3:c.2023C>T, NM_000260.3:c.731G>C, NM_000260.3:c.3596dupT, NM_000260.3:c.1184G>A, NM_000260.3:c.133-2A>G | Deafness autosomal recessive type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| MYO7A | Usher syndrome type 1B | NM_000260.3 | NM_000260.3:c.1996C>T, NM_000260.3:c.1884C>A, NM_000260.3:c.448C>T, NM_000260.3:c.2476G>A, NM_000260.3:c.4024delT, NM_000260.3:c.2617C>T, NM_000260.3:c.5227C>T, NM_000260.3:c.1344-1G>A, NM_000260.3:c.5507T>G, NM_000260.3:c.5886_5889delCTTT, NM_000260.3:c.3504-1G>C, NM_000260.3:c.3508G>A, NM_000260.3:c.4018G>A, NM_000260.3:c.5392C>T, NM_000260.3:c.640G>A, NM_000260.3:c.3134T>C, NM_000260.3:c.5824G>T, NM_000260.3:c.3G>A, NM_000260.3:c.494C>T, NM_000260.3:c.5618G>A, NM_000260.3:c.5884_5887delTTCT, NM_000260.3:c.634C>T, NM_000260.3:c.3719G>A, NM_000260.3:c.5967C>G, NM_000260.3:c.3763delA, NM_000260.3:c.635G>A, NM_000260.3:c.6025delG | Usher syndrome type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 1:100,000-9:100,000. | 250,600 |
| NAGA | Schindler disease | NM_000262.2 | NM_000262.2:c.973G>A, NM_000262.2:c.985C>T, NM_000262.2:c.986G>A, NM_000262.2:c.577G>T | Schindler disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGA gene located on chromosomal region 22q13.2. The age of onset is infantile. This disease is characterized by early-onset neuroaxonal dystrophy and neurological signs (convulsion during fever, epilepsy, psychomotor retardation and hypotonia). NAGA deficiency is typically classified in three main phenotypes: NAGA deficiency type I (Schindler disease or Schindler disease type I) with severe manifestations; NAGA deficiency type II (Kanzazi disease or Schindler disease type II) which is mild; NAGA deficiency type III (Schindler disease type III) characterized by mild-to-moderate neurologic manifestations. NAGA deficiency results in the increased urinary excretion of glycopeptides and oligosaccharides containing alpha-N-acetylgalactosaminyl moieties. | 250,600 |
| NEB | Nemaline myopathy type 2 | NM_004543.4 | NM_004543.4:c.11474_11475delTG, NM_004543.4:c.19119_19120delGA, NM_004543.4:c.19306-1G>A, NM_004543.4:c.19606G>T, NM_004543.4:c.6105dupT, NM_004543.4:c.3191A>G, NM_004543.4:c.18318_18319delAG, NM_004543.4:c.11473_11474delAT, NM_004543.4:c.2173G>T, NM_004543.4:c.19097_19098delTT, NM_004543.4:c.19836+1_19836+2insATGGA, NM_004543.4:c.18825+1370C>T, NM_004543.4:c.5567G>A, NM_004543.4:c.6105_6106insT, NM_004543.4:c.16842+1G>A, NM_004543.4:c.843T>G, NM_004543.4:c.8031_8041delAAATAAACGAG, NM_004543.4:c.14182_14183delGCinsAA, NM_004543.4:c.15973C>T | Nemaline myopathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEB gene located on chromosomal region 2q23.3. The age of onset is infantile or adult. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:100,000-9:100,000 and the incidence is 1/50.000 newborn. | 250,600 |
| NMNAT1 | Leber congenital amaurosis type 9 | NM_022787.3 | NM_022787.3:c.451G>T, NM_022787.3:c.25G>A, NM_022787.3:c.457C>G, NM_022787.3:c.507G>A, NM_022787.3:c.710G>T, NM_022787.3:c.619C>T, NM_022787.3:c.769G>A | Leber congenital amaurosis type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NMNAT1 gene located on chromosomal region 1p36.22. The age of onset is early infantile. This disease is characterized by blindness, nystagmus, roving eye movement, leading to severe visual impairment. | 250,600 |
| NPC1 | Niemann-Pick disease type C1 | NM_000271.4 | NM_000271.4:c.1042C>T, NM_000271.4:c.2842G>A, NM_000271.4:c.1628C>T, NM_000271.4:c.2974G>T, NM_000271.4:c.3019C>G, NM_000271.4:c.1211G>A, NM_000271.4:c.2072C>T, NM_000271.4:c.2324A>C, NM_000271.4:c.337T>C, NM_000271.4:c.3107C>T, NM_000271.4:c.530G>A, NM_000271.4:c.743G>T, NM_000271.4:c.3611_3614delTTAC, NM_000271.4:c.813_815delCAT, NM_000271.4:c.2932C>T, NM_000271.4:c.3425T>C, NM_000271.4:c.2761C>T, NM_000271.4:c.3104C>T, NM_000271.4:c.3662delT, NM_000271.4:c.2972_2973delAG, NM_000271.4:c.2974G>A, NM_000271.4:c.2873G>A, NM_000271.4:c.352_353delAG, NM_000271.4:c.3182T>C, NM_000271.4:c.3467A>G, NM_000271.4:c.3175C>T, NM_000271.4:c.2861C>T, NM_000271.4:c.2848G>A | Niemann-Pick disease type C1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC1 gene located on chromosomal region 18q11.2. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000. | 250,600 |
| NPC2 | Niemann-Pick disease type C2 | NM_006432.3 | NM_006432.3:c.115G>A, NM_006432.3:c.190+5G>A, NM_006432.3:c.27delG, NM_006432.3:c.352G>T, NM_006432.3:c.58G>T, NM_006432.3:c.358C>T, NM_006432.3:c.295T>C, NM_006432.3:c.441+1G>A, NM_006432.3:c.436C>T | Niemann-Pick disease type C2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC2 gene located on chromosomal region 14q24.3. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000. | 250,600 |
| NPHP3 | Nephronophthisis type 3 | NM_153240.4 | NM_153240.4:c.1817G>A, NM_153240.4:c.434_437delAAAG, NM_153240.4:c.1119-2A>G, NM_153240.4:c.1729C>T, NM_153240.4:c.2694-2A>G, NM_153240.4:c.1985+5G>A, NM_153240.4:c.3406C>T, NM_153240.4:c.3373C>T, NM_153240.4:c.1381G>T, NM_153240.4:c.2694-2_2694-1delAG, NM_153240.4:c.1157A>G, NM_153240.4:c.2369T>C, NM_153240.4:c.3550G>A, NM_153240.4:c.2541delG, NM_153240.4:c.2570+1G>T, NM_153240.4:c.3156_3157insA, NM_153240.4:c.3662C>T | Nephronophthisis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP3 gene located on chromosomal region 3q22.1. The age of onset is adult. This disease is characterized by polyuria, polydipsia, anemia. Onset of terminal renal failure occur significantly later (median age, 19 years) than in juvenile nephronophthisis. Renal pathology is characterized by alterations of tubular basement membranes, tubular atrophy and dilation, sclerosing tubulointerstitial nephropathy, and renal cyst development predominantly at the corticomedullary junction. The prevalence is <1:1,000,000. | 250,600 |
| NPHP4 | Nephronophthisis type 4 | NM_015102.4 | NM_015102.4:c.4179T>A, NM_015102.4:c.3767_3768insAA, NM_015102.4:c.3674C>T, NM_015102.4:c.556_557insT, NM_015102.4:c.2940_2944dupGCTCC, NM_015102.4:c.3231+1G>C, NM_015102.4:c.517C>T, NM_015102.4:c.2335C>T, NM_015102.4:c.2219G>A, NM_015102.4:c.7G>T, NM_015102.4:c.1972C>T, NM_015102.4:c.1120-1G>C | Nephronophthisis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP4 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease results in end-stage renal disease at age ranging between 6 and 35 years. It is a progressive tubulo-interstitial kidney disorder characterized by polydipsia, polyuria, anemia and growth retardation. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| NPHS1 | Nephrotic syndrome type 1 | NM_004646.3 | NM_004646.3:c.59-5C>G, NM_004646.3:c.3109+1G>A, NM_004646.3:c.3478C>T, NM_004646.3:c.121_122delCT, NM_004646.3:c.1481delC, NM_004646.3:c.2456A>T, NM_004646.3:c.2491C>T, NM_004646.3:c.2464G>A, NM_004646.3:c.1307_1308dupAC, NM_004646.3:c.3250delG, NM_004646.3:c.3325C>T, NM_004646.3:c.2928G>T, NM_004646.3:c.3250_3251insG, NM_004646.3:c.2746G>T, NM_004646.3:c.1715G>A | Nephrotic syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHS1 gene located on chromosomal region 19q13.12. The age of onset is fetal- infantile. This disease is characterized by fetal proteinuria and nephritic infantile syndrome. The prevalence is 1 in 8 200 births. | 250,600 |
| NR2E3 | Enhaced S-Cone Syndrome | NM_014249.3 | NM_014249.3:c.119-2A>C, NM_014249.3:c.297_298delGT, NM_014249.3:c.932G>A, NM_014249.3:c.226C>T, NM_014249.3:c.361G>A, NM_014249.3:c.227G>A, NM_014249.3:c.1034_1038delTGCAG | Enhaced S-Cone Syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NR2E3 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by night blindness, reduced bilateral visual acuity, and typical fundus findings (progressive pigmentary degenerative changes, macular edema, retinoschisis). | 250,600 |
| OCA2 | Oculocutaneous albinism type 2 | NM_000275.2 | NM_000275.2:c.1610A>G, NM_000275.2:c.1960delG, NM_000275.2:c.2359G>A, NM_000275.2:c.819_822delCTGGinsGGTC, NM_000275.2:c.2228C>T, NM_000275.2:c.1025A>G, NM_000275.2:c.1842+1G>T, NM_000275.2:c.157delA, NM_000275.2:c.1182G>A, NM_000275.2:c.1182+2T>C, NM_000275.2:c.1441G>A, NM_000275.2:c.79G>A, NM_000275.2:c.1465A>G, NM_000275.2:c.1327G>A, NM_000275.2:c.1364+1G>T | Oculocutaneous albinism type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OCA2 gene located on chromosomal region 15q12-q13. The age of onset is infantile. This disease is characterized by variable hypopigmentation of the skin and hair, numerous characteristic ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1/38,000-1/40,000 | 250,600 |
| OTOA | Deafness type 22, autosomal recessive | NM_144672.3 | NM_144672.3:c.2301+1G>T, NM_144672.3:c.2359G>T, NM_144672.3:c.121-1G>A, NM_144672.3:c.827delT, NM_144672.3:c.1725_1726delCA | Deafness, autosomal recessive type 22 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOA gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| OTOF | Deaffness type 9, autosomal recessive | NM_194248.2 | NM_194248.2:c.149G>A, NM_194248.2:c.1867G>A, NM_194248.2:c.1669G>A, NM_194248.2:c.2381G>A, NM_194248.2:c.1498C>T, NM_194248.2:c.1544T>C, NM_194248.2:c.5473C>G, NM_194248.2:c.1150G>A, NM_194248.2:c.1778delT, NM_194248.2:c.5103+2T>A, NM_194248.2:c.227+2T>C, NM_194248.2:c.5474_5475delCC, NM_194248.2:c.5332G>A, NM_194248.2:c.584-1G>C, NM_194248.2:c.98G>A, NM_194248.2:c.2348delG, NM_194248.2:c.3032T>C, NM_194248.2:c.4559G>A, NM_194248.2:c.4491T>A, NM_194248.2:c.5816G>A, NM_194248.2:c.766-2A>G, NM_194248.2:c.2485C>T, NM_194248.2:c.2401G>T | Deaffness, autosomal recessive type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| PAH | Phenylketonuria | NM_000277.1 | NM_000277.1:c.1139C>T, NM_000277.1:c.1066-3C>T, NM_000277.1:c.117C>G, NM_000277.1:c.1166delC, NM_000277.1:c.1068C>A, NM_000277.1:c.1315+1G>A, NM_000277.1:c.1162G>A, NM_000277.1:c.143T>C, NM_000277.1:c.1243G>A, NM_000277.1:c.1169A>G, NM_000277.1:c.136G>A, NM_000277.1:c.1184C>A, NM_000277.1:c.194T>C, NM_000277.1:c.1199+17G>A, NM_000277.1:c.232G>A, NM_000277.1:c.1045T>C, NM_000277.1:c.1197A>T, NM_000277.1:c.441+1G>A, NM_000277.1:c.442-1G>A, NM_000277.1:c.442-5C>G, NM_000277.1:c.450_451insA, NM_000277.1:c.472C>T, NM_000277.1:c.204A>T, NM_000277.1:c.482T>C, NM_000277.1:c.250G>T, NM_000277.1:c.261C>A, NM_000277.1:c.1030G>A, NM_000277.1:c.1199+1G>A, NM_000277.1:c.1238G>C, NM_000277.1:c.1241A>G, NM_000277.1:c.673C>G, NM_000277.1:c.688G>A, NM_000277.1:c.721C>T, NM_000277.1:c.722delG, NM_000277.1:c.722G>A, NM_000277.1:c.727C>T, NM_000277.1:c.728G>A, NM_000277.1:c.733G>C, NM_000277.1:c.734T>C, NM_000277.1:c.737C>A, NM_000277.1:c.745C>T, NM_000277.1:c.1042C>G, NM_000277.1:c.638T>C, NM_000277.1:c.764T>C, NM_000277.1:c.782G>A, NM_000277.1:c.806delT, NM_000277.1:c.809G>A, NM_000277.1:c.814G>T, NM_000277.1:c.818C>T, NM_000277.1:c.823C>T, NM_000277.1:c.829T>G, NM_000277.1:c.898G>T, NM_000277.1:c.912+1G>A, NM_000277.1:c.284_286delTCA, NM_000277.1:c.754C>T, NM_000277.1:c.755G>A, NM_000277.1:c.357delC, NM_000277.1:c.1217T>C, NM_000277.1:c.1222C>T, NM_000277.1:c.157C>T, NM_000277.1:c.158G>A, NM_000277.1:c.165T>G, NM_000277.1:c.473G>A, NM_000277.1:c.490A>G, NM_000277.1:c.503delA, NM_000277.1:c.508C>G, NM_000277.1:c.533A>G, NM_000277.1:c.665A>G, NM_000277.1:c.838G>A, NM_000277.1:c.842+5G>A, NM_000277.1:c.896T>G, NM_000277.1:c.320A>G, NM_000277.1:c.441+5G>T, NM_000277.1:c.311C>A, NM_000277.1:c.527G>T, NM_000277.1:c.529G>A, NM_000277.1:c.47_48delCT, NM_000277.1:c.1208C>T, NM_000277.1:c.331C>T, NM_000277.1:c.926C>T, NM_000277.1:c.955G>T, NM_000277.1:c.926C>A, NM_000277.1:c.509+1G>A, NM_000277.1:c.1033G>T, NM_000277.1:c.611A>G, NM_000277.1:c.1066-11G>A, NM_000277.1:c.569T>C | Phenylketonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAH gene located on chromosomal region 12q23.2. The age of onset is neonatal. This disease is characterized by gradual developmental delay, stunted growth, microcephaly, seizures, tremors, eczema, vomiting, and musty odor. Untreated patients subsequently develop intellectual disability, behavioral disorders (hyperactivity) and motor disorders. The prevalence is 1:2,600-1:200,000. | 250,600 |
| PALB2 | Fanconi anemia, complementation group N | NM_024675.3 | NM_024675.3:c.1882_1890delAAGTCCTGC, NM_024675.3:c.2962C>T, NM_024675.3:c.50T>G, NM_024675.3:c.3116delA, NM_024675.3:c.3287A>G, NM_024675.3:c.3549C>G, NM_024675.3:c.3113G>A, NM_024675.3:c.2816T>G, NM_024675.3:c.1240C>T, NM_024675.3:c.557_558insA | Fanconi anemia, complementation group N follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PALB2 gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| PANK2 | Pantothenate kinase-associated neurodegeneration | NM_153638.2 | NM_153638.2:c.1561G>A, NM_153638.2:c.688G>A, NM_153638.2:c.790C>T, NM_153638.2:c.821_822delCT, NM_153638.2:c.1583C>T, NM_153638.2:c.1211A>T | Pantothenate kinase-associated neurodegeneration follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PANK2 gene located on chromosomal region 20p13. The age of onset is infantile. This disease is characterized by progressive extrapyramidal dysfunction (dystonia, rigidity, choreoathetosis), iron accumulation on the brain and axonal spheroids in the central nervous system. The prevalence is 1-2/1,000,000. | 250,600 |
| PC | Pyruvate carboxylase deficiency | NM_000920.3 | NM_000920.3:c.434T>C, NM_000920.3:c.1748G>T, NM_000920.3:c.496G>A | Pyruvate carboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PC gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by metabolic acidosis, failure to thrive, developmental delay, and recurrent seizures. The prevalence is 1:250,000. | 250,600 |
| PCCA | Propionic acidemia type 1 | NM_000282.3 | NM_000282.3:c.1598_1601delTTGT, NM_000282.3:c.412G>A, NM_000282.3:c.1226_1227delTT, NM_000282.3:c.1891G>C, NM_000282.3:c.1899+1_1899+4delGTAA, NM_000282.3:c.1284+1G>A, NM_000282.3:c.229C>T, NM_000282.3:c.1023dupT, NM_000282.3:c.600+1G>A, NM_000282.3:c.261_262insT, NM_000282.3:c.1118T>A, NM_000282.3:c.862A>T | Propionic acidemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCA gene located on chromosomal region 13q32.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000. | 250,600 |
| PCCB | Propionic acidemia type 2 | NM_000532.4 | NM_000532.4:c.1279_1291delGTTCCCinsAA, NM_000532.4:c.1283C>T, NM_000532.4:c.337C>T, NM_000532.4:c.1538_1540dupCCC, NM_000532.4:c.990dupT, NM_000532.4:c.1304A>G, NM_000532.4:c.1228C>T, NM_000532.4:c.1229_1230insT, NM_000532.4:c.1606A>G, NM_000532.4:c.1223_1226delTCAT, NM_000532.4:c.1490C>T, NM_000532.4:c.1534C>T, NM_000532.4:c.1173_1174insT, NM_000532.4:c.1540_1541insCCC, NM_000532.4:c.331C>T, NM_000532.4:c.683C>T, NM_000532.4:c.797G>T, NM_000532.4:c.737G>T, NM_000532.4:c.1218_1231delinsTAGAGCACAGGA, NM_000532.4:c.502G>A, NM_000532.4:c.562G>A, NM_000532.4:c.1219_1224delGGCATCinsAA | Propionic acidemia type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCB gene located on chromosomal region 3q22.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy.. The prevalence is 1:100,000. | 250,600 |
| PCDH15 | Usher syndrome type 1F | NM_033056.3 | NM_033056.3:c.1583T>A, NM_033056.3:c.4885delA, NM_033056.3:c.4961_4962insTGAT, NM_033056.3:c.5659A>T, NM_033056.3:c.4937_4940dupTGAT, NM_033056.3:c.785G>A, NM_033056.3:c.5622_5624delAAC, NM_033056.3:c.400C>T, NM_033056.3:c.5724_5755delACGCACAAATGTTTCAGAACTTCAAACTATGT, NM_033056.3:c.4864delA, NM_033056.3:c.1737C>G, NM_033056.3:c.1021C>T, NM_033056.3:c.1088delT, NM_033056.3:c.1006C>T, NM_033056.3:c.1940C>G, NM_033056.3:c.400C>G, NM_033056.3:c.3718-2A>G, NM_033056.3:c.4548_4551dupATCT, NM_033056.3:c.7C>T, NM_033056.3:c.2645_2646delAT | Usher syndrome type 1F follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCDH15 gene located on chromosomal region 10q21.1. The age of onset is early. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 4.4:100,000. | 250,600 |
| PDE6A | Retinitis pigmentosa type 43 | NM_000440.2 | NM_000440.2:c.1683G>A, NM_000440.2:c.1113+1G>T, NM_000440.2:c.718-4_718-3insT, NM_000440.2:c.1749C>G, NM_000440.2:c.2053G>A, NM_000440.2:c.1560_1561insA, NM_000440.2:c.304C>A, NM_000440.2:c.1040C>T, NM_000440.2:c.1113+1G>A | Retinitis pigmentosa 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 250,600 |
| PDE6B | Retinitis pigmentosa type 43 | NM_000283.3 | NM_000283.3:c.1580T>C, NM_000283.3:c.655T>C, NM_000283.3:c.1540delC, NM_000283.3:c.1572delC, NM_000283.3:c.1920+2T>C, NM_000283.3:c.1669C>T, NM_000283.3:c.892C>T | Retinitis pigmentosa 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 250,600 |
| PEX1 | Peroxisome biogenesis disorder type 1A | NM_000466.2 | NM_000466.2:c.2097dupT, NM_000466.2:c.2916delA, NM_000466.2:c.1842delA, NM_000466.2:c.1991T>C, NM_000466.2:c.1239+1G>T | Peroxisome biogenesis disorder type 1A (Zellweger) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. The age of onset is early. This disease is characterized by neuronal migration defects in the brain, dysmorphic craniofacial features, profound hypotonia, neonatal seizures, and liver dysfunction. The prevalence is 1:1,000,000. | 250,600 |
| PEX1 | Peroxisome biogenesis disorder type 1B | NM_000466.2 | NM_000466.2:c.2097_2098insT, NM_000466.2:c.1952_1960dupCAGTGTGGA, NM_000466.2:c.877C>T, NM_000466.2:c.3505_3517delCAGTTGTTTTCAC, NM_000466.2:c.2528G>A | Peroxisome biogenesis disorder type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. The age of onset is early. This disease includes neonatal adrenoleukodystrophy and infantile Refsum disease, two milder manifestations of the Zellweger disease spectrum. The clinical course of patients is variable and may include developmental delay, hypotonia, liver dysfunction, sensorineural hearing loss, retinal dystrophy and vision impairment. | 250,600 |
| PEX7 | Rhizomelic chondrodysplasia punctata type 1 | NM_000288.3 | NM_000288.3:c.694C>T, NM_000288.3:c.649G>A, NM_000288.3:c.618G>A, NM_000288.3:c.722A>T, NM_000288.3:c.875T>A, NM_000288.3:c.653C>T, NM_000288.3:c.854A>G, NM_000288.3:c.532C>T, NM_000288.3:c.903+1G>C | Rhizomelic chondrodysplasia punctata type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX7 gene located on chromosomal region 6q23.3. The age of onset is early. This disease is characterized by proximal shortening of the humerus and to a lesser degree the femur (rhizomelia), punctate calcifications in cartilage with epiphyseal and metaphyseal abnormalities (chondrodysplasia punctata), coronal clefts of the vertebral bodies, cataracts, postnatal growth deficiency is profound, intellectual disability is severe, seizures. The prevalence is <1:100,000. | 250,600 |
| PHYH | Refsum disease | NM_006214.3 | NM_006214.3:c.135-2A>G, NM_006214.3:c.497-2A>G, NM_006214.3:c.135-1G>C, NM_006214.3:c.805A>C, NM_006214.3:c.678+5G>T, NM_006214.3:c.823C>T, NM_006214.3:c.530A>G, NM_006214.3:c.164delT, NM_006214.3:c.678+2T>G, NM_006214.3:c.824G>A | Refsum disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHYH gene located on chromosomal region 10p13. The age of onset is variable. This disease is characterized by hemeralopia (loss of vision in the dark), followed by episods of chronic distal motor polyneuropathy. Other associated signs include perceptive deafness, anosmia, cerebellous ataxia and sometimes, severe intellectual deficiency. Over the course of time cutaneous signs appear (ichtyosis), along with polyepiphyseal dysplasia, myocardiopathy, elevated protein in cerebrospinal fluid, and pigmentary retinitis that may result in blindness. The prevalence is 1:1.000,000-9:1.000,000. | 250,600 |
| PKHD1 | Polycystic kidney disease, autosomal recessive | NM_138694.3 | NM_138694.3:c.10515C>A, NM_138694.3:c.11363_11372delCTTCCCTGGA, NM_138694.3:c.10585G>C, NM_138694.3:c.107C>T, NM_138694.3:c.10452dupT, NM_138694.3:c.2452C>T, NM_138694.3:c.2747A>C, NM_138694.3:c.12027C>G, NM_138694.3:c.11284C>A, NM_138694.3:c.3367G>A, NM_138694.3:c.353delG, NM_138694.3:c.2827_2828delGA, NM_138694.3:c.2854G>A, NM_138694.3:c.1342G>C, NM_138694.3:c.1409G>A, NM_138694.3:c.11611T>C, NM_138694.3:c.3761_3762delCCinsG, NM_138694.3:c.2414C>T, NM_138694.3:c.5895_5896insA, NM_138694.3:c.5895dupA, NM_138694.3:c.6499C>T, NM_138694.3:c.664A>G, NM_138694.3:c.682A>G, NM_138694.3:c.6854G>A, NM_138694.3:c.370C>T, NM_138694.3:c.8407T>C, NM_138694.3:c.3766delC, NM_138694.3:c.3940delA, NM_138694.3:c.1486C>T, NM_138694.3:c.2341C>T, NM_138694.3:c.10219C>T, NM_138694.3:c.9107T>G, NM_138694.3:c.930delC, NM_138694.3:c.9370C>T, NM_138694.3:c.9530T>C, NM_138694.3:c.9689delA, NM_138694.3:c.982C>T, NM_138694.3:c.9866G>T, NM_138694.3:c.10036T>C, NM_138694.3:c.3229-2A>C, NM_138694.3:c.4870C>T, NM_138694.3:c.4165C>A, NM_138694.3:c.9719G>A, NM_138694.3:c.5325_5326delAG, NM_138694.3:c.5498C>T, NM_138694.3:c.8824C>T, NM_138694.3:c.85G>T, NM_138694.3:c.10412T>G, NM_138694.3:c.8518C>T, NM_138694.3:c.8408G>A, NM_138694.3:c.8317G>T, NM_138694.3:c.8870T>C | Autosomal recessive polycystic kidney disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKHD1 gene located on chromosomal region 6p12.3-p12.2. The age of onset is early. This disease is characterized by the development of cysts affecting the collecting ducts. It is frequently associated with hepatic involvement. After birth, in addition to nephromegaly, arterial hypertension and urinary tract infections are common and often severe. The prevalence is 1:10,000-1:40,000. | 250,600 |
| PKLR | Hemolytic anemia due to red cell pyruvate kinase deficiency | NM_000298.5 | NM_000298.5:c.1151C>T, NM_000298.5:c.1706G>A, NM_000298.5:c.1529G>A, NM_000298.5:c.1528C>T, NM_000298.5:c.1595G>A, NM_000298.5:c.721G>T, NM_000298.5:c.1076G>A, NM_000298.5:c.1675C>T, NM_000298.5:c.1261C>A, NM_000298.5:c.1436G>A, NM_000298.5:c.1456C>T | Hemolytic anemia due to red cell pyruvate kinase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKLR gene located on chromosomal region 1q22. The age of onset is early. This disease is characterized by highly variable degree of chronic hemolysis, with severe neonatal jaundice and fatal anemia at birth, severe transfusion-dependent chronic hemolysis, and moderate hemolysis with exacerbation during infection. The prevalence is 1:20,000. | 250,600 |
| PLCE1 | Nephrotic syndrome type 3 | NM_016341.3 | NM_016341.3:c.3346C>T, NM_016341.3:c.4808delA, NM_016341.3:c.3846delG, NM_016341.3:c.3736C>T, NM_016341.3:c.5560C>T, NM_016341.3:c.4451C>T, NM_016341.3:c.5669C>T, NM_016341.3:c.961C>T | Nephrotic syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLCE1 gene located on chromosomal region 10q23.33. The age of onset is variable. This disease is characterized by low blood protein levels, high cholesterol levels, high triglyceride levels, and presence of protein in the urine. The prevalence is 2:100,000-7:100,000 Children; 3:100,000 adults. | 250,600 |
| PLG | Congenital plasminogen deficiency type 1 | NM_000301.3 | NM_000301.3:c.704G>A, NM_000301.3:c.1848G>A, NM_000301.3:c.1435G>T, NM_000301.3:c.693_695delGAA, NM_000301.3:c.1120G>T, NM_000301.3:c.112A>G | Plasminogen deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLG gene located on chromosomal region 6q26. The age of onset is infantile.This disease is characterized by markedly impaired extracellular fibrinolysis leading to the formation of ligneous (fibrin-rich) pseudomembranes on mucosae during wound healing. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| PMM2 | Congenital disorders of glycosylation type 1a | NM_000303.2 | NM_000303.2:c.349G>C, NM_000303.2:c.357C>A, NM_000303.2:c.255+2T>C, NM_000303.2:c.127G>C, NM_000303.2:c.395T>C, NM_000303.2:c.415G>A, NM_000303.2:c.368G>A, NM_000303.2:c.385G>A, NM_000303.2:c.470T>C, NM_000303.2:c.484C>T, NM_000303.2:c.422G>A, NM_000303.2:c.442G>A, NM_000303.2:c.623G>C, NM_000303.2:c.647A>T, NM_000303.2:c.652C>G, NM_000303.2:c.323C>T, NM_000303.2:c.677C>G, NM_000303.2:c.691G>A, NM_000303.2:c.710C>G, NM_000303.2:c.669C>G, NM_000303.2:c.95_96delTAinsGC, NM_000303.2:c.95T>G, NM_000303.2:c.53C>G, NM_000303.2:c.710C>T, NM_000303.2:c.620T>C, NM_000303.2:c.97C>T, NM_000303.2:c.193G>T, NM_000303.2:c.338C>T, NM_000303.2:c.563A>G, NM_000303.2:c.131T>C, NM_000303.2:c.26G>A, NM_000303.2:c.109C>T, NM_000303.2:c.317A>T, NM_000303.2:c.190delT, NM_000303.2:c.256-1G>C | Congenital disorder of glycosylation type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PMM2 gene located on chromosomal region 16p13.2. The age of onset is infantile. This disease is characterized by highly variable clinical manifestations that may include feeding problems, vomiting, and diarrhea with failure to thrive in infants, and severe encephalopathy with axial hypotonia, abnormal eye movement, marked psychomotor retardation, peripheral neuropathy, cerebellar hypoplasia, stroke-like episodes, and retinitis pigmentosa in late infancy, childhood or adulthood. | 250,600 |
| POLG | Mitochondrial DNA depletion syndrome, Alpers type | NM_002693.2 | NM_002693.2:c.2617G>T, NM_002693.2:c.1120C>T, NM_002693.2:c.830A>T, NM_002693.2:c.3218C>T, NM_002693.2:c.3630dupC | Mitochondrial DNA depletion syndrome, Alpers type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by the clinical triad of psychomotor regression, seizures, and liver disease. The prevalence is 1:1,600 newborn. | 250,600 |
| POLG | Progressive external ophthalmoplegia | NM_002693.2 | NM_002693.2:c.1437C>G, NM_002693.2:c.2591A>G, NM_002693.2:c.1754G>A, NM_002693.2:c.1399G>A, NM_002693.2:c.1491G>C, NM_002693.2:c.3151G>C, NM_002693.2:c.803G>C, NM_002693.2:c.3286C>T, NM_002693.2:c.2794C>T, NM_002693.2:c.752C>T, NM_002693.2:c.3644-1G>A, NM_002693.2:c.1879C>T, NM_002693.2:c.2605C>T, NM_002693.2:c.911T>G, NM_002693.2:c.1760C>T, NM_002693.2:c.2542G>A, NM_002693.2:c.1550G>T, NM_002693.2:c.2557C>T, NM_002693.2:c.2207A>G, NM_002693.2:c.2243G>C, NM_002693.2:c.2209G>C | Progressive external ophthalmoplegia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by ptosis, paralysis of the extraocular muscles, oropharyngeal weakness, and variably severe proximal limb weakness. | 250,600 |
| POMGNT1 | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3 | NM_017739.3 | NM_017739.3:c.1425G>A, NM_017739.3:c.1545delC, NM_017739.3:c.1274G>C, NM_017739.3:c.1864delC, NM_017739.3:c.1411A>T, NM_017739.3:c.1469G>A, NM_017739.3:c.1539+1G>A, NM_017739.3:c.92dupA, NM_017739.3:c.1539+1G>T, NM_017739.3:c.932G>A, NM_017739.3:c.794G>A, NM_017739.3:c.880-1G>A, NM_017739.3:c.652+1G>A, NM_017739.3:c.931C>T, NM_017739.3:c.1666G>A, NM_017739.3:c.1814G>C, NM_017739.3:c.636C>T, NM_017739.3:c.187C>T | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3 which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMGNT1 gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent psychomotor development, eye involvement and seizures. The prevalence is 1-9:100,000. | 250,600 |
| POMT1 | Congenital muscular dystrophy with intellectual disability type B1 | NM_007171.3 | NM_007171.3:c.598G>C, NM_007171.3:c.193G>A, NM_007171.3:c.1770G>C, NM_007171.3:c.2005G>A, NM_007171.3:c.2163C>A, NM_007171.3:c.1746G>C, NM_007171.3:c.793C>T | Congenital muscular dystrophy with intellectual disability type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 gene located on chromosomal region 9q34.13. The age of onset is early. This disease is associated with mental retardation and mild structural brain abnormalities. | 250,600 |
| POMT1 | Walker-Warburg syndrome | NM_007171.3 | NM_007171.3:c.1540C>T, NM_007171.3:c.226G>A, NM_007171.3:c.1611C>G, NM_007171.3:c.1242-2A>G, NM_007171.3:c.907C>T, NM_007171.3:c.2163_2164insG, NM_007171.3:c.2167dupG, NM_007171.3:c.1153C>T, NM_007171.3:c.1261_1262insC, NM_007171.3:c.831C>G, NM_007171.3:c.1545C>G, NM_007171.3:c.1280_1281delAGinsTC | Walker-Warburg syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 and POMT2 genes located on chromosomal regions 9q34.13 and 14q24.3 respectively. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent or very poor psychomotor development, eye involvement and seizures. The prevalence is 1:100,000-9:100,000. | 250,600 |
| POMT2 | Congenital muscular dystrophy with intellectual disability type A2 | NM_013382.5 | NM_013382.5:c.2243G>C, NM_013382.5:c.1997A>G, NM_013382.5:c.2242T>C, NM_013382.5:c.1445G>T, NM_013382.5:c.2177G>A, NM_013382.5:c.1238G>C, NM_013382.5:c.1941G>A, NM_013382.5:c.1057G>A, NM_013382.5:c.551C>T | Congenital muscular dystrophy with intellectual disability type A2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT2 gene located on chromosomal region 14q24.3. The age of onset is early. This disorder characterized by congenital muscular dystrophy associated with cobblestone lissencephaly and other brain anomalies, eye malformations, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. | 250,600 |
| POMT2 | Walker-Warburg syndrome | NM_013382.5 | NM_013382.5:c.1726-2A>G, NM_013382.5:c.1417C>T, NM_013382.5:c.1912C>T, NM_013382.5:c.1608_1609delCA, NM_013382.5:c.1045_1052delinsG | Walker-Warburg syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 and POMT2 genes located on chromosomal regions 9q34.13 and 14q24.3 respectively. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent or very poor psychomotor development, eye involvement and seizures. The prevalence is 1:100,000-9:100,000. | 250,600 |
| PPT1 | Neuronal ceroid-lipofuscinoses type 1 | NM_000310.3 | NM_000310.3:c.29T>A, NM_000310.3:c.223A>C, NM_000310.3:c.627+1G>T, NM_000310.3:c.169_170insA, NM_000310.3:c.451C>T, NM_000310.3:c.541G>T, NM_000310.3:c.840_841insA | Neuronal ceroid lipofuscinoses, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PPT1 gene located on chromosomal region 1p32. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 1.5:1,000,000-9:1,000,000. | 250,600 |
| PRODH | Hyperprolinemia type 1 | NM_016335.4 | NM_016335.4:c.865T>A, NM_016335.4:c.1331G>A | Hyperprolinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PRODH gene located on chromosomal region 22q11.2. The age of onset is variable. This disease is characterized by benign symptoms, but associations with renal abnormalities, epileptic seizures, and other neurological manifestations, as well as certain forms of schizophrenia have been reported. | 250,600 |
| PROM1 | Retinitis pigmentosa type 41 | NM_006017.2 | NM_006017.2:c.1841delG, NM_006017.2:c.1354_1355insT, NM_006017.2:c.1726C>T, NM_006017.2:c.199C>T, NM_006017.2:c.2490-2A>G, NM_006017.2:c.1177_1178delAT | Retinitis pigmentosa 41 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROM1 gene located on chromosomal region 4p15.32. The age of onset is early. This disease is characterized by night blindness often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 19:100,000-27:100,000. | 250,600 |
| PYGM | McArdle disease | NM_005609.2 | NM_005609.2:c.1628A>C, NM_005609.2:c.1466C>G, NM_005609.2:c.1094C>T, NM_005609.2:c.1827G>A, NM_005609.2:c.13_14delCT, NM_005609.2:c.1A>G, NM_005609.2:c.2009C>T, NM_005609.2:c.2128_2130delTTC, NM_005609.2:c.393delG, NM_005609.2:c.2392T>C, NM_005609.2:c.148C>T, NM_005609.2:c.1621G>T, NM_005609.2:c.613G>A, NM_005609.2:c.1963G>A, NM_005609.2:c.2262delA, NM_005609.2:c.1722T>G, NM_005609.2:c.255C>A, NM_005609.2:c.280C>T, NM_005609.2:c.1768+1G>A, NM_005609.2:c.501dupT, NM_005609.2:c.481C>T, NM_005609.2:c.1726C>T | McArdle disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PYGM gene located on chromosomal region 11q13.1. The age of onset is infantile. This disease is characterized by muscular exercise intolerance with myalgia, cramps, fatigue, and muscle weakness. | 250,600 |
| RAG1 | Immunodeficiency severe combined B cell-negative | NM_000448.2 | NM_000448.2:c.2333G>A, NM_000448.2:c.2320G>T, NM_000448.2:c.2164G>A, NM_000448.2:c.940C>T, NM_000448.2:c.2814T>G, NM_000448.2:c.2923C>T, NM_000448.2:c.2326C>T | Severe combined immunodeficiency, autosomal recessive, T cell-negative, B cell negative, NK cell positive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 gene located on chromosomal region 11p13. The age of onset is early. This disease is characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development. | 250,600 |
| RAG1 | Omenn syndrome | NM_000448.2 | NM_000448.2:c.983G>A, NM_000448.2:c.3016A>G, NM_000448.2:c.256_257delAA, NM_000448.2:c.1682G>A, NM_000448.2:c.1681C>T | Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. | 250,600 |
| RAPSN | Congenital myasthenic syndrome | NM_005055.4 | NM_005055.4:c.484G>A, NM_005055.4:c.264C>A, NM_005055.4:c.807C>A, NM_005055.4:c.848T>C, NM_005055.4:c.490C>T, NM_005055.4:c.603C>A | Congenital myasthenic syndromes follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by fatigable weakness of skeletal muscle (e.g., ocular, bulbar, limb muscles) with onset at or shortly after birth or in early childhood; rarely, symptoms may not manifest until later in childhood. Cardiac and smooth muscle are not involved. Severity and course of disease are highly variable, ranging from minor symptoms to progressive disabling weakness. The prevalence is 1:3,000. | 250,600 |
| RAPSN | Fetal akinesia deformation sequence | NM_005055.4 | NM_005055.4:c.416T>C, NM_005055.4:c.566C>T | Fetal akinesia deformation sequence follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by multiple joint contractures, facial anomalies and pulmonary hypoplasia. The prevalence is 1:3,000. | 250,600 |
| RAX | Isolated microphthalmia type 3 | NM_013435.2 | NM_013435.2:c.909C>G, NM_013435.2:c.18C>A, NM_013435.2:c.197G>C, NM_013435.2:c.439C>T, NM_013435.2:c.383_384delAG | Isolated microphthalmia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAX gene located on chromosomal region 18q21.32. Microphthalmia designates a heterogeneous group of ocular malformations with a more or less evident reduction in the size of the eyeball. Additional features include high hypermetropia and a short axial length. | 250,600 |
| RDH12 | Leber congenital amaurosis type 13 | NM_152443.2 | NM_152443.2:c.184C>T, NM_152443.2:c.146C>T, NM_152443.2:c.152T>A, NM_152443.2:c.451C>A, NM_152443.2:c.295C>A, NM_152443.2:c.377C>T, NM_152443.2:c.379G>T, NM_152443.2:c.565C>T, NM_152443.2:c.677A>G, NM_152443.2:c.805_809delGCCCT, NM_152443.2:c.164C>T, NM_152443.2:c.210dupC, NM_152443.2:c.448+1_448+4delGTAA, NM_152443.2:c.451C>G, NM_152443.2:c.464C>T, NM_152443.2:c.523T>C | Leber congenital amaurosis type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDH12 gene located on chromosomal region 14q24.1. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. | 250,600 |
| RGR | Retinitis pigmentosa type 44 | NM_001012720.1 | NM_001012720.1:c.196A>C, NM_001012720.1:c.249_250insGGCTCGGA, NM_001012720.1:c.261_262insGGCTCGGA, NM_001012720.1:c.454C>A, NM_001012720.1:c.865C>T, NM_001012720.1:c.877C>T | Retinitis pigmentosa type 44 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RGR gene located on chromosomal region 10q23.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 250,600 |
| RHO | Retinitis pigmentosa type 4 | NM_000539.3 | NM_000539.3:c.152G>C, NM_000539.3:c.173C>T, NM_000539.3:c.448G>A, NM_000539.3:c.620T>G, NM_000539.3:c.670G>A, NM_000539.3:c.745G>T, NM_000539.3:c.659T>G | Retinitis pigmentosa type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RHO gene located on chromosomal region 3q22.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 250,600 |
| RLBP1 | Retinitis punctata albescens | NM_000326.4 | NM_000326.4:c.333T>G, NM_000326.4:c.452G>A, NM_000326.4:c.700C>T, NM_000326.4:c.875C>T | Retinitis punctata albescens follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RLBP1 gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by night blindness from early childhood, delay in the regeneration of cone and rod photopigments in young adults, followed by macular degeneration and a decrease in visual acuity that led to legal blindness in early adulthood. | 250,600 |
| RPE65 | Leber congenital amaurosis type 2 | NM_000329.2 | NM_000329.2:c.1067delA, NM_000329.2:c.1301C>T, NM_000329.2:c.1292A>G, NM_000329.2:c.272G>A, NM_000329.2:c.907A>T, NM_000329.2:c.514_515delGT | Leber congenital amaurosis 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus. | 250,600 |
| RPE65 | Retinitis pigmentosa type 20 | NM_000329.2 | NM_000329.2:c.1022T>C, NM_000329.2:c.1087C>A, NM_000329.2:c.1102T>C, NM_000329.2:c.271C>T, NM_000329.2:c.1355T>G, NM_000329.2:c.1543C>T, NM_000329.2:c.394G>A, NM_000329.2:c.881A>C | Retinitis pigmentosa type 20 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 250,600 |
| RPGRIP1L | Joubert syndrome type 7 | NM_015272.2 | NM_015272.2:c.1177G>A, NM_015272.2:c.1326_1329delAAAA, NM_015272.2:c.1329_1330insA, NM_015272.2:c.1843A>C, NM_015272.2:c.1975T>C, NM_015272.2:c.2030C>T, NM_015272.2:c.2050C>T, NM_015272.2:c.2413C>T, NM_015272.2:c.757C>T, NM_015272.2:c.3548C>G, NM_015272.2:c.697A>T, NM_015272.2:c.3634_3637delGAAA, NM_015272.2:c.776+1G>A, NM_015272.2:c.2794_2795delTT | Joubert syndrome type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. This disease is characterized by cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy and renal disease. | 250,600 |
| RPGRIP1L | Meckel syndrome type 5 | NM_015272.2 | NM_015272.2:c.394A>T, NM_015272.2:c.3706C>T, NM_015272.2:c.2614C>T | Meckel syndrome, type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. This disease is characterized by a combination of renal cysts and variably associated features, including developmental anomalies of the central nervous system (usually occipital encephalocele), hepatic ductal dysplasia and cysts, and polydactyly. The prevalence is <1:1,000,000. | 250,600 |
| RYR1 | Central core disease | NM_000540.2 | NM_000540.2:c.1021G>A, NM_000540.2:c.10343C>T, NM_000540.2:c.10579C>T, NM_000540.2:c.10616G>A, NM_000540.2:c.11798A>G, NM_000540.2:c.1205T>C, NM_000540.2:c.13480G>T, NM_000540.2:c.13513G>C, NM_000540.2:c.14365-2A>T, NM_000540.2:c.14511+1_14511+2delGT, NM_000540.2:c.14545G>A, NM_000540.2:c.1739_1742dupATCA, NM_000540.2:c.1841G>T, NM_000540.2:c.325C>T, NM_000540.2:c.4076delG, NM_000540.2:c.4178A>G, NM_000540.2:c.4405C>T, NM_000540.2:c.487C>T, NM_000540.2:c.5036G>A, NM_000540.2:c.5333C>A, NM_000540.2:c.5726_5727delAG, NM_000540.2:c.6082C>T, NM_000540.2:c.6104A>T, NM_000540.2:c.631+2T>C, NM_000540.2:c.6961A>G, NM_000540.2:c.7025A>G, NM_000540.2:c.7268T>A, NM_000540.2:c.7300G>A, NM_000540.2:c.7360C>T, NM_000540.2:c.7373G>A, NM_000540.2:c.738T>G, NM_000540.2:c.7463_7475delCAAAGATGTCAGC, NM_000540.2:c.9000+1G>T, NM_000540.2:c.14126C>T, NM_000540.2:c.1655G>A, NM_000540.2:c.4729G>A, NM_000540.2:c.7781C>A, NM_000540.2:c.7836-1G>A, NM_000540.2:c.8360C>G, NM_000540.2:c.9868G>A, NM_000540.2:c.9905_9906insC, NM_000540.2:c.1186G>T, NM_000540.2:c.6721C>T | Central core disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RYR1 gene located on chromosomal region 19q13.2. Typical central core disease is a relatively mild congenital myopathy, usually characterized by motor developmental delay and signs of mild proximal weakness most pronounced in the hip girdle musculature. Orthopedic complications, particularly congenital dislocation of the hips and scoliosis, are common, and patients are at risk of having malignant hyperthermia. Onset is usually in childhood, although adult onset has also been reported. | 250,600 |
| SACS | Spastic ataxia, Charlevoix-Saguenay type | NM_014363.5 | NM_014363.5:c.10907G>A, NM_014363.5:c.10954C>A, NM_014363.5:c.11624G>A, NM_014363.5:c.12160C>T, NM_014363.5:c.517C>T, NM_014363.5:c.6355C>T, NM_014363.5:c.6781C>A, NM_014363.5:c.7504C>T, NM_014363.5:c.8107C>T, NM_014363.5:c.8844delT, NM_014363.5:c.994A>T, NM_014363.5:c.13237C>T, NM_014363.5:c.3198T>A, NM_014363.5:c.4933C>T, NM_014363.5:c.5618_5619delAT, NM_014363.5:c.6563T>A | Spastic ataxia, Charlevoix-Saguenay type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SACS gene located on chromosomal region 13q11. The age of onset is early. This disease is characterized by early-onset cerebellar ataxia with spasticity, a pyramidal syndrome and peripheral neuropathy. The prevalence is 1:1,500-1:2,000. | 250,600 |
| SAG | Oguchi disease | NM_000541.4 | NM_000541.4:c.293_294insG, NM_000541.4:c.523C>T, NM_000541.4:c.577C>T, NM_000541.4:c.874C>T, NM_000541.4:c.916G>T, NM_000541.4:c.926delA, NM_000541.4:c.993C>G | Oguchi disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SAG gene located on chromosomal region 2q37. The age of onset is infantile. This disease is characterized by congenital stationary night blindness and the Mizuo-Nakamura phenomenon which is a unique morphological and functional abnormality of the retina that presents with a typical golden-yellow or silver-gray discoloration of the fundus in the presence of light that disappears after dark-adaptation and appears again after the onset of light. | 250,600 |
| SBDS | Shwachman-Diamond syndrome | NM_016038.2 | NM_016038.2:c.120delG, NM_016038.2:c.127G>T, NM_016038.2:c.183_184delTAinsCT, NM_016038.2:c.184A>T, NM_016038.2:c.377G>C, NM_016038.2:c.505C>T, NM_016038.2:c.652C>T, NM_016038.2:c.258+2T>C | Shwachman-Diamond syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBDS gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by chronic and usually mild neutropenia, pancreatic exocrine insufficiency associated with steatorrhea and growth failure, skeletal dysplasia with short stature, and an increased risk of bone marrow aplasia or leukemic transformation, cutaneous (eczema or ichthyosis) and dental anomalies, and psychomotor retardation. The prevalence is 1:76,000 newborn. | 250,600 |
| SCNN1B | Pseudohypoaldosteronism, type 1 | NM_000336.2 | NM_000336.2:c.109G>A | Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest. | 250,600 |
| SCNN1G | Pseudohypoaldosteronism, type 1 | NM_001039.3 | NM_001039.3:c.1373+2T>C, NM_001039.3:c.1570-1G>A, NM_001039.3:c.1627delG, NM_001039.3:c.598_599insA | Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest. | 250,600 |
| SERPINA1 | Alpha1-antitrypsin deficiency | NM_000295.4 | NM_000295.4:c.1177C>T, NM_000295.4:c.187C>T, NM_000295.4:c.194T>C, NM_000295.4:c.230C>T, NM_000295.4:c.250G>A, NM_000295.4:c.272G>A, NM_000295.4:c.347T>A, NM_000295.4:c.415G>A, NM_000295.4:c.514G>A, NM_000295.4:c.514G>T, NM_000295.4:c.739C>T, NM_000295.4:c.839A>T, NM_000295.4:c.1093G>A, NM_000295.4:c.848A>T | Alpha-1-antitrypsin deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SERPINA1 gene located on chromosomal region 14q32.13. The age of onset is variable. This disease is characterized by emphysema, which becomes evident by the third to fourth decade. A less common manifestation of the deficiency is liver disease, which occurs in children and adults, and may result in cirrhosis and liver failure. Environmental factors, particularly cigarette smoking, greatly increase the risk of emphysema at an earlier age. The prevalence is 1:1,500-1:3,500 in European. | 250,600 |
| SETX | Spinocerebellar ataxia with axonal neuropathy type 2 | NM_015046.5 | NM_015046.5:c.1027G>T, NM_015046.5:c.1166T>C, NM_015046.5:c.1807A>G, NM_015046.5:c.2602C>T, NM_015046.5:c.3880C>T, NM_015046.5:c.4087C>T, NM_015046.5:c.5630delG, NM_015046.5:c.5927T>G, NM_015046.5:c.6848_6851delCAGA, NM_015046.5:c.994C>T, NM_015046.5:c.5308_5311delGAGA, NM_015046.5:c.5549-1G>T, NM_015046.5:c.6834_6839delAACAAA | Spinocerebellar ataxia with axonal neuropathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SETX gene located on chromosomal region 9q34.13. The age of onset is infantile. This disease is characterized by progressive cerebellar ataxia, axonal sensorimotor neuropathy with oculomotor apraxia, fixation instability, extrapyramidal features and an elevated serum alpha-fetoprotein level. The prevalence is 4:100,000-8:100,000. | 250,600 |
| SGCA | Limb-girdle muscular dystrophy type 2D | NM_000023.2 | NM_000023.2:c.101G>A, NM_000023.2:c.229C>T, NM_000023.2:c.371T>C, NM_000023.2:c.518T>C, NM_000023.2:c.574C>T, NM_000023.2:c.850C>T, NM_000023.2:c.662G>A, NM_000023.2:c.739G>A, NM_000023.2:c.904_905insCC | Autosomal recessive limb-girdle muscular dystrophy type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCA gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness and calf pseudohypertrophy. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| SGCG | Limb-girdle muscular dystrophy type 2C | NM_000231.2 | NM_000231.2:c.195+4_195+7delAGTA, NM_000231.2:c.505+1G>A, NM_000231.2:c.787G>A, NM_000231.2:c.848G>A, NM_000231.2:c.88delG, NM_000231.2:c.521delT | Autosomal recessive limb-girdle muscular dystrophy type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCG gene located on chromosomal region 13q12.12. The age of onset is variable. This disease is characterized by limb-girdle weakness, calf hypertrophy, diaphragmatic weakness, and variable cardiac abnormalities. | 250,600 |
| SGSH | Mucopolysaccharidosis type 3A (Sanfilippo disease type A) | NM_000199.3 | NM_000199.3:c.1167C>A, NM_000199.3:c.1298G>A, NM_000199.3:c.130G>A, NM_000199.3:c.1339G>A, NM_000199.3:c.1380delT, NM_000199.3:c.197C>G, NM_000199.3:c.220C>T, NM_000199.3:c.235A>C, NM_000199.3:c.320delT, NM_000199.3:c.337_345delinsGCACAGGTGAG, NM_000199.3:c.364G>A, NM_000199.3:c.383C>T, NM_000199.3:c.416C>T, NM_000199.3:c.449G>A, NM_000199.3:c.466A>T, NM_000199.3:c.617G>C, NM_000199.3:c.752G>C, NM_000199.3:c.757delG, NM_000199.3:c.877C>T, NM_000199.3:c.892T>C | Mucopolysaccharidosis type 3A (Sanfilippo syndrome type A) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGSH gene located on chromosomal region 17q25.3. The age of onset is infantile. This disease is characterized by behavioural disorders (hyperkinesia, aggressiveness) and intellectual deterioration, sleep disorders and very mild dysmorphism. The prevalence is >1:70,000 newborn. | 250,600 |
| SH3TC2 | Charcot-Marie-Tooth disease type 4C | NM_024577.3 | NM_024577.3:c.1586G>A, NM_024577.3:c.1747_1748delAG, NM_024577.3:c.1969G>A, NM_024577.3:c.1972C>T, NM_024577.3:c.1982T>C, NM_024577.3:c.217_227delGCTGCTCGGAGinsCCAGTAA, NM_024577.3:c.2191delG, NM_024577.3:c.2491_2492delAG, NM_024577.3:c.2710C>T, NM_024577.3:c.2829T>G, NM_024577.3:c.2860C>T, NM_024577.3:c.28delG, NM_024577.3:c.2993_2994insC, NM_024577.3:c.3325C>T, NM_024577.3:c.3326G>C, NM_024577.3:c.3341delC, NM_024577.3:c.3601C>T, NM_024577.3:c.3686A>T, NM_024577.3:c.505T>C, NM_024577.3:c.52+1delG, NM_024577.3:c.530-2A>G, NM_024577.3:c.735G>A, NM_024577.3:c.920G>A, NM_024577.3:c.3676-1G>A, NM_024577.3:c.1724T>A, NM_024577.3:c.53-1G>C | Charcot-Marie-Tooth disease, type 4C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SH3TC2 gene located on chromosomal region 5q32. The age of onset is infantile. This disease is characterized by scoliosis or kyphoscoliosis, neuropathy, foot deformities, respiratory insufficiency, hypoacousis and deafness. | 250,600 |
| SLC12A1 | Bartter syndrome type 1 | NM_000338.2 | NM_000338.2:c.1875G>A, NM_000338.2:c.1942G>A, NM_000338.2:c.2805_2806insA, NM_000338.2:c.347G>A, NM_000338.2:c.611T>C, NM_000338.2:c.628+2T>C, NM_000338.2:c.814G>T, NM_000338.2:c.223C>T, NM_000338.2:c.2952_2955delCAAA | Bartter syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A1 gene located on chromosomal region 15q15-21. The age of onset is infantile. This disease is characterized by polyhydramnios, premature delivery, polyuria, dehydration, hypercalciuria and nephrocalcinosis. The prevalence is 1:1,000,000. | 250,600 |
| SLC17A5 | Sialic acid storage disease | NM_012434.4 | NM_012434.4:c.115C>T, NM_012434.4:c.406A>G, NM_012434.4:c.43G>T, NM_012434.4:c.918T>G, NM_012434.4:c.1259+1G>A, NM_012434.4:c.500T>C | Sialic acid storage diseases, follow an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC17A5 gene located on chromosomal region 6q13. The age of onset is from infantile to adult forms. The main symptoms are hypotonia, cerebellar ataxia, and mental retardation; visceromegaly and coarse features are also present in the infantile cases. | 250,600 |
| SLC24A1 | Night blindness, congenital stationary type 1D | NM_004727.2 | NM_004727.2:c.1963C>T | Night blindness, congenital stationary type 1D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC24A1 gene located on chromosomal region 15q22.31. The age of onset is early. This disease is characterized by hemeralopia with a moderate loss of visual acuity. | 250,600 |
| SLC26A2 | Achondrogenesis type 1B | NM_000112.3 | NM_000112.3:c.1020_1022delTGT, NM_000112.3:c.1273A>G, NM_000112.3:c.532C>T, NM_000112.3:c.2033G>T | Achondrogenesis type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by severe micromelia with very short fingers and toes, a flat face, a short neck, thickened soft tissue around the neck, hypoplasia of the thorax, protuberant abdomen, a hydropic fetal appearance and distinctive histological features of the cartilage. The prevalence is 1:20,000. | 250,600 |
| SLC26A2 | Atelosteogenesis type 2 | NM_000112.3 | NM_000112.3:c.1535C>A, NM_000112.3:c.835C>T | Atelosteogenesis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by limb shortening, normal sized skull with cleft palate, hitchhiker thumbs, distinctive facial dysmorphism and radiographic skeletal features. The prevalence is 1:20,000. | 250,600 |
| SLC26A2 | Diastrophic dysplasia | NM_000112.3 | NM_000112.3:c.1724delA, NM_000112.3:c.1878delG, NM_000112.3:c.1361A>C, NM_000112.3:c.767T>C, NM_000112.3:c.833delC, NM_000112.3:c.496G>A, NM_000112.3:c.1957T>A | Diastrophic dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by short stature with short extremities (final adult height is 120cm), and joint malformations leading to multiple joint contractures (principally involving the shoulders, elbows, interphalangeal joints and hips). The prevalence is 1:20,000. | 250,600 |
| SLC26A4 | Deafness type 4, autosomal recessive | NM_000441.1 | NM_000441.1:c.1001G>T, NM_000441.1:c.1034T>A, NM_000441.1:c.2162C>T, NM_000441.1:c.1975G>C, NM_000441.1:c.1174A>T, NM_000441.1:c.2131G>A, NM_000441.1:c.1454C>T, NM_000441.1:c.1468A>C, NM_000441.1:c.2211G>C, NM_000441.1:c.269C>T, NM_000441.1:c.916dupG, NM_000441.1:c.281C>T, NM_000441.1:c.1634T>G, NM_000441.1:c.1707+5G>A, NM_000441.1:c.1489G>A, NM_000441.1:c.961A>T, NM_000441.1:c.2048T>C, NM_000441.1:c.898A>C, NM_000441.1:c.918+2T>C, NM_000441.1:c.1001+1G>T, NM_000441.1:c.970A>T, NM_000441.1:c.563T>C | Autosomal recessive nonsyndromic sensorineural deafness type DFNB4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| SLC26A4 | Pendred syndrome | NM_000441.1 | NM_000441.1:c.1246A>C, NM_000441.1:c.1826T>G, NM_000441.1:c.1229C>T, NM_000441.1:c.1263+1G>A, NM_000441.1:c.1061T>C, NM_000441.1:c.1790T>C, NM_000441.1:c.2168A>G, NM_000441.1:c.1151A>G, NM_000441.1:c.1226G>A, NM_000441.1:c.1003T>C, NM_000441.1:c.919-2A>G, NM_000441.1:c.554G>C, NM_000441.1:c.626G>T, NM_000441.1:c.1334T>G, NM_000441.1:c.1198delT, NM_000441.1:c.412G>T, NM_000441.1:c.707T>C | Pendred syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. The main presenting clinical sign is prelingual sensorineural deafness, although occasionally the hearing loss develops later in childhood. The degree of hearing loss is variable: it can be mild-to-moderate and progressive in some patients, and severe-to-profound in others. Fluctuations in hearing are also common and may be associated with or preceded by vertigo. The onset and presentation of euthyroid goiter (75%) is highly variable within and between families, with thyroid enlargement usually developing in late childhood or early adulthood. The thyromegaly reflects a defect in iodide transport from the thyrocyte to the colloid, although organification itself is not impaired. Hypothyroidism may develop if nutritional iodide intake is low. | 250,600 |
| SLC37A4 | Glycogen storage disease types 1b, 1c and 1d | NM_001164278.1 | NM_001164278.1:c.1042_1043delCT, NM_001164278.1:c.1081G>T, NM_001164278.1:c.1082G>A, NM_001164278.1:c.1108_1109delCT, NM_001164278.1:c.1129G>T, NM_001164278.1:c.1190-2_1190-1delAG, NM_001164278.1:c.1309C>T, NM_001164278.1:c.287G>A, NM_001164278.1:c.352T>C, NM_001164278.1:c.593A>T, NM_001164278.1:c.706_708delGTG, NM_001164278.1:c.83G>A, NM_001164278.1:c.899G>A | Glycogen storage disease due to glucose-6-phosphatase deficiency types 1b, 1c and 1d follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC37A4 gene located on chromosomal region 11q23. The age of onset is early. This disease is characterized by impairment of terminal steps of glycogenolysis and gluconeogenesis. Patients manifest a wide range of clinical symptoms and biochemical abnormalities, including hypoglycemia, severe hepatomegaly due to excessive accumulation of glycogen, kidney enlargement, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. Glycogen storage disease type 1B patients also present a tendency towards infections associated with neutropenia, relapsing aphthous gingivostomatitis, and inflammatory bowel disease. The incidence is 1:100,000. | 250,600 |
| SLC4A11 | Congenital hereditary endothelial dystrophy type 2 | NM_032034.3 | NM_032034.3:c.1038_1039insA, NM_032034.3:c.1391G>A, NM_032034.3:c.2318C>T, NM_032034.3:c.1466C>T, NM_032034.3:c.1813C>T, NM_032034.3:c.2264G>A, NM_032034.3:c.2605C>T, NM_032034.3:c.2399C>T, NM_032034.3:c.554_561delGCTTCGCC, NM_032034.3:c.2606G>A | Congenital hereditary endothelial dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by a diffuse ground-glass appearance of the corneas and marked corneal thickening from birth with nystagmus, and blurred vision. | 250,600 |
| SLC4A11 | Corneal dystrophy and perceptive deafness | NM_032034.3 | NM_032034.3:c.2528T>C, NM_032034.3:c.1463G>A, NM_032034.3:c.473_480delGCTTCGCC, NM_032034.3:c.2566A>G, NM_032034.3:c.637T>C, NM_032034.3:c.625C>T, NM_032034.3:c.2224G>A, NM_032034.3:c.2240_2240+1insTATGACAC | Corneal dystrophy - perceptive deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by the association of congenital hereditary endothelial dystrophy with progressive, postlingual sensorineural hearing loss. | 250,600 |
| SLX4 | Fanconi anemia, complementation group P | NM_032444.2 | NM_032444.2:c.1093delC, NM_032444.2:c.286delA, NM_032444.2:c.4921_4922insG, NM_032444.2:c.5097_5098delTC, NM_032444.2:c.5408_5409insAC, NM_032444.2:c.4739+1G>T, NM_032444.2:c.2808_2809delAG | Fanconi anemia complementation group P follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLX4 gene located on chromosomal region 16p13.3. The age of onset is early. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1:160,000. | 250,600 |
| SMN1 | Spinal muscular atrophy | - | del ex7, del ex7-8, del ex8 (Detection by MLPA) | Spinal muscular atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMN1 gene located on chromosomal region 5q13.2. The age of onset is variable. This disease comprise a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. Autosomal recessive forms are classified according to the age of onset, the maximum muscular activity achieved, and survivorship. The severity of the disease is mainly determined by the copy number of SMN2, a copy gene which predominantly produces exon 7-skipped transcripts and only low amount of full-length transcripts that encode for a protein identical to SMN1. Only about 4% of patients bear one SMN1 copy with an intragenic mutation. Type 1 is a severe form, with onset before 6 months of age. Patients never achieve the ability to sit. Type 2 has intermediate severity, with onset between 6 and 18 months. Patients do not reach the motor milestone of standing, and survive into adulthood. Type 3 onset is after 18 months. Patients develop ability to stand and walk and survive into adulthood. Type 4 onset is in adulthood, disease progression is slow, and patients can stand and walk. The incidence is 1:10,000 and the prevalence is 1:80,000. | 250,600 |
| SMPD1 | Niemann-Pick disease | NM_000543.4 | NM_000543.4:c.103_118delCTGGTGCTGGCGCTGG, NM_000543.4:c.103_119delCTGGTGCTGGCGCTGGC, NM_000543.4:c.103_107delCTGGT, NM_000543.4:c.103_113delCTGGTGCTGGCGinsCTGGTG, NM_000543.4:c.1092-1G>C, NM_000543.4:c.1117C>T, NM_000543.4:c.106delG, NM_000543.4:c.108_124delGCTGGCGCTGGCGCTGGC, NM_000543.4:c.1267C>T, NM_000543.4:c.1299T>G, NM_000543.4:c.1327C>T, NM_000543.4:c.1420_1421delCT, NM_000543.4:c.1426C>T, NM_000543.4:c.1624C>T, NM_000543.4:c.1630delA, NM_000543.4:c.1805G>A, NM_000543.4:c.354delC, NM_000543.4:c.475T>C, NM_000543.4:c.551C>T, NM_000543.4:c.557C>T, NM_000543.4:c.558_559insC, NM_000543.4:c.558_574delGCCCCCCAAACCCCCTA, NM_000543.4:c.564delC, NM_000543.4:c.573delT, NM_000543.4:c.689G>A, NM_000543.4:c.730G>A, NM_000543.4:c.739G>A, NM_000543.4:c.740delG, NM_000543.4:c.742G>A, NM_000543.4:c.757G>C, NM_000543.4:c.785_807delTGTTGAGTGGGCTGGGCCCAGCC, NM_000543.4:c.788T>A, NM_000543.4:c.842_849dupTCCCCGCA, NM_000543.4:c.911T>C, NM_000543.4:c.940G>A, NM_000543.4:c.96G>A, NM_000543.4:c.996delC, NM_000543.4:c.688C>T, NM_000543.4:c.995C>G, NM_000543.4:c.1829_1831delGCC, NM_000543.4:c.1264-1G>T, NM_000543.4:c.1152G>A | Niemann-Pick disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMPD1 gene located on chromosomal region 11p15.4. The clinical phenotype ranges from a severe infantile form with neurologic degeneration resulting in death usually by 3 years of age (type A) to a later-onset nonneurologic form (type B) that is compatible with survival into adulthood. | 250,600 |
| SPG11 | Spastic paraplegia type 11 | NM_025137.3 | NM_025137.3:c.118C>T, NM_025137.3:c.529_533delATATT, NM_025137.3:c.5623C>T, NM_025137.3:c.1339_1342dupGGCT, NM_025137.3:c.342delT, NM_025137.3:c.7152-1G>C, NM_025137.3:c.733_734delAT, NM_025137.3:c.6805_6806delCT, NM_025137.3:c.1736-1G>C, NM_025137.3:c.6100C>T, NM_025137.3:c.6848_6849insTC | Spastic paraplegia type 11 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG11 gene located on chromosomal region 13q13.3. The age of onset is infantile. This disease is characterized by progressive spasticity and weakness of the lower limbs frequently associated with the following: mild intellectual disability with learning difficulties in childhood and/or progressive cognitive decline; peripheral neuropathy; pseudobulbar involvement; and increased reflexes in the upper limbs. The prevalence is 5:100.000. | 250,600 |
| SPG7 | Spastic paraplegia type 7 | NM_003119.3 | NM_003119.3:c.1457G>A, NM_003119.3:c.1529C>T, NM_003119.3:c.2075G>C, NM_003119.3:c.233T>A, NM_003119.3:c.1676delA, NM_003119.3:c.1749G>C, NM_003119.3:c.773_774delTG, NM_003119.3:c.1045G>A, NM_003119.3:c.1124delG, NM_003119.3:c.679C>T, NM_003119.3:c.758+2T>C, NM_003119.3:c.286+1G>T | Spastic paraplegia type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG7 gene located on chromosomal region 16q24.3. The age of onset is adult. This disease is characterized by insidiously progressive bilateral lower limb weakness and spasticity. The prevalence is 1:100,000-9:100,000. | 250,600 |
| STRC | Deafness type 16, autosomal recessive | NM_153700.2 | NM_153700.2:c.4561_4562insC, NM_153700.2:c.5188C>T, NM_153700.2:c.3556C>T, NM_153700.2:c.5168_5171delTTCT, NM_153700.2:c.5185C>T, NM_153700.2:c.4545+1G>C | Autosomal recessive nonsyndromic sensorineural deafness type DFNB16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRC gene located on chromosomal region 15q15.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| TCAP | Cardiomyopathy, hypertrophic, type 25 | NM_003673.3 | NM_003673.3:c.260G>A, NM_003673.3:c.316C>T | Cardiomyopathy, hypertrophic, type 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by dyspnea, syncope, collapse, palpitations, and chest pain. They can be readily provoked by exercise. The disorder has inter- and intrafamilial variability ranging from benign to malignant forms with high risk of cardiac failure and sudden cardiac death. | 250,600 |
| TCAP | Limb-girdle muscular dystrophy type 2G | NM_003673.3 | NM_003673.3:c.157C>T | Autosomal recessive limb-girdle muscular dystrophy type 2G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by muscle weakness in the four limbs, mild scapular winging, severe atrophy of the quadriceps and anterior tibialis muscles, calf hypertrophy, and lack of respiratory and cardiac involvement. | 250,600 |
| TCIRG1 | Osteopetrosis type 1, autosomal recessive | NM_006019.3 | NM_006019.3:c.1331G>T, NM_006019.3:c.1674-1G>A, NM_006019.3:c.179A>G, NM_006019.3:c.2236+1G>A, NM_006019.3:c.2415-3C>G, NM_006019.3:c.112_113delAG, NM_006019.3:c.1213G>A | Autosomal recessive osteopetrosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCIRG1 gene located on chromosomal region 11q13.2. The age of onset is early. This disease is characterized by bone marrow failure, fractures and visual impairment. The incidence is 1:200.000 live births and the prevalence is 1:250,000. | 250,600 |
| TERT | Dyskeratosis congenita, autosomal recessive | NM_198253.2 | NM_198253.2:c.1234C>T, NM_198253.2:c.835G>A, NM_198253.2:c.2701C>T, NM_198253.2:c.2431C>T | Dyskeratosis congenita, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TERT gene located on chromosomal region 5p15.33. The age of onset is early. This disease has a wide phenotypic spectrum and age onset. It usually manifests during childhood with the triad of dysplastic nails, lacy reticular pigmentation and atrophy of the skin at the level of the neck and upper chest, and oral leukoplakia. Patients show an increased risk for progressive bone marrow failure and may develop myelodysplastic syndrome or acute myelogenous leukemia at any age (the risk increasing with age). There is also an increased risk for solid tumors, typically squamous cell carcinoma of head and neck (see this term) or anogenital cancer. Various additional clinical findings have been reported and may include: developmental delay, short stature, microcephaly, blepharitis, epiphora, periodontal disease, taurodontism, decreased teeth/root ratio, esophageal stenosis, liver disease, urethral stenosis, osteoporosis, avascular necrosis of femur and/or humerus, premature hair greying/alopecia, or abnormal eyelashes. Individuals with DC are at high risk of pulmonary fibrosis. The prevalence is 1:1.000.000. | 250,600 |
| TFR2 | Hemochromatosis, type 3 | NM_003227.3 | NM_003227.3:c.1330G>A, NM_003227.3:c.1403G>A, NM_003227.3:c.1469T>G, NM_003227.3:c.1235_1237delACA, NM_003227.3:c.1861_1872delGCCGTGGCCCAG, NM_003227.3:c.2343G>A, NM_003227.3:c.313C>T, NM_003227.3:c.1665delC, NM_003227.3:c.750C>G, NM_003227.3:c.840C>G, NM_003227.3:c.949C>T, NM_003227.3:c.515T>A, NM_003227.3:c.1632_1633delGA, NM_003227.3:c.2014C>T, NM_003227.3:c.2374G>A, NM_003227.3:c.1473+1G>A, NM_003227.3:c.1186C>T | Hemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000. | 250,600 |
| TK2 | Mitochondrial DNA depletion syndrome type 2 | NM_004614.4 | NM_004614.4:c.323C>T, NM_004614.4:c.361C>A, NM_004614.4:c.373C>T, NM_004614.4:c.500G>A, NM_004614.4:c.604_606delAAG, NM_004614.4:c.635T>A, NM_004614.4:c.623A>G, NM_004614.4:c.159C>G, NM_004614.4:c.268C>T | Mitochondrial DNA depletion syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TK2 gene located on chromosomal region 16q21. The age of onset is infantile. This disease is characterized by generalized hypotonia, proximal muscle weakness, loss of previously acquired motor skills, poor feeding, and respiratory difficulties leading to respiratory failure and death within a few years after diagnosis. The prevalence is 1.2:100,000. | 250,600 |
| TMEM67 | COACH syndrome | NM_153704.5 | NM_153704.5:c.1769T>C, NM_153704.5:c.2498T>C | COACH syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is variable. This disease is characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable. | 250,600 |
| TMEM67 | Joubert syndrome type 6 | NM_153704.5 | NM_153704.5:c.130C>T, NM_153704.5:c.148_149insTAAT, NM_153704.5:c.1538A>G | Joubert syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is infantile. This disease is characterized by an irregular breathing pattern (episodic tachypnea and/or apnea), and nystagmus. During infancy, hypotonia may appear. Cerebellar ataxia (staggering gait and imbalance) may develop later. Delayed acquisition of motor milestones is common. Cognitive abilities are variable, ranging from severe intellectual deficit to normal intelligence. Neuro-ophthalmologic examination may show oculomotor apraxia. In some cases, seizures occur. Careful examination of the face shows a characteristic appearance: large head, prominent forehead, high rounded eyebrows, epicanthal folds, ptosis (occasionally), an upturned nose with prominent nostrils, an open mouth (which tends to have an oval shape early on, a 'rhomboid' appearance later, and finally can appear triangular with downturned angles), tongue protrusion and rhythmic tongue motions, and occasionally low-set and tilted ears. Other features sometimes present in Joubert syndrome include retinal dystrophy, nephronophthisis, and polydactyly. The prevalence is 1:80,000-1:100,000. | 250,600 |
| TMEM67 | Meckel syndrome type 3 | NM_153704.5 | NM_153704.5:c.1309C>G, NM_153704.5:c.755T>C, NM_153704.5:c.1046T>C, NM_153704.5:c.653G>C, NM_153704.5:c.406+1402_406+1403insTAAT, NM_153704.5:c.622A>T | Meckel syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22. The age of onset is variable. This disease is characterized multiple congenital anomaly disorder characterized by the triad of brain malformation mainly occipital encephalocele (see this term), large polycystic kidneys, and polydactyly as well as associated abnormalities that may include cleft lip/palate (see these terms), cardiac and genital anomalies, central nervous system (CNS) malformations, liver fibrosis, and bone dysplasia. | 250,600 |
| TMPRSS3 | Deafness types 8/10, autosomal recessive | NM_024022.2 | NM_024022.2:c.1211C>T, NM_024022.2:c.1276G>A, NM_024022.2:c.1159G>A, NM_024022.2:c.413C>A, NM_024022.2:c.446+1G>T, NM_024022.2:c.647G>T, NM_024022.2:c.753G>C, NM_024022.2:c.646C>T, NM_024022.2:c.208delC, NM_024022.2:c.242C>G | Autosomal recessive nonsyndromic sensorineural deafness type DFNB10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMPRSS3 gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness. | 250,600 |
| TPP1 | Neuronal ceroid-lipofuscinoses type 2 | NM_000391.3 | NM_000391.3:c.1093T>C, NM_000391.3:c.616C>T, NM_000391.3:c.622C>T, NM_000391.3:c.1340G>A, NM_000391.3:c.141_144delGAGT, NM_000391.3:c.827A>T, NM_000391.3:c.509-1G>C, NM_000391.3:c.851G>T | Neuronal ceroid lipofuscinosis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPP1 gene located on chromosomal region 11p15.4. Age of onset is infantile. This disease is characterized by epilepsy, followed by regression of developmental milestones, myoclonic ataxia, and pyramidal signs. Visual impairment typically appears at age four to six years and rapidly progresses to light/dark awareness only. Life expectancy ranges from age six years to early teenage. The prevalence is 1.5:1,000,000-9:1,000,000. | 250,600 |
| TRIOBP | Deafness type 28, autosomal recessive | NM_001039141.2 | NM_001039141.2:c.2362C>T, NM_001039141.2:c.3194delT, NM_001039141.2:c.1039C>T, NM_001039141.2:c.1741C>T, NM_001039141.2:c.4577C>G, NM_001039141.2:c.2639_2640insTCAC, NM_001039141.2:c.5316G>A, NM_001039141.2:c.3202C>T, NM_001039141.2:c.4429_4430insG | Deafness autosomal recessive type 28 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIOBP gene located on chromosomal region 22q13.1. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 250,600 |
| TSEN54 | Pontocerebellar hypoplasia | NM_207346.2 | NM_207346.2:c.670_671delAA, NM_207346.2:c.736C>T, NM_207346.2:c.1027C>T, NM_207346.2:c.1039A>T, NM_207346.2:c.887G>A, NM_207346.2:c.919G>T | Pontocerebellar hypoplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSEN54 gene located on chromosomal region 17q25.1. Pontocerebellar hypoplasia (PCH) refers to a group of severe neurodegenerative disorders affecting growth and function of the brainstem and cerebellum, resulting in little or no development. Different types were classified based on the clinical picture and the spectrum of pathologic changes. | 250,600 |
| TSFM | Combined oxidative phosphorylation deficiency type 3 | NM_001172696.1 | NM_001172696.1:c.1_2delAT, NM_001172696.1:c.580delC, NM_001172696.1:c.919C>T, NM_001172696.1:c.21_22delGC | Combined oxidative phosphorylation deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSFM gene located on chromosomal region 12q14.1. The age of onset is early. This disease is characterized by hypotonia, lactic acidosis, and hepatic insufficiency, with progressive encephalomyopathy or hypertrophic cardiomyopathy. | 250,600 |
| TSHR | Hypothyroidism | NM_000369.2 | NM_000369.2:c.100G>A, NM_000369.2:c.1170T>G, NM_000369.2:c.484C>G, NM_000369.2:c.500T>A, NM_000369.2:c.122G>C, NM_000369.2:c.326G>A, NM_000369.2:c.1741_1742insC, NM_000369.2:c.202C>T | Hypothyroidism due to TSH receptor mutations follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSHR gene located on chromosomal region 14q31. The age of onset is early. This disease is characterized by decreased activity and increased sleep, feeding difficulty and constipation, prolonged jaundice, myxedematous facies, large fontanels (especially posterior), macroglossia, a distended abdomen with umbilical hernia, and hypotonia. Slow linear growth and developmental delay are usually apparent by 4-6 months of age. Without treatment CH results in severe intellectual deficit and short stature. The prevalence is 1:3,000-1:4,000 newborn. | 250,600 |
| TTN | Cardiomyopathy, dilated/Tibial muscular dystrophy | NM_133378.4 | NM_133378.4:c.13149C>A, NM_133378.4:c.22246G>A, NM_133378.4:c.31780G>A, NM_133378.4:c.40211dupT, NM_133378.4:c.44668delG, NM_133378.4:c.52977dupT, NM_133378.4:c.61640C>G, NM_133378.4:c.84669_84675delTGAATTC, NM_133378.4:c.94567C>T, NM_133378.4:c.96388C>T, NM_133378.4:c.96388delC, NM_133378.4:c.98366_98367delAT, NM_133378.4:c.12064C>T, NM_133378.4:c.28739-1G>A, NM_133378.4:c.3165-1G>T, NM_133378.4:c.4724_4728delTGAAA, NM_133378.4:c.48944-1G>A, NM_133378.4:c.91114_91117delTCCA, NM_133378.4:c.100185delA, NM_133378.4:c.40549delA, NM_133378.4:c.24568_24571delAGCA | Cardiomyopathy, dilated/Tibial muscular dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTN gene located on chromosomal region 2q31.2. The age of onset is variable. This disease is characterized by slowly progressive weakness and atrophy of the anterior tibial muscles with decreased dorsiflexion. Sometimes it could be companied by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death. The prevalence is >9:100,000. | 250,600 |
| TTPA | Ataxia with vitamin E deficiency | NM_000370.3 | NM_000370.3:c.661C>T, NM_000370.3:c.744delA, NM_000370.3:c.575G>A | Ataxia with vitamin E deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTPA gene located on chromosomal region 8q13. The age of onset is variable. This disease is characterized by progressive spino-cerebellar ataxia, loss of proprioception, areflexia, and is associated with a marked deficiency in vitamin E. The prevalence is 0.56:1,000,000-3.5:1,000,000. | 250,600 |
| TYR | Oculocutaneous albinism type 1 | NM_000372.4 | NM_000372.4:c.1012_1013insC, NM_000372.4:c.1146C>A, NM_000372.4:c.1164delT, NM_000372.4:c.1177delG, NM_000372.4:c.1147G>A, NM_000372.4:c.115T>G, NM_000372.4:c.1255G>A, NM_000372.4:c.1265G>A, NM_000372.4:c.1209G>T, NM_000372.4:c.1217C>T, NM_000372.4:c.140G>A, NM_000372.4:c.1467dupT, NM_000372.4:c.1501dupC, NM_000372.4:c.164G>A, NM_000372.4:c.1A>G, NM_000372.4:c.230G>A, NM_000372.4:c.242C>T, NM_000372.4:c.265T>C, NM_000372.4:c.272G>A, NM_000372.4:c.286dupA, NM_000372.4:c.533G>A, NM_000372.4:c.1336G>A, NM_000372.4:c.1342G>A, NM_000372.4:c.646T>A, NM_000372.4:c.650G>A, NM_000372.4:c.823G>T, NM_000372.4:c.896G>A, NM_000372.4:c.1111A>G, NM_000372.4:c.1118C>A, NM_000372.4:c.325G>A, NM_000372.4:c.572delG, NM_000372.4:c.616G>A | Oculocutaneous albinism type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYR gene located on chromosomal region 11q14.2. The age of onset is early. This disease is characterized by white hair and skin, blue, fully translucent irises, nystagmus and misrouting of the optic nerves. | 250,600 |
| TYRP1 | Oculocutaneous albinism type 3 | NM_000550.2 | NM_000550.2:c.107delT, NM_000550.2:c.1103delA, NM_000550.2:c.1057_1060delAACA, NM_000550.2:c.1067G>A, NM_000550.2:c.1557T>G, NM_000550.2:c.176C>G, NM_000550.2:c.497C>G, NM_000550.2:c.1120C>T, NM_000550.2:c.1369_1370insCAGA | Type 3 oculocutaneous albinism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYRP1 gene located on chromosomal region 9p23. The age of onset is early. This disease is characterized by rufous or brown albinism and occurring mainly in the African population. The prevalence is of 1/8,500 individuals in Africa. | 250,600 |
| UGT1A1 | Crigler-Najjar syndrome type 1 | NM_000463.2 | NM_000463.2:c.1021C>T, NM_000463.2:c.1070A>G | Crigler-Najjar syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by severe neonatal unconjugated hyperbilirubinemia, persistent jaundice and bilirubin encephalopathy manifesting as hypotonia, deafness, oculomotor palsy and lethargy. Neurologic defects can occur, generally associated with intellectual and motor impairment. | 250,600 |
| UGT1A1 | Crigler-Najjar syndrome type 2 | NM_000463.2 | NM_000463.2:c.1207C>T, NM_000463.2:c.674T>G, NM_000463.2:c.1130G>T, NM_000463.2:c.524T>A, NM_000463.2:c.44T>G | Crigler-Najjar syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by unconjugated hyperbilirubinemia due to reduced and inducible activity of hepatic bilirubin glucuronosyltransferase with pigmented bile that contains bilirubin glucuronides, and generally do not present neurologic or intellectual impairment. Bilirubin encephalopathy may develop in later life when patients experience a superimposed infection or stress. | 250,600 |
| UGT1A1 | Gilbert syndrome | NM_000463.2 | NM_000463.2:c.1211T>C, NM_000463.2:c.1456T>G | Gilbert syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by jaundice due to unconjugated hyperbilirubinemia, resulting a partial deficiency in hepatic bilirubin glucuronosyltransferase activity. | 250,600 |
| USH1C | Usher syndrome type 1C | NM_153676.3 | NM_153676.3:c.216G>A, NM_153676.3:c.2362G>A, NM_153676.3:c.2622_2623delCA, NM_153676.3:c.2688_2695dupAATTCACC, NM_153676.3:c.238_239insC, NM_153676.3:c.238delC, NM_153676.3:c.2547-1G>T, NM_153676.3:c.2695_2696insAATTCACC, NM_153676.3:c.388G>A | Usher syndrome type 1C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1C gene located on chromosomal region 11p15.1. The age of onset is infantile. This disease is characterized by the association of sensorineural deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 3:100,000-4:100,000. | 250,600 |
| USH2A | Retinitis pigmentosa type 39 | NM_206933.2 | NM_206933.2:c.10073G>A, NM_206933.2:c.2296T>C, NM_206933.2:c.14519T>C, NM_206933.2:c.7364G>A, NM_206933.2:c.12574C>T, NM_206933.2:c.2276G>T | Retinitis pigmentosa refers to a heterogeneous group of inherited ocular diseases that result in a progressive retinal degeneration. Type 39 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. The age of onset is adult. This disease is characterized by night blindness, the development of tunnel vision, and slowly progressive decreased central vision. The global prevalence of all types of retinitis pigmentosa is 1/3,000 to 1/5,000. | 250,600 |
| USH2A | Usher syndrome type 2A | NM_206933.2 | NM_206933.2:c.10636G>A, NM_206933.2:c.10561T>C, NM_206933.2:c.15371delT, NM_206933.2:c.2167+5G>A, NM_206933.2:c.11864G>A, NM_206933.2:c.14803C>T, NM_206933.2:c.2898delG, NM_206933.2:c.3491_3492delCT, NM_206933.2:c.11549-5_11549-4insT, NM_206933.2:c.2299delG, NM_206933.2:c.5975A>G, NM_206933.2:c.6670G>T, NM_206933.2:c.6862G>T, NM_206933.2:c.5743_5744delAG, NM_206933.2:c.779T>G, NM_206933.2:c.820C>T, NM_206933.2:c.8981G>A, NM_206933.2:c.956G>A, NM_206933.2:c.9799T>C, NM_206933.2:c.15089C>A, NM_206933.2:c.2135delC, NM_206933.2:c.4338_4339delCT, NM_206933.2:c.5573-2A>G, NM_206933.2:c.920_923dupGCCA, NM_206933.2:c.13709delG, NM_206933.2:c.14926G>A, NM_206933.2:c.15520-1G>A, NM_206933.2:c.8431C>A, NM_206933.2:c.12234_12235delGA, NM_206933.2:c.14442C>A | Usher syndrome type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. The age of onset is infantile. This disease is characterized by the association of sensorineural deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 3:100,000-4:100,000. | 250,600 |
| WFS1 | Wolfram syndrome | NM_006005.3 | NM_006005.3:c.1234_1237delGTCT, NM_006005.3:c.1511C>T, NM_006005.3:c.2168T>C, NM_006005.3:c.2171C>T, NM_006005.3:c.1944G>A, NM_006005.3:c.2084G>T, NM_006005.3:c.577A>C, NM_006005.3:c.676C>T, NM_006005.3:c.2327A>T, NM_006005.3:c.407_408insGGGCCGTCGCGAGGCT, NM_006005.3:c.2576G>A, NM_006005.3:c.2643_2644delCT, NM_006005.3:c.616C>T, NM_006005.3:c.1060_1062delTTC, NM_006005.3:c.400G>A, NM_006005.3:c.1943G>A, NM_006005.3:c.1230_1233delCTCT | Wolfram syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WFS1 gene located on chromosomal region 4p16.1. The age of onset is infantile. This disease is characterized by diabetes mellitus type I, diabetes insipidus, optical atrophy and neurological signs. The prevalence is 1:1,000,000-9:1,000,000. | 250,600 |
| WNT10A | Hypohidrotic ectodermal dysplasia, autosomal recessive | NM_025216.2 | NM_025216.2:c.347T>C, NM_025216.2:c.383G>A, NM_025216.2:c.321C>A | Hypohidrotic ectodermal displasia, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by sparse hair (atrichosis or hypotrichosis), abnormal or missing teeth and the inability to sweat due to the absence of sweat glands. The prevalence is <1:1,000,000. | 250,600 |
| WNT10A | Odontoonychodermal dysplasia | NM_025216.2 | NM_025216.2:c.697G>T | Odonto-onycho-dermal dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by hyperkeratosis and hyperhidrosis of the palms and soles, atrophic malar patches, hypodontia, conical teeth, onychodysplasia, and dry and sparse hair. The prevalence is <1:1,000,000. | 250,600 |
| ZFYVE26 | Spastic paraplegia type 15, autosomal recessive | NM_015346.3 | NM_015346.3:c.3206G>A, NM_015346.3:c.3642_3643insCCACACTTAG, NM_015346.3:c.1477C>T, NM_015346.3:c.2887G>C, NM_015346.3:c.5422C>T, NM_015346.3:c.5485-1G>A, NM_015346.3:c.4312C>T, NM_015346.3:c.4936C>T, NM_015346.3:c.3182delT, NM_015346.3:c.2114_2115insC | Spastic paraplegia type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZFYVE26 gene located on chromosomal region 14q24.1. The age of onset is infancy. This disease is characterized by progressive spasticity primarily affecting the lower limbs. It is a complex form of spastic paraplegia, associated with other neurologic dysfunction, including variable mental retardation, hearing and visual defects, and thin corpus callosum. The prevalence is <1 / 1,000,000. | 250,600 |
| Gene | Disease | Transcript | Mutations | Disease.description | products |
|---|---|---|---|---|---|
| ABCA4 | Stargardt disease type 1; Cone-rod dystrophy type 3 | NM_000350.2 | NM_000350.2:c.6449G>A, NM_000350.2:c.6394G>T, NM_000350.2:c.6320G>A, NM_000350.2:c.6118C>T, NM_000350.2:c.6089G>A, NM_000350.2:c.5912T>G, NM_000350.2:c.5882G>A, NM_000350.2:c.5881G>A, NM_000350.2:c.5819T>C, NM_000350.2:c.5714+5G>A, NM_000350.2:c.5512delC, NM_000350.2:c.5461-10T>C, NM_000350.2:c.5338C>G, NM_000350.2:c.4793C>A, NM_000350.2:c.4469G>A, NM_000350.2:c.4457C>T, NM_000350.2:c.4429C>T, NM_000350.2:c.4139C>T, NM_000350.2:c.3970delG, NM_000350.2:c.3364G>A, NM_000350.2:c.3322C>T, NM_000350.2:c.3210_3211dupGT, NM_000350.2:c.3106G>A, NM_000350.2:c.3083C>T, NM_000350.2:c.2791G>A, NM_000350.2:c.2616_2617delCT, NM_000350.2:c.2588G>C, NM_000350.2:c.2300T>A, NM_000350.2:c.2160+1G>T, NM_000350.2:c.1964T>G, NM_000350.2:c.1938-1G>A, NM_000350.2:c.1848delA, NM_000350.2:c.1804C>T, NM_000350.2:c.1771delT, NM_000350.2:c.1755delA, NM_000350.2:c.1622T>C, NM_000350.2:c.1225delA, NM_000350.2:c.1222C>T, NM_000350.2:c.1018T>G, NM_000350.2:c.763C>T, NM_000350.2:c.634C>T, NM_000350.2:c.286A>G, NM_000350.2:c.67-2A>G, NM_000350.2:c.52C>T | Stargardt disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ABCA4 gene located on chromosomal region 1p22. The age of onset is infantile. This disease is characterized by progressive central vision loss, mild loss of color vision, delayed dark adaptation and macular atrophy with or without paramacular flecks and degeneration of the underlying retinal pigment ephitelium. The estimated prevalence is 1:8,000-10,000. Mutations in the ABCA4 gene account also for 30 to 60 percent of cases of cone-rod dystrophy that are inherited in an autosomal recessive pattern. The problems associated with this condition include a loss of visual sharpness (acuity), an increased sensitivity to light (photophobia), and impaired color vision. These vision problems worsen over time. | 600,25 |
| ACAD9 | Mitochondrial complex I deficiency due to ACAD9 | NM_014049.4 | NM_014049.4:c.23delT, NM_014049.4:c.130T>A, NM_014049.4:c.359delT, NM_014049.4:c.453+1G>A, NM_014049.4:c.797G>A, NM_014049.4:c.976G>C, NM_014049.4:c.1240C>T, NM_014049.4:c.1249C>T, NM_014049.4:c.1594C>T | Mitochondrial complex I deficiency due to ACAD9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACAD9 gene located on chromosomal region 3q21.3. The age of onset is neonatal/infantile. This disease is a multisystem disorder characterized by infantile onset of acute metabolic acidosis, hypertrophic cardiomyopathy, and muscle weakness associated with a deficiency of mitochondrial complex I activity in muscle, liver, and fibroblasts (summary by Haack et al., 2010). | 600,25 |
| ACADM | Medium-chain acyl-CoA dehydrogenase deficiency | NM_001286043.1 | NM_001286043.1:c.250C>T, NM_001286043.1:c.386-2A>G, NM_001286043.1:c.461C>T, NM_001286043.1:c.548_551delCTGA, NM_001286043.1:c.546G>A, NM_001286043.1:c.715C>T, NM_001286043.1:c.716G>A, NM_001286043.1:c.833C>T, NM_001286043.1:c.896A>G, NM_001286043.1:c.898G>A, NM_001286043.1:c.916_928delGCAATGGGAGCTT, NM_001286043.1:c.1083delG, NM_001286043.1:c.1084A>G, NM_001286043.1:c.1201_1204delTTAG | Medium-chain acyl-CoA dehydrogenase (MCAD) deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADM gene located on chromosomal region 1p31. Inherited deficiency of MCAD is a condition that prevents the body from converting certain fats to energy, particularly during periods without food (fasting). Signs and symptoms of MCAD deficiency typically appear during infancy or early childhood and can include vomiting, lack of energy (lethargy), and low blood sugar (hypoglycemia). Individuals with MCAD deficiency are at risk of serious complications such as seizures, breathing difficulties, liver problems, brain damage, coma, and sudden death. The estimated prevalence is 1:4,900-1:27,000 in Caucasian populations and 1:14,600 in worldwide populations. | 600,25 |
| ACADS | Short-chain acyl-CoA dehydrogenase deficiency | NM_000017.3 | NM_000017.3:c.136C>T, NM_000017.3:c.319C>T, NM_000017.3:c.417G>C, NM_000017.3:c.529T>C, NM_000017.3:c.561_568delCAATGCCT, NM_000017.3:c.1095G>T, NM_000017.3:c.1147C>T | Short-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADS gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by seizures, developmental delay, failure to grow with poor feeding, and usually muscle weakness and hypotonia. The prevalence is <1:50,000. | 600,25 |
| ACADSB | Short/branched-chain acyl-CoA dehydrogenase deficiency | NM_001609.3 | NM_001609.3:c.303+1G>A, NM_001609.3:c.443C>T, NM_001609.3:c.621G>A, NM_001609.3:c.763C>T | Short/branched-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADSB gene located on chromosomal region 10q26.3. The age of onset is neonatal/infantile. This disease is characterized by muscle hypotonia, cerebral palsy, developmental delay, lethargy, hypoglycemia, and metabolic acidosis. The prevalence is <1:1,000,000. | 600,25 |
| ACADVL | Very long-chain acyl-CoA dehydrogenase deficiency | NM_001270447.1 | NM_001270447.1:c.347-1G>A, NM_001270447.1:c.367_368delCA, NM_001270447.1:c.412delG, NM_001270447.1:c.469C>T, NM_001270447.1:c.546+1G>C, NM_001270447.1:c.589G>A, NM_001270447.1:c.754C>T, NM_001270447.1:c.822-2A>C, NM_001270447.1:c.917T>C, NM_001270447.1:c.965_967delAGA, NM_001270447.1:c.1165C>T, NM_001270447.1:c.1166G>A, NM_001270447.1:c.1175T>C, NM_001270447.1:c.1210_1212delGAG, NM_001270447.1:c.1251+1G>A, NM_001270447.1:c.1426C>T, NM_001270447.1:c.1444dupC, NM_001270447.1:c.1458dupG, NM_001270447.1:c.1475G>A, NM_001270447.1:c.1537G>C, NM_001270447.1:c.1601+1G>A, NM_001270447.1:c.1906C>T, NM_001270447.1:c.1912C>T, NM_001270447.1:c.1951delC | Very long-chain acyl-CoA dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ACADVL gene located on chromosomal region 17p13.1. The age of onset is neonatal/infantile. This disease is characterized by cardiomyopathy, hypoketotic hypoglycemia, liver disease, exercise intolerance and rhabdomyolysis. The prevalence is 1:100,000-9:100,000. | 600,25 |
| ACE | Renal tubular dysgenesis | NM_000789.3 | NM_000789.3:c.798C>G, NM_000789.3:c.1319_1322delTGGA, NM_000789.3:c.1486C>T, NM_000789.3:c.1511delC, NM_000789.3:c.1587-2A>G, NM_000789.3:c.2371C>T | Renal tubular dysgenesis deficiency follows an autosomal recessive pattern of inheritance and the most common cause are pathogenic variants in the ACE (chromosomal region 17q23.3). The age of onset is fetal. This disease is characterized by absent or poorly developed proximal tubules of the kidneys, persistent oligohydramnios, leading to Potter sequence, and skull ossification defects. | 600,25 |
| ADA | Adenosine deaminase deficiency / Severe combined immunodeficiency due to ADA deficiency | NM_000022.3 | NM_000022.3:c.986C>T, NM_000022.3:c.956_960delAAGAG, NM_000022.3:c.890C>A, NM_000022.3:c.872C>T, NM_000022.3:c.632G>A, NM_000022.3:c.320T>C | Adenosine deaminase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADA gene located on chromosomal region 20q13.12. The age of onset is neonatal/infantile. This disease is characterized by profound lymphopenia and very low immunoglobulin levels of all isotypes resulting in severe and recurrent opportunistic infections. The annual incidence is 1:200,000-1:1,000,000. The prevalence is 1:100,000-9:100,000. | 600,25 |
| ADGRV1 | Usher syndrome, type 2C | NM_032119.3 | NM_032119.3:c.2258_2270delAAGTGCTGAAATC, NM_032119.3:c.2864C>A, NM_032119.3:c.5357_5358delAA, NM_032119.3:c.6275-1G>A, NM_032119.3:c.6312dupT, NM_032119.3:c.6901C>T, NM_032119.3:c.8713_8716dupAACA, NM_032119.3:c.8790delC, NM_032119.3:c.11377G>T, NM_032119.3:c.14973-1G>C, NM_032119.3:c.15196_15199dupCAAA, NM_032119.3:c.17668_17669delAT, NM_032119.3:c.18131A>G | Usher syndrome type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ADGRV1 and PDZD7 genes located on chromosomal regions 5q14.3 and 10q24.32 respectively. The age of onset is infantile. This disease is characterized by the association of sensorineural prelingual deafness (usually congenital) with retinitis pigmentosa and progressive vision loss. The prevalence is 1/30,000. | 600,25 |
| AGL | Glycogen storage disease type 3 | NM_000028.2 | NM_000028.2:c.16C>T, NM_000028.2:c.18_19delGA, NM_000028.2:c.294-2A>T, NM_000028.2:c.1222C>T, NM_000028.2:c.1485delT, NM_000028.2:c.1783C>T, NM_000028.2:c.1999delC, NM_000028.2:c.2039G>A, NM_000028.2:c.2590C>T, NM_000028.2:c.3216_3217delGA, NM_000028.2:c.3980G>A, NM_000028.2:c.4260-12A>G, NM_000028.2:c.4260-1G>T, NM_000028.2:c.4342G>C, NM_000028.2:c.4456delT, NM_000028.2:c.4529dupA | Glycogen storage disease (GSD) type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGL gene located on chromosomal region 1p21.2. The age of onset is infantile. This metabolic disorder is caused by deficiency of the glycogen debrancher enzyme and is associated with an accumulation of abnormal glycogen with short outer chains. Most patients are enzyme-deficient in both liver and muscle (IIIa), but about 15% are enzyme-deficient in liver only (IIIb) (Shen et al., 1996). These subtypes have been explained by differences in tissue expression of the deficient enzyme (Endo et al., 2006). In rare cases, selective loss of only 1 of the 2 debranching activities, glucosidase or transferase, results in type IIIc or IIId, respectively (Van Hoof and Hers, 1967; Ding et al., 1990). Clinically, patients with GSD type 3 present in infancy or early childhood with hepatomegaly, hypoglycemia, and growth retardation. Muscle weakness in those with IIIa is minimal in childhood but can become more severe in adults; some patients develop cardiomyopathy (Shen et al., 1996). | 600,25 |
| AGXT | Hyperoxaluria, primary, type 1 | NM_000030.2 | NM_000030.2:c.33dupC, NM_000030.2:c.121G>A, NM_000030.2:c.166-2A>G, NM_000030.2:c.245G>A, NM_000030.2:c.248A>G, NM_000030.2:c.322T>C, NM_000030.2:c.454T>A, NM_000030.2:c.466G>A, NM_000030.2:c.508G>A, NM_000030.2:c.560C>T, NM_000030.2:c.613T>C, NM_000030.2:c.697C>T, NM_000030.2:c.698G>A, NM_000030.2:c.731T>C, NM_000030.2:c.738G>A | Primary hyperoxaluria type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AGXT gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by variable clinical presentation, ranging from occasional symptomatic nephrolithiasis to nephrocalcinosis and end-stage renal disease with systemic involvement. The prevalence is 1:1,000,000-9:1,000,000. | 600,25 |
| AHI1 | Joubert syndrome type 3 | NM_001134830.1 | NM_001134830.1:c.3263_3264delGG, NM_001134830.1:c.2295dupA, NM_001134830.1:c.2168G>A, NM_001134830.1:c.1484G>A, NM_001134830.1:c.1303C>T, NM_001134830.1:c.1052G>T, NM_001134830.1:c.1051C>T, NM_001134830.1:c.985C>T | Joubert syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the AHI1 gene located on chromosomal region 6q23.3. The age of onset is variable. This disease is characterized by the neurological features of Joubert syndrome (neonatal hypotonia, developmental delay, mild to severe intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia and primary position nystagmus) associated with retinal dystrophy. | 600,25 |
| AIPL1 | Leber congenital amaurosis type 4 | NM_014336.4 | NM_014336.4:c.1053_1064delTGCAGAGCCACC, NM_014336.4:c.834G>A, NM_014336.4:c.715T>C, NM_014336.4:c.589G>C | Leber congenital amaurosis type 4 (LCA4) is a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus. Mutations in the AIPL1 gene may cause approximately 20% of recessive LCA. Other conditions caused by pathogenic variants in the AIPL1 gene are cone rod dystrophy and the less agressive form, juvenile retinitis pigmentosa. Cone-rod dystropy is characterized by decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness. | 600,25 |
| ALDOB | Fructose intolerance, hereditary | NM_000035.3 | NM_000035.3:c.1067C>A, NM_000035.3:c.1013C>T, NM_000035.3:c.1005C>G, NM_000035.3:c.720C>A, NM_000035.3:c.612T>A, NM_000035.3:c.524C>A, NM_000035.3:c.448G>C, NM_000035.3:c.442T>C, NM_000035.3:c.360_363delCAAA, NM_000035.3:c.178C>T, NM_000035.3:c.113-1_115delGGTA, NM_000035.3:c.10C>T, NM_000035.3:c.2T>C | Hereditary fructose intolerance follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALDOB gene located on chromosomal region 9q21.3-q22.2. The age of onset is neonatal/infantile. This disease is characterized by severe abdominal pain, vomiting, and hypoglycemia following ingestion of fructose or other sugars metabolised through fructose-1-phosphate. The prevalence is 1:100,000-9:100,000. | 600,25 |
| ALG6 | Congenital disorder of glycosylation, type 1c | NM_013339.3 | NM_013339.3:c.316C>T, NM_013339.3:c.897_899delAAT, NM_013339.3:c.998C>T, NM_013339.3:c.1432T>C | Congenital disorder of glycosylation type 1c follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALG6 gene located on chromosomal region 1p31.3. The age of onset is neonatal/infantile. This disease is characterized by psychomotor delay and muscular hypotonia, and possible coagulation anomalies, hormonal abnormalities and seizures. The prevalence is <1:1,000,000. | 600,25 |
| ALMS1 | Alstr�m syndrome | NM_015120.4 | NM_015120.4:c.2323C>T, NM_015120.4:c.4246delC, NM_015120.4:c.5584C>T, NM_015120.4:c.8383C>T, NM_015120.4:c.9614_9618delCAGAA, NM_015120.4:c.11443C>T, NM_015120.4:c.11453dupA, NM_015120.4:c.11612_11613delCT, NM_015120.4:c.12439C>T, NM_015120.4:c.12445C>T | Alstr�m syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ALMS1 gene located on chromosomal region 2p13.1. The age of onset is neonatal/infantile. This disease is characterized by cone-rod dystrophy, hearing loss, obesity, insulin resistance and hyperinsulinemia, type 2 diabetes mellitus, dilated cardiomyopathy and progressive hepatic and renal dysfunction. The prevalence is 1:10,000-1:1,000,000. | 600,25 |
| ANO5 | Limb-girdle muscular dystrophy type 12 (LGMDR12; formerly LGMD2L) | NM_213599.2 | NM_213599.2:c.172C>T, NM_213599.2:c.191dupA, NM_213599.2:c.206_207delAT, NM_213599.2:c.692G>T, NM_213599.2:c.1210C>T, NM_213599.2:c.1295C>G, NM_213599.2:c.1407+5G>A, NM_213599.2:c.1627dupA, NM_213599.2:c.1733T>C, NM_213599.2:c.1887delA, NM_213599.2:c.1898+1G>A, NM_213599.2:c.1914G>A | Limb-girdle muscular dystrophy type 12 (LGMDR12, formerly LGMD2L) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ANO5 gene located on chromosomal region 11p14.3. This disease is characterized by weakness and wasting restricted to the limb musculature. Most often is characterized by an adult onset (but ranging from 11 to 51 years) of mainly proximal lower limb weakness, with difficulties standing on tiptoes being one of the initial signs. Proximal upper limb and distal lower limb weakness is also common, as well as atrophy of the quadriceps (most commonly), biceps brachii, and lower leg muscles. Calf hypertrophy has also been reported in some cases. LGMDR12 progresses slowly, with most patients remaining ambulatory until late adulthood. The estimated prevalence is <1:1,000,000. | 600,25 |
| APTX | Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia | NM_001195248.1 | NM_001195248.1:c.917-1G>A, NM_001195248.1:c.879G>A, NM_001195248.1:c.830T>G, NM_001195248.1:c.659C>T, NM_001195248.1:c.362delC, NM_001195248.1:c.209delT, NM_001195248.1:c.176-2A>G, NM_001195248.1:c.166C>T | Ataxia, early-onset, with oculomotor apraxia and hipoalbuminemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the APTX gene located on chromosomal region 9p13.1. Ataxia-oculomotor apraxia syndrome is an early-onset autosomal recessive, progressive, cerebellar ataxia with peripheral axonal neuropathy, oculomotor apraxia (defined as the limitation of ocular movements on command), and hypoalbuminemia. The prevalence is unknown. | 600,25 |
| AR | Androgen insensitivity syndrome, complete | NM_000044.3 | NM_000044.3:c.340C>T, NM_000044.3:c.1771A>T, NM_000044.3:c.2323C>T, NM_000044.3:c.2391G>A, NM_000044.3:c.2395C>G, NM_000044.3:c.2567G>A, NM_000044.3:c.2650A>T | The complete androgen insensitivity syndrome (CAIS) follows an X-linked pattern of inheritance and is caused by pathogenic variants in the AR gene located on chromosomal region Xq12. Affected males have female external genitalia, female breast development, blind vagina, absent uterus and female adnexa, and abdominal or inguinal testes, despite a normal male 46,XY karyotype. There is unresponsiveness to age-appropriate levels of androgens. There is also a partial androgen insensitivity syndrome (PAIS; OMIM 312300) caused by mutations in the AR gene, called Reifenstein syndrome, which results in hypospadias and micropenis with gynecomastia. Note: A specific type of mutation in the AR gene (a CAG repeat expansion) also cause a rare condition known as Spinal and bulbar muscular atrophy or Kennedy disease; this mutation is not tested by this carrier test. | 600,25 |
| ARSA | Metachromatic leukodystrophy | NM_000487.5 | NM_000487.5:c.1408_1418delGCAGCTGTGAC, NM_000487.5:c.1401_1411delGTTAGACGCAG, NM_000487.5:c.1283C>T, NM_000487.5:c.1241delC, NM_000487.5:c.1232C>T, NM_000487.5:c.1210+1G>A, NM_000487.5:c.1175G>A, NM_000487.5:c.1174C>T, NM_000487.5:c.1150G>A, NM_000487.5:c.1125_1126delCT, NM_000487.5:c.1108-2A>G, NM_000487.5:c.991G>T, NM_000487.5:c.986C>T, NM_000487.5:c.979G>A, NM_000487.5:c.938G>A, NM_000487.5:c.937C>T, NM_000487.5:c.931G>A, NM_000487.5:c.899T>C, NM_000487.5:c.883G>A, NM_000487.5:c.869G>A, NM_000487.5:c.854+1G>A, NM_000487.5:c.827C>T, NM_000487.5:c.763G>A, NM_000487.5:c.739G>A, NM_000487.5:c.737G>A, NM_000487.5:c.641C>T, NM_000487.5:c.583delT, NM_000487.5:c.582delC, NM_000487.5:c.542dupT, NM_000487.5:c.542T>G, NM_000487.5:c.465+1G>A, NM_000487.5:c.346C>T, NM_000487.5:c.302G>A, NM_000487.5:c.293C>T, NM_000487.5:c.257G>A, NM_000487.5:c.195delC, NM_000487.5:c.34delG | Metachromatic leukodystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSA gene located on chromosomal region 22q13.33. The age of onset is variable. This disease is characterized by hypotonia, walking difficulties, optic atrophy and motor regression preceding mental impairment in the late infantile form, arrested intellectual development, followed by motor regression, epileptic seizures and ataxia in the juvenile form, and motor or psychiatric disorders, but with slow progression in the adult form. The incidence is 0.5:5,000-1:50,000ᅠand the prevalence is 1:10,000 -5/10,000. | 600,25 |
| ARSB | Mucopolysaccharidosis type 6 (Maroteaux-Lamy) | NM_000046.3 | NM_000046.3:c.1438dupG, NM_000046.3:c.1366C>T, NM_000046.3:c.1214G>A, NM_000046.3:c.1178A>C, NM_000046.3:c.1161dupC, NM_000046.3:c.1143-1G>C, NM_000046.3:c.1143-8T>G, NM_000046.3:c.979C>T, NM_000046.3:c.971G>T, NM_000046.3:c.944G>A, NM_000046.3:c.937C>G, NM_000046.3:c.921delA, NM_000046.3:c.753C>G, NM_000046.3:c.629A>G, NM_000046.3:c.589C>T, NM_000046.3:c.571C>T, NM_000046.3:c.427delG, NM_000046.3:c.349T>C | Mucopolysaccharidosis type 6 (Maroteaux-Lamy) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ARSB gene located on chromosomal region 5q14.1. The age of onset is infantile. This lysosomal storage disorder resulting from a deficiency of arylsulfatase B is characterized by educed pulmonary function, hepatosplenomegaly, hearing loss, sleep apnea, corneal clouding, carpal tunnel disease and occasionally central nervous system findings may include cervical cord compression caused by cervical spinal instability, meningeal thickening and/or bony stenosis, communicating hydrocephalus, optic nerve atrophy and blindness. The prevalence is 1:250,000-1:600,000 newborns. | 600,25 |
| ARSE | Chondrodysplasia punctata, X-linked recessive | NM_001282628.1 | NM_001282628.1:c.1807C>T, NM_001282628.1:c.1517C>T, NM_001282628.1:c.1504delG, NM_001282628.1:c.485G>T, NM_001282628.1:c.194T>G, NM_001282628.1:c.99-1G>A | X-linked chondrodysplasia punctata follows an X-linked pattern of inheritance and is caused by pathogenic variants in the ARSE gene located on chromosomal region Xp22.33. The age of onset is neonatal. Thisᅠis a disorder of cartilage and bone development that occurs almost exclusively in males. Include short stature and unusually short fingertips and ends of the toes. This condition is also associated with distinctive facial features, particularly a flattened-appearing nose with crescent-shaped nostrils and a flat nasal bridge. People with X-linked chondrodysplasia punctata 1 typically have normal intelligence and a normal life expectancy. However, some affected individuals have had serious or life-threatening complications including abnormal thickening (stenosis) of the cartilage that makes up the airways, which restricts breathing. Also, abnormalities of spinal bones in the neck can lead to pinching (compression) of the spinal cord, which can cause pain, numbness, and weakness. Other, less common features of X-linked chondrodysplasia punctata 1 include delayed development, hearing loss, vision abnormalities, and heart defects. The prevalence is 1:500,000. | 600,25 |
| ASL | Argininosuccinic aciduria | NM_000048.3 | NM_000048.3:c.35G>A, NM_000048.3:c.337C>T, NM_000048.3:c.346C>T, NM_000048.3:c.446+1G>A, NM_000048.3:c.525-2A>T, NM_000048.3:c.532G>A, NM_000048.3:c.539T>G, NM_000048.3:c.544C>T, NM_000048.3:c.578G>A, NM_000048.3:c.602+1G>A, NM_000048.3:c.857A>G, NM_000048.3:c.1045_1057delGTCATCTCTACGC, NM_000048.3:c.1060C>T, NM_000048.3:c.1135C>T, NM_000048.3:c.1144-2A>G, NM_000048.3:c.1153C>T, NM_000048.3:c.1255_1256delCT, NM_000048.3:c.1369dupG | Argininosuccinic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASL gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by severe hyperammonemic coma, hypotonia, growth failure, anorexia and chronic vomiting or behavioral disorders during childhood, and hyperammonemic coma or behavioral disorders that simulate psychiatric disorders later in life. The prevalence is 1:70,000 newborns. | 600,25 |
| ASPA | Canavan disease | NM_000049.2 | NM_000049.2:c.212G>A, NM_000049.2:c.433-2A>G, NM_000049.2:c.654C>A, NM_000049.2:c.693C>A, NM_000049.2:c.854A>C, NM_000049.2:c.914C>A | Canavan disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPA gene located on chromosomal region 17p13.3. The age of onset is neonatal/infantile. This disease is characterized by a variable spectrum between severe forms with leukodystrophy, macrocephaly and severe developmental delay, and a very rare mild/juvenile form characterized by mild developmental delay. The prevalence is 1:6,400- 1:13,500 in Askenazis Jewis. | 600,25 |
| ASPM | Primary microcephaly type 5, autosomal recessive | NM_018136.4 | NM_018136.4:c.10059C>A, NM_018136.4:c.9789T>A, NM_018136.4:c.9754delA, NM_018136.4:c.9747_9748delCT, NM_018136.4:c.9730C>T, NM_018136.4:c.9697C>T, NM_018136.4:c.9685delA, NM_018136.4:c.9677dupG, NM_018136.4:c.9557C>G, NM_018136.4:c.9492T>G, NM_018136.4:c.9319C>T, NM_018136.4:c.9238A>T, NM_018136.4:c.9190C>T, NM_018136.4:c.9178C>T, NM_018136.4:c.9159delA, NM_018136.4:c.9115_9118dupCATT, NM_018136.4:c.8844delC, NM_018136.4:c.8711_8712delAA, NM_018136.4:c.8668C>T, NM_018136.4:c.8508_8509delGA, NM_018136.4:c.8378delT, NM_018136.4:c.8230dupA, NM_018136.4:c.8131_8132delAA, NM_018136.4:c.7894C>T, NM_018136.4:c.7860_7861delGA, NM_018136.4:c.7782_7783delGA, NM_018136.4:c.7761T>G, NM_018136.4:c.7491_7495delTATTA, NM_018136.4:c.6732delA, NM_018136.4:c.6337_6338delAT, NM_018136.4:c.6232C>T, NM_018136.4:c.6189T>G, NM_018136.4:c.6073delG, NM_018136.4:c.5439_5440delAG, NM_018136.4:c.5149delA, NM_018136.4:c.5136C>A, NM_018136.4:c.4858_4859delAT, NM_018136.4:c.4795C>T, NM_018136.4:c.4583delA, NM_018136.4:c.4195dupA, NM_018136.4:c.3979C>T, NM_018136.4:c.3978G>A, NM_018136.4:c.3811C>T, NM_018136.4:c.3796G>T, NM_018136.4:c.3710C>G, NM_018136.4:c.3663delG, NM_018136.4:c.3527C>G, NM_018136.4:c.3477_3481delCGCTA, NM_018136.4:c.3188T>G, NM_018136.4:c.3082G>A, NM_018136.4:c.3055C>T, NM_018136.4:c.2967G>A, NM_018136.4:c.2389C>T, NM_018136.4:c.1990C>T, NM_018136.4:c.1959_1962delCAAA, NM_018136.4:c.1729_1730delAG, NM_018136.4:c.1590delA, NM_018136.4:c.1406_1413delATCCTAAA, NM_018136.4:c.1366G>T, NM_018136.4:c.1260_1266delTCAAGTC, NM_018136.4:c.1179delT, NM_018136.4:c.1154_1155delAG, NM_018136.4:c.1002delA, NM_018136.4:c.719_720delCT, NM_018136.4:c.577C>T, NM_018136.4:c.349C>T | Primary autosomal recessive microcephaly type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASPM gene located on chromosomal region 1q31. The age of onset is neonatal/infantile. This disease is characterized by a reduction in head circumference at birth, mild to moderate non-progressive intellectual impairment and delay in early motor milestones, speech delay and hyperactive behavior are common.ᅠThe annual incidence is 1:1,000,000. | 600,25 |
| ASS1 | Citrullinemia type 1 | NM_000050.4 | NM_000050.4:c.40G>A, NM_000050.4:c.256C>T, NM_000050.4:c.257G>A, NM_000050.4:c.349G>A, NM_000050.4:c.421-2A>G, NM_000050.4:c.470G>A, NM_000050.4:c.496-2A>G, NM_000050.4:c.535T>C, NM_000050.4:c.539G>A, NM_000050.4:c.571G>A, NM_000050.4:c.787G>A, NM_000050.4:c.793C>T, NM_000050.4:c.794G>A, NM_000050.4:c.805G>A, NM_000050.4:c.814C>T, NM_000050.4:c.835C>T, NM_000050.4:c.836G>A, NM_000050.4:c.910C>T, NM_000050.4:c.919C>T, NM_000050.4:c.970G>A, NM_000050.4:c.970+5G>A, NM_000050.4:c.1085G>T, NM_000050.4:c.1087C>T, NM_000050.4:c.1088G>A, NM_000050.4:c.1168G>A, NM_000050.4:c.1194-1G>C | Citrullinemia type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ASS1 gene located on chromosomal region 9q34.1. The age of onset is variable. This disease is characterized by hyperammonemia, progressive lethargy, poor feeding and vomiting in the neonatal form and by variable hyperammonemia in the later-onset form. The prevalence is 1:100,000-9:100,000. | 600,25 |
| ATIC | AICA-ribosiduria due to ATIC deficiency | NM_004044.6 | NM_004044.6:c.1277A>G | AICA-ribosiduria due to ATIC deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATIC gene located on chromosomal region 2q35. The age of onset is neonatal/infantile. This disease is characterized by profound intellectual deficit, epilepsy, dysmorphic features of the knees, elbows, and shoulders and congenital blindness. The prevalence is <1:1,000,000. | 600,25 |
| ATP7B | Wilson disease | NM_000053.3 | NM_000053.3:c.4088C>T, NM_000053.3:c.4058G>A, NM_000053.3:c.3990_3993delTTAT, NM_000053.3:c.3955C>T, NM_000053.3:c.3809A>G, NM_000053.3:c.3796G>A, NM_000053.3:c.3694A>C, NM_000053.3:c.3359T>A, NM_000053.3:c.3207C>A, NM_000053.3:c.3083delA, NM_000053.3:c.2975C>T, NM_000053.3:c.2972C>T, NM_000053.3:c.2930C>T, NM_000053.3:c.2906G>A, NM_000053.3:c.2807T>A, NM_000053.3:c.2804C>T, NM_000053.3:c.2795C>A, NM_000053.3:c.2755C>T, NM_000053.3:c.2755C>G, NM_000053.3:c.2621C>T, NM_000053.3:c.2605G>A, NM_000053.3:c.2532delA, NM_000053.3:c.2356-2A>G, NM_000053.3:c.2305A>G, NM_000053.3:c.2297C>G, NM_000053.3:c.2123T>C, NM_000053.3:c.2071G>A, NM_000053.3:c.1934T>G, NM_000053.3:c.1846C>T, NM_000053.3:c.1745_1746delTA, NM_000053.3:c.1512dupT, NM_000053.3:c.1145_1151delCCCAACT, NM_000053.3:c.915T>A, NM_000053.3:c.562C>T, NM_000053.3:c.19_20delCA | Wilson disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATP7B gene located on chromosomal region 13q14.3. The age of onset is infantile. This disease is characterized by the toxic accumulation of copper, mainly in the liver and central nervous system, and symptomatic patients may present with hepatic, neurologic or psychiatric forms. The birth incidence is 1:30,000-1:100,000 in France and The prevalence is 1:10,000-1:30,000. | 600,25 |
| ATR | Seckel syndrome type 1 | NM_001184.3 | NM_001184.3:c.6488delT, NM_001184.3:c.6037dupA, NM_001184.3:c.5645delA, NM_001184.3:c.5635G>T, NM_001184.3:c.2341+1G>A, NM_001184.3:c.975_976delCT | Seckel syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ATR gene located on chromosomal region 3q23. The age of onset is neonatal/infantile. This disease is characterized by a proportionate dwarfism of prenatal onset, a severe microcephaly with a bird-headed like appearance and mental retardation.ᅠThe prevalence is <1:1,000,000. | 600,25 |
| BCKDHA | Maple syrup urine disease, type 1a | NM_000709.3 | NM_000709.3:c.14delT, NM_000709.3:c.632C>T, NM_000709.3:c.659C>T, NM_000709.3:c.741dupT, NM_000709.3:c.797delA, NM_000709.3:c.853G>C, NM_000709.3:c.868G>A, NM_000709.3:c.905A>C, NM_000709.3:c.909_910delGT, NM_000709.3:c.917delT, NM_000709.3:c.929C>G, NM_000709.3:c.964C>T, NM_000709.3:c.979G>A, NM_000709.3:c.1036C>T, NM_000709.3:c.1037G>A, NM_000709.3:c.1234G>A | Maple syrup urine disease type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BCKDHA gene located on chromosomal region 19q13.1-13.2. The age of onset is neonatal/infantile. This disease is characterized by poor feeding, lethargy, vomiting, a maple syrup odor in the cerumen and urine, encephalopathy and central respiratory failure if untreated. The prevalence is 1:1,000,000-9:1,000,000. | 600,25 |
| BCS1L | BCS1L-related disorders, including Leigh syndrome | NM_001079866.1 | NM_001079866.1:c.103G>C, NM_001079866.1:c.133C>T, NM_001079866.1:c.148A>G, NM_001079866.1:c.166C>T, NM_001079866.1:c.232A>G, NM_001079866.1:c.547C>T, NM_001079866.1:c.548G>A, NM_001079866.1:c.550C>T, NM_001079866.1:c.696delT, NM_001079866.1:c.830G>A, NM_001079866.1:c.1057G>A | Leigh syndrome caused by mutations in the BCS1L gene -located on chromosomal region 2q35- follows an autosomal recessive pattern of inheritance. Leigh syndrome is a clinically and genetically heterogeneous disorder resulting from defective mitochondrial energy generation; It presents extensive genetic heterogeneity (more than 75 different genes) with mutations identified in both nuclear- and mitochondrial-encoded genes involved in energy metabolism, including mitochondrial respiratory chain complexes I, II, III, IV, and V. It most commonly presents as a progressive and severe neurodegenerative disorder with onset within the first months or years of life, and may result in early death. Affected individuals usually show global developmental delay or developmental regression, hypotonia, ataxia, dystonia, and ophthalmologic abnormalities, such as nystagmus or optic atrophy. The BCS1L protein is critical for the formation of mitochondrial complex III. This syndrome affects at least 1 in 40,000 newborns. | 600,25 |
| BEST1 | Bestrophinopathy, AR | NM_001139443.1 | NM_001139443.1:c.242G>A, NM_001139443.1:c.341_342delTG, NM_001139443.1:c.344delG, NM_001139443.1:c.418C>T, NM_001139443.1:c.434T>C, NM_001139443.1:c.502G>A, NM_001139443.1:c.754G>A, NM_001139443.1:c.769G>A, NM_001139443.1:c.1129_1130insCCAAAGA, NM_001139443.1:c.1203_1204insGCCTTGATGGA, NM_001139443.1:c.1311_1317dupCAAAGAC | Bestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram. Genetic heterogeneity: Mutations in this gene may cause dominant phenotypes like Macular dystrophy, vitelliform, 2 ( OMIM 153700) and Vitreoretinochoroidopathy (193220). | 600,25 |
| BEST1 | Bestrophinopathy, AR | NM_004183.3 | NM_004183.3:c.122T>C | Bestrophinopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BEST1 gene located on chromosomal region 11q13. The age of onset is variable. This disease is characterized by central visual loss in the first 2 decades of life associated with an absent electrooculogram light rise, and a reduced electroretinogram. Genetic heterogeneity: Mutations in this gene may cause dominant phenotypes like Macular dystrophy, vitelliform, 2 ( OMIM 153700) and Vitreoretinochoroidopathy (193220). | 600,25 |
| BSND | Bartter syndrome, type 4a | NM_057176.2 | NM_057176.2:c.1A>T, NM_057176.2:c.3G>A, NM_057176.2:c.10G>T, NM_057176.2:c.22C>T, NM_057176.2:c.23G>T, NM_057176.2:c.35T>C, NM_057176.2:c.139G>A | Bartter syndrome type 4A with deafness follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BSND gene located on chromosomal region 1p32.3. The age of onset is neonatal/infantile. This disease is characterized by maternal polyhydramnios, premature delivery, polyuria, sensorineural deafness and is associated with hypokalemic alkalosis, increased levels of plasma renin and aldosterone, low blood pressure, and vascular resistance to angiotensin II. | 600,25 |
| BTD | Biotinidase deficiency | NM_001281723.2 | NM_001281723.2:c.190G>A, NM_001281723.2:c.241C>T, NM_001281723.2:c.340G>C, NM_001281723.2:c.449G>A, NM_001281723.2:c.517G>A, NM_001281723.2:c.534G>T, NM_001281723.2:c.563G>A, NM_001281723.2:c.589A>G, NM_001281723.2:c.601G>A, NM_001281723.2:c.635A>G, NM_001281723.2:c.637C>T, NM_001281723.2:c.649C>T, NM_001281723.2:c.670G>A, NM_001281723.2:c.761A>G, NM_001281723.2:c.800A>T, NM_001281723.2:c.939delT, NM_001281723.2:c.1330delG, NM_001281723.2:c.1345C>T, NM_001281723.2:c.1358G>A, NM_001281723.2:c.1374A>C, NM_001281723.2:c.1495C>T, NM_001281723.2:c.1514_1518delGGATG, NM_001281723.2:c.1601C>T, NM_001281723.2:c.1618C>T | Biotinidase deficiency an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the BTD gene located on chromosomal region 3p25. The age of onset is neonatal/infantile. This disease is characterized by seizures, breathing difficulties, hypotonia, skin rash, alopecia, hearing loss and delayed development. | 600,25 |
| CAPN3 | Limb-girdle muscular dystrophy type 1 (LGMDR1; formerly LGMD2A) | NM_000070.2 | NM_000070.2:c.133G>A, NM_000070.2:c.223dupT, NM_000070.2:c.257C>T, NM_000070.2:c.328C>T, NM_000070.2:c.550delA, NM_000070.2:c.580delT, NM_000070.2:c.598_612delTTCTGGAGTGCTCTG, NM_000070.2:c.855_864dupGTTGATTGCA, NM_000070.2:c.956C>T, NM_000070.2:c.1322delG, NM_000070.2:c.1466G>A, NM_000070.2:c.1468C>T, NM_000070.2:c.1469G>A, NM_000070.2:c.1599_1602delGAGC, NM_000070.2:c.1715G>A, NM_000070.2:c.1795dupA, NM_000070.2:c.1838delA, NM_000070.2:c.2120A>G, NM_000070.2:c.2212C>T, NM_000070.2:c.2243G>A, NM_000070.2:c.2251_2254dupGTCA, NM_000070.2:c.2306G>A, NM_000070.2:c.2362_2363delAGinsTCATCT | Limb-girdle muscular dystrophy type 1 (LGMDR1; formerly LGMD2A) follows an autosomal recessive pattern of inheritance and is caused by biallelic pathogenic variants in the CAPN3 gene located on chromosomal region 15q15.1. The age of onset is variable. This disease is characterized by a variable age of onset of progressive, typically symmetrical and selective weakness and atrophy of proximal shoulder- and pelvic-girdle muscles (gluteus maximus, thigh adductors, and muscles of the posterior compartment of the limbs are most commonly affected) without cardiac or facial involvement. Clinical manifestations include exercise intolerance, a waddling gait, scapular winging and calf pseudo-hypertrophy.The prevalence is 1:100,000- 9:100,000. Genetic heterogeneity: Heterozygous mutation in the CAPN3 gene can cause autosomal dominant limb-girdle muscular dystrophy-4 (LGMDD4; OMIM 618129), which has a later onset and milder features. | 600,25 |
| CBS | Homocystinuria, B6-responsive and nonresponsive types | NM_000071.2 | NM_000071.2:c.1330G>A, NM_000071.2:c.1280C>T, NM_000071.2:c.1150A>G, NM_000071.2:c.1136G>A, NM_000071.2:c.1058C>T, NM_000071.2:c.1006C>T, NM_000071.2:c.992C>A, NM_000071.2:c.969G>A, NM_000071.2:c.959T>C, NM_000071.2:c.919G>A, NM_000071.2:c.833T>C, NM_000071.2:c.797G>A, NM_000071.2:c.689delT, NM_000071.2:c.676G>A, NM_000071.2:c.572C>T, NM_000071.2:c.526G>T, NM_000071.2:c.502G>A, NM_000071.2:c.434C>T, NM_000071.2:c.430G>A, NM_000071.2:c.415G>A, NM_000071.2:c.393G>C, NM_000071.2:c.374G>A, NM_000071.2:c.341C>T, NM_000071.2:c.325T>C, NM_000071.2:c.162G>A, NM_000071.2:c.146C>T | Homocystinuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CBS gene located on chromosomal region 21q22.3. The age of onset is infantile. This disease is characterized by the multiple involvement of the eye, skeleton, central nervous system and vascular system. The prevalence is 1:200,000-1:335,000. | 600,25 |
| CC2D2A | Joubert syndrome type 9; Meckel syndrome type 6 | NM_001080522.2 | NM_001080522.2:c.2486+1G>C, NM_001080522.2:c.2848C>T, NM_001080522.2:c.3145C>T, NM_001080522.2:c.3289delG, NM_001080522.2:c.3364C>T, NM_001080522.2:c.3594+1G>A, NM_001080522.2:c.4179+1delG, NM_001080522.2:c.4181delG, NM_001080522.2:c.4333C>T, NM_001080522.2:c.4582C>T, NM_001080522.2:c.4667A>T | Joubert syndrome type 9 defect follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CC2D2A gene located on chromosomal region 4p15.32. The age of onset is neonatal/infantile. This disease is characterized neonatal hypotonia, developmental delay, intellectrual disability, ataxia, and abnormal eye movements including oculomotor apraxia, primary position nystagmus and congenital hepatic fibrosis. | 600,25 |
| CDH23 | Usher syndrome, type 1D | NM_022124.5 | NM_022124.5:c.146-2A>G, NM_022124.5:c.193delC, NM_022124.5:c.288+1G>A, NM_022124.5:c.1858+2T>G, NM_022124.5:c.3141C>A, NM_022124.5:c.3516_3519delATCC, NM_022124.5:c.3579+2T>C, NM_022124.5:c.4504C>T, NM_022124.5:c.5237G>A, NM_022124.5:c.5663T>C, NM_022124.5:c.6050-9G>A, NM_022124.5:c.6393delC, NM_022124.5:c.6442G>A | Non-syndromic autosomal recessive deafness type 12 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDH23 gene located on chromosomal region 10p22.1. The age of onset is neonatal/infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. | 600,25 |
| CDHR1 | Cone-rod dystrophy, type 15 | NM_033100.3 | NM_033100.3:c.338delG, NM_033100.3:c.524dupA, NM_033100.3:c.640delG, NM_033100.3:c.1112delC, NM_033100.3:c.1463delG, NM_033100.3:c.1485+2T>C, NM_033100.3:c.1485+2T>G | Cone-rod dystrophy, type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CDHR1 gene located on chromosomal region 10q23.1. This disease is characterized by decreased visual acuity and sensitivity in the central visual field, followed by loss of peripheral vision. The overall prevalence of all types of cone-rod dystrophy is 1-9:100,000. | 600,25 |
| CENPJ | Primary microcephaly type 6, autosomal recessive | NM_018451.4 | NM_018451.4:c.3842_3843dupTA, NM_018451.4:c.3704A>T, NM_018451.4:c.3699_3702dupAATA, NM_018451.4:c.3568_3571dupGTCA, NM_018451.4:c.3415G>T, NM_018451.4:c.3243_3246delTCAG, NM_018451.4:c.2968_2972delAAAAA, NM_018451.4:c.2614delT, NM_018451.4:c.2460_2463delGACG, NM_018451.4:c.1949_1952dupAGTG, NM_018451.4:c.757_760delGTCT, NM_018451.4:c.289dupA, NM_018451.4:c.232_236delCAGAA, NM_018451.4:c.40C>T | Primary autosomal recessive microcephaly type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CENPJ gene located on chromosomal region 13q12.12.ᅠThe age of onset is neonatal/infantile. This disease is characterized by reduced head circumference at birth with no gross anomalies of brain architecture and variable degrees of intellectual impairment. | 600,25 |
| CEP290 | Meckel syndrome type 4; Joubert syndrome type 5 | NM_025114.3 | NM_025114.3:c.7341dupA, NM_025114.3:c.7341delA, NM_025114.3:c.7324G>T, NM_025114.3:c.6798G>A, NM_025114.3:c.6645+1G>A, NM_025114.3:c.6624delG, NM_025114.3:c.6448_6455delCAGTTGAA, NM_025114.3:c.5668G>T, NM_025114.3:c.5611_5614delCAAA, NM_025114.3:c.4962_4963delAA, NM_025114.3:c.4916C>A, NM_025114.3:c.4723A>T, NM_025114.3:c.4705-1G>T, NM_025114.3:c.4656delA, NM_025114.3:c.4393C>T, NM_025114.3:c.3185delT, NM_025114.3:c.2249T>G, NM_025114.3:c.1681C>T, NM_025114.3:c.1665_1666delAA, NM_025114.3:c.1501G>T, NM_025114.3:c.613C>T, NM_025114.3:c.384_387delTAGA, NM_025114.3:c.164_167delCTCA, NM_025114.3:c.21G>T | Meckel syndrome type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CEP290 gene located on chromosomal region 12q21.32. The age of onset is neonatal. This disease is characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically occipital encephalocele), hepatic ductal dysplasia and cysts, and postaxial polydactyly. The prevalence is <1/1,000,000. | 600,25 |
| CERKL | Retinitis pigmentosa type 26 | NM_001030311.2 | NM_001030311.2:c.1090C>T, NM_001030311.2:c.858delT, NM_001030311.2:c.847C>T, NM_001030311.2:c.312delA | Retinitis pigmentosa 26 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CERKL gene located on chromosomal region 2q31.3. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000. | 600,25 |
| CFH | Complement factor H deficiency | NM_000186.3 | NM_000186.3:c.380G>T, NM_000186.3:c.1606T>C, NM_000186.3:c.2876G>A | Complement factor H deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFH gene located on chromosomal region 1q32. This disease is characterized by increased susceptibility to recurrent, usually severe, infections (particularly by Neisseria meningitidis, Escherichia coli, and Haemophilus influenzae), renal impairment and/or autoimmune diseases. | 600,25 |
| CFTR | Cystic fibrosis | NM_000492.3 | NM_000492.3:c.1A>G, NM_000492.3:c.4C>T, NM_000492.3:c.11C>A, NM_000492.3:c.50delT, NM_000492.3:c.44T>C, NM_000492.3:c.53+1G>T, NM_000492.3:c.57G>A, NM_000492.3:c.79G>T, NM_000492.3:c.88C>T, NM_000492.3:c.115C>T, NM_000492.3:c.137C>A, NM_000492.3:c.164+1G>A, NM_000492.3:c.164+1G>T, NM_000492.3:c.164+2T>C, NM_000492.3:c.164+4dupT, NM_000492.3:c.165-3C>T, NM_000492.3:c.165-1G>A, NM_000492.3:c.166G>A, NM_000492.3:c.169T>G, NM_000492.3:c.170G>A, NM_000492.3:c.171G>A, NM_000492.3:c.174_177delTAGA, NM_000492.3:c.175dupA, NM_000492.3:c.178G>A, NM_000492.3:c.178G>T, NM_000492.3:c.200C>T, NM_000492.3:c.223C>T, NM_000492.3:c.233dupT, NM_000492.3:c.254G>A, NM_000492.3:c.262_263delTT, NM_000492.3:c.263T>A, NM_000492.3:c.263T>G, NM_000492.3:c.271G>A, NM_000492.3:c.273+1G>A, NM_000492.3:c.273+3A>C, NM_000492.3:c.274-2A>G, NM_000492.3:c.274-1G>A, NM_000492.3:c.274G>A, NM_000492.3:c.274G>T, NM_000492.3:c.292C>T, NM_000492.3:c.305T>G, NM_000492.3:c.310delA, NM_000492.3:c.313delA, NM_000492.3:c.325_327delTATinsG, NM_000492.3:c.328G>C, NM_000492.3:c.328G>T, NM_000492.3:c.349C>T, NM_000492.3:c.350G>A, NM_000492.3:c.350G>T, NM_000492.3:c.366T>A, NM_000492.3:c.409delC, NM_000492.3:c.413_415dupTAC, NM_000492.3:c.416A>G, NM_000492.3:c.442delA, NM_000492.3:c.445G>A, NM_000492.3:c.445G>T, NM_000492.3:c.446G>T, NM_000492.3:c.489+1G>T, NM_000492.3:c.531delT, NM_000492.3:c.532G>A, NM_000492.3:c.543_546delTAGT, NM_000492.3:c.571T>G, NM_000492.3:c.577G>T, NM_000492.3:c.579+1G>T, NM_000492.3:c.579+3A>G, NM_000492.3:c.579+5G>A, NM_000492.3:c.580-1G>T, NM_000492.3:c.595C>T, NM_000492.3:c.613C>T, NM_000492.3:c.617T>G, NM_000492.3:c.647G>A, NM_000492.3:c.658C>T, NM_000492.3:c.680T>G, NM_000492.3:c.695T>A, NM_000492.3:c.708delT, NM_000492.3:c.717delG, NM_000492.3:c.803delA, NM_000492.3:c.825C>G, NM_000492.3:c.828C>A, NM_000492.3:c.850dupA, NM_000492.3:c.861_865delCTTAA, NM_000492.3:c.935_937delTCT, NM_000492.3:c.933C>G, NM_000492.3:c.948delT, NM_000492.3:c.987delA, NM_000492.3:c.988G>T, NM_000492.3:c.1000C>T, NM_000492.3:c.1001G>T, NM_000492.3:c.1006_1007insG, NM_000492.3:c.1007T>A, NM_000492.3:c.1013C>T, NM_000492.3:c.1021_1022dupTC, NM_000492.3:c.1021T>C, NM_000492.3:c.1029delC, NM_000492.3:c.1037T>C, NM_000492.3:c.1040G>A, NM_000492.3:c.1040G>C, NM_000492.3:c.1055G>A, NM_000492.3:c.1075C>A, NM_000492.3:c.1079C>A, NM_000492.3:c.1081delT, NM_000492.3:c.1116+1G>A, NM_000492.3:c.1117-1G>A, NM_000492.3:c.1130dupA, NM_000492.3:c.1155_1156dupTA, NM_000492.3:c.1202G>A, NM_000492.3:c.1203G>A, NM_000492.3:c.1209+1G>A, NM_000492.3:c.1211delG, NM_000492.3:c.1240C>T, NM_000492.3:c.1301_1307delCACTTCT, NM_000492.3:c.1327_1330dupGATA, NM_000492.3:c.1340delA, NM_000492.3:c.1364C>A, NM_000492.3:c.1365_1366delGG, NM_000492.3:c.1393-2A>G, NM_000492.3:c.1393-1G>A, NM_000492.3:c.1397C>A, NM_000492.3:c.1397C>G, NM_000492.3:c.1400T>C, NM_000492.3:c.1418delG, NM_000492.3:c.1420G>A, NM_000492.3:c.1438G>T, NM_000492.3:c.1466C>A, NM_000492.3:c.1475C>T, NM_000492.3:c.1477_1478delCA, NM_000492.3:c.1477C>T, NM_000492.3:c.1487G>A, NM_000492.3:c.1505T>C, NM_000492.3:c.1519_1521delATC, NM_000492.3:c.1516A>G, NM_000492.3:c.1519A>G, NM_000492.3:c.1521_1523delCTT, NM_000492.3:c.1523T>G, NM_000492.3:c.1538A>G, NM_000492.3:c.1545_1546delTA, NM_000492.3:c.1558G>T, NM_000492.3:c.1572C>A, NM_000492.3:c.1573C>T, NM_000492.3:c.1584+1G>A, NM_000492.3:c.1585-8G>A, NM_000492.3:c.1585-1G>A, NM_000492.3:c.1624G>T, NM_000492.3:c.1645A>C, NM_000492.3:c.1646G>A, NM_000492.3:c.1647T>G, NM_000492.3:c.1648G>T, NM_000492.3:c.1650delA, NM_000492.3:c.1651G>A, NM_000492.3:c.1652G>A, NM_000492.3:c.1654C>T, NM_000492.3:c.1657C>T, NM_000492.3:c.1670delC, NM_000492.3:c.1673T>C, NM_000492.3:c.1675G>A, NM_000492.3:c.1679G>A, NM_000492.3:c.1679G>C, NM_000492.3:c.1679+1G>A, NM_000492.3:c.1679+1G>C, NM_000492.3:c.1680-886A>G, NM_000492.3:c.1680-1G>A, NM_000492.3:c.1682C>A, NM_000492.3:c.1692delA, NM_000492.3:c.1703delT, NM_000492.3:c.1705T>G, NM_000492.3:c.1721C>A, NM_000492.3:c.1753G>T, NM_000492.3:c.1766+1G>A, NM_000492.3:c.1766+1G>C, NM_000492.3:c.1766+1G>T, NM_000492.3:c.1766+3A>G, NM_000492.3:c.1766+5G>T, NM_000492.3:c.1792_1798delAAAACTA, NM_000492.3:c.1826A>G, NM_000492.3:c.1882G>C, NM_000492.3:c.1923_1931delCTCAAAACTinsA, NM_000492.3:c.1973_1985delGAAATTCAATCCTinsAGAAA, NM_000492.3:c.1986_1989delAACT, NM_000492.3:c.2012delT, NM_000492.3:c.2017G>T, NM_000492.3:c.2052dupA, NM_000492.3:c.2052delA, NM_000492.3:c.2051_2052delAAinsG, NM_000492.3:c.2053dupC, NM_000492.3:c.2053C>T, NM_000492.3:c.2125C>T, NM_000492.3:c.2128A>T, NM_000492.3:c.2143C>T, NM_000492.3:c.2158C>T, NM_000492.3:c.2175dupA, NM_000492.3:c.2195T>G, NM_000492.3:c.2215delG, NM_000492.3:c.2241_2248delGATACTGC, NM_000492.3:c.2290C>T, NM_000492.3:c.2353C>T, NM_000492.3:c.2374C>T, NM_000492.3:c.2423_2424dupAT, NM_000492.3:c.2453delT, NM_000492.3:c.2463_2464delTG, NM_000492.3:c.2464G>T, NM_000492.3:c.2490+1G>A, NM_000492.3:c.2491G>T, NM_000492.3:c.2537G>A, NM_000492.3:c.2538G>A, NM_000492.3:c.2547C>A, NM_000492.3:c.2551C>T, NM_000492.3:c.2583delT, NM_000492.3:c.2589_2599delAATTTGGTGCT, NM_000492.3:c.2601dupA, NM_000492.3:c.2645G>A, NM_000492.3:c.2657+5G>A, NM_000492.3:c.2658-1G>C, NM_000492.3:c.2668C>T, NM_000492.3:c.2735C>A, NM_000492.3:c.2737_2738insG, NM_000492.3:c.2739T>A, NM_000492.3:c.2763_2764dupAG, NM_000492.3:c.2780T>C, NM_000492.3:c.2810dupT, NM_000492.3:c.2825delT, NM_000492.3:c.2834C>T, NM_000492.3:c.2869_2870insG, NM_000492.3:c.2875delG, NM_000492.3:c.2896delA, NM_000492.3:c.2908G>C, NM_000492.3:c.2930C>T, NM_000492.3:c.2936A>T, NM_000492.3:c.2988G>A, NM_000492.3:c.2988+1G>A, NM_000492.3:c.2989-2A>G, NM_000492.3:c.2989-1G>A, NM_000492.3:c.3002_3003delTG, NM_000492.3:c.3011_3019delCTATAGCAG, NM_000492.3:c.3017C>A, NM_000492.3:c.3039dupC, NM_000492.3:c.3039delC, NM_000492.3:c.3067_3072delATAGTG, NM_000492.3:c.3080T>C, NM_000492.3:c.3107C>A, NM_000492.3:c.3124C>T, NM_000492.3:c.3139_3139+1delGG, NM_000492.3:c.3140-26A>G, NM_000492.3:c.3160C>G, NM_000492.3:c.3181G>C, NM_000492.3:c.3194T>C, NM_000492.3:c.3196C>T, NM_000492.3:c.3197G>A, NM_000492.3:c.3205G>A, NM_000492.3:c.3209G>A, NM_000492.3:c.3230T>C, NM_000492.3:c.3266G>A, NM_000492.3:c.3276C>A, NM_000492.3:c.3276C>G, NM_000492.3:c.3292T>C, NM_000492.3:c.3293G>A, NM_000492.3:c.3294G>A, NM_000492.3:c.3294G>C, NM_000492.3:c.3294G>T, NM_000492.3:c.3302T>A, NM_000492.3:c.3302T>G, NM_000492.3:c.3304A>T, NM_000492.3:c.3310G>T, NM_000492.3:c.3353C>T, NM_000492.3:c.3368-2A>G, NM_000492.3:c.3435G>A, NM_000492.3:c.3454G>C, NM_000492.3:c.3468G>A, NM_000492.3:c.3468+5G>A, NM_000492.3:c.3472C>T, NM_000492.3:c.3484C>T, NM_000492.3:c.3528delC, NM_000492.3:c.3532_3535dupTCAA, NM_000492.3:c.3536_3539delCCAA, NM_000492.3:c.3587C>G, NM_000492.3:c.3605delA, NM_000492.3:c.3611G>A, NM_000492.3:c.3612G>A, NM_000492.3:c.3659delC, NM_000492.3:c.3691delT, NM_000492.3:c.3700A>G, NM_000492.3:c.3717+4A>G, NM_000492.3:c.3717+5G>A, NM_000492.3:c.3717+40A>G, NM_000492.3:c.3718-2477C>T, NM_000492.3:c.3718-3T>G, NM_000492.3:c.3718-1G>A, NM_000492.3:c.3719T>G, NM_000492.3:c.3731G>A, NM_000492.3:c.3744delA, NM_000492.3:c.3747delG, NM_000492.3:c.3752G>A, NM_000492.3:c.3761T>G, NM_000492.3:c.3763T>C, NM_000492.3:c.3764C>A, NM_000492.3:c.3773dupT, NM_000492.3:c.3846G>A, NM_000492.3:c.3848G>T, NM_000492.3:c.3873+1G>A, NM_000492.3:c.3873+2T>C, NM_000492.3:c.3883_3886delATTT, NM_000492.3:c.3883delA, NM_000492.3:c.3889dupT, NM_000492.3:c.3891dupT, NM_000492.3:c.3908delA, NM_000492.3:c.3909C>G, NM_000492.3:c.3937C>T, NM_000492.3:c.3971T>C, NM_000492.3:c.4036_4042delCTAAGCC, NM_000492.3:c.4046G>A, NM_000492.3:c.4077_4080delTGTTinsAA, NM_000492.3:c.4086dupT, NM_000492.3:c.4111G>T, NM_000492.3:c.4127_4131delTGGAT, NM_000492.3:c.4144C>T, NM_000492.3:c.4147dupA, NM_000492.3:c.4197_4198delCT, NM_000492.3:c.4231C>T, NM_000492.3:c.4234C>T, NM_000492.3:c.4242+1G>A, NM_000492.3:c.4242+1G>T, NM_000492.3:c.4251delA, NM_000492.3:c.4300_4301dupAG, NM_000492.3:c.4426C>T | Cystic fibrosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CFTR gene located on chromosomal region 7q31.2. The age of onset of severe form is neonatal or infantile but there are also variants associated with moderate clinical or late onset. This disease is characterized by the production of sweat with a high salt content, mucus secretions with an abnormal viscosity, chronic bronchitis, pancreatic insufficiency, adolescent diabetes and, more rarely, stercoral obstruction and cirrhosis. Male sterility is a constant feature. Late-onset forms, which are usually only mild or monosymptomatic. The prevalence is 1:10,000-9:10,000. | 600,25 |
| CHST6 | Macular corneal dystrophy | NM_021615.4 | NM_021615.4:c.853delC, NM_021615.4:c.820G>T, NM_021615.4:c.392C>A, NM_021615.4:c.327_328delCT | Macular corneal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CHST6 gene located on chromosomal region 16q22. The age of onset is variable. This disease is characterized by bilateral ill-defined cloudy regions within a hazy stroma, and eventually severe visual impairment. The prevalence is 1:100,000-9:100,000. | 600,25 |
| CLCN1 | Myotonia congenita, recessive | NM_000083.2 | NM_000083.2:c.180+3A>T, NM_000083.2:c.225dupC, NM_000083.2:c.409T>G, NM_000083.2:c.871G>A, NM_000083.2:c.1238T>G, NM_000083.2:c.1453A>G, NM_000083.2:c.2680C>T | Myotonia congenita follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLCN1 gene located on chromosomal region 7q35. The age of onset is neonatal/infantile. This is a nondystrophic skeletal muscle disorder characterized by muscle stiffness and an inability of the muscle to relax after voluntary contraction. Most patients have symptom onset in the legs, which later progresses to the arms, neck, and facial muscles. Many patients show marked hypertrophy of the lower limb muscles. The prevalence is 1:100,000. | 600,25 |
| CLDN19 | Rena hypomagnesemia type 5, with ocular involvement | NM_148960.2 | NM_148960.2:c.425_437delCCCTGGTGACCCA, NM_148960.2:c.269T>C, NM_148960.2:c.169C>G, NM_148960.2:c.59G>A | Renal hypomagnesemia type 5, with ocular involvement follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLDN19 gene located on chromosomal region 1p34.2. The age of onset is infantile. This disease is characterized by excessive magnesium and calcium renal wasting, bilateral nephrocalcinosis, progressive renal failure and severe ocular abnormalities. The prevalence is <1:1,000,000. | 600,25 |
| CLRN1 | Usher syndrome, type 3A | NM_001195794.1 | NM_001195794.1:c.669_670insT, NM_001195794.1:c.630dupT, NM_001195794.1:c.189C>A, NM_001195794.1:c.144T>G, NM_001195794.1:c.118T>G, NM_001195794.1:c.92C>T | Usher syndrome type 3A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CLRN1 gene located on chromosomal region 3q25.1. The age of onset is neonatal/infantile. This disease is characterized by the association of sensorineural deafness with retinitis pigmentosa and progressive vision loss. The prevalence is 1:1.000.000- 9/1.000.000. | 600,25 |
| CNGA1 | Retinitis pigmentosa type 49 | NM_001142564.1 | NM_001142564.1:c.2179delA, NM_001142564.1:c.2134C>T, NM_001142564.1:c.1747C>T, NM_001142564.1:c.1166C>T, NM_001142564.1:c.1001G>A, NM_001142564.1:c.656+2T>C, NM_001142564.1:c.445G>T, NM_001142564.1:c.304dupA | Retinitis pigmentosa 49 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGA1 gene located on chromosomal region 4p12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000-5:10,000. | 600,25 |
| CNGB1 | Retinitis pigmentosa type 45 | NM_001297.4 | NM_001297.4:c.3462+1G>A, NM_001297.4:c.3425delT, NM_001297.4:c.3150delG, NM_001297.4:c.2762_2765delACGA, NM_001297.4:c.2653delG, NM_001297.4:c.2492+2T>G, NM_001297.4:c.1958-1G>A, NM_001297.4:c.1122-2A>T, NM_001297.4:c.952C>T, NM_001297.4:c.413-1G>A, NM_001297.4:c.218-2A>G | Retinitis pigmentosa 45 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB1 gene located on chromosomal region 16q13. The age of onset is variable. This disease is characterized by night blindness, peripheral visual field impairment and over time loss of central vision. The prevalence is 1:10,000 to 5:10,000. | 600,25 |
| CNGB3 | Achromatopsia type 3 | NM_019098.4 | NM_019098.4:c.2048_2049delCA, NM_019098.4:c.2011G>T, NM_019098.4:c.1148delC, NM_019098.4:c.1063C>T, NM_019098.4:c.893_897delCAAAA, NM_019098.4:c.887_896delCTTCTACAAA, NM_019098.4:c.886_890delACTTC, NM_019098.4:c.819_826delCAGACTCC, NM_019098.4:c.446_447insT | Achromatopsia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CNGB3 gene located on chromosomal region 8q21.3. The age of onset is neonatal/Infantile. This disease is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, and reduced or complete loss of color discrimination. Most individuals have complete form, with total lack of function in all three types of cones. Rarely, individuals have incomplete form, with similar, but generally less severe symptoms. The prevalence is 1/30,000-1/50,000. | 600,25 |
| COL17A1 | Epidermolysis bullosa, junctional, non-Herlitz type | NM_000494.3 | NM_000494.3:c.4319dupC, NM_000494.3:c.4003_4004delGG, NM_000494.3:c.3908G>A, NM_000494.3:c.3897_3900delATCT, NM_000494.3:c.3827dupC, NM_000494.3:c.3795delC, NM_000494.3:c.3676C>T, NM_000494.3:c.3277+1G>A, NM_000494.3:c.3067C>T, NM_000494.3:c.3043C>T, NM_000494.3:c.2965delA, NM_000494.3:c.2944_2947+1delGAAGG, NM_000494.3:c.2564T>G, NM_000494.3:c.2551+1G>T, NM_000494.3:c.2430_2431insCCGA, NM_000494.3:c.2383C>T, NM_000494.3:c.2336-1G>T, NM_000494.3:c.2336-2A>G, NM_000494.3:c.2228-3_2235delCAGGTCCTGCTinsTTG, NM_000494.3:c.1898G>A, NM_000494.3:c.1706delC, NM_000494.3:c.520_521delAG, NM_000494.3:c.433C>T | Epidermolysis bullosa, junctional, non-Herlitz type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL17A1 gene located on chromosomal region 10q24.3. The age of onset is neonatal/infantile. This disease is characterized by a generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement. | 600,25 |
| COL18A1 | Knobloch syndrome, type 1 | NM_130444.2 | NM_130444.2:c.1700_1701insGACGTGAAAGAGGGG, NM_130444.2:c.2240_2241insGACGTGAAAGAGGGG, NM_130444.2:c.3294_3295delAG, NM_130444.2:c.3502C>T, NM_130444.2:c.4072_4084delCCCCCAGGCCCAC, NM_130444.2:c.4214_4223delCAGGGCCCCC, NM_130444.2:c.4222_4223delCC, NM_130444.2:c.4323_4323+1delGG, NM_130444.2:c.4759_4760delCT, NM_130444.2:c.5168dupG | Knobloch syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL18A1 gene located on chromosomal region 21q22.3. The age of onset is neonatal/infantile. This disease is characterized by vitreoretinal and macular degeneration, and occipital encephalocele.ᅠThe prevalence is <1:1,000,000. | 600,25 |
| COL4A3 | Alport syndrome 3B, autosomal recessive | NM_000091.4 | NM_000091.4:c.345delG, NM_000091.4:c.898G>A, NM_000091.4:c.2083G>A, NM_000091.4:c.2111delC, NM_000091.4:c.2954G>T, NM_000091.4:c.4420_4424delCTTTT, NM_000091.4:c.4441C>T, NM_000091.4:c.4571C>G | Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn. | 600,25 |
| COL4A4 | Alport syndrome, autosomal recessive | NM_000092.4 | NM_000092.4:c.4923C>A, NM_000092.4:c.4129C>T, NM_000092.4:c.3713C>A, NM_000092.4:c.3601G>A, NM_000092.4:c.2312delG, NM_000092.4:c.71+1G>A | Alport syndrome, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL4A3 and COL4A4 genes located on chromosomal region 2q36.3. The age of onset is infantile. This disease is characterized by renal, cochlear, and ocular involvement. Renal disease progresses from microscopic hematuria to proteinuria, progressive renal insufficiency, and end-stage renal disease. Progressive sensorineural hearing loss is usually present by late childhood or early adolescence. Ocular findings include anterior lenticonus, maculopathy, corneal endothelial vesicles, and recurrent corneal erosion. The prevalence is 1:50,000 newborn. | 600,25 |
| COL7A1 | Epidermolysis bullosa dystrophica, AR | NM_000094.3 | NM_000094.3:c.8524_8527+10delGAAGGTGAGGACAG, NM_000094.3:c.8479C>T, NM_000094.3:c.8440C>T, NM_000094.3:c.8393T>A, NM_000094.3:c.8245G>A, NM_000094.3:c.7957G>A, NM_000094.3:c.7930-1G>C, NM_000094.3:c.7912G>T, NM_000094.3:c.7411C>T, NM_000094.3:c.7345-1G>A, NM_000094.3:c.6946G>A, NM_000094.3:c.6859G>A, NM_000094.3:c.6752G>A, NM_000094.3:c.6670G>T, NM_000094.3:c.6573+1G>T, NM_000094.3:c.6527dupC, NM_000094.3:c.6205C>T, NM_000094.3:c.6187C>T, NM_000094.3:c.6091G>A, NM_000094.3:c.5821-1G>A, NM_000094.3:c.5532+1G>A, NM_000094.3:c.5287C>T, NM_000094.3:c.5096C>T, NM_000094.3:c.5052+1G>A, NM_000094.3:c.4888C>T, NM_000094.3:c.4783G>C, NM_000094.3:c.4373C>T, NM_000094.3:c.4119+1G>T, NM_000094.3:c.4039G>C, NM_000094.3:c.3831+1G>T, NM_000094.3:c.2471dupG, NM_000094.3:c.933C>A, NM_000094.3:c.887delG, NM_000094.3:c.706C>T, NM_000094.3:c.425A>G, NM_000094.3:c.336C>G | Epidermolysis bullosa dystrophica follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COL7A1 gene located on chromosomal region 3p21.1. The age of onset is neonatal/infantile. This disease is characterized by generalized cutaneous and mucosal blistering and scarring associated with severe deformities and major extracutaneous involvement. The prevalence is <1:1,000,000. | 600,25 |
| COQ2 | Primary coenzyme Q10 deficiency, type 1 | NM_015697.7 | NM_015697.7:c.1197delT, NM_015697.7:c.890A>G, NM_015697.7:c.723delT, NM_015697.7:c.683A>G, NM_015697.7:c.590G>A | Primary coenzyme Q10 deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ2 gene located on chromosomal region 4q21.23. The age of onset is neonatal/infantile. The phenotypes include an encephalomyopathic form with seizures and ataxia; a multisystem infantile form with encephalopathy, cardiomyopathy and renal failure; a predominantly cerebellar form with ataxia and cerebellar atrophy; Leigh syndrome with growth retardation; and an isolated myopathic form. | 600,25 |
| COQ8A | Primary coenzyme Q10 deficiency, type 4 | NM_020247.4 | NM_020247.4:c.589-3C>G, NM_020247.4:c.637C>T, NM_020247.4:c.815G>A, NM_020247.4:c.815G>T, NM_020247.4:c.911C>T, NM_020247.4:c.1541A>G, NM_020247.4:c.1645G>A, NM_020247.4:c.1651G>A, NM_020247.4:c.1750_1752delACC, NM_020247.4:c.1813dupG | Primary coenzyme Q10 deficiency type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the COQ8A gene located on chromosomal region 1q42.13. The age of onset is infantile. This disease is characterized by progressive ataxia, cerebellar atrophy, and often exercise intolerance with elevated lactate levels and mild intellectual deficit. | 600,25 |
| CPT2 | Carnitine palmitoyltransferase type 2 deficiency, lethal neonatal | NM_000098.2 | NM_000098.2:c.149C>A, NM_000098.2:c.338C>T, NM_000098.2:c.359A>G, NM_000098.2:c.370C>T, NM_000098.2:c.452G>A, NM_000098.2:c.464dupT, NM_000098.2:c.520G>A, NM_000098.2:c.638A>G, NM_000098.2:c.680C>T, NM_000098.2:c.725_726delAC, NM_000098.2:c.886C>T, NM_000098.2:c.1148T>A, NM_000098.2:c.1237C>T, NM_000098.2:c.1239_1240delGA, NM_000098.2:c.1369A>T, NM_000098.2:c.1437C>G, NM_000098.2:c.1784delC, NM_000098.2:c.1883A>C, NM_000098.2:c.1891C>T | Carnitine palmitoyltransferase deficiency, type 2, lethal neonatal form follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CPT2 gene located on chromosomal region 1p32. The age of onset is neonatal/infantile. This disease is characterized by a severe fasting intolerance leading to metabolic derangements of hypoketotic hypoglycemia, resulting in coma and seizures, and hepatic encephalopathy leading to liver failure.ᅠThe prevalence is <1:1,000,000. | 600,25 |
| CRB1 | Retinitis pigmentosa type 12, AR; Leber congenital amaurosis type 8 | NM_201253.2 | NM_201253.2:c.498_506delAATTGATGG, NM_201253.2:c.613_619delATAGGAA, NM_201253.2:c.2290C>T, NM_201253.2:c.2401A>T, NM_201253.2:c.2416G>T, NM_201253.2:c.2688T>A, NM_201253.2:c.2983G>T, NM_201253.2:c.3055_3059dupTATAT, NM_201253.2:c.3122T>C, NM_201253.2:c.3299T>C, NM_201253.2:c.3299T>G, NM_201253.2:c.3383delT, NM_201253.2:c.3419T>A, NM_201253.2:c.3997G>T | Retinitis pigmentosa type 12 and leber congenital amaurosis type 8 follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the CRB1 gene located on chromosomal region 1q31-q32.1. Retinitis pigmentosa type 12 is characterized by night blindness, peripheral visual field impairment and over time loss of central visionm, and its prevalence is 1-5:10,000. Leber congenital amaurosis, with a neonatal/infantile age of onset, comprises a group of early-onset childhood retinal dystrophies characterized by vision loss, nystagmus, and severe retinal dysfunction. Patients usually present at birth with profound vision loss and pendular nystagmus. Other clinical findings of this disease may include high hypermetropia, photodysphoria, oculodigital sign, keratoconus, cataracts, and a variable appearance to the fundus. | 600,25 |
| CTNS | Cystinosis (atypical/juvenile/ocular) nephropathic | NM_001031681.2 | NM_001031681.2:c.283G>T, NM_001031681.2:c.329G>T, NM_001031681.2:c.357_360delCAGC, NM_001031681.2:c.397_398delAT, NM_001031681.2:c.414G>A, NM_001031681.2:c.416C>T, NM_001031681.2:c.506G>A, NM_001031681.2:c.589G>A, NM_001031681.2:c.646dupA, NM_001031681.2:c.853-3C>G, NM_001031681.2:c.1015G>A | Nephropathic cystinosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTNS gene located on chromosomal region 17p13. The age of onset is neonatal/infantile. This disease is characterized by hypothyroidism, insulin-dependent diabetes, hepatosplenomegaly with portal hypertension, and muscle, cerebral and ocular involvement, caused by cystine deposits in various organs. The prevalence is 1:100,000-1:200,000. | 600,25 |
| CTSK | Pycnodysostosis | NM_000396.3 | NM_000396.3:c.926T>C, NM_000396.3:c.721C>T, NM_000396.3:c.436G>C, NM_000396.3:c.236G>A, NM_000396.3:c.154A>T | Pycnodysostosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CTSK gene located on chromosomal region 1q21. The age of onset is variable. This disease is characterized by osteosclerosis, short stature or dwarfism, acroosteolysis of the distal phalanges, fragile bones associated with spontaneous fractures and dysplasia of the clavicles. The prevalence is 1/1,000,000 to 9/1,000,000. | 600,25 |
| CYP4V2 | Bietti crystalline corneoretinal dystrophy | NM_207352.3 | NM_207352.3:c.130T>A, NM_207352.3:c.327+1G>A, NM_207352.3:c.332T>C, NM_207352.3:c.1523G>A | Bietti crystalline corneoretinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP4V2 gene located on chromosomal region 4q35.2. The age of onset is adult. This disease is characterized by nightblindness, decreased vision, paracentral scotoma, and, in the end stages of the disease, legal blindness. | 600,25 |
| CYP7B1 | Spastic paraplegia type 5A, autosomal recessive | NM_004820.4 | NM_004820.4:c.1460dupT, NM_004820.4:c.1456C>T, NM_004820.4:c.1162C>T, NM_004820.4:c.889A>G, NM_004820.4:c.825T>A, NM_004820.4:c.321_324delACAA, NM_004820.4:c.187C>T | Spastic paraplegia type 5A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the CYP7B1 gene located on chromosomal region 8q21.3. The age of onset is neonatal/infantile. This disease is characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. The prevalence is below 1,000,000. | 600,25 |
| D2HGDH | D-2-hydroxyglutaric aciduria | NM_152783.4 | NM_152783.4:c.440T>G, NM_152783.4:c.1123G>T, NM_152783.4:c.1315A>G, NM_152783.4:c.1331T>C, NM_152783.4:c.1333_1334delAC | D-2-Hydroxyglutaric aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the D2HGDH gene located on chromosomal region 2q37.3. The age of onset is variable. This disease is characterized by extremely variable clinical manifestations, with severe cases characterized by neonatal or early infantile-onset epileptic encephalopathy, and marked hypotonia, and cerebral visual failure, developmental delay, seizures, involuntary movements, and cardiomyopathy are also common in these cases. The prevalence is below 1,000,000. | 600,25 |
| DBT | Maple syrup urine disease, type 2 | NM_001918.3 | NM_001918.3:c.1281+1G>A, NM_001918.3:c.939G>C, NM_001918.3:c.901C>T, NM_001918.3:c.871C>T, NM_001918.3:c.827T>G, NM_001918.3:c.772+1G>A, NM_001918.3:c.670G>T, NM_001918.3:c.581C>G, NM_001918.3:c.294C>G, NM_001918.3:c.272_275delCAGT, NM_001918.3:c.126T>G | Maple syrup urine disease, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DBT gene located on chromosomal region 1p21.2. The age of onset in neonatal/infantil. This disease is characterized by a maple syrup odor to the urine, deficient diet, lethargy and focal dystonia, followed by progressive encephalopathy and central respiratory failure if not treated. The prevalence is 1-5/10,000. | 600,25 |
| DCLRE1C | Omenn syndrome; Severe combined immunodeficiency, Athabascan type | NM_001033855.2 | NM_001033855.2:c.1639G>T, NM_001033855.2:c.1558dupA, NM_001033855.2:c.780+1delG, NM_001033855.2:c.597C>A, NM_001033855.2:c.2T>C | Omenn syndrome and Athabascan type severe combined immunodeficiency follow an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the DCLRE1C gene located on chromosomal region 10p13. Omenn syndrome has an early age of onset and it is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. The age of onset of Athabascan type severe combined immunodeficiency is neonatal/infantile and it is characterized by severe and recurrent infections, diarrhea, failure to thrive, and cell sensitivity to ionizing radiation. The prevalence is 1-9/1,000,000. | 600,25 |
| DGUOK | DGUOK-related mitochondrial DNA depletion syndrome | NM_080916.2 | NM_080916.2:c.137A>G, NM_080916.2:c.313C>T, NM_080916.2:c.425G>A, NM_080916.2:c.494A>T, NM_080916.2:c.707+2T>G, NM_080916.2:c.763G>T | Mitochondrial DNA depletion syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DGUOK gene located on chromosomal region 2p13. The age of onset is neonatal/infantile. This disease is characterized by progressive liver failure, hypoglycemia and neurologic abnormalities including hypotonia, encephalopathy and peripheral neuropathy | 600,25 |
| DHCR7 | Smith-Lemli-Opitz syndrome | NM_001163817.1 | NM_001163817.1:c.1342G>A, NM_001163817.1:c.1337G>A, NM_001163817.1:c.1228G>A, NM_001163817.1:c.1210C>T, NM_001163817.1:c.1055G>A, NM_001163817.1:c.1054C>T, NM_001163817.1:c.976G>T, NM_001163817.1:c.964-1G>C, NM_001163817.1:c.907G>A, NM_001163817.1:c.866C>T, NM_001163817.1:c.841G>A, NM_001163817.1:c.839A>G, NM_001163817.1:c.832-1G>C, NM_001163817.1:c.744G>T, NM_001163817.1:c.730G>A, NM_001163817.1:c.725G>A, NM_001163817.1:c.724C>T, NM_001163817.1:c.506C>T, NM_001163817.1:c.461C>G, NM_001163817.1:c.453G>A, NM_001163817.1:c.452G>A, NM_001163817.1:c.356A>T, NM_001163817.1:c.292C>T, NM_001163817.1:c.278C>T, NM_001163817.1:c.151C>T, NM_001163817.1:c.1A>G | Smith-Lemli-Opitz syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DHCR7 gene located on chromosomal region 11q13.4. The age of onset is neonatal/infantile. This disease is characterized by multiple congenital anomalies, intellectual deficit, and behavioral problems.ᅠThe prevalence is 1/20,000 to 1/40,000 newborn. | 600,25 |
| DPYD | Dihydropyrimidine dehydrogenase deficiency | NM_000110.3 | NM_000110.3:c.1905+1G>A, NM_000110.3:c.1679T>G, NM_000110.3:c.1109_1110delTA, NM_000110.3:c.299_302delTCAT | Dihydropyrimidine dehydrogenase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DPYD gene located on chromosomal region 1p22. This disease shows large phenotypic variability, ranging from no symptoms to a convulsive disorder with motor and mental retardation in homozygous patients. In people with severe dihydropyrimidine dehydrogenase deficiency, the disorder becomes apparent in infancy. These affected individuals have recurrent seizures (epilepsy), intellectual disability, a small head size (microcephaly), increased muscle tone (hypertonia), delayed development of motor skills such as walking, and autistic behaviors that affect communication and social interaction. The prevalence is unknow. In addition, homozygous and heterozygous mutation carriers can develop severe toxicity after the administration of the antineoplastic drug 5-fluorouracil (5FU). | 600,25 |
| DSP | Cardiomyopathy, dilated, with woolly hair and keratoderma; Epidermolysis bullosa, lethal acantholytic | NM_004415.3 | NM_004415.3:c.3098delA, NM_004415.3:c.5800C>T, NM_004415.3:c.6370_6371delCT, NM_004415.3:c.7000C>T, NM_004415.3:c.7180_7181delAG, NM_004415.3:c.8188C>T | Dilated cardiomyopathy with woolly hair and keratoderma, known as Carvajal syndrome, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DSP gene located on chromosomal region 6p24. The age of onset is neonatal/infantile. This disease is characterized by woolly hair is present at birth and the palmoplantar keratoderma appears during the first year of life. The cardiac anomaly presents during childhood and is marked by dilation of the left ventricle accompanied by alterations in muscle contractility. The dilated cardiomyopathy may lead to life-threatening congestive heart failure and death. The prevalence is below 1,000,000. Furthermore, mutations in the DSP gene have been identified in people with an autosomal recessive disorder called lethal acantholytic epidermolysis bullosa. Features of this condition include very fragile skin that blisters and detaches easily, a complete absence of hair (alopecia), abnormal or missing fingernails, teeth that are present from birth (neonatal teeth), and abnormalities of the heart muscle (cardiomyopathy). The skin abnormalities lead to a severe loss of fluids and death in early infancy. | 600,25 |
| DYSF | Miyoshi muscular dystrophy, type 1; Muscular dystrophy, limb-girdle, autosomal recessive, type 2 | NM_001130978.1 | NM_001130978.1:c.1481-1G>A | Miyoshi muscular dystrophy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is young adulthood. This disease is characterized by weakness and atrophy in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000. Mutations in the DYSF gene can also cause muscular dystrophy, limb-girdle, autosomal recessive, type 2. This disease is characterized by an onset in late adolescence or early adulthood of slowly progressive, proximal weakness and atrophy of shoulder and pelvic girdle muscles. Cardiac and respiratory muscles are not involved. Hypertrophy of the calf muscles and highly elevated serum creatine kinase levels are frequently observed. | 600,25 |
| DYSF | Miyoshi muscular dystrophy, type 1; Muscular dystrophy, limb-girdle, autosomal recessive, type 2 | NM_001130987.1 | NM_001130987.1:c.203_204delTGinsAT, NM_001130987.1:c.396_397delCC, NM_001130987.1:c.706C>T, NM_001130987.1:c.759+1G>C, NM_001130987.1:c.797G>A, NM_001130987.1:c.853C>T, NM_001130987.1:c.991G>A, NM_001130987.1:c.991G>T, NM_001130987.1:c.1033+1G>A, NM_001130987.1:c.1149+1G>A, NM_001130987.1:c.1372G>A, NM_001130987.1:c.1380+2T>C, NM_001130987.1:c.1464C>A, NM_001130987.1:c.1488dupA, NM_001130987.1:c.1494-2A>G, NM_001130987.1:c.1494-1G>A, NM_001130987.1:c.1609G>A, NM_001130987.1:c.1674delA, NM_001130987.1:c.1692+2T>A, NM_001130987.1:c.1717C>T, NM_001130987.1:c.1867C>T, NM_001130987.1:c.1888C>T, NM_001130987.1:c.1927G>T, NM_001130987.1:c.2924_2928delAGACC, NM_001130987.1:c.2923C>T, NM_001130987.1:c.3051G>T, NM_001130987.1:c.3095A>G, NM_001130987.1:c.3166C>T, NM_001130987.1:c.3229-2A>T, NM_001130987.1:c.3498_3499delTGinsAA, NM_001130987.1:c.3531C>A, NM_001130987.1:c.3532C>T, NM_001130987.1:c.3695delC, NM_001130987.1:c.3762delA, NM_001130987.1:c.3859G>T, NM_001130987.1:c.3957+1delG, NM_001130987.1:c.4011delC, NM_001130987.1:c.4144C>T, NM_001130987.1:c.4162_4163delGT, NM_001130987.1:c.4307G>A, NM_001130987.1:c.4873C>T, NM_001130987.1:c.4989_4993delGCCCGinsCCCC, NM_001130987.1:c.5194C>T, NM_001130987.1:c.5318A>G, NM_001130987.1:c.5383C>T, NM_001130987.1:c.5458-2A>C, NM_001130987.1:c.5546G>A, NM_001130987.1:c.5546+1G>T, NM_001130987.1:c.5614G>T, NM_001130987.1:c.5626G>A, NM_001130987.1:c.5642+1G>A, NM_001130987.1:c.5711delG, NM_001130987.1:c.5761C>T, NM_001130987.1:c.5815_5816delAG, NM_001130987.1:c.5830C>T, NM_001130987.1:c.5953_5956delCAGC, NM_001130987.1:c.6096dupA, NM_001130987.1:c.6109G>T, NM_001130987.1:c.6241C>T | Miyoshi muscular dystrophy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the DYSF gene located on chromosomal region 2p13.3. The age of onset is young adulthood. This disease is characterized by weakness and atrophy in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and is associated with difficulties in standing on tip toes. The prevalence is 1/1,000,000 to 9/1,000,000. Mutations in the DYSF gene can also cause muscular dystrophy, limb-girdle, autosomal recessive, type 2. This disease is characterized by an onset in late adolescence or early adulthood of slowly progressive, proximal weakness and atrophy of shoulder and pelvic girdle muscles. Cardiac and respiratory muscles are not involved. Hypertrophy of the calf muscles and highly elevated serum creatine kinase levels are frequently observed. | 600,25 |
| EDA | Ectodermal dysplasia, type 1, hypohidrotic, X-linked | NM_001399.4 | NM_001399.4:c.181T>C, NM_001399.4:c.183C>G, NM_001399.4:c.187G>A, NM_001399.4:c.463C>T, NM_001399.4:c.466C>T, NM_001399.4:c.467G>A, NM_001399.4:c.573_574insT, NM_001399.4:c.671G>C, NM_001399.4:c.826C>T, NM_001399.4:c.1045G>A | Hypohidrotic ectodermal dysplasia, type 1, hypohidrotic, X-linked follows an X-linked pattern of inheritance and is caused by pathogenic variants in the EDA gene located on chromosomal region Xq12-q13.1. The age of onset is neonatal/infantile. This disease is characterized by malformation of ectodermal structures such as skin, hair, teeth and sweat glands. The prevalence is 1/5,000 to 1/10,000 newborns. | 600,25 |
| ERCC2 | Trichothiodystrophy, type 1 | NM_000400.3 | NM_000400.3:c.2230_2233dupCTAG, NM_000400.3:c.2176C>T, NM_000400.3:c.2047C>T, NM_000400.3:c.1972C>T, NM_000400.3:c.1703_1704delTT, NM_000400.3:c.1621A>C, NM_000400.3:c.1454T>C, NM_000400.3:c.1381C>G, NM_000400.3:c.1354C>T, NM_000400.3:c.1308-1G>A, NM_000400.3:c.950-2A>G, NM_000400.3:c.949+1G>A, NM_000400.3:c.719-1G>A, NM_000400.3:c.567G>A, NM_000400.3:c.183+2T>A | Trichothiodystrophy (TTD), type 1 is a heterogeneous group of disorders that follows an autosomal recessive pattern of inheritance. It is caused by pathogenic variants in the ERCC2 gene located on chromosomal region 19q13.32. The age of onset is neonatal or infantile. This disease, with variable clinical expression, is characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. About half of the patients with TTD exhibit marked photosensitivity. | 600,25 |
| ERCC5 | Cerebrooculofacioskeletal syndrome, type 3 | NM_000123.3 | NM_000123.3:c.88+2T>C, NM_000123.3:c.215C>A, NM_000123.3:c.381-2A>G, NM_000123.3:c.406C>T, NM_000123.3:c.464dupA, NM_000123.3:c.526C>T, NM_000123.3:c.787C>T, NM_000123.3:c.2144dupA, NM_000123.3:c.2375C>T, NM_000123.3:c.2573T>C, NM_000123.3:c.2751delA | Cerebrooculofacioskeletal syndrome type 3, also known as COFS syndrome, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC5 gene located on chromosomal region 13q33.1. COFS syndrome is characterized by prenatal onset of arthrogryposis, microcephaly and growth failure. Postnatal features include severe developmental delay, congenital cataracts (in some), and marked UV sensitivity of the skin. Survival beyond 6 years of age is rare. The prevalence is below 1/1,000,000. | 600,25 |
| ERCC6 | Cockayne syndrome, type B; Cerebrooculofacioskeletal syndrome, type 1 | NM_000124.3 | NM_000124.3:c.3862C>T, NM_000124.3:c.3591_3592dupGA, NM_000124.3:c.2587C>T, NM_000124.3:c.2203C>T, NM_000124.3:c.2047C>T, NM_000124.3:c.1550G>A, NM_000124.3:c.1357C>T, NM_000124.3:c.422+1G>A, NM_000124.3:c.207dupG, NM_000124.3:c.48_49delCT | Cockayne syndrome (CS), type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ERCC6 gene located on chromosomal region 10q11.23. The age of onset is variable. This disease is characterized by short stature, a characteristic facial appearance, premature aging, photosensitivity, progressive neurological dysfunction, and intellectual deficit. Mutations in the ERRC6 gene have been also found in patients with COFS syndrome type 1, an extreme prenatal form of the CS clinical spectrum. This autosomal recessive progressive neurodegenerative disorder is characterized by microcephaly, congenital cataracts, severe mental retardation, facial dysmorphism, and arthrogryposis. | 600,25 |
| EYS | Retinitis pigmentosa, type 25 | NM_001292009.1 | NM_001292009.1:c.9468T>A, NM_001292009.1:c.9362_9365delCTCA, NM_001292009.1:c.9099delT, NM_001292009.1:c.8711_8718delCATGCAGA, NM_001292009.1:c.8692_8695dupACAG, NM_001292009.1:c.8632G>T, NM_001292009.1:c.8471dupA, NM_001292009.1:c.7822C>T, NM_001292009.1:c.7095T>G, NM_001292009.1:c.6170delA, NM_001292009.1:c.6102dupT, NM_001292009.1:c.5928-2A>G, NM_001292009.1:c.5857G>T, NM_001292009.1:c.5757dupT, NM_001292009.1:c.4462_4469dupAGCCCCTC, NM_001292009.1:c.4350_4356delTATAGCT, NM_001292009.1:c.4120C>T, NM_001292009.1:c.4045C>T, NM_001292009.1:c.2826_2827delAT, NM_001292009.1:c.1211dupA, NM_001292009.1:c.571dupA, NM_001292009.1:c.490C>T, NM_001292009.1:c.232delT, NM_001292009.1:c.103C>T | Retinitis pigmentosa, type 25 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the EYS gene located on chromosomal region 6q12. The age of onset is variable. This disease is characterized by night blindness (nyctalopia), peripheral visual field impairment and over time loss of central vision. The prevalence is 1/10,000 to 5/10,000. | 600,25 |
| F11 | Factor XI deficiency, autosomal recessive | NM_000128.3 | NM_000128.3:c.166T>C, NM_000128.3:c.403G>T, NM_000128.3:c.438C>A, NM_000128.3:c.595+3A>G, NM_000128.3:c.901T>C, NM_000128.3:c.1211C>A, NM_000128.3:c.1613C>T, NM_000128.3:c.1693G>A | Factor XI deficiency, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the F11 gene located on chromosomal region 4q35. The age of onset is variable. This disease is characterized by reduced levels and activity of factor XI resulting in moderate bleeding symptoms, usually occurring after trauma or surgery. The prevalence is 1/1,000,000 to 9/1,000,000. | 600,25 |
| F9 | Hemophilia B | NM_000133.3 | NM_000133.3:c.82T>C, NM_000133.3:c.1031T>C, NM_000133.3:c.1136G>A, NM_000133.3:c.1150C>T | Hemophilia B follows an X-linked pattern of inheritance and is caused by pathogenic variants in the F9 gene located on chromosomal region Xq27.1-q27.2. The age of onset is neonatal/infantile. This disease is characterized by spontaneous or prolonged hemorrhages due to factor IX deficiency. The prevalence is 1/100,000 to 9/100,000. | 600,25 |
| FAH | Tyrosinemia, type 1 | NM_000137.2 | NM_000137.2:c.47A>T, NM_000137.2:c.192G>T, NM_000137.2:c.401C>A, NM_000137.2:c.456G>A, NM_000137.2:c.554-1G>T, NM_000137.2:c.707-1G>A, NM_000137.2:c.782C>T, NM_000137.2:c.786G>A, NM_000137.2:c.837+1G>A, NM_000137.2:c.939delC, NM_000137.2:c.982C>T, NM_000137.2:c.1009G>A, NM_000137.2:c.1027G>T, NM_000137.2:c.1062+5G>A, NM_000137.2:c.1069G>T, NM_000137.2:c.1090G>T, NM_000137.2:c.1141A>G | Tyrosinemia, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FAH gene located on chromosomal region 15q25.1. The age of onset is variable. This disease is characterized by progressive liver disease, renal tubular dysfunction, porphyria-like crises and a dramatic improvement in prognosis following treatment with nitisinone. The birth incidence is 1/100,000, notably in Qu�bec, Canada, and the prevalence is 1/100,000 to 1/120,000 newborns. | 600,25 |
| FANCA | Fanconi anemia, complementation group A | NM_000135.2 | NM_000135.2:c.4130C>G, NM_000135.2:c.3788_3790delTCT, NM_000135.2:c.3763G>T, NM_000135.2:c.3558dupG, NM_000135.2:c.2303T>C, NM_000135.2:c.1115_1118delTTGG, NM_000135.2:c.233_236delTTGA, NM_000135.2:c.131dupA | Fanconi anemia, complementation group A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCA gene located on chromosomal region 16q24.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 600,25 |
| FANCC | Fanconi anemia, complementation group C | NM_000136.2 | NM_000136.2:c.1642C>T, NM_000136.2:c.1487T>G, NM_000136.2:c.1103_1104delTG, NM_000136.2:c.1015delA, NM_000136.2:c.996+1G>T, NM_000136.2:c.67delG, NM_000136.2:c.37C>T | Fanconi anemia, complementation group C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCC gene located on chromosomal region 9q22.3. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 600,25 |
| FANCG | Fanconi anemia, complementation group G | NM_004629.1 | NM_004629.1:c.1852_1853delAA, NM_004629.1:c.1795_1804delTGGATCCGTC, NM_004629.1:c.1480+1G>C, NM_004629.1:c.1077-2A>G, NM_004629.1:c.907_908dupCT, NM_004629.1:c.637_643delTACCGCC, NM_004629.1:c.510+1G>A, NM_004629.1:c.313G>T | Fanconi anemia, complementation group G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FANCG gene located on chromosomal region 9p13. The age of onset is infantile. This disease is characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors. The prevalence is 1/1,000,000 to 9/1,000,000. | 600,25 |
| FGB | Congenital afibrinogenemia | NM_005141.4 | NM_005141.4:c.1148T>G, NM_005141.4:c.1289G>A | Congenital afibrinogenemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FGB gene located on chromosomal region 4q28. The age of onset is variable. This disease is characterized by bleeding symptoms ranging from mild to severe resulting from reduced quantity and/or quality of circulating fibrinogen. The prevalence is 1/1,000,000 to 9/1,000,000. | 600,25 |
| FIG4 | Charcot-Marie-Tooth disease, type 4J; Yunis-Varon syndrome | NM_014845.5 | NM_014845.5:c.122T>C, NM_014845.5:c.311G>A, NM_014845.5:c.501C>G, NM_014845.5:c.547C>T, NM_014845.5:c.592C>T, NM_014845.5:c.737G>A, NM_014845.5:c.831_838delTAAATTTG, NM_014845.5:c.2299dupG | Charcot-Marie-Tooth disease, type 4J follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FIG4 gene located on chromosomal region 6q.21. The age of onset is neonatal/infantile. This disease is characterized by rapidly progressive, asymmetric motor neuron degeneration with slow nerve conduction velocities, weakness and paralysis, without sensory loss. The prevalence is 4/100,000 to 8/100,000. Mutations in the FIG4 gene have been also found in patient with Yunis-Varon syndrome. This disease is a severe autosomal recessive disorder characterized by skeletal defects, including cleidocranial dysplasia and digital anomalies, and severe neurologic involvement with neuronal loss. Enlarged cytoplasmic vacuoles are found in neurons, muscle, and cartilage. The disorder is usually lethal in infancy. | 600,25 |
| FKRP | Muscular dystrophy-dystroglycanopathy, type 5A, 5B and 5C | NM_001039885.2 | NM_001039885.2:c.160C>T, NM_001039885.2:c.1154C>A, NM_001039885.2:c.1343C>T, NM_001039885.2:c.1387A>G | Muscular dystrophy-dystroglycanopathy type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the FKRP gene located on chromosomal region 19q13.32. The age of onset is neonatal or early infancy. There are three subtypes of dystroglycanopathies related to FKRP gene: subtype 5A, 5B and 5C. Subtype 5A is the most severe phenotype and is associated with congenital brain and eye anomalies, cobblestone lissencephaly, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Subtype 5B represents an intermediate phenotype with or without congenital mental retardation, white matter changes and structural brain abnormalities. Finally, subtype 5C is the less severe phenotype characterized by limb-girdle muscular dystrophy, variable age at onset, normal cognition, and no structural brain changes. | 600,25 |
| FMR1 | Fragile X syndrome | -0 | (CGG)n pre-mutated allele | Fragile X syndrome follows an X-linked pattern of inheritance and is caused by pathogenic variants in the FMR1 gene located on chromosomal region Xq27.3. The symptoms are variable depending on the range of CGG triplet expansion. In complete mutation the onset is infantile in men and is characterized by intellectual disability, characteristic appearance (large head, long face, prominent forehead and chin, protruding ears) joint laxity and large testes after puberty. In carrier female, the symptoms are milder and include primary ovarian insufficiency. The prevalence is 1/2,500 (full mutation allele) to 1/4,000 (prevalence of symptomatic cases) for both genders. | 600,25 |
| FRAS1 | Fraser syndrome, type 1 | NM_025074.6 | NM_025074.6:c.835_838delGTGT, NM_025074.6:c.3799C>T, NM_025074.6:c.5605_5606insT, NM_025074.6:c.6433C>T, NM_025074.6:c.6991_6992insGG, NM_025074.6:c.7813C>T, NM_025074.6:c.11160_11167delGCTGGAGA | Fraser syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the gene FRAS1 located on chromosomal region 4q21.21. The age of onset is early infancy. Twenty-five per cent of affected infants are stillborn, while 20 % die before the age of 1 year. This disease is characterized mainly by cryptophthalmos and syndactyly, besides urinary and genital anormalities. The prevalence is <1:1,000,000. | 600,25 |
| G6PC | Glycogen storage disease, type 1A | NM_000151.3 | NM_000151.3:c.113A>T, NM_000151.3:c.229T>C, NM_000151.3:c.230+1G>C, NM_000151.3:c.247C>T, NM_000151.3:c.248G>A, NM_000151.3:c.370G>A, NM_000151.3:c.379_380dupTA, NM_000151.3:c.447-1G>A, NM_000151.3:c.497T>G, NM_000151.3:c.508C>T, NM_000151.3:c.562G>C, NM_000151.3:c.883C>T, NM_000151.3:c.1039C>T | Glycogen storage disease, type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000. | 600,25 |
| G6PC | Glycogen storage disease, type 1A | NM_001270397.1 | NM_001270397.1:c.474G>A | Glycogen storage disease, type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the G6PC gene located on chromosomal region 17q21.31. The age of onset is infantile. This disease is characterized by poor tolerance to fasting, significant hepatomegaly and growth retardation. The incidence is 1/100,000. | 600,25 |
| GALC | Krabbe disease | NM_000153.3 | NM_000153.3:c.2056T>C, NM_000153.3:c.1964delC, NM_000153.3:c.1814dupA, NM_000153.3:c.1796T>G, NM_000153.3:c.1723_1724insT, NM_000153.3:c.1700A>C, NM_000153.3:c.1695delT, NM_000153.3:c.1592G>A, NM_000153.3:c.1591C>T, NM_000153.3:c.1586C>T, NM_000153.3:c.1543G>A, NM_000153.3:c.1489+1_1489+2delGT, NM_000153.3:c.1488_1489+2delTGGT, NM_000153.3:c.1488_1489delTG, NM_000153.3:c.1472delA, NM_000153.3:c.1161+2T>G, NM_000153.3:c.1153G>T, NM_000153.3:c.953C>G, NM_000153.3:c.658C>T, NM_000153.3:c.655C>T, NM_000153.3:c.628A>T, NM_000153.3:c.582+1G>A, NM_000153.3:c.453G>A, NM_000153.3:c.430delA, NM_000153.3:c.388G>A, NM_000153.3:c.205C>T | Krabbe disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALC gene located on chromosomal region 14q31.3. There are two forms of the disease: infantile form (2-6 months onset) more severe and adult form less severe. It is a degenerative disorder that affects the nervous system characterized by a muscle stiffness, blindness, deafness, and eventually death. The incidence is 1/100,000-1/250,000 and the prevalence is 1/100,000. | 600,25 |
| GALT | Galactosemia | NM_000155.3 | NM_000155.3:c.18delC, NM_000155.3:c.41delCinsTT, NM_000155.3:c.71_72insA, NM_000155.3:c.113A>C, NM_000155.3:c.118G>T, NM_000155.3:c.130G>A, NM_000155.3:c.132delG, NM_000155.3:c.152G>A, NM_000155.3:c.158G>A, NM_000155.3:c.199C>T, NM_000155.3:c.203A>C, NM_000155.3:c.220_221delCT, NM_000155.3:c.221T>C, NM_000155.3:c.253-2A>G, NM_000155.3:c.265T>G, NM_000155.3:c.289_291delAAC, NM_000155.3:c.290A>G, NM_000155.3:c.292G>A, NM_000155.3:c.329-2A>C, NM_000155.3:c.367C>T, NM_000155.3:c.386T>C, NM_000155.3:c.400delT, NM_000155.3:c.404C>T, NM_000155.3:c.413C>T, NM_000155.3:c.425T>A, NM_000155.3:c.428C>T, NM_000155.3:c.445dupG, NM_000155.3:c.442C>T, NM_000155.3:c.443G>A, NM_000155.3:c.502_504delGTG, NM_000155.3:c.505C>A, NM_000155.3:c.508-1G>C, NM_000155.3:c.512T>C, NM_000155.3:c.547C>A, NM_000155.3:c.552C>A, NM_000155.3:c.563A>G, NM_000155.3:c.565_578delGTATGGGCCAGCAG, NM_000155.3:c.568T>C, NM_000155.3:c.580T>C, NM_000155.3:c.584T>C, NM_000155.3:c.598delC, NM_000155.3:c.601C>T, NM_000155.3:c.602G>A, NM_000155.3:c.607G>A, NM_000155.3:c.610C>T, NM_000155.3:c.619C>T, NM_000155.3:c.626A>G, NM_000155.3:c.634C>T, NM_000155.3:c.688-2A>C, NM_000155.3:c.692G>A, NM_000155.3:c.719_728delTAGTACTGGT, NM_000155.3:c.772C>T, NM_000155.3:c.775C>T, NM_000155.3:c.790delC, NM_000155.3:c.790_792delCTAinsTAG, NM_000155.3:c.820+13A>G, NM_000155.3:c.844C>G, NM_000155.3:c.855G>T, NM_000155.3:c.904+1G>T, NM_000155.3:c.905-2A>G, NM_000155.3:c.939G>A, NM_000155.3:c.947G>A, NM_000155.3:c.957C>A, NM_000155.3:c.985T>C, NM_000155.3:c.997C>G, NM_000155.3:c.997C>T, NM_000155.3:c.998G>A, NM_000155.3:c.1006A>T, NM_000155.3:c.1030C>A, NM_000155.3:c.1048delA, NM_000155.3:c.1052delC, NM_000155.3:c.1138T>C | Galactosemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GALT gene located on chromosomal region 9p13.3. The age of onset is neonatal. This disease is characterized by feeding difficulties, lethargy, and severe liver disease. Long-term complications appear including cognitive impairments, motor deficits, and ovarian dysfunction with reduced fertility in women and diminished bone density. The prevalence is 1/40,000-1/60,000. | 600,25 |
| GAN | Giant axonal neuropathy, type 1 | NM_022041.3 | NM_022041.3:c.413G>A, NM_022041.3:c.505G>A, NM_022041.3:c.601C>T, NM_022041.3:c.1268T>C, NM_022041.3:c.1429C>T, NM_022041.3:c.1447C>T, NM_022041.3:c.1456G>A | Giant axonal neuropathy, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GAN gene located on chromosomal region 16q23.2. The age of onset is infantile. This disease is characterized by a progressive motor and sensitive peripheral and central nervous system neuropathy. Twenty families have been reported with this disease but the frequency is likely to be under-estimated. | 600,25 |
| GBA | Gaucher disease | NM_000157.3 | NM_000157.3:c.1604G>A, NM_000157.3:c.1504C>T, NM_000157.3:c.1448T>G, NM_000157.3:c.1448T>C, NM_000157.3:c.1361C>G, NM_000157.3:c.1348T>A, NM_000157.3:c.1343A>T, NM_000157.3:c.1342G>C, NM_000157.3:c.1319C>T, NM_000157.3:c.1309G>T, NM_000157.3:c.1307T>C, NM_000157.3:c.1301G>C, NM_000157.3:c.1297G>T, NM_000157.3:c.1295G>T, NM_000157.3:c.1274dupA, NM_000157.3:c.1246G>A, NM_000157.3:c.1240G>T, NM_000157.3:c.1240G>C, NM_000157.3:c.1228C>G, NM_000157.3:c.1226A>G, NM_000157.3:c.1208G>C, NM_000157.3:c.1192C>T, NM_000157.3:c.1184C>T, NM_000157.3:c.1174C>G, NM_000157.3:c.1171G>C, NM_000157.3:c.1141T>G, NM_000157.3:c.1098dupA, NM_000157.3:c.1090G>A, NM_000157.3:c.1085C>T, NM_000157.3:c.1060G>C, NM_000157.3:c.1053G>T, NM_000157.3:c.1049A>G, NM_000157.3:c.1043C>T, NM_000157.3:c.914delC, NM_000157.3:c.586A>C, NM_000157.3:c.509G>T, NM_000157.3:c.508C>T, NM_000157.3:c.487delG, NM_000157.3:c.481C>T, NM_000157.3:c.476G>A, NM_000157.3:c.475C>T, NM_000157.3:c.431T>G, NM_000157.3:c.407C>A, NM_000157.3:c.354G>C, NM_000157.3:c.259C>T, NM_000157.3:c.254G>A, NM_000157.3:c.160G>T, NM_000157.3:c.115+1G>A, NM_000157.3:c.84dupG | Gaucher disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBA gene located on chromosomal region 1q22. Gaucher disease encompasses a continuum of clinical findings from a perinatal lethal disorder to an asymptomatic type. There are three major clinical types (1, 2, and 3) and two other subtypes (perinatal-lethal and cardiovascular). Type 1 is characterized by the presence of clinical or radiographic evidence of bone disease, hepatosplenomegaly, anemia and thrombocytopenia, lung disease, and the absence of primary central nervous system disease. GD types 2 and 3 are characterized by the presence of primary neurologic disease. Type 2 has an onset before age two years, limited psychomotor development, and a rapidly progressive course with death by age two to four years. Type 3 may have onset before age two years, but often have a more slowly progressive course, with survival into the third or fourth decade. The perinatal-lethal form is associated with ichthyosiform or collodion skin abnormalities or with nonimmune hydrops fetalis. The cardiovascular form is characterized by calcification of the aortic and mitral valves, mild splenomegaly, corneal opacities, and supranuclear ophthalmoplegia. Cardiopulmonary complications have been described with all the clinical subtypes, although varying in frequency and severity. The incidence is 1/60,000 and the prevalence is approximately 1/100,000. | 600,25 |
| GBE1 | Glycogen storage disease, type 4 | NM_000158.3 | NM_000158.3:c.2052+1G>A, NM_000158.3:c.1883A>G, NM_000158.3:c.1774G>T, NM_000158.3:c.1604A>G, NM_000158.3:c.1571G>A, NM_000158.3:c.1570C>T, NM_000158.3:c.1543C>T, NM_000158.3:c.986A>C, NM_000158.3:c.771T>A, NM_000158.3:c.466_470delCGTAT | Glycogen storage disease, type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GBE1 gene located on chromosomal region 3p12.2. The age of onset is infantile. This disease is characterized by failure to thrive; hepatomegaly, liver dysfunction, and progressive liver cirrhosis; hypotonia; cardiomyopathy and, finally, death. | 600,25 |
| GCDH | Glutaricaciduria, type 1 | NM_000159.3 | NM_000159.3:c.74C>A, NM_000159.3:c.271+1G>A, NM_000159.3:c.383G>A, NM_000159.3:c.416C>T, NM_000159.3:c.542A>G, NM_000159.3:c.572T>C, NM_000159.3:c.636-1G>A, NM_000159.3:c.680G>C, NM_000159.3:c.743C>T, NM_000159.3:c.751C>T, NM_000159.3:c.764C>T, NM_000159.3:c.769C>T, NM_000159.3:c.877G>A, NM_000159.3:c.883T>C, NM_000159.3:c.914C>T, NM_000159.3:c.1002_1003delGA, NM_000159.3:c.1060G>A, NM_000159.3:c.1093G>A, NM_000159.3:c.1168G>C, NM_000159.3:c.1198G>A, NM_000159.3:c.1199dupT, NM_000159.3:c.1204C>T, NM_000159.3:c.1244-2A>C, NM_000159.3:c.1247C>T, NM_000159.3:c.1262C>T | Glutaricaciduria, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GCDH gene located on chromosomal region 19p13.2. The age of onset is infantile or neonatal. This disease is characterized by encephalopathic crises resulting in striatal injury and a severe dystonic dyskinetic movement disorder. The prevalence is 1 in 100,000 births. | 600,25 |
| GJB2 | Deafness, autosomal recessive, type 1A | NM_004004.5 | NM_004004.5:c.617A>G, NM_004004.5:c.551G>C, NM_004004.5:c.550C>T, NM_004004.5:c.516G>A, NM_004004.5:c.465T>A, NM_004004.5:c.439G>A, NM_004004.5:c.427C>T, NM_004004.5:c.416G>A, NM_004004.5:c.402delG, NM_004004.5:c.365A>T, NM_004004.5:c.358_360delGAG, NM_004004.5:c.334_335delAA, NM_004004.5:c.313_326delAAGTTCATCAAGGG, NM_004004.5:c.310_323delAGGAAGTTCATCAA, NM_004004.5:c.299_300delAT, NM_004004.5:c.299A>T, NM_004004.5:c.270dupA, NM_004004.5:c.269dupT, NM_004004.5:c.269T>C, NM_004004.5:c.250G>T, NM_004004.5:c.250G>C, NM_004004.5:c.239A>C, NM_004004.5:c.238C>T, NM_004004.5:c.235delC, NM_004004.5:c.231G>A, NM_004004.5:c.230G>A, NM_004004.5:c.229T>C, NM_004004.5:c.169C>T, NM_004004.5:c.139G>T, NM_004004.5:c.132G>A, NM_004004.5:c.35delG | Autosomal recessive nonsyndromic sensorineural deafness type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB2 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment. No other associated medical findings are present. | 600,25 |
| GJB6 | Deafness, autosomal recessive, type 1B | NM_001110219.2 | NM_001110219.2:c.485dupA, NM_001110219.2:c.443delC, NM_001110219.2:c.383_384delTA, NM_001110219.2:c.261dupA, NM_001110219.2:c.169C>T, NM_001110219.2:c.14C>T | Autosomal recessive nonsyndromic sensorineural deafness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GJB6 gene located on chromosomal region 13q12.11. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment. No other associated medical findings are present. | 600,25 |
| GLB1 | GM1-gangliosidosis, type 1 | NM_001317040.1 | NM_001317040.1:c.1877A>G, NM_001317040.1:c.1790C>T, NM_001317040.1:c.1721dupG, NM_001317040.1:c.1693G>T, NM_001317040.1:c.1600_1610dupGGTGCATATAT, NM_001317040.1:c.1589G>A, NM_001317040.1:c.1514G>A, NM_001317040.1:c.1513C>T, NM_001317040.1:c.1499dupA, NM_001317040.1:c.1469G>A, NM_001317040.1:c.1465G>A, NM_001317040.1:c.1457G>A, NM_001317040.1:c.1318_1319delCT, NM_001317040.1:c.1212+1G>T, NM_001317040.1:c.1195C>T, NM_001317040.1:c.1148C>T, NM_001317040.1:c.1091A>G, NM_001317040.1:c.1045G>A, NM_001317040.1:c.962G>T, NM_001317040.1:c.766C>T, NM_001317040.1:c.746G>A, NM_001317040.1:c.745C>T, NM_001317040.1:c.735dupT, NM_001317040.1:c.601+2T>C, NM_001317040.1:c.586C>T, NM_001317040.1:c.586C>A, NM_001317040.1:c.582_584delTCT, NM_001317040.1:c.420G>A, NM_001317040.1:c.346C>T, NM_001317040.1:c.320G>A, NM_001317040.1:c.319C>T, NM_001317040.1:c.315C>G, NM_001317040.1:c.296T>C, NM_001317040.1:c.289C>T | Gangliosidosis GM1, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLB1 gene located on chromosomal region 3p22.3. Although the three types differ in severity, their features can overlap significantly. The age of onset in type 1 is infantile, in type 2 is late-infantile or juvenile and adult in type3. This disease is characterized by arrest/regression of neurological development, hypotonia, visceromegaly, macular cherry-red spots, dysostosis and coarse facial features. The prevalence is 1:100,000 a 200,000 newborn. | 600,25 |
| GLDC | Glycine encephalopathy | NM_000170.2 | NM_000170.2:c.2405C>T, NM_000170.2:c.2284G>A, NM_000170.2:c.2216G>A, NM_000170.2:c.1691G>T, NM_000170.2:c.1545G>C, NM_000170.2:c.1166C>T, NM_000170.2:c.322G>T | Glycine encephalopathy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in GLDC gene located on chromosomal region 9p24.1. The age of onset is neonatal/infantile. This disease is characterized by lethargy or even coma, hypotonia, hiccups, myoclonic jerks, and breathing/swallowing disorders, with subsequent intellectual deficit, spasticity and intractable seizures. The prevalence is 1:1,000,000-9:1,000,000. | 600,25 |
| GLE1 | Lethal congenital contracture syndrome, type 1 | NM_001003722.1 | NM_001003722.1:c.898-2A>G, NM_001003722.1:c.1412_1413delAG, NM_001003722.1:c.2051T>C, NM_001003722.1:c.2069_2072delTTCT | Lethal congenital contracture syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GLE1 gene located on chromosomal region 9q34.11. The age of onset is neonatal. This disease is characterized by total fetal akinesia (detectable since the 13th week of gestation) accompanied by hydrops, micrognathia, pulmonary hypoplasia, pterygia and multiple joint contractures (usually flexion contractures in the elbows and extension in the knees), leading invariably to death before the 32nd week of gestation. Lack of anterior horn motoneurons, severe atrophy of the ventral spinal cord and severe skeletal muscle hypoplasia are characteristic neuropathological findings, with no evidence of other organ structural anomalies. | 600,25 |
| GNE | Inclusion body myopathy, type 2 (Nonaka myopathy) | NM_001128227.2 | NM_001128227.2:c.2228T>C, NM_001128227.2:c.2179G>A, NM_001128227.2:c.1937C>G, NM_001128227.2:c.1891G>A, NM_001128227.2:c.1820G>A, NM_001128227.2:c.1002T>A, NM_001128227.2:c.880C>T, NM_001128227.2:c.830G>A, NM_001128227.2:c.478C>T | Inclusion body myopathy, type 2 (Nonaka myopathy) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNE gene located on chromosomal region 9p13.3. The age of onset is adult. This disease is characterized by progressive muscle weakness and joint deformity. The prevalence is 1:500-1:1,000. | 600,25 |
| GNPTAB | Mucolipidosis 2 alpha/beta | NM_024312.4 | NM_024312.4:c.3663delG, NM_024312.4:c.3565C>T, NM_024312.4:c.3560_3561delAG, NM_024312.4:c.3503_3504delTC, NM_024312.4:c.3410T>A, NM_024312.4:c.3326dupA, NM_024312.4:c.3173C>G, NM_024312.4:c.2896delA, NM_024312.4:c.2383delG, NM_024312.4:c.1906dupA, NM_024312.4:c.1759C>T, NM_024312.4:c.1196C>T, NM_024312.4:c.1000C>T, NM_024312.4:c.749dupA, NM_024312.4:c.732_733delAA, NM_024312.4:c.648_651delAGAA, NM_024312.4:c.616_619delACAG, NM_024312.4:c.99delC, NM_024312.4:c.25C>T, NM_024312.4:c.10A>C | Mucolipidosis type 2 alpha/beta follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GNPTAB gene located on chromosomal region 12q23.2. The age of onset is infantile. This disease is characterized by growth retardation, short stature, skeletal abnormalities, facial dysmorphism, stiff skin, developmental delay and cardiomegaly and that is lethal in childhood. The prevalence is 1:123,500-1:625,500. | 600,25 |
| GPR179 | Night blindness, congenital stationary (complete), type 1E, autosomal recessive | NM_001004334.3 | NM_001004334.3:c.6847_6848delCT, NM_001004334.3:c.5763_5764delGA, NM_001004334.3:c.5693dupT, NM_001004334.3:c.4699_4700delAG, NM_001004334.3:c.3233_3234delCT, NM_001004334.3:c.1807C>T, NM_001004334.3:c.1784+1G>A, NM_001004334.3:c.1368delT, NM_001004334.3:c.1236G>A, NM_001004334.3:c.984delC, NM_001004334.3:c.839_842delATCA, NM_001004334.3:c.278dupC, NM_001004334.3:c.278delC | Congenital stationary night blindness type 1E follow an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GPR179 gene located on chromosomal region 17q12. The age of onset is infantile. This disease is characterized by hemeralopia with a moderate loss of visual acuity. | 600,25 |
| GRM6 | Night blindness, congenital stationary (complete), type 1B, autosomal recessive | NM_000843.3 | NM_000843.3:c.2560C>T, NM_000843.3:c.2341G>A, NM_000843.3:c.2213_2219delCCAGAGG, NM_000843.3:c.2122C>T, NM_000843.3:c.1861C>T, NM_000843.3:c.1565G>A, NM_000843.3:c.1336C>T, NM_000843.3:c.1258C>T, NM_000843.3:c.1214T>C, NM_000843.3:c.727dupG, NM_000843.3:c.719_720insG, NM_000843.3:c.712C>T | Congenital stationary night blindness type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GRM6 gene located on chromosomal region 5q35.3. The age of onset is early infancy. This disease is characterized by hemeralopia with a moderate loss of visual acuity. | 600,25 |
| GUSB | Mucopolysaccharidosis, type 7 | NM_000181.3 | NM_000181.3:c.1881G>T, NM_000181.3:c.1856C>T, NM_000181.3:c.1831C>T, NM_000181.3:c.1730G>T, NM_000181.3:c.1618G>T, NM_000181.3:c.1534G>A, NM_000181.3:c.1521G>A, NM_000181.3:c.1429C>T, NM_000181.3:c.1338G>A, NM_000181.3:c.1337G>A, NM_000181.3:c.1244+1G>A, NM_000181.3:c.1219_1220insC, NM_000181.3:c.1144C>T, NM_000181.3:c.1084G>A, NM_000181.3:c.1065+1G>T, NM_000181.3:c.1061C>T, NM_000181.3:c.1050G>C, NM_000181.3:c.866G>A, NM_000181.3:c.820_821delAC, NM_000181.3:c.646C>T, NM_000181.3:c.526C>T, NM_000181.3:c.499C>T, NM_000181.3:c.442C>T | Mucopolysaccharidosis type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the GUSB gene located on chromosomal region 7q11.21. The age of onset is variable. There are prenatal forms with non-immune hydrops fetalis, and severe neonatal forms with dysmorphism, hernias, hepatosplenomegaly, club feet, dysostosis, severe hypotonia and neurological disorders that ultimately lead to profound intellectual deficit and small stature in patients that survive. Finally, there are also very mild cases that are discovered during adolescence or adulthood following presentation with thoracic kyphosis. The prevalence is 1:250,000 in newborn. | 600,25 |
| HADHA | LCHAD deficiency | NM_000182.4 | NM_000182.4:c.2146+1G>A, NM_000182.4:c.2132dupC, NM_000182.4:c.1918C>T, NM_000182.4:c.1793_1794delAT, NM_000182.4:c.1678C>T, NM_000182.4:c.1644delC, NM_000182.4:c.1620+2_1620+6delTAAGG, NM_000182.4:c.1528G>C, NM_000182.4:c.1422dupT, NM_000182.4:c.1132C>T, NM_000182.4:c.919-2A>G, NM_000182.4:c.845T>A, NM_000182.4:c.499delA, NM_000182.4:c.274_278delTCATC | Isolated deficiency of long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD deficiency) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HADHA gene located on chromosomal region 2p23.3. This disease is characterized in infancy/early childhood of hypoketotic hypoglycemia, metabolic acidosis, liver disease, hypotonia and, frequently, cardiac involvement with arrhythmias and/or cardiomyopathy. The prevalence is 1/250,000. | 600,25 |
| HBB | HBB-related hemoglobinopathy | NM_000518.4 | NM_000518.4:c.*110T>C, NM_000518.4:c.440_441dupAC, NM_000518.4:c.440A>T, NM_000518.4:c.440A>C, NM_000518.4:c.439C>G, NM_000518.4:c.438T>A, NM_000518.4:c.437A>G, NM_000518.4:c.436T>C, NM_000518.4:c.435G>C, NM_000518.4:c.431A>C, NM_000518.4:c.428C>A, NM_000518.4:c.421G>A, NM_000518.4:c.383A>C, NM_000518.4:c.371_378delCCCCACCA, NM_000518.4:c.364G>T, NM_000518.4:c.364G>A, NM_000518.4:c.347C>A, NM_000518.4:c.344T>C, NM_000518.4:c.343_344delCTinsG, NM_000518.4:c.341T>A, NM_000518.4:c.332T>C, NM_000518.4:c.328delG, NM_000518.4:c.328G>A, NM_000518.4:c.323dupG, NM_000518.4:c.320T>G, NM_000518.4:c.316-1G>T, NM_000518.4:c.316-1G>A, NM_000518.4:c.316-2A>G, NM_000518.4:c.316-2A>C, NM_000518.4:c.316-3C>A, NM_000518.4:c.316-106C>G, NM_000518.4:c.316-146T>G, NM_000518.4:c.316-197C>T, NM_000518.4:c.315+2T>G, NM_000518.4:c.315+1G>C, NM_000518.4:c.315+1G>A, NM_000518.4:c.312C>G, NM_000518.4:c.306G>C, NM_000518.4:c.305A>G, NM_000518.4:c.304G>A, NM_000518.4:c.302C>T, NM_000518.4:c.299A>T, NM_000518.4:c.299A>G, NM_000518.4:c.299A>C, NM_000518.4:c.298G>T, NM_000518.4:c.298G>C, NM_000518.4:c.298G>A, NM_000518.4:c.295G>A, NM_000518.4:c.293A>T, NM_000518.4:c.287dupA, NM_000518.4:c.282_283dupTG, NM_000518.4:c.283G>C, NM_000518.4:c.277C>T, NM_000518.4:c.277C>A, NM_000518.4:c.275T>C, NM_000518.4:c.271G>T, NM_000518.4:c.269G>A, NM_000518.4:c.268A>C, NM_000518.4:c.257T>C, NM_000518.4:c.251delG, NM_000518.4:c.248A>T, NM_000518.4:c.248A>C, NM_000518.4:c.247A>G, NM_000518.4:c.230delC, NM_000518.4:c.226delC, NM_000518.4:c.217_221delAGTGAinsT, NM_000518.4:c.217dupA, NM_000518.4:c.216dupT, NM_000518.4:c.208G>A, NM_000518.4:c.206T>A, NM_000518.4:c.203_204delTG, NM_000518.4:c.201delA, NM_000518.4:c.199A>G, NM_000518.4:c.194delG, NM_000518.4:c.190C>T, NM_000518.4:c.184A>T, NM_000518.4:c.182T>A, NM_000518.4:c.179A>C, NM_000518.4:c.176C>G, NM_000518.4:c.162delT, NM_000518.4:c.143_146dupATCT, NM_000518.4:c.143dupA, NM_000518.4:c.135delC, NM_000518.4:c.134C>G, NM_000518.4:c.130G>T, NM_000518.4:c.126_129delCTTT, NM_000518.4:c.128T>C, NM_000518.4:c.127T>G, NM_000518.4:c.127T>C, NM_000518.4:c.114_120delGACCCAG, NM_000518.4:c.117_118delCC, NM_000518.4:c.118C>T, NM_000518.4:c.114G>A, NM_000518.4:c.113G>A, NM_000518.4:c.112delT, NM_000518.4:c.110delC, NM_000518.4:c.108C>A, NM_000518.4:c.103G>T, NM_000518.4:c.93G>T, NM_000518.4:c.93-1G>C, NM_000518.4:c.93-1G>A, NM_000518.4:c.93-2A>C, NM_000518.4:c.93-21G>A, NM_000518.4:c.92+6T>C, NM_000518.4:c.92+5G>T, NM_000518.4:c.92+5G>C, NM_000518.4:c.92+5G>A, NM_000518.4:c.92+2T>C, NM_000518.4:c.92+2T>A, NM_000518.4:c.92+1G>T, NM_000518.4:c.92+1G>A, NM_000518.4:c.92G>C, NM_000518.4:c.92G>A, NM_000518.4:c.91A>C, NM_000518.4:c.90C>T, NM_000518.4:c.86T>A, NM_000518.4:c.85dupC, NM_000518.4:c.82G>T, NM_000518.4:c.80A>G, NM_000518.4:c.79_80insT, NM_000518.4:c.79G>T, NM_000518.4:c.79G>A, NM_000518.4:c.75T>A, NM_000518.4:c.68_74delAAGTTGG, NM_000518.4:c.64dupG, NM_000518.4:c.59A>G, NM_000518.4:c.52A>T, NM_000518.4:c.51delC, NM_000518.4:c.48G>A, NM_000518.4:c.47G>A, NM_000518.4:c.46delT, NM_000518.4:c.45dupG, NM_000518.4:c.36delT, NM_000518.4:c.27dupG, NM_000518.4:c.25_26delAA, NM_000518.4:c.20delA, NM_000518.4:c.20A>T, NM_000518.4:c.19G>A, NM_000518.4:c.17_18delCT, NM_000518.4:c.8A>C, NM_000518.4:c.4delG, NM_000518.4:c.4G>T, NM_000518.4:c.3G>A, NM_000518.4:c.2T>G, NM_000518.4:c.2T>C, NM_000518.4:c.2T>A, NM_000518.4:c.1A>G, NM_000518.4:c.-50A>C, NM_000518.4:c.-75G>C, NM_000518.4:c.-78A>G, NM_000518.4:c.-78A>C, NM_000518.4:c.-79A>G, NM_000518.4:c.-80T>A, NM_000518.4:c.-137C>G, NM_000518.4:c.-137C>A, NM_000518.4:c.-138C>T, NM_000518.4:c.-151C>T | DNA variations in the HBB gene result in the production of different versions of beta-globin. Some of these variations may affect a person's health while other variations cause no noticeable signs or symptoms. Two of the most common HBB-related conditions are beta-thalassemia and sickle cell anemia (SCA). Beta thalassemia is caused by HBB gene mutations that prevent or decrease beta-globin production, subunits that make up hemoglobin. A lack of hemoglobin disrupts the normal development of red blood cells. A shortage of mature red blood cells can reduce the amount of oxygen that is delivered to tissues to below what is needed to satisfy the body's energy needs. A lack of oxygen in the body's tissues can lead to poor growth, organ damage, and other health problems associated with beta thalassemia. SCA is a multisystem disease associated with episodes of acute illness and progressive organ damage. SCA-associated mutations cause red blood cells assuming an abnormal, rigid, sickle shape promoting cell break down prematurely, which can lead to anemia. Anemia can cause shortness of breath, fatigue, and delayed growth and development in children. | 600,25 |
| HESX1 | Growth hormone deficiency with pituitary anomalies | NM_003865.2 | NM_003865.2:c.450_451delCA, NM_003865.2:c.445G>A, NM_003865.2:c.77T>C, NM_003865.2:c.18G>C | Growth hormone deficiency with pituitary anomalies follows an autosomal recessive pattern of inheritance and are caused by pathogenic variants in the HESX1 gene located on chromosomal region 3p14.3. The age of onset is infantile. These diseases are characterized by short stature, cognitive alterations or delayed puberty. The incidence is 1:3,000 and 1:4,000 births. | 600,25 |
| HEXA | Tay-Sachs disease | NM_000520.5 | NM_000520.5:c.254-1G>C | Tay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births. | 600,25 |
| HEXA | Tay-Sachs disease | NM_001318825.1 | NM_001318825.1:c.1570C>T, NM_001318825.1:c.1561C>T, NM_001318825.1:c.1544G>A, NM_001318825.1:c.1543delC, NM_001318825.1:c.1543C>T, NM_001318825.1:c.1532delT, NM_001318825.1:c.1529G>A, NM_001318825.1:c.1528C>T, NM_001318825.1:c.1477G>A, NM_001318825.1:c.1455G>C, NM_001318825.1:c.1311_1312insTATC, NM_001318825.1:c.1307_1310dupTATC, NM_001318825.1:c.1293G>C, NM_001318825.1:c.1247_1248delAAinsG, NM_001318825.1:c.1210C>T, NM_001318825.1:c.1209G>A, NM_001318825.1:c.1020G>A, NM_001318825.1:c.1019+3A>G, NM_001318825.1:c.948_950delCTT, NM_001318825.1:c.838+1G>C, NM_001318825.1:c.838+1G>A, NM_001318825.1:c.838G>A, NM_001318825.1:c.805G>C, NM_001318825.1:c.782G>A, NM_001318825.1:c.705+1G>A, NM_001318825.1:c.665T>C, NM_001318825.1:c.662C>T, NM_001318825.1:c.573C>G, NM_001318825.1:c.571T>C, NM_001318825.1:c.566G>T, NM_001318825.1:c.566G>A, NM_001318825.1:c.565C>T, NM_001318825.1:c.542G>A, NM_001318825.1:c.541C>T, NM_001318825.1:c.492+5G>A, NM_001318825.1:c.413T>G, NM_001318825.1:c.173G>A, NM_001318825.1:c.116T>G, NM_001318825.1:c.78G>A, NM_001318825.1:c.77G>A, NM_001318825.1:c.2T>C, NM_001318825.1:c.1A>T, NM_001318825.1:c.1A>G | Tay-Sachs disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXA gene located on chromosomal region 15q23. The age of onset is infantile. There are three forms, type 1 (infantile), with a psychomotor retardation which is associated with hypotonia, amaurosis and megalencephaly. Type 2 is characterized by locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities. Type three (chronic form) shows spinocerebellar ataxia or spinal amyotrophy. The prevalence is 1 case per 320 000 live births. | 600,25 |
| HEXB | Sandhoff disease, infantile, juvenile, and adult forms | NM_000521.3 | NM_000521.3:c.115delG, NM_000521.3:c.171delG, NM_000521.3:c.202_203insGG, NM_000521.3:c.298delC, NM_000521.3:c.508C>T, NM_000521.3:c.797A>G, NM_000521.3:c.841C>T, NM_000521.3:c.850C>T, NM_000521.3:c.1238_1242delCAAAG, NM_000521.3:c.1250C>T, NM_000521.3:c.1310_1311delCA, NM_000521.3:c.1345delT, NM_000521.3:c.1375G>T, NM_000521.3:c.1380G>A, NM_000521.3:c.1517_1529dupCAAGTGCTGTTGG, NM_000521.3:c.1539_1540delCT | Sandhoff disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HEXB gene located on chromosomal region 5q13.3. The age of onset is adult or infantile. This disease is characterized by central nervous system degeneration, with startle reactions, early blindness, progressive motor and mental deterioration, macrocephaly and cherry-red spots on the macula. The prevalence is 1/130.000. | 600,25 |
| HGD | Alkaptonuria | NM_000187.3 | NM_000187.3:c.1189-2A>G, NM_000187.3:c.1111dupC, NM_000187.3:c.1102A>G, NM_000187.3:c.899T>G, NM_000187.3:c.808G>A, NM_000187.3:c.688C>T, NM_000187.3:c.674G>A, NM_000187.3:c.481G>A, NM_000187.3:c.469+2T>C, NM_000187.3:c.342+1G>A, NM_000187.3:c.175delA, NM_000187.3:c.172A>T, NM_000187.3:c.140C>T, NM_000187.3:c.16-1G>A | Alkaptonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGD gene located on chromosomal region 3q13.33. The age of onset is infantile. This disease is characterized by darkening of the urine when it is left exposed to air, grey-blue colouration of the eye sclerae and the ear helix (ochronosis), and a disabling joint disease involving both the axial and peripheral joints (ochronotic arthropathy). The prevalence is 1:250,000-1:1.000.000 newborn. | 600,25 |
| HGSNAT | Mucopolysaccharidosis type 3C (Sanfilippo C) | NM_152419.2 | NM_152419.2:c.493+1G>A, NM_152419.2:c.607C>T, NM_152419.2:c.848C>T, NM_152419.2:c.1030C>T, NM_152419.2:c.1250+1G>A, NM_152419.2:c.1378-1G>A, NM_152419.2:c.1464+1G>A, NM_152419.2:c.1503delA, NM_152419.2:c.1553C>T, NM_152419.2:c.1622C>T | Mucopolysaccharidosis type 3C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HGSNAT gene located on chromosomal region 8p11.21. The age of onset is infantile. This disease is characterized by defective or missing enzymes to break down mucopolysaccharides are missing or are defective. The prevalence is <1:70.000 newborn. | 600,25 |
| HPD | Tyrosinemia, type 3 | NM_002150.2 | NM_002150.2:c.987delA, NM_002150.2:c.774T>G, NM_002150.2:c.600C>G | Tyrosinemia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the HPD gene located on chromosomal region 12q24.31. The age of onset is infantile. This disease is characterized by intellectual deficit and ataxia. The prevalence is 1:100,000-1:120,000 newborn. | 600,25 |
| IGHMBP2 | Charcot-Marie-Tooth disease, axonal, type 2S | NM_002180.2 | NM_002180.2:c.121C>T, NM_002180.2:c.638A>G, NM_002180.2:c.661delA, NM_002180.2:c.1107C>G, NM_002180.2:c.1488C>A, NM_002180.2:c.1540G>A, NM_002180.2:c.1738G>A, NM_002180.2:c.2362C>T, NM_002180.2:c.2611+1G>T | Charcot-Marie-Tooth disease, axonal, type 2S follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IGHMBP2 gene located on chromosomal region 11q13.3. The age of onset can be infancy, childhood, adult or adolescent. This disease is characterized by progressive distal muscle weakness and atrophy of both the lower and upper limbs, absent or reduced deep tendon reflexes, mild sensory loss, foot drop, and pes cavus leading eventually to wheelchair dependence. Some patients present with early hypotonia and delayed motor development. Scoliosis and variable autonomic disturbances may be associated. The prevalence is below 1/1,000,000. | 600,25 |
| INPP5E | Joubert syndrome, type 1 | NM_019892.5 | NM_019892.5:c.1879C>T, NM_019892.5:c.1688G>A, NM_019892.5:c.1543C>T, NM_019892.5:c.1304G>A, NM_019892.5:c.1132C>T, NM_019892.5:c.855_856insCG | Joubert syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INPP5E gene located on chromosomal region 9q34.3. The age of onset is early infantile. This disease is characterized congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. | 600,25 |
| INSR | Diabetes mellitus, insulin-resistant, with acanthosis nigricans, type A | NM_000208.3 | NM_000208.3:c.3680G>C, NM_000208.3:c.3079C>T, NM_000208.3:c.2668C>T, NM_000208.3:c.1114C>T, NM_000208.3:c.172G>A | Diabetes mellitus, insulin-resistant, with acanthosis nigricans type A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the INSR gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by the triad of hyperinsulinemia, acanthosis nigricans (skin lesions associated with insulin resistance), and signs of hyperandrogenism in females without lipodystrophy and who are not overweight. It is generally diagnosed in young women with marked signs of hyperandrogenism, but insulin resistance and acanthosis nigricans may be observed in men and in childhood. Acromegaloid facies or muscular cramps are sometimes associated. Hyperinsulinemia, a biological marker for insulin resistance, is often associated with glucose tolerance defects over the course of the disease, and diabetes progressively sets in. Hyperandrogenism (associated with polycystic ovarian syndrome (see this term) or ovarian hyperthecoses) leads to fertility problems. The prevalence is <1:1,000,000. | 600,25 |
| ITGB4 | Epidermolysis bullosa, junctional, with pyloric atresia | NM_000213.4 | NM_000213.4:c.112T>C, NM_000213.4:c.182G>A, NM_000213.4:c.1150delG, NM_000213.4:c.1660C>T, NM_000213.4:c.1684T>C, NM_000213.4:c.2608delC, NM_000213.4:c.2792G>A, NM_000213.4:c.3321_3331delACTGGACCGGA, NM_000213.4:c.3674G>A, NM_000213.4:c.3793+1G>A, NM_000213.4:c.3801dupT, NM_000213.4:c.3841C>T, NM_000213.4:c.4620delG, NM_000213.4:c.4643G>A, NM_000213.4:c.4828C>T, NM_000213.4:c.5329+2T>C | Junctional epidermolysis bullosa with pyloric atresia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ITGB4 gene located on chromosomal region 17q25.1. The age of onset is early infantile. This disease is characterized by generalized blistering at birth and congenital atresia of the pylorus and rarely of other portions of the gastrointestinal tract. More than 100 cases have been reported around the world. | 600,25 |
| IVD | Isovaleric acidemia | NM_002225.3 | NM_002225.3:c.2T>G, NM_002225.3:c.134T>C, NM_002225.3:c.157C>T, NM_002225.3:c.158G>A, NM_002225.3:c.158G>C, NM_002225.3:c.243+1G>A, NM_002225.3:c.367G>A, NM_002225.3:c.390delT, NM_002225.3:c.406_407delTG, NM_002225.3:c.434_437dupATGA, NM_002225.3:c.465+2T>C, NM_002225.3:c.478_479insGT, NM_002225.3:c.507delG, NM_002225.3:c.559+1G>A, NM_002225.3:c.593G>A, NM_002225.3:c.605G>T, NM_002225.3:c.627delT, NM_002225.3:c.793+1G>A, NM_002225.3:c.941C>T, NM_002225.3:c.994_995delAT, NM_002225.3:c.1141T>C, NM_002225.3:c.1145_1147+4delTTGGTGA, NM_002225.3:c.1183C>T, NM_002225.3:c.1188delT, NM_002225.3:c.1192C>T, NM_002225.3:c.1208A>G | Isovaleric academia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the IVD gene located on chromosomal region 15q15.1. The age of onset is neonatal. This disease is characterized by vomiting, dehydration, coma and abnormal movements. The prevalence is 1/100,000. | 600,25 |
| JAK3 | Severe Combined Immunodeficiency, autosomal recessive, T-negative/B-positive type | NM_000215.3 | NM_000215.3:c.1837C>T, NM_000215.3:c.1765G>A, NM_000215.3:c.1695C>A, NM_000215.3:c.1333C>T, NM_000215.3:c.1172_1173insG, NM_000215.3:c.299A>G | Severe combined immunodeficiency, T-B+ type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the JAK3 gene located on chromosomal region 19p13.11. The age of onset is infantile. This disease is characterized by chronic diarrhea, failure to thrive, recurrent respiratory infections and/or generalized infections due to opportunistic pathogens. The incidence is 1/100,000 and 1/1,000,000. | 600,25 |
| KCNJ1 | Bartter syndrome, type 2 | NM_000220.4 | NM_000220.4:c.1014delA, NM_000220.4:c.1012C>T, NM_000220.4:c.996_999delAAAG, NM_000220.4:c.942T>G, NM_000220.4:c.657C>G, NM_000220.4:c.641C>T, NM_000220.4:c.592G>A, NM_000220.4:c.500G>A, NM_000220.4:c.372T>A, NM_000220.4:c.322G>C, NM_000220.4:c.237C>G | Bartter syndrome, type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNJ1 gene located on chromosomal region 11q24.3. The age of onset is antenatal. This disease is characterized by severe polyhydramnios in mother leading to premature delivery, postnatally newborns suffer from recurrent episodes of severe dehydration and electrolyte imbalance which can lead to fatal outcome. | 600,25 |
| KCNV2 | Retinal cone dystrophy, type 3B | NM_133497.3 | NM_133497.3:c.226C>T, NM_133497.3:c.325C>T, NM_133497.3:c.357dupC, NM_133497.3:c.427G>T, NM_133497.3:c.442G>T, NM_133497.3:c.491T>C, NM_133497.3:c.767C>G, NM_133497.3:c.778A>T, NM_133497.3:c.916G>T, NM_133497.3:c.1016_1024delACCTGGTGG, NM_133497.3:c.1133dupT, NM_133497.3:c.1376G>A | Retinal cone dystrophy, type 3B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the KCNV2 gene located on 9p24.2. The age of onset is in the first or second decade of life. This disease is characterized by is characterized by onset in the first or second decade of life of very marked photophobia, myopia, reduced color vision along the red-green axis with relatively preserved tritan discrimination, and central scotomata with peripheral widespread sensitivity loss predominating in the superior visual field. Nyctalopia is a later feature of the disorder. There is often retinal pigment epithelium disturbance at the macula with a normal retinal periphery. | 600,25 |
| LAMA2 | LAMA2-related muscular dystrophy | NM_000426.3 | NM_000426.3:c.112+1G>A, NM_000426.3:c.184G>T, NM_000426.3:c.825delC, NM_000426.3:c.1050delT, NM_000426.3:c.1612C>T, NM_000426.3:c.2049_2050delAG, NM_000426.3:c.2098_2099delTT, NM_000426.3:c.2323-2A>T, NM_000426.3:c.2451-2A>G, NM_000426.3:c.2750-1G>C, NM_000426.3:c.2901C>A, NM_000426.3:c.2962C>T, NM_000426.3:c.3215delG, NM_000426.3:c.3237C>A, NM_000426.3:c.3630delT, NM_000426.3:c.3718C>T, NM_000426.3:c.3976C>T, NM_000426.3:c.4645C>T, NM_000426.3:c.5050G>T, NM_000426.3:c.5227G>T, NM_000426.3:c.6011delA, NM_000426.3:c.6038delT, NM_000426.3:c.6334A>T, NM_000426.3:c.6429+1G>A, NM_000426.3:c.6617delT, NM_000426.3:c.6955C>T, NM_000426.3:c.7147C>T, NM_000426.3:c.7279_7280delCT, NM_000426.3:c.7536delC, NM_000426.3:c.7732C>T, NM_000426.3:c.7810C>T, NM_000426.3:c.7888C>T, NM_000426.3:c.8314delA, NM_000426.3:c.8705delT, NM_000426.3:c.8748delA, NM_000426.3:c.9101_9104dupAACA, NM_000426.3:c.9221delA, NM_000426.3:c.9253C>T | LAMA2-related muscular dystrophy 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMA2 gene located on chromosomal region 6q22.33. LAMA2-related muscular dystrophy is a disorder that causes weakness and atrophy of skeletal muscles. This condition varies in severity, from a severe, early-onset type to a milder, late-onset form. Early-onset LAMA2-related muscular dystrophy is apparent at birth or within the first few months of life, called merosin-deficient congenital muscular dystrophy type 1A (607855). Patients show hypotonia, poor suck and cry, and delayed motor development; most never achieve independent ambulation. Most patients also have periventricular white matter abnormalities on brain imaging, but mental retardation and/or seizures occur only rarely. Symptoms of late-onset LAMA2-related muscular dystrophy become evident later in childhood or adulthood, and are similar to those of a group of muscle disorders classified as autosomal recessive limb-girdle muscular dystrophies, type 23. This group is characterized by slowly progressive proximal muscle weakness primarily affecting the lower limbs and resulting in gait difficulties. Additional features include white matter abnormalities on brain imaging, increased serum creatine kinase, and dystrophic features, with partial LAMA2 deficiency on muscle biopsy. Some patients may have additional neurologic features, including executive deficits, seizures, and peripheral neuropathy. Patients remain ambulatory well into adulthood. The prevalence is 1/30,000. | 600,25 |
| LAMB3 | Junctional epidermolysis bullosa, Herlitz and non-Herlitz type | NM_000228.2 | NM_000228.2:c.3228+1G>T, NM_000228.2:c.3228+1G>A, NM_000228.2:c.2806C>T, NM_000228.2:c.1903C>T, NM_000228.2:c.1830G>A, NM_000228.2:c.1587_1588delAG, NM_000228.2:c.1438_1442delCCGTG, NM_000228.2:c.1357delT, NM_000228.2:c.904delT, NM_000228.2:c.727C>T, NM_000228.2:c.628+1delG, NM_000228.2:c.628G>A, NM_000228.2:c.565-2A>G, NM_000228.2:c.496C>T, NM_000228.2:c.124C>T | Junctional epidermolysis bullosa follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LAMB3 gene located on chromosomal region 1q32.2. The age of onset is neonatal/infancy. Junctional epidermolysis bullosa (JEB) is a group of genetic conditions that cause the skin to be very fragile and to blister easily. Blisters and skin erosions form in response to minor injury or friction, such as rubbing or scratching. Researchers classify junctional epidermolysis bullosa into two main types based on severity: Herlitz JEB and non-Herlitz JEB. Herlitz type is more severe phenotype characterized by blisters and erosions, localized to the skin and mucous membranes and often results in early death. More than 80 mutations in the LAMB3 gene have been identified in people with Herlitz JEB. Other LAMB3 gene mutations cause the milder form non-Herlitz JEB, disease characterized by generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement. | 600,25 |
| LMNA | LMNA-related disorders, autosomal recessive | NM_001282626.1 | NM_001282626.1:c.1818+6C>T | LMNA-related disorders, autosomal recessive, are caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22, and include Charcot-Marie-Tooth disease, type 2B1, Emery-Dreifuss muscular dystrophy type 3, mandibuloacral dysplasia, lethal restrictive dermopathy among others. Charcot-Marie-Tooth disease constitutes a clinically and genetically heterogeneous group of hereditary motor and sensory neuropathies. Emery-Dreifuss muscular dystrophy is characterized classically by the triad of weakness of the shoulder and pelvic girdle muscles, contractures of the elbows, neck, and Achilles tendon, and cardiac involvement, most commonly arrhythmias. Mandibuloacral dysplasia is characterized by growth retardation, craniofacial anomalies with mandibular hypoplasia, skeletal abnormalities with progressive osteolysis of the distal phalanges and clavicles, and pigmentary skin changes. Restrictive dermopathy is a rare, lethal genodermatosis characterized by thin, tightly adherent translucent skin with erosions at flexure sites, superficial vessels, typical facial dysmorphism, and generalized joint ankylosis. | 600,25 |
| LMNA | LMNA-related disorders, autosomal recessive | NM_170707.3 | NM_170707.3:c.419T>C, NM_170707.3:c.1072G>A, NM_170707.3:c.1228C>T, NM_170707.3:c.1366A>C, NM_170707.3:c.1411C>T, NM_170707.3:c.1488+1G>A, NM_170707.3:c.1579C>T, NM_170707.3:c.1580G>A, NM_170707.3:c.1583C>A, NM_170707.3:c.1585G>A, NM_170707.3:c.1586C>T, NM_170707.3:c.1626G>C | LMNA-related disorders, autosomal recessive, are caused by pathogenic variants in the LMNA gene located on chromosomal region 1q22, and include Charcot-Marie-Tooth disease, type 2B1, Emery-Dreifuss muscular dystrophy type 3, mandibuloacral dysplasia, lethal restrictive dermopathy among others. Charcot-Marie-Tooth disease constitutes a clinically and genetically heterogeneous group of hereditary motor and sensory neuropathies. Emery-Dreifuss muscular dystrophy is characterized classically by the triad of weakness of the shoulder and pelvic girdle muscles, contractures of the elbows, neck, and Achilles tendon, and cardiac involvement, most commonly arrhythmias. Mandibuloacral dysplasia is characterized by growth retardation, craniofacial anomalies with mandibular hypoplasia, skeletal abnormalities with progressive osteolysis of the distal phalanges and clavicles, and pigmentary skin changes. Restrictive dermopathy is a rare, lethal genodermatosis characterized by thin, tightly adherent translucent skin with erosions at flexure sites, superficial vessels, typical facial dysmorphism, and generalized joint ankylosis. | 600,25 |
| LRP5 | Osteoporosis-pseudoglioma syndrome | NM_002335.3 | NM_002335.3:c.804_813delGGGGAAGAGG, NM_002335.3:c.1453G>T, NM_002335.3:c.1468delG, NM_002335.3:c.1481G>A, NM_002335.3:c.1708C>T, NM_002335.3:c.1709G>A, NM_002335.3:c.2202G>A, NM_002335.3:c.2254C>G, NM_002335.3:c.2305delG, NM_002335.3:c.2557C>T, NM_002335.3:c.4099G>A, NM_002335.3:c.4651G>A | Osteoporosis-pseudoglioma syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the LRP5 gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by congenital or infancy-onset blindness and severe juvenile-onset osteoporosis and spontaneous fractures. The prevalence is 1:2,000,000. | 600,25 |
| MAN2B1 | Mannosidosis, alpha-, types I and II | NM_000528.3 | NM_000528.3:c.2686_2687delCTinsG, NM_000528.3:c.2436+2T>C, NM_000528.3:c.2426T>C, NM_000528.3:c.2398G>A, NM_000528.3:c.2368C>T, NM_000528.3:c.2278C>T, NM_000528.3:c.2119C>T, NM_000528.3:c.2013delT, NM_000528.3:c.1929G>A, NM_000528.3:c.1915C>T, NM_000528.3:c.1830+1G>C, NM_000528.3:c.1780C>T, NM_000528.3:c.384G>A, NM_000528.3:c.1A>G | Alpha-mannosidosis follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MAN2B1 gene located on chromosomal region 19p13.2. The age of onset is infantile. This disease is characterized by immunodeficiency, facial and skeletal abnormalities, hearing impairment and intellectual disability. The prevalence is 1:1,000,000-9:1,000,000. | 600,25 |
| MCCC2 | 3-Methylcrotonyl-CoA carboxylase type 2, deficiency | NM_022132.4 | NM_022132.4:c.295G>C, NM_022132.4:c.380C>G, NM_022132.4:c.464G>A, NM_022132.4:c.499T>C, NM_022132.4:c.517dupT, NM_022132.4:c.641delG, NM_022132.4:c.735dupC, NM_022132.4:c.838G>T, NM_022132.4:c.929C>G, NM_022132.4:c.994C>T, NM_022132.4:c.1015G>A, NM_022132.4:c.1065A>T, NM_022132.4:c.1072+1G>A, NM_022132.4:c.1577dupT, NM_022132.4:c.1580G>A | 3-methylcrotonyl-CoA carboxylase deficiency type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MCCC2 gene located on chromosomal region 5q13.2. The age of onset is neonatal. This disease is characterized by a highly variable clinical picture ranging from neonatal onset with severe neurological involvement to asymptomatic adults. The prevalence is 1:75,000 newborn. | 600,25 |
| MED25 | Basel-Vanagait-Smirin-Yosef syndrome | NM_030973.3 | NM_030973.3:c.320delG, NM_030973.3:c.1366C>T | Basel-Vanagait-Smirin-Yosef syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MED25 gene located on chromosomal region 19q13.33. The age of onset neonatal/infantile. This syndrome is characterized by eye, brain, cardiac and palatal abnormalities as well as growth retardation, microcephaly and severe intellectual disability. | 600,25 |
| MEFV | Familial Mediterranean fever, AR | NM_000243.2 | NM_000243.2:c.2282G>A, NM_000243.2:c.2230G>T, NM_000243.2:c.2177T>C, NM_000243.2:c.2084A>G, NM_000243.2:c.2082G>A, NM_000243.2:c.2080A>G, NM_000243.2:c.2076_2078delAAT, NM_000243.2:c.2040G>C, NM_000243.2:c.2040G>A, NM_000243.2:c.1958G>A, NM_000243.2:c.1437C>G, NM_000243.2:c.1141C>T, NM_000243.2:c.656dupG, NM_000243.2:c.501G>C, NM_000243.2:c.163dupA | Familial Mediterranean fever follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MEFV gene located on chromosomal region 16p13.3. The age of onset is infantile or adult (before the age of 30). This disease is characterized by recurrent short episodes of fever and serositis resulting in pain in the abdomen, chest, joints and muscles. The prevalence is 1:10,000-5:10,000. | 600,25 |
| MERTK | Retinitis pigmentosa type 38 | NM_006343.2 | NM_006343.2:c.1605-2A>G, NM_006343.2:c.2070_2074delAGGAC, NM_006343.2:c.2189+1G>T, NM_006343.2:c.2211_2214delCTGT, NM_006343.2:c.2323C>T, NM_006343.2:c.2785_2786dupTA | Retinitis pigmentosa type 38 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MERTK gene located on chromosomal region 2q13. The age of onset is infantile. This disease is characterized by. This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness. | 600,25 |
| MFRP | Microphthalmia, isolated type 5 | NM_031433.3 | NM_031433.3:c.1149dupC, NM_031433.3:c.1124+1G>T, NM_031433.3:c.545T>C, NM_031433.3:c.523C>T, NM_031433.3:c.498delC | Microphthalmia, isolated type 5 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MFRP gene located on chromosomal region 11q23.3. The age of onset is infantile. This disease is characterized by posterior microphthalmos, retinitis pigmentosa, foveoschisis, and optic disk drusen. | 600,25 |
| MKKS | Bardet-Biedl syndrome type 6 | NM_018848.3 | NM_018848.3:c.1436C>G, NM_018848.3:c.1225_1226delGG, NM_018848.3:c.830T>C, NM_018848.3:c.353delG | Bardet-Biedl syndrome type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKKS gene located on chromosomal region 20p12.2. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. | 600,25 |
| MKS1 | Bardet-Biedl syndrome type 13 | NM_001321269.1 | NM_001321269.1:c.1024+1G>A, NM_001321269.1:c.508C>T | Bardet-Biedl syndrome type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MKS1 gene located on chromosomal region 17q22. The age of onset is antenatal or infacy. This disease is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. | 600,25 |
| MMACHC | Methylmalonic aciduria and homocystinuria, cblC type | NM_015506.2 | NM_015506.2:c.271dupA, NM_015506.2:c.331C>T, NM_015506.2:c.347T>C, NM_015506.2:c.388_390delTAC, NM_015506.2:c.394C>T, NM_015506.2:c.440G>C, NM_015506.2:c.481C>T, NM_015506.2:c.482G>A, NM_015506.2:c.547_548delGT, NM_015506.2:c.608G>A, NM_015506.2:c.609G>A, NM_015506.2:c.615C>A, NM_015506.2:c.615C>G, NM_015506.2:c.619dupG, NM_015506.2:c.616C>T, NM_015506.2:c.658_660delAAG, NM_015506.2:c.688C>T | Vitamin B12-responsive methylmalonic acidemia type cbl B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MMAB gene located on chromosomal region 12q24.31. The age of onset is early infantile. This disease is characterized by developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea. The prevalence is <1:1,000,000. | 600,25 |
| MOCS2 | Molybdenum cofactor deficiency B | NM_004531.4 | NM_004531.4:c.567A>C, NM_004531.4:c.539_540delAA, NM_004531.4:c.502G>A, NM_004531.4:c.377+1G>A, NM_004531.4:c.106_107delAT, NM_004531.4:c.58delT, NM_004531.4:c.3G>A | Molybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death. | 600,25 |
| MOCS2 | Molybdenum cofactor deficiency B | NM_176806.3 | NM_176806.3:c.16C>T | Molybdenum cofactor deficiency type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MOCS2 gene located on chromosomal region 5q11.2. This disease is characterized by severe neurological abnormalities, dislocated ocular early death. | 600,25 |
| MTTP | Abetalipoproteinemia | NM_001300785.1 | NM_001300785.1:c.789_790delCA, NM_001300785.1:c.1700G>A, NM_001300785.1:c.1850G>T, NM_001300785.1:c.1948+1G>A, NM_001300785.1:c.2112delC, NM_001300785.1:c.2674G>T | Abetalipoproteinemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MTTP gene located on chromosomal region 4q23. The age of onset is infantile. This disease is characterized by growth delay, malabsorption, hepatomegaly, and neurological and neuromuscular manifestations. The prevalence is <1:1,000,000. | 600,25 |
| MUT | Methylmalonic aciduria, mut(0) type | NM_000255.3 | NM_000255.3:c.2150G>T, NM_000255.3:c.2080C>T, NM_000255.3:c.1924G>C, NM_000255.3:c.1871A>G, NM_000255.3:c.1867G>A, NM_000255.3:c.1741C>T, NM_000255.3:c.1658delT, NM_000255.3:c.1445-2A>G, NM_000255.3:c.1420C>T, NM_000255.3:c.1399C>T, NM_000255.3:c.1280G>A, NM_000255.3:c.1207C>T, NM_000255.3:c.1181T>A, NM_000255.3:c.1106G>A, NM_000255.3:c.914T>C, NM_000255.3:c.682C>T, NM_000255.3:c.671_678dupAATTTATG, NM_000255.3:c.655A>T, NM_000255.3:c.643G>A, NM_000255.3:c.607G>A, NM_000255.3:c.572C>A, NM_000255.3:c.313T>C, NM_000255.3:c.280G>A, NM_000255.3:c.278G>A, NM_000255.3:c.91C>T | Methylmalonic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MUT gene located on chromosomal region 6p12.3. The age of onset is very early infantile. This disease is characterized by recurrent ketoacidotic comas or transient vomiting, dehydration, hypotonia and intellectual deficit, which does not respond to administration of vitamin B12. | 600,25 |
| MVK | Mevalonic aciduria | NM_000431.3 | NM_000431.3:c.59A>C, NM_000431.3:c.185G>A, NM_000431.3:c.494C>T, NM_000431.3:c.803T>C, NM_000431.3:c.902A>C, NM_000431.3:c.928G>A, NM_000431.3:c.1000G>A, NM_000431.3:c.1129G>A | Mevalonic aciduria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MVK gene located on chromosomal region 12q24.11. The age of onset is infantile. This disease is characterized by psychomotor retardation, failure to thrive, progressive cerebellar ataxia, dysmorphic features, progressive visual impairment and recurrent febrile crises. The prevalence is <1:1,000,000. | 600,25 |
| MYO15A | Deafness, autosomal recessive type 3 | NM_016239.3 | NM_016239.3:c.625G>T, NM_016239.3:c.755dupA, NM_016239.3:c.3313G>T, NM_016239.3:c.3336delG, NM_016239.3:c.3385C>T, NM_016239.3:c.3693-2A>G, NM_016239.3:c.3756+1G>T, NM_016239.3:c.4751_4752dupTC, NM_016239.3:c.5326C>T, NM_016239.3:c.5492G>T, NM_016239.3:c.6004delG, NM_016239.3:c.6864_6874delGGACCTGGAGC, NM_016239.3:c.8148G>T, NM_016239.3:c.8410A>T, NM_016239.3:c.8548C>T, NM_016239.3:c.9958_9961delGACT, NM_016239.3:c.10573delA | Deafness autosomal recessive type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO15A gene located on chromosomal region 17p11.2. The age of onset is infantile, etc/. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 600,25 |
| MYO3A | Deafness, autosomal recessive type 30 | NM_017433.4 | NM_017433.4:c.1A>G, NM_017433.4:c.732-2A>G, NM_017433.4:c.770C>G, NM_017433.4:c.1086T>G, NM_017433.4:c.1193C>A, NM_017433.4:c.1777-12G>A, NM_017433.4:c.1953delC, NM_017433.4:c.2243delA, NM_017433.4:c.2506-1G>A, NM_017433.4:c.2793+2T>A, NM_017433.4:c.3112-2A>G, NM_017433.4:c.3154C>T, NM_017433.4:c.4586+2T>G, NM_017433.4:c.4730+1G>A | Deafness autosomal recessive type 30 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO3A gene located on chromosomal region 10p12.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 600,25 |
| MYO6 | Deafness, autosomal recessive type 37 | NM_004999.3 | NM_004999.3:c.1452dupT, NM_004999.3:c.2907_2909delAGA, NM_004999.3:c.3496C>T, NM_004999.3:c.3808C>T | Deafness autosomal recessive type 37 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO6 gene located on chromosomal region 6q14.1. The age of onset is infantile. This disease is characterized by mild-to-profound sensorineural hearing impairment with no associated visible abnormalities of the external ear or any related medical problems. | 600,25 |
| MYO7A | Usher syndrome, type 1B | NM_000260.3 | NM_000260.3:c.3G>A, NM_000260.3:c.133-2A>G, NM_000260.3:c.448C>T, NM_000260.3:c.494C>T, NM_000260.3:c.634C>T, NM_000260.3:c.635G>A, NM_000260.3:c.640G>A, NM_000260.3:c.731G>C, NM_000260.3:c.1184G>A, NM_000260.3:c.1344-1G>A, NM_000260.3:c.1797G>A, NM_000260.3:c.1884C>A, NM_000260.3:c.1996C>T, NM_000260.3:c.2476G>A, NM_000260.3:c.3504-1G>C, NM_000260.3:c.3508G>A, NM_000260.3:c.3596dupT, NM_000260.3:c.3719G>A, NM_000260.3:c.3764delA, NM_000260.3:c.4024delT, NM_000260.3:c.5392C>T, NM_000260.3:c.5618G>A, NM_000260.3:c.5824G>T, NM_000260.3:c.5886_5889delCTTT, NM_000260.3:c.5967C>G, NM_000260.3:c.6025delG | Usher syndrome type 1B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the MYO7A gene located on chromosomal region 11q13.5. The age of onset is infantile. This disease is characterized by congenital, bilateral, profound sensorineural hearing loss, vestibular areflexia, and adolescent-onset retinitis pigmentosa. The prevalence is 1:100,000-9:100,000. | 600,25 |
| NAGA | Schindler disease, type I | NM_000262.2 | NM_000262.2:c.986G>A, NM_000262.2:c.985C>T, NM_000262.2:c.973G>A, NM_000262.2:c.577G>T | Schindler disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NAGA gene located on chromosomal region 22q13.2. The age of onset is infantile. This disease is characterized by early-onset neuroaxonal dystrophy and neurological signs (convulsion during fever, epilepsy, psychomotor retardation and hypotonia). NAGA deficiency is typically classified in three main phenotypes: NAGA deficiency type I (Schindler disease or Schindler disease type I) with severe manifestations; NAGA deficiency type II (Kanzazi disease or Schindler disease type II) which is mild; NAGA deficiency type III (Schindler disease type III) characterized by mild-to-moderate neurologic manifestations. NAGA deficiency results in the increased urinary excretion of glycopeptides and oligosaccharides containing alpha-N-acetylgalactosaminyl moieties. | 600,25 |
| NEB | Nemaline myopathy type 2, autosomal recessive | NM_001271208.1 | NM_001271208.1:c.12238_12239delAT, NM_001271208.1:c.8031_8041delAAATAAACGAG, NM_001271208.1:c.6105dupT, NM_001271208.1:c.2173G>T, NM_001271208.1:c.843T>G | Nemaline myopathy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NEB gene located on chromosomal region 2q23.3. The age of onset is infantile or adult. This disease is characterized by hypotonia, weakness and depressed or absent deep tendon reflexes, with pathologic evidence of nemaline bodies (rods) on muscle biopsy. The prevalence is 1:100,000-9:100,000 and the incidence is 1/50.000 newborn. | 600,25 |
| NMNAT1 | Leber congenital amaurosis type 9 | NM_001297778.1 | NM_001297778.1:c.25G>A, NM_001297778.1:c.451G>T, NM_001297778.1:c.457C>G, NM_001297778.1:c.507G>A, NM_001297778.1:c.619C>T, NM_001297778.1:c.710G>T, NM_001297778.1:c.769G>A | Leber congenital amaurosis type 9 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NMNAT1 gene located on chromosomal region 1p36.22. The age of onset is early infantile. This disease is characterized by blindness, nystagmus, roving eye movement, leading to severe visual impairment. | 600,25 |
| NPC1 | Niemann-Pick disease, type C1 | NM_000271.4 | NM_000271.4:c.3662delT, NM_000271.4:c.3611_3614delTTAC, NM_000271.4:c.3467A>G, NM_000271.4:c.3425T>C, NM_000271.4:c.3182T>C, NM_000271.4:c.3175C>T, NM_000271.4:c.3107C>T, NM_000271.4:c.3104C>T, NM_000271.4:c.3019C>G, NM_000271.4:c.2974G>T, NM_000271.4:c.2974G>A, NM_000271.4:c.2972_2973delAG, NM_000271.4:c.2932C>T, NM_000271.4:c.2873G>A, NM_000271.4:c.2861C>T, NM_000271.4:c.2848G>A, NM_000271.4:c.2842G>A, NM_000271.4:c.2761C>T, NM_000271.4:c.2324A>C, NM_000271.4:c.2072C>T, NM_000271.4:c.1628C>T, NM_000271.4:c.1211G>A, NM_000271.4:c.1042C>T, NM_000271.4:c.813_815delCAT, NM_000271.4:c.530G>A, NM_000271.4:c.352_353delAG, NM_000271.4:c.337T>C | Niemann-Pick disease type C1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC1 gene located on chromosomal region 18q11.2. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000. | 600,25 |
| NPC2 | Niemann-pick disease, type C2 | NM_006432.3 | NM_006432.3:c.436C>T, NM_006432.3:c.358C>T, NM_006432.3:c.352G>T, NM_006432.3:c.295T>C, NM_006432.3:c.190+5G>A, NM_006432.3:c.115G>A, NM_006432.3:c.58G>T, NM_006432.3:c.27delG | Niemann-Pick disease type C2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPC2 gene located on chromosomal region 14q24.3. The age of onset varies between the perinatal period and the age of 50 years or more. This disease is characterized by hepatosplenomegaly and progressive neurological involvement. The prevalence is 1/130,000. | 600,25 |
| NPHP3 | Meckel syndrome type 7 | NM_153240.4 | NM_153240.4:c.3406C>T, NM_153240.4:c.3373C>T, NM_153240.4:c.3156dupA, NM_153240.4:c.2694-2_2694-1delAG, NM_153240.4:c.2694-2A>G, NM_153240.4:c.2570+1G>T, NM_153240.4:c.2541delG, NM_153240.4:c.2369T>C, NM_153240.4:c.1985+5G>A, NM_153240.4:c.1817G>A, NM_153240.4:c.1729C>T, NM_153240.4:c.1381G>T, NM_153240.4:c.1119-2A>G, NM_153240.4:c.434_437delAAAG | Meckel syndrome type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP3 gene located on chromosomal region 3q22.1. The age of onset is infantile. This is a disorder characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically encephalocele), hepatic ductal dysplasia and cysts, and polydactyly. | 600,25 |
| NPHP4 | Nephronophthisis type 4 | NM_015102.4 | NM_015102.4:c.3767_3768insAA, NM_015102.4:c.3231+1G>C, NM_015102.4:c.2940_2944dupGCTCC, NM_015102.4:c.2335C>T, NM_015102.4:c.1972C>T, NM_015102.4:c.1120-1G>C, NM_015102.4:c.556_557insT, NM_015102.4:c.517C>T | Nephronophthisis type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHP4 gene located on chromosomal region 1p36.31. The age of onset is infantile. This disease results in end-stage renal disease at age ranging between 6 and 35 years. It is a progressive tubulo-interstitial kidney disorder characterized by polydipsia, polyuria, anemia and growth retardation. The prevalence is 1:1,000,000-9:1,000,000. | 600,25 |
| NPHS1 | Nephrotic syndrome, type 1 | NM_004646.3 | NM_004646.3:c.3478C>T, NM_004646.3:c.3325C>T, NM_004646.3:c.3250dupG, NM_004646.3:c.3250delG, NM_004646.3:c.3109+1G>A, NM_004646.3:c.2928G>T, NM_004646.3:c.2491C>T, NM_004646.3:c.1715G>A, NM_004646.3:c.1481delC, NM_004646.3:c.1307_1308dupAC, NM_004646.3:c.121_122delCT | Nephrotic syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NPHS1 gene located on chromosomal region 19q13.12. The age of onset is fetal- infantile. This disease is characterized by fetal proteinuria and nephritic infantile syndrome. The prevalence is 1 in 8 200 births. | 600,25 |
| NR2E3 | Enhanced S-cone syndrome | NM_014249.3 | NM_014249.3:c.119-2A>C, NM_014249.3:c.226C>T, NM_014249.3:c.298_299delTG, NM_014249.3:c.932G>A, NM_014249.3:c.1034_1038delTGCAG | Enhaced S-Cone Syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the NR2E3 gene located on chromosomal region 15q23. The age of onset is infantile. This disease is characterized by night blindness, reduced bilateral visual acuity, and typical fundus findings (progressive pigmentary degenerative changes, macular edema, retinoschisis). | 600,25 |
| OCA2 | Oculocutaneous albinism type 2 | NM_000275.2 | NM_000275.2:c.2228C>T, NM_000275.2:c.1960delG, NM_000275.2:c.1842+1G>T, NM_000275.2:c.1465A>G, NM_000275.2:c.1364+1G>T, NM_000275.2:c.1327G>A, NM_000275.2:c.1182+2T>C, NM_000275.2:c.1182G>A, NM_000275.2:c.1025A>G, NM_000275.2:c.819_822delCTGGinsGGTC, NM_000275.2:c.157delA, NM_000275.2:c.79G>A | Oculocutaneous albinism type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OCA2 gene located on chromosomal region 15q12-q13. The age of onset is infantile. This disease is characterized by variable hypopigmentation of the skin and hair, numerous characteristic ocular changes and misrouting of the optic nerves at the chiasm. The prevalence is 1/38,000-1/40,000 | 600,25 |
| OTOA | Deafness, autosomal recessive type 22 | NM_144672.3 | NM_144672.3:c.121-1G>A, NM_144672.3:c.828delT, NM_144672.3:c.1725_1726delCA | Deafness, autosomal recessive type 22 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOA gene located on chromosomal region 16p12.2. The age of onset is infantile. This disease is characterized by hearing loss with no associated visible abnormalities of the external ear or any related medical problems. | 600,25 |
| OTOF | Auditory neuropathy, autosomal recessive, type 1 | NM_001287489.1 | NM_001287489.1:c.5474_5475delCC, NM_001287489.1:c.5473C>G, NM_001287489.1:c.5103+2T>A, NM_001287489.1:c.4559G>A, NM_001287489.1:c.4491T>A, NM_001287489.1:c.3032T>C, NM_001287489.1:c.2485C>T, NM_001287489.1:c.2348delG, NM_001287489.1:c.1778delT, NM_001287489.1:c.1544T>C, NM_001287489.1:c.1498C>T, NM_001287489.1:c.766-2A>G, NM_001287489.1:c.584-1G>C, NM_001287489.1:c.227+2T>C, NM_001287489.1:c.149G>A | Auditory neuropathy, autosomal recessive type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. Patients can have varying degrees of hearing loss with poor speech reception out of proportion to the degree of hearing loss. | 600,25 |
| OTOF | Auditory neuropathy, autosomal recessive, type 1 | NM_004802.3 | NM_004802.3:c.3515G>A | Auditory neuropathy, autosomal recessive type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the OTOF gene located on chromosomal region 2p23.3. Patients can have varying degrees of hearing loss with poor speech reception out of proportion to the degree of hearing loss. | 600,25 |
| PAH | Phenylketonuria | NM_000277.1 | NM_000277.1:c.1315+1G>A, NM_000277.1:c.1243G>A, NM_000277.1:c.1241A>G, NM_000277.1:c.1238G>C, NM_000277.1:c.1222C>T, NM_000277.1:c.1217T>C, NM_000277.1:c.1208C>T, NM_000277.1:c.1199+17G>A, NM_000277.1:c.1199+1G>A, NM_000277.1:c.1197A>T, NM_000277.1:c.1184C>A, NM_000277.1:c.1169A>G, NM_000277.1:c.1166delC, NM_000277.1:c.1162G>A, NM_000277.1:c.1139C>T, NM_000277.1:c.1068C>A, NM_000277.1:c.1066-3C>T, NM_000277.1:c.1066-11G>A, NM_000277.1:c.1045T>C, NM_000277.1:c.1042C>G, NM_000277.1:c.1033G>T, NM_000277.1:c.1030G>A, NM_000277.1:c.955G>T, NM_000277.1:c.926C>T, NM_000277.1:c.926C>A, NM_000277.1:c.912+1G>A, NM_000277.1:c.898G>T, NM_000277.1:c.896T>G, NM_000277.1:c.842+5G>A, NM_000277.1:c.838G>A, NM_000277.1:c.829T>G, NM_000277.1:c.823C>T, NM_000277.1:c.818C>T, NM_000277.1:c.814G>T, NM_000277.1:c.809G>A, NM_000277.1:c.806delT, NM_000277.1:c.782G>A, NM_000277.1:c.764T>C, NM_000277.1:c.755G>A, NM_000277.1:c.754C>T, NM_000277.1:c.745C>T, NM_000277.1:c.737C>A, NM_000277.1:c.734T>C, NM_000277.1:c.733G>C, NM_000277.1:c.728G>A, NM_000277.1:c.727C>T, NM_000277.1:c.722delG, NM_000277.1:c.722G>A, NM_000277.1:c.721C>T, NM_000277.1:c.688G>A, NM_000277.1:c.673C>G, NM_000277.1:c.665A>G, NM_000277.1:c.638T>C, NM_000277.1:c.611A>G, NM_000277.1:c.569T>C, NM_000277.1:c.533A>G, NM_000277.1:c.529G>A, NM_000277.1:c.527G>T, NM_000277.1:c.509+1G>A, NM_000277.1:c.508C>G, NM_000277.1:c.503delA, NM_000277.1:c.490A>G, NM_000277.1:c.482T>C, NM_000277.1:c.473G>A, NM_000277.1:c.472C>T, NM_000277.1:c.450dupA, NM_000277.1:c.442-1G>A, NM_000277.1:c.442-5C>G, NM_000277.1:c.441+5G>T, NM_000277.1:c.441+1G>A, NM_000277.1:c.357delC, NM_000277.1:c.331C>T, NM_000277.1:c.320A>G, NM_000277.1:c.311C>A, NM_000277.1:c.284_286delTCA, NM_000277.1:c.261C>A, NM_000277.1:c.250G>T, NM_000277.1:c.204A>T, NM_000277.1:c.194T>C, NM_000277.1:c.165T>G, NM_000277.1:c.143T>C, NM_000277.1:c.136G>A, NM_000277.1:c.117C>G, NM_000277.1:c.47_48delCT | Phenylketonuria follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PAH gene located on chromosomal region 12q23.2. The age of onset is neonatal. This disease is characterized by gradual developmental delay, stunted growth, microcephaly, seizures, tremors, eczema, vomiting, and musty odor. Untreated patients subsequently develop intellectual disability, behavioral disorders (hyperactivity) and motor disorders. The prevalence is 1:2,600-1:200,000. | 600,25 |
| PANK2 | Neurodegeneration with brain iron accumulation type 1 | NM_153638.3 | NM_153638.3:c.790C>T, NM_153638.3:c.823_824delCT, NM_153638.3:c.1561G>A, NM_153638.3:c.1583C>T | Neurodegeneration with brain iron accumulation type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PANK2 gene located on chromosomal region 20p13. The age of onset is infantile. This disease is characterized by progressive extrapyramidal dysfunction (dystonia, rigidity, choreoathetosis), iron accumulation on the brain and axonal spheroids in the central nervous system. The prevalence is 1-2/1,000,000. | 600,25 |
| PC | Pyruvate carboxylase deficiency | NM_000920.3 | NM_000920.3:c.1748G>T, NM_000920.3:c.434T>C | Pyruvate carboxylase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PC gene located on chromosomal region 11q13.2. The age of onset is infantile. This disease is characterized by metabolic acidosis, failure to thrive, developmental delay, and recurrent seizures. The prevalence is 1:250,000. | 600,25 |
| PCCA | Propionic acidemia | NM_000282.3 | NM_000282.3:c.229C>T, NM_000282.3:c.261dupT, NM_000282.3:c.412G>A, NM_000282.3:c.600+1G>A, NM_000282.3:c.862A>T, NM_000282.3:c.1023dupT, NM_000282.3:c.1118T>A, NM_000282.3:c.1226_1227delTT, NM_000282.3:c.1284+1G>A, NM_000282.3:c.1598_1601delTTGT, NM_000282.3:c.1891G>C, NM_000282.3:c.1899+4_1899+7delAGTA | Propionic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCA gene located on chromosomal region 13q32.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000. | 600,25 |
| PCCB | Propionic acidemia | NM_001178014.1 | NM_001178014.1:c.331C>T, NM_001178014.1:c.337C>T, NM_001178014.1:c.562G>A, NM_001178014.1:c.622G>A, NM_001178014.1:c.743C>T, NM_001178014.1:c.1050dupT, NM_001178014.1:c.1233dupT, NM_001178014.1:c.1278_1291delGGGCATCATCCGGCinsTAGAGCACAGGA, NM_001178014.1:c.1279_1284delGGCATCinsAA, NM_001178014.1:c.1283_1286delTCAT, NM_001178014.1:c.1288C>T, NM_001178014.1:c.1289_1290insT, NM_001178014.1:c.1343C>T, NM_001178014.1:c.1364A>G, NM_001178014.1:c.1594C>T, NM_001178014.1:c.1598_1600dupCCC, NM_001178014.1:c.1666A>G | Propionic acidemia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCCB gene located on chromosomal region 3q22.3. The age of onset is infantile. This disease is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and may be complicated by cardiomyopathy. The prevalence is 1:100,000. | 600,25 |
| PCDH15 | Deafness, autosomal recessive type 23 | NM_001142763.1 | NM_001142763.1:c.5680A>T, NM_001142763.1:c.4982_4983insTGAT, NM_001142763.1:c.4958_4961dupTGAT, NM_001142763.1:c.4885delA, NM_001142763.1:c.4569_4572dupATCT, NM_001142763.1:c.3733-2A>G, NM_001142763.1:c.2660_2661delAT, NM_001142763.1:c.1955C>G, NM_001142763.1:c.1752C>G, NM_001142763.1:c.1598T>A, NM_001142763.1:c.1103delT, NM_001142763.1:c.1021C>T, NM_001142763.1:c.800G>A, NM_001142763.1:c.415C>T, NM_001142763.1:c.415C>G, NM_001142763.1:c.7C>T | Deafness, autosomal recessive 23 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PCDH15 gene located on chromosomal region 10q21.1. This is a form of non-syndromic sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information. | 600,25 |
| PDE6A | Retinitis pigmentosa type 43 | NM_000440.2 | NM_000440.2:c.2053G>A, NM_000440.2:c.1749C>G, NM_000440.2:c.1683G>A, NM_000440.2:c.1560dupA, NM_000440.2:c.1113+1G>T, NM_000440.2:c.1113+1G>A | Retinitis pigmentosa type 43 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6A gene located on chromosomal region 5q32. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 600,25 |
| PDE6B | Retinitis pigmentosa type 40 | NM_000283.3 | NM_000283.3:c.892C>T, NM_000283.3:c.1540delC, NM_000283.3:c.1572delC, NM_000283.3:c.1580T>C, NM_000283.3:c.1669C>T, NM_000283.3:c.1920+2T>C | Retinitis pigmentosa 40 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PDE6B gene located on chromosomal region 4p16.3. The age of onset is variable. Retinitis pigmentosa 40 is a retinal dystrophy belonging to the group of pigmentary retinopathies.This disease is characterized by night blindness, followed by a progressive loss of peripheral vision in the daylight period and leading to blindness. | 600,25 |
| PEX1 | Heimler syndrome type 1 | NM_000466.2 | NM_000466.2:c.3505_3517delCAGTTGTTTTCAC, NM_000466.2:c.2916delA, NM_000466.2:c.2528G>A, NM_000466.2:c.2097dupT, NM_000466.2:c.1991T>C, NM_000466.2:c.1952_1960dupCAGTGTGGA, NM_000466.2:c.1842delA, NM_000466.2:c.1239+1G>T, NM_000466.2:c.877C>T | Heimler syndrome 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX1 gene located on chromosomal region 7q21.2. This disease is characterized by sensorineural hearing loss, enamel hyoplasia of the secondary dentition, and nail abnormalities. | 600,25 |
| PEX7 | Rhizomelic chondrodysplasia punctata, type 1 | NM_000288.3 | NM_000288.3:c.532C>T, NM_000288.3:c.618G>A, NM_000288.3:c.649G>A, NM_000288.3:c.653C>T, NM_000288.3:c.694C>T, NM_000288.3:c.854A>G, NM_000288.3:c.875T>A, NM_000288.3:c.903+1G>C | Rhizomelic chondrodysplasia punctata type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PEX7 gene located on chromosomal region 6q23.3. The age of onset is early. This disease is characterized by proximal shortening of the humerus and to a lesser degree the femur (rhizomelia), punctate calcifications in cartilage with epiphyseal and metaphyseal abnormalities (chondrodysplasia punctata), coronal clefts of the vertebral bodies, cataracts, postnatal growth deficiency is profound, intellectual disability is severe, seizures. The prevalence is <1:100,000. | 600,25 |
| PHYH | Refsum disease | NM_001323082.1 | NM_001323082.1:c.830G>A, NM_001323082.1:c.829C>T, NM_001323082.1:c.811A>C, NM_001323082.1:c.684+5G>T, NM_001323082.1:c.684+2T>G, NM_001323082.1:c.503-2A>G, NM_001323082.1:c.164delT, NM_001323082.1:c.135-1G>C, NM_001323082.1:c.135-2A>G | Refsum disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PHYH gene located on chromosomal region 10p13. The age of onset is variable. This disease is characterized by hemeralopia (loss of vision in the dark), followed by episods of chronic distal motor polyneuropathy. Other associated signs include perceptive deafness, anosmia, cerebellous ataxia and sometimes, severe intellectual deficiency. Over the course of time cutaneous signs appear (ichtyosis), along with polyepiphyseal dysplasia, myocardiopathy, elevated protein in cerebrospinal fluid, and pigmentary retinitis that may result in blindness. The prevalence is 1:1.000,000-9:1.000,000. | 600,25 |
| PKHD1 | Polycystic kidney disease type 4 | NM_138694.3 | NM_138694.3:c.12027C>G, NM_138694.3:c.11363_11372delCTTCCCTGGA, NM_138694.3:c.10452dupT, NM_138694.3:c.10412T>G, NM_138694.3:c.10219C>T, NM_138694.3:c.9719G>A, NM_138694.3:c.9689delA, NM_138694.3:c.9530T>C, NM_138694.3:c.9370C>T, NM_138694.3:c.8870T>C, NM_138694.3:c.8824C>T, NM_138694.3:c.8408G>A, NM_138694.3:c.8407T>C, NM_138694.3:c.8317G>T, NM_138694.3:c.6499C>T, NM_138694.3:c.5895dupA, NM_138694.3:c.5325_5326delAG, NM_138694.3:c.4870C>T, NM_138694.3:c.3940delA, NM_138694.3:c.3766delC, NM_138694.3:c.3761_3762delCCinsG, NM_138694.3:c.3367G>A, NM_138694.3:c.3229-2A>C, NM_138694.3:c.2854G>A, NM_138694.3:c.2827_2828delGA, NM_138694.3:c.2452C>T, NM_138694.3:c.2414C>T, NM_138694.3:c.2341C>T, NM_138694.3:c.1486C>T, NM_138694.3:c.982C>T, NM_138694.3:c.930delC, NM_138694.3:c.682A>G, NM_138694.3:c.664A>G, NM_138694.3:c.370C>T, NM_138694.3:c.353delG, NM_138694.3:c.107C>T, NM_138694.3:c.85G>T | Polycystic kidney disease type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKHD1 gene located on chromosomal region 6p12.3-p12.2. The age of onset is early. This disease is a severe form of polycystic kidney disease affecting the kidneys and, in some cases, the hepatic biliary tract. Up to 50% of the affected neonates die shortly after birth, as a result of severe pulmonary hypoplasia and secondary respiratory insufficiency. In the subset that survives the perinatal period, morbidity and mortality are mainly related to severe systemic hypertension, renal insufficiency, and portal hypertension due to portal-tract fibrosis. | 600,25 |
| PKLR | Pyruvate kinase deficiency | NM_000298.5 | NM_000298.5:c.1675C>T, NM_000298.5:c.1529G>A, NM_000298.5:c.1528C>T, NM_000298.5:c.1456C>T, NM_000298.5:c.1436G>A, NM_000298.5:c.1261C>A, NM_000298.5:c.1151C>T, NM_000298.5:c.721G>T | Pyruvate kinase deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PKLR gene located on chromosomal region 1q22. The age of onset is early. This disease is characterized by highly variable degree of chronic hemolysis, with severe neonatal jaundice and fatal anemia at birth, severe transfusion-dependent chronic hemolysis, and moderate hemolysis with exacerbation during infection. The prevalence is 1:20,000. | 600,25 |
| PLCE1 | Nephrotic syndrome, type 3 | NM_016341.3 | NM_016341.3:c.961C>T, NM_016341.3:c.3346C>T, NM_016341.3:c.3736C>T, NM_016341.3:c.3846delG, NM_016341.3:c.4451C>T, NM_016341.3:c.4809delA, NM_016341.3:c.5560C>T | Nephrotic syndrome type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLCE1 gene located on chromosomal region 10q23.33. The age of onset is variable. This disease is characterized by low blood protein levels, high cholesterol levels, high triglyceride levels, and presence of protein in the urine. The prevalence is 2:100,000-7:100,000 Children; 3:100,000 adults. | 600,25 |
| PLG | Plasminogen deficiency, type I | NM_000301.3 | NM_000301.3:c.112A>G, NM_000301.3:c.693_695delGAA, NM_000301.3:c.704G>A, NM_000301.3:c.1120G>T, NM_000301.3:c.1435G>T, NM_000301.3:c.1848G>A | Plasminogen deficiency type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PLG gene located on chromosomal region 6q26. The age of onset is infantile.This disease is characterized by markedly impaired extracellular fibrinolysis leading to the formation of ligneous (fibrin-rich) pseudomembranes on mucosae during wound healing. The prevalence is 1:1,000,000-9:1,000,000. | 600,25 |
| PMM2 | Congenital disorder of glycosylation, type 1a | NM_000303.2 | NM_000303.2:c.26G>A, NM_000303.2:c.53C>G, NM_000303.2:c.95T>G, NM_000303.2:c.95_96delTAinsGC, NM_000303.2:c.97C>T, NM_000303.2:c.109C>T, NM_000303.2:c.131T>C, NM_000303.2:c.190delT, NM_000303.2:c.193G>T, NM_000303.2:c.255+2T>C, NM_000303.2:c.256-1G>C, NM_000303.2:c.323C>T, NM_000303.2:c.338C>T, NM_000303.2:c.349G>C, NM_000303.2:c.357C>A, NM_000303.2:c.368G>A, NM_000303.2:c.385G>A, NM_000303.2:c.395T>C, NM_000303.2:c.415G>A, NM_000303.2:c.422G>A, NM_000303.2:c.442G>A, NM_000303.2:c.470T>C, NM_000303.2:c.484C>T, NM_000303.2:c.563A>G, NM_000303.2:c.620T>C, NM_000303.2:c.623G>C, NM_000303.2:c.647A>T, NM_000303.2:c.652C>G, NM_000303.2:c.669C>G, NM_000303.2:c.677C>G, NM_000303.2:c.691G>A, NM_000303.2:c.710C>G, NM_000303.2:c.710C>T | Congenital disorder of glycosylation type 1a follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PMM2 gene located on chromosomal region 16p13.2. The age of onset is infantile. This disease is characterized by highly variable clinical manifestations that may include feeding problems, vomiting, and diarrhea with failure to thrive in infants, and severe encephalopathy with axial hypotonia, abnormal eye movement, marked psychomotor retardation, peripheral neuropathy, cerebellar hypoplasia, stroke-like episodes, and retinitis pigmentosa in late infancy, childhood or adulthood. | 600,25 |
| POLG | Mitochondrial DNA depletion syndrome 4A (Alpers type) | NM_001126131.1 | NM_001126131.1:c.3644-1G>A, NM_001126131.1:c.3630dupC, NM_001126131.1:c.3286C>T, NM_001126131.1:c.3218C>T, NM_001126131.1:c.3151G>C, NM_001126131.1:c.2794C>T, NM_001126131.1:c.2617G>T, NM_001126131.1:c.2605C>T, NM_001126131.1:c.2591A>G, NM_001126131.1:c.2557C>T, NM_001126131.1:c.2542G>A, NM_001126131.1:c.2243G>C, NM_001126131.1:c.2209G>C, NM_001126131.1:c.1879C>T, NM_001126131.1:c.1760C>T, NM_001126131.1:c.1754G>A, NM_001126131.1:c.1437C>G, NM_001126131.1:c.1399G>A, NM_001126131.1:c.1120C>T, NM_001126131.1:c.911T>G, NM_001126131.1:c.752C>T | Mitochondrial DNA depletion syndrome, Alpers type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POLG gene located on chromosomal region 15q26.1. The age of onset is early. This disease is characterized by the clinical triad of psychomotor regression, seizures, and liver disease. The prevalence is 1:1,600 newborn. | 600,25 |
| POMGNT1 | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3 | NM_001243766.1 | NM_001243766.1:c.1864delC, NM_001243766.1:c.1814G>C, NM_001243766.1:c.1545delC, NM_001243766.1:c.1539+1G>T, NM_001243766.1:c.1539+1G>A, NM_001243766.1:c.1469G>A, NM_001243766.1:c.1425G>A, NM_001243766.1:c.1411A>T, NM_001243766.1:c.1274G>C, NM_001243766.1:c.932G>A, NM_001243766.1:c.931C>T, NM_001243766.1:c.880-1G>A, NM_001243766.1:c.652+1G>A, NM_001243766.1:c.636C>T, NM_001243766.1:c.187C>T, NM_001243766.1:c.92dupA | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3 which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMGNT1 gene located on chromosomal region 1p34.1. The age of onset is infantile. This disease is characterized by generalized severe hypotonia, muscle weakness, absent psychomotor development, eye involvement and seizures. The prevalence is 1-9:100,000. | 600,25 |
| POMT1 | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1 | NM_007171.3 | NM_007171.3:c.193G>A, NM_007171.3:c.226G>A, NM_007171.3:c.598G>C, NM_007171.3:c.793C>T, NM_007171.3:c.831C>G, NM_007171.3:c.907C>T, NM_007171.3:c.1153C>T, NM_007171.3:c.1242-2A>G, NM_007171.3:c.1261dupC, NM_007171.3:c.1280_1281delAGinsTC, NM_007171.3:c.1540C>T, NM_007171.3:c.1545C>G, NM_007171.3:c.1746G>C, NM_007171.3:c.1770G>C, NM_007171.3:c.2005G>A, NM_007171.3:c.2163C>A, NM_007171.3:c.2167dupG | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT1 gene located on chromosomal region 9q34.13. Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies (type A), which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), is a genetically heterogeneous disorder with characteristic brain and eye malformations, profound mental retardation, congenital muscular dystrophy, and early death. The phenotype commonly includes cobblestone (type II) lissencephaly, cerebellar malformations, and retinal malformations. | 600,25 |
| POMT2 | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2 | NM_013382.5 | NM_013382.5:c.2243G>C, NM_013382.5:c.2177G>A, NM_013382.5:c.1997A>G, NM_013382.5:c.1941G>A, NM_013382.5:c.1912C>T, NM_013382.5:c.1726-2A>G, NM_013382.5:c.1608_1609delCA, NM_013382.5:c.1445G>T, NM_013382.5:c.1417C>T, NM_013382.5:c.1057G>A, NM_013382.5:c.1045_1052delCGGATGGCinsG, NM_013382.5:c.551C>T | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the POMT2 gene located on chromosomal region 14q24.3. Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies (type A), which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), is a genetically heterogeneous disorder with characteristic brain and eye malformations, profound mental retardation, congenital muscular dystrophy, and early death. The phenotype commonly includes cobblestone (type II) lissencephaly, cerebellar malformations, and retinal malformations. | 600,25 |
| PPT1 | Ceroid lipofuscinosis, neuronal, type 1 | NM_000310.3 | NM_000310.3:c.840dupA, NM_000310.3:c.627+1G>T, NM_000310.3:c.541G>T, NM_000310.3:c.451C>T, NM_000310.3:c.223A>C, NM_000310.3:c.169dupA, NM_000310.3:c.29T>A | Neuronal ceroid lipofuscinoses, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PPT1 gene located on chromosomal region 1p32. The age of onset is adult. This disease is characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration. The prevalence is 1.5:1,000,000-9:1,000,000. | 600,25 |
| PROM1 | Retinitis pigmentosa, type 41 | NM_006017.2 | NM_006017.2:c.2490-2A>G, NM_006017.2:c.1841delG, NM_006017.2:c.1726C>T, NM_006017.2:c.1354dupT, NM_006017.2:c.1177_1178delAT, NM_006017.2:c.199C>T | Retinitis pigmentosa, type 41 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PROM1 gene located on chromosomal region 4p15.32. The age of onset is early. This disease is characterized by night blindness often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 19:100,000-27:100,000. | 600,25 |
| PYGM | McArdle disease | NM_005609.3 | NM_005609.3:c.2392T>C, NM_005609.3:c.2262delA, NM_005609.3:c.2128_2130delTTC, NM_005609.3:c.1963G>A, NM_005609.3:c.1827G>A, NM_005609.3:c.1768+1G>A, NM_005609.3:c.1726C>T, NM_005609.3:c.1722T>G, NM_005609.3:c.1628A>C, NM_005609.3:c.1621G>T, NM_005609.3:c.1466C>G, NM_005609.3:c.613G>A, NM_005609.3:c.501dupT, NM_005609.3:c.393delG, NM_005609.3:c.280C>T, NM_005609.3:c.255C>A, NM_005609.3:c.148C>T, NM_005609.3:c.13_14delCT, NM_005609.3:c.1A>G | McArdle disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the PYGM gene located on chromosomal region 11q13.1. The age of onset is infantile. This disease is characterized by muscular exercise intolerance with myalgia, cramps, fatigue, and muscle weakness. | 600,25 |
| RAG1 | Omenn syndrome; Severe combined immunodeficiency, B cell-negative | NM_000448.2 | NM_000448.2:c.256_257delAA, NM_000448.2:c.940C>T, NM_000448.2:c.983G>A, NM_000448.2:c.1681C>T, NM_000448.2:c.1682G>A, NM_000448.2:c.2164G>A, NM_000448.2:c.2320G>T, NM_000448.2:c.2326C>T, NM_000448.2:c.2333G>A, NM_000448.2:c.2814T>G, NM_000448.2:c.2923C>T | Omenn syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAG1 and RAG2 genes located on chromosomal region 11p12. The age of onset is early. This disease is characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency. Severe combined immunodeficiency, autosomal recessive, T cell-negative (T-), B cell negative (B-), NK cell positive (NK+) is also caused by mutation in the RAG1 and RAG2 genes. This disease is characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development. Without treatment, patients usually die within the first year of life. | 600,25 |
| RAPSN | Fetal akinesia deformation sequence | NM_005055.4 | NM_005055.4:c.848T>C, NM_005055.4:c.807C>A, NM_005055.4:c.566C>T, NM_005055.4:c.490C>T, NM_005055.4:c.484G>A, NM_005055.4:c.416T>C, NM_005055.4:c.264C>A | Fetal akinesia deformation sequence follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAPSN gene located on chromosomal region 11p11.2. The age of onset is early. This disease is characterized by multiple joint contractures, facial anomalies and pulmonary hypoplasia. The prevalence is 1:3,000. | 600,25 |
| RAX | Isolated microphthalmia, type 3 | NM_013435.2 | NM_013435.2:c.909C>G, NM_013435.2:c.439C>T, NM_013435.2:c.383_384delAG, NM_013435.2:c.18C>A | Isolated microphthalmia type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RAX gene located on chromosomal region 18q21.32. Microphthalmia designates a heterogeneous group of ocular malformations with a more or less evident reduction in the size of the eyeball. Additional features include high hypermetropia and a short axial length. | 600,25 |
| RDH12 | Leber congenital amaurosis, type 13 | NM_152443.2 | NM_152443.2:c.146C>T, NM_152443.2:c.152T>A, NM_152443.2:c.184C>T, NM_152443.2:c.210dupC, NM_152443.2:c.295C>A, NM_152443.2:c.377C>T, NM_152443.2:c.379G>T, NM_152443.2:c.451C>A, NM_152443.2:c.451C>G, NM_152443.2:c.464C>T, NM_152443.2:c.523T>C, NM_152443.2:c.565C>T, NM_152443.2:c.677A>G, NM_152443.2:c.806_810delCCCTG | Leber congenital amaurosis type 13 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RDH12 gene located on chromosomal region 14q24.1. The age of onset is early. This disease is characterized by blindness, nystagmus, roving eye movement and lack of detectable signals on an electroretinogram, leading to severe visual impairment within the first year of life. | 600,25 |
| RGR | Retinitis pigmentosa, type 44 | NM_002921.3 | NM_002921.3:c.262_269dupGGCTCGGA, NM_002921.3:c.273_274insGGCTCGGA, NM_002921.3:c.877C>T | Retinitis pigmentosa type 44 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RGR gene located on chromosomal region 10q23.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 600,25 |
| RHO | Retinitis pigmentosa, type 4, autosomal recessive | NM_000539.3 | NM_000539.3:c.173C>T, NM_000539.3:c.448G>A, NM_000539.3:c.620T>G, NM_000539.3:c.745G>T | Retinitis pigmentosa type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RHO gene located on chromosomal region 3q22.1. The age of onset is variable. This disease is characterized by night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. The prevalence is 1:10,000-5:10,000. | 600,25 |
| RLBP1 | Bothnia retinal dystrophy | NM_000326.4 | NM_000326.4:c.700C>T, NM_000326.4:c.452G>A, NM_000326.4:c.333T>G | Bothnia retinal dystrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RLBP1 gene located on chromosomal region 15q26.1. This disease is characterized by night blindness from early childhood with features consistent with retinitis punctata albescens and macular degeneration. The prevalence is unknown. | 600,25 |
| RPE65 | Leber congenital amaurosis, type 2 | NM_000329.2 | NM_000329.2:c.1543C>T, NM_000329.2:c.1355T>G, NM_000329.2:c.1292A>G, NM_000329.2:c.1102T>C, NM_000329.2:c.1087C>A, NM_000329.2:c.1067delA, NM_000329.2:c.1022T>C, NM_000329.2:c.907A>T, NM_000329.2:c.514_515delGT, NM_000329.2:c.271C>T | Leber congenital amaurosis 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPE65 gene located on chromosomal region 1p31.3-p31.2. The age of onset is variable. This disease is characterized by a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus. | 600,25 |
| RPGRIP1L | Joubert syndrome, type 7; Meckel syndrome, type 5; COACH syndrome | NM_015272.4 | NM_015272.4:c.3634_3637delGAAA, NM_015272.4:c.2794_2795delTT, NM_015272.4:c.2614C>T, NM_015272.4:c.2413C>T, NM_015272.4:c.2050C>T, NM_015272.4:c.1975T>C, NM_015272.4:c.1843A>C, NM_015272.4:c.1329dupA, NM_015272.4:c.1326_1329delAAAA, NM_015272.4:c.776+1G>A, NM_015272.4:c.757C>T, NM_015272.4:c.697A>T, NM_015272.4:c.394A>T | Joubert syndrome (JBTS) type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the RPGRIP1L gene located on chromosomal region 16q12.2. The age of onset is early. JBTS is characterized by congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (less common in JBTS7) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. RPGRIP1L gene is also associated with Meckel syndrome type 5, a rare, autosomal recessive lethal condition characterized by central nervous system malformations, postaxial, polydactyly, multicystic kidney dysplasia, and ductal proliferation in the portal area of the liver. Other phenotype associated is COACH syndrome, an autosomal recessive disorder characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable. COACH syndrome is considered by some to be a subtype of Joubert syndrome with congenital hepatic fibrosis. | 600,25 |
| RYR1 | Minicore myopathy with external ophthalmoplegia | NM_000540.2 | NM_000540.2:c.325C>T, NM_000540.2:c.487C>T, NM_000540.2:c.631+2T>C, NM_000540.2:c.738T>G, NM_000540.2:c.1021G>A, NM_000540.2:c.1186G>T, NM_000540.2:c.1205T>C, NM_000540.2:c.1739_1742dupATCA, NM_000540.2:c.1841G>T, NM_000540.2:c.4076delG, NM_000540.2:c.4405C>T, NM_000540.2:c.5333C>A, NM_000540.2:c.5726_5727delAG, NM_000540.2:c.6082C>T, NM_000540.2:c.6104A>T, NM_000540.2:c.6721C>T, NM_000540.2:c.7268T>A, NM_000540.2:c.7300G>A, NM_000540.2:c.7360C>T, NM_000540.2:c.7373G>A, NM_000540.2:c.7463_7475delCAAAGATGTCAGC, NM_000540.2:c.7781C>A, NM_000540.2:c.7836-1G>A, NM_000540.2:c.9000+1G>T, NM_000540.2:c.9905dupC, NM_000540.2:c.10343C>T, NM_000540.2:c.10579C>T, NM_000540.2:c.13480G>T, NM_000540.2:c.14126C>T, NM_000540.2:c.14365-2A>T, NM_000540.2:c.14545G>A | Multiminicore disease (MMD) is an inherited neuromuscular disorder defined pathologically by the presence of multiple areas of reduced mitochondrial oxidative activity running along a limited extent of the longitudinal axis of the muscle fiber, so-called 'minicores.' These regions show sarcomere disorganization and mitochondria depletion. Typically, no dystrophic signs, such as muscle fiber necrosis or regeneration or significant endomysial fibrosis, are present. MMD is a pathologic diagnosis and shows clinical and genetic heterogeneity. Affected individuals have clinical features of a congenital myopathy, including neonatal hypotonia, delayed motor development, and generalized muscle weakness and amyotrophy, which may progress slowly or remain stable (Ferreiro and Fardeau, 2002).Patients with recessive mutations in the RYR1 gene typically show severe congenital muscular dystrophy with ophthalmoplegia, although there is phenotypic variability. Some patients may present in utero with fetal akinesia, arthrogryposis, and lung hypoplasia resulting in fetal or perinatal death (McKie et al., 2014). Skeletal muscle biopsy of patients with recessive RYR1 mutations show variable features, including central cores (Jungbluth et al., 2007), congenital fiber-type disproportion (CFTD) (Monnier et al., 2009), and centronuclear myopathy (Wilmshurst et al., 2010). | 600,25 |
| SACS | Spastic ataxia, Charlevoix-Saguenay, type | NM_014363.5 | NM_014363.5:c.13237C>T, NM_014363.5:c.12160C>T, NM_014363.5:c.8844delT, NM_014363.5:c.7504C>T, NM_014363.5:c.6563T>A, NM_014363.5:c.6355C>T, NM_014363.5:c.5618_5619delAT, NM_014363.5:c.4933C>T, NM_014363.5:c.3198T>A, NM_014363.5:c.994A>T, NM_014363.5:c.517C>T | Spastic ataxia, Charlevoix-Saguenay type follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SACS gene located on chromosomal region 13q11. The age of onset is early. This disease is characterized by early-onset cerebellar ataxia with spasticity, a pyramidal syndrome and peripheral neuropathy. The prevalence is 1:1,500-1:2,000. | 600,25 |
| SAG | Oguchi disease, type 1 | NM_000541.4 | NM_000541.4:c.298dupG, NM_000541.4:c.523C>T, NM_000541.4:c.577C>T, NM_000541.4:c.874C>T, NM_000541.4:c.916G>T, NM_000541.4:c.926delA, NM_000541.4:c.993C>G | Oguchi disease type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SAG gene located on chromosomal region 2q37. The age of onset is infantile. This disease is characterized by congenital stationary night blindness and the Mizuo-Nakamura phenomenon which is a unique morphological and functional abnormality of the retina that presents with a typical golden-yellow or silver-gray discoloration of the fundus in the presence of light that disappears after dark-adaptation and appears again after the onset of light. | 600,25 |
| SBDS | Shwachman-Diamond syndrome | NM_016038.2 | NM_016038.2:c.377G>C, NM_016038.2:c.258+2T>C, NM_016038.2:c.184A>T, NM_016038.2:c.183_184delTAinsCT, NM_016038.2:c.120delG | Shwachman-Diamond syndrome follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SBDS gene located on chromosomal region 7q11.21. The age of onset is infantile. This disease is characterized by chronic and usually mild neutropenia, pancreatic exocrine insufficiency associated with steatorrhea and growth failure, skeletal dysplasia with short stature, and an increased risk of bone marrow aplasia or leukemic transformation, cutaneous (eczema or ichthyosis) and dental anomalies, and psychomotor retardation. The prevalence is 1:76,000 newborn. | 600,25 |
| SCNN1B | Pseudohypoaldosteronism, type 1 | NM_000336.2 | NM_000336.2:c.109G>A | Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest. | 600,25 |
| SCNN1G | Pseudohypoaldosteronism, type 1 | NM_001039.3 | NM_001039.3:c.600dupA, NM_001039.3:c.1373+2T>C, NM_001039.3:c.1570-1G>A, NM_001039.3:c.1627delG | Pseudohypoaldosteronism type 1, follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SCNN1A (12p13), SCNN1B (16p12.2-p12.1) and SCNN1G (16p12) genes. The age of onset is early. This disease is characterized by severe dehydration, vomiting and failure to thrive occurring in the first weeks of life, the clinical picture may be complicated by cardiac dysrhythmias, collapse, shock or cardiac arrest. | 600,25 |
| SETX | Spinocerebellar ataxia, autosomal recessive, type 1 | NM_015046.5 | NM_015046.5:c.6848_6851delCAGA, NM_015046.5:c.6834_6839delAACAAA, NM_015046.5:c.5927T>G, NM_015046.5:c.5630delG, NM_015046.5:c.5549-1G>T, NM_015046.5:c.5308_5311delGAGA, NM_015046.5:c.4087C>T, NM_015046.5:c.2602C>T, NM_015046.5:c.1166T>C, NM_015046.5:c.1027G>T, NM_015046.5:c.994C>T | Spinocerebellar ataxia with axonal neuropathy type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SETX gene located on chromosomal region 9q34.13. The age of onset is infantile. This disease is characterized by progressive cerebellar ataxia, axonal sensorimotor neuropathy with oculomotor apraxia, fixation instability, extrapyramidal features and an elevated serum alpha-fetoprotein level. The prevalence is 4:100,000-8:100,000. | 600,25 |
| SGCA | Muscular dystrophy, limb-girdle, type 2D | NM_000023.3 | NM_000023.3:c.101G>A, NM_000023.3:c.229C>T, NM_000023.3:c.371T>C, NM_000023.3:c.518T>C, NM_000023.3:c.574C>T, NM_000023.3:c.739G>A, NM_000023.3:c.850C>T, NM_000023.3:c.903_904dupCC | Autosomal recessive limb-girdle muscular dystrophy type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCA gene located on chromosomal region 4q12. The age of onset is variable. This disease is characterized by limb-girdle weakness and calf pseudohypertrophy. The prevalence is 1:1,000,000-9:1,000,000. | 600,25 |
| SGCG | Muscular dystrophy, limb-girdle, type 2C | NM_000231.2 | NM_000231.2:c.89delG, NM_000231.2:c.195+4_195+7delAGTA, NM_000231.2:c.505+1G>A, NM_000231.2:c.525delT, NM_000231.2:c.787G>A, NM_000231.2:c.848G>A | Autosomal recessive limb-girdle muscular dystrophy type 2C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGCG gene located on chromosomal region 13q12.12. The age of onset is variable. This disease is characterized by limb-girdle weakness, calf hypertrophy, diaphragmatic weakness, and variable cardiac abnormalities. | 600,25 |
| SGSH | Mucopolysaccharidosis, type 3A (Sanfilippo A) | NM_000199.3 | NM_000199.3:c.1380delT, NM_000199.3:c.1339G>A, NM_000199.3:c.1298G>A, NM_000199.3:c.1167C>A, NM_000199.3:c.892T>C, NM_000199.3:c.877C>T, NM_000199.3:c.757delG, NM_000199.3:c.617G>C, NM_000199.3:c.466A>T, NM_000199.3:c.449G>A, NM_000199.3:c.383C>T, NM_000199.3:c.364G>A, NM_000199.3:c.337_345delCAAGCTGGTinsGCACAGGTGAG, NM_000199.3:c.320delT, NM_000199.3:c.235A>C, NM_000199.3:c.220C>T, NM_000199.3:c.197C>G, NM_000199.3:c.130G>A | Mucopolysaccharidosis type 3A (Sanfilippo syndrome type A) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SGSH gene located on chromosomal region 17q25.3. The age of onset is infantile. This disease is characterized by behavioural disorders (hyperkinesia, aggressiveness) and intellectual deterioration, sleep disorders and very mild dysmorphism. The prevalence is >1:70,000 newborn. | 600,25 |
| SH3TC2 | Charcot-Marie-Tooth disease, type 4C | NM_024577.3 | NM_024577.3:c.3676-1G>A, NM_024577.3:c.3601C>T, NM_024577.3:c.3341delC, NM_024577.3:c.3326G>C, NM_024577.3:c.3325C>T, NM_024577.3:c.2993_2994insC, NM_024577.3:c.2860C>T, NM_024577.3:c.2829T>G, NM_024577.3:c.2710C>T, NM_024577.3:c.2491_2492delAG, NM_024577.3:c.2191delG, NM_024577.3:c.1982T>C, NM_024577.3:c.1972C>T, NM_024577.3:c.1969G>A, NM_024577.3:c.1747_1748delAG, NM_024577.3:c.1724T>A, NM_024577.3:c.1586G>A, NM_024577.3:c.920G>A, NM_024577.3:c.735G>A, NM_024577.3:c.530-2A>G, NM_024577.3:c.217_227delGCTGCTCGGAGinsCCAGTAA, NM_024577.3:c.53-1G>C, NM_024577.3:c.52+1delG, NM_024577.3:c.28delG | Charcot-Marie-Tooth disease, type 4C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SH3TC2 gene located on chromosomal region 5q32. The age of onset is infantile. This disease is characterized by scoliosis or kyphoscoliosis, neuropathy, foot deformities, respiratory insufficiency, hypoacousis and deafness. | 600,25 |
| SLC12A1 | Bartter syndrome, type 1 | NM_000338.2 | NM_000338.2:c.223C>T, NM_000338.2:c.628+2T>C, NM_000338.2:c.814G>T, NM_000338.2:c.1875G>A, NM_000338.2:c.1942G>A, NM_000338.2:c.2805dupA, NM_000338.2:c.2952_2955delCAAA | Bartter syndrome type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC12A1 gene located on chromosomal region 15q15-21. The age of onset is infantile. This disease is characterized by polyhydramnios, premature delivery, polyuria, dehydration, hypercalciuria and nephrocalcinosis. The prevalence is 1:1,000,000. | 600,25 |
| SLC17A5 | Salla disease | NM_012434.4 | NM_012434.4:c.1259+1G>A, NM_012434.4:c.406A>G, NM_012434.4:c.115C>T, NM_012434.4:c.43G>T | Salla disease follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC17A5 gene located on chromosomal region 6q13. The age of onset is from infantile to adult forms. The main symptoms are hypotonia, cerebellar ataxia, and mental retardation; visceromegaly and coarse features are also present in the infantile cases. | 600,25 |
| SLC26A2 | Achondrogenesis, type 1B (diastrophic dysplasia) | NM_000112.3 | NM_000112.3:c.496G>A, NM_000112.3:c.532C>T, NM_000112.3:c.833delC, NM_000112.3:c.835C>T, NM_000112.3:c.1020_1022delTGT, NM_000112.3:c.1273A>G, NM_000112.3:c.1361A>C, NM_000112.3:c.1535C>A, NM_000112.3:c.1724delA, NM_000112.3:c.1878delG, NM_000112.3:c.1957T>A, NM_000112.3:c.2033G>T | Achondrogenesis type 1B (diastrophic dysplasia) follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A2 gene located on chromosomal region 5q32. The age of onset is early. This disease is characterized by severe micromelia with very short fingers and toes, a flat face, a short neck, thickened soft tissue around the neck, hypoplasia of the thorax, protuberant abdomen, a hydropic fetal appearance and distinctive histological features of the cartilage. The prevalence is 1:20,000. | 600,25 |
| SLC26A4 | Deafness, autosomal recessive, type 4 | NM_000441.1 | NM_000441.1:c.269C>T, NM_000441.1:c.281C>T, NM_000441.1:c.412G>T, NM_000441.1:c.554G>C, NM_000441.1:c.563T>C, NM_000441.1:c.626G>T, NM_000441.1:c.707T>C, NM_000441.1:c.916dupG, NM_000441.1:c.918+2T>C, NM_000441.1:c.919-2A>G, NM_000441.1:c.961A>T, NM_000441.1:c.1001G>T, NM_000441.1:c.1001+1G>T, NM_000441.1:c.1003T>C, NM_000441.1:c.1034T>A, NM_000441.1:c.1151A>G, NM_000441.1:c.1174A>T, NM_000441.1:c.1198delT, NM_000441.1:c.1226G>A, NM_000441.1:c.1229C>T, NM_000441.1:c.1246A>C, NM_000441.1:c.1263+1G>A, NM_000441.1:c.1334T>G, NM_000441.1:c.1489G>A, NM_000441.1:c.1707+5G>A, NM_000441.1:c.1975G>C, NM_000441.1:c.2048T>C, NM_000441.1:c.2162C>T, NM_000441.1:c.2168A>G | Autosomal recessive nonsyndromic sensorineural deafness type 4 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC26A4 gene located on chromosomal region 7q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 600,25 |
| SLC37A4 | Glycogen storage disease, type 1b | NM_001164278.1 | NM_001164278.1:c.1309C>T, NM_001164278.1:c.1190-2_1190-1delAG, NM_001164278.1:c.1129G>T, NM_001164278.1:c.1108_1109delCT, NM_001164278.1:c.1082G>A, NM_001164278.1:c.1081G>T, NM_001164278.1:c.706_708delGTG, NM_001164278.1:c.352T>C, NM_001164278.1:c.287G>A, NM_001164278.1:c.83G>A | Glycogen storage disease due to glucose-6-phosphatase deficiency type 1b follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC37A4 gene located on chromosomal region 11q23. The age of onset is early. This disease is characterized by impairment of terminal steps of glycogenolysis and gluconeogenesis. Patients manifest a wide range of clinical symptoms and biochemical abnormalities, including hypoglycemia, severe hepatomegaly due to excessive accumulation of glycogen, kidney enlargement, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. Glycogen storage disease type 1B patients also present a tendency towards infections associated with neutropenia, relapsing aphthous gingivostomatitis, and inflammatory bowel disease. The incidence is 1:100,000. | 600,25 |
| SLC4A11 | Corneal endothelial dystrophy, autosomal recessive | NM_001174090.1 | NM_001174090.1:c.2687G>A, NM_001174090.1:c.2686C>T, NM_001174090.1:c.2647A>G, NM_001174090.1:c.2609T>C, NM_001174090.1:c.2345G>A, NM_001174090.1:c.2314_2321dupTATGACAC, NM_001174090.1:c.2305G>A, NM_001174090.1:c.1894C>T, NM_001174090.1:c.1547C>T, NM_001174090.1:c.1544G>A, NM_001174090.1:c.1472G>A, NM_001174090.1:c.1119_1120insA, NM_001174090.1:c.718T>C, NM_001174090.1:c.554_561delGCTTCGCC | Congenital hereditary endothelial dystrophy type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SLC4A11 gene located on chromosomal region 20p13. The age of onset is early. This disease is characterized by a diffuse ground-glass appearance of the corneas and marked corneal thickening from birth with nystagmus, and blurred vision. | 600,25 |
| SMN1 | Spinal muscular atrophy | -0 | del ex7, del ex7-8 | Spinal muscular atrophy follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMN1 gene located on chromosomal region 5q13.2. The age of onset is variable. This disease comprise a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. Autosomal recessive forms are classified according to the age of onset, the maximum muscular activity achieved, and survivorship. The severity of the disease is mainly determined by the copy number of SMN2, a copy gene which predominantly produces exon 7-skipped transcripts and only low amount of full-length transcripts that encode for a protein identical to SMN1. Only about 4% of patients bear one SMN1 copy with an intragenic mutation. Type 1 is a severe form, with onset before 6 months of age. Patients never achieve the ability to sit. Type 2 has intermediate severity, with onset between 6 and 18 months. Patients do not reach the motor milestone of standing, and survive into adulthood. Type 3 onset is after 18 months. Patients develop ability to stand and walk and survive into adulthood. Type 4 onset is in adulthood, disease progression is slow, and patients can stand and walk. The incidence is 1:10,000 and the prevalence is 1:80,000. | 600,25 |
| SMPD1 | Niemann-Pick disease, type A and type B | NM_000543.4 | NM_000543.4:c.96G>A, NM_000543.4:c.103_107delCTGGT, NM_000543.4:c.106delG, NM_000543.4:c.354delC, NM_000543.4:c.475T>C, NM_000543.4:c.557C>T, NM_000543.4:c.564delC, NM_000543.4:c.564dupC, NM_000543.4:c.573delT, NM_000543.4:c.688C>T, NM_000543.4:c.730G>A, NM_000543.4:c.740delG, NM_000543.4:c.739G>A, NM_000543.4:c.742G>A, NM_000543.4:c.757G>C, NM_000543.4:c.788T>A, NM_000543.4:c.842_849dupTCCCCGCA, NM_000543.4:c.911T>C, NM_000543.4:c.996delC, NM_000543.4:c.1092-1G>C, NM_000543.4:c.1117C>T, NM_000543.4:c.1152G>A, NM_000543.4:c.1264-1G>T, NM_000543.4:c.1267C>T, NM_000543.4:c.1299T>G, NM_000543.4:c.1327C>T, NM_000543.4:c.1420_1421delCT, NM_000543.4:c.1426C>T, NM_000543.4:c.1624C>T, NM_000543.4:c.1630delA, NM_000543.4:c.1805G>A, NM_000543.4:c.1829_1831delGCC | Niemann-Pick disease, type A and type B follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SMPD1 gene located on chromosomal region 11p15.4. The clinical phenotype ranges from a severe infantile form with neurologic degeneration resulting in death usually by 3 years of age (type A) to a later-onset nonneurologic form (type B) that is compatible with survival into adulthood. Since intermediate cases also have been reported, the disease is best regarded a single entity with a clinical spectrum. | 600,25 |
| SPG11 | Amyotrophic lateral sclerosis, type 5, juvenile | NM_025137.3 | NM_025137.3:c.7152-1G>C, NM_025137.3:c.6847_6848dupTC, NM_025137.3:c.6805_6806delCT, NM_025137.3:c.6100C>T, NM_025137.3:c.5623C>T, NM_025137.3:c.1736-1G>C, NM_025137.3:c.1339_1342dupGGCT, NM_025137.3:c.733_734delAT, NM_025137.3:c.529_533delATATT, NM_025137.3:c.342delT, NM_025137.3:c.118C>T | Amyotrophic lateral sclerosis, type 5, juvenile follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG11 gene located on chromosomal region 15q21.1. The age of onset is infancy/childhood. This disease is characterized by progressive upper and lower motor neuron degeneration causing facial spasticity, dysarthria, and gait disorders with onset before 25 years of age. The prevalence is <1/1,000,000. | 600,25 |
| SPG7 | Spastic paraplegia, type 7, autosomal recessive | NM_003119.3 | NM_003119.3:c.233T>A, NM_003119.3:c.286+1G>T, NM_003119.3:c.679C>T, NM_003119.3:c.758+2T>C, NM_003119.3:c.773_774delTG, NM_003119.3:c.1045G>A, NM_003119.3:c.1124delG, NM_003119.3:c.1529C>T, NM_003119.3:c.1676delA, NM_003119.3:c.1749G>C, NM_003119.3:c.2075G>C | Spastic paraplegia type 7 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the SPG7 gene located on chromosomal region 16q24.3. The age of onset is adult. This disease is characterized by by progressive muscle stiffness (spasticity) and the development of paralysis of the lower limbs (paraplegia) due to degeneration of corticospinal axons. The prevalence is 1:100,000-9:100,000. | 600,25 |
| STRC | Deafness, autosomal recessive, type 16 | NM_153700.2 | NM_153700.2:c.5188C>T, NM_153700.2:c.5185C>T, NM_153700.2:c.5168_5171delTTCT, NM_153700.2:c.4560dupC, NM_153700.2:c.4545+1G>C, NM_153700.2:c.3556C>T | Autosomal recessive nonsyndromic sensorineural deafness type DFNB16 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the STRC gene located on chromosomal region 15q15.3. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 600,25 |
| TCAP | Muscular dystrophy, limb-girdle, type 2G | NM_003673.3 | NM_003673.3:c.157C>T | Autosomal recessive limb-girdle muscular dystrophy type 2G follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCAP gene located on chromosomal region 17q12. The age of onset is variable. This disease is characterized by muscle weakness in the four limbs, mild scapular winging, severe atrophy of the quadriceps and anterior tibialis muscles, calf hypertrophy, and lack of respiratory and cardiac involvement. | 600,25 |
| TCIRG1 | Osteopetrosis, autosomal recessive, type 1 | NM_006019.3 | NM_006019.3:c.115_116delGA, NM_006019.3:c.1213G>A, NM_006019.3:c.1331G>T, NM_006019.3:c.1674-1G>A, NM_006019.3:c.2236+1G>A | Autosomal recessive osteopetrosis type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TCIRG1 gene located on chromosomal region 11q13.2. The age of onset is early. This disease is characterized by bone marrow failure, fractures and visual impairment. The incidence is 1:200.000 live births and the prevalence is 1:250,000. | 600,25 |
| TERT | Dyskeratosis congenita, autosomal recessive, type 4 | NM_198253.2 | NM_198253.2:c.2701C>T, NM_198253.2:c.2431C>T | Dyskeratosis congenita, autosomal recessive follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TERT gene located on chromosomal region 5p15.33. The age of onset is early. This disease has a wide phenotypic spectrum and age onset. It usually manifests during childhood with the triad of dysplastic nails, lacy reticular pigmentation and atrophy of the skin at the level of the neck and upper chest, and oral leukoplakia. Patients show an increased risk for progressive bone marrow failure and may develop myelodysplastic syndrome or acute myelogenous leukemia at any age (the risk increasing with age). There is also an increased risk for solid tumors, typically squamous cell carcinoma of head and neck (see this term) or anogenital cancer. Various additional clinical findings have been reported and may include: developmental delay, short stature, microcephaly, blepharitis, epiphora, periodontal disease, taurodontism, decreased teeth/root ratio, esophageal stenosis, liver disease, urethral stenosis, osteoporosis, avascular necrosis of femur and/or humerus, premature hair greying/alopecia, or abnormal eyelashes. Individuals with DC are at high risk of pulmonary fibrosis. The prevalence is 1:1,000,000. | 600,25 |
| TFR2 | Hemochromatosis, type 3 | NM_001206855.1 | NM_001206855.1:c.2T>A | Hemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000. | 600,25 |
| TFR2 | Hemochromatosis, type 3 | NM_003227.3 | NM_003227.3:c.2374G>A, NM_003227.3:c.2343G>A, NM_003227.3:c.2014C>T, NM_003227.3:c.1861_1872delGCCGTGGCCCAG, NM_003227.3:c.1665delC, NM_003227.3:c.1632_1633delGA, NM_003227.3:c.1473+1G>A, NM_003227.3:c.1469T>G, NM_003227.3:c.1330G>A, NM_003227.3:c.1235_1237delACA, NM_003227.3:c.1186C>T, NM_003227.3:c.949C>T, NM_003227.3:c.750C>G, NM_003227.3:c.313C>T | Hemochromatosis type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TFR2 gene located on chromosomal region 7q22.1. The age of onset is adult. This disease is characterized by excessive tissue iron deposition of genetic origin, liver disease, hypogonadism, arthritis, diabetes and skin pigmentation. The prevalence is <1:1,000,000. | 600,25 |
| TK2 | Mitochondrial DNA depletion syndrome , type 2 (myopathic type) | NM_004614.4 | NM_004614.4:c.635T>A, NM_004614.4:c.604_606delAAG, NM_004614.4:c.500G>A, NM_004614.4:c.373C>T, NM_004614.4:c.361C>A, NM_004614.4:c.323C>T, NM_004614.4:c.268C>T, NM_004614.4:c.159C>G | Mitochondrial DNA depletion syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TK2 gene located on chromosomal region 16q21. The age of onset is infantile. This disease is characterized by generalized hypotonia, proximal muscle weakness, loss of previously acquired motor skills, poor feeding, and respiratory difficulties leading to respiratory failure and death within a few years after diagnosis. The prevalence is 1.2:100,000. | 600,25 |
| TMEM67 | Joubert syndrome, type 6; Meckel syndrome, type 3; COACH syndrome | NM_153704.5 | NM_153704.5:c.130C>T, NM_153704.5:c.148_149insTAAT, NM_153704.5:c.622A>T, NM_153704.5:c.755T>C, NM_153704.5:c.1046T>C, NM_153704.5:c.1538A>G, NM_153704.5:c.1769T>C, NM_153704.5:c.2498T>C | Joubert syndrome (JBTS) type 6 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMEM67 gene located on chromosomal region 8q22.1. The age of onset is early. JBTS is characterized by congenital malformation of the brainstem and agenesis of the cerebellar vermis (molar tooth sign) leading to an abnormal respiratory pattern, nystagmus, hypotonia, mental retardation, ataxia, and delay in achieving motor milestones. Other variable features include retinal dystrophy (manifesting with either Leber congenital amaurosis or progressive retinal dystrophy) and nephronophthisis (usually juvenile). The prevalence is 1:100,000. The TMEM67 gene is also associated with Meckel syndrome type 3, a rare, autosomal recessive lethal condition characterized by central nervous system malformations, postaxial, polydactyly, multicystic kidney dysplasia, and ductal proliferation in the portal area of the liver. Other phenotype associated with mutations in the TMEM67 gene is COACH syndrome, an autosomal recessive disorder characterized by mental retardation, ataxia due to cerebellar hypoplasia, and hepatic fibrosis. Other features, such as coloboma and renal cysts, may be variable. COACH syndrome is considered by some to be a subtype of Joubert syndrome with congenital hepatic fibrosis. | 600,25 |
| TMPRSS3 | Deafness, autosomal recessive, type 8/10 | NM_024022.2 | NM_024022.2:c.1276G>A, NM_024022.2:c.1211C>T, NM_024022.2:c.753G>C, NM_024022.2:c.647G>T, NM_024022.2:c.446+1G>T, NM_024022.2:c.413C>A, NM_024022.2:c.242C>G, NM_024022.2:c.208delC | Autosomal recessive nonsyndromic sensorineural deafness type DFNB10 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TMPRSS3 gene located on chromosomal region 21q22.3. The age of onset is early. This disease is characterized by hearing loss and deafness. | 600,25 |
| TPP1 | Ceroid lipofuscinosis, neuronal, type 2 | NM_000391.3 | NM_000391.3:c.1340G>A, NM_000391.3:c.1093T>C, NM_000391.3:c.851G>T, NM_000391.3:c.827A>T, NM_000391.3:c.622C>T, NM_000391.3:c.616C>T, NM_000391.3:c.509-1G>C, NM_000391.3:c.141_144delGAGT | Neuronal ceroid lipofuscinosis type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TPP1 gene located on chromosomal region 11p15.4. Age of onset is infantile. This disease is characterized by epilepsy, followed by regression of developmental milestones, myoclonic ataxia, and pyramidal signs. Visual impairment typically appears at age four to six years and rapidly progresses to light/dark awareness only. Life expectancy ranges from age six years to early teenage. The prevalence is 1.5:1,000,000-9:1,000,000. | 600,25 |
| TRIOBP | Deafness, autosomal recessive, type 28 | NM_001039141.2 | NM_001039141.2:c.1039C>T, NM_001039141.2:c.1741C>T, NM_001039141.2:c.2362C>T, NM_001039141.2:c.2639_2640insTCAC, NM_001039141.2:c.3195delT, NM_001039141.2:c.3202C>T, NM_001039141.2:c.4436dupG, NM_001039141.2:c.4577C>G, NM_001039141.2:c.5316G>A | Deafness autosomal recessive type 28 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TRIOBP gene located on chromosomal region 22q13.1. The age of onset is early. This disease is characterized by hearing loss and deafness, no associated visible abnormalities of the external ear or any related medical problems. | 600,25 |
| TSEN54 | Pontocerebellar hypoplasia, type 2A | NM_207346.2 | NM_207346.2:c.670_671delAA, NM_207346.2:c.736C>T, NM_207346.2:c.887G>A, NM_207346.2:c.919G>T, NM_207346.2:c.1027C>T, NM_207346.2:c.1039A>T | Pontocerebellar hypoplasia type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSEN54 gene located on chromosomal region 17q25.1. Pontocerebellar hypoplasia (PCH) refers to a group of severe neurodegenerative disorders affecting growth and function of the brainstem and cerebellum, resulting in little or no development. Different types were classified based on the clinical picture and the spectrum of pathologic changes.ᅠ | 600,25 |
| TSFM | Combined oxidative phosphorylation deficiency, type 3 | NM_001172696.1 | NM_001172696.1:c.1_2delAT, NM_001172696.1:c.24_25delCG, NM_001172696.1:c.581delC, NM_001172696.1:c.919C>T | Combined oxidative phosphorylation deficiency type 3 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSFM gene located on chromosomal region 12q14.1. The age of onset is early. This disease is characterized by hypotonia, lactic acidosis, and hepatic insufficiency, with progressive encephalomyopathy or hypertrophic cardiomyopathy. | 600,25 |
| TSHR | Hypothyroidism, congenital, nongoitrous, type 1 | NM_000369.2 | NM_000369.2:c.122G>C, NM_000369.2:c.202C>T, NM_000369.2:c.326G>A, NM_000369.2:c.484C>G, NM_000369.2:c.500T>A, NM_000369.2:c.1170T>G, NM_000369.2:c.1742dupC | Hypothyroidism, congenital, nongoitrous, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TSHR gene located on chromosomal region 14q31.1. This disease is characterized by increased levels of plasma TSH and low levels of thyroid hormone. Only a subset of patients develop frank hypothyroidism; the remainder are euthyroid and asymptomatic. | 600,25 |
| TTN | Limb-girdle muscular dystrophy type 10 (LGMDR10; formerly LGMD2J); Early-onset myopathy with fatal cardiomyopathy | NM_001267550.2 | NM_001267550.2:c.107889delA, NM_001267550.2:c.106070_106071delAT, NM_001267550.2:c.104092delC, NM_001267550.2:c.104092C>T, NM_001267550.2:c.98818_98821delTCCA, NM_001267550.2:c.92373_92379delTGAATTC, NM_001267550.2:c.69344C>G, NM_001267550.2:c.60681dupT, NM_001267550.2:c.56648-1G>A, NM_001267550.2:c.52372delG, NM_001267550.2:c.48253delA, NM_001267550.2:c.47915dupT, NM_001267550.2:c.32471-1G>A, NM_001267550.2:c.28300_28303delAGCA, NM_001267550.2:c.16881C>A, NM_001267550.2:c.15796C>T, NM_001267550.2:c.3165-1G>T | LGMDR10 is a severe recessive form of LGMD phenotype with onset in the first to third decades involving weakness of all proximal muscles. Severe disability with loss of ambulation may occur within 20 years (third to sixth decades). Most of the cases are without facial muscle involvement or cardiomyopathy. Some patients later developed distal muscle involvement. Early-onset myopathy with fatal cardiomyopathy (EOMFC), known as Salih myopathy, also follows an autosomal recessive pattern of inheritance. This disease is characterized by skeletal muscle weakness and a form of heart disease called dilated cardiomyopathy. Affected individuals have delayed development of motor skills, such as sitting, standing, and walking. The age of onset is neonatal/infancy. LGMDR10 and EOMFC are caused by pathogenic variants in the TTN gene located on chromosomal region 2q31.2. | 600,25 |
| TTPA | Ataxia with isolated vitamin E deficiency | NM_000370.3 | NM_000370.3:c.744delA, NM_000370.3:c.661C>T, NM_000370.3:c.575G>A | Ataxia with vitamin E deficiency follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TTPA gene located on chromosomal region 8q13. The age of onset is variable. This disease is characterized by progressive spino-cerebellar ataxia, loss of proprioception, areflexia, and is associated with a marked deficiency in vitamin E. The prevalence is 0.56:1,000,000-3.5:1,000,000. | 600,25 |
| TYR | Albinism, oculocutaneous, type 1A | NM_000372.4 | NM_000372.4:c.1A>G, NM_000372.4:c.140G>A, NM_000372.4:c.164G>A, NM_000372.4:c.230G>A, NM_000372.4:c.242C>T, NM_000372.4:c.265T>C, NM_000372.4:c.272G>A, NM_000372.4:c.286dupA, NM_000372.4:c.325G>A, NM_000372.4:c.533G>A, NM_000372.4:c.572delG, NM_000372.4:c.616G>A, NM_000372.4:c.646T>A, NM_000372.4:c.650G>A, NM_000372.4:c.823G>T, NM_000372.4:c.896G>A, NM_000372.4:c.1012_1013insC, NM_000372.4:c.1111A>G, NM_000372.4:c.1118C>A, NM_000372.4:c.1146C>A, NM_000372.4:c.1147G>A, NM_000372.4:c.1164delT, NM_000372.4:c.1177delG, NM_000372.4:c.1209G>T, NM_000372.4:c.1217C>T, NM_000372.4:c.1255G>A, NM_000372.4:c.1265G>A, NM_000372.4:c.1336G>A, NM_000372.4:c.1342G>A, NM_000372.4:c.1467dupT, NM_000372.4:c.1501dupC | Oculocutaneous albinism type 1A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYR gene located on chromosomal region 11q14.2. The age of onset is early. This disease is characterized by white hair and skin, blue, fully translucent irises, nystagmus and misrouting of the optic nerves. | 600,25 |
| TYRP1 | Albinism, oculocutaneous, type 3 | NM_000550.2 | NM_000550.2:c.107delT, NM_000550.2:c.176C>G, NM_000550.2:c.497C>G, NM_000550.2:c.1057_1060delAACA, NM_000550.2:c.1067G>A, NM_000550.2:c.1103delA, NM_000550.2:c.1120C>T, NM_000550.2:c.1372_1375dupGACA | Type 3 oculocutaneous albinism follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the TYRP1 gene located on chromosomal region 9p23. The age of onset is early. This disease is characterized by rufous or brown albinism and occurring mainly in the African population. The prevalence is of 1/8,500 individuals in Africa. | 600,25 |
| UGT1A1 | Crigler-Najjar syndrome, type 2 | NM_000463.2 | NM_000463.2:c.44T>G, NM_000463.2:c.1021C>T, NM_000463.2:c.1070A>G, NM_000463.2:c.1456T>G | Crigler-Najjar syndrome type 2 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the UGT1A1 gene located on chromosomal region 2q37. The age of onset is early. This disease is characterized by unconjugated hyperbilirubinemia due to reduced and inducible activity of hepatic bilirubin glucuronosyltransferase with pigmented bile that contains bilirubin glucuronides, and generally do not present neurologic or intellectual impairment. Bilirubin encephalopathy may develop in later life when patients experience a superimposed infection or stress. | 600,25 |
| USH1C | Usher syndrome, type 1C; Deafness, autosomal recessive, type 18A | NM_153676.3 | NM_153676.3:c.2688_2695dupAATTCACC, NM_153676.3:c.2622_2623delCA, NM_153676.3:c.2547-1G>T, NM_153676.3:c.238dupC, NM_153676.3:c.238delC, NM_153676.3:c.216G>A | Usher syndrome type 1C follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH1C gene located on chromosomal region 11p15.1. This disease is characterized by the association of sensorineural deafness (usually congenital, severe and stable), progressive vision loss caused by retinitis pigmentosa apparent in childhood and balance problems. The prevalence is 4.4:100,000. The USH1C gene is also associated with autosomal recessive nonsyndromic sensorineural deafness type 18A. This phenotype is characterized by profound, prelingual, nonsyndromic sensorineural deafness with normal vestibular and visual function. | 600,25 |
| USH2A | Usher syndrome, type 2A | NM_206933.2 | NM_206933.2:c.15520-1G>A, NM_206933.2:c.15371delT, NM_206933.2:c.15089C>A, NM_206933.2:c.14803C>T, NM_206933.2:c.14442C>A, NM_206933.2:c.13709delG, NM_206933.2:c.12574C>T, NM_206933.2:c.12234_12235delGA, NM_206933.2:c.11864G>A, NM_206933.2:c.10636G>A, NM_206933.2:c.10561T>C, NM_206933.2:c.10073G>A, NM_206933.2:c.9799T>C, NM_206933.2:c.8981G>A, NM_206933.2:c.7364G>A, NM_206933.2:c.6862G>T, NM_206933.2:c.5743_5744delAG, NM_206933.2:c.5573-2A>G, NM_206933.2:c.4338_4339delCT, NM_206933.2:c.3491_3492delCT, NM_206933.2:c.2898delG, NM_206933.2:c.2299delG, NM_206933.2:c.2276G>T, NM_206933.2:c.2167+5G>A, NM_206933.2:c.2135delC, NM_206933.2:c.920_923dupGCCA, NM_206933.2:c.820C>T, NM_206933.2:c.779T>G | Usher syndrome type 2A follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the USH2A gene located on chromosomal region 1q41. This disease is characterized by the association of sensorineural deafness (usually congenital, moderate/severe and stable) and progressive vision loss that begins in adolescence or adulthood caused by retinitis pigmentosa. Unlike the other forms of Usher syndrome, type 2 is not associated with vestibular abnormalities that cause difficulties with balance. USH2A accounts for more than half of all cases of Usher syndrome type 2. The estimated prevalence is 3:100,000-4:100,000. | 600,25 |
| WFS1 | Wolfram syndrome, type 1 | NM_001145853.1 | NM_001145853.1:c.616C>T, NM_001145853.1:c.676C>T, NM_001145853.1:c.1060_1062delTTC, NM_001145853.1:c.1230_1233delCTCT, NM_001145853.1:c.1234_1237delGTCT, NM_001145853.1:c.1511C>T, NM_001145853.1:c.1943G>A, NM_001145853.1:c.1944G>A, NM_001145853.1:c.2084G>T, NM_001145853.1:c.2643_2644delCT | Wolfram syndrome, type 1 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WFS1 gene located on chromosomal region 4p16.1. The age of onset is infantile. This disease is characterized by diabetes mellitus type I, diabetes insipidus, optical atrophy and neurological signs. The prevalence is 1:1,000,000-9:1,000,000. | 600,25 |
| WHRN | Usher syndrome, type 2D; Deafness, autosomal recessive, type 31 | NM_015404.3 | NM_015404.3:c.817C>T | Usher syndrome type 2D follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WHRN gene located on chromosomal region 9q32. This disease is characterized by the association of sensorineural deafness (usually congenital, moderate/severe and stable) and progressive vision loss that begins in adolescence or adulthood caused by retinitis pigmentosa. Unlike the other forms of Usher syndrome, type 2 is not associated with vestibular abnormalities that cause difficulties with balance. The WHRN gene is also associated with autosomal recessive nonsyndromic sensorineural deafness type 31. This phenotype is characterized by congenital, non-progressive, mild-to-profound sensorineural hearing impairment.ᅠ | 600,25 |
| WNT10A | Odontoonychodermal dysplasia | NM_025216.2 | NM_025216.2:c.321C>A, NM_025216.2:c.383G>A, NM_025216.2:c.697G>T | Odonto-onycho-dermal dysplasia follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the WNT10A gene located on chromosomal region 2q35. The age of onset is infantile. This disease is characterized by hyperkeratosis and hyperhidrosis of the palms and soles, atrophic malar patches, hypodontia, conical teeth, onychodysplasia, and dry and sparse hair. The prevalence is <1:1,000,000. | 600,25 |
| ZFYVE26 | Spastic paraplegia, type 15, autosomal recessive | NM_015346.3 | NM_015346.3:c.5485-1G>A, NM_015346.3:c.5422C>T, NM_015346.3:c.4936C>T, NM_015346.3:c.4312C>T, NM_015346.3:c.3642_3643insCCACACTTAG, NM_015346.3:c.3206G>A, NM_015346.3:c.3182delT, NM_015346.3:c.2114dupC, NM_015346.3:c.1477C>T | Spastic paraplegia type 15 follows an autosomal recessive pattern of inheritance and is caused by pathogenic variants in the ZFYVE26 gene located on chromosomal region 14q24.1. The age of onset is infancy. This disease is characterized by progressive spasticity primarily affecting the lower limbs. It is a complex form of spastic paraplegia, associated with other neurologic dysfunction, including variable mental retardation, hearing and visual defects, and thin corpus callosum. The prevalence is <1 / 1,000,000. | 600,25 |
- Current version
- Historic versions
| chrom | OMIM (gene) | gene | previous | OMIM (phen) | disease name (phenotype) | inheritance |
|---|---|---|---|---|---|---|
| 7 | 602421 | CFTR | 219700 | Cystic fibrosis | Autosomal recessive | |
| X | 309550 | FMR1 | 300624 | Fragile X syndrome | X-linked | |
| X | 305900 | G6PD | 300908 | Hemolytic anemia, G6PD deficient (favism) | X-linked | |
| 13 | 121011 | GJB2 | 220290 | Deafness, autosomal recessive, type 1A; Deafness, digenic, GJB2/GJB6 | Autosomal recessive; Digenic inheritance (GJB6 gene) | |
| 16 | 141800 | HBA1 | 604131 | Thalassemia, alpha- | Autosomal recessive | |
| 16 | 141850 | HBA2 | 604131 | Thalassemia, alpha- | Autosomal recessive | |
| 11 | 141900 | HBB | 603903 | HBB-related hemoglobinopathy | Autosomal recessive | |
| 5 | 600354 | SMN1 | 253300 | Spinal muscular atrophy | Autosomal recessive |
- CGT Essential
- Historic versions
| chrom | OMIM (gene) | Gene | Previous symbol | OMIM (phen) | DISEASE | MOI |
|---|---|---|---|---|---|---|
| 1 | 607008 | ACADM | 201450 | Medium-chain acyl-CoA dehydrogenase deficiency | Autosomal recessive | |
| 2 | 604285 | AGXT | 259900 | Hyperoxaluria, primary, type 1 | Autosomal recessive | |
| 22 | 607574 | ARSA | 250100 | Metachromatic leukodystrophy | Autosomal recessive | |
| 3 | 609019 | BTD | 253260 | Biotinidase deficiency | Autosomal recessive | |
| 21 | 613381 | CBS | 236200 | Homocystinuria due to cystathionine beta-synthase | Autosomal recessive | |
| 7 | 602421 | CFTR | 219700 | Cystic fibrosis | Autosomal recessive | |
| 11 | 602858 | DHCR7 | 270400 | Smith-Lemli-Opitz syndrome | Autosomal recessive | |
| X | 300384 | EMD | 310300 | Emery-Dreifuss muscular dystrophy, type 1, X-linked | X-linked | |
| X | 309550 | FMR1 | 300624 | Fragile X syndrome | X-linked | |
| 17 | 606800 | GAA | 232300 | Glycogen storage disease, type 2 | Autosomal recessive | |
| 9 | 606999 | GALT | 230400 | Galactosemia | Autosomal recessive | |
| X | 300644 | GLA | 301500 | Fabry disease | X-linked | |
| 2 | 600890 | HADHA | 609016; 609015 | Long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD) deficiency; Mitochondrial trifunctional protein deficiency | Autosomal recessive | |
| 11 | 141900 | HBB | 603903 | HBB-related hemoglobinopathy | Autosomal recessive | |
| 1 | 609831 | MMACHC | 277400 | Methylmalonic aciduria and homocystinuria, cblC type | Autosomal recessive, digenic inheritance (PRDX1 gene) | |
| 12 | 612349 | PAH | 261600 | Phenylketonuria | Autosomal recessive | |
| 16 | 601785 | PMM2 | 212065 | Congenital disorder of glycosylation, type 1A | Autosomal recessive | |
| 5 | 606718 | SLC26A2 | 600972 | Achondrogenesis, type 1B (diastrophic dysplasia) | Autosomal recessive | |
| 5 | 600354 | SMN1 | 253300 | Spinal muscular atrophy | Autosomal recessive |